Analysis of the SINE S1 Pol III promoter from Brassica; impact of methylation and influence of external sequences

Analysis of the SINE S1 Pol III promoter from Brassica;impact of methylation and in¯uence of external sequences

Philippe Arnaud1², Yasushi Yukawa2², Laurence Lavie1, Thierry PeÂ lissier1, Masahiro Sugiura2 and Jean-Marc Deragon1,*

1CNRS UMR6547 and GDR2157, Biomove, UniversiteÂ Blaise Pascal Clermont-Ferrand II, 63177 AubieÁre Cedex,

France, and2Center for Gene Research, Nagoya University, Nagoya 464±8602, Japan

Received 17 November 2000; revised 16 February 2001; accepted 23 February 2001.*For correspondence (fax +33 473407777; e-mail [email protected]).²The authors wish it to be known that, in their opinion, the ®rst two authors should be regarded as joint First Authors

Summary

Transcription is an important control point in the transposable element mobilization process. To better

understand the regulation of the plant SINE (Short Interspersed Elements) S1, its promoter sequence

was studied using an in vitro pol III transcription system derived from tobacco cells. We show that the

internal S1 promoter can be functional although upstream external sequences were found to enhance

this basal level of transcription. For one putative `master' locus (na7), three CAA triplets (in positions

±12, ±7 and ±2) and two overlapping TATA motifs (in positions ±54 to ±43) were important to stimulate

transcription. For this locus, two transcription initiation regions were characterized, one centered on

position + 1 (®rst nucleotide of the S1 element) and one centered on position ± 19 independently of the

internal motifs. The CAA triplets only in¯uence transcription in + 1 and work in association with the

internal motifs. We show that methylation can inhibit transcription at the na7 locus. We also observe

that S1 RNA is cleaved in a smaller Poly (A) minus product by a process analogous to the maturation of

mammalian SINEs.

Keywords: RNA polymerase III, RNA processing, retroposable element, Alu, DNA methylation.

Introduction

RNA polymerase III (RNA pol III) is responsible for the

synthesis of most small cytoplasmic RNAs, some small

nuclear RNAs, SINE retroposon RNAs and several viral

RNAs (reviewed in Paule and White, 2000; Schmid, 1998;

Willis, 1993). The genes transcribed by RNA pol III can be

separated into four types. Type-1 is restricted to 5S

ribosomal RNA genes and is characterized by a tripartite

intragenic promoter consisting of an A and C block

separated by an intermediate I element. Type-2 genes are

characterized by a bipartite intragenic promoter consisting

of an A and B block usually separated by 30±60 bp. Most

genes encoding tRNA, the adenovirus VA genes and SINE

retroposons are members of this group. Type-3 genes rely

solely on promoter elements upstream of the initiation

site. This group includes small RNA-like U6 and 7SK in all

higher eukaryotes, as well as U3 and 7SL in plants (Heard

et al., 1995). Finally, type-4 gene transcription is dependent

on intragenic and external elements. This group include

the Xenopus selenocysteine tRNA gene, the EBER genes of

Epstein-Barr virus, the human 7SL gene and the vault RNA

gene (Vilalta et al., 1994).

The type-2 genes require, in addition to RNA pol III, two

fractions named TFIIIB and TFIIIC to initiate transcription.

For mammalians, TFIIIC can be separated into two

components called TFIIIC1 and TFIIIC2. TFIIIC2 binds to

the B block and then serves to recruit TFIIIC1 that makes

contact with the A block region. The TFIIIC factors can then

recruit the TBP (TATA-binding protein) containing TFIIIB

fraction through protein±protein interactions. The TFIIIB-

TFIIIC-DNA complex serves to recruit RNA pol III. The

5¢-¯anking region can also participate in the initiation

process in cooperation with the internal element. A

pyrimidine-purine dinucleotide at or near the initiation

site and a TATA element in position ± 32 to ± 24 are

important for optimal type-2 gene expression (Choisne

et al., 1997; Ulmanov and Folk, 1995; Zecherle et al., 1996).

The presence of the TATA motif enables the TBP portion of

TFIIIB to interact directly with DNA so that TFIIIC is not

The Plant Journal (2001) 26(3), 295±305

ã 2001 Blackwell Science Ltd 295

solely responsible for its recruitment. Type-3 and type-4

genes also possess TATA motifs in their 5¢-¯anking region.

For type-4 genes, the TATA motif compensates for less

than optimal intragenic elements. For example, in the case

of the type-4 vault gene, TFIIIC can not interact with the

internal promoter unless it is recruited by a direct inter-

action with TFIIIB bound to the external TATA motifs

(Vilalta et al., 1994). The TATA motif in type-3 genes works

in association with other upstream sequences to recruit

the RNA pol III, independently of intragenic motif.

Mammalians type-3 promoters utilize TFIIIC1 but not

TFIIIC2 (Oettel et al., 1997) and the TFIIIB fraction employed

by these promoters is distinct from the one used by the

other types of genes (Teichmann et al., 1997). Also, the

TFIIIB that assembles on a TATA containing promoter is

different from the ones that is implicated in the initiation of

TATA-less promoter (Park et al., 1997). The organization of

the factors that nucleate the RNA pol III can therefore vary

among type-2, type-3 and type-4 genes.

SINEs are an abundant class of transposable elements

found in a wide variety of eukaryotes (Deininger, 1989;

Okada and Ohshima, 1995). The presence of an internal pol

III promoter in mammalian SINEs was initially suggested

as being directly responsible for their high copy number

since new elements would keep their capacity to be

transcribed and to engage in new retroposition cycles

(Roger, 1985). However, evolutionary and molecular

studies have shown that only a few `master' loci are active

in retroposition and that, in most cases, the SINE type-2

internal promoter is silent (Deininger and Batzer, 1995).

Several mechanisms appear to be involved in this silenc-

ing, including DNA methylation, the formation of a

repressive chromatin structure and the binding of positive

and negative trans-acting factors (Schmid, 1998). SINE loci

that escape this negative regulation are usually associated

with external enhancers (Chesnokov and Schmid, 1996;

Deininger et al., 1996). A productive combination between

internal signals (provided by the SINE element) and

external signals (provided by the integration site) can

therefore result in ef®cient transcription for a limited

number of SINE loci. These transcriptionally active loci

are candidates for `master sequences' responsible for the

ampli®cation of SINE subfamilies (Deininger et al., 1996).

