Upload
others
View
3
Download
0
Embed Size (px)
Citation preview
University of Vermont University of Vermont
ScholarWorks @ UVM ScholarWorks @ UVM
Graduate College Dissertations and Theses Dissertations and Theses
2020
Anti-Tumor Signaling Of Thyroid Hormone Receptor Beta In Breast Anti-Tumor Signaling Of Thyroid Hormone Receptor Beta In Breast
And Thyroid Cancer Cells And Thyroid Cancer Cells
Eric Bolf University of Vermont
Follow this and additional works at: https://scholarworks.uvm.edu/graddis
Part of the Cell Biology Commons, and the Molecular Biology Commons
Recommended Citation Recommended Citation Bolf, Eric, "Anti-Tumor Signaling Of Thyroid Hormone Receptor Beta In Breast And Thyroid Cancer Cells" (2020). Graduate College Dissertations and Theses. 1193. https://scholarworks.uvm.edu/graddis/1193
This Dissertation is brought to you for free and open access by the Dissertations and Theses at ScholarWorks @ UVM. It has been accepted for inclusion in Graduate College Dissertations and Theses by an authorized administrator of ScholarWorks @ UVM. For more information, please contact [email protected].
ANTI-TUMOR SIGNALING OF THYROID HORMONE RECEPTOR BETA IN
BREAST AND THYROID CANCER CELLS
A Dissertation Presented
by
Eric L. Bolf
to
The Faculty of the Graduate College
of
The University of Vermont
In Partial Fulfillment of the Requirements
for the Degree of Doctor of Philosophy
Specializing in Cellular, Molecular, and Biomedical Sciences
May, 2020
Defense Date: March 24, 2020
Dissertation Examination Committee:
Frances E. Carr, Ph.D., Advisor
Karen C. Glass, Ph.D., Chairperson
Jane B. Lian, Ph.D.
Karen M. Lounsbury, Ph.D.
Cynthia J. Forehand, Ph.D., Dean of the Graduate College
ABSTRACT
Dysregulation of the tumor suppressor thyroid hormone receptor beta (TRβ) is a
frequent event in a number of solid tumors. As a nuclear hormone receptor, the primary
function of TRβ is to regulate transcriptional activity in a ligand-dependent manner.
However, TRβ activity is not well-defined and the pathways it regulates are not yet fully
delineated. The two cancer types where TRβ is best studied are thyroid cancer and breast
cancer. Interestingly, thyroid cancer is a risk factor for breast cancer and breast cancer is
a risk factor for thyroid cancer, suggestive of an etiological link. Determining the
molecular mechanisms of a tumor suppressor shared by both diseases may reveal critical
tumor suppressive pathways.
First, in order to discover novel pathways that are regulated by TRβ, TRβ was
stably overexpressed in an anaplastic thyroid cancer (ATC) cell line through lentiviral
transduction. TRβ has not previously been overexpressed in ATC and, through
triiodothyronine (T3) stimulation, TRβ repressed pro-malignant phenotypes including
cellular growth, migration, and stemness. Additionally, TRβ and T3 promoted apoptosis.
RNA-sequencing and subsequent analysis revealed novel TRβ-mediated STAT1
stimulation. Additionally, unmodified anaplastic thyroid cancer cells were sensitive to
treatment with a STAT1 agonist.
Next, to determine if there is common transcriptional signaling between different
types of solid tumors, the TRβ-RUNX2 pathway was examined in breast cell lines. In
thyroid cancer, TRβ represses expression of the pro-metastatic transcription factor
RUNX2. In addition to promoting thyroid cancer, aberrant overexpression of RUNX2 is a
driver of breast carcinogenesis. This informed the hypothesis that TRβ-mediated
repression of RUNX2 and resultant signaling is common to thyroid and breast cancers. T3
treatment reduced RUNX2 expression in breast cell lines. Additionally, TRβ bound to
thyroid hormone response elements in the RUNX2 promoter, the same mechanism of
action for T3-mediated repression as in thyroid cells.
Lastly, to more broadly address mechanisms mediated by TRβ, TRβ was stably
overexpressed in a basal-like aggressive breast cancer cell line. TRβ is already known to
be able to repress tumor growth and metastasis in this type of cancer. However, the
specific molecular mechanisms driving the anti-tumor phenotype are not well delineated.
In order to determine which molecular signaling pathways are regulated by TRβ, RNA-
sequencing was performed. TRβ induced a more epithelial profile of these cells, in
contrast to the typically mesenchymal nature of basal-like breast cancer. Novel TRβ-
mediated repression of pro-invasive cytokeratins was found. The genes regulated by TRβ
in these cells were also compared to the findings in ATC. The set of common genes
included chromatin remodelers and enzymes involved in stearate biosynthesis; the latter
is known to have anti-cancer properties and may be an important driver of TRβ-mediated
tumor suppression in both breast and thyroid cancers.
ii
CITATIONS
Material from this dissertation has been published in the following form:
Bolf E.L., Sprague B.L., Carr F.E.. (2019). A Linkage Between Thyroid and Breast
Cancer: A Common Etiology? Cancer Epidemiology, Biomarkers & Prevention. 4,
643-649.
Bolf E.L., Gillis N.E., Barnum M.S., Beaduet C.M., Yu G.Y., Tomczak J.A., Stein J.L.,
Lian J.B., Stein G.S., Carr F.E.. (2020). The Thyroid Hormone Receptor-RUNX2 Axis:
A Novel Tumor Suppressive Pathway in Breast Cancer. Hormones and Cancer. 11(1),
34-41.
AND
Material from this dissertation has been submitted for publication to Molecular Cancer
Research (March 26, 2020) in the following form:
Bolf, E.L., Gillis N.E., Davidson C.D., Rodriguez P.D., Cozzens L., Tomczak J.A.,
Frietze S., Carr F.E., Thyroid Hormone Receptor Beta Induces a Tumor Suppressive
Program in Anaplastic Thyroid Cancer. Molecular Cancer Research.
iii
ACKNOWLEDGEMENTS
I’d like to start this section with those who have helped me reach graduate school.
I’d be amiss to not start with my parents, Linda and Lewis Bolf, who each instilled a set
of values in me that drove me to pursue higher education and not quit when life is hard.
As a teacher by profession, my mother always encouraged me to learn, ensuring that I
was able to take advantage of the opportunities available to me. My father taught me the
value of hard work, and I like to think that some of his stubbornness rubbed off onto me,
stubbornness that has ensured I stuck with my scientific pursuits, especially when it was
difficult to see a way forward.
I also want to thank my wife, Sanja Raejour, for supporting my desire for further
education, even though it required us to move halfway across the country. She has been a
source of stability during my time in Vermont, a sympathetic ear, and has been more than
willing to help in whatever way she could. I’m grateful for her assisting in the more
artistic ways to my pursuits, including taking a sketch and turning it into a proper figure
for a pilot grant that the lab was ultimately awarded, and which has helped to fund my
research.
Of course, I wouldn’t have the success here at UVM without the continuous help
of my advisor. I have been lucky to have the privilege of working for Dr. Frances Carr,
who encouraged my ideas and allowed my interests to take the lab in a different direction.
She repeatedly places her students first and has been a strong advocate for me.
The members of my committee have also been stellar. My chair, Dr. Karen Glass,
has done a great job of being the impartial voice during meetings. She’s also given
iv
incredibly helpful advice on the necessity of focus when pursuing scientific research. Dr.
Jane Lian has been a great collaborator and helped shape the direction my dissertation
took. She is the one who encouraged me to write my first review and also advocated for
me to pursuing sequencing experiments. Dr. Lian has also been a gracious pre-
submission reviewer, taking time out of her busy days to not only edit manuscripts and
grants, but also to sit down and discuss how to improve the work. I also want to
emphasize how helpful Dr. Karen Lounsbury has been. She always strove to make my
work better. Her kindly-delivered critiques have helped to strengthen the weakest parts of
my writing and research, and ultimately the science I’ve performed.
Lastly, I need to thank the people who I’ve worked with at the bench for many
years. This includes our long-time technician, Jennifer (Jenny) Tomczak, Dr. Carr’s
current graduate students, Cole Davidson and Noelle Gillis, and her former graduate
student, Thomas (Thommy) Taber. Jenny has been a ray of sunshine in even the hardest
moments of graduate school, she is a voice of encouragement and was more than willing
to share her expertise with me when I was first starting out. Cole, Noelle, and Thommy
have been great colleagues and peers to work with. Graduate school can be a lonely
experience, but not with these three. We shared our frustrations with each other, and
celebrated successes. I’m lucky to have been a part of such a great team.
v
TABLE OF CONTENTS
Page
CITATIONS ................................................................................................................ ii
ACKNOWLEDGEMENTS ........................................................................................ iii
LIST OF TABLES ..................................................................................................... ix
LIST OF FIGURES ......................................................................................................x
CHAPTER 1: COMPREHENSIVE LITERATURE REVIEW ......................................1
1.1. Thyroid Hormone Receptor Signaling .................................................................1
1.1.1. Thyroid Hormone Receptor Regulation of Gene Expression ...........................2
1.1.2. Thyroid Hormone Signaling in Cancer ...........................................................4
1.1.3. Structural Biology of Thyroid Hormone Receptor Beta ..................................9
1.2. Thyroid Cancer ................................................................................................. 11
1.2.1. Differentiated Thyroid Cancer ...................................................................... 12
1.2.2. Dedifferentiated Thyroid Cancer .................................................................. 13
1.3. Breast Cancer.................................................................................................... 15
1.3.1. Luminal Breast Cancer ................................................................................. 17
1.3.2. HER2 Positive Breast Cancer ....................................................................... 19
1.3.3. Basal-like Breast Cancer .............................................................................. 21
1.4. Scope of Dissertation ........................................................................................ 23
References ............................................................................................................... 25
vi
CHAPTER 2: THYROID HORMONE RECEPTOR BETA INDUCES A TUMOR
SUPPRESSIVE PROGRAM IN ANAPLASTIC THYROID CANCER ..................... 50
2.1. Abstract ............................................................................................................ 50
2.2. Introduction ...................................................................................................... 51
2.3. Methods ............................................................................................................ 52
2.4. Results .............................................................................................................. 57
2.4.1. Expression of TRβ inhibits pro-tumorigenic characteristics of human
anaplastic thyroid cells ........................................................................................... 57
2.4.2. TRβ reprograms anaplastic thyroid cancer cell signaling .............................. 59
2.4.3. Liganded TRβ reduces ATC stem cell characteristics ................................... 63
2.4.4. TRβ stimulates apoptotic signaling ............................................................... 66
2.4.5. TRβ promotes anti-proliferative signaling .................................................... 68
2.5. Discussion ........................................................................................................ 70
References ............................................................................................................... 73
CHAPTER 3: THE THYROID HORMONE RECEPTOR-RUNX2 AXIS: A NOVEL
TUMOR SUPPRESSIVE PATHWAY IN BREAST CANCER. ................................. 81
3.1. Abstract ............................................................................................................ 81
3.2. Introduction ...................................................................................................... 82
3.3.Materials and Methods ....................................................................................... 84
3.4. Results .............................................................................................................. 88
3.4.1. TR expression in reduced in aggressive breast cancer ................................... 88
3.4.2. Thyroid hormone repression of RUNX2 is driven by TRβ ............................ 89
3.4.3. TRβ binds to the RUNX2 promoter ............................................................... 92
vii
3.5. Discussion ........................................................................................................ 94
References ............................................................................................................... 96
CHAPTER 4: COMMON TUMOR SUPPRESSIVE SIGNALING OF THYROID
HORMONE RECEPTOR BETA IN BREAST AND THYROID CANCER
CELLS. .................................................................................................................... 103
4.1. Abstract .......................................................................................................... 103
4.2. Introduction .................................................................................................... 104
4.3. Methods .......................................................................................................... 105
4.4. Results ............................................................................................................ 107
4.5. Discussion ...................................................................................................... 115
References ............................................................................................................. 116
CHAPTER 5: A LINKAGE BETWEEN THYROID AND BREAST CANCER: A
COMMON ETIOLOGY? ......................................................................................... 123
5.1. Abstract .......................................................................................................... 123
5.2. Introduction .................................................................................................... 123
5.3. What is the Epidemiological Evidence of the Relationship Between Breast and
Thyroid Cancer? .................................................................................................... 125
5.4. What Genetic Factors Link the Diseases? ........................................................ 128
5.5. What is the Impact of Cancer Treatment on Future Risk? ................................ 130
5.6. Are Thyroid Disease and Disruptions of Thyroid Hormone Signaling Risk
Factors? ................................................................................................................. 132
viii
5.7. Does Hormonal Disruption alter Metachronous Cancer Susceptibility? ........... 133
5.8. Are Lifestyle Related Environmental Factors Common Between Breast and
Thyroid Cancer? .................................................................................................... 136
5.9. Concluding Remarks ....................................................................................... 137
References ............................................................................................................. 139
CHAPTER 6: DISCUSSION AND CONCLUDING REMARKS. ............................ 154
6.1. Summary ........................................................................................................ 154
6.2. Implications .................................................................................................... 155
6.3. Future Directions ............................................................................................ 157
6.4. Concluding Remarks ....................................................................................... 158
References ............................................................................................................. 158
COMPREHENSIVE BIBLIOGRAPHY ................................................................... 161
APPENDIX A: Supplemental Materials for Chapter 2 .............................................. 188
APPENDIX B: Supplemental Materials for Chapter 3 .............................................. 210
APPENDIX C: Supplemental Materials for Chapter 4 .............................................. 214
APPENDIX D: List of Abbreviations ....................................................................... 226
ix
LIST OF TABLES
Table Page
Table 1: Summary of Studies linking Breast and Thyroid Cancer Incidence. ............. 126
x
LIST OF FIGURES
Figure Page
Figure 1: The Thyroid Hormone Modulated Pathways MAPK and PI3K are Drivers
of Tumorigenesis .........................................................................................................6
Figure 2: Functional Domains of TRβ ..........................................................................9
Figure 3: Breast Cancer Subtypes Vary in Prevalence and Prognosis. ......................... 17
Figure 4: HER2 stimulates PKC, MAPK, and PI3K pathways .................................... 20
Figure 5: TRβ Repressed Growth of SW1736 ............................................................ 58
Figure 6: TRβ-T3 Altered the Transcriptome of ATC Cells ......................................... 60
Figure 7: TRβ Reduced Stem Cell Characteristics in ATC Cells. ................................ 65
Figure 8: Re-expression of TRβ Increased Apoptotic Signaling. ................................. 68
Figure 9: The Interferon-JAK1-STAT1 Pathway is Activated by TRβ. ....................... 69
Figure 10: TRβ Activates Alternate Apoptotic Pathway. ............................................. 70
Figure 11: Baseline expression of thyroid hormone receptors and RUNX2 in breast
cells. ........................................................................................................................... 89
Figure 12: RUNX2 expression is reduced by Thyroid Hormone Treatment. ................ 90
Figure 13: TRβ, and not TRα, Represses RUNX2 ....................................................... 91
xi
Figure 14: Knockdown of THRB in MCF10A enhances RUNX2 and RUNX2
activity. ...................................................................................................................... 92
Figure 15: TRβ Binds to the RUNX2 Promoter........................................................... 93
Figure 16: Thyroid Hormone Receptor Beta Alters Genes that Determine Breast
Intrinsic Subtype....................................................................................................... 108
Figure 17: Expression of Thyroid Hormone Receptor Beta Induced Alterations to
the Transcriptome and Signaling Networks ............................................................... 110
Figure 18: Chromatin Immunoprecipitation Enrichment Analysis Reveals Putative
Secondary Regulators ............................................................................................... 111
Figure 19: Thyroid Hormone Receptor Beta Represses Invasive Pathways. .............. 113
Figure 20: A Subset of Genes are Regulated by TRβ in Breast and Thyroid Cancer
Cells ......................................................................................................................... 114
Figure 21: Thyroid Cancer and Breast Cancer Incidence are Positively Correlated
among Vermont Counties ......................................................................................... 135
Figure 22: Summary of Possible Etiological Factors in the Thyroid and Breast Cancer
Link .......................................................................................................................... 138
1
CHAPTER 1: Comprehensive Literature Review
1.1. Thyroid Hormone Receptor Signaling
The human genome encodes for two nuclear thyroid hormone receptors (TR),
which are member of the nuclear hormone receptor (NR) superfamily of genes. TRs are
encoded by the genes THRA, which produces the protein TRα, and THRB, which codes
for TRβ. TRs serve as receptors to the hormones produced by the thyroid gland,
thyroxine (T4) and triiodothyronine (T3). Both proteins exhibit greater binding affinity to
T3 over T4. As a result, T4 functions as a pro-hormone for TRs. Although the thyroid does
produce some T3, most T3 is the result of deiodinases cleaving the 5’ iodine atom from T4
in peripheral tissues (1). Nuclear TRs are ubiquitously expressed throughout the body,
however different tissues exhibit different concentrations of each TR. Expression of TRα
is greater in muscle and fat tissue, whereas TRβ is the predominate TR expressed in the
brain and liver (1). TRs, unlike steroid NRs, are predominately nuclear even in the
absence of endogenous ligand. As a consequence, TRs are able to exert transcriptional
effects in the presence and the absence of ligand. Additionally, the integrin αvβ3 is
preferentially responsive to T4, rendering the pro-hormone status of T4 dependent upon
the context of the signaling that occurs within a given cellular system (2). As a cell
membrane bound receptor, αvβ3 triggers a kinase cascade, primarily through stimulation
of the mitogen activated protein kinase (MAPK) pathway (3).
The different modes of signaling from thyroid hormones have recently been
codified based upon broad mechanisms of action (4). Type 1 signaling reflects the
canonical model of thyroid hormone action, transcriptional regulation. In this model,
2
nuclear TRs bind to chromatin directly, either as a monomer, a homodimer, or a
heterodimer, and recruit protein complexes to alter transcription of a gene. Type 2
signaling is where TRs bind to other DNA-bound proteins to modulate their activity. This
mechanism has been demonstrated to occur with AP1 where TRs blocks AP1 signaling
(5-7). Type 3 signaling is the last to occur with nuclear TRs, however the mechanism is
entirely non-genomic. TR binds to a cytoplasmic protein in order to regulation signaling.
An example of this is that both TRα and TRβ are able to bind to the phosphoinositide 3-
kinase (PI3K) complex in the cytoplasm in order to alter downstream AKT
phosphorylation (8). Lastly, type 4 thyroid hormone signaling is through receptors other
than nuclear TRs. This is primarily through the αvβ3 integrin.
1.1.1. Thyroid Hormone Receptor Regulation of Gene Expression
The primary method by which TRs act in a cell is through type 1 signaling. The
canonical model by which TRs exert regulatory effects is through cofactor switching (1).
In the absence of hormone, TR is bound to DNA at a thyroid hormone response element
(TRE) and recruits proteins that repress gene expression. The census element upon which
TRs bind is AGGTCA, which forms a half-site. A full TRE contains two direct binding
sites, typically separated by 0, 4, or 6 nucleotides (9). These binding sets may be direct
repeats, palindromic, or inverted palindromes. Depending upon the nature of the TRE,
TR may bind to a single half site, as a dimer to two consensus elements, or as a
heterodimer with another transcription factor, most commonly retinoid x receptor (RXR).
Notable co-repressors of gene expression are nuclear receptor co-repressor (NCOR) and
silencing mediator for retinoid or thyroid-hormone receptors (SMRT) (10,11). These co-
repressors aid in the further recruitment of histone methyltransferases (12) and histone
3
deacetylases (13), which leads to the modification of chromatin in order to compact DNA
and inhibit the ability of polymerases to synthesize RNA. Upon binding of cognate
ligand, a conformation change in TR occurs and the association between TR and co-
repressor complexes dissociates. Co-activator proteins including nuclear receptor
coactivator 1 (NCOA1), p300, and the vitamin D receptor interacting protein/thyroid
hormone receptor-associated protein (DRIP/TRAP) complex (14,15). Importantly,
NCOA1 and p300 have each been shown to exert histone acetyltransferase (HAT)
activity, thereby modifying chromatin to induce an open structure and promote gene
transcription (15). Although, the DRIP/TRAP complex does not demonstrate HAT
activity and does not require histones to be present to promote transcriptional activity,
demonstrating that varied mechanisms of gene induction are utilized on TREs (16).
In addition to positively inducing the expression of genes, a minority of TREs
are responsible for repressing gene expression in the presence of T3. These negative
TREs are not as well characterized as positive TREs, although many of the same co-
regulatory proteins are involved. In the absence of hormone, TRs can stimulate
expression of a gene regulated by a negative TRE while the addition of T3 drives gene
repression (17). This hormone-null stimulation is blocked in a mutant TR which cannot
interact with co-repressor proteins NCOR and SMRT (18). Additionally, T3 treatment
initiated the dissociation of NCOR and SMRT from a negative TRE, however there was
no accumulation of coactivator proteins (19). These results suggest that corepressor
proteins act in a stimulatory manner in the context of a negative TRE, although the
molecular mechanism is not yet understood.
4
Cistrome wide data of TRβ binding demonstrates the inadequacy of the
canonical type 1 model. A key concept of this model is that, on absence of cognate
ligand, TRs bind to TREs and that addition of T3 is not required to initiate a protein-DNA
interaction. However, chromatin immunoprecipitation (ChIP)-sequencing of TRβ in
mouse liver shows that there is minimal overlap between peaks in hypothyroid and
hyperthyroid animals (20). This is contrary to the canonical model discussed above where
TRs bind to TREs independent of hormonal control. Additionally, evidence from
glucocorticoid receptor (GR), another member of the NR superfamily, show that
interaction between a NR and chromatin are transient (21). Residence times on the
chromatin for GR varied significantly, depending upon the response element, ranging
from 0.2 to 47 seconds. If TRs act in a similar fashion it would mean that the current
model is insufficient to explain how unliganded TRs repress the expression of positive
TREs.
1.1.2. Thyroid Hormone Signaling in Cancer
Thyroid hormones have been investigated in tumor biology since the 19th
century when thyroid extract was used in conjunction with an ovariectomy for
management of surgically unresectable breast cancer (22). Due to there being three
receptors that respond to thyroid hormones in the body, it has been difficult to determine
whether thyroid hormone activity is of a net positive or negative with regard to cancer
risk. There is epidemiological evidence of a pro-oncogenic role of high levels of thyroid
hormones (23) as well as evidence of hypothyroidism protecting against breast cancer
(24). However, the type of tissue matters as hypothyroidism is deleterious in
hepatocellular carcinoma (HCC), where low levels of thyroid hormones are associated
5
with increased risk of HCC (25,26). Importantly, hypothyroidism is associated with
reduced survival following liver transplantation for HCC patients (27). There is also
evidence that hypothyroidism impairs the efficacy of tyrosine kinase inhibitors in cancer
patients (28). Additionally, patients treated with T3 after being rendered hypothyroid
showed improved outcomes in a small, multicancer clinical study (29). These data are
consistent with the different thyroid hormone receptors playing different roles in tumor
biology and further demonstrate the anti-tumor potential of T3 signaling while
highlighting how T4-mediated pathways can promote oncogenesis.
As mentioned previously, the T4 responsive αvβ3 integrin exerts activity through
stimulation of the MAPK pathway. The MAPK pathway is well-characterized to be pro-
tumorigenic and drives the survival of a multitude of types of cancers (Figure 1). Briefly,
following stimulation of a receptor tyrosine kinase (RTK) and subsequent
autophosphorylation the phosphotyrosine residues serve as a docking site for a scaffold
complex. Through this complex a Ras protein is activated by replacement of bound
guanidine diphosphate (GDP) with guanidine triphosphate (GTP). This allows for
binding, and subsequent activation, of a rapidly accelerated fibrosarcoma (RAF) family
protein. In turn, RAF phosphorylates MEK, which activates ERK (also known as MAPK)
by phosphorylation (30). ERK acts upon an array of proteins to promote pro-tumorigenic
signaling to induce unchecked cell proliferation and evade apoptosis. As a result of
MAPK stimulation, The T4-αvβ3 axis promotes tumor cell proliferation and anti-
apoptotic activity (31). Additionally, αvβ3 is a driver of migration and invasiveness in
cancer cell lines (32,33). This activity can result in pro-tumorigenic signaling from T4
when expression of αvβ3 is high.
6
Figure 1: The Thyroid Hormone Modulated Pathways MAPK and PI3K are Drivers of
Tumorigenesis
The nuclear TRs also have a role in tumor biology. The viral oncogene v-erbA is
homologous to TRα (34,35). In chicken embryonic fibroblasts, v-erbA induced
anchorage-independent growth and tumor formation (36). This viral gene lacks functional
hormone receptor binding, and so can act antagonistically to endogenous thyroid
hormone signaling ((37). However, it has also been demonstrated that the majority of
genes regulated by v-erbA are not regulated by TRα, suggesting that the competition
model is incomplete (38). TRα itself has a putative oncogenic role. High levels of TRα
expressed in intestinal tissue increase tumor formation (39). This is likely due to the
known proliferative role of TRα in the colon, primarily through stimulation of the WNT
pathway effector β-catenin (40). TRα is also a putative oncogene in breast tissue; high
levels of the ligand-responsive splice variant TRα1 are associated with reduced survival
odds in breast tumors (41). Additionally, high levels of TRα is linked with worse
outcomes in patients diagnosed with BRCA-associated breast cancer (42). This is in
7
contrast to TRβ, which was reported to have a protective role in the same study (42).
Heightened TRβ expression has also been demonstrated to increase survival odds in
triple-negative breast cancer (43). Some of the protective role of TRβ expression may be
a result of sensitizing tumor cells to chemotherapeutic agents (43).
There are a multitude of studies which highlight the functional significance of
TRβ in tumor biology. Some of the earliest evidence demonstrating that TRβ could have
a tumor suppressing function was the observation that TRβ was frequently mutated in
hepatocellular carcinoma (44) and PTC (45). The tumor suppressive functionality of TRβ
was validated with the discovery that a N-terminal mutation which causes resistance to
thyroid hormone (designated TRβ-PV) can spur the development of FTC in mice (46,47).
When homozygous TRβ-PV mice were crosses with Pten+/- mice, the resulting
THRBPV/PV Pten+/- animals developed more aggressive thyroid cancer, including tumors
with increased anaplasia and metastasis (48). WT TRβ abrogates the tumorigenicity of
FTC cells, as demonstrated by xenograft experiments (49). Further investigation of TRβ
in cancer models showed that overexpression can inhibit the progression of
hepatocellular carcinoma and both luminal and basal breast cancers (50,51). Additionally,
in a breast cancer xenograft, TRβ-PV fails to inhibit tumorigenesis (52).
The cancer studies on TRβ have revealed important anti-tumorigenic signaling.
TRβ-PV exhibits strong binding to the PI3K complex, specifically to the regulatory p85α
subunit in a classic type 3 mechanism (53,54). In the class model of the PI3K pathway
(Figure 1), PI3K is stimulated by an RTK to promote cell growth. PI3K catalyzes the
production of phosphatidylinositol (3,4,5)-trisphosphate (PIP3) from phosphatidylinositol
4,5-bisphosphate (PIP2). PIP3 serves as a docking site for the enzymes 3-
8
phosphoinositide dependent protein kinase-1 (PDK1) and mammalian target of
rapamycin complex 2 (mTORC2). Both PDK1 and mTORC2 phosphorylate the kinase
AKT, also known in the literature as protein kinase B, on threonine 308 and serine 473,
respectively, in order to induce the activity of AKT (55-57). Once activated, AKT
phosphorylates a variety of proteins to promote cell growth, migration, and suppress
apoptosis. TRβ and T3 act to increase PI3K activity in non-cancerous models (58,59),
however in tumor studies WT TRβ consistently reduces AKT phosphorylation,
demonstrating a role in abrogating this pro-tumorigenic pathway (49,52,60).
TRβ anti-tumor activity has been demonstrated through regulation of other
pathways implicated in tumorigenesis. TRβ reduces expression of the oncogenes β-
Catenin (61,62) and RUNX2 (63) in thyroid cancer. Additionally in thyroid cancer, TRβ
represses NF-κβ signaling (64) and modulates inflammatory processes (64). Studies in
breast cancer models demonstrate that TRβ inhibits pro-tumorigenic signaling from
STAT3 (51), the Ras/MAPK pathway (65), and lowers expression of epithelial to
mesenchymal transition (EMT) markers (50).
In addition to the evidence from epidemiological association studies, the TRβ-
PV mutant, and delineation of anti-oncogenic signaling, it has also been demonstrated
that TRβ prevents tumorigenesis from initiating. Hyperthyroid mice are less likely to
develop liver tumors than euthyroid animals, whereas hypothyroid mice are the most
likely to develop hepatocellular carcinoma (66). As TRβ is the predominant thyroid
hormone receptor in liver cells, this action is likely through TRβ signaling. Additionally,
knockout of TRs in mice drive the development of thyroid tumors (67). Collectively,
these data show that TRβ is a potent tumor suppressor of multiple types of solid tumors
9
and further investigation into the molecular activity of TRβ is merited.
