An Introduction to Genomics, Pharmacogenomics, An Introduction to Genomics, Pharmacogenomics, and Personalized Medicineand Personalized Medicine

Michael D. Kane, PhDAssociate Professor, University Faculty Scholar, Graduate Education Chair

Department of Computer and Information TechnologyCollege of Technology

&Lead Genomic Scientist, Bindley Bioscience Center at Discovery Park

Purdue UniversityWest Lafayette, Indiana 47907

Bioinformatics.tech.purdue.edu

DNA is Information Storage

Introduction to Genomics

“Zipped Files”

Decompression

“Executable Files”

CAGGACCATGGAACTCAGCGTCCTCCTCTTCCTTGCACTCCTCACAGGACTCTTGCTACTCCTGGTTCAGCGCCACCCTAACACCCATGACCGCCTCCCACCAGGGCCCCGCCCTCTGCCCCTTTTGGGAAACCTTCTGCAGATGGATAGAAGAGGCCTACTCAAATCCTTTCTGAGGTTCCGAGAGAAATATGGGGACGTCTTCACGGTACACCTGGGACCGAGGCCCGTGGTCATGCTGTGTGGAGTAGAGGCCATACGGGAGGCCCTTGTGGACAAGGCTGAGGCCTTCTCTGGCCGGGGAAAAATCGCCATGGTCGACCCATTCTTCCGGGGATATGGTGTGATCTTTGCCAATGGAAACCGCTGGAAGGTGCTTCGGCGATTCTCTGTGACCACTATGAGGGACTTCGGGATGGGAAAGCGGAGTGTGGAGGAGCGGATTCAGGAGGAGGCTCAGTGTCTGATAGAGGAGCTTCGGAAATCCAAGGGGGCCCTCATGGACCCCACCTTCCTCTTCCAGTCCATTACCGCCAACATCATCTGCTCCATCGTCTTTGGAAAACGATTCCACTACCAAGATCAAGAGTTCCTGAAGATGCTGAACTTGTTCTACCAGACTTTTTCACTCATCAGCTCTGTATTCGGCCAGCTGTTTGAGCTCTTCTCTGGCTTCTTGAAATACTTTCCTGGGGCACACAGGCAAGTTTACAAAAACCTGCAGGAAATCAATGCTTACATTGGCCACAGTGTGGAGAAGCACCGTGAAACCCTGGACCCCAGCGCCCCCAAGGACCTCATCGACACCTACCTGCTCCACATGGAAAAAGAGAAATCCAACGCACACAGTGAATTCAGCCACCAGAACCTCAACCTCAACACGCTCTCGCTCTTCTTTGCTGGCACTGAGACCACCAGCACCACTCTCCGCTACGGCTTCCTGCTCATGCTCAAATACCCTCATGTTGCAGAGAGAGTCTACAGGGAGATTGAACAGGTGATTGGCCCACATCGCCCTCCAGAGCTTCATGACCGAGCCAAAATGCCATACACAGAGGCAGTCATCTATGAGATTCAGAGATTTTCCGACCTTCTCCCCATGGGTGTGCCCCACATTGTCACCCAACACACCAGCTTCCGAGGGTACATCATCCCCAAGGACACAGAAGTATTTCTCATCCTGAGCACTGCTCTCCATGACCCACACTA

THEREDCAT_HSDKLSD_WASNOTHOTBUT_WKKNASDNKSAOJ.ASDNALKS_WASWET_ASDFLKSDOFIJEIJKNAWDFN_ANDMAD_WERN.JSNDFJN_YETSAD_MNSFDGPOIJD_BUTTHEFOX_SDKMFIDSJIR.JER_GOTWET_JSN.DFOIAMNJNER_ANDATEHIM.