SINE retroposition is also controlled at the post-tran-

scriptional level. SINE transcriptional termination usually

occurs at the ®rst run of Ts (at least four) ¯anking the

insertion site. On average the primary SINE transcript

contains 200 nucleotides of unique sequence from the

insertion site. The nature of this 3¢ sequence will in¯uence

the lifetime and processing of SINE RNA (Maraia et al.,

1992). Mammalian SINE RNAs (Alu, B1, ID) are post-

transcriptionally processed in smaller, Poly (A) minus,

products called sc (small cytoplasmic) SINE RNAs

(Deininger et al., 1996; Maraia et al., 1993; Maraia, 1991).

In vivo, an uncharacterized 3¢-end processing activity

removes the terminal Poly (A) region and, for Alu, also

cleaves the A-rich regions between the two monomers.

Since the terminal Poly (A) region is likely to be important

for reverse transcription and integration (Boeke, 1997;

Deininger et al., 1996), this processing should limit SINE

retroposition. For Alu and B1, this 3¢-end processing was

proposed to be regulated in vitro by the RNA terminus-

binding protein La (Goodier and Maraia, 1998). In addition

to this post-transcriptional processing, the appropriate

folding of SINE RNA in conserved secondary structure

domains derived from ancestral functional RNAs (7SL or

tRNA) is probably also important for ef®cient retroposition

(Sinnett et al., 1992).

The S1 element is a small (180 bp) plant SINE that was

®rst described and studied in Brassica napus and is widely

distributed among Cruciferae (Deragon et al., 1994; Gilbert

et al., 1997; Lenoir et al., 1997; Tatout et al., 1999). S1

present all structural characteristic features found in

SINEs, including a primary and secondary sequence

homology to tRNA, a 3¢ Poly (A) region and internal

conserved pol III motifs (an A and B block) (Deragon et al.,

1994). Surprisingly, S1 seems to share many characteris-

tics with mammalian SINEs, like a similar subfamily

distribution (Deragon et al., 1994), a similar target site

selection (Tatout et al., 1998), a preferential colocalization

with MAR elements (Tikonov et al. 2001), and the capacity

to act as nucleation center for de novo methylation

(Arnaud et al., 2000). Also, S1 elements are highly

methylated in vivo and their transcription is severely

repressed in B. napus (Deragon et al., 1996; Goubely

et al., 1999). The objective of this work was to test the

functionality of the internal S1 promoter and the putative

impact of external sequences. We were also interested to

determine if methylation could repress S1 transcription.

Results

Two different S1 loci were selected for the in vitro study.

The ®rst locus, na7, contains an S1 element that is identical

to the consensus sequence of the young Èa' subfamily

(Deragon et al., 1996; Lenoir et al., 1997). This element was

shown by a sequence-speci®c primer-extension to be

transcribed in vivo (P. Arnaud, C. Goubely and

J.M. Deragon, unpublished). The na7 sequence is also

identical to the sequence of the major S1 transcript

described in a previous study (Ea1 in Deragon et al.,

1996). It is therefore likely that the S1 element at the na7

locus is a major contributor of S1 RNA in vivo. The second

locus, na2, contains an S1 element that is identical to the

consensus sequence of the youngest (and Brassica napus-

speci®c) À' subfamily (Deragon et al., 1996; Lenoir et al.,

1997). However, a transcript from the À' subfamily was

296 Philippe Arnaud et al.

ã Blackwell Science Ltd, The Plant Journal, (2001), 26, 295±305

not detected in a previous study and it is not known

whether this element is transcribed in vivo.

S1 transcription is highly in¯uenced by upstream

external sequences.

Several lines of evidence indicate that there may be

differences in the initiation of pol III transcription between

animals compared with plants and fungi (Choisne et al.,

1997; Connelly et al., 1994). Although most in vitro studies

on plant pol III promoters have been carried out in extracts

from animal or S. cerevisiae nuclei, we decided to use a

plant in vitro pol III transcription system recently

developed from BY-2 tobacco cultured cells (Fan and

Sugiura, 1996). For na7, three constructions were tested

(see Figure 1a). Na7±1 contains the S1 element without its

Poly (A) tail, na7±2 the S1 element with the Poly (A) and

Figure 1. In vitro transcription products of two S1 loci revealed by primer-extension analysis.(a) Description of the six constructs used in the transcription experiments.(b) In vitro transcription of the na7 and na2 constructs. All transcriptions were made in the presence of a low concentration (0.5 mg ml-1) of a-amanitin. AnRNA molecular weight ladder (L) is presented. The positions of the initiation sites, deduced from the molecular weight of the primer-extension products,are indicated on the left. Position + 1 represents the ®rst nucleotide of the S1 element. For na7±1, na7±2, na2±1 and na2±2 several artefactual bandscorresponding to initiation in the vector sequence can be observed.(c) Comparison of the internal promoter region of na7 with na2 S1 elements. The spacing between the A and B block is indicated (in base pair).

Plant SINE transcriptional regulation 297


17 bp of 3¢ ¯anking genomic sequences (up to a TTTT

terminator) and na7±3 is composed of na7±2 plus 160 bp of

5¢ ¯anking genomic sequences. These three constructs

were tested in the in vitro assay and transcription products

were analyzed by speci®c primer-extensions (see

Experimental procedures section). Using, the na7±1 and

na7±2 constructs, no speci®c transcription product was

detected (Figure 1b). However, using the na7±3 construct,

we have detected transcriptional products resistant to low

concentration of a-amanitin (0.5 mg ml-1) which inhibit pol

II activity completely in vitro (Yukawa et al., 1997). The

precise sizing of these primer-extension products revealed

two transcriptional initiation regions: one centered in ± 19

and another centered in + 1 (+ 1 being the ®rst nucleotide

of the S1 element). The ± 19 region (referred to as the

upstream region) is composed of products initiated in ± 23,

± 19, ± 17 and ± 14, while the + 1 region is composed of

products initiated in ± 1, + 1, + 2 and + 3 (see Figure 2c).