1.1.3. Structural Biology of Thyroid Hormone Receptor Beta
The structural features of TRβ drive the molecular role of the protein. TRβ is
comprised of four domains. These are the N-terminal A/B transactivation domain, the
DNA-binding domain (DBD), a hinge domain, and a C-terminal ligand-binding domain
(LBD) (Figure 2) (68). Although not required for binding to DNA ,the A/B domain is
essential for induction of transcriptional activity (69). The LBD is comprised of 12 alpha
helices that, in addition to stabilizing the interaction between receptor and T3, act as
interaction sites for dimerization, co-activators, and co-repressors (70). Additionally, TRβ
contains a nuclear localization signal (NLS) within the hinge domain starting at amino
acid 184 and nuclear export signals (NES) are present in the ligand binding domain of
TRβ (71) (Figure 1). Most NRs are predominately cytoplasmic until binding to ligand,
however, TRs are unique in that they are constrictively nuclear, which does allow for
ligand-independent transcriptional regulation (72).
Figure 2: Functional Domains of TRβ.
Like many proteins within the body, TRβ is a phosphoprotein. Phosphorylation of
TRβ has been shown to enhance transcriptional activity (73). Additionally, kinase
inhibitors can block T3 induced transcription of lipogenic enzymes (74). Inhibition of
serine/threonine kinases have also been shown to reduce the stability of TRβ as well as
reduce the level of THRB mRNA expressed in cells and dimerization with retinoid x
10
receptor (75,76). Additionally, T3 appears to be able a key signal to induce
serine/threonine phosphorylation of TRβ (77). Identified sites of phosphorylation are
T134 and S142 in the DBD and Y406 in the LBD (78-80). T134 is phosphorylated by
protein kinase C and has a role in protein localization, keeping the receptor in the
cytoplasm. Phosphorylation of S142 is trigged by the MAPK pathway and disrupts
interactions between TRβ and SMRT. Src phosphorylates TRβ on the residue Y406 and
phospho-ablative mutants of TRβ are unable to suppress xenograft tumor growth (80,81).
Additional putative phosphorylation of DBD residues Y147 and Y171 was observed in
the hippocampus, and although mutation of the residues blocked TRβ driven induction of
the PI3K pathway direct phosphorylation of Y147 and Y171 was not empirically
confirmed when TRβ was subjected to mass spectroscopy (59).
Other post-translational modifications to TRβ has also been demonstrated to be
important in regulating TRβ activity. Ubiquitin in a small protein that is linked to lysine
residues by a ligase; polyubiquitination serves as a signal for proteasomal degradation.
This process serves to rapidly degrade TRs upon T3 binding, thereby modulating the
transcriptional activity of TR (82). Interestingly, inhibition of ubiquitin-mediated
degradation reduced the transcriptional activity of TRβ in vitro (82). This phenomenon is
similar to what has been observed in estrogen receptor (ER) α and progesterone receptor
(PR) and may be a common feature in the regulation of NRs (83). TRβ is also regulated
by SUMOylation, that is, the addition of small ubiquitin-like modifier (SUMO) to a
lysine residue. SUMOylation enhances the transcriptional activity of TRβ on both
positive and negative TREs and alters affinity for co-regulator interactions (84). These
11
modifications add an additional layer of nuance to regulation of gene expression by TRβ
beyond activation by ligand binding.
1.2. Thyroid Cancer
Thyroid cancer is the most commonly diagnosed cancer in the United States.
Incidence of the disease is increasing rapidly and has been for multiple decades (85).
Thyroid cancer is projected to be the 4th most commonly diagnosed cancer in the
United States by 2030 (86), although in the last few years the increase in thyroid cancer
incidence has started to stabilize (87). This stabilization may be due, in part, to
reclassification of the thyroid cancer subtype “noninvasive encapsulated follicular
variant of papillary thyroid cancer” to “noninvasive follicular thyroid neoplasm with
papillary-like nuclear features” (88). This variant has been estimated to make up
approximately 9% of papillary thyroid cancer diagnoses (89). Regardless, the increase
in incidence is unlikely to be simply the result of improvements in diagnostics due to
the increase in incidence of both relatively benign and more aggressive cancers (90).
The majority of thyroid tumors develop from the epithelial follicular cells,
which are responsible for production of thyroid hormones T4 and T3. This includes the
major subtypes of papillary (PTC), follicular (FTC), poorly differentiated (PDTC), and
anaplastic thyroid cancer (ATC) (91). PTC and FTC are differentiated tumors with
overall positive prognosis, whereas PDTC and ATC are dedifferentiated tumors with
poor prognosis. These subtypes of thyroid cancer are distinguished by differences in
their morphology and genetic drivers. Additionally, different subtypes of thyroid cancer
vary in their prognoses and treatment options.
12
1.2.1. Differentiated Thyroid Cancer
The primary subtypes of differentiated thyroid cancer are PTC and FTC. Over
80% of thyroid cancers are diagnosed as PTC and approximately 10% are FTC (92). Both
subtypes typically exhibit an overall good prognosis, although FTC is the more
aggressive of the two. The primary cytopathological difference is FTC nodules are
typically encapsulated by fibrous connective tissues and PTC is unencapsulated (93).
Additionally, FTC typically presents with larger tumors at time of diagnosis.
The genetic alterations and signaling pathways that induce differentiated thyroid
cancers are well-established. Mutations to the BRAF gene are common, 45% of PTC
cases exhibit the constitutively active BRAFV600E variant (94). The other primary
molecular subtype of PTC are Ras-like carcinomas (95). BRAF and Ras proteins are
effectors within the mitogen activated MAPK pathway (Figure 1), which promotes cell
growth. Increased MAPK signaling is the primary molecular alteration driving PTC
development and malignancy (91). Mutations to RAF proteins and effectors of the
MAPK pathway are common in an array of cancers and inhibitors of the pathway have
demonstrable utility in treating tumors, including thyroid tumors (96). Mutation of the
RAF gene BRAF is predictive of a worse prognosis in thyroid cancer patients (97).
Additionally, ~5% of PTCs have been reported to harbor mutations to EGFR, an
upstream RTK and itself a recognized oncogene (98). The second major driver of thyroid
cancer is the phosphoinositide 3-kinase (PI3K) pathway (Figure 1). Mutations to the
PI3K pathway are common in FTC, which includes mutations to the catalytic subunit of
PI3K, PIK3CA, and mutations or deletions to the phosphatase PTEN (91), which reverses
PI3K driven phosphorylation of PIP2. The PI3K pathway is recognized to be the primary
13
molecular pathway driving FTC malignancy (91).
Differentiated thyroid cancer is treated primarily through surgery and
radioactive iodide (RAI) treatment (99). Depending upon overall risk of the lesion,
surgical options include partial or a complete thyroidectomy. RAI is the first example
of precision medicine applied to cancer, with reports dating back to the 1940s (100).
RAI is effective and selective because thyroid glands express a sodium-iodide
symporter (NIS), unlike most other cells in the body, due to the necessity of iodine for
the synthesis of thyroid hormones. This allows for systemic RAI to preferentially target
the cancerous thyroid tissue if the tumor robustly expresses NIS and if the cells retain
iodide. Without NIS activity, the iodide anion cannot cross through the cell membrane
and, as a result, these cells are not subjected to radiotoxicity. However, during the
process of tumorigenesis resistance to RAI can develop through loss of NIS expression
and activity. The MAPK pathway has been implicated in this process as inhibition of
the MAPK effector MEK1 increases expression of NIS and restores the ability of a
thyroid tumor cell to retain iodide (101). In clinical trials MEK1 inhibition restored NIS
functionality sufficiently to allow formerly RAI retractive patients to be successfully
treated with RAI (102,103).
1.2.2. Dedifferentiated Thyroid Cancer
Dedifferentiated thyroid tumors include both PDTC and ATC. These subtypes
of thyroid cancer are rare; PDTC makes up approximately 3% of thyroid tumors (104)
and ATC comprises 1-2% of thyroid tumors (105). Both tumor types are highly
invasive and exhibit low expression of thyroid markers including NIS. ATC is
distinguished from PDTC pathologically by exhibiting greater necrosis, increased
14
heterogeneity of cellular morphology, and atypical nuclei (105). Additionally, ATC is
definitionally a stage IV neoplasm (106). Both of these subtypes of cancer have a worse
prognosis than differentiated thyroid cancers. Five year survival in PDTC is
approximately 60% (107) and less than 15% of ATC patients survive two years after
diagnosis (105).
In recent years, the genetic markers defining these two thyroid cancer subtypes
have been delineated. These alterations provide insights into the molecular drivers of
the most aggressive variants of thyroid cancer. Both dedifferentiated subtypes exhibit
mutations in the MAPK signaling pathway; mutations to BRAF are particularly
prominent being found in a third of PDTC and nearly half of ATC cases (108).
Mutations to TERT are also common in both subtypes, with 40% of PDTC and over
70% of ATC tumors exhibiting a TERT mutation. Almost three quarters of ATC tumors
exhibit mutations to the transcriptional regulator TP53, which is rarely mutated in other
thyroid cancer subtypes (108,109). Additionally, mutations to SWI/SNF components,
PI3K effectors, and histone methyl transferases are more common in ATC than in
PDTC (108). There was also a difference in the thyroid differentiation score (TDS), a
value derived from the expression of 16 genes (95) (now 13 genes (110)) that defines
thyroid cells. These are primarily genes that are necessary for the synthesis of thyroid
hormones. PDTC tumors had a higher TDS than ATC tumors, additionally, Ras-like
PDTC tumors exhibit an even greater TDS (108).
Due to low expression and activity of NIS in dedifferentiated thyroid cancers,
RAI is not an effective treatment option. Conventional treatment of ATC is largely
palliative, with the goal being to improve quality of life at the expense of life extension
15
(105). Conventional treatments include the use of surgery, beam radiotherapy, and
broad-spectrum chemotherapy. Inhibitors of both MAPK and PI3K signaling are
actively being investigated for use in advanced thyroid cancers, including PDTC and
ATC (111). In 2018, the FDA approved a combinational therapy of a BRAF and MEK
inhibitor for ATC, with a response rate of over 60% in trials (112). In one trial, 80% of
patients with BRAF mutant ATC were alive after 12 months (113). Immunotherapies
have also shown promise, with antibodies against PD-1 exhibiting a 20% response rate
(112).
As in treatment resistant differentiated thyroid cancer, there is an interest in
inducing expression of NIS in dedifferentiated thyroid tumors. Transfection of wild
type p53 into cultured ATC cells restored NIS expression and rendered the cells
sensitive to RAI (114). PI3K inhibition also increased NIS expression in ATC stem
cells (115). An inverse agonist to estrogen-related receptor gamma, GSK5182,
increased expression of NIS and other thyroid markers (116). In ATC xenografts
GSK5182 also restored sensitive to RAI, where co-treatment with the GSK5182 and
131I reduced tumor burden (116).
1.3. Breast Cancer
Breast cancer is the most common cancer diagnosed in women in the United
States with over 250,000 cases per year (87). Additionally, breast cancer is the second
leading cause of cancer mortality in American women (87). Globally, breast cancer is
the most common cancer in women and also responsible for the greatest number of
cancer deaths (117). Breast cancer has also been revealed to be a risk factor for thyroid
16
cancer, similarly a past history of thyroid cancer increases the risk for the development
of a breast malignancy (118).
Clinical classification of breast cancer is primarily based upon the expression of
ERα, PR, and the epidermal growth factor receptor HER2, also known as ERBB2
(119). Expression of ERα and PR are linked to a more differentiated disease whereas
highly aggressive breast cancers exhibit loss of these three receptors. These receptors
are also druggable and are commonly targeted in clinical practice to reduce tumor
burden. Molecular analysis has increased understanding of the differences between
breast tumors resulting in the PAM50 algorithm. A set of 50 genes are now used to
define the intrinsic subtypes of breast cancer and classify breast tumors (120,121).
These subtypes include hormone receptor positive luminal A and luminal B, HER2
positive, normal-breast like, and basal-like breast cancers. In the United States,
Surveillance, Epidemiology, and Endpoints Results classifications includes both
luminal subtypes, HER2 positive, and basal-like subtypes, but not Normal-like.
Luminal A breast cancer is the most commonly diagnosed and HER2 positive is the
rarest (Figure 3) (122). Luminal A exhibits the greatest survival odds, whereas basal-
like breast cancer patients have the worst outcomes (Figure 3) (122).
17
Figure 3: Breast Cancer Subtypes Vary in Prevalence and Prognosis. A) Prevalence of Breast
Cancer Subtypes in the United States of America (2012-2016). B) Relative 5-year Survival of
Breast Cancer Subtypes in the United States of America (2010-2015).
1.3.1. Luminal Breast Cancer
Luminal breast tumors are defined as ERα positive tumors. Luminal subtypes
are distinguished from each other by expression of the proliferation marker Ki-67 and
PR; luminal B breast cancer exhibits either increased Ki-67 or reduced PR whereas
luminal A tumors express comparatively high PR and low Ki-67 (123). Luminal B
tumors may also have increased expression of HER2 (124). Luminal subtypes are less
likely to present with distal metastases, with the least likely being luminal A, consistent
with the observed heightened survival of this subtype (125).
The most prominent genetic feature in luminal breast cancers is the heightened
expression and activity of ERα, however it is not the sole genetic driver of the disease.
Mutations to PIK3CA are relatively common; present in approximately 45% of luminal
A cancers and in approximately 30% of luminal B tumors (126,127). GATA3 is mutated
in approximately 15% of luminal breast cancers and mutually exclusive to PIK3CA
18
alterations. Mutations to MAP3K1 are most prevalent in luminal A, however TP53
mutations are more common in luminal B (126,127).
The primary treatment for luminal breast cancer is surgical intervention with
adjuvant chemotherapy (128). Due to the high expression and activity of ERα in
luminal breast cancers, it is relatively common to treat them with a selective estrogen
receptor modulator (SERM) (128,129). SERMS act on ERα in a tissue selective manner
to reduce estrogenic signaling in the breast while maintaining a degree of estrogenic
function in other body tissues (130). This specificity arises, in part, due to the tissue
specific expression of ERα and ERβ, the dimerization partner for ERα on a response
element, and subtle differences in protein conformation that results from a SERM or
endogenous estrogen binding and resultant co-factor binding (130). This results in an
antagonistic effect in some tissues and an agonistic effect in others. For example, the
prototypical SERM tamoxifen is anti-estrogenic in breast, but pro-estrogenic in uterine
tissue (130). Aromatase inhibitors (AI) are also commonly used as they inhibit the
ability of the enzyme aromatase to synthesize bioactive estrogen (131). AI therapy may
be prescribed separately, or in conjunction with a SERM. Both AIs and SERMs are
used to reduce the odds of recurrence and to control the spread of metastatic nodules.
However, treatment resistance is a relatively common occurrence and limits the utility
of AIs and SERMs. Alterations to multiple pathways can contribute to resistance.
Tamoxifen resistance can arise from upregulation of HER2 and/or PI3K activity (132).
SERM resistance can also arise from a truncated ERα, dubbed ERα-36, which acts
along with HER2 to drive tumor growth (133,134). Mutations to the ligand binding
domain of ERα are associated with AI resistance (135) and have been shown in cell
19
models to be transcriptionally active in absence of cognate ligand (136). These
mechanisms of resistance ultimately limit the utility of anti-estrogen therapies, but also
provide alternate approaches for the treatment of luminal breast tumors.
1.3.2. HER2 Positive Breast Cancer
The HER2 positive subtype of breast cancer is defined by high expression of
HER2 and low expression of the hormone receptors ERα and PR. Increased HER2
expression is associated with an increase in tumor grade (137). A primary or secondary
metastasis occurs within HER2 positive breast cancer approximately 30% of the time,
more often than in any other subtype of breast cancer (125).
HER2 itself is a member of the epidermal growth factor receptor family of
RTKs, however it has no known ligand (138). HER2 can homodimerize and also
heterodimerize with related RTKs, most prominently EGFR and HER3, in order to
initiate a phosphorylation cascade (139). Following dimerization, HER2 stimulates the
previously described PI3K and MAPK pathways. Additionally, HER2 will stimulate
protein kinase c (PKC) though phospholipase c (PLC) (140) (Figure 4). PLC cleaves
PIP2 to release the products diacylglycerol (DAG) and inositol 1,4,5-trisphosphate
(IP3) (141). IP3 is important for calcium release, however DAG directly binds to PKC
in order to stimulate kinase activity. These three pathways are all tumorigenic and
promote proliferation via progression through the cell cycle, increase invasiveness, and
stimulate pro-survival/anti-apoptotic activity (140).
20
Figure 4: HER2 stimulates PKC, MAPK, and PI3K pathways.
In addition to heightened expression of HER2, the HER2 positive subtype of
breast cancer also exhibits significant mutational burdens. Alterations to PI3K effectors
are common, PIK3CA is mutated approximately 40% of the time and PTEN is mutated or
lost in approximately 20% of tumors (126,127). Additionally, TP53 is mutated in 75% of
cases (126,127). HER2 positive breast cancers exhibit a greater overall mutational burden
than other breast cancer subtypes (127).
Similar to luminal breast cancers, the standard of care for HER2 positive breast
cancer is surgery with adjuvant chemotherapy (128). Additionally, the use of a
monoclonal antibody that inhibits HER2 is recommended. The first approved anti-HER2
agent is trastuzumab, which is still the front line therapy for HER2 positive breast cancer
and substantially improved survival for patients (142). Other anti-HER2 agents have
since been developed, including the monoclonal antibody pertuzumab and irreversible
kinase inhibitors afatinib and neratinib (138). Unfortunately, cardiac side effects are
21
relatively common with trastuzumab, as high as 27% in initial studies however that has
been reduced to less than 10% in more recent trials, likely a result of different patients
populations exhibiting varying degrees of sensitivity to these side effects (143). The
HER2 kinase inhibitors exhibit a more favorable cardiac profile than antibody therapy
(143). As with other targeted therapies, resistance to trastuzumab is a problem. A variant
known as p95HER2, which lacks the trastuzumab-binding extracellular domain, is one of
the known mechanisms of resistance (144). Strikingly, this variant does exhibit kinase
activity and stimulates canonical HER2 downstream effectors (145). Loss of PTEN
expression (146) and PIK3CA mutations (147) also inhibit the anti-tumor activity of
trastuzumab.
1.3.3. Basal-like Breast Cancer
Basal-like breast tumors exhibit a triple-negative phenotype, that is, they do not
express ER, PR, or HER2. As a result of this, treatment options are more limited than the
other breast cancer subtypes. Accordingly, outcomes are worse with basal-like breast
cancer exhibiting the lowest 5-year survival rate of the breast cancer subtypes (Figure 3).
In addition, basal-like breast tumors have a high propensity to metastasize, only HER2
positive breast cancer exhibits a greater capacity to develop metastatic lesions (125).
In addition to the defined lack of ER, PR, and HER2, basal-like breast cancer
exhibits a unique and complex molecular signature. TP53 is more likely to be mutated in
basal-like breast cancers than any other breast cancer subtype (126). Additionally, genetic
alterations to the PI3K pathways are common, with mutations to PIK3CA and deletion of
PTEN being relatively common (126). BRCA-associated breast cancers are
disproportionally basal-like (148). The basal-like subtype also has a unique
22
transcriptomic profile, exhibiting increased expression of EGFR and basal cytokeratins
(149).
A further division of basal-like breast cancer can be made based upon the
expression levels of claudins. Claudins are a class of proteins which are responsible for
maintaining the tight junctions between epithelial cells (150). Basal breast tumors that
express low levels of claudins are more mesenchymal than claudin-high breast cancer,
also, claudin-low breast cancer exhibits increased levels of stem-cell markers (151). Both
of these features promote the ability of the tumor cells to survival disaggregation and
colonize a new tumor elsewhere in the body.
Similar to other breast cancers, the standard of care for non-metastatic basal-like
breast cancer is surgical, with supplemental radiation (152). Broad spectrum
chemotherapy is also appropriate for invasive cases and for patients with metastatic
disease. Additionally, combinational approaches are being attempted in order to induce
synthetic lethality. Poly (ADP-Ribose) polymerase (PARP) inhibitors are used to impair
the ability of the cells to repair damaged DNA. PARP inhibitors have been shown in
multiple trials to slow tumor progression, with enhanced efficacy when paired with
another anti-tumor agent (153), and are now approved for use clinically. The RTKs
VEGFR and EGFR are also being actively investigated as potential targets for inhibition
with promising results in clinical trials (154).
BRCA mutations lead to basal-like breast cancer more often than any other
subtype and represent 25% of basal-like tumors (155). Due to BRCA proteins acting to
repair DNA, platinum-based compounds that work by damaging DNA have been
investigated to determine if these cells are more sensitive to this treatment modality. The
23
data so far trends towards BRCA mutant breast cancer being more sensitive to platinum-
based drugs, although recent meta-analysis suggests that the advantage of this therapeutic
approach is relatively minor (156-158).
The androgen receptor (AR) is emerging as another important molecular target
in basal-like breast cancer. Although AR is expressed in luminal breast cancer, there is a
lack of druggable targets in basal-like breast cancer, making it more significant in this
subtype (159). AR functions in a similar function to other nuclear NRs, including ERs. In
the cytoplasm, AR is bound to heat shock proteins (HSP) until a ligand binds, at which
point it translocates into the nucleus. In the nucleus, AR binds to response elements to
recruit a protein complex which regulates transcriptional activity of the gene (159). A
recent phase II trial demonstrated that a subset of breast cancer patients responded
positively to the AR antagonist enzalutamide (160). As the molecular signaling driving
basal-like breast tumors becomes better understood, other new therapeutic strategies are
emerging.
1.4. Scope of Dissertation
TRβ exhibits profound anti-tumorigenic activity in multiple tissue types, most
prominently thyroid and breast. There are effective treatment options for the more
differentiated subtypes of these diseases, however the more aggressive variants present a
challenge. The PI3K-AKT pathway is commonly mutated in both thyroid and breast
tumors, and this is a pathway upon which TRβ has a profound suppressive role. However,
TRβ primarily acts as a transcription factor and the transcriptional activity of TRβ in
cancer cells is not well-delineated, a gap that this dissertation attempts to fill.
24
In chapter 2, the ATC cell line SW1736 to characterize how TRβ alters cellular
pathways and phenotypic characteristics that underly the tumor suppressive response.
This work expands upon the prior study from the Carr lab that detailed the discovery of
the TRβ-RUNX2 pathway (63). In addition to describing how TRβ acts to repress pro-
malignant cellular characteristics, the discovery of novel TRβ-induced re-differentiation
and induction of STAT1 activity are delineated.
Chapter 3 was also the result of expanding on the discovery of the TRβ-RUNX2
pathway in thyroid cancer. In this chapter, the evidence showing this pathway is also
active in breast cells is presented. Additionally, this chapter is a demonstration that the
T3-mediated repression of RUNX2 is a TRβ-specific pathway by highlighting that TRα is
unable to regulate RUNX2 expression.
In chapter 4, TRβ signaling in breast cancer was further investigated by
performing a similar analysis to what is detailed in chapter 2. To determine the effect
TRβ and T3 have on the breast cancer transcriptome, TRβ was overexpressed and RNA-
sequencing was conducted. Novel regulation of genes involved in EMT are described.
Additionally, the differentially expressed genes are compared to the results in thyroid
cancer to reveal common TRβ signaling in thyroid and breast cancer.
Chapter 5 of this dissertation is a further review of the scientific literature, and
the result of serendipitously learning of an epidemiological link between thyroid and
breast cancers. The evidence for the link is discussed as well as putative etiological
factors, including thyroid hormone receptor signaling. This work reframes the results of
the experimental approaches used in prior chapters.
25
This dissertation focuses on the molecular events that the tumor suppressor TRβ
regulates in thyroid and breast cancer. This has revealed novel signaling mechanisms,
potential druggable targets, and demonstrates the importance of cellular identity on the
pathways TRβ regulates.
References
1. Yen PM. Physiological and molecular basis of thyroid hormone action.
Physiological reviews. 2001;81(3):1097-1142.
2. Davis PJ, Davis FB, Mousa SA, Luidens MK, Lin HY. Membrane receptor for
thyroid hormone: physiologic and pharmacologic implications. Annu Rev
Pharmacol Toxicol. 2011;51:99-115.
3. Lin HY, Tang HY, Shih A, Keating T, Cao G, Davis PJ, Davis FB. Thyroid
hormone is a MAPK-dependent growth factor for thyroid cancer cells and is anti-
apoptotic. Steroids. 2007;72(2):180-187.
4. Flamant F, Cheng SY, Hollenberg AN, Moeller LC, Samarut J, Wondisford FE,
Yen PM, Refetoff S. Thyroid Hormone Signaling Pathways: Time for a More
Precise Nomenclature. Endocrinology. 2017;158(7):2052-2057.
5. Desbois C, Aubert D, Legrand C, Pain B, Samarut J. A novel mechanism of
action for v-ErbA: abrogation of the inactivation of transcription factor AP-1 by
retinoic acid and thyroid hormone receptors. Cell. 1991;67(4):731-740.
6. Schmidt ED, Cramer SJ, Offringa R. The thyroid hormone receptor interferes
with transcriptional activation via the AP-1 complex. Biochem Biophys Res
Commun. 1993;192(1):151-160.
26
7. Zhang XK, Wills KN, Husmann M, Hermann T, Pfahl M. Novel pathway for
thyroid hormone receptor action through interaction with jun and fos oncogene
activities. Molecular and cellular biology. 1991;11(12):6016-6025.
8. Hiroi Y, Kim HH, Ying H, Furuya F, Huang Z, Simoncini T, Noma K, Ueki K,
Nguyen NH, Scanlan TS, Moskowitz MA, Cheng SY, Liao JK. Rapid
nongenomic actions of thyroid hormone. Proceedings of the National Academy of
Sciences of the United States of America. 2006;103(38):14104-14109.
9. Cheng SY. Multiple mechanisms for regulation of the transcriptional activity of
thyroid hormone receptors. Rev Endocr Metab Disord. 2000;1(1-2):9-18.
10. Horlein AJ, Naar AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A,
Kamei Y, Soderstrom M, Glass CK, et al. Ligand-independent repression by the
thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature.
1995;377(6548):397-404.
11. Chen JD, Umesono K, Evans RM. SMRT isoforms mediate repression and anti-
repression of nuclear receptor heterodimers. Proceedings of the National
Academy of Sciences of the United States of America. 1996;93(15):7567-7571.
12. Li J, Lin Q, Yoon HG, Huang ZQ, Strahl BD, Allis CD, Wong J. Involvement of
histone methylation and phosphorylation in regulation of transcription by thyroid
hormone receptor. Molecular and cellular biology. 2002;22(16):5688-5697.
13. Ishizuka T, Lazar MA. The N-CoR/histone deacetylase 3 complex is required for
repression by thyroid hormone receptor. Molecular and cellular biology.
2003;23(15):5122-5131.
27
14. Glass CK, Rosenfeld MG. The coregulator exchange in transcriptional functions
of nuclear receptors. Genes Dev. 2000;14(2):121-141.
15. Cheng S-Y, Leonard JL, Davis PJ. Molecular Aspects of Thyroid Hormone
Actions. Endocrine Reviews. 2010;31(2):139-170.
16. Fondell JD, Ge H, Roeder RG. Ligand induction of a transcriptionally active
thyroid hormone receptor coactivator complex. Proceedings of the National
Academy of Sciences of the United States of America. 1996;93(16):8329-8333.
17. Astapova I. Role of co-regulators in metabolic and transcriptional actions of
thyroid hormone. Journal of molecular endocrinology. 2016;56(3):73-97.
18. Tagami T, Madison LD, Nagaya T, Jameson JL. Nuclear receptor corepressors
activate rather than suppress basal transcription of genes that are negatively
regulated by thyroid hormone. Molecular and cellular biology. 1997;17(5):2642-
2648.
19. Wang D, Xia X, Liu Y, Oetting A, Walker RL, Zhu Y, Meltzer P, Cole PA, Shi
Y-B, Yen PM. Negative Regulation of TSHα Target Gene by Thyroid Hormone
Involves Histone Acetylation and Corepressor Complex Dissociation. Molecular
Endocrinology. 2009;23(5):600-609.
20. Grontved L, Waterfall JJ, Kim DW, Baek S, Sung MH, Zhao L, Park JW, Nielsen
R, Walker RL, Zhu YJ, Meltzer PS, Hager GL, Cheng SY. Transcriptional
activation by the thyroid hormone receptor through ligand-dependent receptor
recruitment and chromatin remodelling. Nat Commun. 2015;6:7048.
28
21. Paakinaho V, Presman DM, Ball DA, Johnson TA, Schiltz RL, Levitt P, Mazza
D, Morisaki T, Karpova TS, Hager GL. Single-molecule analysis of steroid
receptor and cofactor action in living cells. Nat Commun. 2017;8:15896.
22. Herman GE. A CASE OF RECURRENT CANCER OF THE BREAST
TREATED BY OÖPHORECTOMY AND THYROID EXTRACT. The Lancet.
1898;151(3902):1612-1613.
23. Shi XZ, Jin X, Xu P, Shen HM. Relationship between breast cancer and levels of
serum thyroid hormones and antibodies: a meta-analysis. Asian Pac J Cancer
Prev. 2014;15(16):6643-6647.
