Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
Analysis of Munc18c and Syntaxin4 Function During Tumour Cell Invasion
by
David Michael Martynowicz
A Thesis presented to
The University of Guelph
In partial fulfilment of requirements for the degree of
Master of Science in
Molecular and Cellular Biology
Guelph, Ontario, Canada
© David Michael Martynowicz, December, 2015
ABSTRACT
ANALYSIS OF MUNC18C AND SYNTAXIN4 FUNCTION DURING TUMOUR CELL INVASION
David Martynowicz Advisor: University of Guelph, 2015 Dr. M. G. Coppolino
Tumour cell invasion through the ECM (extracellular matrix) involves the precise
localization of proteins required for ECM proteolysis and cell migration. Membrane
trafficking events, mediated by SNAREs (Soluble NSF Attachment Protein Receptors),
have been implicated in these cellular processes. Previous studies on SNAREs indicate
that Syntaxin4 is involved in the formation of invadopodia (specialized degradative
structures formed during tumour cell invasion) in MDA-MB-231 cells; however, it
remains unclear how Syntaxin4 function is regulated during tumour cell invasion.
Munc18c is a known regulator of Syntaxin4 activity, and a potential role for Munc18c in
invadopodium-based ECM degradation and cell migration has been identified. Here,
biochemical and microscopic analyses revealed an association between Munc18c and
Syntaxin4. Munc18c knockdown perturbed invadopodium formation and cell migration.
Expression of a truncated form of Syntaxin4 designed to perturb Syntaxin4-Munc18c
interactions had similar effects. These results suggest Munc18c facilitates Syntaxin4
function during tumour cell invasion.
iii
Table of Contents
Acknowledgments ..............................................................................................................v
Declaration of Work Performed ..................................................................................... vi
List of Abbreviations ...................................................................................................... vii
List of Figures ..................................................................................................................... x
1.0 – Introduction ...............................................................................................................1
1.1 – Overview ................................................................................................................1
1.2 – Tumour Cell Invasion ...........................................................................................3
1.3 – Cellular contact and adhesion with the extracellular matrix ...........................3
1.4 – Cell Migration .......................................................................................................7
1.5 – Extracellular matrix proteolysis ..........................................................................7
1.6 – Invadopodia Formation ......................................................................................10
1.7 – Intracellular membrane trafficking ..................................................................13
1.8 – SNARE structure and function .........................................................................14
1.9 – SNARE-mediated trafficking during cell migration and invasion .................18
1.10 – Regulation of SNARE Complex Formation ...................................................19
1.11 – Munc18c Function as a Sec1/Munc18 protein ................................................21
1.12 – Experimental Objectives ..................................................................................24
2.0 – Materials and Methods ...........................................................................................26
2.1 – Materials ..............................................................................................................26
2.1.1: Reagents ...........................................................................................................262.1.2: cDNA constructs ..............................................................................................262.1.3: Cell Culture ......................................................................................................272.1.4: Transfections ....................................................................................................28
2.2 – Methods ................................................................................................................28
2.2.1: Creation of Stable Cell Lines ...........................................................................282.2.2: Cell Migration Assay .......................................................................................28
iv
2.2.3: Invadopodium Formation Assay ......................................................................292.2.4: Immunoprecipitation ........................................................................................292.2.5: Immunoblotting ...............................................................................................302.2.6: Immunofluoresence Microscopy .....................................................................302.2.7: Statistical Analysis ...........................................................................................31
3.0 Results .........................................................................................................................32
3.1 Syntaxin4 associates with Munc18c in MDA-MB-231 cells ...............................32
3.2 Syntaxin4 and Munc18c association is enhanced during invadopodium formation ......................................................................................................................34
3.3 Analysis of Munc18c localization relative to invadopodium components ........34
3.4 Munc18c knockdown impairs invadopodium formation ...................................36
3.5 Expression of N-terminal Syntaxin4-GFP impairs invadopodium formation .39
3.6 Munc18c knockdown and expression of N-terminal Syntaxin4-GFP impair cell migration .......................................................................................................................43
3.7 Creation of stable cell lines expressing either Munc18c, Syntaxin4-FL-GFP or N-terminal Syntaxin4-GFP .........................................................................................43
3.8 Evaluating invadopodium formation and cell migration by stable cell lines ...49
4.0 Discussion ...................................................................................................................52
5.0 Summary .....................................................................................................................61
6.0 References ...................................................................................................................64
v
Acknowledgments I would like to thank my supervisor, Dr. Marc Coppolino for his support during
my studies and providing me with the tools and experience that facilitated my growth as a
molecular and cellular biologist. I would also like to thank my advisory committee, Dr.
Nina Jones and Dr. Dick Mosser for their additional support during the entire process.
In no particular order, special thanks goes to the following people for their
influence throughout my entire experience in MCB: Maria Anillo, Vadika Mishra, Erin
Specker, Sean White, Matt Clarke, Dr. Steffen Graether, Evan Mallette, Kevin Bosse,
Agata Zienowicz, Charles Wroblewski, Reema Deol, Kestral Danzmann, Rachael
MacNeilly, Jennifer Butler, Allie Davidson, Tijana Matovic, Michael Brodzikowski, Wei
Wu, Rebecca Rumney, Jeff Madge, John Atkinson, Andrew Jenkins, Dr. Vladimir
Bamm, Dr. George Harauz, Sara Timpano, Richard Preiss, Angus Ross, Kristina
O’Hanley, Jessica Wong, Ranko Savic, Jordan Meyers, Marina Atalla, Greer Wallen,
Shruti Patel, Anna Quach, Katie MacKenzie, Megan Brasher, Joban Dhanoa, Pam
Loughran, Dr. Rod Merrill, Dr. John Dawson, Julia Ebeling, Dan Krska, Adam Schmidt,
Tom Keeling, Jordan Willis, Ava Keyvani Chahi, Claire Martin, Olivia Anderson,
Brianna Guild, Roman Kondra, Megan Massey, Adam Rocker, Kayla Heney, Dr. Karla
Williams, Stephanie Brunelle, Madison Turner, Rob Taylor-Reid, Amanda Poole, Kelly
Boddington, Dr. Kenrick Vassall, Dr. Miguel de Avila, Paula Russell, Hussam Alsarraf,
Jaspreet Kaur, Kim Kirby, Dr. Peihua Lu, Haidun Lu, Matiyo Ojehomon, Mackenzie
Charter, Candace Mehaffey, Brass Taps management, and the Second cup ladies.
Last but not least, to my parents and family, I could not have done this without
you – the most important tools to succeed were provided by you.
vi
Declaration of Work Performed Together, Ranko Savic and Megan Brasher performed ligations and subsequently
verified the creation of the following expression constructs: N-terminal Syntaxin4-GFP
and untagged human Munc18c. Dr. Marc Coppolino created the G418 kill-curve
necessary for the selection and maintenance of the stable cell lines described in this
thesis. The author performed all other experiments.
vii
List of Abbreviations α-SNAP N-ethylmaleimide-sensitive factor attachment protein alpha
ARP Actin-related protein BCS Bovine Calf Serum BSA Bovine Serum Albumin CD44 Cluster of differentiation 44 cDNA Complementary deoxyribonucleic acid CHO Chinese Hamster Ovary DMEM Dulbecco’s modified Eagle’s medium DNA Deoxyribonucleic acid DOC Deoxycholate ECM Extracellular Matrix EDTA Ethylenediaminetetraacetic acid EGFP Enhanced Green Fluorescent Protein F-actin Filamentous actin FBS Fetal Bovine Serum FL Full Length G418 Geneticin GFP Green Fluorescent Protein GLUT4 Glucose transporter type 4 GTPase Guanosine triphosphate hydrolase Habc Domain with anti-parallel α-helices labelled a, b, and c HEK-293 Human embryonic kidney cells 293
viii
HRP Horseradish peroxidase IgG Immunoglobulin type G IP Immunoprecipitation kDa kiloDaltons M Mouse miRNA Micro ribonucleic acid MMP Matrix Metalloprotease MT1-MMP Membrane Type 1 – Matrix Metalloprotease Munc18 Mammalian uncoordinated-18 NA Numerical Aperture NSF N-ethylmaleimide sensitive fusion protein NP40 Nonylphenoxypolyethoxylethanol N-terminal Amino terminal N-WASP Neuronal Wiskott-Aldrich syndrome protein ORF Open reading frame PAGE Polyacrylamide gel electrophoresis PBS Phosphate buffered saline PCR Polymerase chain reaction PFA Paraformaldehyde PLL Poly-L-Lysine PVDF Polyvinylidene fluoride Rb Rabbit Rab Ras-related in brain
ix
Ras Rat sarcoma RNA Ribonucleic acid RNAi Ribonucleic acid interference SDS Sodium dodecyl sulfate Sec1 Protein transport protein SEC1 S.E.M. Standard error of the mean STX4 Syntaxin 4 siRNA Short interfering ribonucleic acid SNAP Synaptosomal-associated protein
SNARE Soluble N-ethylmaleimide-sensitive factor attachment protein receptor
TBST Tris buffered saline with Tween-20 added Tris 2-Amino-2(hydroxymethyl)-1,3-propanediol TX-100 Triton X-100 VAMP Vesicle-associated membrane protein
x
List of Figures
Figure 1: Schematic representation of metastasis ...........................................................4
Figure 2: Schematic diagram of cell adhesion .................................................................6
Figure 3: Schematic diagram of two-dimensional cell migration ..................................8
Figure 4: Simplified model of invadopodium formation ..............................................12
Figure 5: Overview of membrane trafficking pathways ..............................................15
Figure 6: SNARE-mediated membrane fusion .............................................................17
Figure 7: Different Syntaxin binding modes of SM proteins .......................................22
Figure 8: Analysis of Syntaxin4 and Munc18c association in MDA-MB-231 cells. ...33
Figure 9: Syntaxin4 and Munc18c association increases during invadopodium formation. .................................................................................................................35
Figure 10: Subcellular distribution of Munc18c during the formation of invadopodia ..............................................................................................................37
Figure 11: RNAi-mediated knockdown of Munc18c ....................................................38
Figure 12: RNAi-mediated knockdown of Munc18c impairs invadopodium formation. .................................................................................................................40
Figure 13: Segmental architecture of N-terminal Syntaxin4-GFP. .............................41
Figure 14: N-terminal Syntaxin4-GFP impairs invadopodium formation. ................42
Figure 15: N-terminal Syntaxin4-GFP does not alter co-immunoprecipitation of Syntaxin4 with Munc18c. ........................................................................................44
Figure 16: Munc18c knockdown or overexpression of N-terminal Syntaxin4 impairs cell migration. ...........................................................................................................45
Figure 17: Expression of GFP-Munc18c in HEK-293 cells. .........................................46
Figure 18: Expression of Munc18c, GFP-Syntaxin4-full length or GFP-Syntaxin4-N-terminus in stable cell lines. ....................................................................................48
Figure 19: Analysis of invadopodium formation by stable cell lines. .........................50
Figure 20: Quantification of invadopodium formation and cell migration by stable cell lines. ....................................................................................................................51
xi
Figure 21: Proposed model of Munc18c function during tumour cell invasion .........63
1
1.0 – Introduction 1.1 – Overview
Cellular invasion and migration are fundamental to the homeostasis of
multicellular organisms. They are integral parts of many physiological processes
including embryogenesis and the maintenance of tissue architecture. During embryonic
development, cells must remodel the ECM and migrate to their intended destination in
order to form specialized tissues and organs (Moissoglu & Schwartz, 2012). During
vertebrate organogenesis, movement through and breakdown of the ECM by epithelial
cells of the lung and kidney are important for the expansion of these tissues (Andrew &
Ewald, 2010; Lu, Sternlicht, & Werb, 2006). Cellular invasion also plays an important
role in wound healing and immune cell surveillance. Mesenchymal stem cells must
migrate to the damaged area in order to fill in a wound, and subsequently leukocytes, in
response to external stimuli, extravasate through the vascular basement membrane to
mitigate foreign material within the wounded area (Huttenlocher & Horwitz, 2011).
Similar cellular processes that mediate cellular invasion in normal physiological
processes are also attributed to the progression of pathological disorders such as cancer
(Friedl & Alexander, 2011). Metastatic spread of cancer is mediated, in part, by tumour
cell invasion through the ECM. Tumour cell invasion through the ECM barrier can be
defined as a multistep process comprising cell adhesion, ECM proteolysis and cell
migration (Bravo-Cordero, Hodgson, & Condeelis, 2012). To move through the ECM,
cells first utilize surface receptors to engage with ECM components. Cells also secrete
proteases to degrade the ECM and ultimately migrate through it. The molecular
mechanisms that regulate the function of these processes are currently an important area
2
of research due to their significance to cancer management and treatment. An important
area of study that has advanced our understanding of the molecular machinery used by
cells during tumour cell invasion is invadopodia. These subcellular structures are actin-
driven cell membrane protrusions utilizing both cell surface ECM receptors and
proteolytic enzymes for their function and formation. Invadopodia have been studied in
cancer cells in a variety of microenvironments in vitro (Artym et al., 2015; Tolde, Rösel,
Veselý, Folk, & Brábek, 2010), and evidence from in vivo studies supports their
relevance and role in the dissemination of tumour cell populations (Clark et al., 2008;
Leong et al., 2014; Lohmer, Kelley, Hagedorn, & Sherwood, 2014).
Membrane trafficking of proteins to invadopodia is required for their formation
and function during tumour cell invasion. The molecular mechanisms controlling the
trafficking of these proteins are an active area of study. Key players of intracellular
membrane trafficking events are SNAREs. These proteins function to localize and fuse
vesicles with target membranes. Work has started to highlight an important role for
SNARE-mediated trafficking in invadopodium formation and tumour cell invasion;
however, the mechanism that controls SNARE function in this context is not well
understood. Research into this area may lead to a better understanding of the formation of
invadopodia and the mechanisms by which cells can become invasive. Furthermore, by
defining the mechanism of SNARE regulation in this process, the development of
therapies that could reduce ECM degradation and invasion by tumour cells may be
possible.
3
1.2 – Tumour Cell Invasion
A simple model of metastasis describes the escape of a tumour cell from a
primary tumour and movement through the ECM, ultimately leading to its dissemination
to distant sites within the body (Beaty & Condeelis, 2014). The degradation of the ECM
by invading carcinoma cells is a good example of this (Hanahan & Weinberg, 2011).
Carcinomas restricted to the epithelium may be considered benign. However, the
acquisition of an invasive phenotype by cells of the tumour would lead to the breaching
of the basement membrane, and individual or groups of cancer cells may then begin to
invade underlying ECM and nearby lymphatic or vascular vessels (Yamaguchi, 2012)
(Figure 1). Once these cells arrive within the lumen of these vessels, they can travel
within the blood or lymph to other areas of the body and potentially establish metastases.
Invasion into the ECM by carcinoma cells also releases growth and survival factors that
have been sequestered by the ECM (Talmadge & Fidler, 2010). Taken together, tumour
cell invasion involves alterations in the molecular mechanisms that control cell adhesion,
proteolytic degradation of the ECM, and cell migration.