We did a similar analysis with the na2 locus. Again, three

constructs were tested (na2±1, na2±2 and na2±3) that differ

in the presence or absence of ¯anking sequences (see

Figure 1a). For na2±1 and na2±2, a transcriptional product

resistant to a low concentration of a-amanitin and corres-

ponding to an initiation in position + 1 was detected

(Figure 1b). The higher molecular weight bands also

observed for na2±1 and na2±2 correspond to initiations

in the vector sequence. For na2±3, in the presence of

107 bp of 5¢ ¯anking sequences, the + 1 signal was

enhanced and a second signal, corresponding to an

initiation in ± 3 was detected (Figure 1b). These results

show that genomic region upstream of S1 elements can

in¯uence transcription by RNA pol III. For na7, the

upstream region seems to be required for transcription

while for na2 just the internal promoter allows transcrip-

tion in vitro with the 5¢-external sequence acting as an

enhancer. To understand this difference we have com-

pared the promoter region of na7 and na2 (Figure 1c).

While the A and B blocks are identical, the spacing

between them is not. The two motifs are separated by

26 bp for na7 and 32 bp for na2, the optimal spacing of the

A and B motifs in tRNA being between 30 and 60pb

(Sprague, 1995).

Analysis of the na7 5¢ genomic region

The genomic region upstream of S1 at the na7 locus

presents two putative cis-acting elements that could be

responsible for its transcriptional activating properties

(Figure 2a). First, three CAA trinucleotides are present in

positions ± 12, ± 7 and ± 2. A CAA triplet at or immediately

preceding the transcription start site (usually in positions

± 7 to ± 3), was found to be important for the transcription

ef®ciency of plant tRNA genes (Choisne et al., 1997).

Deletion of this triplet led to a signi®cant decrease in

transcription ef®ciency for the tRNALeu gene from

Phaseolus vulgaris (Choisne et al., 1997). Second, two

overlapping TATA motifs are present in positions ± 54 to

± 43 (Figure 2a). TATA elements are generally known to act

as enhancers for the pol II system but have also been

implicated as enhancers of pol III transcription (Willis,

1993). The importance of these two cis-acting elements

was tested by mutagenesis. The direct radioactive labeling

of RNAs during the in vitro transcription using normal or

mutagenized templates is presented in Figure 2(b). The

two largest RNAs (RNA1 approximately 230 bases and

RNA2 approximately 210 bases) correspond to an initiation

of transcription in the ± 19 or + 1 region and a termination

of transcription at the TTTT site of the construct. These

products were expected from the primer-extension results

(Figure 1b). The two other products (RNA3 and RNA4) are

smaller (approximately 175 and approximately 160 bases,

respectively) and result from the maturation of RNA2 (as

described later). The primer-extension products obtained

from the in vitro transcription of the different constructs

are presented in Figure 2(c).

Mutagenesis of the three CAA triplets (na7±5) resulted in

a reduction in transcription ef®ciency for the + 1 region

(evaluated by combining the intensity of RNA2, 3 and 4)

without affecting initiation in the upstream region (RNA1,

Figure 2b). Leaving one of the three CAA triplets overlap-

ping the initiation site (na7±6) resulted in a small reduction

in initiation ef®ciency in the + 1 region (RNA2, 3 4)

compared with wild type situation (na7±3, Figure 2b).

Mutation of the two TATA motifs (na7±4) completely

abolished initiation in the upstream region (except for

the ± 14 site, described later) (Figure 2b,c). This mutation

also enhanced transcription in the + 1 region (Figure 2b). A

construction where the CAA triplets and the TATA motifs

were mutated (na7±7) did not allow transcription initiation

in the upstream region (except for the ± 14 position) and

resulted in a reduction of the initiation ef®ciency in the + 1

region (Figure 2b,c). Finally, a mutation in the internal A

block (na7±8, Figure 2b,c) did not affect initiation in the

upstream region but completely abolished initiation in

Figure 2. Functional analysis of the 5¢ ¯anking region from the na7 locus.(a) Description of the constructs used in the transcription experiments. The position of the TATA and CAA motifs is indicated. Spacing (in base pair)between the TATA motifs and the upstream initiation site is also indicated.(b) Labeled in vitro transcription products after 120 min of transcription. RNA3 and RNA4 are processed products from RNA2 (see also Figure 3).(c) Primer-extension products obtained from the in vitro transcription of the different constructs. A different migration time, that includes na7±9, is shownin the box.





the + 1 region. These results suggest that the CAA motifs

work in association with the internal A and B blocks to

stimulate transcription in the + 1 region while the TATA

motifs work independently of the internal blocks to stimu-

late transcription in the upstream region.

In our case, the TATA motifs are not in consensus

positions (± 34 to ± 29) to stimulate initiation in the + 1

region. To determine if the TATA motifs could stimulate

transcription in the + 1 region if correctly positioned, a

22-bp deletion was made deleting one of the TATA

motives and placing the remaining one in position ± 34

(construction na7±9, Figure 2a). No stimulation of tran-

scription was observed in the + 1 region but initiation at

the upstream site was displaced to position ± 10 (Figure

2b,c). In the na7±9 construction, the ± 10 site is located

23 bp downstream of the TATA motif (Figure 2a).

Similarly, in the na7±3 construction, the upstream site is

centered on position ± 19, 23 bp downstream of the TATA

motifs. These results agree with the mutation experiments

and suggest that the TATA motifs of na7±3 and the

remaining TATA motif of na7±9 are directing the transcrip-

tional initiation in the upstream region. Since all transcrip-

tion initiation events are resistant to low concentrations of

a-amanitin, the TATA motifs are controlling the initiation

site of RNA polymerase III, independently of the internal

motifs. Initiation in position ± 14 is not dependent on the

presence of the TATA, CAA or internal A block and is of

unknown origin.

3¢-end maturation of S1 RNAs.

The RNA3 and RNA4 products observed after direct

labeling of RNAs during the in vitro transcription (Figure

2b), could result from a different termination of transcrip-

tion and/or from a processing event. To distinguish

between these two possibilities, a time course of the

transcription reaction was done (Figure 3a). After 30 min of

transcription, only the two largest RNA products are

visible. After 60 min, RNA3 is also visible and accumulates

up to 180 min before decreasing in intensity at 240 min.