24. Cristofanilli M, Yamamura Y, Kau SW, Bevers T, Strom S, Patangan M, Hsu L,
Krishnamurthy S, Theriault RL, Hortobagyi GN. Thyroid hormone and breast
carcinoma. Primary hypothyroidism is associated with a reduced incidence of
primary breast carcinoma. Cancer. 2005;103(6):1122-1128.
25. Hassan MM, Kaseb A, Li D, Patt YZ, Vauthey JN, Thomas MB, Curley SA, Spitz
MR, Sherman SI, Abdalla EK, Davila M, Lozano RD, Hassan DM, Chan W,
Brown TD, Abbruzzese JL. Association between hypothyroidism and
hepatocellular carcinoma: a case-control study in the United States. Hepatology.
2009;49(5):1563-1570.
26. Reddy A, Dash C, Leerapun A, Mettler TA, Stadheim LM, Lazaridis KN, Roberts
RO, Roberts LR. Hypothyroidism: a possible risk factor for liver cancer in
patients with no known underlying cause of liver disease. Clin Gastroenterol
Hepatol. 2007;5(1):118-123.
29
27. Zhang N, Jin W, Zhou S, Yang JD, Harmsen WS, Giama NH, Wongjarupong N,
Heimbach JK, Watt KD, Malhi H, Therneau TM, Roberts LR. Hypothyroidism is
associated with worse outcomes of hepatocellular carcinoma patients after liver
transplantation. Cancer Med. 2018;7(12):5870-5878.
28. Lechner MG, Vyas CM, Hamnvik OR, Alexander EK, Larsen PR, Choueiri TK,
Angell TE. Hypothyroidism During Tyrosine Kinase Inhibitor Therapy Is
Associated with Longer Survival in Patients with Advanced Nonthyroidal
Cancers. Thyroid : official journal of the American Thyroid Association.
2018;28(4):445-453.
29. Hercbergs A, Johnson RE, Ashur-Fabian O, Garfield DH, Davis PJ. Medically
induced euthyroid hypothyroxinemia may extend survival in compassionate need
cancer patients: an observational study. The oncologist. 2015;20(1):72-76.
30. Samatar AA, Poulikakos PI. Targeting RAS-ERK signalling in cancer: promises
and challenges. Nature reviews Drug discovery. 2014;13(12):928-942.
31. Lin HY, Glinsky GV, Mousa SA, Davis PJ. Thyroid hormone and anti-apoptosis
in tumor cells. Oncotarget. 2015;6(17):14735-14743.
32. Cohen K, Flint N, Shalev S, Erez D, Baharal T, Davis PJ, Hercbergs A, Ellis M,
Ashur-Fabian O. Thyroid hormone regulates adhesion, migration and matrix
metalloproteinase 9 activity via alphavbeta3 integrin in myeloma cells.
Oncotarget. 2014;5(15):6312-6322.
33. Uzair ID, Conte Grand J, Flamini MI, Sanchez AM. Molecular Actions of
Thyroid Hormone on Breast Cancer Cell Migration and Invasion via Cortactin/N-
WASP. Front Endocrinol (Lausanne). 2019;10:139.
30
34. Weinberger C, Thompson CC, Ong ES, Lebo R, Gruol DJ, Evans RM. The c-erb-
A gene encodes a thyroid hormone receptor. Nature. 1986;324(6098):641-646.
35. Sap J, Muñoz A, Damm K, Goldberg Y, Ghysdael J, Leutz A, Beug H,
Vennström B. The c-erb-A protein is a high-affinity receptor for thyroid hormone.
Nature. 1986;324(6098):635-640.
36. Gandrillon O, Jurdic P, Benchaibi M, Xiao JH, Ghysdael J, Samarut J. Expression
of the v-erbA oncogene in chicken embryo fibroblasts stimulates their
proliferation in vitro and enhances tumor growth in vivo. Cell. 1987;49(5):687-
697.
37. Thormeyer D, Baniahmad A. The v-erbA oncogene (review). Int J Mol Med.
1999;4(4):351-358.
38. Bresson C, Keime C, Faure C, Letrillard Y, Barbado M, Sanfilippo S, Benhra N,
Gandrillon O, Gonin-Giraud S. Large-scale analysis by SAGE reveals new
mechanisms of v-erbA oncogene action. BMC Genomics. 2007;8:390.
39. Kress E, Skah S, Sirakov M, Nadjar J, Gadot N, Scoazec JY, Samarut J, Plateroti
M. Cooperation between the thyroid hormone receptor TRalpha1 and the WNT
pathway in the induction of intestinal tumorigenesis. Gastroenterology.
2010;138(5):1863-1874.
40. Plateroti M, Kress E, Mori JI, Samarut J. Thyroid hormone receptor alpha1
directly controls transcription of the beta-catenin gene in intestinal epithelial cells.
Molecular and cellular biology. 2006;26(8):3204-3214.
41. Jerzak KJ, Cockburn J, Pond GR, Pritchard KI, Narod SA, Dhesy-Thind SK,
Bane A. Thyroid hormone receptor alpha in breast cancer: prognostic and
31
therapeutic implications. Breast cancer research and treatment. 2015;149(1):293-
301.
42. Heublein S, Mayr D, Meindl A, Angele M, Gallwas J, Jeschke U, Ditsch N.
Thyroid Hormone Receptors Predict Prognosis in BRCA1 Associated Breast
Cancer in Opposing Ways. PLoS One. 2015;10(6):e0127072.
43. Gu G, Gelsomino L, Covington KR, Beyer AR, Wang J, Rechoum Y, Huffman K,
Carstens R, Ando S, Fuqua SA. Targeting thyroid hormone receptor beta in triple-
negative breast cancer. Breast cancer research and treatment. 2015;150(3):535-
545.
44. Lin KH, Shieh HY, Chen SL, Hsu HC. Expression of mutant thyroid hormone
nuclear receptors in human hepatocellular carcinoma cells. Mol Carcinog.
1999;26(1):53-61.
45. Puzianowska-Kuznicka M, Krystyniak A, Madej A, Cheng S-Y, Nauman J.
Functionally Impaired TR Mutants Are Present in Thyroid Papillary Cancer. The
Journal of Clinical Endocrinology & Metabolism. 2002;87(3):1120-1128.
46. Kato Y, Ying H, Willingham MC, Cheng SY. A tumor suppressor role for thyroid
hormone beta receptor in a mouse model of thyroid carcinogenesis.
Endocrinology. 2004;145(10):4430-4438.
47. Suzuki H, Willingham MC, Cheng SY. Mice with a mutation in the thyroid
hormone receptor beta gene spontaneously develop thyroid carcinoma: a mouse
model of thyroid carcinogenesis. Thyroid : official journal of the American
Thyroid Association. 2002;12(11):963-969.
32
48. Guigon CJ, Zhao L, Willingham MC, Cheng SY. PTEN deficiency accelerates
tumour progression in a mouse model of thyroid cancer. Oncogene.
2009;28(4):509-517.
49. Kim WG, Zhao L, Kim DW, Willingham MC, Cheng SY. Inhibition of
tumorigenesis by the thyroid hormone receptor beta in xenograft models. Thyroid
: official journal of the American Thyroid Association. 2014;24(2):260-269.
50. Martinez-Iglesias O, Garcia-Silva S, Tenbaum SP, Regadera J, Larcher F,
Paramio JM, Vennstrom B, Aranda A. Thyroid hormone receptor beta1 acts as a
potent suppressor of tumor invasiveness and metastasis. Cancer research.
2009;69(2):501-509.
51. Park J, Zhao L, Cheng S. Inhibition of estrogen-dependent tumorigenesis by the
thyroid hormone receptor β in xenograft models. Vol 3. Am J Cancer
Res2013:302-311.
52. Park JW, Zhao L, Willingham M, Cheng S-y. Oncogenic mutations of thyroid
hormone receptor β. Oncotarget. 2015;6(10):8115-8131.
53. Furuya F, Hanover JA, Cheng SY. Activation of phosphatidylinositol 3-kinase
signaling by a mutant thyroid hormone beta receptor. Proceedings of the National
Academy of Sciences of the United States of America. 2006;103(6):1780-1785.
54. Lu C, Zhu X, Willingham MC, Cheng SY. Activation of tumor cell proliferation
by thyroid hormone in a mouse model of follicular thyroid carcinoma. Oncogene.
2012;31(16):2007-2016.
55. Liu P, Cheng H, Roberts TM, Zhao JJ. Targeting the phosphoinositide 3-kinase
pathway in cancer. Nature reviews Drug discovery. 2009;8(8):627-644.
33
56. Alessi DR, James SR, Downes CP, Holmes AB, Gaffney PR, Reese CB, Cohen P.
Characterization of a 3-phosphoinositide-dependent protein kinase which
phosphorylates and activates protein kinase Balpha. Curr Biol. 1997;7(4):261-
269.
57. Hresko RC, Mueckler M. mTOR.RICTOR is the Ser473 kinase for Akt/protein
kinase B in 3T3-L1 adipocytes. J Biol Chem. 2005;280(49):40406-40416.
58. Verga Falzacappa C, Petrucci E, Patriarca V, Michienzi S, Stigliano A, Brunetti
E, Toscano V, Misiti S. Thyroid hormone receptor TRbeta1 mediates Akt
activation by T3 in pancreatic beta cells. Journal of molecular endocrinology.
2007;38(1-2):221-233.
59. Martin NP, Marron Fernandez de Velasco E, Mizuno F, Scappini EL, Gloss B,
Erxleben C, Williams JG, Stapleton HM, Gentile S, Armstrong DL. A rapid
cytoplasmic mechanism for PI3 kinase regulation by the nuclear thyroid hormone
receptor, TRbeta, and genetic evidence for its role in the maturation of mouse
hippocampal synapses in vivo. Endocrinology. 2014;155(9):3713-3724.
60. Kim DW, Zhao L, Hanover J, Willingham M, Cheng SY. Thyroid hormone
receptor beta suppresses SV40-mediated tumorigenesis via novel nongenomic
actions. Am J Cancer Res. 2012;2(5):606-619.
61. Guigon CJ, Zhao L, Lu C, Willingham MC, Cheng SY. Regulation of beta-
catenin by a novel nongenomic action of thyroid hormone beta receptor.
Molecular and cellular biology. 2008;28(14):4598-4608.
34
62. Guigon CJ, Kim DW, Zhu X, Zhao L, Cheng SY. Tumor suppressor action of
liganded thyroid hormone receptor beta by direct repression of beta-catenin gene
expression. Endocrinology. 2010;151(11):5528-5536.
63. Carr FE, Tai PW, Barnum MS, Gillis NE, Evans KG, Taber TH, White JH,
Tomczak JA, Jaworski DM, Zaidi SK, Lian JB, Stein JL, Stein GS. Thyroid
Hormone Receptor-beta (TRbeta) Mediates Runt-Related Transcription Factor 2
(Runx2) Expression in Thyroid Cancer Cells: A Novel Signaling Pathway in
Thyroid Cancer. Endocrinology. 2016;157(8):3278-3292.
64. Park S, Zhu J, Altan-Bonnet G, Cheng SY. Monocyte recruitment and activated
inflammation are associated with thyroid carcinogenesis in a mouse model. Am J
Cancer Res. 2019;9(7):1439-1453.
65. Garcia-Silva S, Aranda A. The thyroid hormone receptor is a suppressor of ras-
mediated transcription, proliferation, and transformation. Molecular and cellular
biology. 2004;24(17):7514-7523.
66. Chi HC, Chen SL, Tsai CY, Chuang WY, Huang YH, Tsai MM, Wu SM, Sun
CP, Yeh CT, Lin KH. Thyroid hormone suppresses hepatocarcinogenesis via
DAPK2 and SQSTM1-dependent selective autophagy. Autophagy.
2016;12(12):2271-2285.
67. Zhu XG, Zhao L, Willingham MC, Cheng SY. Thyroid hormone receptors are
tumor suppressors in a mouse model of metastatic follicular thyroid carcinoma.
Oncogene. 2010;29(13):1909-1919.
68. Anyetei-Anum CS, Roggero VR, Allison LA. Thyroid hormone receptor
localization in target tissues. The Journal of endocrinology. 2018;237(1):R19-r34.
35
69. Wilkinson JR, Towle HC. Identification and characterization of the AF-1
transactivation domain of thyroid hormone receptor beta1. J Biol Chem.
1997;272(38):23824-23832.
70. Apriletti JW, Ribeiro RC, Wagner RL, Feng W, Webb P, Kushner PJ, West BL,
Nilsson S, Scanlan TS, Fletterick RJ, Baxter JD. Molecular and structural biology
of thyroid hormone receptors. Clin Exp Pharmacol Physiol Suppl. 1998;25:S2-11.
71. Mavinakere MS, Powers JM, Subramanian KS, Roggero VR, Allison LA.
Multiple novel signals mediate thyroid hormone receptor nuclear import and
export. J Biol Chem. 2012;287(37):31280-31297.
72. Baniahmad A. Introduction to thyroid hormone receptors. Methods Mol Biol.
2002;202:1-12.
73. Lin KH, Ashizawa K, Cheng SY. Phosphorylation stimulates the transcriptional
activity of the human beta 1 thyroid hormone nuclear receptor. Proceedings of the
National Academy of Sciences of the United States of America. 1992;89(16):7737-
7741.
74. Swierczynski J, Mitchell DA, Reinhold DS, Salati LM, Stapleton SR, Klautky
SA, Struve AE, Goodridge AG. Triiodothyronine-induced accumulations of malic
enzyme, fatty acid synthase, acetyl-coenzyme A carboxylase, and their mRNAs
are blocked by protein kinase inhibitors. Transcription is the affected step. The
Journal of biological chemistry. 1991;266(26):17459-17466.
75. Ting YT, Bhat MK, Wong R, Cheng S. Tissue-specific stabilization of the thyroid
hormone beta1 nuclear receptor by phosphorylation. The Journal of biological
chemistry. 1997;272(7):4129-4134.
36
76. Bhat MK, Ashizawa K, Cheng SY. Phosphorylation enhances the target gene
sequence-dependent dimerization of thyroid hormone receptor with retinoid X
receptor. Proceedings of the National Academy of Sciences of the United States of
America. 1994;91(17):7927-7931.
77. Ting YT, Cheng SY. Hormone-activated phosphorylation of human beta1 thyroid
hormone nuclear receptor. Thyroid : official journal of the American Thyroid
Association. 1997;7(3):463-469.
78. Sun K, Montana V, Chellappa K, Brelivet Y, Moras D, Maeda Y, Parpura V,
Paschal BM, Sladek FM. Phosphorylation of a conserved serine in the
deoxyribonucleic acid binding domain of nuclear receptors alters intracellular
localization. Molecular endocrinology (Baltimore, Md). 2007;21(6):1297-1311.
79. Lin HY, Zhang S, West BL, Tang HY, Passaretti T, Davis FB, Davis PJ.
Identification of the putative MAP kinase docking site in the thyroid hormone
receptor-beta1 DNA-binding domain: functional consequences of mutations at the
docking site. Biochemistry. 2003;42(24):7571-7579.
80. Park JW, Zhao L, Webb P, Cheng S-y. Src-dependent phosphorylation at Y406 on
the thyroid hormone receptor β confers the tumor suppressor activity. Oncotarget.
2014;5(20):10002-10016.
81. Park JW, Zhao L, Willingham MC, Cheng S-y. Loss of tyrosine phosphorylation
at Y406 abrogates the tumor suppressor functions of the thyroid hormone receptor
β. Molecular Carcinogenesis. 2017;56(2):489-498.
82. Dace A, Zhao L, Park KS, Furuno T, Takamura N, Nakanishi M, West BL,
Hanover JA, Cheng S. Hormone binding induces rapid proteasome-mediated
37
degradation of thyroid hormone receptors. Proceedings of the National Academy
of Sciences of the United States of America. 2000;97(16):8985-8990.
83. Xin QL, Qiu JT, Cui S, Xia GL, Wang HB. Transcriptional activation of nuclear
estrogen receptor and progesterone receptor and its regulation. Sheng Li Xue Bao.
2016;68(4):435-454.
84. Liu YY, Kogai T, Schultz JJ, Mody K, Brent GA. Thyroid hormone receptor
isoform-specific modification by small ubiquitin-like modifier (SUMO)
modulates thyroid hormone-dependent gene regulation. J Biol Chem.
2012;287(43):36499-36508.
85. Davies L, Welch HG. Current thyroid cancer trends in the United States. JAMA
otolaryngology-- head & neck surgery. 2014;140(4):317-322.
86. Rahib L, Smith BD, Aizenberg R, Rosenzweig AB, Fleshman JM, Matrisian LM.
Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid,
liver, and pancreas cancers in the United States. Cancer research.
2014;74(11):2913-2921.
87. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2018. CA: a cancer journal for
clinicians. 2018;68(1):7-30.
88. Baloch ZW, Harrell RM, Brett EM, Randolph G, Garber JR. AMERICAN
ASSOCIATION OF CLINICAL ENDOCRINOLOGISTS AND AMERICAN
COLLEGE OF ENDOCRINOLOGY DISEASE STATE COMMENTARY:
MANAGING THYROID TUMORS DIAGNOSED AS NONINVASIVE
FOLLICULAR THYROID NEOPLASM WITH PAPILLARY-LIKE NUCLEAR
FEATURES. Endocrine practice : official journal of the American College of
38
Endocrinology and the American Association of Clinical Endocrinologists.
2017;23(9):1150-1155.
89. Bychkov A, Jung CK, Liu Z, Kakudo K. Noninvasive Follicular Thyroid
Neoplasm with Papillary-Like Nuclear Features in Asian Practice: Perspectives
for Surgical Pathology and Cytopathology. Endocrine pathology. 2018;29(3):276-
288.
90. Kilfoy BA, Zheng T, Holford TR, Han X, Ward MH, Sjodin A, Zhang Y, Bai Y,
Zhu C, Guo GL, Rothman N, Zhang Y. International patterns and trends in
thyroid cancer incidence, 1973-2002. Cancer Causes Control. 2009;20(5):525-
531.
91. Xing M. Molecular pathogenesis and mechanisms of thyroid cancer. Nat Rev
Cancer. 2013;13(3):184-199.
92. Lim H, Devesa SS, Sosa JA, Check D, Kitahara CM. Trends in thyroid cancer
incidence and mortality in the united states, 1974-2013. JAMA.
2017;317(13):1338-1348.
93. Dralle H, Machens A, Basa J, Fatourechi V, Franceschi S, Hay ID, Nikiforov YE,
Pacini F, Pasieka JL, Sherman SI. Follicular cell-derived thyroid cancer. Nature
reviews Disease primers. 2015;1:15077.
94. Xing M. BRAF mutation in thyroid cancer. Endocrine-related cancer.
2005;12(2):245-262.
95. Cancer Genome Atlas Research N. Integrated genomic characterization of
papillary thyroid carcinoma. Cell. 2014;159(3):676-690.
39
96. Li DD, Zhang YF, Xu HX, Zhang XP. The role of BRAF in the pathogenesis of
thyroid carcinoma. Frontiers in bioscience (Landmark edition). 2015;20:1068-
1078.
97. Xing M, Westra WH, Tufano RP, Cohen Y, Rosenbaum E, Rhoden KJ, Carson
KA, Vasko V, Larin A, Tallini G, Tolaney S, Holt EH, Hui P, Umbricht CB,
Basaria S, Ewertz M, Tufaro AP, Califano JA, Ringel MD, Zeiger MA, Sidransky
D, Ladenson PW. BRAF mutation predicts a poorer clinical prognosis for
papillary thyroid cancer. The Journal of clinical endocrinology and metabolism.
2005;90(12):6373-6379.
98. Murugan AK, Dong J, Xie J, Xing M. Uncommon GNAQ, MMP8, AKT3, EGFR,
and PIK3R1 mutations in thyroid cancers. Endocrine pathology. 2011;22(2):97-
102.
99. Haugen BR, Alexander EK, Bible KC, Doherty GM, Mandel SJ, Nikiforov YE,
Pacini F, Randolph GW, Sawka AM, Schlumberger M, Schuff KG, Sherman SI,
Sosa JA, Steward DL, Tuttle RM, Wartofsky L. 2015 American Thyroid
Association Management Guidelines for Adult Patients with Thyroid Nodules and
Differentiated Thyroid Cancer: The American Thyroid Association Guidelines
Task Force on Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid :
official journal of the American Thyroid Association. 2016;26(1):1-133.
100. Seidlin SM, Marinelli LD, Oshry E. Radioactive iodine therapy; effect on
functioning metastases of adenocarcinoma of the thyroid. Journal of the American
Medical Association. 1946;132(14):838-847.
40
101. Chakravarty D, Santos E, Ryder M, Knauf JA, Liao XH, West BL, Bollag G,
Kolesnick R, Thin TH, Rosen N, Zanzonico P, Larson SM, Refetoff S, Ghossein
R, Fagin JA. Small-molecule MAPK inhibitors restore radioiodine incorporation
in mouse thyroid cancers with conditional BRAF activation. The Journal of
clinical investigation. 2011;121(12):4700-4711.
102. Iravani A, Solomon B, Pattison DA, Jackson P, Ravi Kumar AS, Kong G,
Hofman MS, Akhurst T, Hicks RJ. Mitogen-activated protein kinase pathway
inhibition for re-differentiation of radioiodine-refractory differentiated thyroid
cancer: an evolving protocol. Thyroid : official journal of the American Thyroid
Association. 2019.
103. Larson SM, Osborne JR, Grewal RK, Tuttle RM. Redifferentiating Thyroid
Cancer: Selumetinib-enhanced Radioiodine Uptake in Thyroid Cancer. Mol
Imaging Radionucl Ther. 2017;26(Suppl 1):80-86.
104. Sanders EM, Jr., LiVolsi VA, Brierley J, Shin J, Randolph GW. An evidence-
based review of poorly differentiated thyroid cancer. World journal of surgery.
2007;31(5):934-945.
105. Molinaro E, Romei C, Biagini A, Sabini E, Agate L, Mazzeo S, Materazzi G,
Sellari-Franceschini S, Ribechini A, Torregrossa L, Basolo F, Vitti P, Elisei R.
Anaplastic thyroid carcinoma: from clinicopathology to genetics and advanced
therapies. Nature Reviews Endocrinology. 2017;13:644.
106. Perrier ND, Brierley JD, Tuttle RM. Differentiated and anaplastic thyroid
carcinoma: Major changes in the American Joint Committee on Cancer eighth
41
edition cancer staging manual. CA: a cancer journal for clinicians.
2018;68(1):55-63.
107. Ibrahimpasic T, Ghossein R, Carlson DL, Nixon I, Palmer FL, Shaha AR, Patel
SG, Tuttle RM, Shah JP, Ganly I. Outcomes in patients with poorly differentiated
thyroid carcinoma. The Journal of clinical endocrinology and metabolism.
2014;99(4):1245-1252.
108. Landa I, Ibrahimpasic T, Boucai L, Sinha R, Knauf JA, Shah RH, Dogan S,
Ricarte-Filho JC, Krishnamoorthy GP, Xu B, Schultz N, Berger MF, Sander C,
Taylor BS, Ghossein R, Ganly I, Fagin JA. Genomic and transcriptomic
hallmarks of poorly differentiated and anaplastic thyroid cancers. The Journal of
Clinical Investigation. 2016;126(3):1052-1066.
109. Nikiforova MN, Wald AI, Roy S, Durso MB, Nikiforov YE. Targeted Next-
Generation Sequencing Panel (ThyroSeq) for Detection of Mutations in Thyroid
Cancer. The Journal of Clinical Endocrinology and Metabolism.
2013;98(11):E1852-E1860.
110. Landa I, Pozdeyev N, Korch C, Marlow LA, Smallridge RC, Copland JA,
Henderson YC, Lai SY, Clayman GL, Onoda N, Tan AC, Garcia-Rendueles
MER, Knauf JA, Haugen BR, Fagin JA, Schweppe RE. Comprehensive Genetic
Characterization of Human Thyroid Cancer Cell Lines: A Validated Panel for
Preclinical Studies. Clinical cancer research : an official journal of the American
Association for Cancer Research. 2019;25(10):3141-3151.
111. Naoum GE, Morkos M, Kim B, Arafat W. Novel targeted therapies and
immunotherapy for advanced thyroid cancers. Molecular cancer. 2018;17(1):51.
42
112. Huang J, Harris EJ, Lorch JH. Treatment of Aggressive Thyroid Cancer. Surgical
pathology clinics. 2019;12(4):943-950.
113. Subbiah V, Kreitman RJ, Wainberg ZA, Cho JY, Schellens JHM, Soria JC, Wen
PY, Zielinski C, Cabanillas ME, Urbanowitz G, Mookerjee B, Wang D,
Rangwala F, Keam B. Dabrafenib and Trametinib Treatment in Patients With
Locally Advanced or Metastatic BRAF V600-Mutant Anaplastic Thyroid Cancer.
Journal of clinical oncology : official journal of the American Society of Clinical
Oncology. 2018;36(1):7-13.
114. Liu L, Li D, Chen Z, Yang J, Ma Y, Cai H, Shan C, Lv Z, Zhang X. Wild-Type
P53 Induces Sodium/Iodide Symporter Expression Allowing Radioiodide
Therapy in Anaplastic Thyroid Cancer. Cellular physiology and biochemistry :
international journal of experimental cellular physiology, biochemistry, and
pharmacology. 2017;43(3):905-914.
115. Bozorg-Ghalati F, Hedayati M, Dianatpour M, Azizi F, Mosaffa N, Mehrabani D.
Effects of a Phosphoinositide-3-Kinase Inhibitor on Anaplastic Thyroid Cancer
Stem Cells. Asian Pacific journal of cancer prevention : APJCP.
2017;18(8):2287-2291.
116. Singh TD, Jeong SY, Lee SW, Ha JH, Lee IK, Kim SH, Kim J, Cho SJ, Ahn BC,
Lee J, Jeon YH. Inverse Agonist of Estrogen-Related Receptor gamma Enhances
Sodium Iodide Symporter Function Through Mitogen-Activated Protein Kinase
Signaling in Anaplastic Thyroid Cancer Cells. Journal of nuclear medicine :
official publication, Society of Nuclear Medicine. 2015;56(11):1690-1696.
43
117. Ghoncheh M, Pournamdar Z, Salehiniya H. Incidence and Mortality and
Epidemiology of Breast Cancer in the World. Asian Pacific journal of cancer
prevention : APJCP. 2016;17(S3):43-46.
118. An JH, Hwangbo Y, Ahn HY, Keam B, Lee KE, Han W, Park DJ, Park IA, Noh
DY, Youn YK, Cho BY, Im SA, Park YJ. A Possible Association Between
Thyroid Cancer and Breast Cancer. Thyroid : official journal of the American
Thyroid Association. 2015;25(12):1330-1338.
119. Tao Z, Shi A, Lu C, Song T, Zhang Z, Zhao J. Breast Cancer: Epidemiology and
Etiology. Cell biochemistry and biophysics. 2015;72(2):333-338.
120. Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA, Pollack JR,
Ross DT, Johnsen H, Akslen LA, Fluge O, Pergamenschikov A, Williams C, Zhu
SX, Lonning PE, Borresen-Dale AL, Brown PO, Botstein D. Molecular portraits
of human breast tumours. Nature. 2000;406(6797):747-752.
121. Parker JS, Mullins M, Cheang MC, Leung S, Voduc D, Vickery T, Davies S,
Fauron C, He X, Hu Z, Quackenbush JF, Stijleman IJ, Palazzo J, Marron JS,
Nobel AB, Mardis E, Nielsen TO, Ellis MJ, Perou CM, Bernard PS. Supervised
risk predictor of breast cancer based on intrinsic subtypes. Journal of clinical
oncology : official journal of the American Society of Clinical Oncology.
2009;27(8):1160-1167.
122. Surveillance, Epidemiology, and End Results (SEER) Program
(www.seer.cancer.gov) Research Data (1975-2016). National Cancer Institute,
DCCPS, Surveillance Research Program; Released April 2019, based on the
November 2018 submission.
44
123. Gao JJ, Swain SM. Luminal A Breast Cancer and Molecular Assays: A Review.
The oncologist. 2018;23(5):556-565.
124. Cheang MC, Chia SK, Voduc D, Gao D, Leung S, Snider J, Watson M, Davies S,
Bernard PS, Parker JS, Perou CM, Ellis MJ, Nielsen TO. Ki67 index, HER2
status, and prognosis of patients with luminal B breast cancer. Journal of the
National Cancer Institute. 2009;101(10):736-750.
125. Kast K, Link T, Friedrich K, Petzold A, Niedostatek A, Schoffer O, Werner C,
Klug SJ, Werner A, Gatzweiler A, Richter B, Baretton G, Wimberger P. Impact
of breast cancer subtypes and patterns of metastasis on outcome. Breast cancer
research and treatment. 2015;150(3):621-629.
126. Santarpia L, Bottai G, Kelly CM, Gyorffy B, Szekely B, Pusztai L. Deciphering
and Targeting Oncogenic Mutations and Pathways in Breast Cancer. The
oncologist. 2016;21(9):1063-1078.
127. Luen S, Virassamy B, Savas P, Salgado R, Loi S. The genomic landscape of
breast cancer and its interaction with host immunity. Breast (Edinburgh,
Scotland). 2016;29:241-250.