Start with a thin 2 x 4 lego block…

Add a 2 x 2 lego block…

Add a 2 x 3 lego block…

Add a 2 x 4 lego block…

organism estimated sizeestimated

gene number

average gene densitychromo-some

number

Homo sapiens(human)

3200 million bases ~30,000 1 gene per 100,000 bases 46

Rattus norvegicus(rat)

2750 million bases ~30,000 1 gene per 100,000 bases 42

Mus musculus (mouse)

2500 million bases ~30,000 1 gene per 100,000 bases 40

Drosophila melanogaster(fruit fly)

180 million bases 13,600 1 gene per 9,000 bases 8

Arabidopsis thaliana(plant)

125 million bases 25,500 1 gene per 4000 bases 5

Caenorhabditis elegans(roundworm)

97 million bases 19,100 1 gene per 5000 bases 6

Saccharomyces cerevisiae(yeast)

12 million bases 6300 1 gene per 2000 bases 16

Escherichia coli(bacteria)

4.7 million bases 3200 1 gene per 1400 bases 1

H. influenzae (bacteria)

1.8 million bases 1700 1 gene per 1000 bases 1

The onion genome is 6-times bigger that the human genome

The lily genome is 30-times bigger that the human genome

GenBank Data

Year Base Pairs Sequences

1982 680,338 606

1983 2,274,029 2,427

1984 3,368,765 4,175

1985 5,204,420 5,700

1986 9,615,371 9,978

1987 15,514,776 14,584

1988 23,800,000 20,579

1989 34,762,585 28,791

1990 49,179,285 39,533

1991 71,947,426 55,627

1992 101,008,486 78,608

1993 157,152,442 143,492

1994 217,102,462 215,273

1995 384,939,485 555,694

1996 651,972,984 1,021,211

1997 1,160,300,687 1,765,847

1998 2,008,761,784 2,837,897

1999 3,841,163,011 4,864,570

2000 11,101,066,288 10,106,023

2001 15,849,921,438 14,976,310

2002 28,507,990,166 22,318,883

2003 36,553,368,485 30,968,418

2004 44,575,745,176 40,604,319

2005 56,037,734,462 52,016,762

2006 69,019,290,705 64,893,747

2007 83,874,179,730 80,388,382

2008 99,116,431,942 98,868,465

In 2008 a new gene sequence was uncovered every 1.7 seconds!…equivalent to 483 DNA base pairs every second of every day!

DNA contains “Genes” (i.e. “blueprint for living systems on earth)

“Genes” are the ‘coding’ information to make “Proteins”

Proteins are the functional units of life…enzymes, structures, etc., etc., etc.,…(i.e. the bricks, mortar, steel, hinges, cables, motors, etc.)

( ) ( ) ( ) ( )gene gene gene gene

Example: Hemoglobin

Single Nucleotide Polymorphisms (SNPs) are simple changes (or differences) in the DNA sequence that appear to have little or no impact on human health. They represent 90% of all human genetic variations.

Genetically similar to a mutation, but distinct in that a SNP is not causal to a clinical disease or disorder (or at least not yet causally linked, and not really applicable to ages >40 yrs old).

Across the human genome we average approximately 1 SNP for every 300 base pairs of DNA (over one million known SNPs that occur at a frequency of 1% or higher in the world population).

Important Consideration: Inheritance

The appearance of deleterious mutations during evolution tend to NOT be inherited for obvious reasons, at least those that affect growth, reproduction and viability.

…and our modern existence is the result of millions of years of tolerated (and occasionally beneficial) changes in our genome, which is most often evident in what we can and cannot eat or consume (think: evolutionary pressure & natural selection)

Monomethyl Hydrazine (in “False” Morel Mushrooms) Tylenol: Acetaminophen (Cats?)(many examples of “toxins” in nature, many of themare presumably synthesized to prevent consumptionor predation of the host plant or organism)

Introduction to PharmacoGenomics

Modern drug discovery & development falls outside the tolerances & toxicity that have resulted from evolution, because most of these compounds have NEVER been seen in nature.

Introduction to PharmacoGenomics

When you ingest a drug, the drug is absorbed into the circulatory system and is distributed throughout the body.