RNA4 is visible at 90 min and accumulates to a maximum

at 240 min. This smallest RNA is the major product after

240 min of transcription. The production of RNA3 and 4 is

stimulated by an increase in the concentration of magne-

sium (Figure 3b), an essential factor for RNA processing

(Yukawa et al., 1997). These results suggest that RNA3 and

4 result from RNA processing and not from the use of

different transcription termination sites. To determine if

this processing concerns the 5¢ region, we analyzed by

primer-extension the RNAs produced after 45 min,

120 min and 240 min using primer P1 (Figure 3c).

Additional (smaller) primer-extension products expected

if the RNA is 5¢ end processed, are not detected at 120 and

240 min compared with 45 min (Figure 3d). Also, the

relative intensity between the products was unchanged

between 45 and 240 min (Figure 3d). These results suggest

that the processing did not implicate the 5¢ end of the S1

RNA. Mutation analysis revealed that the amount of the

two maturation products (RNA3 and 4) is correlated with

the production of RNA 2 (initiated in the + 1 region) and

not with the production of RNA1 (initiated the ± 19 region)

(Figure 2b compare na7±4 and na7±8). The sizes of RNA3

and 4 are compatible with a 3¢-end processing of RNA 2

that would cleave the Poly (A) region of S1 to generate

Poly (A) minus S1 RNA (Figure 3a,c). RNA3 would be an

intermediate, with a ®rst cut in the Poly (A) region (Figure

3c), and RNA4 would be the ®nal Poly (A) minus product.

This is compatible with the observation that RNA3 appears

sooner (60 min) compared with RNA 4 (90 min) in the time

course experiment and that the decrease in the amount of

RNA3 is correlated with an increase in the amount of

RNA4. RNA1 is also degraded in the time course experi-

ment (Figures 3a, 240 min). This degradation does not

generate detectable processing products (Figure 2b, na7±8

and Figure 3a) and since the 5¢ primer-extension (± 19)

product is not reduced at 240 min (Figure 3d), it must be

limited to the 3¢-end of the RNA.

Impact of methylation on S1 transcription.

The impact of DNA methylation on the in vitro transcrip-

tion of na7±3 was tested. The na7±3 construct was

methylated using the CpG-speci®c SssI methylase. Three

different treatments were done and the level of methyl-

ation was estimated by bisul®te (genomic sequencing)

analysis (see Experimental procedures section). Thirteen

to 16 clones were sequenced for each treatment (T1 to T3).

Although the protocol for each treatment was similar, the

level of methylation was found to vary greatly. For the T1

treatment, only three clones out of 16 were found

completely methylated and the average CpG methylation

was 52%. A second treatment (T2) was more ef®cient with

®ve clones out of 13 completely methylated and an

average CpG methylation of 70%. The third treatment

(T3) was the most ef®cient with 11 out of 13 clones

completely methylated and an average CpG methylation of

95%. We used the product of these three different

treatments in the in vitro assay. We observed an inhibition

of transcription that is proportional to the methylation

level of the templates with a complete inhibition using the

highly methylated template (not shown).

Discussion

We show here that the transcription of a putative S1

`master' locus from the Ea subfamily, the na7 locus,

depends largely on upstream ¯anking sequences. The

reason for this dependence is probably linked to a 6-bp



deletion between the A and B motifs, a diagnostic muta-

tion for the Ea subfamily. This deletion places the two

motifs at 26 bp instead of 32 bp in the S1 general

consensus. For tRNA genes and for the adenovirus VAI

genes, transcription ef®ciency is reduced if the spacing

between the A and B motifs is smaller than 30 bp (Cannon

et al., 1986; Murphy and Baralle, 1984). A low transcrip-

tional ef®ciency at short interblock spacing is attributed to

steric hindrance for the binding of the TFIIIC1 and TFIIIC2

on the internal promoter (Cannon et al., 1986). At short

interblock spacing, TFIIIC2, bound to the B block, will

partially overlap onto the A block. Since the recruitment of

TFIIIC1 requires a contact with TFIIIC2 and with the A block,

it is likely to be impaired in this situation. For na7, it is

likely that the 26 bp spacing between the A and B blocks is

responsible for the undetectable level of transcription from

the intragenic promoter (na7±1 and na7±2, Figure 1b). For

na2, the interblock spacing is of 32 bp. A low level of na-2

transcription was found using the internal promoter only,

although transcription was enhanced by the addition of

external sequences (Figure 1b). Most S1 elements have an

interblock spacing similar to na2, with the exception of S1

from the Ea (26 bp) and Eb (29 bp) subfamilies. We

therefore suggest that the majority of S1 elements possess

a weak but functional type-2 internal promoter while the

presence of external cis-elements is very important to

promote ef®cient pol III transcription from these retro-

transposons.

For na7, two different RNA pol III initiation regions (± 19

and + 1) are used and two putative cis-elements (TATA and

CAA motifs) are present in the ¯anking region. The

importance of the TATA and CAA cis-elements for na7

Figure 3. Analysis of the maturation products obtained after transcription of the na7±3 construct.(a) Time course of the transcription reaction. Labeled nucleotides were used in the transcription reaction and the resulting RNAs, collected after 30±240 min, were separated on a polyacrylamide gel. Arrows indicate RNA1±4.(b) Time course of the transcription reaction (from 90 to 265 min) as in (a), but using two different concentrations (1 mM and 3 mM) of magnesium.(c) Position of the primer (P1) and of the 3¢ processing sites.(d) Primer-extension products obtained from the in vitro transcription of na7±3 after 45, 120 and 240 min using the primer P1.



transcription was tested. First, we observed that mutations

in the two TATA motifs abolish initiation in the upstream

region (except for position ± 14, Figure 2, na7±4) and led to

an augmentation of the initiation in the + 1 region (Figure

2, na7±4). The deletion of one TATA motif and the

displacement of the remaining one resulted in an identical

displacement of the upstream (± 19) site without enhanc-

ing transcription in the + 1 region (Figure 2, na7±9). Also,

the mutation of the internal A block did not abolish the

upstream site (Figure 2, na7±8). These results suggest that

initiation of transcription at the upstream site requires at

least one of the two overlapping TATA motifs and is

completely independent of the intragenic motifs, a situ-

ation usually encountered for type 3 promoter. In the

upstream region, position ± 14 is behaving differently from

the other sites. Initiation in position ± 14 is independent of

the TATA, CAA and A motif and may be directed by an

uncharacterized upstream cis-element or, more likely,

represent an artifact of in vitro transcription.