128. Maughan KL, Lutterbie MA, Ham PS. Treatment of breast cancer. American
family physician. 2010;81(11):1339-1346.
129. Maximov PY, Lee TM, Jordan VC. The discovery and development of selective
estrogen receptor modulators (SERMs) for clinical practice. Current clinical
pharmacology. 2013;8(2):135-155.
45
130. Martinkovich S, Shah D, Planey SL, Arnott JA. Selective estrogen receptor
modulators: tissue specificity and clinical utility. Clinical interventions in aging.
2014;9:1437-1452.
131. Blakemore J, Naftolin F. Aromatase: Contributions to Physiology and Disease in
Women and Men. Physiology (Bethesda, Md). 2016;31(4):258-269.
132. Osborne CK, Schiff R. Mechanisms of endocrine resistance in breast cancer.
Annual review of medicine. 2011;62:233-247.
133. Teymourzadeh A, Mansouri S, Farahmand L, Hosseinzade A, Majidzadeh AK.
ER-alpha36 Interactions With Cytosolic Molecular Network in Acquired
Tamoxifen Resistance. Clinical breast cancer. 2017;17(6):403-407.
134. Yin L, Wang ZY. Roles of the ER-alpha36-EGFR/HER2 positive regulatory
loops in tamoxifen resistance. Steroids. 2016;111:95-99.
135. Schiavon G, Hrebien S, Garcia-Murillas I, Cutts RJ, Pearson A, Tarazona N,
Fenwick K, Kozarewa I, Lopez-Knowles E, Ribas R, Nerurkar A, Osin P,
Chandarlapaty S, Martin LA, Dowsett M, Smith IE, Turner NC. Analysis of
ESR1 mutation in circulating tumor DNA demonstrates evolution during therapy
for metastatic breast cancer. Science translational medicine.
2015;7(313):313ra182.
136. Martin LA, Ribas R, Simigdala N, Schuster E, Pancholi S, Tenev T, Gellert P,
Buluwela L, Harrod A, Thornhill A, Nikitorowicz-Buniak J, Bhamra A, Turgeon
MO, Poulogiannis G, Gao Q, Martins V, Hills M, Garcia-Murillas I, Fribbens C,
Patani N, Li Z, Sikora MJ, Turner N, Zwart W, Oesterreich S, Carroll J, Ali S,
Dowsett M. Discovery of naturally occurring ESR1 mutations in breast cancer
46
cell lines modelling endocrine resistance. Nature communications.
2017;8(1):1865.
137. Chibon F, de Mascarel I, Sierankowski G, Brouste V, Bonnefoi H, Debled M,
Mauriac L, MacGrogan G. Prediction of HER2 gene status in Her2 2+ invasive
breast cancer: a study of 108 cases comparing ASCO/CAP and FDA
recommendations. Modern pathology : an official journal of the United States and
Canadian Academy of Pathology, Inc. 2009;22(3):403-409.
138. Asif HM, Sultana S, Ahmed S, Akhtar N, Tariq M. HER-2 Positive Breast Cancer
- a Mini-Review. Asian Pacific journal of cancer prevention : APJCP.
2016;17(4):1609-1615.
139. Bailey TA, Luan H, Clubb RJ, Naramura M, Band V, Raja SM, Band H.
Mechanisms of Trastuzumab resistance in ErbB2-driven breast cancer and newer
opportunities to overcome therapy resistance. Journal of carcinogenesis.
2011;10:28.
140. Iqbal N, Iqbal N. Human Epidermal Growth Factor Receptor 2 (HER2) in
Cancers: Overexpression and Therapeutic Implications. Molecular biology
international. 2014;2014:852748.
141. Kadamur G, Ross EM. Mammalian phospholipase C. Annual review of
physiology. 2013;75:127-154.
142. Lambertini M, Ponde NF, Solinas C, de Azambuja E. Adjuvant trastuzumab: a
10-year overview of its benefit. Expert review of anticancer therapy.
2017;17(1):61-74.
47
143. Ponde NF, Lambertini M, de Azambuja E. Twenty years of anti-HER2 therapy-
associated cardiotoxicity. ESMO open. 2016;1(4):e000073.
144. Molina MA, Saez R, Ramsey EE, Garcia-Barchino MJ, Rojo F, Evans AJ,
Albanell J, Keenan EJ, Lluch A, Garcia-Conde J, Baselga J, Clinton GM. NH(2)-
terminal truncated HER-2 protein but not full-length receptor is associated with
nodal metastasis in human breast cancer. Clinical cancer research : an official
journal of the American Association for Cancer Research. 2002;8(2):347-353.
145. Scaltriti M, Rojo F, Ocana A, Anido J, Guzman M, Cortes J, Di Cosimo S,
Matias-Guiu X, Ramon y Cajal S, Arribas J, Baselga J. Expression of p95HER2, a
truncated form of the HER2 receptor, and response to anti-HER2 therapies in
breast cancer. Journal of the National Cancer Institute. 2007;99(8):628-638.
146. Nagata Y, Lan KH, Zhou X, Tan M, Esteva FJ, Sahin AA, Klos KS, Li P, Monia
BP, Nguyen NT, Hortobagyi GN, Hung MC, Yu D. PTEN activation contributes
to tumor inhibition by trastuzumab, and loss of PTEN predicts trastuzumab
resistance in patients. Cancer cell. 2004;6(2):117-127.
147. Berns K, Horlings HM, Hennessy BT, Madiredjo M, Hijmans EM, Beelen K,
Linn SC, Gonzalez-Angulo AM, Stemke-Hale K, Hauptmann M, Beijersbergen
RL, Mills GB, van de Vijver MJ, Bernards R. A functional genetic approach
identifies the PI3K pathway as a major determinant of trastuzumab resistance in
breast cancer. Cancer cell. 2007;12(4):395-402.
148. Foulkes WD, Stefansson IM, Chappuis PO, Begin LR, Goffin JR, Wong N,
Trudel M, Akslen LA. Germline BRCA1 mutations and a basal epithelial
phenotype in breast cancer. J Natl Cancer Inst. 2003;95(19):1482-1485.
48
149. Foulkes WD, Smith IE, Reis-Filho JS. Triple-negative breast cancer. N Engl J
Med. 2010;363(20):1938-1948.
150. Singh AB, Sharma A, Dhawan P. Claudin family of proteins and cancer: an
overview. J Oncol. 2010;2010:541957.
151. Prat A, Parker JS, Karginova O, Fan C, Livasy C, Herschkowitz JI, He X, Perou
CM. Phenotypic and molecular characterization of the claudin-low intrinsic
subtype of breast cancer. Breast cancer research : BCR. 2010;12(5):R68.
152. Wahba HA, El-Hadaad HA. Current approaches in treatment of triple-negative
breast cancer. Cancer biology & medicine. 2015;12(2):106-116.
153. Kamel D, Gray C, Walia JS, Kumar V. PARP Inhibitor Drugs in the Treatment of
Breast, Ovarian, Prostate and Pancreatic Cancers: An Update of Clinical Trials.
Current drug targets. 2018;19(1):21-37.
154. Ali AM, Ansari JAK, El-Aziz NMA, Abozeed WN, Warith AMA, Alsaleh K,
Nabholtz JM. Triple Negative Breast Cancer: A Tale of Two Decades. Anti-
cancer agents in medicinal chemistry. 2017;17(4):491-499.
155. Greenup R, Buchanan A, Lorizio W, Rhoads K, Chan S, Leedom T, King R,
McLennan J, Crawford B, Kelly Marcom P, Shelley Hwang E. Prevalence of
BRCA mutations among women with triple-negative breast cancer (TNBC) in a
genetic counseling cohort. Ann Surg Oncol. 2013;20(10):3254-3258.
156. Petrelli F, Coinu A, Borgonovo K, Cabiddu M, Ghilardi M, Lonati V, Barni S.
The value of platinum agents as neoadjuvant chemotherapy in triple-negative
breast cancers: a systematic review and meta-analysis. Breast cancer research
and treatment. 2014;144(2):223-232.
49
157. Guan X, Ma F, Fan Y, Zhu W, Hong R, Xu B. Platinum-based chemotherapy in
triple-negative breast cancer: a systematic review and meta-analysis of
randomized-controlled trials. Anticancer Drugs. 2015;26(8):894-901.
158. Caramelo O, Silva C, Caramelo F, Frutuoso C, Almeida-Santos T. The effect of
neoadjuvant platinum-based chemotherapy in BRCA mutated triple negative
breast cancers -systematic review and meta-analysis. Hered Cancer Clin Pract.
2019;17:11.
159. Rampurwala M, Wisinski KB, O'Regan R. Role of the androgen receptor in triple-
negative breast cancer. Clinical advances in hematology & oncology : H&O.
2016;14(3):186-193.
160. Traina TA, Miller K, Yardley DA, Eakle J, Schwartzberg LS, O'Shaughnessy J,
Gradishar W, Schmid P, Winer E, Kelly C, Nanda R, Gucalp A, Awada A,
Garcia-Estevez L, Trudeau ME, Steinberg J, Uppal H, Tudor IC, Peterson A,
Cortes J. Enzalutamide for the Treatment of Androgen Receptor-Expressing
Triple-Negative Breast Cancer. Journal of clinical oncology : official journal of
the American Society of Clinical Oncology. 2018;36(9):884-890.
50
CHAPTER 2: Thyroid Hormone Receptor Beta Induces a Tumor Suppressive
Program in Anaplastic Thyroid Cancer.
2.1. Abstract
The thyroid hormone receptor beta (TRβ), a key regulator of cellular growth and
differentiation, is frequently dysregulated in cancers. Diminished expression of TRβ is
noted in thyroid, breast, and other solid tumors and is correlated with more aggressive
disease. Restoration of TRβ levels decreased tumor growth supporting the concept that
TRβ could function as a tumor suppressor. Yet, the TRβ tumor suppression transcriptome
is not well delineated and the impact of TRβ is unknown in aggressive anaplastic thyroid
cancer (ATC). Here, we establish that restoration of TRβ expression in the human ATC
cell line SW1736 (SW-TRβ) reduces the aggressive phenotype, decreases cancer stem-
cell populations and induces cell death in a T3-dependent manner. Transcriptomic
analysis of SW-TRβ cells via RNA-sequencing revealed distinctive expression patterns
induced by ligand-bound TRβ and revealed novel molecular signaling pathways. Of note,
liganded TRβ repressed multiple nodes in the PI3K/AKT pathway, induced expression of
thyroid differentiation markers, and promoted pro-apoptotic pathways. Our results further
revealed the JAK1-STAT1 pathway as a novel, T3-mediated, anti-tumorigenic pathway
that can be activated in additional ATC lines. These findings elucidate a TRβ-driven
tumor suppression transcriptomic signature, highlight unexplored therapeutic options for
ATC, and support TRβ activation as a promising therapeutic option in cancers.
Implications: TRβ-T3 induced a less aggressive phenotype and tumor suppression
program in anaplastic thyroid cancer cells revealing new potential therapeutic targets.
51
2.2. Introduction
The non-steroidal nuclear hormone receptor thyroid hormone receptor beta
(TRβ) has been characterized as a tumor suppressor in multiple tumor types, primarily
thyroid, breast, and hepatocellular carcinomas (1,2). Expression of TRβ is typically
reduced in aggressive tumors. Epigenetic silencing of THRB is frequent, while mutations
in the gene are relatively rare. As a nuclear hormone receptor, the canonical function of
TRβ is to regulate gene expression in response to its ligand triiodothyronine (T3). It is
also known that TRβ exerts ligand-independent genomic signaling and has non-genomic
functions that are ligand regulated (3).
Multiple lines of evidence demonstrate the tumor suppressive activity of TRβ in
thyroid cancer. Re-expression of silenced TRβ using demethylating agents delays thyroid
tumor progression in vivo (4), mice expressing a c-terminal frameshift of TRβ (ThrbPV)
spontaneously develop follicular thyroid cancer (5), and ThrbPV/PV KrasG12D mice develop
thyroid tumors with features of dedifferentiated thyroid cancer (6).
TRβ has previously been shown to modulate anti-tumorigenic signaling in
thyroid cancer in part through repression of driver pathways such as PI3K/AKT (7) and
NF-κβ (8); modulation of inflammatory processes (8); and repression of the oncogenes β-
Catenin (9,10) and RUNX2 (11,12). These signaling nodes are important contributors to
the tumor suppressive activity of TRβ, but they likely do not constitute the entire tumor
suppression program.
The current understanding of TRβ tumor suppressive activity has been described
primarily in differentiated thyroid cancers, but there is a need to determine TRβ-mediated
tumor suppressive actions in dedifferentiated anaplastic thyroid cancer (ATC). Although
52
this tumor subtype is rare, ATC is responsible for nearly 40% of thyroid cancer deaths
with most patients exhibiting a median survival time of less than six months (13). This is
mainly due to a lack of effective targeted therapeutic options. Characterization of the
activity of tumor suppressors can provide important insights into the development of
rationally designed treatment interventions.
These studies aimed to understand the systemic impact of TRβ and its ligand
thyroid hormone (T3) on ATC cancer cell characteristics. We performed transcriptomic
analysis of TRβ in ATC cells to provide a comprehensive network of cellular signaling
events altered by TRβ and T3. We have paired this transcriptomic data with functional
studies to characterize the TRβ-mediated changes to ATC cell characteristics. Lastly, this
analysis has revealed that activation of a STAT1-dependent anti-proliferative pathway is
a vulnerability in ATC that can be exploited pharmacologically.
2.3. Materials and Methods
Culture of thyroid cell lines.
Anaplastic thyroid cancer cell lines (SW1736, 8505C, OCUT-2, and KTC-2)
were cultured in RPMI 1640 growth media with L-glutamine (300 mg/L), sodium
pyruvate and nonessential amino acids (1%) (Corning Inc, Corning, NY, USA),
supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Waltham, MA,
USA) and penicillin-streptomycin (200 IU/L) (Corning) at 37°C, 5% CO2, and 100%
humidity. Lentivirally modified SW1736 cells were generated as recently described (12)
with either an empty vector (SW-EV) or to overexpress TRβ (SW-TRβ). SW-EV and
SW-TRβ were grown in the above conditions with the addition of 1 µg/ml puromycin
53
(Gold Bio, St Louis, MO, USA). SW1736 and KTC-2 were authenticated by the Vermont
Integrative Genomics Resource at the University of Vermont using short tandem repeat
profiles and Promega GenePrint10 System (SW1736, May 2019; KTC-2, October 2019).
8505C and OCUT-2 were authenticated by University of Colorado by short tandem
repeat profiles (8505C, June 2013; OCUT-2, June 2018).
RNA-seq Library Construction and Quality Control.
80% confluent monolayers of SW-EV and SW-TRβ cells were hormone starved
for 24 hours in phenol red free RPMI with charcoal-stripped fetal bovine serum. 10-8 M
T3 was added and incubated for 24 hours prior to sample collection. Total RNA was
extracted and purified using RNeasy Plus Kit (Qiagen, Venlo, Netherlands) according to
manufacturer’s protocol. Purity of the total RNA samples was assessed via BioAnalyzer
(Agilent Technologies, Santa Clara, CA, USA) and samples with a RIN score >7 were
used for library construction. rRNA was depleted using 1 μg of total RNA with the
RiboErase kit (Roche, Basel, Switzerland). Strand-specific Illumina cDNA libraries were
prepared using the KAPA Stranded RNA-Seq library preparation kit with 10 cycles of
PCR (Roche). Library quality was assessed by BioAnalyzer (Agilent Technologies) to
ensure an average library size of 300 bp and the absence of excess adaptors in each
sample. RNA-Seq libraries were pooled and sequenced on the Illumina HiSeq 1500 with
50 bp single-end reads. Quality scores across sequenced reads were assessed using
FASTQC. All samples were high quality. For alignment and transcript assembly, the
sequencing reads were mapped to hg38 using STAR. Sorted reads were counted using
HTSeq and differential expression analysis was performed using DESeq2. Genes with a
p-value of <0.05 and a fold change of >2 were considered differentially expressed and
54
were used for further analysis through Ingenuity Pathway Analysis (IPA) (Qiagen) and
Gene Set Enrichment Analysis (GSEA).
Immunoblot Analysis.
Proteins were isolated from whole cells in lysis buffer (20mM Tris-HCl [pH 8],
137mM NaCl, 10% glycerol, 1% Triton X-100, and 2mM EDTA) containing Protease
Inhibitor Cocktail 78410 (Thermo Fisher Scientific). Proteins were resolved by
polyacrylamide gel electrophoresis on 10% sodium dodecyl sulfate gels EC60752
(Thermo Fisher Scientific) and immobilized onto nitrocellulose membranes (GE
Healthcare, Chicago, IL, USA) by electroblot (Bio-Rad Laboratories, Hercules, CA,
USA). Specific proteins were detected by immunoblotting with the indicated antibodies
(Appendix A-1); immunoreactive proteins were detected by enhanced
chemiluminescence (Thermo Scientific) on a ChemiDoc XRS+ (Bio-Rad Laboratories).
Growth Assays.
Cell growth was measured either through live cell imaging or by cell counting at
discrete points. Live cell imaging was used to assess the growth kinetics of SW-EV and
SW-TRβ. To perform live cell imaging, 5000 cells were plated per well in 24 well plates.
After 24 hours in phenol red free, charcoal stripped media, media was supplemented with
either 10-8 M T3 or equivolume vehicle (NaOH). Every two hours cells were imaged with
a Lionheart automated microscope (Agilent Technologies) and quantified with Gen5
software (Agilent Technologies). The cells entered the log phase of growth at
approximately 48 hours, and we used the portion of the curve following this point to
calculate the doubling time of the cells.
Sulforhodamine B Cell Cytotoxicity Assay Kit (Abcam, Cambridge, UK) was
55
used to stain cell protein as a readout for cell viability. ATC cells were plated in 96-well
clear flat-bottom plates at a density of 5,000 cells/well. Cells were treated with serial
dilutions of the STAT1 activator 2-(1,8-Naphthyridin-2-ly)phenol (2-NP) (Abcam) or
vehicle (DMSO). Plates were then incubated for 72 hours. Cells were fixed, stained, and
then imaged using a plate reader according to manufacturer’s instructions.
Soft Agar Colony Formation Assay.
Soft agar colony forming assays were used to assess anchorage-independent
growth. A layer 0.50% agar in thyroid media (as described) was solidified in 6-well cell
culture plates. SW-EV or SW-TRβ cells were plated in a second layer of 0.25% agar in
thyroid media. 200uL of thyroid media was maintained at the top of each well to prevent
the agar from drying. Where indicated, 10-8 M T3 or vehicle (NaOH) was added to the
media in all layers to evaluate the effects of liganded TRβ on anchorage-independent
growth. Colonies were allowed to grow for 14 days. Live SW-EV and SW-TRβ colonies
were detected via GFP expression using a ChemiDoc XRS+ (Bio-Rad Laboratories).
Colonies were then counted with ImageJ using the Colony Counter plugin.
Tumorsphere Assay.
Tumorsphere-forming assays were used to assess self-renewal and sphere-
forming efficiency. For generating thyrospheres, adherent SW-EV and SW-TRβ
monolayer cells were dissociated with Trypsin-EDTA, and single cells were moved to
round-bottom ultra-low attachment 96-well plates at a density of 1000 cells/well
(Corning). Thyrospheres were cultured in RPMI 1640 growth media supplemented with
20ng/mL each of epidermal growth factor (EGF) and fibroblastic growth factor (FGF)
(Gold Bio). Where indicated, 10-8 M T3 or vehicle (NaOH) was added to the media to
56
evaluate the effects of liganded TRβ on thyrosphere growth. Thyrospheres grew for seven
days and were then counted with an inverted microscope.
Migration Assay.
Cell migration was determined by wound healing assay. Cells were plated and
allowed to grow to 100% confluency. Two hours prior to scratching, cells were treated
with 10 mg/ml Mitomycin C. A scratch was performed with a P1000 pipette tip and
debris was washed away with PBS. Migration media was supplemented with 10-8 M T3.
Images were obtained at 0, 24, 48, and 72 hours. Wound closure was measured using
ImageJ macro “Wound Healing Tool” (http://dev.mri.cnrs.fr/projects/imagej-
macros/wiki/Wound_Healing_Tool). Values were normalized so that the initial scratch
was 0% closure.
Apoptosis Assay.
Cells were plated at a density of 50,000 cells/well and treated with vehicle (1 N
NaOH) or 10-8 M T3. After 5 days the cells were lysed for analysis, poly (ADP-ribose)
polymerase 1 (PARP1) and Caspase 3 cleavage were assessed by immunoblot to measure
apoptotic signaling.
RNA Extraction and Quantitative Real-Time PCR (qRT-PCR).
Total RNA was extracted using RNeasy Plus Kit (Qiagen) according to
manufacturer’s protocol. cDNA was then generated using the 5X RT Mastermix (ABM,
Vancouver, Canada). Gene expression to validate RNASeq analysis was quantified by
qRT-PCR using 2X SuperGreen Mastermix (Thermo Fisher Scientific) on a QuantStudio
3 real-time PCR system (Thermo Fisher Scientific). Fold change in gene expression
compared to endogenous controls was calculated using the ddCT method. Primer
57
sequences are indicated in Appendix A-2.
Statistics.
All statistical analyses were performed using GraphPad Prism software. Paired
comparisons were by T-test and group comparisons were made by a 2-way ANOVA
followed by a Tukey multiple comparisons test (p<0.05). Data are represented as mean
standard deviation, or when stated otherwise mean standard error of the mean. Area
under the curve (AUC) at the 95th confidence interval was used to evaluate statistical
differences in growth and migration assays.
2.4. Results
2.4.1. Expression of TRβ inhibits pro-tumorigenic characteristics of human anaplastic
thyroid cells.
Anti-tumorigenic signaling from the tumor suppressor TRβ has not been
comprehensively defined in ATC. We utilized the human ATC cell line SW1736,
modified to overexpress TRβ (previously used in (12)), to examine the effect of both T3
and TRβ on the cellular growth. T3 modestly decreased the growth rate of SW-EV (Figure
5A). Vehicle treated SW-EV also grew faster than vehicle treated SW-TRβ. Importantly,
the combination of TRβ overexpression and T3 treatment profoundly reduced cellular
growth. T3 treated SW-TRβ also exhibited the greatest doubling time (Figure 5B). TRβ
expression and treatment with cognate ligand profoundly reduced the growth of these
cells.
58
Figure 5: Liganded TRβ Repressed Growth and Migration of ATC Cells. A) The combination of TRβ
expression and T3 treatment repressed the growth of the ATC cells (n=8). Variability is represented by the
standard error of the mean; significance was determined by calculating the 95th confident interval of AUC
measurements. B) TRβ and T3 acted to increase doubling time of the cells (n=8, * p<0.01). C) SW-TRβ
treated with T3 exhibited significantly reduced scratch closure at the 95th confidence interval by AUC (n=9)
and D) representative images.
In addition to inducing anti-proliferative activity, TRβ is known to block
metastasis in vivo (14). As metastasis and invasiveness require heightened cellular
motility, we also assessed the impact of T3 and TRβ on ATC cell migration by wound
healing assay. Ligand treated SW-TRβ showed reduced migratory potential compared to
ligand treated SW-EV (Figure 5C-D). These data indicate that TRβ in the presence of T3
59
ligand exerts tumor suppressor activity in ATC cells.
2.4.2. TRβ reprograms the anaplastic thyroid cancer cell transcriptome.
Given that T3 significantly reduced ATC cell growth and migration, we then
interrogated the gene expression patterns elicited by TRβ with T3 treatment by RNA-seq.
The expression patterns of differentially expressed genes (DEGs) across each condition
was visualized using a clustered heatmap (Figure 6A). This analysis resulted in 5
distinctive clusters of DEGs. Clusters 1 and 5 are DEGs regulated by T3 in the absence of
TRβ overexpression. Clusters 2 and 3 are DEGs that are T3-regulated only when TRβ is
overexpressed. Cluster 4 includes the DEGs that are repressed by T3 in the absence of
TRβ and induced by T3 in cells that overexpress TRβ.
60
Figure 6: TRβ-T3 Altered the Transcriptome of ATC Cells. A) Thresholds for differentially regulated
genes (DEGs) were set at p<0.05 and an absolute log2foldchange of at least 1, upregulated transcripts in
red and repressed transcripts in blue. Genes were clustered according to patterns of expression. Clusters 1
and 5 are genes that are T3 regulated independent of TRβ overexpression. Clusters 2-4 require TRβ for T3 to
exert a regulatory effect. B) Ingenuity Pathway Analysis (IPA) software was utilized to determine pathways
altered within each cluster. Notable cancer-related pathways are highlighted. C) IPA software was used to
ascertain upstream regulators within each cluster. Exogenous chemicals were excluded, however
endogenous chemicals were retained.
61
Enriched pathways within these five clusters of DEGs were determined using
IPA software (Figure 6B). Highly enriched processes include Integrin-linked kinase
(ILK) signaling (cluster 1), interferon signaling (cluster 2), endoplasmic reticulum (ER)
stress (cluster 2), nucleotide excision repair (NER) (cluster 3), DNA methylation and
transcriptional repression (cluster 3), and protein ubiquitination (cluster 4). Of these
pathways highlighted in the cluster analysis, TRβ has previously been shown to regulate
ILK (hereafter PI3K/ILK) and interferon signaling (hereafter interferon/JAK1/STAT1)
(7,15).
Following PI3K phosphorylation of PIP2, ILK catalyzes phosphorylation AKT
and activates proliferative and invasive cellular processes (16). A pairwise comparison
between T3-treated SW-EV and SW-TRβ cells demonstrates that expression of TRβ
further represses genes within the PI3K/ILK pathway (Appendix A-3 A-I). Therefore,
changes to the PI3K/ILK pathway are likely a reflection of the known repressive effect
TRβ has on PI3K in cancer cells (7). TRβ repression of PI3K signaling was confirmed by
assessing pAKT/AKT by immunoblot (Appendix A-3 J).
TRβ has recently been shown to alter a set of genes in the
interferon/JAK1/STAT1 pathway in breast cancer cells (15). This pathway was also
significantly upregulated by TRβ in our ATC cell line model as predicted by IPA (Figure
6B, Appendix A-4) and GSEA (Appendix A-5). Since the transcriptomic profiling of
SW1736 was performed in vitro, the observed interferon response is likely intrinsic
signaling (17). In the intrinsic interferon pathway, stimulation of the interferon receptor
in cells drives phosphorylation of JAK proteins, which in turn phosphorylate STAT1 to
initiate a transcriptional response. STAT1 signaling has been reported to promote
62
apoptosis and differentiation of tumor cells, as well as inhibit growth (17).
The upstream regulators of each cluster were determined using IPA (Figure 6C).
This analysis further confirmed alteration of the PI3K/ILK and interferon/JAK1/STAT1
pathways. Suppression of PI3K/ILK signaling was consistent with repression of the PI3K
family and the receptor tyrosine kinases FGF2 and EGFR (cluster 1). There was
predicted activation of multiple effectors within the interferon/JAK1/STAT1 signaling
network, including IFNG, IRF1, IFNA2, and STAT1 in cluster 2 as well as IRF7 in
clusters 2 and 5.
Analysis of the upstream regulators highlighted other genes known to be
important in tumorigenesis. Notable upstream regulators were NF-κβ (cluster 1), MAPK1
(cluster 2), CCND1 (cluster 4), ATF4 (clusters 1 and 3), and SMARCB1 (cluster 5). NF-
κβ and MAPK1 are well recognized to be oncogenic (18,19) and were predicted to be
repressed by TRβ and T3. CCND1 encodes the protein cyclin D1, a cell cycle regulator
which is regulated by T3 and TRβ in other cell types (20), and was predicted to be
repressed in this analysis. The ER stress regulator ATF4 was repressed, itself a gene that
is typically upregulated in malignancy and a potential drug target for ATC (21). Genes
positively regulated by SMARCB1, a component of the SWI/SNF chromatin remodeling
complex, were induced by T3. SWI/SNF components are more commonly mutated in
ATC than in other thyroid cancer subtypes (22).
These gene clusters were also used for chromatin immunoprecipitation
enrichment analysis (ChEA) (23) in order to determine which transcription factors have
overrepresented binding sites (Appendix A-6). Of these transcription factors, GATA2,
IRF1, NELFE, VDR, and ZMIZ1 exhibited altered expression and are therefore possible
63
drivers of TRβ-mediated signaling.
The majority of the DEGs in this analysis belong to clusters that were only
significantly altered in the TRβ-T3 condition. Therefore, a pairwise comparison between
SW-EV-T3 and SW-TRβ-T3 was performed (Appendix A-7). The long noncoding RNAs
(lncRNA) were pulled from the set of genes due to their emerging role in tumor biology
(24). lncRNAs upregulated included C1QTNF1-AS1, MIR210HG, TBILA, GAS6-AS1,
LUCAT1, DRAIC, KIAA0125, MIR22HG, and UCA1. Conversely, LINC01133 was
repressed. These lncRNAs have all been found to have a role in tumorigenesis (25-33).
In addition to the pathways and key regulators uncovered by the use of
bioinformatics software, we decided to directly examine cell cycle regulators that may
aid in explaining the anti-proliferative phenotype we observed in the SW-TRβ-T3 group.