1.3 – Cellular contact and adhesion with the extracellular matrix
The ECM is an important interlocking mesh composed of fibrous proteins and
glycoproteins acting as a supportive scaffold and physical barrier to maintain tissue
organization (Ridley et al., 2003). Examples of ECM components include: collagen,
fibronectin and vitronectin (Oskarsson, 2013). In multicellular organisms, contact
between the cell and ECM provides a crucial biochemical bridge between the
extracellular and intracellular environments allowing modulation of cellular behaviour.
Cells make contact with the ECM through a variety of specialized structures that mediate
4
Figure 1: Schematic representation of metastasis In the epithelium, cells of a primary tumour develop an invasive phenotype and invade the basement membrane with the aid of invadopodia. Invasive cells can then migrate through the stromal tissue to intravasate a nearby blood vessel, travel to secondary sites, and potentially form metastases.
Invadopodia) Invasion)
Primary)Tumour)
Basement))membrane)
Blood)vessel)
Distant)Metastasis)
Stroma)
5
homeostasis by conferring anchorage, motility, and signal transduction (Adams, 2002).
Anchorage of the cell to the ECM can be provided by mechanically supportive contacts
such as hemidesmosomes, which link the cytoskeleton of epithelial cells to the basement
membrane through the engagement of specialized adhesion receptors (Borradori &
Sonnenberg, 1999). Contractile contacts, such as focal adhesions, mediate cellular
movement by utilizing the cells actomyosin motor system to provide force against the
rigid ECM via cytoskeletal remodelling (Zamir et al., 2000). Protrusive contacts, such as
filopodia, are actin-containing extensions of the plasma membrane at the leading edge of
migrating cells, which facilitate extension into the ECM (Mattila & Lappalainen, 2008).
Collectively, cell-matrix contacts are dynamic and specialized structures that allow
sampling of the environment around the cell body.
Cell adhesion and interaction with the ECM is primarily mediated through the
integrin family of receptors (Berrier & Yamada, 2007). Integrins are transmembrane
glycoproteins, which perform their function as heterodimers of α and β subunits. Each
subunit comes together to bind ECM substrates located in the pericellular environment
and this transmits intracellular signals through the cytoplasmic domains. Briefly, cell
adhesion begins with the binding of integrins to ECM substrates resulting in the
recruitment of other integrins and signalling and scaffolding proteins that mediate
cytoskeletal rearrangements. This focal accumulation of proteins is termed a focal
adhesion, and as the cell spreads, more focal adhesions take shape, leading to a fully
spread and adherent cell (Figure 2).
6
Figure 2: Schematic diagram of cell adhesion Adhesion to the ECM is mediated by integrins. Upon binding to an ECM substrate, integrins recruit cytoskeletal, scaffolding and signalling proteins. Focal sites of attachment form, which can mature into focal adhesions. Focal adhesions are stabilized by F-actin fibres, leading to a fully spread and adherent cell.
Cell$in$suspension$
Adhesion$ Spreading$
F3ac5n$ Integrin$ Extracellular$Matrix$
7
1.4 – Cell Migration Cell migration is a multistep process that occurs in response to external stimuli
and involves the repetition of the following steps: 1) membrane extension at the leading
edge, 2) cell adhesion to the ECM, 3) contraction of the cell body, and 4) detachment at
the cell rear (Ridley et al., 2003). Initially, membrane protrusions such as lamellipodia at
the leading edge of the cell take shape and sample the environment beyond the cell body
(Figure 3). Regulators of actin polymerization promote the formation of these
protrusions. Once an actin containing protrusion has been produced, adhesive contacts
must form to prevent retraction of the newly formed membrane protrusion. This is
facilitated by focal adhesions, which ultimately link the actin cytoskeleton to the ECM.
The next step in cell migration involves the contraction of the cell body. This is primarily
mediated through actomyosin-based forces directed against the ECM. Concomitantly,
adhesions that were initially produced at the leading edge reach the rear of the cell as the
cell body translocates. These older adhesions disassemble in response to actomyosin
contraction or protease-directed degradation. Taken together, actomyosin contraction
and adhesion disassembly at the rear promotes cell body translocation.
1.5 – Extracellular matrix proteolysis
Dissolution of the ECM is an important prerequisite for tumour cell invasion
(Hanahan & Weinberg, 2011). This process has been shown to be largely dependent on
the engagement of MMPs with ECM substrates (Egeblad & Werb, 2002; Hojilla, Wood,
& Khokha, 2008). Furthermore, invadopodia rely on MMPs to facilitate their maturation
(Clark & Weaver, 2008; Linder, 2007). The human MMP family of proteins comprises
23 members that are zinc dependent-endopeptidases with broad substrate specificity
8
Figure 3: Schematic diagram of two-dimensional cell migration Cells adherent to ECM establish focal adhesions. Migration begins with membrane protrusions such as lamellipodia that extend in the direction of movement. New focal adhesions form at the leading edge and actomyosin contraction causes the cell body to translocate while older focal adhesions at the cell rear disassemble.
Focal&Adhesion&
New&Adhesion&
Lamellipodium&
Extension&
Adhesion&
De8adhesion&
Direc:on&of&Movement&
Cell&body&movement&
9
(Jackson, Nebert, & Vasiliou, 2010). Two further divisions categorize these proteins as
soluble or membrane-anchored. The membrane-anchored MMPs contain either a
transmembrane domain or a glycosylphosphatidylinositol anchor and the soluble MMPs
are secreted by cells into the ECM environment (Llano et al., 1999; Sohail et al., 2008;
Takino, Sato, Shinagawa, & Seiki, 1995). Both types are translated as inactive zymogens,
therefore requiring cleavage of their intrinsic pro-domains to be proteolytically active.
The activity of MMPs has been shown to be closely linked to the invasiveness of several
aggressive cancers such as melanoma, breast, ovarian, and colorectal (Decock et al.,
2008; Seftor et al., 2001; Sodek, Ringuette, & Brown, 2007; Zucker et al., 1999). Tumour
progression in these cancers has also been shown to correlate specifically with the
enzymatic activity of MT1-MMP (Sabeh, Shimizu-Hirota, & Weiss, 2009). Moreover,
invadopodium formation has been shown to be mediated by MT1-MMP (Artym, Zhang,
Seillier-Moiseiwitsch, Yamada, & Mueller, 2006). Over-expression of MT1-MMP in
moderately invasive melanoma cells was shown to increase matrix degradation and
invadopodium activity (Revach & Geiger, 2014). Other studies have demonstrated that
over-expression of MT1-MMP in different cancer cell types promoted invasion using in
vitro and in vivo models (Hotary et al., 2003; Sabeh, 2004). In addition, the knockdown
of MT1-MMP in invasive breast cancer cell lines reduced the ability of cells to invade
ECM substrates in vitro (Jiang et al., 2006). MT1-MMP is important to the degradation
of ECM components utilized by invasive carcinomas, and much evidence points to a role
for MT1-MMP in invadopodium-based tumour cell invasion.
10
1.6 – Invadopodia Formation
Cellular degradation and migration through the ECM is important for cellular
processes involving tissue remodelling, including wound healing, embryogenesis, and
immune cell surveillance (Daley, Peters, & Larsen, 2008; Lu, Takai, Weaver, & Werb,
2011; Vicente-Manzanares, 2005). Actin-driven invadosomes are protrusive contacts that
facilitate focal ECM degradation and cell motility through the use of proteolytic enzymes
(Linder, Wiesner, & Himmel, 2011; Murphy & Courtneidge, 2011). Podosomes refer to
these structures in normal cells, such as macrophages and dendritic cells (Burns, 2001;
Linder, Hufner, Wintergerst, & Aepfelbacher, 2000), whereas in cancerous cells they are
referred to as invadopodia (Gimona, Buccione, Courtneidge, & Linder, 2008). The partial
degradation of ECM components is crucial for tumour cell invasion and it is the
employment of invadopodia with their localized proteolytic machinery that helps to
initiate metastasis (Blouw, Seals, Pass, Díaz, & Courtneidge, 2008; Clark et al., 2008).
In 1989, the term ‘invadopodia’ was first used to describe the phenomenon of
overlapping microfilament-containing membrane protrusions and localized sites of
substratum degradation in Rous sarcoma virus transformed fibroblasts (Chen, 1989).
More accurately, these sub-cellular structures are now described to be located
predominantly on the ventral surface and situated below the nucleus of an invasive
carcinoma cell (Artym et al., 2015). Furthermore, these protrusions can be observed in
vitro, using confocal microscopy techniques, and have been observed to overlap with
sites of proteolytic degradation and F-actin punctae when aggressive cancer cells are
cultured on various ECM substrates, such as fluorescently conjugated gelatin or
fibronectin (Hoshino et al., 2013; Oser et al., 2009).
11
The multitude of proteins that converge at invadopodia is indicative of a complex
and highly regulated means of cellular invasion. Research into these sub-cellular
structures has discerned 4 main subgroups of proteins involved in their formation and
activity. The first group consists of cell motility and protrusion-inducing machinery,
which includes regulators of F-actin polymerization and branching. Examples of these are
ARP2/3, N-WASP, cofilin, cortactin, and dynamin (Baldassarre, 2002; Oser et al., 2009;
Yamaguchi et al., 2005). Adhesion proteins constitute the second group, categorized
based on the maintenance of cell-ECM contact. These adhesion molecules are
exemplified by integrins and CD44 (Kajita et al., 2001; Wolf et al., 2007).The third group
consists of signalling proteins from the tyrosine kinase family and Ras-related GTPases,
which ultimately regulate membrane trafficking and dynamics (Neel et al., 2012; Tehrani,
Tomasevic, Weed, Sakowicz, & Cooper, 2007). The final group is made up of the
proteolytic machinery that facilitates ECM degradation, including members of the MMP
family, separase, and urokinase-type plasminogen activators system (Artym, 2002;
Monsky et al., 1994; Revach & Geiger, 2014).
During the formation of invadopodia (Figure 4), cells adhere to the ECM through
interactions with ventral surface integrins. Concomitantly, growth factors such as
epidermal growth factor and platelet derived growth factor trigger a signalling cascade
that ultimately leads to the recruitment of actin modifying proteins to sites of forming
invadopodia (Mader et al., 2011; Yamaguchi et al., 2005). Next, cortactin associates with
N-WASP and the ARP2/3 complex to mediate F-actin assembly and branching, resulting
in a protrusion of the plasma membrane, driven by the force of actin filament formation.
Subsequently, membrane trafficking of MT1-MMP to invadopodia facilitates membrane
12
Figure 4: Simplified model of invadopodium formation Cells initially establish adhesions through integrins and stimulate signalling pathways through growth factor receptor tyrosine kinases (RTKs). F-actin formation and branching by N-WASP and cortactin establishes protrusions of the cell membrane into the extracellular matrix. Trafficking of MT1-MMP facilitates invadopodium maturation through degradation of extracellular matrix components. F-actin core disassembly begins through changes to actin modifying proteins, initiating invadopodia disassembly and subsequent cellular migration through the degraded extracellular matrix.
Ini$a$on' Assembly' Matura$on' Disassembly'
Cortac$n'
N7WASP'
F7ac$n'
MT17MMP'
RTK'
Integrin'
13
protrusion into the basement membrane as the invadopodium matures (Clark, Whigham,
Yarbrough, & Weaver, 2007; Steffen et al., 2008). MT1-MMP is theorized to invoke a
positive, feed forward mechanism through the release of extracellular growth factors
from the ECM (Díaz, Yuen, Iizuka, Higashiyama, & Courtneidge, 2013) and the
activation of MMP-2, which can also activate growth factor receptors (Dean et al., 2007;
Sato et al., 1994). Mature invadopodia are established once ECM degradation has
occurred and are relatively long-lived structures persisting for hours. Their disassembly
has been suggested to begin with the clearance of F-actin and cortactin leaving behind an
MT1-MMP containing invadopodium that is still capable of localized ECM degradation
(Artym et al., 2006).
1.7 – Intracellular membrane trafficking
Eukaryotic plasma membranes provide a physical barrier between a cell and its
extracellular environment, and regulate the transport of molecules to and from this
environment in order to maintain homeostasis inside the cell. Membranes are also
important inside the cell: each organelle within the cell (for example, the Golgi complex)
is surrounded by a lipid bilayer, which, similar to the plasma membrane, is involved in
regulation of transport into and out of each organelle.
Cell migration and invasion require the precise localization of adhesion and
signalling proteins. Membrane trafficking coordinates the transport and localization of
these proteins from different membrane compartments. The transport of vesicles between
membranes can be broadly defined (Figure 5). In summary, vesicle formation involves
the budding off of vesicles from the donor membrane. Vesicle movement is the
transportation of vesicles along microtubules or actin filaments through the action of
14
motor proteins. Vesicle tethering and docking mediates the correct targeting of vesicles
and brings donor and target membranes in close proximity. Ultimately, this leads to the
process by which lipid bilayers merge, therefore delivering the contents of the vesicle to
the target compartment or extracellular environment. SNAREs are proteins that mediate
membrane fusion events and the purpose of the studies described in this thesis is to
examine the regulation of SNAREs during cellular invasion.
1.8 – SNARE structure and function
Thirty-six SNAREs have been identified in humans (Jahn & Scheller, 2006).
SNAREs assemble into complexes containing a 4-helix bundle formed by their SNARE
motifs. Initially, SNARE proteins were classified according to the membrane they reside
in, the target or vesicle. Elucidation of the 3D structures of SNARE complexes
subsequently revealed the presence of a central ionic layer in the α-helix bundle
containing three glutamine (Q) residues and one arginine (R). This led to the
reclassification of SNARE proteins as either R- or Q-SNAREs depending on which
residue they contribute to the ionic layer (Kloepper, Kienle, & Fasshauer, 2007). The 4-
helix bundle of the SNARE complex contains one member of each of the four SNARE
subtypes, referred to as R, Qa, Qb, and Qc.
Within cells, SNAREs can be functionally described under three general protein
types. Syntaxins, a family of Q-SNARE proteins, are found to be localized to different
membrane compartments and function in several trafficking pathways (Teng, Wang, &
Tang, 2001). membrane compartments and function in several trafficking pathways For
example, Syntaxin4 is predominantly found at the plasma membrane in many cell types
(Band et al., 2002), and in adipocytes it is involved in the fusion of GLUT4 storage
15
Figure 5: Overview of membrane trafficking pathways Intracellular trafficking allows transport of cargo contained in vesicles to other membranous compartments within the cell. The biosynthetic pathway shuttles material synthesized in the ER to the Golgi complex for processing and is subsequently secreted to the plasma membrane. Recycling begins with endocytosis at the plasma membrane and trafficking to an early endosomal compartment. Some endocytosed material is then delivered to late endosomes and then lysosomes for degradation. Another endocytic route brings material back to the plasma membrane from the early endosome directly or through a recycling endosome.
Recycling))Endosome)
Recycling)
Lysosome)
Late))Endosome)
Endocytosis)
Early)Endosome)
Trans4Golgi)network)
Golgi)
Endoplasmic)Re9culum)
Nucleus)
16
vesicles with the plasma membrane in response to insulin signalling (Tellam, Macaulay,
McIntosh, & Hewish, 1997). The cytoplasmic portion of Syntaxin4 contains a conserved
SNARE motif, and a regulatory Habc domain consisting of three anti-parallel helices at its
N-terminus (Ungar & Hughson, 2003). The Habc domain is able to regulate SNARE
complex formation by conferring an open or closed conformation. The open
conformation allows Syntaxin4 to interact with cognate partners. The closed
conformation prevents SNARE complex formation (Dulubova et al., 2007). The second
type of SNAREs, synaptosome-associated proteins (SNAP), has two Q-SNARE domains.