Mutation of the three CAA motifs reduces the initiation

ef®ciency in the + 1 region without affecting the upstream

region (Figure 2b, na7±5, na7±7). Leaving only one of the

three CAA (the one overlapping the initiation site) resulted

in a small reduction of initiation ef®ciency in the + 1 region

(RNA2, 3 4) compared with wild type situation (na7±3 and

na7±6, Figure 2b). The CAA motifs work in association with

the internal promoter since mutations in the A block

completely abolish initiation in the + 1 region (Figure 2b,c,

na7±8). These results suggest that transcription from

the + 1 region is enhanced by the presence of at least

one CAA motif at the initiation site and is dependent on the

internal promoter, a situation characteristic of type 2

promoter. To our knowledge, the na7 locus represents

the ®rst example of a mixed type-2/type-3 RNA pol III

promoter. The transcription ef®ciency in the + 1 region is

higher in construction na7±5 (CAA mutated in CAG at the

initiation site) than for construction na7±2 or na7±1 (CAA

changed for TTA after cloning in pGEM-T) (Figures 1b and

2b). This can be explained if the CAG triplet at the initiation

site conserved a transcription stimulating activity com-

pared with the TTA triplet.

Based on these results, we suggest that the composition

and organization of the factors that nucleate the RNA pol III

are different for the ± 19 and + 1 region. For the + 1 region,

The ®rst round of transcription would be slowly initiated

by the weak (type 2) S1 internal promoter. The CAA motifs

would then participate in the reinitiation as this was

recently shown for tRNA in plants (Yukawa et al., 2000).

In the presence of at least one CAA motif, multiple-round

of transcription would take place leading to the accumu-

lation of S1 RNA initiated in the + 1 region. For the

initiation in the upstream region, the complex ®xed on

the TATA motif could be different and organized as

suggested for type-3 promoter (Yoon et al., 1995). In that

case the complex would consist in a TBP fraction loosely

associated to certain TFIIIB TAFs and bound by a TFIIIC1-

like fraction. This complex could recruit RNA pol III,

possibly in association with uncharacterized upstream

cis-elements, and initiate transcription independently of

the intragenic motifs. In vitro initiations in the ± 19 and + 1

region are likely to be in competition and the augment-

ation of transcription in the + 1 region following mutation

of the TATA motif (Figure 2b, na7±3, na7±4) can be

explained by the abolition of this competition in favor of

the + 1 region.

We have shown previously that S1 elements, including

the na7 locus, are highly methylated in vivo (Goublely

et al., 1999; Arnaud et al., 2000). The impact of DNA

methylation on pol III transcription is not clear and relies

on a small number of reports, all using animal systems

(Jutterman et al., 1991; Minarovits et al., 1992) and con-

cludes in a more or less severe inhibition following

methylation. While the general tendency for methylation

is to inhibit pol III transcription, exceptions exist (Besser

et al., 1990). Here we present for the ®rst time the impact of

methylation on a plant pol III promoter. In our plant in vitro

assay, we detect a transcriptional inhibition that is directly

correlated to the level of template methylation. The

inhibition is complete at high methylation levels. From

these observations, we suggest that the very low level of

general S1 transcription in vivo (Deragon et al., 1996)

results from S1 internal promoter methylation. An import-

ant question then is how, despite its high level of

methylation, the na7 locus can be ef®ciently transcribed

in vivo? We suggest that the presence of external motifs at

this locus can by-pass the down-regulation imposed on S1

internal promoters. In that scenario, initiation in the ±19

region would be necessary to maintain the internal

promoter accessible for transcription factors initiating in

the + 1 region. The combination of TATA motifs (promot-

ing initiation in the ±19 region) and CAA motifs (promoting

initiation in the + 1 region) could give a particular tran-

scriptional advantage to this locus over other S1 loci. This

could explain why na7 is most likely responsible for the

major S1 transcript and may well represent the `master'

locus of the Ea subfamily. However, at this point, we can

not exclude the possibility that the ±19 site is not used

in vivo.

When the na7±3 transcription products were directly

labeled in our assay, four RNA were detected instead of the

two expected ones (initiation in ± 19 and + 1 regions and

termination at the TTTT site). The time course analysis

shows that the two (unexpected) smaller products are

gradually generated in the assay and that their appearance

can be speeded up by an increase (from 1 mM to 3 mM) in

magnesium (Figure 3b). Since RNA processing in the

extract used was shown to be minimal at 1 mM and

optimal over 3 mM of magnesium (Yukawa et al., 1997), we



suggest that the smaller products resulted from the

processing of the largest ones. Size determination of

RNA products, primer-extension analysis (Figure 3) and

transcription from the mutant templates (Figure 2b)

suggest that the two smallest RNAs (RNA3 and 4) are

3¢-processed Poly (A) minus forms of the RNA initiated in

the + 1 region (RNA2). RNA3 is probably an intermediate

resulting of a ®rst cleavage in the Poly (A) tail while RNA4

is the ®nal Poly (A) minus product. This S1 Poly (A) minus

RNA is similar to the small cytoplasmic mammalian SINE

RNA obtained after the in vitro incubation of a full length

SINE RNA with nuclear extract or after SINEs were

expressed in vivo in Xenopus oocytes (Deininger et al.,

1996; Maraia et al., 1993; Maraia, 1991). Since retroposition

appears to be limited to unprocessed transcripts, the

formation of S1 Poly (A) minus RNA should lower the

retropositional potential of S1 transcripts. By analogy to

mammalian system, the 3¢-end processing of S1 RNA

would constitute, after transcription, a second barrier to

retroposition.

