Analytical Biochemistry 391 (2009) 157–159

Contents lists available at ScienceDirect

Analytical Biochemistry

journal homepage: www.elsevier .com/locate /yabio

Notes & Tips

An integrated cell culture and quantitative polymerase chain reaction techniquefor determining titers of functional and infectious adenoviruses

Feng Li *, Liqiang Feng, Yichu Liu, Xuehua Zheng, Ling Chen *

Center for Vaccines and Biotherapeutics, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou International Business Incubator A3,Guangzhou Science City, Guangzhou 510663, China

a r t i c l e i n f o

Article history:Received 15 March 2009Available online 18 May 2009

0003-2697/$ - see front matter � 2009 Elsevier Inc. Adoi:10.1016/j.ab.2009.05.017

* Corresponding authors. Fax: +86 20 3229 0606.E-mail addresses: li_feng@gibh.ac.cn (F. Li), chen_l

1 Abbreviations used: PCR, polymerase chain reactionPCR, reverse transcription PCR; mRNA, messengerTCID50, 50% tissue culture infective dose; SEAP, seDMEM, Dulbecco’s modified Eagle’s medium; FBS, fephate-buffered solution; Q-TCID50, quantitative TCID5

a b s t r a c t

We describe a simple and rapid assay for determining the titer of functional and infectious adenovirusesthat yields reliable results within 36 h. The method consists of an initial incubation of serial diluted ade-noviruses on HEK293 cells and a subsequent detection of adenovirus genomic DNA with quantitativepolymerase chain reaction. With an adenovirus of known titer as a reference, the exact titers of fourunknown adenoviruses could be easily and accurately determined in one 96-well plate. This methodcan be potentially modified for quality control of other viruses.

� 2009 Elsevier Inc. All rights reserved.

Adenoviruses are the most frequently used vectors for transfer-ring therapeutic genes in human clinical trials because they aresafe and easy to produce in high titers [1]. However, not all viralparticles produced are functional or infectious. Therefore, the U.S.Food and Drug Administration has recommended the use of adeno-virus vectors with a minimum ratio of total virions to infectiousvirions of 3.3/100 for vector use in human clinical trials.

Precise determination of the concentration of these vectors iscritical to ensure equivalence of different studies as well as to en-sure comparability between preclinical and clinical studies. Deter-mining the titer of adenovirus usually involves infection of cells inculture, followed by detection techniques that depend on some as-pect of the biological functionality of the vector, for example, for-mation of a visible plaque in a monolayer of cells that permitreplication of the vector or histochemical or immunohistochemicalstaining of infected target cells expressing particular vector-associ-ated reporter transgenes. These techniques have been reviewedextensively elsewhere [2], and they all appear to share one limita-tion, namely, that they take several days to produce results. Plaqueformation, the most commonly used method, usually takes morethan 10 days, whereas analysis of foreign gene expression or histo-chemical/immunohistochemical staining methods may also takeseveral days.

Polymerase chain reaction (PCR)1 technology has been widelyused in virology and vaccine development due to its high sensitivity

ll rights reserved.

ing@gibh.ac.cn (L. Chen).; qPCR, quantitative PCR; RT–RNA; CPE, cytopathic effect;creted alkaline phosphatase;tal bovine serum; PBS, phos-0.

and rapidity [3,4]. For quality evaluation of adenovirus products, thequantitative PCR (qPCR) method has also been introduced [5–9].However, most of these assays detect only virus particles and cannotdiscriminate biological functionality or nonfunctionality. Ko and col-leagues developed an improved assay by combining the TaqManreal-time reverse transcription PCR (RT–PCR) method and cell cul-ture infectivity to allow rapid detection of messenger RNA (mRNA)produced by infectious adenoviruses in water samples [9]. Althoughthe detection process time was greatly shortened to within 3 days,the assay included multiple steps: virus infection, mRNA extraction,DNA elimination, mRNA reverse transcription, and qPCR operations.Consequently, it was both costly and labor-intensive.

In this article, we describe a simple and rapid method that inte-grates adenovirus infection and SYBR Green I-based qPCR fordetermining adenovirus titers. With a known adenovirus titer asa reference, determined by a cytopathic effect (CPE)-based assay(hereafter termed CPE–TCID50 [50% tissue culture infective dose]),the titers of test adenoviruses can be easily determined. No specialreagent other than deionized water is required for viral genomicDNA extraction, and titers of unknown adenoviruses can be rapidlyobtained within 36 h postinfection.