For example, the ubiquitously expressed, SNAP23 interacts with Syntaxin4 during
GLUT4 vesicle fusion with the plasma membrane in adipocytes (Widberg, 2003).
Separated by a flexible linker region, these proteins are membrane anchored by post-
translational palmitoylation of cysteine residues in this linker region (Puri & Roche,
2006). Finally, vesicle of associated membrane proteins (VAMP) are members of the R-
SNARE family, and are comprised of a C-terminal transmembrane domain, a SNARE
motif, and a variable N-terminal domain. (Jahn & Scheller, 2006). Multiple VAMP
isoforms have been identified, with roles in a wide range of cellular trafficking pathways.
SNARE complex formation can occur when a vesicle membrane is apposed to a
target membrane (Figure 6). Once the SNAREs are in contact with each other, they form
a trans-SNARE complex when SNARE motifs form a coiled-coil. The energy released
from this complex formation helps overcome the energy barrier to merge the two
membranes, promoting membrane fusion and leaving a cis-SNARE complex (Hong,
2005). The disassembly of cis-SNARE complexes does not occur spontaneously and is
regulated by the cytosolic proteins NSF (N-ethylmaleimide sensitive fusion protein) and
17
Figure 6: SNARE-mediated membrane fusion SNARE complex assembly and vesicle docking occurs as the SNARE motif of an R-SNARE (blue) forms a complex with two other SNARE motifs from a SNAP family member (yellow) and one from Syntaxin (red). Trans-complex formation results from the zippering of the four SNARE motifs. Membrane fusion results in a cis-complex.
Target'Membrane'
Target'+'Vesicle'Membrane'
trans2complex'
cis2complex'
Vesicle'
18
α-SNAP (soluble NSF attachment protein alpha). The adaptor protein, α-SNAP, binds to
the cis-SNARE complex and recruits NSF, which through its ATPase activity separates
the complex. The SNARE proteins are recycled through the retrograde transport of R-
SNAREs and separation of Q-SNAREs.
1.9 – SNARE-mediated trafficking during cell migration and invasion
Studies of SNARE-mediated trafficking and integrin localization have shown the
relevance of SNARE function during cell migration and cell spreading. Expression of a
dominant negative form of NSF (E329Q-NSF) has been observed to impair disassembly
of SNARE complexes (Coppolino et al., 2001), thereby reducing the amount of free
SNAREs available to mediate membrane fusion. Expression of this construct impaired
cell migration in CHO cells (Tayeb et al., 2005). It was then determined that inhibition of
specific SNARE-mediated trafficking pathways perturbed trafficking of α5β1 and
impeded cell spreading, but not cell adhesion, when CHO cells were seeded on
fibronectin (Skalski & Coppolino, 2005).
SNARE-mediated membrane trafficking is also important for the delivery of
MMPs to the plasma membrane and during invadopodium formation. Previous work has
demonstrated that in the invasive cell line, HT-1080, inhibition of Syntaxin13, SNAP23
and VAMP3 perturbed the trafficking of MT1-MMP and the secretion of MMP2 and
MMP9, but did not alter cell migration (Kean et al., 2009). Other studies have shown the
importance of SNARE-mediate trafficking of MT1-MMP to the plasma membrane in
invasive carcinoma cells (Miyata et al., 2004; Steffen et al., 2008). Using the MDA-MB-
231 cell line as a model system for the study of invadopodia, SNAREs have been
identified to have a role in invadopodium formation (Williams & Coppolino, 2014). The
19
SNARE complex responsible for the delivery of MT1-MMP to invadopodia was
elucidated to be dependent on the Q-SNAREs SNAP23 and Syntaxin4, and the R-
SNARE VAMP7 (Williams, McNeilly, & Coppolino, 2014). Moreover, inhibition of
these SNAREs perturbed invadopodium formation. Taken together, specific SNARE-
mediated trafficking pathways have been identified which are important for the
localization of key proteins involved in cellular invasion.
1.10 – Regulation of SNARE Complex Formation
Although it is known that SNAREs are central mediators of membrane fusion,
how the formation of SNARE complexes is regulated during cell invasion in not
completely understood. The control of SNARE complex formation has been shown to
involve regulatory non-SNARE proteins and post-translational modifications (Hong,
2005; Tomes, 2015). Both of these factors have been implemented in the restriction of
SNARE assembly, catalysis of SNARE complex assembly, or the maintenance of
SNAREs in an active or inactive conformation. Some of the ways that SNARE complex
formation can be regulated by these factors are briefly described below.
The regulation of SNARE complex formation can be controlled by the
phosphorylation of SNAREs. For example, SNAP23 is phosphorylated by SNAK kinase,
resulting in a lack of association with Syntaxin4 at the plasma membrane (Cabaniols,
Ravichandran, & Roche, 1999). SNAP23 has also been shown to be phosphorylated by
protein kinase C, resulting in reduced binding to Syntaxin4 (Polgár, Lane, Chung, Houng,
& Reed, 2003). Syntaxin4 can be serine/threonine phosphorylated in vitro by casein
kinase 2 (Risinger & Bennett, 2002), protein kinase C (Chung, Polgár, & Reed, 2000),
and protein kinase A (Foster et al., 1998) and these phosphorylation events reduce
20
binding to cognate SNAREs. Phosphorylation of Syntaxin4 by Rab3d-kinase was also
found to decrease binding to SNAP23 (Pombo et al., 2001). Previous work has made the
observation that serine/threonine phosphorylation of Syntaxin4 was decreased during
invadopodium formation, suggesting that Syntaxin4 dephosphorylation was regulated
during trafficking of MT1-MMP to the invadopodial plasma membrane (Williams et al.,
2014). Taken together, phosphorylation of SNARE proteins is a means of regulating
cognate SNARE binding and therefore subsequent vesicle-target membrane fusion.
SNARE complex formation can also be regulated through interactions with non-
SNARE proteins. For example, the neuronal protein Snapin complexes with SNAP25 in
order to enhance binding to cognate SNAREs and therefore facilitate exocytosis (Pan,
Tian, & Sheng, 2009). Other neuronal proteins, synaptophysin and tomosyn, also regulate
vesicle fusion by controlling SNARE interactions. Synaptophysin binds to the R-SNARE
synaptobrevin preventing any binding with SNAP25, and tomosyn binds with SNAP25 to
prevent synaptobrevin binding (Yelamanchili et al., 2005). Another neuronal protein,
Munc18a, has been shown to bind to isolated Syntaxin1 in the closed conformation as
well as its cognate SNARE trans-complex (Dulubova et al., 2007; Schollmeier, Krause,
Kreye, Malsam, & Söllner, 2011). This protein is hypothesized to regulate membrane
fusion in neuronal cells either by inhibiting Syntaxin1 from forming complexes or by
enhancing membrane fusion – its exact function remains unclear. It has also been shown
that in pancreatic beta cells gelsolin binds Syntaxin4, and this interaction prevents
SNARE complex formation. Perturbation of this interaction by glucose uptake facilitates
insulin exocytosis (Kalwat, Wiseman, Luo, Wang, & Thurmond, 2012).
21
1.11 – Munc18c Function as a Sec1/Munc18 protein
Sec1/Munc18 (SM) proteins were first identified through a genetic screen of
uncoordinated mutants of the nematode Caenorhabditis elegans (Brenner, 1974) and
orthologs in mammals were subsequently identified, defining three isoforms: Munc18-a, -
b and –c (Hata, Slaughter, & Südhof, 1993). SM proteins are 60-70 kDa proteins, found
both in the cytosol and associated with membranes via interaction with their cognate
SNAREs. Studies in neuronal tissue identified Syntaxin as a major binding partner of SM
proteins (Pevsner, Hsu, & Scheller, 1994). Structural data shows that the overall fold of
SM proteins is highly conserved between different species, supporting the notion of a
common function (Bracher & Weissenhorn, 2002; Hu, Latham, Gee, James, & Martin,
2007; Misura, Scheller, & Weis, 2000). The structure includes three domains that fold
together to form a large cavity on one side, and a groove on the other. SM proteins have
been shown to interact with syntaxin by at least one of three ways (Figure 7): through
binding to the closed conformation, the N-terminal peptide domain, and the 4-helical
SNARE complex (Südhof & Rothman, 2009; Yu et al., 2013).
SM proteins show a similar loss-of-function phenotype as that of SNAREs and
are essential for every pathway of intracellular vesicle fusion (Burgoyne et al., 2009; Carr
& Rizo, 2010; Toonen & Verhage, 2007). SM proteins have previously been viewed as
regulators of SNARE function, but current findings suggest that SM proteins also
cooperate with SNARE complexes to mediate membrane fusion. Munc18a is able to bind
to closed Syntaxin1, as well as the trans-SNARE complex (Dulubova et al., 2007;
Schollmeier et al., 2011). The same observation has been made with Munc18c and its
high affinity binding partner, Syntaxin4 (Yu et al., 2013). Munc18a and Munc18c are not
22
Figure 7: Different Syntaxin binding modes of SM proteins SM proteins (purple) have been shown to interact with their cognate syntaxin (red) by three ways: full-length closed conformation of the syntaxin, the trans-SNARE complex, and the N-terminal domain of Syntaxin.
Full$length* SNARE$complex* N$terminal*
NH3+*
NH3+*
NH3+*
Habc*
SNARE$mo<f*
23
functionally interchangeable, suggesting there is a conserved mechanism of action
between isoforms though differences lie in cognate SNARE recognition. As a result, the
current model for SM protein function is that the Q-SNARE Syntaxin adopts a closed
conformation and is sequestered from cognate SNAREs by an SM protein (Baker et al.,
2015). When the vesicle comes into the proximity of the target membrane, the SM
protein-bound Q-SNARE assembles with the R-SNARE and then the other Q-SNAREs.
The SM protein then repositions to enhance trans-SNARE complex formation, therefore
promoting membrane fusion.
Munc18c has broad tissue distribution (McIntosh, 1995) and has been implicated
in several exocytic pathways. It has been found to influence secretion in neutrophils
(Brochetta et al., 2008), exocytosis in platelets (Schraw et al., 2004), and the sustained
phase of insulin secretion in adipocytes (Oh & Thurmond, 2009). Physiologically,
Munc18c has been shown to be crucial for the exocytosis of the glucose transporter,
GLUT4, during glucose homeostasis (Jewell et al., 2011). In response to insulin
signalling, GLUT4 storage vesicle fusion requires Syntaxin4 and SNAP23 as the Q-
SNAREs, VAMP2 as the R-SNARE, and Munc18c as the cognate SM protein (Brandie
et al., 2008). Homozygous knockout of Munc18c is embryonic lethal in mice; however,
heterozygous mice are viable, exhibiting a large decrease in insulin-stimulated GLUT4
plasma membrane integration compared to wild-type mice (Oh, Spurlin, Pessin, &
Thurmond, 2005). Furthermore, disruption of the interaction between endogenous
Munc18c and Syntaxin4 was also found to cause a decrease in the fusion of GLUT4-
containing vesicles with the plasma membrane and thus glucose uptake (Thurmond,
Kanzaki, Khan, & Pessin, 2000).
24
1.12 – Experimental Objectives
The observed functional importance of SNARE complex regulation on membrane
trafficking events in other contexts suggests that it may be contributing to membrane
trafficking events that support tumour cell invasion. Recent research has contributed to a
model wherein cellular invasion and invadopodium formation are dependent on the
SNARE-mediated trafficking of key proteins that facilitate invasion through the ECM
(Kean et al., 2009; Williams et al., 2014; Williams & Coppolino, 2014). Syntaxin4 has
been identified as one of the SNARE proteins responsible for the trafficking of MT1-
MMP to the plasma membrane (Miyata et al., 2004), including sites of invadopodium
formation in MDA-MB-231 cells. The ubiquitous expression of Munc18c in tissues
suggests that it may be involved in regulating Syntaxin4 in cells forming invadopodia.
The purpose of this study is to characterize the relationship between Syntaxin4 and
Munc18c during tumour cell invasion in MDA-MB-231 cells. The hypothesis of this
study is thus: Munc18c function facilitates invasion of the ECM by MDA-MB-231 cells.
To elucidate the function of Munc18c, the aims of this thesis are as follows:
Aim 1: Characterize the interaction between Syntaxin4 and Munc18c during cellular
invasion.
This will be achieved by using co-immunoprecipitation experiments to monitor
the association between endogenous Munc18c and Syntaxin4. Confocal microscopy will
be used to assess the localization of these proteins during invadopodium formation.
Aim 2: Examine the role of Munc18c during cellular invasion.
Inhibition of Munc18c function will be carried out using RNAi-mediated
knockdown and through the expression of a truncated version of Syntaxin4. Truncated
25
Syntaxin4 is predicted to act as a competitive inhibitor for Munc18c and Syntaxin4
interactions. Munc18c overexpression will be used to assess the effect of excess
Munc18c within cells. Using these approaches, the role of Syntaxin4-Munc18c
interactions in cell migration, invasion and invadopodium formation will be examined.
26
2.0 – Materials and Methods 2.1 – Materials 2.1.1: Reagents Reagents and chemicals were purchased from either Fisher-Scientific Ltd.
(Nepean, ON) or Sigma-Aldrich Co. (St. Louis, MO, USA), unless otherwise indicated.
Primary antibodies were purchased from the following suppliers: Rabbit anti-MMP14,
mouse anti-MMP14, rabbit anti-GFP, rabbit anti-Munc18c (Abcam: ab3644, ab78738,
ab290, ab175238); mouse anti-Munc18c (Santa Cruz Biotechnology: sc-373813); mouse
anti-Syntaxin4, (BD Biosciences: 610439); mouse anti-actin (Pierce: MA5-15739);
mouse anti-β1 integrin (Developmental Hybridoma Studies Bank: P4C10). All
fluorescently labelled secondary antibodies, Hoechst 33342, and AlexaFluor647-
conjugated phalloidin were purchased from Life Technologies (Mississauga, ON). HRP-
conjugated secondary antibodies were purchased from Bio-Rad (Mississauga, ON). Anti-
fade fluorescent mounting medium was obtained from DAKO, Inc. (Burlington, ON).
2.1.2: cDNA constructs
The pEGFP-N1-Syntaxin4-FL construct was described previously (Williams et
al., 2014). The N-terminal sequence of Syntaxin4 was PCR amplified from pEGFP-N1-
Syntaxin4-FL, and the amplicon was cloned into pEGFP-N1 using XhoI and KpnI to
create the plasmid encoding N-terminal Syntaxin4-GFP. Mouse Munc18c with an N-
terminal V5-epitope tag in pDEST40 was a generous gift from William S. Trimble
(Hospital for Sick Children, Toronto). The untagged ORF was PCR amplified and the
amplicon was cloned into pEGFP-C1 using EcoRI and BamHI to create the plasmid
encoding GFP-Munc18c. Human Munc18c cDNA in pCMV-Sp6 was purchased from
27
Dharmacon (MHS6278-202759106). The ORF sequence was PCR amplified, and the
amplicon was cloned into pcDNA3.1(-) using XhoI and BamHI to create the plasmid
encoding untagged human Munc18c. The following oligonucleotides were used as
primers: Forward N-terminal Syntaxin4 (5’ –
TGACGGTAAATGGCCCGCCTGGCATTATG – 3’), Reverse N-terminal Syntaxin4
(5’ - TTTATCATTGGTACCGGGTGCACCACCAGCGCG – 3’), Forward human
Munc18c (5’ – TATTTATACTCGAGCGGGAAGATGGCGCCGC – 3’), Reverse
human Munc18c (5’ –
AATGTATTAGGATCCCATATTAGTAAGAATCTCTAAACCCTC – 3’), Forward
Mouse Munc18c (5’ – GTCTCGAAGCTTCGATGGCGCCGCCGGTATC – 3’), and
Reverse Mouse Munc18c (5’ – CGAACCGCGGATCCTCTAGATCAACCACTTTG –
3’).