Experimental procedures

Constructions

Na2±3 (GeneBank AF101144) and na7±3 (GeneBank AF101149)loci were ampli®ed by PCR using Brassica napus genomic DNAand cloned in pGem-T easy vector (Promega, Charbonniere,France). The PCR primers used were na2±3.1: TCAACTCGGCCGC-TAAC, na2±3.2: GAATATTTACGCACTATCACG, na7±3.1: GAGG-TAGACAACGATTAGTGG, na7±3.2: CCAAAACAAATGTTTTGTCT-TGA. Using different internal PCR primer combinations and na2±3or na7±3 as template we were able to generate (and clone) PCRproducts corresponding to na2±1, na2±2, na7±1 and na7±2 loci.The na7±4 to na7±9 constructs were generated using themegaprimer PCR method (Barik, 1998) and na7±3 as template.Brie¯y, mutagenesis by the megaprimer method requires threeprimers, one in 5¢ (na7±3.1), one in 3¢ (na7±3.2) of na7±3 and aninternal primer encoding the sequence changes needed. Theinternal and the 5¢-end (na7±3.1) primers were used in a ®rstround of PCR ampli®cation using the Vent DNA polymerase at60°C for 35 cycles under conditions recommended by themanufacturer (New England Biolabs, St. Quentin, Yvelines,France). This PCR product was gel-puri®ed and used as a`megaprimer' (10 mM) with the 3¢-end (na7±3.2) primer in a secondround of PCR ampli®cation using the HotStart Taq DNApolymerase at 60°C for 35 cycles as recommended by themanufacturer (Qiagen). The ®nal PCR product was gel-puri®edand cloned in the pGemT-easy vector. The deletion mutant na7±9was generated from na7±3 by the PCR inverse method (Yukawaet al., 2000). All PCR products were puri®ed by Qiaquick gelextraction Kit (Qiagen, Courtaboeuf, France). Cloning in pGem-Teasy vector was performed as previously described (Arnaud et al.,2000). Plasmid DNA constructs were prepared using the Quia®lterplasmid Kit (Qiagen).

Preparation of tobacco nuclear extract

Tobacco nuclear extracts were prepared by a modi®cation of theprocedure of Fan and Sugiura (1995) and Yukawa et al. (1997).

Tobacco cultured cells (BY-2 cell line) (Nagata et al., 1992) wereharvested at middle log phase (approximately 85 h after inocula-tion) with Miracloth (Calbiochem, USA) from a 1.5 litter culture.The cells are digested in 500 ml of enzyme solution [2% CellulaseÒnozuka' RS (Yakult Pharmachemical, Tokyo, Japan) and 0.2%Pectolyase Y-23 (Kikkoman, Tokyo, Japan) in the LS mediumcontaining 0.38 M mannitol and 3% sucrose, pH 5.5] at 30°C for50 min. Protoplasts were collected by centrifugation at 250 g for2 min at 2°C, washed twice with ice cold 0.38 M mannitol (pH 5.5).The pellet was suspended in 300 ml nuclear isolation buffer (NIB)[15 mM HEPES-KOH (pH 7.9), 18% (w/v) Ficoll 400, 4 mM MgSO4,1 mM NaF, 1 mM EGTA, 0.5 mM EDTA, 3 mM DTT, 0.5 mM PMSF,0.5 mM benzamidine hydrochloride, 1.5 mg/ml pepstatin A, 1 mgml±1 leupeptin] and for braking cell membrane, vacuum-®ltratedtwice through one layer of 20 mm nylon mesh (Schweiz.Seidengazefabrik AG Thal, Switzerland). The ®ltrate was centri-fuged at 2500 g for 12 min at 2°C and the nuclear pellet wassuspended with 250 ml NIB and centrifuged at 2500 g for 10 minat 2°C. Washed nuclei were suspended in 3 volumes of nuclearextraction buffer (NEB) [25 mM HEPES-KOH (pH 7.9), 20% (v/v)glycerol, 4 mM MgSO4, 0.4 mM EGTA, 1 mM NaF, 5 mM DTT, 3 mgml±1 pepstatin A, 2 mg ml±1 leupeptin]. Ammonium sulfate wasadded to 0.42 M, and then rotated at 2°C for 30 min. Nuclear lysatewas centrifuged at 200 000 g for 1 h and the supernatant wassubjected to precipitation of 60% saturated ammonium sulfate indialysis buffer (DB) [20 mM HEPES-KOH (pH 7.9), 20% (v/v)glycerol, 4 mM MgSO4, 0.2 mM EGTA, 0.1 mM EDTA, 2 mM DTT,0.5 mM PMSF, 0.5 mM benzamidine hydrochloride]. The precipi-tate was dissolved with 2 ml of DB and dialyzed twice with MWCO12 000 cellulose membrane (Wako Chemical USA, Richemond,VA, USA) at 4°C for 1.5 h each against 500 ml DB. The resultingnuclear extract was aliquoted and frozen in a deep freezer.

In vitro transcription and primer-extension.

In vitro transcription reactions from S1 elements using tobacconuclear extracts were done as previously described (Yukawa et al.,1997) with minor modi®cations. Brie¯y, reaction was performedin a 20-ml volume containing 30 mM HEPES-KOH (pH 7.9), 3 mM

MgSO4, 80 mM KOAc, 0.1 mM EGTA, 2 mM DTT, 10% glycerol,0.5 mM each of ATP, CTP, UTP, 25 mM GTP, 37 kBq [a-32P]GTP,0.2 pmol circular plasmids, 0.5 mg ml±1 a-amanitin and 15 mgtobacco nuclear extract. After incubation at 28°C for the indicatedtime, the 32P-labeled RNA was extracted by phenolation or TotalRNA SafeKit (BIO101, La Jolla, CA, USA). The extracted RNA wasseparated by 5±8% polyacrylamide gel containing 7 M urea andTBE. Radioactivity was detected by Bio-Imaging Analyzer BAS-2000 II (Fuji Photo Film, Tokyo, Japan).

For primer-extension assay, in vitro transcription was per-formed in the same reaction mix except for 1 mM each of 4NTPsas substrates. The primers used were P1: CCGCGAGTCGA-ACAGCC, corresponding to position 48±64 of the S1 element atthe na7 locus and pBN2: CCCCCTCCCCGCCAGTCGAACAACCG,corresponding to position 53±78 of the S1 element at the na2locus. Total nucleic acid was extracted twice with phenol/chloro-form and once with chloroform. After ethanol precipitation with100 fmol [5¢ 32P]primers, the resulting pellet was dissolved in 10 mlof reverse transcription buffer [50 mM Tris±HCl (pH 8.3), 75 mM

KCl, 3 mM MgCl2 and 10 mM DTT], and subjected to denaturationat 70°C for 5 min and annealing at 60°C for 10 min. After adding10 ml of RTase cocktail [1 mM each of 4dNTPs, 100 mM actinomy-cin D, 10 U RNase inhibitor, 100 U ReverTra Ace (Toyobo, Japan)in 1x RTase buffer], the mixture was incubated at 50°C for 1 h.Reaction was stopped by phenol/chloroform treatment. After



ethanol precipitation, the pellet was dissolved in loading buffer[95% formamide, 5 mM EDTA, 0.1% bromophenol blue, 0.1%xylene cyanol], and then separated with 8% polyacrylamide gelcontaining 7 M urea and TBE. The sequencing ladder wasprepared from the same combinations of templates and primersusing Thermosequenase Cycle Sequencing Kit (AmershamPharmacia, Saclay, France). Detection was the same as above.