We first determined the titer of an Ad5–SEAP (secreted alkalinephosphatase) virus using an endpoint dilution method. Briefly,2 � 104 HEK293 cells in 150 ll of complete Dulbecco’s modifiedEagle’s medium (DMEM) containing 10% fetal bovine serum (FBS)were seeded and incubated for 24 h at 37 �C and 5% CO2 prior toinfection. A 10-fold dilution series from 10�1 to 10�10 Ad5–SEAPvirus was applied to a 96-well plate from lines 1 to 10 in eight rep-licates (75 ll each well). Cells in lines 11 and 12 served as negativecontrol. Plates were incubated at 37 �C and 5% CO2, and 10 days la-ter CPE–TCID50 titers were calculated by the Spearman–Karbermethod. Positive wells were confirmed only when more than 50%of all the cells in the well were cytopathic. The titer of the

158 Notes & Tips / Anal. Biochem. 391 (2009) 157–159

Ad5–SEAP virus was 3.13 � 109 CPE–TCID50/ml, represented bythe mean value from two independent experiments.

Next, we showed a linear correlation between CPE–TCID50 andCt number value in a cell culture-based real-time PCR assay by afour-step process (Fig. 1A). First, 5 � 104 HEK293 cells in 100 llof complete DMEM containing 10% FBS were seeded in a 96-wellformat, which was coated with 0.1% gelatin, 24 h prior to infection.Ad5–SEAP virus was serially diluted from 104 CPE–TCID50/100 llto 101.5 CPE–TCID50/100 ll in a 0.5 log descending order withcomplete DMEM containing 10% FBS. Next, 24 h later, culture med-ium was replaced with 100-ll virus dilutes. After 4 h incubation,virus inoculum was changed to 100 ll of complete DMEMcontaining 10% FBS (Fig. 1B). Second, adenovirus genomic DNAwas extracted with an osmosis disruption method. At 24 h post-infection, the culture medium was removed and cells were rinsedtwice with 200 ll of phosphate-buffered solution (PBS, pH 7.2) towash away adenovirus on the cell surface. Cells were then treatedwith DNase/RNase-free deionized water (100 ll/well) for 10 min atroom temperature to allow cell swelling and rupture by osmoticpressure. The supernatant was then collected and subjected to abrief centrifugation at 16,000g for 15 s to remove cellular debris.The supernatant was diluted by 10-fold with DNase/RNase-freedeionized water for later use. Third, SYBR Green I-based qPCR,modified from a previously described Taqman real-time PCR meth-od detecting a 99-bp segment from 14,327 to 14,425 nt (GenBank:AC_000008) [10], was carried out in an Opticon 2 continuous fluo-rescence detection system (CFD-3220, MJ Research, USA). The reac-tion mixture consisted of 10 ll of 2� SYBR Premix Ex Taq (Takara,Japan), 4 ll of DNase/RNase-free deionized water, 2 ll of tem-plates, and 4 ll of mixed forward primer (TCTGAGTTGGCACCCCTATTC) and reverse primer (GTTGCTGTGGTCGTTCTGGTA)(final concentration 200 nM each) in a final volume of 20 ll. Theamplification reaction for plate reading was as follows: 1 cycle at50 �C, hold for 2 min; 1 cycle at 95 �C, hold for 1 min; 35 cyclesof 95 �C for 15 s; 60 �C for 50 s; and 80 �C for 1 s for plate reading.A melting curve and the PCR amplicon sequencing confirmed thatspecific amplicons could be amplified with this primer pair. The Ct

number for each dilution was the average of triplicate samples. A

-1

4

-2

3.5

-3

3

-4

2.5 2 1.5

-1 -2 -3 -4 -1 -2 -3 -4

-1 -2 -3 -4Standard Virus TV-1

TV-2 TV-3 TV-4

A B

C

Adenovirus infection

Viral DNA extraction with osmotic disruption

qPCR detection

Data analysis(Standard curve making

with a reference virus and titer calculation)

y = -3.8097x+34.672

1.5 2.0 2.5 3.0 3.5 4.018

20

22

24

26

28

30

Ct V

alue

Log10 CPE-TCID50

R2=0.9991

Fig. 1. Schematics of qPCR-based titration assay. (A) Flow chart of the entiretitration operation. (B) Layout of standard virus (Ad5–SEAP) and test adenoviruses(TVs) in one 96-well plate. Ad5–SEAP was diluted to 104, 103.5, 103, 102.5, 102, and101.5 CPE–TCID50/100 ll. Four test adenoviruses could be tested in one 96-wellplate by serial dilution to 10�1 to 10�4-fold. (C) Representative standard curve ofAd5–SEAP.

