Upload
richard-cook
View
218
Download
0
Tags:
Embed Size (px)
Citation preview
Annotation of Drosophila primer
GEP Workshop – August 2015
Wilson Leung and Chris Shaffer
Outline
Overview of the GEP annotation projectAnnotation goalsNomenclature
GEP annotation strategyUsing genomics databasesInterpreting RNA-Seq dataUnderstanding the phase of splice sites
“Annotation of a Drosophila gene” walkthrough
AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCTTAAAAAAGAGCAAGAACAGTTTAACCATTGAAAACAAGATTATTCCAATAGCCGTAAGAGTTCATTTAATGACAATGACGATGGCGGCAAAGTCGATGAAGGACTAGTCGGAACTGGAAATAGGAATGCGCCAAAAGCTAGTGCAGCTAAACATCAATTGAAACAAGTTTGTACATCGATGCGCGGAGGCGCTTTTCTCTCAGGATGGCTGGGGATGCCAGCACGTTAATCAGGATACCAATTGAGGAGGTGCCCCAGCTCACCTAGAGCCGGCCAATAAGGACCCATCGGGGGGGCCGCTTATGTGGAAGCCAAACATTAAACCATAGGCAACCGATTTGTGGGAATCGAATTTAAGAAACGGCGGTCAGCCACCCGCTCAACAAGTGCCAAAGCCATCTTGGGGGCATACGCCTTCATCAAATTTGGGCGGAACTTGGGGCGAGGACGATGATGGCGCCGATAGCACCAGCGTTTGGACGGGTCAGTCATTCCACATATGCACAACGTCTGGTGTTGCAGTCGGTGCCATAGCGCCTGGCCGTTGGCGCCGCTGCTGGTCCCTAATGGGGACAGGCTGTTGCTGTTGGTGTTGGAGTCGGAGTTGCCTTAAACTCGACTGGAAATAACAATGCGCCGGCAACAGGAGCCCTGCCTGCCGTGGCTCGTCCGAAATGTGGGGACATCATCCTCAGATTGCTCACAATCATCGGCCGGAATGNTAANGAATTAATCAAATTTTGGCGGACATAATGNGCAGATTCAGAACGTATTAACAAAATGGTCGGCCCCGTTGTTAGTGCAACAGGGTCAAATATCGCAAGCTCAAATATTGGCCCAAGCGGTGTTGGTTCCGTATCCGGTAATGTCGGGGCACAATGGGGAGCCACACAGGCCGCGTTGGGGCCCCAAGGTATTTCCAAGCAAATCACTGGATGGGAGGAACCACAATCAGATTCAGAATATTAACAAAATGGTCGGCCCCGTTGTTATGGATAAAAAATTTGTGTCTTCGTACGGAGATTATGTTGTTAATCAATTTTATTAAGATATTTAAATAAATATGTGTACCTTTCACGAGAAATTTGCTTACCTTTTCGACACACACACTTATACAGACAGGTAATAATTACCTTTTGAGCAATTCGATTTTCATAAAATATACCTAAATCGCATCGTC
Start codon Coding region Stop codon
Splice donor Splice acceptor UTR
Annotation:Adding labels to a sequence
Genes: Novel or known genes, pseudogenes
Regulatory elements: Promoters, enhancers, silencers
Non-coding RNA: tRNAs, miRNAs, siRNAs, snoRNAs
Repeats: Transposable elements, simple repeats
Structural: Origins of replication, synteny
Experimental results: DNase I Hypersensitive sites (DHS)ChIP-chip and ChIP-Seq datasets (e.g., modENCODE)
GEP Drosophila annotation projects
D. melanogasterD. simulansD. sechelliaD. yakubaD. erectaD. ficusphilaD. eugracilisD. biarmipesD. takahashiiD. elegansD. rhopaloaD. kikkawai
D. ananassaeD. bipectinata
D. pseudoobscuraD. persimilisD. willistoni
D. mojavensisD. virilisD. grimshawi
ReferencePublished
Annotation projects for Fall 2015 / Spring 2016
Species in the Four Genomes Paper
New species sequenced by modENCODE
Phylogenetic tree produced by Thom Kaufman as part of the modENCODE project
Manuscript in progress
Muller element nomenclature
Species A B C D E F
D. simulans X 2L 2R 3L 3R 4
D. sechellia X 2L 2R 3L 3R 4
D. melanogaster X 2L 2R 3L 3R 4
D. yakuba X 2L 2R 3L 3R 4
D. erecta X 2L 2R 3L 3R 4
D. ananassae XLXR 3R 3L 2R 2L 4L4R
D. pseudoobscura
XL 4 3 XR 2 5
D. persimilis XL 4 3 XR 2 5
D. willistoni XL 2R 2L XR 3
D. mojavensis X 3 5 4 2 6
D. virilis X 4 5 3 2 6
D. grimshawi X 3 2 5 4 6
Muller elements
Gene structure nomenclature
Gene span
Primary
mRNA
Protein
ExonsExon
UTR’sUTR
CDS’sCDS
GEP annotation strategy
Technique is optimized for projects with a moderately close, well annotated neighbor species
Example: D. melanogaster
Need to apply different strategies when annotating genes in other species
Examples: corn, parrot
GEP annotation goals Identify and annotate all the genes in your project