Knockdown of Munc18c was performed using a commercially available pool of 3
siRNA duplexes targeting human Munc18c. Munc18c and control siRNA were purchased
from Santa Cruz Biotechnologies (SC-42312 and SC-37007).
2.1.3: Cell Culture
MDA-MB-231 and HEK-293 cells were cultured in DMEM supplemented with
10% BCS. Stable cell lines derived from MDA-MB-231 cells were cultured in selection
media comprising DMEM supplemented with 5% BCS, 1 mg/mL G418 (BioShop) and
Penicillin-Streptomycin (Life Technologies). Growth conditions were kept at 37°C with
humidity and a 5% CO2 atmosphere. Cells were lifted by using 5 mM EDTA/PBS, pH
7.4. For all experiments, cells were used between passage number 5 and 20. All cells
were passaged at most, 24 hours before each experiment.
28
2.1.4: Transfections
Cells were transfected using jetPRIME Polyplus (VWR International) as per the
manufacturer’s protocol. All transiently transfected constructs were expressed for a total
of 24 hours. Cells were transfected with 50 nM siRNA and underwent knockdown for 48
hours. Co-transfections were performed using the manufacturer’s recommended amount
of marker pEGFP-C1 plasmid in addition to 50 nM siRNA for a total of 48 hours.
2.2 – Methods 2.2.1: Creation of Stable Cell Lines
In a 10 cm tissue culture plate, cells were transfected with either pcDNA3.1(-)-
Munc18c, pEGFP-N1-full length Syntaxin4, or pEGFP-N1-Nterminal Syntaxin4. After
24 hours, transfected cells and non-transfected cells were lifted in selection media and
split at a ratio of 1:4 into one 15 cm plate. Once distinct colonies had formed and all cells
in the control non-transfected plate died, 18 separate colonies were lifted using a P200
pipet tip and seeded onto 24-well plates. Once confluent, each colony-derived population
of cells was split into a 6-well dish and western blot analysis was used to confirm
expression. The cell lines that indicated the highest level of expression were propagated.
2.2.2: Cell Migration Assay
Boyden transwell migration assays were performed as previously described
(Williams et al., 2014). Tissue culture inserts with an 8-µm pore diameter (Corning) in
24-well plates were coated with 20 µg/mL fibronectin/PBS on the bottom of the
membrane. Both transfected cells and stable cell lines were serum starved for 2 hours and
subsequently counted using a haemocytometer. In serum-free media, containing 0.1%
BSA and Penicillin-Streptomycin, 20,000 cells were added to the top chamber. Cells
29
were allowed to migrate for 6 hours towards the lower chamber containing the above
medium, supplemented with 10% FBS. The top and bottom of the membrane was fixed in
4% PFA/PBS for 20 minutes, washed with 150 mM glycine/PBS for 10 minutes, stained
with Hoechst, and mounted on coverslips. Ten fields of cells per membrane were
counted, using fluorescence microscopy. For transient transfections, the data is
represented as the number of transfected cells that migrated to the bottom of the
membrane divided by the number of transfected cells that remained on top. For stable
cell lines, the data is presented as the number of cells that migrated to the bottom of the
chamber divided by the number of parental MDA-MB-231 cells that migrated to the
bottom of the chamber.
2.2.3: Invadopodium Formation Assay Invadopodium formation was performed as previously described (Artym et al.,
2009). Glass coverslips were coated with 50 µg/mL PLL/PBS, followed by crosslinking
with 0.5% gluteraldehyde/PBS. Coverslips were then inverted onto 70 µL of AlexaFluor-
594 labelled gelatin. The coated coverslips were then incubated with 5 mg/mL
NaBH3/PBS and subsequently washed 10 times with PBS. Tissue culture plates were
coated similarly; the exception being plates were coated with 0.2% unlabelled
gelatin/PBS.
2.2.4: Immunoprecipitation
Antibody was coupled to 450 µg of Protein-G Dynabeads (Invitrogen) overnight
at 4°C in PBS/0.02%Tween on an end-over-end rotator. Cells were grown to 80%
confluency or seeded onto coated tissue culture plates at 60% confluency. Cells were
lysed in situ with cold lysis buffer comprising 1% NP40, 10% glycerol, 0.5% NaDOC,
30
137 mM NaCl, 20 mM Tris-HCl pH 8.0, 10 mM NaF, 10 mM Na2P4O7, 0.2 mM Na3VO4
and protease inhibitor cocktail. Lysate was incubated with antibody bound beads for 1
hour at 4°C on an end-over-end rotator, washed 3 times with cold PBS, and eluted with
2.5X SDS-PAGE loading buffer containing 700 mM β-mercaptoethanol. The resultant
beads-antibody-antigen complex was subsequently heated to 70°C for 15 minutes.
Proteins were separated using SDS-PAGE, and analyzed using Western immunoblotting.
2.2.5: Immunoblotting
Whole cell protein and immunoprecipitation samples were electrophoresed
through a polyacrylamide gel and transferred onto a PVDF membrane with a 0.45 µm
pore diameter (EMD Millipore). Membranes were blocked in either 5% skim milk
powder or 5% BSA in TBST and probed with primary antibody (diluted 1:1000 in
TBST). HRP-conjugated secondary antibodies (diluted 1:7500 in blocking solution) were
used to detect bound primary antibodies using an enhanced chemiluminesence kit (Bio-
Rad).
2.2.6: Immunofluoresence Microscopy Cells were either grown on glass coverslips overnight or seeded onto 0.2% gelatin
coated coverslips (as described under invadopodium formation). Cells were fixed in 4%
PFA/PBS for 20 minutes then washed in 150 mM glycine/PBS for 10 minutes at room
temperature or overnight at 4°C with gentle agitation. Cells were permeabilized in 0.1%
TX-100/PBS for 10 minutes and then blocked in 5% BSA prior to staining with primary
and secondary antibody. Coverslips were mounted onto glass microscope slides using
DAKO fluorescent mounting medium. Samples analyzed by confocal microscopy were
imaged through a 63X (NA 1.4) oil immersion lens using a Leica DM-IRE2 inverted
31
microscope with a Leica TCS SP2 scanning head (Leica, Heidelberg, Germany). Images
were captured using Leica confocal software. Phase-contrast and epifluorescence images
of HEK-293 cells were acquired using a Nikon Eclipse Ti-S inverted microscope through
a 40X (NA 0.6) lens (Melville, NY, USA). Images were captured using Nikon imaging
software. All images were processed and analyzed using ImageJ software (NIH,
Bethseda, MD, USA).
2.2.7: Statistical Analysis The mean of three independent experiments is shown (unless indicated
otherwise), where error bars represent the standard error of the mean. For all treatments,
the experimental group was compared to the respective control group by Student’s t-test,
where the statistical significance threshold was p=0.05. An asterisk in figures represented
a treatment that was significantly different from the control treatment (p<0.05). Microsoft
Excel was used to perform statistical analyses.
32
3.0 Results 3.1 Syntaxin4 associates with Munc18c in MDA-MB-231 cells Previous studies have shown that Syntaxin4 and Munc18c are strong interacting
partners and the latter plays an important role during Syntaxin4-mediated exocytosis
through this interaction (Latham et al., 2006; Yu et al., 2013). To test if Munc18c and
Syntaxin4 are associating in MDA-MB-231 cells, co-immunoprecipitation experiments
were utilized. Cells were lysed in situ and Munc18c was immunoprecipitated. Eluents
were subjected to SDS-PAGE and Western blot analyses using the same Munc18c
antibody for immunoprecipitation in addition to a Syntaxin4 antibody. The results
revealed successful immunoprecipitation of Munc18c, as indicated by the enrichment of
protein in the immunoprecipitation at the predicted molecular weight of ~67 kDa (Figure
8A). Moreover, there was a significant reduction of Munc18c in the output lane relative
to the input control. Successful co-immunoprecipitation of Syntaxin4 was also observed
in Munc18c immunoprecipitates compared to immunoprecipitation control samples.
To further evaluate the association of Munc18c and Syntaxin4, confocal
immunofluorescence microscopy was utilized to assess intracellular localization. Since
Syntaxin4 is a plasma membrane SNARE (Torres, Funk, Zegers, & Beest, 2011), images
of the ventral plasma membrane were analyzed in comparison to the midcell region of
cells grown on glass coverslips. Image analyses revealed that Munc18c and Syntaxin4
were predominantly localized at the ventral plasma membrane relative to the midcell
region (Figure 8B). At the ventral surface, strong co-localization was seen at the edges of
lamellipodia. Moreover, co-localization across the ventral focal plane was incomplete.
33
Figure 8: Analysis of Syntaxin4 and Munc18c association in MDA-MB-231 cells. Munc18c and Syntaxin4 association was analyzed via immunoprecipitation/SDS-PAGE/Western blot and confocal microscopy. (A) Munc18c immunoprecipitates were probed for Munc18c and Syntaxin4. (B) Cells were grown overnight on glass coverslips fixed, permeabilized, and stained for Rb α Munc18c and M α Syntaxin4. To visualize the ventral and midcell regions of cells, the confocal z-plane was changed and the observed signal was centered in the image. White arrows indicate areas of strong co-localization. Scale bar, 10 µm.
10% in
put
10% output
Beads +
Ab
Beads +
Lysa
te
Beads +
Lysa
te
+ IgG
IP
IP: M α Munc18c
IB: Syntaxin4
IB: M α Munc18c
A
B
Vent
ral
Mid
cell
Munc18c Syntaxin4 Overlay
75 –
35 –
34
3.2 Syntaxin4 and Munc18c association is enhanced during invadopodium formation
Syntaxin4 has been shown to play an important role in the trafficking of MT1-
MMP to sites of invadopodia formation in MDA-MB-231 cells (Williams et al., 2014).
Since Syntaxin4 and Munc18c appeared to be associating in MDA-MB-231 cells,
changes to this association were examined in the context of invadopodium formation.
Cells were seeded onto a non-ECM substrate (PLL) or an ECM substrate (gelatin) for 4
hours to induce invadopodium formation. Cells were lysed in situ and Munc18c was
immunoprecipitated. Eluents were subjected to SDS-PAGE and Western blot analyses. In
all treatments, to normalize the amount of Syntaxin4 associating with
immunoprecipitated Munc18c, a second antibody specific to Munc18c was used for
immunoblotting. An increase of about 20%, relative to unlifted cells, in the amount of
Syntaxin4 co-immunoprecipitated with Munc18c was observed when cells were seeded
onto PLL (Figure 9). An increase of about 50%, relative to unlifted cells, in the amount
of Syntaxin4 co-immunoprecipitated with Munc18c was observed during invadopodium
formation on gelatin.
3.3 Analysis of Munc18c localization relative to invadopodium components The increase in Syntaxin4 co-immunoprecipitated with Munc18c during
invadopodium formation suggested that there was an important role for the association of
Munc18c and Syntaxin4 during this process. To evaluate this role, confocal
immunofluorescence microscopy was utilized to assess the localization of Munc18c
relative to proteins typically associated with invadopodium formation and function. Cells
were seeded onto coverslips coated with a thin AlexaFluor-594-labelled gelatin matrix
and incubated for 4 hours prior to fixation and staining. Use of a thin fluorescently
35
Figure 9: Syntaxin4 and Munc18c association increases during invadopodium formation. Cells were seeded onto PLL and gelatin (IVF; invadopodium formation) coated plates for 4 hours, lysed and analyzed by immunoprecipitation/SDS-PAGE/Western blot. (A) Munc18c immunoprecitates were probed for Munc18c and Syntaxin4. (B) Quantification of the amount Syntaxin4 co-immunopreciptated with Munc18c normalized to unlifted cells. Means are from three independent experiments, +/- S.E.M. Asterisks denote values significantly different from control unlifted cells (p<0.05).
A
B
Lysa
te
Unlifted
PLL IV
F Bea
ds
+ Lys
ate
Beads
+ Ab
IP: M α Munc18c
IB: Rb α Munc18c
IB: Syntaxin4
0
20
40
60
80
100
120
140
160
180
Unli%ed PLL IVF
Boun
dSyntaxin4(%
ofC
ontrol)
**
Fig. 2 A-B
75 –
35 –
36
labelled gelatin matrix allowed detection of invadopodia-forming cells within a
heterogeneous population of cells, in addition to analysis of proteins that localize to focal
points of gelatin degradation. In parallel with Munc18c staining, cells were stained for F-
actin, β1 integrin, MT1-MMP, and Syntaxin4 (Figure 10). Confocal microscopy of the
ventral surface revealed that Munc18c was distributed across the focal plane. Black spots
of gelatin degradation that overlaid with F-actin, MT1-MMP and Syntaxin4 at the centre
had Munc18c localized to the edges of degradation. β1 integrin and Munc18c partly co-
localized to the edges of some black spots of gelatin degradation. Munc18c was also
observed to co-localize with F-actin, MT1-MMP, Syntaxin4, and β1 integrin in areas
other than focal degradation sites. However, co-localization of Munc18c with the above
proteins was not complete across the focal plane.
3.4 Munc18c knockdown impairs invadopodium formation Previous work has shown that knockdown of Syntaxin4 inhibits invadopodium
formation in MDA-MB-231 cells (Williams et al., 2014). Since Munc18c and Syntaxin4
are associating in these cells, we sought to test whether Munc18c knockdown produced a
similar phenotype. Cells were transfected with a pool of siRNA targeting human
Munc18c or a non-specific control siRNA. Optimal knockdown of Munc18c was seen
after 48 hours, as determined by SDS-PAGE and Western blot analyses (data not shown).
Relative to cells transfected with control siRNA, Munc18c levels were found to be
reduced by approximately 50% (Figure 11). Munc18c knockdown had no observed
effects on β1 integrin, Syntaxin4, and MT1-MMP protein levels. Invadopodium
formation was subsequently analyzed to evaluate the effect of reduced Munc18c
expression after 48 hours. Cells co-transfected with pEGFP-C1 and siRNA were
37
Figure 10: Subcellular distribution of Munc18c during the formation of invadopodia Cells were analyzed by confocal microscopy after being plated on AlexaFluor-594-labeled gelatin for 4 hours, fixed, permeabilized, and stained for markers of invadopodia as indicated: F-actin, β1 integrin, MT1-MMP, and Syntaxin4 (cyan; white arrow). Cells were also stained for Munc18c (green; orange arrow). Dark spots in the red field indicate sites of gelatin degradation corresponding to invadopodia. Scale bar, 10 µm.