The drug is then available to carry out its intended ‘mechanism of action’ (MOA). In the case of WARFARIN, it inhibits Vitamin K Epoxide Reductase Complex 1 (VKORC1), and reduces blood clotting. It is the largest selling anticoagulant in the world, and the leading case in support of Personalized Medicine”.

Subsequently, the body has the ability to eliminate the drug from the body through “drug metabolism”, which is primarily carried out in the liver. WARFARIN is metabolized primarily by the oxidative liver enzyme CYP2C9, which basically adds an oxygen group to the WARFARIN structure thereby inactivating its MOA and increasing its likelihood of elimination from the body via the kidneys (urine).

For this reason, drug tests that utilize urine a sample source often look for the “metabolite” of the drug in the urine, rather than the ingested drug.

IMPORTANT: If you are prescribed WARFARIN, you have a condition that generates potentially life-threatening blood clots. If you are dosed with too much WARFARIN you could die from complications due to internal bleeding, yet if you are dosed with too little WARFARIN you may be in danger of serious consequences due to circulating embolism.

The “ideal” dosing curve for WARFARIN

Drug Plasma Concentration vs. Time

Minimum effectiveplasma concentration

Minimum toxicplasma concentration

WARFARIN

MOA: VKORC1 - Inhibition to prevent blood clottingMETABOLISM: CYP2C9 – Removable from the body

What would happen if there was a SNP in the gene for VKORC1 that (1) did NOT affect the clotting cascade, yet altered the protein enough to prevent WARFARIN binding and inhibition?

The drug is present in the patient, but NOT effective in patients that have this specific SNP!

RESULT: Excessive blood clotting and circulating emboli.

It is estimated that SNPs in VKORC1 are responsible for 15-30% of variability in WARFARIN therapy.

WARFARIN

MOA: VKORC1 - Inhibition to prevent blood clottingMETABOLISM: CYP2C9 – Removable from the body

What would happen if there was a SNP in CYP2C9 that reduced the rate of drug metabolism and elimination of WARFARIN?

The drug dosing curve would be elevated due to decreased metabolism and clearance of the drug from the body.

RESULT: Increased risk of complications due to internal bleeding, associated with WARFARIN overdosing.

There are 2 different SNPs in CYP2C9 that decrease WARRAFIN metabolism, occurring in 7% and 11% of the population, respectively.

Introduction to Personalized Medicine

It is estimated that up to 50% of variability in WARFARIN therapeutics and effectiveness are due to the presence of genetic variations (SNPs) in the genome.

This is certainly true for most other prescription drugs on the market, in light of variability that we all are familiar, such as decreased compliance, drug-drug interactions, certain drugs are more effective in some people, etc.

PERSONALIZED MEDICINE: using clinical genotyping to identify which drugs (and drug doses) are most safe and most effective in an individual, by identifying which SNPs that patient harbors (if any) that can be used to predict the patient’s response to a prescribed drug.

Missense mutations with functional effects mapped in the crystal structure of human CYP2C9 protein bound with warfarin (PDB: 10G5). S-warfarin and heme are shown in the skeleton model with pink and red, respectively. Amino acid residues are shown in the sphere mode with colors.

Introduction to Personalized Medicine

APPLIED GENOMICS: Personalized Medicine vs. Diagnostics/Prognostics

Modern healthcare can utilize the DNA testing as a means to determine an individual’s risk for developing certain diseases (i.e. Diagnostics and Prognostics), but this use of clinical genotyping is associated with serious legal, ethical and business hindrances.

GINA: The Genetic Information Non-discrimination Act (passed into law May 21, 2008, effective Nov 21st, 2009).

Personalized Medicine applies the methods of clinical genotyping ONLY to genetic markers associated with drug safety and drug efficacy, these markers are NOT associated with disease.

Furthermore, the practice of personalized medicine will significantly decrease adverse drug responses in the population (one of the top ten causes of death in the US), thereby making pharmacotherapeutics safer, and prevent the removal of beneficial drugs from the market.

Therefore personalized medicine is supported by a viable ‘value proposition’ to benefit pharmaceutical companies, healthcare insurers, and healthcare consumers.