For each gene, identify and precisely map (accurate to the base pair) all coding exons (CDS)Do this for ALL isoformAnnotate the initial transcribed exon and transcription start site (TSS)
Optional curriculum not submitted to GEPClustal analysis (protein, promoter regions)Repeats analysisSynteny analysis
Evidence-based annotation
Human-curated analysisMore accurate than standard ab initio and evidence-based gene finders
Goal: collect, analyze, and synthesize all the available evidence to create the best-supported gene model
Example: 4591-4688, 5157-5490, 5747-6001
Collect, analyze, and synthesize
Collect:Genome BrowserConservation (BLAST searches)
Analyze:Interpreting Genome Browser evidence tracksInterpreting BLAST results
Synthesize:Construct the best-supported gene model based on potentially contradictory evidence
Basic annotation workflow1. Identify the likely ortholog in D. melanogaster
2. Observe the gene structure of the ortholog
3. Map each CDS of ortholog to the project sequenceUse BLASTX to identify conserved regionNote position and reading frame
4. Use these data to construct a gene modelUse TopHat splice junctions to identify splice site boundaries, or a combination of conservation, splice signals, reading frameIdentify the exact start and stop base position for each CDS
5. Use the Gene Model Checker to verify the gene model
6. For each additional isoform, repeat steps 2-5
BLASTX search of each D. melanogaster CDS against the contig
ContigFeature
Annotation workflow (graphically)
Contig
BLASTP search of feature against the D. melanogaster proteins database
Feature
D. melanogaster gene model (1 isoform, 5 CDS)
1 3Reading frame
Alignment
2 13
Identify the exact coordinates of each CDS using the Genome Browser
Annotation workflow (graphically)BLASTX search of each D. melanogaster CDS against the contig
Contig
1 3Reading frame
Alignment
2 13
GT
1
AG GTM
3Reading frame
Use the Gene Model Checker to verify the final CDS coordinates
Gene model
1245 1383 1437 1678 1740 2081 2159 2337 2397 2511
1245-1383, 1437-1678, 1740-2081, 2159-2337, 2397-2511
Coordinates:
Four main web sites used by the GEP annotation strategy
1. GEP UCSC Genome Browser (http://gander.wustl.edu)
2. FlyBase (http://flybase.org) Tools Genomic/Map Tools BLAST
3. Gene Record Finder (http://gep.wustl.edu)Projects Annotation Resources
4. NCBI BLAST (http://blast.ncbi.nlm.nih.gov)BLASTX select the checkbox:
UCSC Genome Browser
Provides a graphical view of genomic regionSequence conservationGene and splice site predictionsRNA-Seq data and splice junction predictions
BLAT – BLAST-Like Alignment ToolMap protein or nucleotide sequence against an assemblyFaster but less sensitive than BLAST
Table BrowserAccess raw data used to create the graphical browser
Two different versions of the UCSC Genome Browser
Official UCSC Versionhttp://genome.ucsc.edu
Published data, lots of species, whole genomes, used for “Chimp Chunks”
GEP Versionhttp://gander.wustl.edu
GEP data, parts of genomes, used for annotation of Drosophila species
Additional training resources
Training section on the UCSC web sitehttp://genome.ucsc.edu/training/index.html Training videos, user guides and tutorialsMailing lists
OpenHelix tutorials and training materialshttp://www.openhelix.com/ucsc Pre-recorded tutorialsReference cards
GEP UCSC Genome Browser overview
Genomic sequence
Evidence tracks
Control how evidence tracks are displayed on the Genome Browser