Marker Munc18c Gelatin Overlay
F-ac
tinβ 1
inte
grin
MT1
-MM
PSy
ntax
in4
Fig. 3
38
Figure 11: RNAi-mediated knockdown of Munc18c Cells were transfected with siRNA targeting Munc18c or non-specific control siRNA. (A-B) Cells were lysed, and lysate was analyzed to assess knockdown of Munc18c via SDS-PAGE/Western blot. (C) Quantification of the amount of Munc18c protein present after knockdown normalized to actin. Means are representative of three independent experiments; +/- S.E.M. Asterisks denote values significantly different from control. (p<0.05).
Control siRNA
Munc18c siRNA
Munc18c siRNA
Control siRNA
IB: β1 integrin
IB: Munc18c
IB: Actin
IB: Syntaxin4
IB: MT1-MMP
IB: Actin
0
20
40
60
80
100
120
ControlsiRNA
Munc18csiRNA
Amou
ntofM
unc18c
(%ofcon
trol)
*
B
A
C
Fig. 3 A-C
75 –
135 –
48 –
35 –
50 –
50 –
37 –
39
incubated for 44 hours, and subsequently seeded onto coverslips coated with AlexaFluor-
594 labelled gelatin. After 4 hours of invadopodium formation, cells were fixed and
stained for F- actin or MT1-MMP (Figure 12). A GFP-positive cell that had F-actin
punctae overlying black spots of degradation was counted as a cell that was forming
invadopodia. Results indicated that knockdown of Munc18c reduced the number of GFP-
positive cells forming invadopodia by approximately 50% relative to control
transfections.
3.5 Expression of N-terminal Syntaxin4-GFP impairs invadopodium formation Previous work has shown that the N-terminal 29 amino acids of Syntaxin4
facilitates binding to Munc18c (Latham et al., 2006). In vitro pull-down experiments
showed that the presence of this small polypeptide reduced the association of Munc18c
and Syntaxin4, suggesting this N-terminal domain can act as a competitive inhibitor of
Munc18c and Syntaxin4 interactions. We therefore examined the effect of a GFP-tagged
N-terminal domain of Syntaxin4 (Figure ) on invadopodium formation. Cells transfected
with either N-terminal Syntaxin4-GFP or GFP alone were subjected to invadopodium
formation assays (Figure 13). Overexpression of N-terminal Syntaxin4-GFP reduced the
amount of cells forming invadopodia by approximately 80% relative to cells transfected
with control GFP.
To assess the biochemical effects of N-terminal Syntaxin4-GFP, co-
immunoprecipitation experiments were utilized to probe for changes in the amount of
Syntaxin4 associated with Munc18c. Cells were lysed in situ and eluents of Munc18c
immunoprecipitates from cells that were either non-transfected, GFP transfected, or N-
terminal Syntaxin4-GFP transfected were analyzed via SDS-PAGE and Western blot
40
Figure 12: RNAi-mediated knockdown of Munc18c impairs invadopodium formation. (A) Invadopodium-based degradation of AlexaFluor-594-gelatin by cells co-transfected with GFP and control siRNA or Munc18c siRNA Cells transfected for 44 hours, seeded onto gelatin for 4 hours and then fixed, permeabilized, stained for MT1-MMP and analyzed by confocal microscopy. (B) Cells with F-actin punctae overlying dark spots of gelatin degradation were counted as cells forming invadopodia. Percentages of cells forming invadopodia, normalized to control (GFP-transfected) cells, are presented as the mean +/- S.E.M. from four independent experiments in which 50 cells per sample were counted. Asterisks denote values significantly different from control (p<0.05). Bar, 10 µm.
Con
trol
si
RN
AM
unc1
8c
siR
NA
GFP MT1-MMP Gelatin Overlay
0
25
50
75
100
125
Control siRNA Munc18c siRNA
Inva
dopo
dium
For
mat
ion
(% o
f con
trol
)
B
A
*
Fig. 3 D-E
41
Figure 13: Segmental architecture of N-terminal Syntaxin4-GFP. The segmental architecture of Syntaxin4 (red) comprises: an N-terminal domain, Habc domain, SNARE motif, and membrane anchor. To create N-terminal Syntaxin4-GFP, the N-terminal domain (red stripes) of Syntaxin4 was fused to the N-terminus of GFP (green).
Habc SNAREmo-f MembraneAnchor
+H3N
COO-
COO-
+H3N
N-terminal
Syntaxin4
N-terminalSyntaxin4-GFP
34kDa
27kDaCOO-+H3N
GFP
GFP
31kDa
42
Figure 13: N-terminal Syntaxin4-GFP impairs invadopodium formation. (A) Invadopodia-based degradation of gelatin by cells transfected with GFP (control) and N-terminal Syntaxin4–GFP. Cells transfected for 20 hours, seeded onto gelatin for 4 hours, and then fixed, permeabilized, stained for F-actin and analyzed by confocal microscopy. (B) Cells with F-actin punctae overlying dark areas of gelatin degradation were counted as cells forming invadopodia. Percentages of cells forming invadopodia are presented as the mean +/- S.E.M. from four independent experiments, in which 50 cells per sample were counted. Asterisks denote values significantly different from control (p<0.05). Bar, 10 µm.
GFP F-actin Gelatin Overlay
Con
trol
STX4
N-te
rm
0
20
40
60
80
100
120
Control STX4 N-term
Inva
dopo
dium
For
mat
ion
(% o
f con
trol
)
*
A
B
Fig. 4
43
(Figure ). The amount of Syntaxin4 co-immunoprecipitated with Munc18c did not change
relative to control samples. No co-immunoprecipitation of GFP alone or N-terminal
Syntaxin4-GFP was detected.
3.6 Munc18c knockdown and expression of N-terminal Syntaxin4-GFP impair cell migration Since invadopodium formation was reduced by Munc18c knockdown or the expression
of N-terminal Syntaxin4-GFP, we examined the effects of these two treatments on cell
migration using transwell migration assays. Compared to control treatments, Munc18c
knockdown or expression of N-terminal Syntaxin4-GFP inhibited cell migration by
approximately 60% and 50%, respectively (Figure 14).
3.7 Creation of stable cell lines expressing either Munc18c, Syntaxin4-FL-GFP or N-terminal Syntaxin4-GFP Previous work has shown that the overexpression of Munc18c can inhibit vesicle
fusion events that require Syntaxin4 (Tamori et al., 1998). However, other work has also
shown that overexpression of Munc18c had no significant effect on Syntaxin4-mediated
exocytosis (Yu et al., 2013). To examine the effects of Munc18c overexpression in
MDA-MB-231 cells, transient transfections were first employed using GFP-tagged and
untagged mouse Munc18c constructs. Fluorescence microscopy and western blot
analyses showed that transient transfections yielded no expression of the aforementioned
Munc18c constructs in MDA-MB-231 cells (data not shown). To confirm that the lack of
expression was not due to a problem with the expression vector, the GFP-Munc18c
construct was transfected into HEK-293 cells. Fluorescence microscopy showed that
HEK-293 cells were expressing GFP-Munc18c (Figure 15).
Next, the creation of a cell line stably expressing untagged human Munc18c was
44
Figure 15: N-terminal Syntaxin4-GFP does not alter co-immunoprecipitation of Syntaxin4 with Munc18c. Cells were either untransfected (UT) or transfected with GFP or N-terminal Syntaxin4-GFP for 24 hours before lysing and analysis by immunoprecipitation/SDS-PAGE/Western blot. Munc18c immunoprecitates were first probed for Munc18c and Syntaxin4. Membranes were stripped and reprobed for GFP; two exposure times are shown to minimize antibody light chain over- saturation in the immunoprecipitation lanes.
IB: Syntaxin4
IB: Rb α Munc18c
Beads +
Ab
Beads +
Lysa
te
UT GFPGFP
UTN-term
N-term
Lysate IP: M α Munc18c
75 –
35 –
25 – IB: GFP
45
Figure 14: Munc18c knockdown or overexpression of N-terminal Syntaxin4 impairs cell migration. Transfected cells were lifted, counted and subjected to transwell migration assays. (A) Cells were transfected with GFP (control) or N-terminal Syntaxin4–GFP for 18 hours. (B) Cells were co-transfected with GFP and control siRNA or Munc18c siRNA for 38 hours. Means are +/- S.E.M from three independent experiments. Asterisks denote values significantly different from control (p<0.05).
0"
20"
40"
60"
80"
100"
120"
Control' STX4'N-term'
Cell'Migra4o
n'(%
'of'con
trol)'
*"
0"
20"
40"
60"
80"
100"
120"
Control'siRNA' Munc18c'siRNA'
Cell'Migra4o
n''(%
'of'con
trol)'
A
B
*
*
Fig. 5
46
Figure 15: Expression of GFP-Munc18c in HEK-293 cells. Cells were transfected and incubated for 20 hours prior to imaging with fluorescence microscopy. (A) Phase-contrast and GFP fluorescence overlay of HEK293 cells on tissue culture plate. (B) Zoom-in of GFP fluorescence. Scale bar, 10 µm.
A
B
47
undertaken to selectively pressure cells into expressing Munc18c. Cell lines
overexpressing full length Syntaxin4-GFP and N-terminal Syntaxin4-GFP were also
created for use in future experiments in addition to confirming previous results from
transient transfections. After selection and propagation of G418-resistant colonies, SDS-
PAGE and Western blot analyses were performed to assess expression of the proteins of
interest (Figure 16). Probing for Munc18c revealed no increase in Munc18c expression
relative to parental MDA-MB-231 cells. Probing for Syntaxin4 revealed protein bands at
the predicted molecular weights of ~63 kDa (full length Syntaxin4-GFP) and ~34 kDa
(endogenous Syntaxin4) in the full-length Syntaxin4-GFP cell line. A GFP antibody was
used to probe for N-terminal Syntaxin4-GFP, yielding a band at the predicted molecular
weight of ~31 kDa in the N-terminal Syntaxin4-GFP cell line. No observed effects on
MT1-MMP expression were seen in any of the cell lines.
48
Figure 16: Expression of Munc18c, GFP-Syntaxin4-full length or GFP-Syntaxin4-N-terminus in stable cell lines. Stable cell lines were generated to express untagged Munc18c, Syntaxin4-FL-GFP and N-terminal Syntaxin4 – GFP. Parental MDA-MB-231 cells were lysed in conjunction with stable cell lines and lysates were analyzed via SDS-PAGE/Western blot.
IB: Syntaxin4
IB: β1 integrin
IB: Munc18c
IB: Syntaxin4
IB: Actin
IB: GFP
135 –
75 –
63 –
50 –
37 –
31–
Paren
tal
Munc18c
STX4 FL
STX4 N-te
rm
Munc18c
STX4 FL
STX4 N-te
rm
WT
IB: Actin
IB: MT1-MMP
50–
50–
37–
49
3.8 Evaluating invadopodium formation and cell migration by stable cell lines The stable cell lines created were subjected to invadopodium formation assays
and transwell migration assays. Cell lines were seeded onto coverslips coated with
AlexaFluor-594-labelled gelatin and incubated for 4 hours prior to fixation and staining
for F-actin (Figure 17). Relative to parental MDA-MB-231 cells, no significant change in
invadopodium formation was seen for Munc18c and full-length Syntaxin4-GFP cell lines
(Figure 18). The N-terminal Syntaxin4-GFP cell line displayed approximately a 60%
decrease in invadopodium formation. Transwell migration assays revealed no significant
change for Munc18c and full-length Syntaxin4-GFP cell lines, but the N-terminal
Syntaxin4 cell line showed approximately a 60% decrease in cell migration.
50
Figure 17: Analysis of invadopodium formation by stable cell lines. Parental MDA-MB-231 cells or stable cell lines expressing untagged Munc18c, Syntaxin4-FL-GFP or N-terminal Syntaxin4–GFP were seeded onto AlexaFluor-594-labeled gelatin and incubated for 4 hours prior to fixation, staining for F-actin and analysis by confocal microscopy. Scale bar, 10 µm.
Mun
c18c
STX4
FL
STX4
Nte
rmPa
rent
al
F-actin Gelatin OverlayGFP
51
Figure 18: Quantification of invadopodium formation and cell migration by stable cell lines. (A) Cells with F-actin punctae overlying dark spots of gelatin degradation were counted as cells forming invadopodia. Percentages of cells forming invadopodia are presented as means +/- S.E.M. from three independent experiments in which 100 cells per sample were counted and normalized to parental MDA-MB-231 cells. (B) Stable cell lines were lifted, counted and subjected to transwell migration assays. Means +/- S.E.M. are presented from three independent experiments. Asterisks denote values significantly different from control (p<0.05).
0"
20"
40"
60"
80"
100"
120"
Munc18c' STX4FL' STX4Nterm'
Invado
podium
'Forma:
on'
(%'of'con
trol)'
0"
20"
40"
60"
80"
100"
120"
Munc18c' STX4FL' STX4Nterm'
Cell'Migra:o
n'(%
'of'con
trol)'
*
*
A
B
52
4.0 Discussion
The field of study pertaining to intracellular trafficking of proteins that are part of
the molecular machinery utilized by cells during tumour cell invasion has implications on
the establishment of cancer therapies. Previous work has shown the importance of
SNARE-mediated trafficking in all aspects of tumour cell invasion including:
invadopodium formation, cell migration, cell adhesion, and MMP-directed ECM
degradation. Although SNAREs have been identified to play an important role in
membrane trafficking events during the above cellular processes, there is no direct
knowledge of the role SNARE regulation has during tumour cell invasion. A recent study
has demonstrated an important role for the Q-SNARE, Syntaxin4, during tumour cell
invasion by MDA-MB-231 cells (Williams et al., 2014). Here, we demonstrate the
cognate SM protein of Syntaxin4, Munc18c, contributes to cellular migration and
invadopodium formation in these cells. These data may provide insight into the
mechanism of SNARE regulation during tumour cell invasion.
SM proteins and their cognate Syntaxins form strong interactions. Furthermore,
both of these proteins have been shown to be important components of the membrane
fusion machinery (Carr & Rizo, 2010). Munc18c and Syntaxin4 have been well
documented to associate in cell lines such as 3T3-L1 adipocytes (Thurmond et al., 2000;
Yu et al., 2013), but their association has not been demonstrated in invasive cancer cell
lines. Thus, the first step in exploring a possible function for Munc18c during tumour cell
invasion was to determine if Syntaxin4 and Munc18c associate in MDA-MB-231 cells in
culture. Co-immunoprecipitation experiments indicated that Munc18c and Syntaxin4
associate. Furthermore, co-localization analysis by confocal microscopy suggested the
53
association observed by co-immunoprecipitation was occurring at the plasma membrane.
These findings are consistent with a role for Munc18c in regulating Syntaxin4-mediated
fusion events at the plasma membrane. Experiments showing the staining pattern of
Munc18c and Syntaxin4, compared to the localization of a plasma membrane marker can
be performed to confirm plasma membrane localization, for example using a construct
that encodes the acylation motif of Lyn kinase tagged with GFP (Teruel, Blanpied, Shen,
Augustine, & Meyer, 1999; Williams & Coppolino, 2014). Additionally, the detection of
Syntaxin4 and Munc18c in the mid-cell region, presumably around the nucleus, suggests
that these two proteins are also found on the endoplasmic reticulum. Future experiments
will have to assess the staining pattern of calnexin, an endoplasmic reticulum-specific
protein, relative to Syntaxin4 and Munc18c to confirm this possibility.