CDKN1A is a known TRβ-T3 regulated gene in hepatocellular carcinoma, where
CDKN1A mediates the anti-proliferative activity of TRβ (34). Expression of the oncogene
MYC is induced by TRβ-PV in the development of thyroid tumors (6). In SW1736 cells,
TRβ increased expression of CDKN1A and repressed MYC expression (Appendix A-8).
Analysis of the transcriptomic profile induced by overexpression of TRβ and T3
shows that many pathways and key regulators in cancer biology are altered. These
signaling nodes relate to survival signaling, invasiveness, cellular maintenance,
differentiation, and chromatin organization. Thus, T3 treatment of SW-TRβ induces
transcriptomic changes associated with reduced cell growth, migration, cell cycle, and
cell survival.
2.4.3. Liganded TRβ reduces ATC stem-cell characteristics.
Recently, it was demonstrated that TRβ reduces cancer stem cell renewal in
64
luminal breast cancer cell lines (15). We therefore examined whether TRβ expression and
T3 treatment could attenuate the stem-like properties of SW1736 cells. Soft agar colony
formation assays were used to measure changes in anchorage independent growth in the
presence and absence of TRβ and T3. Treatment with T3 reduced anchorage-independent
colony growth in SW-EV cells, and nearly ablated colony growth in SW-TRβ cells
(Figure 7A-B). Tumorsphere assays were used to assess self-renewal and estimate the
size of the cancer stem cell population within our heterogenous cultures. T3 had no effect
on the number of tumorspheres formed from SW-EV cells. Expression of TRβ alone
reduced tumorsphere formation, however the addition of T3 blocked almost all
tumorsphere growth (Figure 7C).
65
Figure 7: TRβ Reduced Stem Cell Characteristics in ATC Cells. A) Treatment of SW1736 cells with T3
was sufficient to decrease anchorage-independent growth; the most pronounced effect was observed in the
SW-TRβ cells (n=4, * p<0.05). B) T3 significantly repressed tumorsphere formation in SW-TRβ, but not
SW-EV (n=4, * p<0.05). D) Thyroid cancer-specific stem cell marker mRNA transcript levels were
significantly repressed by TRβ and T3 by RNA-seq (n=3, * p<0.05). E) Reintroduction of TRβ and
treatment with T3 resulted in a significantly increased thyroid differentiation score (TDS) (n=3, * p<0.05).
Expression of key stem cell markers was also altered. Although the markers for
thyroid cancer stem cells have not been studied with the same rigor as other aggressive
cancer types, a recent review compiled a list of proposed cancer stem cell markers that
66
have been characterized in the thyroid (35). The combination of TRβ overexpression and
T3 significantly reduced expression of the thyroid-specific cancer stem cell genes ALDH,
POU5F1 (encodes OCT3/4), CD44, FUT4 (encodes SSEA-1), and PROM1 (encodes
CD133) (Figure 7D). We also examined the EMT markers CHD1 (E-cadherin), VIM
(Vimentin) (Appendix A-9). The epithelial marker CDH1 exhibited increased expression
in SW1736-TRβ T3 treated cells, whereas expression of the mesenchymal marker VIM
was decreased. Together with the phenotypic assays, these results demonstrate that TRβ
in association with ligand decreases the stem cell population of ATC cells.
To further explore the impact of T3 treatment in this ATC model, the thyroid
differentiation score (TDS) was calculated for the SW1736 cells under each condition to
evaluate whether the transcriptomic data indicates a change in thyroid-specific
differentiation. The TDS has been demonstrated to have utility in predicting the
aggressiveness of a thyroid tumor (36,37). Ten out of the thirteen genes which constitute
the TDS are expressed in at least one condition in this dataset. DIO2, DUOX1, TPO, and
TG, were highly responsive to TRβ expression and the addition of T3 (Appendix A-10).
SW-TRβ cells treated with T3 have a significantly higher TDS, indicating that they have
the most thyroid-like gene expression (Figure 7E). These results suggest that the tumor
suppressive activity of TRβ observed in SW1736 cells may involve cellular
differentiation and a consequential reduction in the cancer stem cell properties.
2.4.4. TRβ stimulates apoptotic signaling.
As a tumor suppressor, TRβ promotes apoptosis in other cancer cell types,
however this has never been described in ATC (6,38). A targeted pathway enrichment
analysis between SW-TRβ treated with vehicle or T3 revealed alterations in pathways that
67
suggested apoptotic programming was occurring (Figure 8A). Additionally, GSEA
analysis using Hallmark gene sets highlighted enrichment of apoptotic signaling (Figure
8B). We further investigated the ability of T3 to stimulate apoptosis in our model. SW-EV
and SW-TRβ cells were cultured in media supplemented with T3 continuously for five
days. Caspase 3 and PARP1 cleavage were detected by immunoblot to assess apoptotic
activity. T3 induced cleavage of these apoptotic effectors only in SW-TRβ (Figure 8C).
Neither T3 nor TRβ alone was sufficient to elicit this response. These data demonstrate
heightened activity of TRβ promotes an apoptotic response in aggressive cancer cells,
further confirming tumor suppressive activity.
68
Figure 8: Re-expression of TRβ Increased Apoptotic Signaling. A) In a comparison of DEGs between
SW-EV and SW-TRβ, both T3 treated, IPA predicted changes in pathways important to apoptotic signaling,
and B) GSEA predicted activation of apoptosis. C) Representative immunoblot demonstrates that 5 days of
T3 treatment induces apoptosis in SW-TR cells assessed by cleavage of PARP1 and caspase 3 (n=6).
2.4.5. TRβ stimulates anti-proliferative interferon/JAK1/STAT1 signaling.
Of the pathways altered by TRβ, the interferon/JAK1/STAT1 pathway was
among the most prominent within our transcriptomic analysis (Figure 6, Appendix A-4).
We therefore decided to investigate the activity of this pathway in ATC and whether it
could be modulated to slow tumor growth. Interferon/JAK1/STAT1 signaling is known to
have potent anti-tumor and anti-proliferative activity (17,39). The primary effector of the
interferon response is the transcription factor STAT1.
Expression of the kinase effectors JAK1 and STAT1 were significantly
increased in SW-TRβ cells following treatment with T3 (Figure 9A and Appendix A-11
A-C). Additionally, transcriptional targets of STAT1 were significantly increased in T3
treated SW-TRβ cells T3 also increased the expression of STAT1 target genes IRF1 and
TAP1, and IRF1 target genes APOL6 and TNFSF10 (Figure 9B). TRβ-T3 mediated
induction of these genes was confirmed by qRT-PCR (Appendix A-11 D).
69
Figure 9: The Interferon-JAK1-STAT1 Pathway is Activated by TRβ. A) Interferon pathway effector
proteins JAK1 and STAT1 are expressed at higher levels in SW-TRβ cells following T3 treatment
(*p<0.05, n=3). B) STAT1 and IRF1 upregulated genes were repressed upon overexpression of TRβ and T3
treatment. (n=3, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001). C) Stimulation of STAT1
transcriptional activity with the agonist 2-NP repressed growth of ATC cell lines (n=8, * p<0.05, **
p<0.01, *** p<0.001).
STAT1 has anti-proliferative activity, raising the question whether it can be
exploited pharmacologically to reduce ATC growth. To identify the effects of STAT1
stimulation the ATC lines SW1736, 8505C, OCUT-2, and KTC-2 were treated for 72
hours with various concentrations of 2-NP, a small molecule activator of STAT1 (40)
(Figure 9C). SW1736 and 8505C were most sensitive to 2-NP, and growth of both KTC-
2 and OCUT-2 were repressed by the compound at 50 µM. Together, these results
70
demonstrate that liganded TRβ stimulates STAT1 signaling, which in turn can repress
growth in ATC cell lines.
2.5. Discussion
While TRβ is a recognized tumor suppressor in thyroid cancer and is known to
be silenced in ATC (11), TRβ-mediated signaling and phenotypic effects are not well
characterized in ATC. Our data in ATC cells demonstrates that TRβ, in conjunction with
T3, acts to regulate pathways important for the process of tumorigenesis and reduces the
aggressive phenotypic characteristics. This change was demonstrated via multiple
measures including reduced growth, migration, and stemness. In addition, the
combination of TRβ and T3 induced the expression of thyroid differentiation markers in
ATC cells, and after 5 days resulted in apoptosis. Indeed, T3 was essential for the
profound anti-tumorigenic molecular signaling and phenotypic remodeling observed in
this study. The major findings of our analysis are represented in Figure 10.
71
Figure 10: TRβ Activates Alternate Apoptotic Pathway. TRβ stimulates activity of STAT1, a transducer
of anti-proliferative signaling. Stemness of the cells is reduced, while thyroid differentiation markers are
increased. Additionally, apoptosis was increased in the cells.
Our transcriptomic results reveal new details about TRβ-mediated regulation of
critical cancer-related pathways in ATC. The prominent pathways from our analysis were
repression of PI3K and activation of STAT1. TRβ-mediated repression of PI3K has been
demonstrated in breast cancer and differentiated thyroid tumors (7,38), suggestive that
this signaling is active in a variety of tumor types. Additionally, we highlight the
interferon/JAK1/STAT1 pathway, previously unknown to be modulated by T3 in thyroid
cells, although STAT1 was recently shown to be activated upon overexpression of TRβ
in estrogen receptor positive breast cancer (15). Evidence of MAPK repression was also
observed, another pathway previously shown to be regulated by TRβ in breast cancer
cells (41). Along with alterations to PI3K and interferon activity, there were changes to
cellular repair processes driven by TRβ overexpression. TRβ and T3 altered expression of
genes involved ER stress. This is consistent with alteration of protein ubiquitination,
which may indicate a greater turnover rate of misfolded proteins, an important
component of ER stress. Additionally, alteration of transcriptional repression and NER
are consistent with observed reduction of cell growth. These pathways can initiate an
apoptotic response, such as through an accumulation of misfolded proteins in the ER
(42), or a failure of DNA repair pathways to repair damaged DNA (43). Thus, these
results indicate that these cells are primed for apoptosis to occur after multiple days of
hormone treatment.
The pathways in this analysis overlap substantially with known drivers of ATC.
72
ATC commonly exhibits mutations to the MAPK and PI3K pathways, the SWI/SNF
complex, and DNA repair processes (22,44). These are also shown to be altered by TRβ
in our analysis. The TRβ driven transcriptomic reprogramming is indicative of a reversal
of the process of malignancy. Indeed, these changes in gene expression suggest that TRβ
is promoting a differentiating effect in the cells, which was demonstrated by the TDS and
multiple stemness assays, indicating that TRβ expression may be predictive in
determining the aggressiveness of a tumor. Our results indicate that TRβ reduces the
aggressive malignant phenotype of ATC cells.
A significant finding here is that TRβ stimulates the activity of STAT1 in ATC.
STAT1 is stimulated by interferons, which have been reported to be tumor suppressive in
multiple cancer types (17). Interestingly, cytokine-cytokine receptor pathway was
predicted to be changed in the thyroids of THRBPV/PV PTEN+/- mice (8), a class of
interactions that includes interferon-interferon receptor. STAT1 itself may be a clinically
important drug target as stimulation of STAT1 activity was sufficient to reduce growth in
multiple ATC cell lines. Treatment strategies that focus on activating STAT1-directed
signaling may have value for prolonging the lifespan of ATC patients. Several studies
have examined the utility of treating thyroid cancer with interferon. Interferon γ reduces
proliferation and migration in papillary thyroid cancer (45), and interferon α suppresses
growth in thyroid cancer cells, including in ATC lines (46). Additionally, a phase II trial
combined interferon α with doxorubicin and observed a modest response in advanced
thyroid cancer patients, however toxicity was high (47). Modulation of STAT1 directly to
suppress tumor growth may be better tolerated. In general, targeting multiple effectors in
the same pathway reduces undesirable side effects in cancer patients (48).
73
We have used our investigation into TRβ signaling to elucidate ATC
vulnerabilities and uncover a novel regulatory effect of TRβ in ATC by stimulating
STAT1. Only recently have targeted therapies in ATC shown success in managing
disease burden and progression (49). These treatment modalities focus primarily upon the
mutational landscape of ATC, however epigenetic alterations, including silencing of the
tumor suppressor TRβ, have an unrealized potential to inform drug development.
Additionally, reversing the epigenetic silencing of TRβ may itself be beneficial. Our
work on TRβ signaling reveals novel functions of TRβ in ATC and the need to
investigate STAT signaling in aggressive thyroid cancers.
Finally, our data demonstrates that there is value to maintaining euthyroid status
in ATC patients. Hypothyroidism is a known consequence of certain treatment regimens
(50) and treating chemotherapy-induced hypothyroidism may improve clinical outcomes
due to stimulation of the tumor suppressive activity of TRβ, illustrating the potential for
TRβ as a diagnostic marker.
References:
1. Aranda A, Martinez-Iglesias O, Ruiz-Llorente L, Garcia-Carpizo V, Zambrano A.
Thyroid receptor: roles in cancer. Trends Endocrinol Metab 2009;20:318-24
2. Kim WG, Cheng SY. Thyroid hormone receptors and cancer. Biochimica et
biophysica acta 2013;1830:3928-36
74
3. Flamant F, Cheng SY, Hollenberg AN, Moeller LC, Samarut J, Wondisford FE, et
al. Thyroid Hormone Signaling Pathways: Time for a More Precise
Nomenclature. Endocrinology 2017;158:2052-7
4. Kim WG, Zhu X, Kim DW, Zhang L, Kebebew E, Cheng SY. Reactivation of the
silenced thyroid hormone receptor beta gene expression delays thyroid tumor
progression. Endocrinology 2013;154:25-35
5. Suzuki H, Willingham MC, Cheng SY. Mice with a mutation in the thyroid
hormone receptor beta gene spontaneously develop thyroid carcinoma: a mouse
model of thyroid carcinogenesis. Thyroid : official journal of the American
Thyroid Association 2002;12:963-9
6. Zhu X, Zhao L, Park JW, Willingham MC, Cheng SY. Synergistic signaling of
KRAS and thyroid hormone receptor beta mutants promotes undifferentiated
thyroid cancer through MYC up-regulation. Neoplasia 2014;16:757-69
7. Kim WG, Zhao L, Kim DW, Willingham MC, Cheng SY. Inhibition of
tumorigenesis by the thyroid hormone receptor beta in xenograft models. Thyroid
: official journal of the American Thyroid Association 2014;24:260-9
8. Park S, Zhu J, Altan-Bonnet G, Cheng SY. Monocyte recruitment and activated
inflammation are associated with thyroid carcinogenesis in a mouse model. Am J
Cancer Res 2019;9:1439-53
9. Guigon CJ, Zhao L, Lu C, Willingham MC, Cheng SY. Regulation of beta-
catenin by a novel nongenomic action of thyroid hormone beta receptor.
Molecular and cellular biology 2008;28:4598-608
75
10. Guigon CJ, Kim DW, Zhu X, Zhao L, Cheng SY. Tumor suppressor action of
liganded thyroid hormone receptor beta by direct repression of beta-catenin gene
expression. Endocrinology 2010;151:5528-36
11. Carr FE, Tai PW, Barnum MS, Gillis NE, Evans KG, Taber TH, et al. Thyroid
Hormone Receptor-beta (TRbeta) Mediates Runt-Related Transcription Factor 2
(Runx2) Expression in Thyroid Cancer Cells: A Novel Signaling Pathway in
Thyroid Cancer. Endocrinology 2016;157:3278-92
12. Gillis NE, Taber TH, Bolf EL, Beaudet CM, Tomczak JA, White JH, et al.
Thyroid Hormone Receptor β Suppression of RUNX2 is Mediated by Brahma
Related Gene 1 Dependent Chromatin Remodeling. Endocrinology 2018:en.2018-
00128-en.2018-
13. Molinaro E, Romei C, Biagini A, Sabini E, Agate L, Mazzeo S, et al. Anaplastic
thyroid carcinoma: from clinicopathology to genetics and advanced therapies.
Nature Reviews Endocrinology 2017;13:644
14. Martinez-Iglesias O, Garcia-Silva S, Regadera J, Aranda A. Hypothyroidism
enhances tumor invasiveness and metastasis development. PLoS One
2009;4:e6428
15. Lopez-Mateo I, Alonso-Merino E, Suarez-Cabrera C, Park JW, Cheng SY,
Alemany S, et al. The thyroid hormone receptor beta inhibits self-renewal
capacity of breast cancer stem cells. Thyroid : official journal of the American
Thyroid Association 2019
76
16. Yen C-F, Wang H-S, Lee C-L, Liao S-K. Roles of integrin-linked kinase in cell
signaling and its perspectives as a therapeutic target. Gynecology and Minimally
Invasive Therapy 2014;3:67-72
17. Parker BS, Rautela J, Hertzog PJ. Antitumour actions of interferons: implications
for cancer therapy. Nat Rev Cancer 2016;16:131-44
18. Xing M. Molecular pathogenesis and mechanisms of thyroid cancer. Nat Rev
Cancer 2013;13:184-99
19. Giuliani C, Bucci I, Napolitano G. The Role of the Transcription Factor Nuclear
Factor-kappa B in Thyroid Autoimmunity and Cancer. Frontiers in endocrinology
2018;9:471
20. Porlan E, Vidaurre OG, Rodriguez-Pena A. Thyroid hormone receptor-beta (TR
beta 1) impairs cell proliferation by the transcriptional inhibition of cyclins D1, E
and A2. Oncogene 2008;27:2795-800
21. Wortel IMN, van der Meer LT, Kilberg MS, van Leeuwen FN. Surviving Stress:
Modulation of ATF4-Mediated Stress Responses in Normal and Malignant Cells.
Trends in endocrinology and metabolism: TEM 2017;28:794-806
22. Landa I, Ibrahimpasic T, Boucai L, Sinha R, Knauf JA, Shah RH, et al. Genomic
and transcriptomic hallmarks of poorly differentiated and anaplastic thyroid
cancers. The Journal of Clinical Investigation 2016;126:1052-66
23. Lachmann A, Xu H, Krishnan J, Berger SI, Mazloom AR, Ma'ayan A. ChEA:
transcription factor regulation inferred from integrating genome-wide ChIP-X
experiments. Bioinformatics (Oxford, England) 2010;26:2438-44
77
24. Sanchez Calle A, Kawamura Y, Yamamoto Y, Takeshita F, Ochiya T. Emerging
roles of long non-coding RNA in cancer. Cancer science 2018;109:2093-100
25. Li H, Zhang B, Ding M, Lu S, Zhou H, Sun D, et al. C1QTNF1-AS1 regulates the
occurrence and development of hepatocellular carcinoma by regulating miR-221-
3p/SOCS3. Hepatol Int 2019;13:277-92
26. Li J, Wu QM, Wang XQ, Zhang CQ. Long Noncoding RNA miR210HG Sponges
miR-503 to Facilitate Osteosarcoma Cell Invasion and Metastasis. DNA Cell Biol
2017;36:1117-25
27. Lu Z, Li Y, Che Y, Huang J, Sun S, Mao S, et al. The TGFbeta-induced lncRNA
TBILA promotes non-small cell lung cancer progression in vitro and in vivo via
cis-regulating HGAL and activating S100A7/JAB1 signaling. Cancer letters
2018;432:156-68
28. Sun Y, Jin SD, Zhu Q, Han L, Feng J, Lu XY, et al. Long non-coding RNA
LUCAT1 is associated with poor prognosis in human non-small lung cancer and
regulates cell proliferation via epigenetically repressing p21 and p57 expression.
Oncotarget 2017;8:28297-311
29. Zhao D, Dong JT. Upregulation of Long Non-Coding RNA DRAIC Correlates
with Adverse Features of Breast Cancer. Noncoding RNA 2018;4
30. Yang Y, Zhao Y, Hu N, Zhao J, Bai Y. lncRNA KIAA0125 functions as a tumor
suppressor modulating growth and metastasis of colorectal cancer via Wnt/beta-
catenin pathway. Cell Biol Int 2019
78
31. Zhang DY, Zou XJ, Cao CH, Zhang T, Lei L, Qi XL, et al. Identification and
Functional Characterization of Long Non-coding RNA MIR22HG as a Tumor
Suppressor for Hepatocellular Carcinoma. Theranostics 2018;8:3751-65
32. Wang H, Guan Z, He K, Qian J, Cao J, Teng L. LncRNA UCA1 in anti-cancer
drug resistance. Oncotarget 2017;8:64638-50
33. Yang XZ, Cheng TT, He QJ, Lei ZY, Chi J, Tang Z, et al. LINC01133 as ceRNA
inhibits gastric cancer progression by sponging miR-106a-3p to regulate APC
expression and the Wnt/beta-catenin pathway. Mol Cancer 2018;17:126
34. Lin YH, Huang YH, Wu MH, Wu SM, Chi HC, Liao CJ, et al. Thyroid hormone
suppresses cell proliferation through endoglin-mediated promotion of p21
stability. Oncogene 2013;32:3904-14
35. Nagayama Y, Shimamura M, Mitsutake N. Cancer Stem Cells in the Thyroid.
Front Endocrinol (Lausanne) 2016;7:20
36. Cancer Genome Atlas Research N. Integrated genomic characterization of
papillary thyroid carcinoma. Cell 2014;159:676-90
37. Landa I, Pozdeyev N, Korch C, Marlow LA, Smallridge RC, Copland JA, et al.
Comprehensive Genetic Characterization of Human Thyroid Cancer Cell Lines: A
Validated Panel for Preclinical Studies. Clinical cancer research : an official
journal of the American Association for Cancer Research 2019;25:3141-51
38. Park JW, Zhao L, Willingham M, Cheng S-y. Oncogenic mutations of thyroid
hormone receptor β. Oncotarget 2015;6:8115-31
39. Meissl K, Macho-Maschler S, Muller M, Strobl B. The good and the bad faces of
STAT1 in solid tumours. Cytokine 2017;89:12-20
79
40. Lynch RA, Etchin J, Battle TE, Frank DA. A small-molecule enhancer of signal
transducer and activator of transcription 1 transcriptional activity accentuates the
antiproliferative effects of IFN-gamma in human cancer cells. Cancer research
2007;67:1254-61
41. Garcia-Silva S, Aranda A. The thyroid hormone receptor is a suppressor of ras-
mediated transcription, proliferation, and transformation. Molecular and cellular
biology 2004;24:7514-23
42. Yadav RK, Chae SW, Kim HR, Chae HJ. Endoplasmic reticulum stress and
cancer. J Cancer Prev 2014;19:75-88
43. Nowsheen S, Yang ES. The intersection between DNA damage response and cell
death pathways. Experimental oncology 2012;34:243-54
44. Pozdeyev N, Gay LM, Sokol ES, Hartmaier R, Deaver KE, Davis S, et al. Genetic
Analysis of 779 Advanced Differentiated and Anaplastic Thyroid Cancers.
Clinical cancer research : an official journal of the American Association for
Cancer Research 2018;24:3059-68
45. Fallahi P, Ferrari SM, Piaggi S, Luconi M, Cantini G, Gelmini S, et al. The
paramount role of cytokines and chemokines in papillary thyroid cancer: a review
and experimental results. Immunol Res 2018;66:710-22
46. Selzer E, Wilfing A, Sexl V, Freissmuth M. Effects of type I-interferons on
human thyroid epithelial cells derived from normal and tumour tissue. Naunyn
Schmiedebergs Arch Pharmacol 1994;350:322-8
80
47. Argiris A, Agarwala SS, Karamouzis MV, Burmeister LA, Carty SE. A phase II
trial of doxorubicin and interferon alpha 2b in advanced, non-medullary thyroid
cancer. Invest New Drugs 2008;26:183-8
48. Bayat Mokhtari R, Homayouni TS, Baluch N, Morgatskaya E, Kumar S, Das B,
et al. Combination therapy in combating cancer. Oncotarget 2017;8:38022-43
49. Ljubas J, Ovesen T, Rusan M. A Systematic Review of Phase II Targeted Therapy
Clinical Trials in Anaplastic Thyroid Cancer. Cancers (Basel) 2019;11
50. Hartmann K. Thyroid Disorders in the Oncology Patient. J Adv Pract Oncol
2015;6:99-106
81
CHAPTER 3: The Thyroid Hormone Receptor-RUNX2 Axis: A Novel Tumor
Suppressive Pathway in Breast Cancer.
3.1. Abstract
Metastatic breast cancer is refractory to conventional therapies and an end stage
disease. RUNX2 is a transcription factor that becomes oncogenic when aberrantly
expressed in multiple tumor types, including breast cancer, supporting tumor progression
and metastases. Our previous work demonstrated that the thyroid hormone receptor beta
(TRβ) inhibits RUNX2 expression and tumorigenic characteristics in thyroid cells. As
TRβ is a tumor suppressor, we investigated the compelling question whether TRβ also
regulates RUNX2 in breast cancer. The Cancer Genome Atlas indicates that TRβ
expression is decreased in the most aggressive basal-like subtype of breast cancer. We
established that modulated levels of TRβ results in corresponding changes in the high
levels of RUNX2 expression in metastatic, basal-like breast cells. The MDA-MB-231
triple negative breast cancer cell line exhibit low expression of TRβ and high levels of
RUNX2. Increased expression of TRβ decreased RUNX2 levels. The thyroid hormone
mediated suppression of RUNX2 is TRβ specific as TRα overexpression failed to alter
RUNX2 expression. Consistent with these findings, knock-down of TRβ in non-tumor
MCF10A mammary epithelial-like cells results in an increase in RUNX2 and RUNX2
target genes. Mechanistically, TRβ directly interacts with the proximal promoter of
RUNX2 through a thyroid hormone response element to reduce promoter activity. The
TRβ suppression of the oncogene RUNX2 is a signaling pathway shared by thyroid and
breast cancers.
82
Implications: Our findings provide a novel mechanism for TRβ-mediated tumor
suppression in breast cancers. This pathway may be common to many solid tumors and
impact treatment for metastatic cancers.
3.2. Introduction
Breast cancer is the most commonly diagnosed malignancy in women worldwide
[1]. In the United States, one in eight women are expected to develop the disease over the
course of their lives [2]. Endocrine therapies that target the estrogen receptor (ERα) are a
cornerstone of breast cancer treatment for most patients. Yet, these therapies often fail, as
a consequence of distinct resistance pathways. Non-steroid nuclear hormone receptors
have emerged as diagnostic and therapeutic targets in breast cancer, yet the functional
mechanistic and clinically relevant roles of most of this family are minimally understood
[3]. Notably, several lines of evidence from gain of function experiments indicate that
thyroid hormone receptor beta (TRβ) exhibits tumor suppressor activity in breast cancer.
In luminal A MCF7 cells, re-expression of TRβ reduced xenograft tumor mass and pro-
oncogenic STAT3 signaling [4]. Similar results were observed in triple negative MDA-
MB-468 cells. TRβ expression reduced metastases and angiogenesis [5]; further,
expression of TRβ repressed of PI3K signaling and induced apoptosis [6]. Additionally,
TRβ is correlated with improved disease-free survival in both BRCA associated tumors
and in triple negative breast cancer [7, 8]. This may be in part due to increased
sensitization to chemotherapeutics [8], necessitating a thorough understanding of the
mechanisms by which TRβ suppresses tumor growth.
83
TRβ also exhibits tumor suppressor activity in thyroid cancer [9], a disease with a
link to breast cancer. Women who develop thyroid cancer are more likely to develop
breast cancer as a second primary tumor and patients with breast cancer are at increased
risk of developing thyroid cancer [10-13]. Further understanding of either of these tumor
types may reveal important insights into the predisposition for the other disease as well as
insights into how both tumor types develop. Reciprocal synergies between these tumors
may be highly informative. Intriguingly, bone is one of the most common distal sites of
metastases in breast cancer [14] and is the second most common site in thyroid
metastases [15]. We recently established a novel tumor suppression pathway by which
the master regulator of osteoblast development, RUNX2, which functions oncogenically
in cancer and promotes invasion and metastasis in thyroid cancer [16, 17], is repressed by
TRβ in thyroid cells [18, 19]. Addition of the ligand, triiodothyronine (T3), enhances the
TRβ mediated transcriptional events, reinforcing this novel pathway. In breast cancer,
RUNX2 drives tumor progression, promoting proliferation and distal metastasis [20, 21]
in part through the upregulation of genes critical to the process of invasion, including
VEGF, OPN, and matrix metalloproteases (MMPs) [17, 22-26]. These findings indicate
that the T3-TRβ-RUNX2 pathway could be active in breast cancer as well as in thyroid
cancer.
Unlike in thyroid cells where the dominant thyroid hormone receptor is TRβ, in
breast cells TRα expression is robust. Although not yet well-defined, TR, in contrast to
TRβ, may be associated with breast tumorigenesis. High TRα expression in BRCA1-
associated breast tumors correlates with a poor prognosis [7]. It has been reported that
84
elevated levels of the splice variant TRα1 of TRα are associated with a poor prognosis
and decreased patient survival [27].
A compelling question is whether the TRβ-RUNX2 signaling is active in breast as
well as thyroid cancer. Given that T3 activates both TRβ and TRα, and that TRα
expression is robust in breast cancer cells our experimental strategy was to determine
whether one or both TRs are responsible for repression of RUNX2 in breast cancer cells.