Five different display modes:Hide: track is hiddenDense: all features appear on a single lineSquish: overlapping features appear on separate lines
Features are half the height compared to full mode
Pack: overlapping features appear on separate linesFeatures are the same height as full mode
Full: each feature is displayed on its own lineSet “Base Position” track to “Full” to see the amino acid translations
Some evidence tracks (e.g., RepeatMasker) only have a subset of these display modes
FlyBase – Database for the Drosophila research community
Lots of ancillary data for each gene in D. melanogaster
Curation of literature for each gene
Reference D. melanogaster annotations for all other databases
Including NCBI, EBI, and DDBJ
Fast release cycle (6-8 releases per year)
Be aware of different annotation releases
D. melanogaster Release 6 genome assemblyFirst change of the assembly since late 2006Most modENCODE analysis used the Release 5 assembly
Gene annotations change much more frequently
Use FlyBase as the canonical reference
GEP data freeze:Update GEP materials before the start of semesterPotential discrepancies in exercise screenshotsMinor differences in search resultsLet us know about major errors or discrepancies
Gene Record Finder – Observe the structure of D. melanogaster genes
Retrieve CDS and exon sequences for each gene in D. melanogaster
CDS and exon usage maps for each isoformList of unique CDS
Optimal for the exon-by-exon annotation strategy
Nomenclature for Drosophila genes
Drosophila gene names are case-sensitiveLowercase initial letter = recessive mutant phenotypeUppercase initial letter = dominant mutant phenotype
Every D. melanogaster gene has an annotation symbolBegins with the prefix CG (Computed Gene)
Some genes have a different gene symbol (e.g., mav)
Suffix after the gene symbol denotes different isoformsmRNA = -R; protein = -Pmav-RA = Transcript for the A isoform of mavmav-PA = Protein product for the A isoform of mav
NCBI – comprehensive database for biomedical and genomics information
One of the most comprehensive genomics databaseQuality of GenBank records will vary
PubMed for literature searches
BLAST web serviceBLAST search against RefSeq, nr/nt databasesAlign two (or more) sequences (bl2seq)
Common BLAST programsExcept for BLASTN, all alignments are based on comparisons of protein sequences
Alignment coordinates are relative to the original sequences
Decide which BLAST program to use based on the type of query and subject sequences:
Program Query Database (Subject)
BLASTN Nucleotide Nucleotide
BLASTP Protein Protein
BLASTX Nucleotide -> Protein
Protein
TBLASTN Protein Nucleotide -> Protein
TBLASTX Nucleotide -> Protein
Nucleotide -> Protein
Where can I run BLAST?
NCBI BLAST web servicehttp://blast.ncbi.nlm.nih.gov/Blast.cgi
EBI BLAST web servicehttp://www.ebi.ac.uk/Tools/sss/
FlyBase BLAST (Drosophila and other insects)
http://flybase.org/blast/
Data on the Genome Browser is incomplete
The Genome Browser contains many different evidence tracks:
Sequence similarity to D. melanogaster proteinsRNA-Seq from different developmental stagesGene and splice site predictionsSequence alignments of multiple Drosophila species
Annotators still need to identify the orthologWARNING! Students often over-interpret the BLASTX alignment track (D. mel Proteins); use with caution
Identify ortholog based on BLASTP search of the feature against D.