The evident association of Munc18c and Syntaxin4 prompted the evaluation of
changes to this association in the context of invadopodium formation. Cells seeded onto
PLL and gelatin both resulted in a significant increase in the amount of Syntaxin4
associating with Munc18c when compared to unlifted cells. The increase in Munc18c and
Syntaxin4 association was greater in cells seeded onto gelatin (invadopodia formation)
than those seeded onto PLL, a non-ECM substrate. The increased association when cells
were seeded onto PLL suggests that Munc18c and Syntaxin4 may have a putative role
during cell spreading and not during integrin-mediated cell attachment. Integrin-
mediated cell attachment, and the signalling pathways this stimulates are minimal when
cells are seeded onto PLL. Negatively charged cell surface proteins are proposed to
mediate the attachment to positively-charged PLL (Mazia, 1975). Future experiments will
need to evaluate the co-immunoprecipitates of Syntaxin4 with Munc18c from cells in
54
suspension, to confirm if their association is a result of cell-substratum interactions. It is
predicted that there will be less Syntaxin4 associating with Munc18c in suspended cells
relative to unlifted cells, because there will be no cell-substratum interactions to support
cell spreading or integrin-mediated signalling.
A previous study has demonstrated that serine/threonine phosphorylation of
Syntaxin4 in MDA-MB-231 cells was significantly reduced during invadopodium
formation, compared to cells seeded onto PLL (Williams et al., 2014). Another study has
shown that phosphorylation of Syntaxin4 and Munc18c inhibits their interaction (Fu,
Naren, Gao, Ahmmed, & Malik, 2005). Therefore, it is reasonable to speculate that
increased association of Syntaxin4 with Munc18c during invadopodium formation is a
result of changes in Syntaxin4 serine/threonine phosphorylation. Future experiments to
analyze the phosphorylation state of Munc18c-associated Syntaxin4 and Munc18c will
extend our understanding of the association between Munc18c and Syntaxin4 during
invadopodium formation in MDA-MB-231 cells.
The increased association of Munc18c and Syntaxin4 during invadopodium
formation prompted an analysis of the subcellular localization of Munc18c during this
process using confocal microscopy. Syntaxin4, MT1-MMP, and F-actin have been shown
to localize to the center of sites of invadopodium formation when invasive cell lines are
seeded onto an ECM substrate (Oser et al., 2009; Williams et al., 2014). β1 integrin has
been implicated in the initiation of invadopodia (Artym et al., 2015; Destaing et al., 2010;
Williams & Coppolino, 2014), in addition to their maturation, as exemplified by integrin
containing adhesion rings around focal sites of invadopodium degradation (Branch,
Hoshino, & Weaver, 2012). When analyzed under confocal microscopy, Munc18c was
55
distributed throughout the confocal plane representative of the ventral plasma membrane.
The location of the ventral plasma membrane was indicated by the strongest signal given
by invadopodium markers. Co-localization of Munc18c and Syntaxin4 observed in
unlifted cells was not consistent with localization observed during invadopodium
formation. It is plausible the observed co-localization of Munc18c and Syntaxin4 in
unlifted cells may be due to Munc18c priming Syntaxin4 for vesicle fusion events.
During invadopodium formation, the requirement for Syntaxin4-mediated vesicle fusion
is stimulated, resulting in changes to Munc18c localization relative to Syntaxin4.
Additionally, given the observed distribution of Munc18c at the cell periphery, it could
be suggested that Munc18c function is not exclusive to invadopodium formation, and
may therefore be involved in a variety of unidentified Syntaxin4-mediated exocytic
events within these cells. When analyzing invadopodia specifically, Munc18c was found
at some of the edges of sites of degradation showing stronger co-localization with β1
integrin. This suggests that Munc18c may be involved in regulating Syntaxin4-mediated
exocytic events that promote the maturation of invadopodia.
The potential role of Munc18c during invadopodium formation prompted an
analysis of Munc18c inhibition using RNAi-mediated knockdown to reduce Munc18c
expression. Previous studies have shown that the depletion or RNAi-mediated
knockdown of Munc18c perturbed Syntaxin4-mediated exocytic events, such as GLUT4
translocation (Jewell et al., 2011; Oh & Thurmond, 2009). Also, RNAi-mediated
knockdown of its cognate SNARE partner, Syntaxin4, in MDA-MB-231 cells was found
to significantly perturb invadopodium formation and cellular invasion, but not cell
migration (Williams et al., 2014). In the present study, RNAi-mediated knockdown of
56
Munc18c was observed to significantly inhibit both invadopodium formation and cell
migration, suggesting that the presence of Munc18c facilitates these processes. The
inhibition of cell migration is surprising, given the previous study that found no effect on
cell migration (Williams et al., 2014). Cell migration requires the precise localization of
adhesion complexes and polarized recycling of integrins (Bravo-Cordero et al., 2012). A
previous study showed that Munc18c stabilizes Syntaxin4 at the plasma membrane,
preventing disorganized intracellular localization of Syntaxin4 (Torres et al., 2011). This
study also showed that depletion of Syntaxin4 leads to the intracellular localization of
proteins such as β1 integrin. The phenotype observed by Williams et al., 2014 might
therefore be due to the cellular compensation for depleted Syntaxin4 by using an
alternative SNARE-mediated trafficking pathway during cell migration, but not during
invadopodium formation. Torres et al., 2011 also showed that Munc18c depletion did not
alter Syntaxin4 localization to the plasma membrane. Therefore, in the present study, the
available Syntaxin4 at the plasma membrane in MDA-MB-231 cells may require
Munc18c to mediate the membrane fusion of key proteins during invadopodium
formation and cell migration. Future experiments will need to verify the intracellular
localization of Syntaxin4 and β1 integrin during invadopodium formation in Munc18c
depleted cells. It is predicted that there will be no alterations in Syntaxin4 plasma
membrane localization and there will be an increased intracellular accumulation of β1
integrin. Taken together, the observations here support a model wherein Syntaxin4-
mediated exocytic machinery, and trafficking of proteins required for cell migration and
invadopodium formation, is dependent on Munc18c.
57
A second method to inhibit Munc18c utilized the N-terminal 29 amino acids of
Syntaxin4. The N-terminal domain of Syntaxin4 forms facilitates binding between
Munc18c and Syntaxin4 (Hu et al., 2007). A previous study demonstrated that the
presence of this small polypeptide inhibited recombinant Munc18c and Syntaxin4
interactions using pull-down experiments (Latham et al., 2006). Here, we expressed a
GFP-tagged version of this N-terminal domain and observed a significant decrease in
both invadopodium formation and cell migration. These results support a role for
Munc18c and Syntaxin4 interactions during invadopodium formation and cell migration.
Attempts to detect an interaction between Munc18c and N-terminal Syntaxin4-GFP were
unsuccessful. These results may be due to the difference in transfection efficiency
between N-terminal Syntaxin4-GFP and GFP. Since there was little N-terminal
Syntaxin4-GFP detected in the lysate, this could suggest the co-immunoprecipitation
experiments were not sensitive enough to detect N-terminal Syntaxin4-GFP. Moreover,
the immunoprecipitation conditions and/or the bulkiness of the GFP-tag may be
contributing to the lack of N-terminal Syntaxin4-GFP co-immunoprecipitation. Future
experiments should employ a FLAG-tagged N-terminal Syntaxin4 – the size and
molecular weight of a FLAG-tag is much smaller than GFP. It is predicted that a FLAG-
tag will allow for the co-immunoprecipitation of N-terminal Syntaxin4 with Munc18c
and will produce a similar level of impairment with respect to invadopodium formation
and cell migration.
Munc18c overexpression studies were attempted using a transiently transfected
expression construct containing a CMV promoter upstream of the Munc18c ORF. Initial
experiments were performed using the mouse Munc18c homolog N-terminally tagged
58
with GFP. The expression of GFP-Munc18c in MDA-MB-231 cells was not successful as
revealed by fluorescence microscopy. The same result was seen using untagged human
Munc18c. Interestingly, expression of GFP was observed when HEK-293 cells were
transfected with mouse GFP-Munc18c. Future experiments should employ western blot
analyses to determine if the observed GFP fluorescence in HEK-293 cells is from GFP-
Munc18c and not GFP where Munc18c is removed by proteases.
To selectively pressure MDA-MB-231 cells into overexpressing Munc18c, stable
cell lines that were transfected with the untagged Munc18c construct were created.
Despite having propagated cells that were resistant to antibiotic, no Munc18c
overexpression was observed. These observations suggest that Munc18c expression
might be regulated at the post-transcriptional (such as miRNA-mediated inhibition) or
post-translational level (such as proteasomal degradation) and future experiments will
need to be performed to explain these results. Interestingly, several studies have shown
that Syntaxin4 and Munc18c expression are interdependent (Kanda et al., 2005; Torres et
al., 2011). However, in the present study, no alteration in Syntaxin4 expression was seen
in the Munc18c depleted cells. It is plausible that the expression of Munc18c was not
depleted enough to see a significant reduction in Syntaxin4.
Stable cell lines derived from MDA-MB-231 cells were created to overexpress N-
terminal Syntaxin4-GFP and Syntaxin4-FL-GFP in order to confirm previous results seen
with transient transfections. Interestingly, the cell line expressing N-terminal-Syntaxin4-
GFP had impaired invadopodium formation and cell migration relative to control parental
MDA-MB-231 cells and Syntaxin4-FL-GFP expressing cells. Further experiments will
need to be performed to elucidate how Syntaxin4-N-terminal-GFP is influencing cell
59
migration and invadopodium formation. Using these stable cell lines, sucrose gradient
centrifugation could be used as a tool to assess the intracellular localization of proteins
involved in invadopodium formation and cell migration. This technique allows for the
detection of proteins accumulated at the plasma membrane and endosomal compartments.
For example, N-terminal Syntaxin4-GFP could be interfering with endogenous Munc18c
and Syntaxin4 function leading to the accumulation of integrins in an endosomal
compartment. The current model of SM protein function is that SM proteins interact with
their cognate Syntaxin and then reposition to impart specificity in SNARE complex
formation (Baker et al., 2015; Yu et al., 2013). Therefore, if N-terminal Syntaxin4-GFP is
interfering with Munc18c and Syntaxin4 interactions within MDA-MB-231 cells then
there may be less Syntaxin4 interaction with cognate SNARE partners. VAMP7,
SNAP23, and Syntaxin4 are required for the delivery of MT1-MMP to sites of
invadopodium formation. Thus, it is plausible that during invadopodium formation
Syntaxin4 immunoprecipitates from the cell line expressing N-terminal Syntaxin4-GFP
would contain less VAMP7 and SNAP23, relative to parental MDA-MB-231 cells,
resulting from N-terminal Syntaxin4-GFP inhibition of SNARE complex formation.
Studies over the past decade have made it clear that trafficking of MMPs and
adhesion molecules has an essential role in the remodelling of the extracellular matrix
during tumour cell invasion, facilitating tumour cell migration through interstitial tissues.
The picture that has emerged is that formation of invadopodia and subsequent matrix
degradation in invasive tumour cells rely on the coordination of cytoskeletal and specific
membrane trafficking events. Membrane trafficking mediated by SNAREs, exocyst
complexes and other components of the membrane fusion machinery have been observed
60
to function during tumour cell invasion (Poincloux, Lizárraga, & Chavrier, 2009).
Nonetheless, a direct role that regulators of SNARE function have on SNARE-mediated
trafficking during tumour cell invasion has yet to be defined. To our knowledge, this
study is the only direct evidence for a role in SNARE regulation during tumour cell
invasion. Previous studies have identified gelsolin, an actin modifying protein, as an
interaction partner for Syntaxin4 (Kalwat et al., 2012), and gelsolin has been identified
separately to have a role during invadopodium formation (Crowley, Smith, Fang,
Takizawa, & Luna, 2009). Whether or not the interaction between gelsolin and Syntaxin4
influences invadopodium formation and cell migration, however, is not known. Thus, the
current study furthers our knowledge of the SNARE-mediated mechanisms that
coordinate the precise localization of proteins during tumour cell invasion. Our results
indicate that regulation of Syntaxin4-mediated events by Munc18c contributes to the
formation of invadopodia and migration by MDA-MB-231 cells.
61
5.0 Summary The aim of this study was to analyze the function of Munc18c and Syntaxin4
during tumour cell invasion by MDA-MB-231 cells. Using co-immunoprecipitation
experiments and confocal microscopy, an association between Munc18c and Syntaxin4
was observed. This association was enhanced when cells were seeded onto non-ECM
(PLL) or ECM (gelatin) substrates. These results suggest that the association of Munc18c
with Syntaxin4 in these cells is not exclusive to cellular processes regulated by cell-ECM
interactions. ECM degradation assays and confocal microscopy indicated Munc18c could
be involved in a variety of Syntaxin4-mediated events within MDA-MB-231 cells,
including the maturation of invadopodia. Munc18c knockdown was shown to impair
invadopodium formation and cell migration. The expression of N-terminal Syntaxin4-
GFP, designed to impair Munc18c and Syntaxin4 interactions within cells, reduced both
invadopodium formation and cell migration. These results were confirmed in a stable cell
line expressing this protein domain of Syntaxin4. Disruption of the interaction between
Munc18c and Syntaxin4 by N-terminal Syntaxin4-GFP could not be demonstrated using
co-immunoprecipitation experiments, and future experiments will be employed to
determine if N-terminal Syntaxin4 fused with a smaller epitope tag is interacting with
Munc18c. Taken together, these data suggest Munc18c interacts with Syntaxin4 in MDA-
MB-231 cells and this interaction contributes to cell migration and invadopodium
formation. Additional biochemical experiments are needed to fully elucidate the effects
of Munc18c knockdown and N-terminal Syntaxin4 expression. Together, the findings
support a model for Munc18c-mediated tumour cell invasion wherein Munc18c regulates
the formation of Syntaxin4-containing SNARE complexes that contribute to the
62
localization of proteins involved in cell migration, and invadopodium formation (Figure
19). Ultimately, these data contribute to our understanding of possible regulatory
mechanisms that control SNARE function during tumour cell invasion. The information
provided in this thesis could potentially be used to design cancer therapies that inhibit
SNARE regulation by non-SNARE proteins within tumour cells, and by extension
metastasis.
63
Figure 19: Proposed model of Munc18c function during tumour cell invasion Munc18c and Syntaxin4 interactions impart Syntaxin4 stability and specificity in SNARE complex formation. This process is carried out in the following steps: [1] Munc18c (purple) is initially associated with Syntaxin4 (red). Vesicles that contain proteins facilitating cell migration and invadopodium formation are trafficked to specific sites of the plasma membrane. [2] Munc18c repositions to mediate trans-SNARE complex formation with the cognate R-SNARE (blue) and Qbc SNARE (yellow) and subsequent vesicle fusion (not shown) with target membrane. [3] Munc18c dissociates from the cis-SNARE complex. [4] NSF and α-SNAP separate the cis-SNARE complex.