Our results establish that TRβ suppresses the oncogenic RUNX2 activity in breast cancer
cells. These findings demonstrate that the suppressive action of T3 is mediated through
TRβ but not TRα and support mechanistic linkage of thyroid hormone control with breast
cancer activation and repression as well as provide potential therapeutic targets that are
based on selective modifications in thyroid hormone receptor relationships.
3.3. Materials and Methods
Cell Culture and Treatments.
MCF10A cells were grown in DMEM/F-12 (1:1) (Hyclone), supplemented with
5% horse serum (Gibco), human insulin (10 µg/ml), human EGF (20 ng/ml), cholera
toxin (100 ng/ml), hydrocortisone (0.5 µg/ml), and L-glutamine (2 mM) (Millipore
Sigma). MDA-MB-231 were maintained in αMEM supplemented with 10% fetal bovine
serum (Life Technologies), and L-glutamine (2 mM). Both cell lines were grown in the
presence of penicillin-streptomycin (200 IU/L) (Cellgro/Mediatech). Cells were
maintained at 37°C, 5% CO2, and 100% humidity. For hormone and drug treatments,
cells were maintained in charcoal stripped serum (Sigma). MCF10A and MDA-MB-231
85
cells were purchased from American Type Culture Collection and authenticated via Short
Tandem Repeat analysis in January 2018.
Transient Transfections and Cloning Transfections were performed using
Lipofectamine 3000 (Thermo Scientific) following manufacturer’s directions. The
pDEST515-FLAG-THRB plasmid is the same used in prior work, as was the negative
control vector [18]. We cloned pDEST515-FLAG-THRA using MCF10A cDNA
(Appendix A-1). The amplicon was purified from an agarose gel with the Monarch® Gel
Extraction Kit (New England Biolabs) and both the pDEST515-FLAG-THRB backbone
vector and the THRA amplicon were digested with HindIII and BamHI (New England
Biolabs). The THRB cds dropped out from the backbone and the THRA cds
corresponding to the TRα1 variant was ligated into the vector. The identity of
pDEST515-FLAG-THRA was confirmed by Sanger sequencing.
Immunoblot.
Proteins were isolated from whole cells in lysis buffer (20mM Tris-HCl, pH 8,
137mM NaCl, 10% glycerol, 1% Triton X-100, and 2mM EDTA) containing Halt
Protease Inhibitor Cocktail (Thermo Scientific 78410) as previously described [19].
Nuclear proteins were prepared with NE-PER Nuclear and Cytoplasmic extraction
reagents (Thermo Scientific 78833) per manufacturer’s protocol. Proteins were resolved
by polyacrylamide gel electrophoresis on Novex 10% Tris-glycine gels (Invitrogen) and
immobilized onto Protran nitrocellulose membranes (GE Healthcare) by electroblot (Bio-
Rad Laboratories). Specific proteins were detected by immunoblotting with the indicated
antibodies (Appendix A-2). Immunoreactive proteins were detected by enhanced
chemiluminescence (GE Healthcare), visualized by VersaDoc MP3000 (Bio-Rad
86
Laboratories), and intensities were quantified by Image Lab (Bio-Rad Laboratories).
RNA Extraction and Quantitative Real-Time PCR (qRT-PCR).
Total RNA was extracted using RNeasy Plus Kit (Qiagen) according to
manufacturer’s protocol. cDNA was then generated using 5X RT Mastermix (ABM).
Gene expression was quantified by qRT-PCR using 2X BrightGreen Mastermix (ABM)
on a QuantStudio 3 real-time PCR system (Applied Biosystems). Primers are indicated in
Appendix B-1. Fold change in gene expression compared to endogenous control GAPDH
was calculated using the ddCT method.
siRNA Transfection.
Loss of function was assayed by siRNA using On Target Plus siRNAs targeting
human TRβ (L-003447-00) with non-targeting siRNA (D-001810-10-20; GE Healthcare
Dharmacon) as control. Cells were plated at a density of 2.5 x 105 per well and
transfected with 50nM–200nM siRNA with Oligofectamine per manufacturer’s protocol
(Invitrogen/Life Technologies). The effect of knockdown of TRβ on endogenous RUNX2
and metastatic markers was determined after 24 hours
Chromatin Immunoprecipitation (ChIP).
Binding to RUNX2 chromatin was determined by ChIP-PCR. Cultured human
breast cells were cross-linked with 1% formaldehyde for 10 minutes, neutralized with
125mM glycine, rinsed twice with PBS, pelleted, and frozen. Cells were lysed in the
presence of protease inhibitors (Roche) and chromatin was extracted and sonicated to
200–500 bp in size using a Covaris S220 Focused-ultrasonicator. Sonicated cell lysate
was incubated with 2 g of indicated antibody (Appendix B-2) and rotated overnight at
4°C. Twenty microliters of Protein G Dynabeads (Invitrogen) were blocked in 0.5% BSA
87
and resuspended in lysis buffer, added to the lysate/antibody mix, and rotated at 4°C for 3
hours. Complexes were washed extensively, eluted, and incubated at 65°C overnight to
reverse cross-links. Samples were treated with ribonuclease A, incubated with Proteinase
K, phenol/chloroform extracted, and ethanol precipitated. Pellets were resuspended in 70-
L 10mM Tris-HCl, pH 8. Fold binding over IgG was determined by qRT-PCR.
Reporter Assay.
Constructs were described in a prior publication [19]. We co-transfected the -763
to -16 pGL3 luciferase reporter plasmid with pDEST515-FLAG-THRB in MCF10A and
MDA-MB-231 cells and recorded luminescence after 48 hours as previously described.
SV40 renilla construct was omitted due to reports of functional thyroid hormone response
elements (TRE) [28].
DNA Pulldown Assay.
The assay performed was as described in a published protocol with the following
optimizations [29]. MyOne T1 Streptavidin beads (Invitrogen) were rinsed twice with
binding buffer (20 mM HEPES, 30 mM KCl, 1 mM EDTA, 10 mM (NH4)2SO4, 1 mM
DTT, 0.2% (v/v) Tween-20, pH 7.6), incubated with 5 ng of biotinylated probe at 4°C for
1 hour, and then washed twice with binding buffer. 350 µg of nuclear protein extract was
precleared with beads and 8 µg of sheared herring sperm DNA (Promega) for 15 minutes
at room temperature. The lysate was combined with the probe-bound beads. Volume was
brought to 0.75 ml with wash buffer (20 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA,
0.5% (v/v) NP-40, pH 7.5) and KCl was added to a final concentration of 300 mM for
incubation at 4°C for 1.5 hours. The beads were then washed three times with wash
buffer, once with water, and proteins were eluted for immunoblot.
88
Statistics.
All statistical analyses were performed using GraphPad Prism software. Unless
otherwise indicated an unpaired T-test (p < 0.05) was used for comparisons between two
sets, a 2-way ANOVA followed by a multiple comparisons test (p < 0.05) was used to
compare groups, and data are represented as means standard deviation.
3.4. Results
3.4.1 TR expression is reduced in aggressive breast cancer
Basal-like breast tumors exhibit elevated expression of RUNX2 [30]. We have
previously reported an inverse relationship between TRβ and RUNX2 in thyroid cancer,
providing a basis for the compelling question if a similar dynamic relationship is present
in breast cancer. Both TRα and TRβ are both expressed in normal breast tissue [31],
necessitating examination of the expression levels for the THRA and THRB genes. We
interrogated RNA expression data from The Cancer Genome Atlas PanCancer Atlas
using the cBioPortal interface [32, 33] (Fig 11). THRB was significantly repressed in the
most aggressive basal-like tumors compared to other molecular subtypes. THRA
expression was strikingly reduced in the basal-like breast tumors, although there was also
increased expression of THRA in HER2 positive tumors. Similar to THRB, THRA
expression does not vary significantly in the differentiated normal-like, luminal A, and
luminal B cancers. In conclusion, the most aggressive basal-like breast cancers exhibit
the lowest expression of both TRs.
89
Figure 11: Baseline expression of thyroid hormone receptors and RUNX2 in breast cells. A)
THRB RNA expression is significantly reduced in basal-like breast tumors in comparison to all other
subtypes. B) THRA RNA expression is significantly repressed in Basal-like breast cancers and greatest in
HER2 expressing tumors. Other significant differences are indicated in the figure. C) MCF10A expresses
higher levels of THRB mRNA than MDA-MB-231 (n=4, p<0.05). Both MCF10A and MDA-MB-231
express comparable THRA mRNA (n=4, p>0.05). D) MCF10A express greater levels of TRβ protein than
MDA-MB-231, while MDA-MB-231 express greater levels of TRα protein than MCF10A cells as
measured by immunoblot (n=6, p<0.05). * p<0.05, *** p<0.001, **** p<0.0001, n.s. not significant
3.4.2 Thyroid hormone repression of RUNX2 is driven by TRβ.
MCF10A mammary epithelial-like cells and MDA-MB-231 triple negative breast
cancer cells were examined to determine whether treatment with T3 can modify RUNX2
expression. Following 24 hours of treatment with 10-8 M of T3 to model euthyroid serum
conditions, RNA was isolated from the cells for analysis by qPCR and protein for
immunoblot analysis. T3 treatment significantly decreased RUNX2 mRNA and protein
90
levels in both cell lines after 24 hours (Fig 12 and Appendix B-3).
Figure 12: RUNX2 expression is reduced by Thyroid Hormone Treatment. MCF10A and
MDA-MB-231 were treated with T3 at 10-8 M for 24 hours. A) Expression of RUNX2 was measured by RT-
qPCR (MCF10A: n=6, p<0.001. MDA-MB-231: n=6, p<0.01). B) RUNX2 protein levels were determined
by immunoblot (MCF10A: n=9, p<0.01. MDA-MB-231: n=9, p<0.05). * p <0.05, ** p<0.01, *** p<0.001
Unlike in the thyroid cells where we previously characterized the action of T3 on
expression of the RUNX2 gene, breast cells express both TRα and TRβ. The DNA
binding domain of TRs is highly conserved with significant homology between both TRs
resulting in competency for both receptors to bind the same canonical response element
on chromatin [34], however there are genes that are selectively regulated by a single TR
[35-37]. To evaluate whether one or both TRs can repress RUNX2 expression MDA-MB-
231 cells were transiently transfected with vectors that overexpress either TRα or TRβ.
When RUNX2 protein was quantitated by immunoblot analysis, TRβ expression was
observed to reduce RUNX2 levels. However, when cells were transfected with a TRα
91
vector, RUNX2 expression did not change (Fig 13). To determine whether TRα could act
as a negative regulator of TRβ, TRα was also overexpressed in MCF10A cells, which
robustly express TRβ. No change to RUNX2 was observed, showing that increased levels
of TRα did not inhibit the suppressive activity of TRβ. These results provide a functional
indication of the specificity for TRβ regulation of RUNX2 in breast cancer.
Figure 13: TRβ, and not TRα, Represses RUNX2. A) Transient transfection into MDA-MB-231
cells of a plasmid encoding TRβ significantly reduced RUNX2 levels (n=6, p<0.01), however transfection
with a TRα vector did not significantly alter RUNX2 protein expression (n=6, p>0.05) with B)
representative immunoblots. Transient transfection of TRα did not alter RUNX2 mRNA levels in C) and
MCF10A D) MDA-MB-231 cells. ** p <0.01, n.s. not significant
To confirm that TRβ can repress RUNX2, TRβ expression was knocked down by
siRNA in the normal breast cell line MCF10A (Fig 14). Decreased levels of TRβ
92
increased RUNX2 expression, and we also observed a significant increase in expression
of the RUNX2 upregulated genes CCND1 [38], MMP9 [22], and VEGFA [24, 25] were
also observed after siRNA knockdown of TRβ. Importantly, each of these have a
demonstrated role in the process of tumorigenesis. These results reinforce the TRβ
repression of RUNX2 expression with the functional consequence of repressing RUNX2
driven pro-tumorigenic activity.
Figure 14: Knockdown of THRB in MCF10A enhances RUNX2 and RUNX2 activity. A)
Treatment of MCF10A with siRNA against TRβ repressed its expression in the cells as confirmed by
immunoblot. B) Loss of TRβ mRNA correlated with significantly increased RUNX2 expression as
measured by RT-qPCR (n=6, P<0.05). There was also an observed increase in the RUNX2 upregulated
genes CCND1 (n=4), MMP9 (n=4) and VEGFA (n=4). * p<0.05
3.4.3 TRβ binds to the RUNX2 promoter
We previously mapped TREs in the P1 promoter of the RUNX2 gene and
demonstrated that TRβ directly interacts with these regions in thyroid cells [19].
93
Following ChIP from MCF10A cells there was significant enrichment of the RUNX2
promoter utilizing a TRβ antibody as compared to IgG control (Fig 15A). This was
further validated by a DNA pulldown assay utilizing biotinylated oligonucleotides
containing a previously characterized TRE. Incubation of this oligonucleotide with
MCF10A lysate revealed TRβ binding, which was ablated when the TRE was mutated
(Fig 15B). Additionally, a luciferase reporter vector was co-transfected with a TRβ
expression vector. Nominal, but insignificant repression was observed in MCF10A, in
contrast to the MDA-MB-231 cells that express very low levels of endogenous TRβ
where there was significant repression (Fig 15C). Taken together, these data provide
evidence for direct interaction between TRβ and the RUNX2 gene to alter gene
expression.
Figure 15: TRβ Binds to the RUNX2 Promoter. A) Chromatin immunoprecipitation-PCR of
RUNX2 in MCF10A cells (n=3, p<0.05). B) Biotinylated RUNX2 proximal promoter successfully pulls
down TRβ from MCF10A lysate as shown by immunoblot. Mutation of the TRE ablated this interaction. C)
Cotransfection of an expression vector and luciferase reporter vector in breast cell lines. Nominal
repression of the promoter due to TRβ overexpression was observed in MCF10A (n=2, P>0.05) and MDA-
MB-231 showed significant repression (n=2, p<0.01). * p<0.05, ** p<0.01
94
3.5. Discussion
These results demonstrate that T3 mediated RUNX2 repression in breast cancer is
facilitated by TRβ and not via TRα. Importantly, we have identified a gene that is
preferentially regulated by TRβ and not TRα. This specificity provides a mechanistic
insight into the observed TRβ tumor suppressor role and the putative oncogenic role of
TRα [7]. We have also demonstrated a common pathway in breast and thyroid cancers,
which demonstrates the value of this pathway for further understanding the observed
epidemiological link between both diseases [10-13].
To understand the etiology of the link between breast and thyroid tumors, it is
vital to understand the actions of shared tumor suppressors and oncogenes. The
mechanisms by which TRβ represses tumorigenesis is an important question in tumor
biology and pathology but minimally understood. Previously characterized mechanisms
of TRβ-mediated tumor suppression in breast cancer focused on regulation of the
PI3K/Akt [39], Ras/MAPK [40], and JAK2-STAT3 [4] pathways, and induction of
mesenchymal-to-epithelial transitions [41]. In thyroid cancer, TRβ suppresses
tumorigenesis through PI3K/Akt [42] and RUNX2 [19]. Our work here demonstrates that
in addition to shared tumor suppression by PI3K/Akt, TRβ acts to repress RUNX2
expression in both cell types. The Ras/MAPK and JAK2-STAT3 pathways and epithelial
characteristics are all features regulated by TRβ in breast cancer that merit further
investigation in thyroid cancer. Revealing common features can aid in understanding the
metachronous nature of the two diseases.
The T3-TRβ-RUNX2 axis could be a common signaling pathway in a variety of
cancers. In addition to the role of RUNX2 in breast and thyroid tumorigenesis, RUNX2
95
has been proposed to contribute to the development of prostate cancer [43], liver
carcinoma [44], colon cancer [45], and melanoma [46]. TRβ and/or T3 has been shown to
have anti-tumor roles in these cancers as well. Overexpression of TRβ reduces cellular
proliferation in vivo in hepatocellular carcinoma [5]. Thyroid hormone also induces
differentiation of colon cancer stem cells [47]. In melanoma, a loss of heterozygosity of
the THRB gene has been observed [48], consistent with functioning as a tumor suppressor
gene, and T3 stimulation of dendritic cells represses melanoma tumor size in a xenograft
[49]. These findings suggest that the T3-TRβ-RUNX2 signaling program may be
operational in a spectrum of tissues.
This work expands the understanding for involvement of the TRs in
tumorigenesis and are consistent with the potential for TRs to improve diagnostic or
prognostic capabilities for cancer diagnosis and treatment responsiveness. Aside from the
treatment of existing thyroid disorders or to alleviate side effects from therapeutics, direct
modulation of thyroid hormone levels is undesirably as potential confounding effects
must be considered. TRα1 is associated with more advanced breast tumors [7, 27] and
potential side effects for the cardiovascular system, that includes tachycardia and
hypertension which result from TRα signaling in the heart [50]. Additionally, the αVβ3
integrin is responsive to thyroid hormones, primarily thyroxine, promoting pro-oncogenic
activity through the MAPK pathway [51, 52] and, through studies utilizing prostate
cancer cells and osteoblasts, it was shown that αVβ3 induces an increase in expression
and transcriptional activity of RUNX2 [53, 54]. However, it is not clear whether αVβ3
can regulate RUNX2 in response to thyroid hormones. Encouragingly, thyromimetic
compounds have been developed as selective agonists to TRβ [55, 56] and may stimulate
96
TRβ tumor suppressor activity in cancer. There is encouraging evidence that
thyromimetics can enhance the sensitivity of aggressive breast cancer cells to certain
chemotherapies [8]. Our work demonstrates another mechanism by which TRβ
pharmacological stimulation may be beneficial.
In closing, our findings demonstrate a tumor suppressive function of TRβ shared
by multiple tissue types. The T3-TRβ-RUNX2 pathway is active in a variety of cancers.
Understanding the role of this signaling in tumorigenesis may be leveraged for
development of novel clinical interventions with high specificity and minimal off-target
consequences.
References
1. Bray, F., et al. 2018 Global cancer statistics 2018: GLOBOCAN estimates of
incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J
Clin 68(6): 394-424.
2. DeSantis, C., et al. 2014 Breast cancer statistics, 2013. CA Cancer J Clin 64(1):
52-62.
3. Doan, T.B., J.D. Graham, and C.L. Clarke. 2017 Emerging functional roles of
nuclear receptors in breast cancer. J Mol Endocrinol 58(3): R169-R190.
4. Park, J.W., L. Zhao, and S.Y. Cheng. 2013 Inhibition of estrogen-dependent
tumorigenesis by the thyroid hormone receptor beta in xenograft models. Am J
Cancer Res 3(3): 302-11.
97
5. Martinez-Iglesias, O., et al. 2009 Thyroid hormone receptor beta1 acts as a potent
suppressor of tumor invasiveness and metastasis. Cancer Res 69(2): 501-9.
6. Park, J.W., et al. 2015 Oncogenic mutations of thyroid hormone receptor beta.
Oncotarget 6(10): 8115-31.
7. Heublein, S., et al. 2015 Thyroid Hormone Receptors Predict Prognosis in
BRCA1 Associated Breast Cancer in Opposing Ways. PLoS One 10(6):
e0127072.
8. Gu, G., et al. 2015 Targeting thyroid hormone receptor beta in triple-negative
breast cancer. Breast Cancer Res Treat 150(3): 535-45.
9. Aranda, A., et al. 2009 Thyroid receptor: roles in cancer. Trends Endocrinol
Metab 20(7): 318-24.
10. Nielsen, S.M., et al. 2016 The Breast-Thyroid Cancer Link: A Systematic Review
and Meta-analysis. Cancer Epidemiol Biomarkers Prev 25(2): 231-8.
11. Joseph, K.R., S. Edirimanne, and G.D. Eslick. 2015 The association between
breast cancer and thyroid cancer: a meta-analysis. Breast Cancer Res Treat
152(1): 173-181.
12. Bolf, E.L., B.L. Sprague, and F.E. Carr. 2019 A Linkage Between Thyroid and
Breast Cancer: A Common Etiology? Cancer Epidemiol Biomarkers Prev 28(4):
643-649.
13. An, J.H., et al. 2015 A Possible Association Between Thyroid Cancer and Breast
Cancer. Thyroid 25(12): 1330-8.
14. Lee, Y.T. 1983 Breast carcinoma: pattern of metastasis at autopsy. J Surg Oncol
23(3): 175-80.
98
15. Durante C, H.N., Baudin E, Leboulleux S, Hartl D, Travagli JP, Caillou B, Ricard
M, Lumbroso JD, De Vathaire F, Schlumberger M. . 2006 Long-term outcome of
444 patients with distant metastases from papillary and follicular thyroid
carcinoma: benefits and limits of radioiodine therapy. . J Clin Endocrinol Metab
91(8): 2892-2899.
16. Sancisi, V., et al. 2012 Runx2 isoform I controls a panel of proinvasive genes
driving aggressiveness of papillary thyroid carcinomas. J Clin Endocrinol Metab
97(10): E2006-15.
17. Niu, D.F., et al. 2012 Transcription factor Runx2 is a regulator of epithelial-
mesenchymal transition and invasion in thyroid carcinomas. Lab Invest 92(8):
1181-90.
18. Gillis, N.E., et al. 2018 Thyroid Hormone Receptor β Suppression of RUNX2 is
Mediated by Brahma Related Gene 1 Dependent Chromatin Remodeling.
Endocrinology: en.2018-00128-en.2018-00128.
19. Carr, F.E., et al. 2016 Thyroid Hormone Receptor-beta (TRbeta) Mediates Runt-
Related Transcription Factor 2 (Runx2) Expression in Thyroid Cancer Cells: A
Novel Signaling Pathway in Thyroid Cancer. Endocrinology 157(8): 3278-92.
20. Ferrari, N., et al. 2013 RUNX2 in mammary gland development and breast
cancer. J Cell Physiol 228(6): 1137-42.
21. Pande, S., et al. 2013 Oncogenic cooperation between PI3K/Akt signaling and
transcription factor Runx2 promotes the invasive properties of metastatic breast
cancer cells. J Cell Physiol 228(8): 1784-92.
99
22. Pratap, J., et al. 2005 The Runx2 osteogenic transcription factor regulates matrix
metalloproteinase 9 in bone metastatic cancer cells and controls cell invasion. Mol
Cell Biol 25(19): 8581-91.
23. Inman, C.K. and P. Shore. 2003 The osteoblast transcription factor Runx2 is
expressed in mammary epithelial cells and mediates osteopontin expression. J
Biol Chem 278(49): 48684-9.
24. Papachristou, D.J., G.I. Papachristou, and O.A. Papaefthimiou. 2005 The MAPK-
AP-1/-Runx2 signalling axes are implicated in chondrosarcoma pathobiology
either independently or via up-regulation of VEGF. Histopathology 47: 565-574.
25. Sun, X., L. Wei, and Q. Chen. 2009 HDAC4 represses vascular endothelial
growth factor expression in chondrosarcoma by modulating RUNX2 activity. J
Biol Chem 284: 21881-21890.
26. Akech, J., et al. 2010 Runx2 association with progression of prostate cancer in
patients: mechanisms mediating bone osteolysis and osteoblastic metastatic
lesions. Oncogene 29(6): 811-21.
27. Jerzak, K.J., et al. 2015 Thyroid hormone receptor alpha in breast cancer:
prognostic and therapeutic implications. Breast Cancer Res Treat 149(1): 293-
301.
28. Kollar, A., et al. 2016 Different Types of Luciferase Reporters Show Distinct
Susceptibility to T3-Evoked Downregulation. Thyroid 26(1): 179-82.
29. Wu, K.K. 2006 Analysis of protein-DNA binding by streptavidin-agarose
pulldown. Methods Mol Biol 338: 281-90.
100
30. McDonald, L., et al. 2014 RUNX2 correlates with subtype-specific breast cancer
in a human tissue microarray, and ectopic expression of Runx2 perturbs
differentiation in the mouse mammary gland. Dis Model Mech 7(5): 525-34.
31. Uhlen, M., et al. 2015 Proteomics. Tissue-based map of the human proteome.
Science 347(6220): 1260419.
32. Gao, J., et al. 2013 Integrative analysis of complex cancer genomics and clinical
profiles using the cBioPortal. Sci Signal 6(269): pl1.
33. Cerami, E., et al. 2012 The cBio cancer genomics portal: an open platform for
exploring multidimensional cancer genomics data. Cancer Discov 2(5): 401-4.
34. Wu, Y. and R.J. Koenig. 2000 Gene regulation by thyroid hormone. Trends
Endocrinol Metab 11(6): 207-11.
35. Strait, K.A., L. Zou, and J.H. Oppenheimer. 1992 Beta 1 isoform-specific
regulation of a triiodothyronine-induced gene during cerebellar development.
Molecular endocrinology (Baltimore, Md.) 6(11): 1874-1880.
36. Nakajima, K., I. Tazawa, and Y. Yaoita. 2018 Thyroid Hormone Receptor α- and
β-Knockout Xenopus tropicalis Tadpoles Reveal Subtype-Specific Roles During
Development. Endocrinology 159(2): 733-743.
37. Denver, R.J., et al. 1999 Basic transcription element-binding protein (BTEB) is a
thyroid hormone-regulated gene in the developing central nervous system.
Evidence for a role in neurite outgrowth. The Journal of biological chemistry
274(33): 23128-23134.
38. Yamada, D., et al. 2018 RUNX2 Promotes Malignant Progression in Glioma.
Neurochem Res 43(11): 2047-2054.
101
39. Park, J.W., et al. 2015 Oncogenic mutations of thyroid hormone receptor β.
Oncotarget 6(10): 8115-8131.
40. Garcia-Silva, S. and A. Aranda. 2004 The thyroid hormone receptor is a
suppressor of ras-mediated transcription, proliferation, and transformation. Mol
Cell Biol 24(17): 7514-23.
41. Martinez-Iglesias, O., et al., Thyroid hormone receptor β1 acts as a potent
suppressor of tumor invasiveness and metastasis. 2009: Cancer Res. p. 501-509.
42. Kim, W.G., et al. 2014 Inhibition of tumorigenesis by the thyroid hormone
receptor beta in xenograft models. Thyroid 24(2): 260-9.
43. Altieri, D.C., et al. 2009 Prostate cancer regulatory networks. J Cell Biochem
107(5): 845-52.
44. Cao, Z., et al. 2017 The Expression and Functional Significance of Runx2 in
Hepatocellular Carcinoma: Its Role in Vasculogenic Mimicry and Epithelial-
Mesenchymal Transition. Int J Mol Sci 18(3).
45. Sase, T., et al. 2012 Runt-related transcription factor 2 in human colon carcinoma:
a potent prognostic factor associated with estrogen receptor. Int J Cancer 131(10):
2284-93.
46. Boregowda, R.K., et al. 2014 RUNX2 is overexpressed in melanoma cells and
mediates their migration and invasion. Cancer Lett 348(1-2): 61-70.
47. Cicatiello, A.G., R. Ambrosio, and M. Dentice. 2017 Thyroid hormone promotes
differentiation of colon cancer stem cells. Mol Cell Endocrinol 459: 84-89.
48. Sisley, K., et al., Loss of heterozygosity of the thyroid hormone receptor B in
posterior uveal melanoma. 1993: Melanoma Res. p. 457-461.
102
49. Alamino, V.A., et al. 2015 Antitumor Responses Stimulated by Dendritic Cells
Are Improved by Triiodothyronine Binding to the Thyroid Hormone Receptor
beta. Cancer Res 75(7): 1265-74.
50. Webb, P. 2004 Selective activators of thyroid hormone receptors. Expert Opin
Investig Drugs 13(5): 489-500.
51. Lin, H.Y., et al. 2015 Thyroid hormone and anti-apoptosis in tumor cells.
Oncotarget 6(17): 14735-43.
52. Davis, P.J., F. Goglia, and J.L. Leonard. 2016 Nongenomic actions of thyroid
hormone. Nat Rev Endocrinol 12(2): 111-21.
53. Gupta, A., W. Cao, and M.A. Chellaiah. 2012 Integrin alphavbeta3 and CD44
pathways in metastatic prostate cancer cells support osteoclastogenesis via a
Runx2/Smad 5/receptor activator of NF-kappaB ligand signaling axis. Mol
Cancer 11: 66.
54. Dai, Z., et al. 2014 Integrin alphavbeta3 mediates the synergetic regulation of
core-binding factor alpha1 transcriptional activity by gravity and insulin-like
growth factor-1 through phosphoinositide 3-kinase signaling. Bone 69: 126-32.
55. Chiellini, G., et al. 1998 A high-affinity subtype-selective agonist ligand for the
thyroid hormone receptor. Chem Biol 5(6): 299-306.
56. Ye, L., et al. 2003 Thyroid receptor ligands. 1. Agonist ligands selective for the
thyroid receptor beta1. J Med Chem 46(9): 1580-8.
103
CHAPTER 4: Common Tumor Suppressive Signaling of Thyroid Hormone
Receptor Beta in Breast and Thyroid Cancer Cells.
4.1. Abstract
An epidemiological link between breast cancer and thyroid cancer has been
established. Both of these diseases primarily impact women and prior history of one of
these tumors increases the chance of an individual developing the other cancer in the
future. Although the link has been established, the cause of the association is still
unknown. The thyroid hormone receptor beta (TRβ) is a tumor suppressor in both breast
and thyroid cancer and further understanding of the molecular mechanisms by which TRβ
abrogates tumorigenesis could aid in understanding the link between both malignancies.