linear relationship between Ct values in qPCR and the CPE–TCID50titer of Ad5–SEAP standard virus was achieved (for Ct number val-ues and CPE–TCID50 titer, at 101.5 to 104 CPE–TCID50/100 ll,y = �3.8097x + 34.672, R2 = 0.9991) (Fig. 1C). Cells subjected toviruses above a dose of 104 CPE–TCID50/100 ll became cytopathicmore rapidly, within 24 h postinfection, and therefore were diffi-cult to remove by washing in the PBS rinsing step (data notshown). Therefore, large infection doses could not be used to ex-tend the linear range of the assay beyond the limits used here.

The theoretical slope rate of a standard curve in conventionalqPCR detection is 3.32 (log210 = 3.32). We also obtained a similarslope rate value when purified adenovirus and plasmids were usedas templates. The higher slope rate value (3.8097) observed in ourstudy may have the following explanation. The functional adenovi-rus experienced one round of replication during the 24 h incuba-tion in our quantitative TCID50 (Q-TCID50) assay. When largedoses of adenovirus were used, there were more viruses per celland the viruses were much more likely to hijack the cellularmachinery for viral replication. This would result, 24 h later, insubstantial differences in the numbers of viral progeny amongthe serial dilutions. Therefore, the genomic DNA copy numberwould be larger than the initial input differences, and the sloperate would be expected to increase above the theoretical value.

Finally, it was demonstrated that the Q-TCID50 assay is a reli-able alternative method to the CPE–TCID50 assay. Seven adenovi-ruses prepared by CsCl centrifugation were subjected to bothCPE–TCID50 titration and Q-TCID50 titration. CPE–TCID50 titerswere determined with the endpoint dilution method as describedabove (Table 1). For the Q-TCID50 titration, 5 � 104 HEK293 cellsin 100 ll of complete DMEM containing 10% FBS were seeded intoa 96-well format pretreated with 0.1% gelatin 24 h prior to infec-tion as described previously. Then Ad5–SEAP was diluted withcomplete DMEM containing 10% FBS to be 101.5, 102, 102.5, 103,103.5, and 104 CPE–TCID50/100 ll. Triplicate wells were used foreach series dilution (100 ll/well) (Fig. 1B). For each test adenovi-rus, four serial dilutions from 10�1 to 10�4 were used during thetest. Four adenoviruses could be tested simultaneously on oneplate (Fig. 1B). Viral genomic DNA was extracted using osmotic dis-ruption, and qPCR was performed. A standard curve was made dur-ing each test with Ad5–SEAP (Fig. 1C). At least one or two Ct

numbers in the four different concentrations of each test adenovi-rus would fall into the linear range. Viral titers could then be easilycalculated according to the standard curve using the following for-mula: Q-TCID50 = 10exp[(Ct � 34.672)/�3.8097] (Table 1). Com-parison of the Q-TCID50 assay with the CPE–TCID50 assayshowed a good match between these two assays. It was also ob-served that titers of adenovirus containing HA, two forms of HAgenes, determined with qPCR assay were larger than titers deter-mined with CPE. Perhaps the toxicity of HA proteins accounts forthe difference. In principle, toxicity of proteins will comprise thenormal growth of cells and the subsequent accurate infectious titerdetermination, especially with the longer time span (e.g., 10 days

Table 1Titers of infectious recombinant adenoviruses using both CPE–TCID50 and Q-TCID50methods.