Methylation and bisul®te treatments.

The na7±3 construct was methylated by the SssI CpG methylase(New England Biolabs, St. Quentin, Yvelines, France) for 4 h at37°C using 2.5 units m±1g of DNA. The methylation ef®ciency wastested using the bisul®te DNA modi®cation method performed aspreviously described (Arnaud et al., 2000).

Acknowledgements

We thank Alain Lenoir for technical help and Christophe Tatoutand Charles White for helpful discussions. This work wassupported by the CNRS (as part of the Genome Project), by theARC foundation (1996±98) and by UniversiteÂ Blaise Pascal. Y. Y. isa Research Fellow of the Japan Society for the Promotion ofScience.

References

Arnaud, P., Goubely, C., PeÂ lissier, T. and Deragon, J.M. (2000).SINE retroposons can be used in vivo as nucleation centers forde novo methylation. Mol. Cell. Biol. 20, 3434±3441.

Barik, S. (1998) Mutagenesis by megaprimer PCR. In GeneticEngineering with PCR (Horton, R.M. and Tait, R.C., eds),Wymondham, UK: Horizon Scienti®c Press, pp. 25±37.

Besser, D., Gotz, F., Schulze-Foster, K., Wagner, H., Kroger, H. andSimon, D. (1990) DNA methylation inhibits transcription byRNA polymerase III of tRNA gene, but not of a 5S rRNA gene.FEBS Lett. 269, 358±362.

Boeke, J.D. (1997) LINEs and Alus-the polyA connection. NatureGenet. 16, 6±7.

Cannon, R.E., Wu, G.J. and Railey, J.F. (1986) Function of andinteractions between the A and B blocks in adenovirus type2-speci®c VARNA1 gene. Proc. Natl Acad. Sci. USA, 83, 1285±1289.

Chesnokov, I. and Schmid, C.W. (1996) Flanking sequences of anAlu source stimulate transcription in vitro by interacting withsequence-speci®c transcription factors. J. Mol. Evol. 42, 30±36.

Choisne, N., Carneiro, V.T.C., Pelletier, G. and Small, I. (1997)Implication of 5¢-¯anking sequence elements in expression of aplant tRNAleu gene. Plant Mol. Biol. 36, 113±123.

Connelly, S., Mashallsay, C., Leader, D., Brown, J.W.S. andFilipowicz, W. (1994) Small nuclear RNA genes transcribed byeither RNA polymerase II or RNA polymerase III in monocotplants share three promoter elements and use a strategy toregulate gene expression different from that used by their dicotplant counterparts. Mol. Cell. Biol. 14, 5910±5919.

Deininger, P.L. (1989) SINEs: short interspersed repeated DNAelements in higher eukaryotes. In Mobile DNA (Berg, D.E. andHowe, M.M., eds), Washington, DC, USA: American Society forMicrobiology, pp. 619±636.

Deininger, P.L. and Batzer, M.A. (1995) SINE master genes andpopulation biology. in the Impact of Short InterspersedElements (Sines) on the Host Genome (Maraia, R.J., ed.),Austin, Texas, USA: R. G. Landes Company, Springer, pp. 43±60.

Deininger, P.L., Tiedge, H., Kim, J. and Brosius, J. (1996)Evolution, expression and possible function of a master genefor ampli®cation of an interspersed repeated DNA family inrodents. Prog. Nucl Acid Res. Mol. Biol. 52, 67±88.

Deragon, J.M., Landry, B.S., PeÂ lissier, T., Tutois, S. and Picard, G.(1994). Analysis of retroposition in plants based on a family ofSINEs from Brassica napus. J. Mol. Evol. 39, 78±386.

Deragon, J.M., Gilbert, N., Rouquet, L., Lenoir, A., Arnaud, P. andPicard, G. (1996) A transcriptional analysis of the S1Bn(Brassica napus) family of SINE retroposons. Plant Mol. Biol.32, 869±878.

Fan, H. and Sugiura, M. (1995) A plant basal in vitro systemsupporting accurate transcription of both RNA polymerase II-and III-dependent genes (Suppl.)of green leaf component (s)drives accurate transcription of a light-responsive rbcS gene.EMBO J. 14, 1024±1031.

Fan, H. and Sugiura, M. (1996) Basal and activated in vitrotranscription in plants by RNA polymerase II and III. Meth.Enzymol. 273, 268±277.

Gilbert, N., Arnaud, P., Lenoir, A., Warwick, S.I., Picard, G. andDeragon, J.M. (1997) Plant S1 SINEs as a model to studyretroposition. Genetica, 10, 155±160.

Goodier, J.L. and Maraia, R.J. (1998) Terminator-speci®c recyclingof a B1-Alu transcription complex by RNA polymerase III ismediated by the RNA terminus-binding protein La. J. Biol.Chem. 273, 26110±26116.

Goubely, C., Arnaud, P., Tatout, C., Heslop-Harrison, J.S. andDeragon, J.M. (1999) S1 SINE retroposons are methylated atsymmetrical and non-symmetrical positions in Brassica napus:Identi®cation of a preferred target site for asymmetricalmethylation. Plant. Mol. Biol. 39, 243±255.

Heard, D.J., Filipowicz, W., Marques, J.P., Palme, K. andGualberto, J.M. (1995) An upstream U-snRNA gene-likepromoter is required for transcription of the Arabidopsisthaliana 7SL RNA gene. Nucl Acids Res. 23, 1970±1976.

Juttermann, R., Hosokawa, K., Kochanek, S. and Doer¯er, W.(1991) Adenovirus type 2 VAI RNA transcription by polymeraseIII is blocked by sequence-speci®c methylation. J. Virol. 65,1735±1742.