Here, we introduce TRβ into the MDA-MB-468 basal-like breast cancer cell line and
perform RNA-sequencing to determine changes in transcriptomic signaling. The TRβ
expressing MDA-MB-468 cells exhibit a more epithelial character as determined by
PCA-PAM50 score and through repression of mesenchymal cytokeratins. The epithelial
to mesenchymal transition pathway is also significantly reduced. The MDA-MB-468
dataset was also compared to RNA sequencing results from the thyroid cancer line
SW1736 to determine which genes are TRβ regulated across both tissue types. Stearate
biosynthesis was revealed as upregulated from the shared gene set, a lipid which is
known to repress breast tumorigenesis. These data provide novel insights into the
molecular mechanism by which TRβ suppresses breast tumorigenesis and suggests a
common metabolic role in breast and thyroid cancer as well a role for TRβ in the
maintenance of epithelial cellular identity.
104
4.2. Introduction
A link has been established between breast cancer and thyroid cancer.
International studies show that patients with breast cancer are at an increased risk of
developing a future thyroid tumor and thyroid cancer increases the risk of breast cancer
(1-7). Both diseases are among the most diagnosed cancers in women, making
understanding this association an important public health concern. Breast cancer is the
most commonly diagnosed cancer in women and thyroid cancer is projected to be the 4th
most common cancer in the United States by 2030 and the 2nd most commonly
diagnosed cancer in women, after breast (8). Strikingly, there are no good explanations
available for the etiology of this association.
A common factor in both diseases is loss of expression of the thyroid hormone
receptor beta (TRβ) (9,10). TRβ is a nuclear hormone that is responsive to levels of
triiodothyronine (T3). It is capable of binding to thyroid hormone response elements
(TRE) both in the presence and absence of ligand in order to regulate transcription. The
tumor suppression activity of TRβ has been validated through in vitro and in vivo studies.
In xenograft experiments, restoration of TRβ expression limits tumor growth in follicular
thyroid cancer cell lines (11), in a luminal A breast cancer cell line (12), and in a basal-
like breast cancer cell line (13). Loss or mutation of TRβ also leads to the development of
tumors in mice (14,15). Notably, TRβ regulates pathways that are drivers of both breast
and thyroid cancer. This includes repression of PI3K signaling and repression of RUNX2
expression (9-11,16,17).
Our laboratory has recently performed an analysis of the TRβ transcriptome in an
anaplastic thyroid cancer (ATC) cell line. In this study, we combine that analysis with a
105
similar experiment performed in a basal-like breast cancer cell line, MDA-MB-468. TRβ
has previously been demonstrated to exert a strong anti-tumor effect in these cells by
independent laboratories (13,16,18). Briefly, the MDA-MB-468 cell line expresses very
low endogenous TRβ and through viral transduction multiple laboratories have been able
to restore TRβ expression exogenously. Increased expression of TRβ reduced the tumor
burden in vivo. Importantly, this anti-tumor activity included repression of growth
markers and increased anti-metastatic potential; mice with tumors expressing TRβ
exhibited fewer metastatic lesions than control animals (13,18). Additionally, when the
animals were rendered hypothyroid, the number of metastatic lesions in the animals
increased (18). These data are suggestive of a vital role for T3 in TRβ-mediated tumor
suppression. Transcriptomic analysis of the MDA-MB-468 cells demonstrated TRβ
regulates breast differentiation, invasive genes, and metabolic signaling in these cells.
When this analysis was compared to our prior analysis of ATC line SW1736 we were
able to further refine the TRβ regulome to define a set of genes regulated in both these
cell lines.
4.3. Methods
Cell Culture
MDA-MB-468 cells were maintained at 37°C, 5% CO2, and 100% humidity. The
cells were grown in αMEM supplemented with 10% fetal bovine serum (Life
Technologies), and L-glutamine (2 mM) as well as the addition of penicillin-streptomycin
(200 IU/L) (Cellgro/Mediatech). Identify of the cells was confirmed by short tandem
repeats via the Promega GenePrint10 System in the Advanced Genome Technologies
106
Core at the University of Vermont (May 2019). The cells were tested for mycoplasma by
PCR using 10 µM of each primer (May 2019) (Appendix C-1).
The MDA-MB-468 cells were transduced as previously described (19). Briefly,
viral particles containing pCDH-MSCV-EF1-GFP-Puro and pCDH-MSCV-EF1-GFP-
Puro-TRβ were generated in human embryo kidney 293 cells and the particles were used
to transduce the cells to express either the empty vector (468-EV) or overexpress TRβ
(468-TRβ). Following lentiviral transduction, the media was further supplemented with 1
µg/ml puromycin (Gold Bio).
Immunoblot
Protein was extracted from the cells by treatment with lysis buffer (20mM Tris-
HCl [pH 8], 137mM NaCl, 10% glycerol, 1% Triton X-100, and 2mM EDTA) containing
Protease Inhibitor Cocktail 78410 (Thermo Scientific). Following quantification by
Bradford assay, the resulting lysate was resolved by polyacrylamide gel electrophoresis
with 10% sodium dodecyl sulfate gels EC60752 (Life Technologies) and immobilized
onto nitrocellulose membranes (GE Healthcare) by electroblot (Bio-Rad Laboratories).
Membranes were probed for TRβ with the antibody MA1-216 (Thermo Scientific) and
for β-actin with MA5-15739 (Thermo Scientific). Blots were imaged using enhanced
chemiluminescence (Thermo Scientific) on a ChemiDoc XRS+ (Bio-Rad Laboratories).
RNA Extraction and Library Generation
468-EV and 468-TRβ cells were plated at 80% confluency and hormone starved
for 24 hours in phenol red free αMEM with charcoal-stripped fetal bovine serum. 10-8 M
T3 was added and incubated for 24 hours prior to sample collection. Total RNA was
extracted and purified using RNeasy Plus Kit (Qiagen) according to manufacturer’s
107
protocol. Purity of the total RNA samples was assessed via BioAnalyzer (Agilent) and
samples with a RIN score >7 were used for library construction. rRNA was depleted
using 1 μg of total RNA and strand-specific Illumina cDNA libraries were prepared using
the NEBNext Ultra II RNA library kit with 7 cycles of PCR (New England Biolabs).
Library quality was assessed by BioAnalyzer (Agilent) to ensure an average library size
of 300 bp and the absence of excess adaptors in each sample. RNA-Seq libraries were
pooled and sequenced with 50 bp single-end reads on the Illumina HiSeq 1500. Quality
scores across sequenced reads were assessed using FASTQC. All samples were high
quality. For alignment and transcript assembly, the sequencing reads were mapped to
hg38 using STAR. Sorted reads were counted using HTSeq and differential expression
analysis was performed using DESeq2. Genes with a p-value of <0.05 and a fold change
of >2 were considered differentially expressed and were used for further analysis through
Ingenuity Pathway Analysis (IPA) (Qiagen), Gene Set Enrichment Analysis (GSEA), and
Chromatin Immunoprecipitation Enrichment Analysis (ChEA)
(https://amp.pharm.mssm.edu/Enrichr/) (20).
4.4 Results
One of the major effects observed in the SW1736 cells was a TRβ-mediated
increase in differentiation markers (as discussed in chapter 3). TRβ has also been
demonstrated to reduce stemness in luminal breast cancer cell lines, further suggestive of
TRβ having a role in tumor differentiation (21). Following confirmation of TRβ
overexpression in the MDA-MB-468 cells we performed RNA sequencing in order to
determine the transcriptomic profile (Appendix C-2). Of interest to the question of
108
differentiation is expression of the PAM50 genes, which are used to determine breast
cancer intrinsic subtypes (22,23). We used the Principle Component Analysis-based
iterative PAM50 subtyping (PCA-PAM50) algorithm on our sequencing data to
quantitatively assess subtype scores for the different experimental conditions (Fig 16)
(24). The scores for the luminal A and luminal B subtype were greatest in the 468-TRβ
cells, particularly following T3 treatment. Additionally, there was a significant reduction
in the basal-like breast cancer score in the 468-TRβ cells treated with T3. Notably, there
was a 60% increase in expression of ESR1, a gene which expression effectively defines
the luminal subtypes of breast cancer. These results are suggestive of a decrease in the
aggressive, basal-like phenotype.
Figure 16: Thyroid Hormone Receptor Beta Alters Genes that Determine Breast Intrinsic Subtype.
Each sample of cells was evaluated to determine scoring for the different intrinsic subtypes of breast
cancer. A and B) TRβ increased the luminal subtype scores. C) The combination of TRβ and cognate ligand
reduced the basal-like score of these cells. D) Expression of ESR1 increased following T3 treatment in the
468-TRβ cells.
109
The changes in gene expression were further delineated by cluster analysis
(Figure 17). Using k-means clustering we separated the MDA-MB-468 differentially
expressed genes (DEGs) into 7 clusters representing different patterns of gene expression.
Analysis using IPA revealed alterations in cancer relevant pathways including interferon
signaling, glioblastoma multiforme signaling, and stearate biosynthesis. Interferon
induces anti-tumor activity through the stimulation of JAK1-STAT1 activity, which
upregulates genes that reduce proliferation and induce apoptosis (25). The IPA
glioblastoma multiforme signaling network incorporates multiple pro-tumor pathways
including MAPK, PI3K, and WNT signaling. Stearate biosynthesis results in increased
levels of the fatty acid stearic acid. Stearic acid has been shown to slow the growth of
breast tumors and induce apoptosis (26-29). Notable upstream regulators derived from
the IPA clusters include effectors within the interferon-JAK1-STAT1 pathway, primarily
from clusters 1, 4, and 6. Also predicted are the estrogen receptors and their cognate
ligand, β-estradiol.
110
Figure 17: Expression of Thyroid Hormone Receptor Beta Induced Alterations to the Transcriptome
and Signaling Networks. A) Cluster analysis of DEGs (p-value < 0.05 and an absolute log2FoldChange ≥
1) reveals distinct patterns of gene regulation. Clusters 1 and 3 are genes that can be repressed or induced by TRβ in absence of ligand. Clusters 2, 5, and 6 showcase genes that are T3 regulated in absence of
exogenous TRβ, however genes in clusters 5 and 6 are more strongly regulated when TRβ expression is
increased. The genes in clusters 4 and 7 are dependent upon both TRβ and T3 for differential expression. B)
Ingenuity Pathway Analysis (IPA) was utilized to determine which signaling networks were altered. Up to
two pathways form each cluster are represented, at p-value < 0.05 and absolute z-score >0. C) IPA was also
used to predict upstream regulators, up to 10 were selected for each cluster as determined by p-value with a
threshold of p-value < 0.05.
The effects that TRβ overexpression had on the transcriptome included both direct
111
regulation of genes (primary regulation) and, due to allowing 24 hours of signaling
following hormone treatment, for the directly regulated genes to exert additional changes
in gene signaling through downstream transcription factors (secondary regulation). In
order to determine putative secondary regulators the clusters were subjected to ChEA
(Figure 18) (20). None of the transcription factors overrepresented in the analysis were
induced or repressed at a level necessary to make the threshold to be considered a DEG,
however ESR1 expression was significantly altered as shown in Figure 16. Additionally,
SUZ12, SMAD4, GATA2, NELFE, and TRIM28 were uncovered from the equivalent
analysis performed in SW1736 cells (Appendix B-6). Of these, NELFE was found to be
repressed by TRβ in the thyroid cells (Appendix A-6), and is a transcription factor that
aids in the induction of epithelial-to-mesenchymal transition (EMT) in pancreatic cancer
(30). Additionally, GATA2 is known to interact with TRβ2 to repress thyroid stimulating
hormone β (31). TRIM28 is known to interact with the SWI/SNF complex, a chromatin
remodeling complex TRβ interacts with (19), and promotes mammosphere formation
(32), which TRβ inhibits (21).
112
Figure 18: Chromatin Immunoprecipitation Enrichment Analysis Reveals Putative Secondary
Regulators. The DEGs from each cluster were input into the ChEA webapplet at
https://amp.pharm.mssm.edu/Enrichr/. Transcription factors from the ENCODE and ChEA Consensus TFs
dataset was used to assign statistical values to each factor.
In order to further investigate the pathways that TRβ regulates in breast cancer the
DEGs from 468-EV and 468-TRβ cells, both T3 treated, were directly compared to each
other via GSEA using the Gene Ontology and Hallmarks datasets (Appendix C-3). The
top three pathways, by significance and effect size, were all processes that were driven by
a change in cytokeratin expression (Figure 19). The set of cytokeratins that TRβ
repressed includes markers of breast cancer aggressiveness that included in diagnostic
assays, including the PAM50 gene set (33,34). Additionally, there are studies which
highlight the importance of some of these genes for invasiveness. Notably, expression of
KRT14 correlates with tumor stage and a basal-like phenotype (35). KRT5, KRT14, and
KRT80 are also drivers of an invasiveness in breast tumors (35,36). Lastly, KRT16 is a
prognostic marker as expression correlates with reduced survival (37). Consistent with
the pro-invasive role of these cytokeratins, there was also a significant reduction in the
expression of EMT drivers.
113
Figure 19: Thyroid Hormone Receptor Beta Represses Invasive Pathways. A) A pairwise comparison
between EV-T3 and TRβ-T3 revealed multiple Gene Ontology pathways that are driven by expression of
cytokeratins were repressed. B) KRT genes were significantly repressed in MDA-MB-468 cells that express
exogenous TRβ following T3 treatment. C) Pairwise comparison between EV-T3 and TRβ-T3 showed
repression of epithelial to mesenchymal transition.
We have recently revealed the TRβ transcriptome within the anaplastic thyroid
cancer cell line SW1736 and so we performed pairwise comparisons between SW1736-
EV-T3 and SW1736-TRβ-T3 and between 468-EV-T3 and 468-TRβ-T3 in order to
determine which genes are differentially expressed independent of cell type. The majority
of DEGs were regulated by TRβ-T3 in only one of the two cell types, however a subset of
genes were regulated by TRβ-T3 in both. A total of 255 genes were induced by T3 in both
cell lines and 70 genes were repressed (Figure 20). These genes were used for pathway
analysis using the IPA algorithm and the top predicted pathways were examined to
114
determine cancer relevance. An important shared pathway uncovered was stearate
biosynthesis. Four genes which encode biosynthetic enzymes were T3-induced in both
SW1736 and MDA-MB-468 cells. Additionally, the shared gene set was used for GSEA
using the Gene Ontology dataset (Appendix C-3 and C-4), which revealed repression of
chromatin organization processes and induction of stress responses, including proteolytic
signaling (Appendix C-5).
Figure 20: A Subset of Genes are Regulated by TRβ in Breast and Thyroid Cancer Cells. A) Pairwise
comparisons of 468-EV-T3 and 468-TRβ-T3 along with SW1736-EV-T3 and SW1736-TRβ-T3 were used to
determine which genes were regulated in a tissue agnostic manner. 255 genes were upregulated and 70
genes were repressed independent of cell type. B) IPA was used to predict pathways of these 325 genes and C-D) stearate biosynthesis was examined in closer detail, demonstrating induction of enzymes necessary
for the conversion of palmitate to stearate.
115
4.5. Discussion
Restored expression of the tumor suppressor TRβ in the breast cancer cell line
MDA-MB-468 profoundly altered the transcriptome of the cells. Existing data from the
cell line shows that TRβ acts to repress proliferation and migration in vitro as well as
tumor growth and metastasis in vivo (13,16,18). Our work here adds to that understanding
by providing evidence of the signaling events that result from TRβ activity. Importantly,
there was a change in the set of genes that are used to define breast cancer subtypes and a
change in EMT markers, revealing that the mesenchymal-like MDA-MB-468 cells were
shifting to be more epithelial, and thus differentiated, in character. This is further
supported by the observed reduction of pro-invasion and pro-metastatic cytokeratins. An
induction of cellular differentiation could also explain why loss of TRβ has been found to
decrease the efficacy of chemotherapeutics in basal-like breast cancer cells (38).
Through comparison of a tumor suppressor in both a thyroid and breast cancer
cell line we have revealed common signaling between both cell types. Notably, enzymes
involved in the biosynthesis of stearic acid were revealed, a lipid that has a profound anti-
tumor role in breast cancer apoptosis (26-29). Not only does the data in this study suggest
that TRβ induces expression of stearate synthetic enzymes, but also that stearate could
have unrealized anti-tumor activity in thyroid cancer. Importantly, the anti-tumor
properties of stearate are similar to that which has been observed to be performed by
TRβ. This includes anti-proliferative, anti-metastatic, and pro-apoptotic effects.
Stearic acid has also been found to have a relationship with obesity, a risk factor
for the development of both breast cancer and thyroid cancer (39-42). Levels of stearic
acid in women with larger adipocytes are reduced (43), and stored stearic acid is
116
inversely correlated with BMI (44). Additionally, stearate is a poor substrate for the
synthesis of triglycerides, which further suggest an anti-adiposity effect (45). Stearic acid
levels may be a connection between obesity and risk of malignancy in both breast and
thyroid cancers and are likely regulated in tumors by TRβ.
References
1. Prinzi N, Baldini E, Sorrenti S, De Vito C, Tuccilli C, Catania A, et al. Prevalence
of breast cancer in thyroid diseases: results of a cross-sectional study of 3,921
patients. Breast cancer research and treatment 2014;144:683-8
2. An JH, Hwangbo Y, Ahn HY, Keam B, Lee KE, Han W, et al. A Possible
Association Between Thyroid Cancer and Breast Cancer. Thyroid : official
journal of the American Thyroid Association 2015;25:1330-8
3. Zhang L, Wu Y, Liu F, Fu L, Tong Z. Characteristics and survival of patients with
metachronous or synchronous double primary malignancies: breast and thyroid
cancer. Oncotarget 2016;7:52450-9
4. Kuo JH, Chabot JA, Lee JA. Breast cancer in thyroid cancer survivors: An
analysis of the Surveillance, Epidemiology, and End Results-9 database. Surgery
2016;159:23-9
5. Shi Y, Li X, Ran L, Arshad B, Li H, Xu Z, et al. Study on the status of thyroid
function and thyroid nodules in chinese breast cancer patients. Oncotarget
2017;8:80820-5
6. Jung HK, Park S, Kim NW, Lee JE, Kim Z, Han SW, et al. Development of
117
second primary cancer in Korean breast cancer survivors. Annals of surgical
treatment and research 2017;93:287-92
7. Luo J, Hendryx M, Nassir R, Cheng TD, Lane D, Margolis KL. Benign breast
disease and risk of thyroid cancer. Cancer causes & control : CCC 2017;28:913-
20
8. Rahib L, Smith BD, Aizenberg R, Rosenzweig AB, Fleshman JM, Matrisian LM.
Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid,
liver, and pancreas cancers in the United States. Cancer research 2014;74:2913-21
9. Carr FE, Tai PW, Barnum MS, Gillis NE, Evans KG, Taber TH, et al. Thyroid
Hormone Receptor-beta (TRbeta) Mediates Runt-Related Transcription Factor 2
(Runx2) Expression in Thyroid Cancer Cells: A Novel Signaling Pathway in
Thyroid Cancer. Endocrinology 2016;157:3278-92
10. Bolf EL, Gillis NE, Barnum MS, Beaudet CM, Yu GY, Tomczak JA, et al. The
Thyroid Hormone Receptor-RUNX2 Axis: A Novel Tumor Suppressive Pathway
in Breast Cancer. Horm Cancer 2019
11. Kim WG, Zhao L, Kim DW, Willingham MC, Cheng SY. Inhibition of
tumorigenesis by the thyroid hormone receptor beta in xenograft models. Thyroid
: official journal of the American Thyroid Association 2014;24:260-9
12. Park J, Zhao L, Cheng S. Inhibition of estrogen-dependent tumorigenesis by the
thyroid hormone receptor β in xenograft models. Volume 3. Am J Cancer
Res2013. p 302-11.
13. Martinez-Iglesias O, Garcia-Silva S, Tenbaum SP, Regadera J, Larcher F,
Paramio JM, et al. Thyroid hormone receptor beta1 acts as a potent suppressor of
118
tumor invasiveness and metastasis. Cancer research 2009;69:501-9
14. Lu C, Zhu X, Willingham MC, Cheng SY. Activation of tumor cell proliferation
by thyroid hormone in a mouse model of follicular thyroid carcinoma. Oncogene
2012;31:2007-16
15. Zhu XG, Zhao L, Willingham MC, Cheng SY. Thyroid hormone receptors are
tumor suppressors in a mouse model of metastatic follicular thyroid carcinoma.
Oncogene 2010;29:1909-19
16. Park JW, Zhao L, Willingham M, Cheng S-y. Oncogenic mutations of thyroid
hormone receptor β. Oncotarget 2015;6:8115-31
17. Kim DW, Zhao L, Hanover J, Willingham M, Cheng SY. Thyroid hormone
receptor beta suppresses SV40-mediated tumorigenesis via novel nongenomic
actions. Am J Cancer Res 2012;2:606-19
18. Martinez-Iglesias O, Garcia-Silva S, Regadera J, Aranda A. Hypothyroidism
enhances tumor invasiveness and metastasis development. PLoS One
2009;4:e6428
19. Gillis NE, Taber TH, Bolf EL, Beaudet CM, Tomczak JA, White JH, et al.
Thyroid Hormone Receptor β Suppression of RUNX2 is Mediated by Brahma
Related Gene 1 Dependent Chromatin Remodeling. Endocrinology 2018:en.2018-
00128-en.2018-
20. Lachmann A, Xu H, Krishnan J, Berger SI, Mazloom AR, Ma'ayan A. ChEA:
transcription factor regulation inferred from integrating genome-wide ChIP-X
experiments. Bioinformatics 2010;26:2438-44
21. Lopez-Mateo I, Alonso-Merino E, Suarez-Cabrera C, Park JW, Cheng SY,
119
Alemany S, et al. Thyroid Hormone Receptor beta Inhibits Self-Renewal
Capacity of Breast Cancer Stem Cells. Thyroid : official journal of the American
Thyroid Association 2020;30:116-32
22. Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA, et al.
Molecular portraits of human breast tumours. Nature 2000;406:747-52
23. Parker JS, Mullins M, Cheang MC, Leung S, Voduc D, Vickery T, et al.
Supervised risk predictor of breast cancer based on intrinsic subtypes. Journal of
clinical oncology : official journal of the American Society of Clinical Oncology
2009;27:1160-7
24. Raj-Kumar PK, Liu J, Hooke JA, Kovatich AJ, Kvecher L, Shriver CD, et al.
PCA-PAM50 improves consistency between breast cancer intrinsic and clinical
subtyping reclassifying a subset of luminal A tumors as luminal B. Scientific
reports 2019;9:7956
25. Parker BS, Rautela J, Hertzog PJ. Antitumour actions of interferons: implications
for cancer therapy. Nat Rev Cancer 2016;16:131-44
26. Habib NA, Wood CB, Apostolov K, Barker W, Hershman MJ, Aslam M, et al.
Stearic acid and carcinogenesis. British journal of cancer 1987;56:455-8
27. Evans LM, Toline EC, Desmond R, Siegal GP, Hashim AI, Hardy RW. Dietary
stearate reduces human breast cancer metastasis burden in athymic nude mice.
Clin Exp Metastasis 2009;26:415-24
28. Hardy S, El-Assaad W, Przybytkowski E, Joly E, Prentki M, Langelier Y.
Saturated fatty acid-induced apoptosis in MDA-MB-231 breast cancer cells. A
role for cardiolipin. J Biol Chem 2003;278:31861-70
120
29. Li C, Zhao X, Toline EC, Siegal GP, Evans LM, Ibrahim-Hashim A, et al.
Prevention of carcinogenesis and inhibition of breast cancer tumor burden by
dietary stearate. Carcinogenesis 2011;32:1251-8
30. Han L, Zan Y, Huang C, Zhang S. NELFE promoted pancreatic cancer metastasis
and the epithelialtomesenchymal transition by decreasing the stabilization of
NDRG2 mRNA. Int J Oncol 2019;55:1313-23
31. Matsunaga H, Sasaki S, Suzuki S, Matsushita A, Nakamura H, Nakamura HM, et
al. Essential Role of GATA2 in the Negative Regulation of Type 2 Deiodinase
Gene by Liganded Thyroid Hormone Receptor beta2 in Thyrotroph. PLoS One
2015;10:e0142400
32. Li J, Xi Y, Li W, McCarthy RL, Stratton SA, Zou W, et al. TRIM28 interacts
with EZH2 and SWI/SNF to activate genes that promote mammosphere
formation. Oncogene 2017;36:2991-3001
33. Shao MM, Chan SK, Yu AM, Lam CC, Tsang JY, Lui PC, et al. Keratin
expression in breast cancers. Virchows Archiv : an international journal of
pathology 2012;461:313-22
34. Joosse SA, Hannemann J, Spotter J, Bauche A, Andreas A, Muller V, et al.
Changes in keratin expression during metastatic progression of breast cancer:
impact on the detection of circulating tumor cells. Clinical cancer research : an
official journal of the American Association for Cancer Research 2012;18:993-
1003
35. Cheung KJ, Gabrielson E, Werb Z, Ewald AJ. Collective invasion in breast cancer
requires a conserved basal epithelial program. Cell 2013;155:1639-51
121
36. Perone Y, Farrugia AJ, Rodriguez-Meira A, Gyorffy B, Ion C, Uggetti A, et al.
SREBP1 drives Keratin-80-dependent cytoskeletal changes and invasive behavior
in endocrine-resistant ERalpha breast cancer. Nature communications
2019;10:2115
37. Shao N, Yuan K, Zhang Y, Yun Cheang T, Li J, Lin Y. Identification of key
candidate genes, pathways and related prognostic values in ER-negative/HER2-
negative breast cancer by bioinformatics analysis. Journal of BUON : official
journal of the Balkan Union of Oncology 2018;23:891-901
38. Gu G, Gelsomino L, Covington KR, Beyer AR, Wang J, Rechoum Y, et al.
Targeting thyroid hormone receptor beta in triple-negative breast cancer. Breast
cancer research and treatment 2015;150:535-45
39. Harvie M, Howell A, Evans DG. Can diet and lifestyle prevent breast cancer:
what is the evidence? Am Soc Clin Oncol Educ Book 2015:e66-73
40. Sprague BL, Trentham-Dietz A, Egan KM, Titus-Ernstoff L, Hampton JM,
Newcomb PA. Proportion of invasive breast cancer attributable to risk factors
modifiable after menopause. Am J Epidemiol 2008;168:404-11
41. Kitahara CM, Platz EA, Freeman LEB, Hsing AW, Linet MS, Park Y, et al.
Obesity and Thyroid Cancer Risk among U.S. Men and Women: A Pooled
Analysis of Five Prospective Studies. Cancer Epidemiology Biomarkers &
Prevention 2011;20:464-72
42. Schmid D, Ricci C, Behrens G, Leitzmann MF. Adiposity and risk of thyroid
cancer: a systematic review and meta-analysis. Obesity Reviews 2015;16:1042-54
43. Caron-Jobin M, Mauvoisin D, Michaud A, Veilleux A, Noel S, Fortier MP, et al.
122
Stearic acid content of abdominal adipose tissues in obese women. Nutr Diabetes
2012;2:e23
44. Roberts R, Hodson L, Dennis AL, Neville MJ, Humphreys SM, Harnden KE, et
al. Markers of de novo lipogenesis in adipose tissue: associations with small
adipocytes and insulin sensitivity in humans. Diabetologia 2009;52:882-90
45. Sampath H, Ntambi JM. The fate and intermediary metabolism of stearic acid.
Lipids 2005;40:1187-91
123
CHAPTER 5: A Linkage Between Thyroid and Breast Cancer: A Common
Etiology?
5.1. Abstract
Breast and thyroid cancers are two malignancies with highest incidence in
women. These cancers often occur metachronously. Women with thyroid cancer are at
increased risk for subsequent breast cancer; women with breast cancer have an increased
incidence of later development of thyroid cancer suggesting a common etiology. This
bidirectional relationship is reported worldwide, however the underlying reasons for this
co-occurrence is unknown. In this review, we summarize the current epidemiological
evidence and putative mechanisms of these metachronous or synchronous cancers. Key
potential causative factors are chemotherapy and radiotherapy of the primary tumor,
genetic variants linking the two diseases, hormonal signaling both from the thyroid gland
and from estrogens, lifestyle and environmental factors. There is a critical need for
additional epidemiological studies focused on gender and regional incidence together
with molecular investigations on common tumorigenic pathways in these endocrine
cancers. Understanding the putative mechanisms will aid in the diagnosis and clinical
management of both diseases.
5.2. Introduction
Breast cancer is the most common cancer diagnosed in women in the United
States (U.S.) with over 250,000 cases per year (1). Survivors of breast cancer are at
increased risk of a second cancer, frequently thyroid cancer (2-4). Thyroid cancer, which
also predominantly affects women, is of great concern as the incidence in the U.S. has
124
more than tripled over the past decades, including the aggressive variants (5,6). The
higher incidence is not due to enhanced surveillance and advances in diagnostics;
increases in tumors of all sizes as well as indolent and aggressive tumors are reported (7).
Male thyroid cancer rates have doubled since 1975 whereas female rates have tripled (6).