melanogaster proteins
Most genes (~90%) remain on the same Muller element across the different Drosophila species
Large increase in E-value from mav-PA to gbb-PB
Basic biological constraints (inviolate rules*)
Coding regions start with a methionine
Coding regions end with a stop codon
Gene should be on only one strand of DNA
Exons appear in order along the DNA (collinear)
Intron sequences should be at least 40 bp
Intron starts with a GT (or rarely GC)
Intron ends with an AG
* There are known exceptions to each rule
Evidence for gene models(in general order of importance)
1. Expression dataRNA-Seq, EST, cDNA
2. ConservationSequence similarity to genes in D. melanogasterSequence similarity to other Drosophila species (Multiz)
3. Computational predictionsGene and splice site predictions
4. Tie-breakers of last resortSee the “Annotation Instruction Sheet”
modENCODE RNA-Seq data
RNA-Seq evidence tracks:RNA-Seq coverage (read depth)TopHat splice junction predictionsAssembled transcripts (Cufflinks, Oases)
Positive results very helpful
Negative results less informativeLack of transcription ≠ no gene
GEP curriculum:RNA-Seq PrimerBrowser-Based Annotation and RNA-Seq Data
Generating RNA-Seq data (Illumina)
Processed mRNA
5’ cap Poly-A tailAAAAAA
RNA fragments(~250bp)
Library with adapters 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’
Paired end sequencing 5’ 3’
~125bp
~125bp
RNA-Seq readsReverseForward
Wang Z et al. (2009) RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10(1):57-63.
Use the TopHat splice junction predictions to identify splice sites
Processed mRNA AAAAAAM
RNA-Seq reads
5’ cap Poly-A tail*
TopHat junctions
ContigIntron Intron
Use BLASTX to map D. melanogaster CDS onto the
contigUse sequence similarity to infer homology
D. melanogaster is very well annotatedCoding sequences evolve slowlyExon structure changes very slowly
Change two settings in the “Algorithm parameters” section when using bl2seq
Turn off compositional adjustments
Turn off the low complexity filter
Strategies for finding small CDS
Examine RNA-Seq coverage and TopHat junctionsSmall CDS is typically part of a larger transcribed exon
Use Query subrange to restrict the search region
Increase the Expect threshold and try againKeep increasing the Expect threshold until you get matchesAlso try decreasing the word size
Use the Small Exon Finder Minimize changes in CDS sizeAvailable under Projects Annotation Resources
See the “Annotation Strategy Guide” for details
A genomic sequence has 6 different reading frames
Frame: Base to begin translation relative to the first base of the sequence
Frames
123
Splice donor and acceptor phases
Phase: Number of bases between the complete codon and the splice site
Donor phase: Number of bases between the end of the last complete codon and the splice donor site (GT/GC)
Acceptor phase: Number of bases between the splice acceptor site (AG) and the start of the first complete codon
Phase is relative to the reading frame of the CDS
Phase depends on the reading frame
Phase of acceptor site:Phase 2 relative to frame +1Phase 0 relative to frame +2Phase 1 relative to frame +3
Splice Acceptor
Phase of the donor and acceptor sites must be compatible
Extra nucleotides from donor and acceptor phases will form an additional codon
Donor phase + acceptor phase = 0 or 3
GT AG… … …CCA AAT G CTC GATTT
P N V L DTranslation:
CCA AAT G
CTC GATGTTCCA AAT
CTC GATTT
Incompatible donor and acceptor phases results in a frame shift
Phase 0 donor is incompatible with phase 2 acceptor; use prior GT, which is a phase 1 donor.
CCA GT AG… …AAT G CTC GATTT
P N G F STranslation:
GT
CCA AAT TCG ATGGT TTC
Verify the final gene model using the Gene Model Checker
Examine the checklist and explain any errors or warnings in the GEP Annotation Report
View your gene model in the context of the other evidence tracks on the Genome Browser
Examine the dot plot and explain any discrepancies in the GEP Annotation Report
Look for large vertical and horizontal gapsSee the “How to do a quick check of student annotations” document on the GEP web site
Questions?
http://www.flickr.com/photos/jac_opo/240254763/sizes/l/