1 32 4
Syntaxin4
R-SNARE
QbcSNARE
NH3+
NH3+
NH3+
+H3N
Munc18c
64
6.0 References Adams, J. C. (2002). Molecular organisation of cell-matrix contacts: essential
multiprotein assemblies in cell and tissue function. Expert Reviews in Molecular Medicine, 4, 1–24.
Andrew, D. J., & Ewald, A. J. (2010). Morphogenesis of epithelial tubes: Insights into tube formation, elongation, and elaboration. Developmental Biology, 341, 34–55.
Artym, V. V. (2002). Molecular proximity of seprase and the urokinase-type plasminogen activator receptor on malignant melanoma cell membranes: dependence on beta1 integrins and the cytoskeleton. Carcinogenesis, 23, 1593–1602.
Artym, V. V., Swatkoski, S., Matsumoto, K., Campbell, C. B., Petrie, R. J., Dimitriadis, E. K., et al. (2015). Dense fibrillar collagen is a potent inducer of invadopodia via a specific signaling network. The Journal of Cell Biology, 208, 331–350.
Artym, V. V., Zhang, Y., Seillier-Moiseiwitsch, F., Yamada, K. M., & Mueller, S. C. (2006). Dynamic Interactions of Cortactin and Membrane Type 1 Matrix Metalloproteinase at Invadopodia: Defining the Stages of Invadopodia Formation and Function. Cancer Research, 66, 3034–3043.
Baker, R. W., Jeffrey, P. D., Zick, M., Phillips, B. P., Wickner, W. T., & Hughson, F. M. (2015). A direct role for the Sec1/Munc18-family protein Vps33 as a template for SNARE assembly. Science, 349, 1111–1114.
Baldassarre, M. (2002). Dynamin Participates in Focal Extracellular Matrix Degradation by Invasive Cells. Molecular Biology of the Cell, 14, 1074–1084.
Band, A. M., Ali, H., Vartiainen, M. K., Welti, S., Lappalainen, P., Olkkonen, V. M., & Kuismanen, E. (2002). Endogenous plasma membrane t-SNARE syntaxin 4 is present in rab11 positive endosomal membranes and associates with cortical actin cytoskeleton. FEBS Letters, 531, 513–519.
Beaty, B. T., & Condeelis, J. (2014). Digging a little deeper: The stages of invadopodium formation and maturation. European Journal of Cell Biology, 93, 438–444.
Berrier, A. L., & Yamada, K. M. (2007). Cell-matrix adhesion. Journal of Cellular Physiology, 213, 565–573.
Blouw, B., Seals, D., Pass, I., Díaz, B., & Courtneidge, S. (2008). A role for the podosome/invadopodia scaffold protein Tks5 in tumor growth in vivo. European Journal of Cell Biology, 87, 555–567.
Borradori, L., & Sonnenberg, A. (1999). Structure and Function of Hemidesmosomes: More Than Simple Adhesion Complexes. Journal of Investigative Dermatology, 112, 411–418.
Bracher, A., & Weissenhorn, W. (2002). Structural basis for the Golgi membrane recruitment of Sly1p by Sed5p. The EMBO Journal, 21, 6114–6124.
Branch, K. M., Hoshino, D., & Weaver, A. M. (2012). Adhesion rings surround invadopodia and promote maturation. Biology Open, 1, 711–722.
Brandie, F. M., Aran, V., Verma, A., McNew, J. A., Bryant, N. J., & Gould, G. W. (2008). Negative Regulation of Syntaxin4/SNAP-23/VAMP2-Mediated Membrane Fusion by Munc18c In Vitro. PLoS ONE, 3, e4074.
Bravo-Cordero, J. J., Hodgson, L., & Condeelis, J. (2012). Directed cell invasion and migration during metastasis. Current Opinion in Cell Biology, 24, 277–283.
Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics, 251–256.
65
Brochetta, C., Vita, F., Tiwari, N., Scandiuzzi, L., Soranzo, M. R., Guérin-Marchand, C., et al. (2008). Involvement of Munc18 isoforms in the regulation of granule exocytosis in neutrophils. Biochimica Et Biophysica Acta (BBA) - Molecular Cell Research, 1783, 1781–1791.
Burgoyne, R. D., Barclay, J. W., Ciufo, L. F., Graham, M. E., Handley, M. T. W., & Morgan, A. (2009). The Functions of Munc18-1 in Regulated Exocytosis. Annals of the New York Academy of Sciences, 1152, 76–86.
Burns, S. (2001). Configuration of human dendritic cell cytoskeleton by Rho GTPases, the WAS protein, and differentiation. Blood, 98, 1142–1149.
Cabaniols, J. P., Ravichandran, V., & Roche, P. A. (1999). Phosphorylation of SNAP-23 by the Novel Kinase SNAK Regulates t-SNARE Complex Assembly. Molecular Biology of the Cell, 10, 4033–4041.
Carr, C. M., & Rizo, J. (2010). At the junction of SNARE and SM protein function. Current Opinion in Cell Biology, 22, 488–495.
Chen, W.-T. (1989). Proteolytic activity of specialized surface protrusions formed at rosette contact sites of transformed cells. Journal of Experimental Zoology, 251, 167–185.
Chung, S. H., Polgár, J., & Reed, G. L. (2000). Protein Kinase C Phosphorylation of Syntaxin 4 in Thrombin-activated Human Platelets. The Journal of Biological Chemistry, 275, 25286–25291.
Clark, E. S., & Weaver, A. M. (2008). A new role for cortactin in invadopodia: regulation of protease secretion. European Journal of Cell Biology, 87, 581–590.
Clark, E. S., Brown, B., Whigham, A. S., Kochaishvili, A., Yarbrough, W. G., & Weaver, A. M. (2008). Aggressiveness of HNSCC tumors depends on expression levels of cortactin, a gene in the 11q13 amplicon. Oncogene, 28, 431–444.
Clark, E. S., Whigham, A. S., Yarbrough, W. G., & Weaver, A. M. (2007). Cortactin Is an Essential Regulator of Matrix Metalloproteinase Secretion and Extracellular Matrix Degradation in Invadopodia. Cancer Research, 67, 4227–4235.
Coppolino, M. G., Kong, C., Mohtashami, M., Schreiber, A. D., Brumell, J. H., Finlay, B. B., et al. (2001). Requirement for N-Ethylmaleimide-sensitive Factor Activity at Different Stages of Bacterial Invasion and Phagocytosis. The Journal of Biological Chemistry, 276, 4772–4780.
Crowley, J. L., Smith, T. C., Fang, Z., Takizawa, N., & Luna, E. J. (2009). Supervillin reorganizes the actin cytoskeleton and increases invadopodial efficiency. Molecular Biology of the Cell, 20, 948–962.
Daley, W. P., Peters, S. B., & Larsen, M. (2008). Extracellular matrix dynamics in development and regenerative medicine. Journal of Cell Science, 121, 255–264.
Dean, R. A., Butler, G. S., Hamma-Kourbali, Y., Delbe, J., Brigstock, D. R., Courty, J., & Overall, C. M. (2007). Identification of Candidate Angiogenic Inhibitors Processed by Matrix Metalloproteinase 2 (MMP-2) in Cell-Based Proteomic Screens: Disruption of Vascular Endothelial Growth Factor (VEGF)/Heparin Affin Regulatory Peptide (Pleiotrophin) and VEGF/Connective Tissue Growth Factor Angiogenic Inhibitory Complexes by MMP-2 Proteolysis. Molecular and Cellular Biology, 27, 8454–8465.
66
Decock, J., Hendrickx, W., Vanleeuw, U., Van Belle, V., Van Huffel, S., Christiaens, M.-R., et al. (2008). Plasma MMP1 and MMP8 expression in breast cancer: Protective role of MMP8 against lymph node metastasis. BMC Cancer, 8, 77.
Destaing, O., Planus, E., Bouvard, D., Oddou, C., Badowski, C., Bossy, V., et al. (2010). β1A integrin is a master regulator of invadosome organization and function. Molecular Biology of the Cell, 21, 4108–4119.
Díaz, B., Yuen, A., Iizuka, S., Higashiyama, S., & Courtneidge, S. A. (2013). Notch increases the shedding of HB-EGF by ADAM12 to potentiate invadopodia formation in hypoxia. The Journal of Cell Biology, 201, 279–292.
Dulubova, I., Khvotchev, M., Liu, S., Huryeva, I., Südhof, T. C., & Rizo, J. (2007). Munc18-1 binds directly to the neuronal SNARE complex. Proceedings of the National Academy of Sciences of the United States of America, 104, 2697–2702.
Egeblad, M., & Werb, Z. (2002). New functions for the matrix metalloproteinases in cancer progression. Nature Reviews Cancer, 2, 161–174.
Foster, L. J., Yeung, B., Mohtashami, M., Ross, K., Trimble, W. S., & Klip, A. (1998). Binary Interactions of the SNARE Proteins Syntaxin-4, SNAP23, and VAMP-2 and Their Regulation by Phosphorylation †. Biochemistry, 37, 11089–11096.
Friedl, P., & Alexander, S. (2011). Cancer Invasion and the Microenvironment: Plasticity and Reciprocity. Cell, 147, 992–1009.
Fu, J., Naren, A. P., Gao, X., Ahmmed, G. U., & Malik, A. B. (2005). Protease-activated receptor-1 activation of endothelial cells induces protein kinase Calpha-dependent phosphorylation of syntaxin 4 and Munc18c: role in signaling p-selectin expression. The Journal of Biological Chemistry, 280, 3178–3184.
Gimona, M., Buccione, R., Courtneidge, S. A., & Linder, S. (2008). Assembly and biological role of podosomes and invadopodia. Current Opinion in Cell Biology, 20, 235–241.
Hanahan, D., & Weinberg, R. A. (2011). Hallmarks of Cancer: The Next Generation. Cell, 144, 646–674.
Hata, Y., Slaughter, C. A., & Südhof, T. C. (1993). Synaptic vesicle fusion complex contains unc-18 homologue bound to syntaxin. Nature, 366, 347–351.
Hojilla, C. V., Wood, G. A., & Khokha, R. (2008). Metalloproteinases as common effectors of inflammation and extracellular matrix breakdown in breast cancer. Breast Cancer Res.
Hong, W. (2005). SNAREs and traffic. Biochimica Et Biophysica Acta, 1744, 120–144. Hoshino, D., Kirkbride, K. C., Costello, K., Clark, E. S., Sinha, S., Grega-Larson, N., et
al. (2013). Exosome Secretion Is Enhanced by Invadopodia and Drives Invasive Behavior. Cell Reports, 5, 1159–1168.
Hotary, K. B., Allen, E. D., Brooks, P. C., Datta, N. S., Long, M. W., & Weiss, S. J. (2003). Membrane Type I Matrix Metalloproteinase Usurps Tumor Growth Control Imposed by the Three-Dimensional Extracellular Matrix. Cell, 114, 33–45.
Hu, S. H., Latham, C. F., Gee, C. L., James, D. E., & Martin, J. L. (2007). Structure of the Munc18c/Syntaxin4 N-peptide complex defines universal features of the N-peptide binding mode of Sec1/Munc18 proteins. Proceedings of the National Academy of Sciences of the United States of America, 104, 8773–8778.
Huttenlocher, A., & Horwitz, A. R. (2011). Integrins in cell migration. Cold Spring Harbor Perspectives in Biology, 3, a005074–a005074.
67
Jackson, B. C., Nebert, D. W., & Vasiliou, V. (2010). Update of human and mouse matrix metalloproteinase families. Human Genomics, 4, 194.
Jahn, R., & Scheller, R. H. (2006). SNAREs — engines for membrane fusion. Nature Reviews. Molecular Cell Biology, 7, 631–643.
Jewell, J. L., Oh, E., Ramalingam, L., Kalwat, M. A., Tagliabracci, V. S., Tackett, L., et al. (2011). Munc18c phosphorylation by the insulin receptor links cell signaling directly to SNARE exocytosis. The Journal of Cell Biology, 193, 185–199.
Jiang, W., Davies, G., Martin, T., Parr, C., Watkins, G., Mason, M., & Mansel, R. (2006). Expression of membrane type-1 matrix metalloproteinase, MT1-MMP in human breast cancer and its impact on invasiveness of breast cancer cells. International Journal of Molecular Medicine. doi:10.3892/ijmm.17.4.583
Kajita, M., Itoh, Y., Chiba, T., Mori, H., Okada, A., Kinoh, H., & Seiki, M. (2001). Membrane-Type 1 Matrix Metalloproteinase Cleaves Cd44 and Promotes Cell Migration. The Journal of Cell Biology, 153, 893–904.
Kalwat, M. A., Wiseman, D. A., Luo, W., Wang, Z., & Thurmond, D. C. (2012). Gelsolin Associates with the N Terminus of Syntaxin 4 to Regulate Insulin Granule Exocytosis. Molecular Endocrinology, 26, 128–141.
Kanda, H., Tamori, Y., Shinoda, H., Yoshikawa, M., Sakaue, M., Udagawa, J., et al. (2005). Adipocytes from Munc18c-null mice show increased sensitivity to insulin-stimulated GLUT4 externalization. Journal of Clinical Investigation, 115, 291–301.
Kean, M. J., Williams, K. C., Skalski, M., Myers, D., Burtnik, A., Foster, D., & Coppolino, M. G. (2009). VAMP3, syntaxin-13 and SNAP23 are involved in secretion of matrix metalloproteinases, degradation of the extracellular matrix and cell invasion. Journal of Cell Science, 122, 4089–4098.
Kloepper, T. H., Kienle, C. N., & Fasshauer, D. (2007). An Elaborate Classification of SNARE Proteins Sheds Light on the Conservation of the Eukaryotic Endomembrane System. Molecular Biology of the Cell, 18, 3463–3471.
Latham, C. F., Lopez, J. A., Hu, S. H., Gee, C. L., Westbury, E., Blair, D. H., et al. (2006). Molecular Dissection of the Munc18c/Syntaxin4 Interaction: Implications for Regulation of Membrane Trafficking. Traffic, 7, 1408–1419.
Leong, H. S., Robertson, A. E., Stoletov, K., Leith, S. J., Chin, C. A., Chien, A. E., et al. (2014). Invadopodia Are Required for Cancer Cell Extravasation and Are a Therapeutic Target for Metastasis. Cell Reports, 8, 1558–1570.
Linder, S. (2007). The matrix corroded: podosomes and invadopodia in extracellular matrix degradation. Trends in Cell Biology, 17, 107–117.
Linder, S., Hufner, K., Wintergerst, U., & Aepfelbacher, M. (2000). Microtubule-dependent formation of podosomal adhesion structures in primary human macrophages. Journal of Cell Science, 113 Pt 23, 4165–4176.
Linder, S., Wiesner, C., & Himmel, M. (2011). Degrading Devices: Invadosomes in Proteolytic Cell Invasion. Annual Review of Cell and Developmental Biology, 27, 185–211.
Llano, E., Pendás, A. M., Freije, J. P., Nakano, A., Knäuper, V., Murphy, G., & López-Otin, C. (1999). Identification and characterization of human MT5-MMP, a new membrane-bound activator of progelatinase a overexpressed in brain tumors. Cancer Research, 59, 2570–2576.
68
Lohmer, L. L., Kelley, L. C., Hagedorn, E. J., & Sherwood, D. R. (2014). Invadopodia and basement membrane invasion in vivo. Cell Adhesion & Migration, 8, 246–255.