Lenoir, A., Cournoyer, B., Warwick, S.I., Picard, G. and Deragon,J.M. (1997). Evolution of SINE S1 retrotransposons inCruciferae plants pecies. Mol. Biol. Evol. 14, 934±941.

Maraia, R.J. (1991) The subset of mouse B1 (Alu-equivalent)sequences expressed as small processed cytoplasmictranscripts. Nucl Acids Res. 19, 5695±5702.

Maraia, R.J., Chang, D.Y., Wolffe, A.P., Vorce, R.L. and Hsu, K.(1992) The RNA polymerase III terminator used by a B1-Aluelement can modulate 3¢ processing of the intermediate RNAproduct. Mol. Cell. Biol. 12, 1500±1506.

Maraia, R.J., Driscoll, C.T., Bilyeu, T., Hsu, K. and Darlington, G.J.(1993) Multiple dispersed loci produce small cytoplasmic AluRNA. Mol. Cell. Biol. 13, 4233±4241.

Minarovits, J., Hu, L.F., Marcsek, Z., Minarovits-Kormuta, S.,Klein, G. and Ernberg, I. (1992) RNA polymerase III-transcribedEBER 1 and 2 transcription units are expressed andhypomethylated in the major Epstein-Barr virus-carrying celltypes. J. Gen. Virol. 73, 1687±1692.

Murphy, M.H. and Baralle, F.E. (1984) Construction and functionalanalysis of a series of synthetic RNA polymerase III promoters.J. Biol. Chem. 259, 10208±10211.

Nagata, T., Nemoto, Y. and Hasegawa, S. (1992) Tobacco BY-2cell line as the `HeLa' cell in the cell biology of higher plants. Int.Rev. Cytol. 132, 1±30.

Oettel, S., Hartel, F., Kober, I., Iben, S. and Seifart, K.H. (1997)



Human transcription factors IIIC2 IIIC1 and novel componentIIIC0 ful®l different aspects of DNA binding to various pol IIIgenes. Nucl Acids Res. 25, 2440±2447.

Okada, N. and Ohshima, K. (1995) Evolution of tRNA-derivedSINEs. In The Impact of Short Interspersed Elements (Sines) onthe Host Genome (Maraia, R.J., ed.), Austin, Texas, USA: R. G.Landes Compagny, Springer, pp. 61±79

Park, J.M., Lee, J.Y., Hat®eld, D.L. and Lee, B.J. (1997) Differentialmode of TBP utilization in transcription of the tRNA (ser) sec geneand TATA-less class III genes. Gene, 196, 99±103.

Paule, M.R. and White, R.J. (2000) Transcription by RNApolymerase I and III. Nucl Acids Res. 28, 1283±1298.

Rogers, J.H. (1985) The origin and evolution of retroposons. Int.Rev. Cytol. 93, 187±279.

Schmid, C.W. (1998) Does SINE evolution preclude Alu function?Nucl Acids Res. 26, 4541±4550.

Sinnett, D., Richer, C., Deragon, J.M. and Labuda, D. (1992) AluRNA transcripts in human embryonal carcinoma cells. Model ofpost-transcriptional selection of master sequences. J. Mol. Biol.226, 689±706.

Sprague, K.U. (1995) Transcription of eukaryotic tRNA genes. In:Trna: Structure, Biosynthesis and Function (Soll, D. andRajBhandary, U., eds) Washington, DC, USA: AmericanSociety for Microbiology, pp. 31±50.

Tatout, C., Lavie, L. and Deragon, J.M. (1998). Similar target siteselection occurs in integration of plant and mammalianretroposons. J. Mol. Evol. 47, 463±470.

Tatout, C., Warwick, S.I., Lenoir, A. and Deragon, J.M. (1999) SINEinsertions as clade markers for wild crucifer species. Mol. Biol.Evol. 16, 1614±1621.

Teichmann, M., Dieci, G., Huet, J., Ruth, J., Sentenac, A. andSeifart, K.H. (1997) Functional interchangeability of TFIIIB

components from yeast and human cells in vitro. EMBO J. 16,4708±4716.

Tikhonov, A.P., Tatout, C., Lavie, L., Bennetzen, J.L., Avramova, Z.and Deragon, J.M. (2001) Matrix-Attachment Regions (MARs)as target sites for, SINE integration in Brassica genomes.Chrom. Res. (in press)

Ulmanov, B. and Folk, W. (1995) Analysis of the role of 5¢ and 3¢¯anking sequence elements upon in vivo expression of theplant tRNATrp genes. Plant Cell, 7, 1723±1734.

Vilalta, A., Kickhoerfer, V.A., Rome, L.H. and Johnson, D.L. (1994)The rat vault RNA gene contains a unique RNA polymerase IIIpromoter composed of both external and internal elements thatfunction synergistically. J. Biol. Chem. 269, 29752±29759.

Willis, I.M. (1993) RNA polymerase III. Genes, factors andtranscriptional speci®city. Eur. J. Biochem. 212, 1±11.

Yoon, J.B., Murphy, S., Bai, L., Wang, Z. and Roeder, R.G. (1995)Proximal sequence element-binding transcription factor (PTF)is a multisubunit complex required for transcription of bothRNA polymerase II and RNA polymerase III-dependent smallnuclear RNA genes. Mol. Cell. Biol. 15, 2019±2026.

Yukawa, Y., Sugita, M. and Sugiura, M. (1997) Ef®cient in vitrotranscription of plant nuclear tRNAser genes in a nuclearextract from tobacco cultured cells. Plant J. 12, 965±970.

Yukawa, Y., Sugita, M., Choisne, N., Small, I. and Sugiura, M.(2000) The TATA motif, the CAA motif and the Poly (T)transcription termination motif are all important fortranscription reinitiation on plant tRNA genes. Plant J. 22,439±447.

Zecherle, G.N., Whelen, S. and Hall, B.D. (1996) Purine arerequired at the 5¢ ends of newly initiated RNAs for optimalRNA polymerase III gene expression. Mol. Cell. Biol. 16, 5801±5810.

GeneBank accession numbers AF101144and AF101149.



Documents

Analysis of the SINE S1 Pol III promoter from Brassica; impact of methylation and influence of external sequences