Adenovirus Q-TCID50a CPE–TCID50b

Ad5-CH-PB2 3.44 ± 2.29E+08 2.78 ± 1.92E+08Ad5–CH–PB1 2.27 ± 0.83E+07 1.65 ± 0.78E+07Ad5–CH–PA 7.94 ± 4.74E+07 5.98 ± 0.00E+07Ad5–CH–HA 1.21 ± 1.13E+08 4.32 ± 1.39E+07Ad5–CH–NA 4.89 ± 1.16E+08 2.59 ± 0.74E+08Ad5–CH–M 5.73 ± 0.81E+08 2.17 ± 0.83E+08Ad5–hu04HA 2.51 ± 0.29E+08 9.91E+07

a Means ± standard errors from three independent experiments.b Means ± standard errors from two independent experiments except the Ad5–

hu04HA.

Notes & Tips / Anal. Biochem. 391 (2009) 157–159 159

in the CPE assay). Because our qPCR-based TCID50 detection meth-od takes only 24 h postinfection, this new approach will providethe accurate adenoviral infectious titers before the effects of for-eign protein expression take place.

In summary, we have successfully developed a simple and rapidassay for titration of adenoviruses that integrates cell culture withSYBR Green I-based qPCR. With a standard adenovirus having knowntiter as a reference, four adenoviruses can be titered in one 96-wellplate and reliable results can be obtained within 36 h postinfection.This Q-TCID50 titration assay potentially can also be used for qualitycontrol of other DNA viruses, such as vaccinia virus and herpes sim-ple viruses, in clinical trials and manufacturing processes.

Acknowledgments

This study was supported by Knowledge Innovation Program ofthe Chinese Academy of Sciences (key project, No: KSCX1-YW-10),and National Science Fund for Distinguished Young Scholar (No.30688004).

References

[1] Wiley Interscience, Gene therapy clinical trial worldwide. Available from:<http://www.wiley.co.uk/genmed/clinical>.

[2] N. Mittereder, K.L. March, B.C. Trapnell, Evaluation of the concentration andbioactivity of adenovirus vectors for gene therapy, J. Virol. 70 (1996) 7498–7509.

[3] I.M. Mackay, K.E. Arden, A. Nitsche, Real-time PCR in virology, Nucleic AcidsRes. 30 (2002) 1292–1305.

[4] J.J. Wolf, L. Wong, F. Wang, Application of PCR technology in vaccine productdevelopment, Exp. Rev. Vaccines 6 (2007) 547–558.

[5] A. Heim, C. Ebnet, G. Harste, P. Pring-Akerblom, Rapid and quantitativedetection of human adenovirus DNA by real-time PCR, J. Med. Virol. 70 (2003)228–239.

[6] L. Ma, H.A.R. Bluyssen, M. De Raeymaeker, V. Laurysens, N. van der Beek, H.Pavliska, A.J. van Zonneveld, P. Tomme, H.H.G. van Es, Rapid determination ofadenoviral vector titers by quantitative real-time PCR, J. Virol. Methods 93(2001) 181–188.

[7] M. Watanabe, U. Kohdera, M. Kino, T. Haruta, S. Nukuzuma, T. Suga, K.Akiyoshi, M. Ito, S. Suga, Y. Komada, Detection of adenovirus DNA in clinicalsamples by SYBR Green real-time polymerase chain reaction assay, Pediatr. Int.47 (2005) 286–291.

[8] J.A. Schalk, C.G. de Vries, T.J. Orzechowski, M.G. Rots, A rapid and sensitiveassay for detection of replication-competent adenoviruses by a combination ofmicrocarrier cell culture and quantitative PCR, J. Virol. Methods 145 (2007)89–95.

[9] G. Ko, N. Jothikumar, V.R. Hill, M.D. Sobsey, Rapid detection of infectiousadenoviruses by mRNA real-time RT–PCR, J. Virol. Methods 127 (2005) 148–153.

[10] M. Aste-Amezaga, A.J. Bett, F.B. Wang, D.R. Casimiro, J.M. Antonello, D.K. Patel,E.C. Dell, L.L. Franlin, N.M. Dougherty, P.S. Bennett, H.C. Perry, M.E. Davies, J.W.Shiver, P.M. Keller, M.D. Yeager, Quantitative adenovirus neutralization assaysbased on the secreted alkaline phosphatase reporter gene: application inepidemiologic studies and in the design of adenovector vaccines, Hum. GeneTher. 15 (2004) 293–304.