Lu, P., Sternlicht, M. D., & Werb, Z. (2006). Comparative Mechanisms of Branching Morphogenesis in Diverse Systems. Journal of Mammary Gland Biology and Neoplasia, 11, 213–228.
Lu, P., Takai, K., Weaver, V. M., & Werb, Z. (2011). Extracellular Matrix Degradation and Remodeling in Development and Disease. Cold Spring Harbor Perspectives in Biology, 3, a005058–a005058.
Mader, C. C., Oser, M., Magalhaes, M. A. O., Bravo-Cordero, J. J., Condeelis, J., Koleske, A. J., & Gil-Henn, H. (2011). An EGFR-Src-Arg-Cortactin Pathway Mediates Functional Maturation of Invadopodia and Breast Cancer Cell Invasion. Cancer Research, 71, 1730–1741.
Mattila, P. K., & Lappalainen, P. (2008). Filopodia: molecular architecture and cellular functions. Nature Reviews. Molecular Cell Biology, 9, 446–454.
Mazia, D. (1975). Adhesion of cells to surfaces coated with polylysine. Applications to electron microscopy. The Journal of Cell Biology, 66, 198–200.
McIntosh, S. (1995). Molecular Identification of Two Novel Munc-18 Isoforms Expressed in Non-neuronal Tissues. Journal of Biological Chemistry, 270, 5857–5863.
Misura, K. M. S., Scheller, R. H., & Weis, W. I. (2000). Three-dimensional structure of the neuronal-Sec1–syntaxin 1a complex. Nature, 404, 355–362.
Miyata, T., Ohnishi, H., Suzuki, J., Yoshikumi, Y., Ohno, H., Mashima, H., et al. (2004). Involvement of syntaxin 4 in the transport of membrane-type 1 matrix metalloproteinase to the plasma membrane in human gastric epithelial cells. Biochemical and Biophysical Research Communications, 323, 118–124.
Moissoglu, K., & Schwartz, M. A. (2012). Integrin signalling in directed cell migration. Biology of the Cell, 98, 547–555.
Monsky, W. L., Lin, C. Y., Aoyama, A., Kelly, T., Akiyama, S. K., Mueller, S. C., & Chen, W. T. (1994). A potential marker protease of invasiveness, seprase, is localized on invadopodia of human malignant melanoma cells. Cancer Research, 54, 5702–5710.
Murphy, D. A., & Courtneidge, S. A. (2011). The 'ins' and “outs” of podosomes and invadopodia: characteristics, formation and function. Nature Reviews. Molecular Cell Biology, 12, 413–426.
Neel, N. F., Rossman, K. L., Martin, T. D., Hayes, T. K., Yeh, J. J., & Der, C. J. (2012). The RalB Small GTPase Mediates Formation of Invadopodia through a GTPase-Activating Protein-Independent Function of the RalBP1/RLIP76 Effector. Molecular and Cellular Biology, 32, 1374–1386.
Oh, E., & Thurmond, D. C. (2009). Munc18c Depletion Selectively Impairs the Sustained Phase of Insulin Release. Diabetes, 58, 1165–1174.
Oh, E., Spurlin, B. A., Pessin, J. E., & Thurmond, D. C. (2005). Munc18c Heterozygous Knockout Mice Display Increased Susceptibility for Severe Glucose Intolerance. Diabetes, 54, 638–647.
Oser, M., Yamaguchi, H., Mader, C. C., Bravo-Cordero, J. J., Arias, M., Chen, X., et al. (2009). Cortactin regulates cofilin and N-WASp activities to control the stages of invadopodium assembly and maturation. The Journal of Cell Biology, 186, 571–587.
69
Oskarsson, T. (2013). Extracellular matrix components in breast cancer progression and metastasis. Breast (Edinburgh, Scotland), 22 Suppl 2, S66–72.
Pan, P.-Y., Tian, J.-H., & Sheng, Z.-H. (2009). Snapin Facilitates the Synchronization of Synaptic Vesicle Fusion. Neuron, 61, 412–424.
Pevsner, J., Hsu, S. C., & Scheller, R. H. (1994). n-Sec1: a neural-specific syntaxin-binding protein. Proceedings of the National Academy of Sciences of the United States of America, 91, 1445–1449.
Poincloux, R., Lizárraga, F., & Chavrier, P. (2009). Matrix invasion by tumour cells: a focus on MT1-MMP trafficking to invadopodia. Journal of Cell Science, 122, 3015–3024.
Polgár, J., Lane, W. S., Chung, S. H., Houng, A. K., & Reed, G. L. (2003). Phosphorylation of SNAP-23 in Activated Human Platelets. The Journal of Biological Chemistry, 278, 44369–44376.
Pombo, I., Martin-Verdeaux, S., Iannascoli, B., Le Mao, J., Deriano, L., Rivera, J., & Blank, U. (2001). IgE receptor type I-dependent regulation of a Rab3D-associated kinase: a possible link in the calcium-dependent assembly of SNARE complexes. The Journal of Biological Chemistry, 276, 42893–42900.
Puri, N., & Roche, P. A. (2006). Ternary SNARE Complexes Are Enriched in Lipid Rafts during Mast Cell Exocytosis. Traffic, 7, 1482–1494.
Revach, O. Y., & Geiger, B. (2014). The interplay between the proteolytic, invasive, and adhesive domains of invadopodia and their roles in cancer invasion. Cell Adhesion & Migration. doi:10.1073/pnas.94.15.7959
Ridley, A. J., Schwartz, M. A., Burridge, K., Firtel, R. A., Ginsberg, M. H., Borisy, G., et al. (2003). Cell migration: integrating signals from front to back. Science, 302, 1704–1709.
Risinger, C., & Bennett, M. K. (2002). Differential Phosphorylation of Syntaxin and Synaptosome-Associated Protein of 25 kDa (SNAP-25) Isoforms. Journal of Neurochemistry, 72, 614–624.
Sabeh, F. (2004). Tumor cell traffic through the extracellular matrix is controlled by the membrane-anchored collagenase MT1-MMP. The Journal of Cell Biology, 167, 769–781.
Sabeh, F., Shimizu-Hirota, R., & Weiss, S. J. (2009). Protease-dependent versus -independent cancer cell invasion programs: three-dimensional amoeboid movement revisited. The Journal of Cell Biology, 185, 11–19.
Sato, H., Takino, T., Okada, Y., Cao, J., Shinagawa, A., Yamamoto, E., & Seiki, M. (1994). A matrix metalloproteinase expressed on the surface of invasive tumour cells. Nature, 370, 61–65.
Schollmeier, Y., Krause, J. M., Kreye, S., Malsam, J., & Söllner, T. H. (2011). Resolving the Function of Distinct Munc18-1/SNARE Protein Interaction Modes in a Reconstituted Membrane Fusion Assay. The Journal of Biological Chemistry, 286, 30582–30590.
Schraw, T. D., Crawford, G. L., Ren, Q., Choi, W., Thurmond, D. C., Pessin, J., & Whiteheart, S. W. (2004). Platelets from Munc18c heterozygous mice exhibit normal stimulus-induced release. Thrombosis and Haemostasis, 92, 829–837.
70
Seftor, R. E., Seftor, E. A., Koshikawa, N., Meltzer, P. S., Gardner, L. M., Bilban, M., et al. (2001). Cooperative interactions of laminin 5 gamma2 chain, matrix metalloproteinase-2, and membrane type-1-matrix/metalloproteinase are required for mimicry of embryonic vasculogenesis by aggressive melanoma. Cancer Research, 61, 6322–6327.
Skalski, M., & Coppolino, M. G. (2005). SNARE-mediated trafficking of α5β1 integrin is required for spreading in CHO cells. Biochemical and Biophysical Research Communications, 335, 1199–1210.
Sodek, K. L., Ringuette, M. J., & Brown, T. J. (2007). MT1-MMP is the critical determinant of matrix degradation and invasion by ovarian cancer cells. British Journal of Cancer, 97, 358–367.
Sohail, A., Sun, Q., Zhao, H., Bernardo, M. M., Cho, J.-A., & Fridman, R. (2008). MT4-(MMP17) and MT6-MMP (MMP25), A unique set of membrane-anchored matrix metalloproteinases: properties and expression in cancer. Cancer Metastasis Reviews, 27, 289–302.
Söllner, T., Bennett, M. K., Whiteheart, S. W., Scheller, R. H., & Rothman, J. E. (1993a). A protein assembly-disassembly pathway in vitro that may correspond to sequential steps of synaptic vesicle docking, activation, and fusion. Cell, 75, 409–418.
Söllner, T., Whiteheart, S. W., Brunner, M., Erdjument-Bromage, H., Geromanos, S., Tempst, P., & Rothman, J. E. (1993b). SNAP receptors implicated in vesicle targeting and fusion. Nature, 362, 318–324.
Steffen, A., Le Dez, G., Poincloux, R., Recchi, C., Nassoy, P., Rottner, K., et al. (2008). MT1-MMP-Dependent Invasion Is Regulated by TI-VAMP/VAMP7. Current Biology, 18, 926–931.
Südhof, T. C., & Rothman, J. E. (2009). Membrane Fusion: Grappling with SNARE and SM Proteins. Science, 323, 474–477.
Takino, T., Sato, H., Shinagawa, A., & Seiki, M. (1995). Identification of the Second Membrane-type Matrix Metalloproteinase (MT-MMP-2) Gene from a Human Placenta cDNA Library: MT-MMPs FORM A UNIQUE MEMBRANE-TYPE SUBCLASS IN THE MMP FAMILY. The Journal of Biological Chemistry, 270, 23013–23020.
Talmadge, J. E., & Fidler, I. J. (2010). AACR centennial series: the biology of cancer metastasis: historical perspective. Cancer Research, 70, 5649–5669.
Tamori, Y., Kawanishi, M., Niki, T., Shinoda, H., Araki, S., Okazawa, H., & Kasuga, M. (1998). Inhibition of Insulin-induced GLUT4 Translocation by Munc18c through Interaction with Syntaxin4 in 3T3-L1 Adipocytes. The Journal of Biological Chemistry, 273, 19740–19746.
Tayeb, M. A., Skalski, M., Cha, M. C., Kean, M. J., Scaife, M., & Coppolino, M. G. (2005). Inhibition of SNARE-mediated membrane traffic impairs cell migration. Experimental Cell Research, 305, 63–73.
Tehrani, S., Tomasevic, N., Weed, S., Sakowicz, R., & Cooper, J. A. (2007). Src phosphorylation of cortactin enhances actin assembly. Proceedings of the National Academy of Sciences of the United States of America, 104, 11933–11938.
Tellam, J. T., Macaulay, S. L., McIntosh, S., & Hewish, D. R. (1997). Characterization of Munc-18c and Syntaxin-4 in 3T3-L1 Adipocytes. Journal of Biological …. doi:10.1074/jbc.272.10.6179
71
Teng, F., Wang, Y., & Tang, B. L. (2001). The syntaxins. Genome Biology, 2, reviews3012.1.
Teruel, M. N., Blanpied, T. A., Shen, K., Augustine, G. J., & Meyer, T. (1999). A versatile microporation technique for the transfection of cultured CNS neurons. Journal of Neuroscience Methods, 93, 37–48.
Thurmond, D. C., Kanzaki, M., Khan, A. H., & Pessin, J. E. (2000). Munc18c Function Is Required for Insulin-Stimulated Plasma Membrane Fusion of GLUT4 and Insulin-Responsive Amino Peptidase Storage Vesicles. Molecular and Cellular Biology, 20, 379–388.
Tolde, O., Rösel, D., Veselý, P., Folk, P., & Brábek, J. (2010). The structure of invadopodia in a complex 3D environment. European Journal of Cell Biology, 89, 674–680.
Tomes, C. N. (2015). The proteins of exocytosis: lessons from the sperm model. Biochemical Journal, 465, 359–370.
Toonen, R. F. G., & Verhage, M. (2007). Munc18-1 in secretion: lonely Munc joins SNARE team and takes control. Trends in Neurosciences, 30, 564–572.
Torres, J., Funk, H. M., Zegers, M. M. P., & Beest, ter, M. B. A. (2011). The syntaxin 4 N terminus regulates its basolateral targeting by munc18c-dependent and -independent mechanisms. The Journal of Biological Chemistry, 286, 10834–10846.
Ungar, D., & Hughson, F. M. (2003). SNARE protein structure and function. Annual Review of Cell and Developmental Biology, 19, 493–517.
Vicente-Manzanares, M. (2005). Cell migration at a glance. Journal of Cell Science, 118, 4917–4919.
Widberg, C. H. (2003). Tomosyn Interacts with the t-SNAREs Syntaxin4 and SNAP23 and Plays a Role in Insulin-stimulated GLUT4 Translocation. The Journal of Biological Chemistry, 278, 35093–35101.
Williams, K. C., & Coppolino, M. G. (2014). SNARE-dependent interaction of Src, EGFR and 1 integrin regulates invadopodia formation and tumor cell invasion. Journal of Cell Science, 127, 1712–1725.
Williams, K. C., McNeilly, R. E., & Coppolino, M. G. (2014). SNAP23, Syntaxin4, and vesicle-associated membrane protein 7 (VAMP7) mediate trafficking of membrane type 1-matrix metalloproteinase (MT1-MMP) during invadopodium formation and tumor cell invasion. Molecular Biology of the Cell, 25, 2061–2070.
Wolf, K., Wu, Y. I., Liu, Y., Geiger, J., Tam, E., Overall, C., et al. (2007). Multi-step pericellular proteolysis controls the transition from individual to collective cancer cell invasion. Nature Cell Biology, 9, 893–904.
Yamaguchi, H. (2012). Pathological roles of invadopodia in cancer invasion and metastasis. European Journal of Cell Biology, 91, 902–907.
Yamaguchi, H., Lorenz, M., Kempiak, S., Sarmiento, C., Coniglio, S., Symons, M., et al. (2005). Molecular mechanisms of invadopodium formation: the role of the N-WASP-Arp2/3 complex pathway and cofilin. The Journal of Cell Biology, 168, 441–452.
Yelamanchili, S. V., Reisinger, C., Becher, A., Sikorra, S., Bigalke, H., Binz, T., & Ahnert-Hilger, G. (2005). The C-terminal transmembrane region of synaptobrevin binds synaptophysin from adult synaptic vesicles. European Journal of Cell Biology, 84, 467–475.
72
Yu, H., Rathore, S. S., Lopez, J. A., Davis, E. M., James, D. E., Martin, J. L., & Shen, J. (2013). Comparative studies of Munc18c and Munc18-1 reveal conserved and divergent mechanisms of Sec1/Munc18 proteins. Proceedings of the National Academy of Sciences of the United States of America, 110, E3271–80.
Zamir, E., Katz, M., Posen, Y., Erez, N., Yamada, K. M., Katz, B. Z., et al. (2000). Dynamics and segregation of cell-matrix adhesions in cultured fibroblasts. Nature Cell Biology, 2, 191–196.
Zucker, S., Hymowitz, M., Conner, C., Zarrabi, H. M., Hurewitz, A. N., Matrisian, L., et al. (1999). Measurement of matrix metalloproteinases and tissue inhibitors of metalloproteinases in blood and tissues. Clinical and experimental applications. Annals of the New York Academy of Sciences, 878, 212–227.