As 5-year survival rates after thyroid cancer are in excess of 90% (1) and the incidence of
the disease is increasing, there are now more survivors of thyroid cancer than in the past.
The risk of a subsequent second primary cancer, most often breast cancer, is increased for
thyroid cancer survivors (3,4,8). Understanding health risks following treatment is critical
for improving public health.
Due to the rising incidence of thyroid cancer in the U.S., and globally (9), it is
critical to understand the risk factors for thyroid cancer and long-term risks associated
with the disease. Intriguingly, the increase in incidence can vary dramatically depending
upon location (9). An increase in thyroid cancer incidence is most pronounced in Asia,
particularly in South Korea, as compared to other regions. Contributing factors likely
include improved health care networks and surveillance, environmental influences,
hereditary factors, radiation exposure, and lifestyle factors. Iodine deficiency is an
important public health problem in several Asian countries (10), and has been linked to
an increased chance of developing thyroid cancer, in addition to increased risk of
thyroidal disorders (reviewed in (11)).
In contrast to the global increase in thyroid cancer incidence, changes in breast
cancer incidence vary globally. U.S. incidence has been stable for the past few decades.
Strikingly, in the 1980s, there was a 30% increase in female total breast cancer diagnoses,
which is attributed to heightened surveillance (12). In China, breast cancer incidence has
125
also increased, however it is difficult to determine a precise figure due to the varying
quality of studies (13). This may be a pattern similar to what was observed in the U.S.
during the 1980s; the rise of breast cancer rates may be a result of China’s rapid growth
in recent decades and improvements to health care technology and access. Low- and
middle-income nations, such as South American nations, have exhibited the greatest
increase in incidence of breast cancer (12). This may also be due to changes in
surveillance and a result of improvements in health care access and technology.
Regardless, a myriad of factors may underlie the observed increase in breast cancer rates
in some regions of the world and the cause is not yet clear.
Over the last 40 years, studies reveal compelling evidence of a bidirectional, and
potentially causative, relationship between breast cancer and thyroid cancer. Women with
breast cancer are at increased risk for developing thyroid cancer; survivors of thyroid
cancer are more likely to develop breast cancer suggesting common etiological features
in the development of both tumor types (14). A metachronous relationship between
thyroid and breast cancers has significant implications for clinical surveillance and
management of both diseases. Additionally, understanding the etiology of the second
primary tumor is vital for the development of new preventive strategies, diagnostics, and
therapeutics.
5.3. What is the Epidemiological Evidence of the Relationship Between Breast and
Thyroid Cancer?
In the past few years alone, population studies in Asia, Europe, and the U.S.
reveal increased incidence of breast cancer among women previously diagnosed with
126
thyroid cancer (15-21). Of note, aggressive follicular thyroid cancer is detected in
patients with a history of breast cancer more often than the more common papillary
thyroid cancer (18). Further, and importantly for determining etiology, non-malignant
thyroid nodules are more common in women with breast cancer than those without breast
tumors (19). There is an increased risk of developing thyroid cancer following breast
cancer (16,20). Women with prior benign breast disease also are reported to be at a
greater risk of thyroid cancer (21). The increased risk of thyroid cancer following breast
cancer and breast cancer following thyroid cancer is reported in both women and men
(22). Women with breast cancer are two-fold more likely to develop future thyroid cancer
and women with thyroid cancer have a 67% greater chance of developing breast cancer
than the general population. These recent studies are summarized in Table 1. Importantly,
the metachronous relationship was evaluated in nations with widespread cancer screening
and nations where screening is becoming more common. In particular, Zhang and
colleagues evaluated cancer patients between 2001 and 2010 in China, which
corresponded with investments into cancer registries (17,23).
Table 1: Summary of Studies linking Breast and Thyroid Cancer Incidence. Only the studies
published in the last 5 years (since 2013) are presented, organized by which cancer was the initial disease.
Some studies explored the bidirectional relationship and are listed twice. Luo et al (marked with a *)
examined benign breast disease rather than a breast malignancy, and Shi et al (marked with a **) studied
thyroid nodules, rather than thyroid cancer. Fold refers to the fold change of risk for the second tumor as
compared to people who do not have a history of the initial cancer. The sample size classifies patients
based upon the site of the earlier cancer. Abbreviations used are OR (Odds Ratio), SIR (Standard Incidence
Ratio), IRR (Incidence Rate Ratio), AD (Age Dependent), and HR (Hazard Ratio).
127
The clinical characteristics of the initial and metachronous tumors exhibit
distinctive features compared to non-metachronous cancer patients. The metachronous
breast tumors following thyroid cancer are more likely to be hormone receptor positive
than breast cancer patients without this history (16). The metachronous thyroid tumors
following breast cancer are smaller but more aggressive than the control population of
females with thyroid cancer without a history of breast cancer. Metachronous thyroid
cancer is also more common when the initial breast tumor was HER2 positive (24).
Analysis of Surveillance, Epidemiology, and End Results data revealed patients who
Sex Breast →
Thyroid
Increased Risk
Breast→Thyroid
Thyroid →
Breast
Increased Risk
Thyroid→Breast
Sample Size
Female Prinzi et
al 2013
15.24 OR 3921
Female
and Male
Van
Fossen et
al 2013
Female 2-Fold
Male 19-Fold
Van
Fossen
et al
2013
Female 1.67-
Fold
Male 29-Fold
74,650
(Breast)
15,940
(Thyroid)
Female An et al
2015
2.18 SIR An et al
2015
2.45 SIR 6833
(Breast)
4243
(Thyroid)
Female Kuo et al
2016
2.07-2.60
IRR (AD)
53,853
Female Zhang L
et al 2016
4.75 SIR Zhang L
et al
2016
2.40 SIR 18,732
(Breast)
12,877
(Thyroid)
Female Jung et al
2017
2.29 SIR 3444
Female Luo et al
2017*
1.38 HR 133,875
Female Shi et al
2017**
2.5-Fold 4189
128
developed metachronous breast cancer following a thyroid tumor typically were
diagnosed with breast cancer at a younger age than average and exhibited histological
features associated with hormone replacement therapy, implicating a potential role for
estrogen (18).
These recent studies highlight the trends observed in prior research and meta-
analyses (25,26). Studies to date have primarily focused on metachronous cancer
incidence in women as both cancers occur primarily in women (100:1 for breast and 4:1
for thyroid, female:male). Remarkably, the co-occurrence of these diseases is even
greater in men. Men with a prior history of breast cancer are 19 times more likely to
develop thyroid cancer. This link is bidirectional; men with prior thyroid cancer are 29
times more likely to develop breast cancer (22). Independent confirmation of the
metachronous risk in male cases is needed. The epidemiological linkage between thyroid
cancer and breast cancer is bidirectional and data from patients collected globally has
consistently demonstrated the metachronous relationship. However, larger studies are
needed to increase confidence as to how much greater a risk there is of a second primary
tumor as the various studies presented in this review do not report increased risk using
the same parameters. Further research is needed to determine if certain demographics are
at greater risk, the role of socioeconomic factors, or if there are geographic hotspots at
greater risk of metachronous disease.
5.4. What Genetic Factors Link the Diseases?
There is a strong familial component in the development of cancer. A recent,
large study examining twins in the Nordic nations estimated hereditability to be
129
approximately 33% of cancer risk (27). There does appear to be some familial link
between thyroid and breast cancer; a study on Swedish patients found that first-degree
relatives of women diagnosed with breast cancer are at an increased risk of developing
thyroid cancer (28). Similar results were observed in a U.S. population (29). Among
other factors that could drive a familial association, genetics has potentially the greatest
explanatory power in the link between breast tumors and thyroid tumors as many driver
mutations are similar in both cancers. Cowden Syndrome is an already recognized
genetic disorder, arising from mutations to the tumor suppressor PTEN, which increases
the risk of both breast and thyroid cancer, among other cancers including endometrial and
gastrointestinal (30,31). PTEN encodes for phosphatase and tensin homolog (PTEN),
which inhibits the catalytic activity of the enzyme phosphatidylinositol-3,4,5-
trisphosphate 3-phosphatase (PI3K) (32). PI3K upregulates the downstream effector
AKT, which then phosphorylates an array of proteins, ultimately changing gene
expression. The PI3K-AKT pathway promotes survival, proliferation, and migration to
drive tumorigenesis. Cowden Syndrome can also be worsened by co-mutations to KLLN
and genes that make up the succinate dehydrogenase complex (SDHx) (25). KLLN is a
transcription factor that shares the PTEN promoter and upregulates TP53 to promote
apoptosis (33). SDHx mutations also dysregulate TP53 through enhanced proteasomal
degradation of p53 (34). Other genes that feed into the PI3K pathway and apoptosis may
be involved in the link between thyroid and breast cancers.
Additionally, germline mutations in PARP4 were identified in women treated for
both cancers (35). Heightened expression of PARP4 also correlated with longer disease-
free survival and overall survival in breast cancer patients. PARP4 belongs to a family of
130
genes, poly-ADP-ribose polymerases (PARPs) that encode enzymes to catalyze synthesis
of poly-ADP-ribose (36). Levels of poly-ADP-ribose increase in response to genetic
insults and is a critical component of DNA repair. PARP inhibitors are used clinically to
treat ovarian tumors and are in clinical trials for breast cancer (37). However, existing
drugs do not target PARP4. PARP4 is unique in that it can also be found in the
cytoplasm, unlike the other members of the PARP family (36). Unfortunately, PARP4 is
not well characterized and more research is needed to determine the biochemical and
physiological processes it regulates.
To date, no other mutations have been demonstrated to be causal agents linking
metachronous breast and thyroid tumors. More studies to examine patients with histories
of both diseases are needed to uncover new gene variants. Further, epigenetic changes
including altered expression of microRNAs and long-noncoding RNAs (lncRNA),
covalent modification of DNA, and mutations to regulatory elements in the genome could
be critical. Recently, the lncRNA MANCR, has been demonstrated to be upregulated and
a driver of aggressive breast cancer (38). MANCR is also upregulated in thyroid cancers
(39). Such information from these two studies exemplifies common transcriptional
regulation in both diseases.
5.5. What is the Impact of Cancer Treatment on Future Risk?
Radiation, despite being a treatment option for breast cancer, is a well-
documented risk factor in the development of cancer and is a major risk factor for thyroid
cancer (40-42). Multiple recent clinical studies demonstrate alteration of the ability of the
thyroid to produce hormones following radiotherapy (43-45). Despite this evidence that
131
radiotherapy harms the thyroid, a very large study from Taiwan of over 55,000 patients
did not report any association between treating breast cancer with radiation and
subsequent thyroid cancer, nonetheless the results did corroborate the previously
discussed relationship between thyroid and breast cancers (46). Another study revealed
that although the use of radiation therapy to treat breast cancer was associated with an
increased risk of certain tumors, including leukemia and lung cancer, there was not an
observed increase in the risk of thyroid cancer (47).
Childhood radiation therapy is documented to increase the chance of a women
developing breast cancer later in life (48,49) Thyroid tumors are not typically treated with
beam radiotherapy, but one of the most commonly prescribed treatments for thyroid
cancer is to treat the patient with radioactive iodide (131I). 131I selectively targets the
tumor via the sodium-iodide symporter (NIS) to kill the diseased thyroid tissue. However,
breast tissue expresses NIS to transport iodide into milk and so could be impacted by
radioactive 131I (50). There is also evidence that dietary iodide intake is protective against
the development of breast cancer (51). Since the 1960s, numerous studies denote a
concern for secondary tissue effects with the use 131I treatment for thyroid diseases (52).
Although increased risk for development of leukemia was determined, no association
with breast cancer was noted (53-55). Additionally, meta-analysis of studies specifically
examining 131I treatment for thyroid cancer reveal no association between the use of 131I
and subsequent development of breast cancer (56). A recent study found no difference in
breast cancer risk between thyroid cancer patients treated with and without 131I,
confirming prior observations (57).
132
While the impact of radiotherapy on thyroid function has been extensively
studied, data on chemotherapy is sparse. Studies on breast cancer patients receiving
different chemotherapeutic treatments reveal a reduction in serum T4 levels, but
subsequent recovery of thyroid function and thyroid cancer risk was not assessed (58-60).
Critically, the impact of chemotherapeutic agents on thyroid function and cancer risk
needs further study.
5.6. Are Thyroid Disease and Disruptions of Thyroid Hormone Signaling Risk
Factors?
Thyroidal status may be an important factor in second tumor development,
although studies are limited. Clinical implications of thyroid hormone mediated effects
altering initial tumor development are unclear, data on the impact of thyroid hormone
levels on the likelihood of developing a tumor are inconsistent (61-63). Regardless, in a
small clinical study utilizing patients with advanced cancers, including breast tumors,
ablation of de novo thyroid hormone synthesis and supplementation with T3 prolonged
patient survival (64). Strikingly, in a mouse xenograft study, more metastases were
observed in hypothyroid than euthyroid animals, and hypothyroid mice developed
smaller primary tumors, suggestive of an important role for thyroid hormones on
tumorigenesis (65). Additionally, the impact of tyrosine kinase inhibitors (TKI) on
thyroid function has predictive value in determining patient outcomes; patients with
cancers other than thyroid cancer rendered hypothyroid after TKI treatment have a more
favorable prognosis, as defined by overall survival (66). The subpopulation of patients
who experienced drug-induced hypothyroidism and received supplemental T4 exhibited
133
greater odds of overall survival than those with untreated hypothyroidism. The authors
note that thyroidal dysfunction may be indicative of the effectiveness of the cancer
treatment but the mechanisms are unknown (66). Overall, studies of drug-induced
hypothyroidism indicate that thyroid hormone signaling may protect against advanced
breast cancer.
The canonical pathway for thyroid hormone action is through the nuclear
hormone receptors thyroid hormone receptor alpha (TRα) and thyroid hormone receptor
beta (TRβ). Of these receptors, TRβ is expressed in both breast and thyroid tissue (67).
TRβ has also been implicated as a tumor suppressor (68). The pathways which TRβ
regulates have not yet been thoroughly explored, however there is evidence that it
represses PI3K in both breast and thyroid cancer cells (69,70). TRβ also represses
transcription of the oncogene RUNX2 in thyroid cancer through an interaction with a
chromatin-remodeling complex (71,72). RUNX2 is a driver of both breast and thyroid
cancers and common thyroid hormone mediated mechanisms may be active in both
tissues (73,74). There is also a non-classical thyroid hormone receptor, the integrin αVβ3,
which responds to T4 rather than T3, and activates the pro-oncogenic MAPK pathway
(75). It is probable that the response a tumor has to thyroidal status depends upon the
genes expressed in the cells due to the multiple receptors that feed into many different
pathways.
5.7. Does Hormonal Disruption alter Metachronous Cancer Susceptibility?
Breast cancer is often hormonally driven through upregulation of estrogen and
progesterone receptors and mimetics of these compounds can be carcinogenic (reviewed
134
in (76)). This relationship has been extensively studied, and although there are still many
unanswered questions regarding the mechanistic details, there is little doubt concerning
whether estrogenic signaling can promote breast tumorigenesis. Estrogen is also
implicated in the development of thyroid cancer, and may explain why women develop
the disease at roughly 4 times the rate as men (reviewed in (77)). Numerous studies have
linked endocrine disrupting chemicals (EDCs) to obesity, developmental perturbations
and hormone-dependent cancers (78). Exposure to EDCs at prenatal and early
developmental stages are associated with later development of cancers (79), which could
predisposition the same individual to developing both tumor types; potentially explaining
why the same person develops both diseases in a short time frame and at a younger age.
For example, EDCs may stimulate thyroid and breast cancer development through
estrogenic signaling. Bisphenol A (80) and flame-retardants (81), mimetics of
endogenous estrogen or xenoestrogens, have been implicated in the development of
thyroid cancer as well as breast cancers (82). Bisphenol A binds to TRs and antagonizes
thyroid hormone action (83,84). As TRβ is a tumor suppressor in both thyroid and breast
cancers, this inhibition may be a common mechanism.
Epidemiological analysis of hotspots for thyroid cancer development is consistent
with the hypothesis that an increase in thyroid cancer may be linked to environmental as
well as lifestyle factors (85). We performed an exploratory analysis in Vermont,
comparing the breast and thyroid cancer incidence rates in different counties, and
observed a weak correlation between the two cancer types (Fig 21). A linear trend line fit
to the data indicated that an increase of breast cancer incidence by 10 per 100,000 women
corresponded to an increase in thyroid cancer of 1.6 per 100,000 people. An investigation
135
into hotspots where breast and thyroid cancers co-occur could reveal environmental
factors, including EDCs, that drive both tumor types.
Figure 21: Thyroid Cancer and Breast Cancer Incidence are Positively Correlated among
Vermont Counties. County-specific age-adjusted thyroid cancer and invasive breast cancer incidence for
2010-2014 among Vermont females was obtained from the state of Vermont Environmental Public Health
Tracking Data Explorer. A linear regression was performed to yield a slope of 0.1565 with an R-square
value of 0.2102. The counties of Essex and Grand Isle were excluded due to insufficient numbers of thyroid
cancer cases in these small population counties.
Approximately 80% of breast tumors are hormone receptor positive. Endocrine
therapies via selective estrogen receptor modulators (SERMs) that target estrogen
receptor alpha are a cornerstone of breast cancer treatment for most patients (86,87). The
prototypical SERM, Tamoxifen, has been reported to stimulate thyroid stimulating
hormone (TSH) production (88) and, in a rat model, to induce thyroid tissue proliferation
(89). In patients on both endocrine therapy and T4 replacement therapy for
hypothyroidism there is an increase to levels of thyroxine-binding globin, total T4, and
136
TSH (90). What effect SERMs have on thyroid tumorigenesis has not been adequately
investigated.
5.8. Are Lifestyle Related Environmental Factors Common Between Breast and
Thyroid Cancer?
Behaviorally driven environmental factors, include obesity, sedentary lifestyle,
alcohol consumption, and tobacco usage have been demonstrated to increase cancer risk
(91). Breast cancer risk increases with weight gain, alcohol consumption, and from a lack
of regular exercise (92,93). Shared risk factors with thyroid cancer are candidates to the
etiology of metachronous tumors. Obesity is a risk factor to the development of
epithelial-derived thyroid cancers, but not to tumors that arise from the thyroid’s c-cells
(94,95). Despite the association with obesity, there does not appear to be strong evidence
of physical activity altering thyroid cancer risk (96,97). Alcohol related mechanisms of
tumorigenesis are also not shared between the two diseases. A meta-analysis pooled over
7,000 thyroid cancer patients and demonstrated alcohol consumption does not contribute
to a heightened risk of developing a thyroid tumor (98). For the patients that develop
metachronous breast and thyroid tumors, specific studies are needed to determine
whether lifestyle factors alter the risk of a second cancer.
A factor addressed earlier in this review, thyroid hormones, do have an impact on
obesity and metabolism. Changes in signaling resulting from activity of the tumor
suppressor TRβ may be related to obesity as a risk factor. A high fat diet enhanced
thyroid tumor growth by the leptin-mediated JAK2-STAT3 pathway in a mouse model
exhibiting mutant variants of TRβ and PTEN (99). Increased STAT3 activity has been
137
demonstrated to promote breast cancer progression in animal xenograft models and
detected at the invasive tumor front in breast biopsy specimens (100,101). STAT3
activity may be important to the breast-thyroid cancer link.
5.9. Concluding Remarks
There is strong evidence of a relationship between breast and thyroid cancer as
survivors of either cancer are at increased risk for development of thyroid or breast
tumors compared with the general population. The etiology of these cancers and possible
causative factors are at an infancy stage and just beginning to be studied. Further
investigation into the genomics and epigenetics underlying both breast and thyroid cancer
can yield clues into the specifics of tumorigenesis and identifying who are at greatest risk
of a metachronous tumor. A greater understanding of the etiology of male cases of both
breast and thyroid cancer also has the potential to uncover important etiological factors.
Different subtypes of breast cancer are more common in men as compared to women
(102) and the same in true for thyroid (103). These differences could account for the
greater rate of metachronous occurrence and investigations into molecular differences
could reveal novel insights. Additionally, although radiotherapy has been investigated
and is unlikely to be a significant factor, there is a lack of convincing evidence in either
metachronous direction as to a potential role for chemotherapy. Further studies are
needed into the effects of chemotherapy and endocrine therapy on thyroid disease and
cancer susceptibility. EDCs promote development of hormone-dependent cancers,
however there is a lack of information on EDC exposure and the development of thyroid
cancer, an area that merits further investigation. Further research into the role of obesity
138
and JAK-STAT signaling on breast and thyroid tumorigenesis may also provide insights
into the metachronous relationship. The potential for the different possible etiologies in
the breast-thyroid cancer relationship is summarized (Fig 22).
Figure 22: Summary of Possible Etiological Factors in the Thyroid and Breast Cancer Link.
Factors that have the potential to drive the relationship between thyroid and breast cancer are displayed
here on an arbitrary scale to represent potential explanatory power. Factors at the top of the figure, darker,
are more likely than agents at the bottom of the figure, lighter. Likely etiological factors include genes,
obesity, and hormonal influences such as estrogen, thyroid hormone, and environmental endocrine
disruptors. Chemotherapy is a possibility, however there are a lack of studies so the role it has is unclear.
Radioactive iodide, or radiotherapy, is very unlikely to be etiological, and both alcohol use and a sedentary
lifestyle are unlikely factors for the development of metachronous breast and thyroid tumors.
Importantly, studies are needed to perform parallel observations in both tumor
types to enhance understanding of which tumorigenic pathways are common to both
breast and thyroid and narrow down risk factors for these metachronous neoplasms. The
existing public databases for thyroid cancer characteristics need expansion to allow for
extensive cross comparison between thyroid and breast cancers. There also needs to be a
greater focus towards generating thyroid cancer public datasets for comparison to the
many existing breast cancer datasets. With the increase in thyroid cancer incidence and
139
improved survivorship of breast and thyroid cancers, it is an important public health
concern to identify the linkages between these cancers in both sexes.
References
1. Siegel RL, Miller KD, Jemal A. Cancer Statistics, 2017. CA: a cancer journal for
clinicians 2017;67:7-30
2. Stan D, Loprinzi CL, Ruddy KJ. Breast cancer survivorship issues.
Hematology/oncology clinics of North America 2013;27:805-27, ix
3. An JH, Hwangbo Y, Ahn HY, Keam B, Lee KE, Han W, et al. A Possible
Association Between Thyroid Cancer and Breast Cancer. Thyroid 2015;25:1330-8
4. Dong L, Lu J, Zhao B, Wang W, Zhao Y. Review of the possible association
between thyroid and breast carcinoma. World journal of surgical oncology
2018;16:130
5. La Vecchia C, Malvezzi M, Bosetti C, Garavello W, Bertuccio P, Levi F, et al.
Thyroid cancer mortality and incidence: a global overview. International journal
of cancer Journal international du cancer 2015;136:2187-95
6. Davies L, Welch HG. Current thyroid cancer trends in the United States. JAMA
otolaryngology-- head & neck surgery 2014;140:317-22
7. Kilfoy BA, Zheng T, Holford TR, Han X, Ward MH, Sjodin A, et al.
International patterns and trends in thyroid cancer incidence, 1973-2002. Cancer
causes & control : CCC 2009;20:525-31
140
8. Brown AP, Chen J, Hitchcock YJ, Szabo A, Shrieve DC, Tward JD. The risk of
second primary malignancies up to three decades after the treatment of
differentiated thyroid cancer. J Clin Endocrinol Metab 2008;93:504-15
9. Wiltshire JJ, Drake TM, Uttley L, Balasubramanian SP. Systematic Review of
Trends in the Incidence Rates of Thyroid Cancer. Thyroid : official journal of the
American Thyroid Association 2016;26:1541-52
10. Zimmermann MB. Iodine deficiency. Endocrine reviews 2009;30:376-408
11. Zimmermann MB, Galetti V. Iodine intake as a risk factor for thyroid cancer: a
comprehensive review of animal and human studies. Thyroid research 2015;8:8
12. Torre LA, Siegel RL, Ward EM, Jemal A. Global Cancer Incidence and Mortality
Rates and Trends--An Update. Cancer epidemiology, biomarkers & prevention : a
publication of the American Association for Cancer Research, cosponsored by the
American Society of Preventive Oncology 2016;25:16-27
13. Fan L, Strasser-Weippl K, Li JJ, St Louis J, Finkelstein DM, Yu KD, et al. Breast
cancer in China. The Lancet Oncology 2014;15:e279-89
14. McTiernan A, Weiss NS, Daling JR. Incidence of thyroid cancer in women in
relation to known or suspected risk factors for breast cancer. Cancer research
1987;47:292-5
15. Prinzi N, Baldini E, Sorrenti S, De Vito C, Tuccilli C, Catania A, et al. Prevalence
of breast cancer in thyroid diseases: results of a cross-sectional study of 3,921
patients. Breast cancer research and treatment 2014;144:683-8
141
16. An JH, Hwangbo Y, Ahn HY, Keam B, Lee KE, Han W, et al. A Possible
Association Between Thyroid Cancer and Breast Cancer. Thyroid : official
journal of the American Thyroid Association 2015;25:1330-8
17. Zhang L, Wu Y, Liu F, Fu L, Tong Z. Characteristics and survival of patients with
metachronous or synchronous double primary malignancies: breast and thyroid
cancer. Oncotarget 2016;7:52450-9
18. Kuo JH, Chabot JA, Lee JA. Breast cancer in thyroid cancer survivors: An
analysis of the Surveillance, Epidemiology, and End Results-9 database. Surgery
2016;159:23-9
19. Shi Y, Li X, Ran L, Arshad B, Li H, Xu Z, et al. Study on the status of thyroid
function and thyroid nodules in chinese breast cancer patients. Oncotarget
2017;8:80820-5
20. Jung HK, Park S, Kim NW, Lee JE, Kim Z, Han SW, et al. Development of
second primary cancer in Korean breast cancer survivors. Annals of surgical
treatment and research 2017;93:287-92
21. Luo J, Hendryx M, Nassir R, Cheng TD, Lane D, Margolis KL. Benign breast
disease and risk of thyroid cancer. Cancer causes & control : CCC 2017;28:913-
20
22. Van Fossen VL, Wilhelm SM, Eaton JL, McHenry CR. Association of thyroid,
breast and renal cell cancer: a population-based study of the prevalence of second
malignancies. Annals of surgical oncology 2013;20:1341-7
142
23. Song QK, Wang XL, Zhou XN, Yang HB, Li YC, Wu JP, et al. Breast Cancer
Challenges and Screening in China: Lessons From Current Registry Data and
Population Screening Studies. The oncologist 2015;20:773-9
24. Hu ZY, Xiao H, Xiao M, Tang Y, Sun J, Xie ZM, et al. Inducing or Preventing
Subsequent Malignancies for Breast Cancer Survivors? Double-edged Sword of
Estrogen Receptor and Progesterone Receptor. Clinical breast cancer 2018
25. Nielsen SM, White MG, Hong S, Aschebrook-Kilfoy B, Kaplan EL, Angelos P, et
al. The Breast-Thyroid Cancer Link: A Systematic Review and Meta-analysis.
Cancer epidemiology, biomarkers & prevention : a publication of the American
Association for Cancer Research, cosponsored by the American Society of
Preventive Oncology 2016;25:231-8
26. Joseph KR, Edirimanne S, Eslick GD. The association between breast cancer and
thyroid cancer: a meta-analysis. Breast cancer research and treatment
2015;152:173-81
27. Mucci LA, Hjelmborg JB, Harris JR, Czene K, Havelick DJ, Scheike T, et al.
Familial Risk and Heritability of Cancer Among Twins in Nordic Countries. Jama
2016;315:68-76
28. Zheng G, Yu H, Hemminki A, Forsti A, Sundquist K, Hemminki K. Familial
associations of female breast cancer with other cancers. International journal of
cancer Journal international du cancer 2017;141:2253-9
29. Goldgar DE, Easton DF, Cannon-Albright LA, Skolnick MH. Systematic
population-based assessment of cancer risk in first-degree relatives of cancer
probands. Journal of the National Cancer Institute 1994;86:1600-8
143
30. Liaw D, Marsh DJ, Li J, Dahia PL, Wang SI, Zheng Z, et al. Germline mutations
of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer
syndrome. Nature genetics 1997;16:64-7
31. Ngeow J, Sesock K, Eng C. Clinical Implications for Germline PTEN Spectrum
Disorders. Endocrinology and metabolism clinics of North America 2017;46:503-
17
32. Liu P, Cheng H, Roberts TM, Zhao JJ. Targeting the phosphoinositide 3-kinase
pathway in cancer. Nature reviews Drug discovery 2009;8:627-44
33. Wang Y, He X, Yu Q, Eng C. Androgen receptor-induced tumor suppressor,
KLLN, inhibits breast cancer growth and transcriptionally activates p53/p73-
mediated apoptosis in breast carcinomas. Human molecular genetics
2013;22:2263-72
34. Ni Y, He X, Chen J, Moline J, Mester J, Orloff MS, et al. Germline SDHx
variants modify breast and thyroid cancer risks in Cowden and Cowden-like
syndrome via FAD/NAD-dependant destabilization of p53. Human molecular
genetics 2012;21:300-10
35. Ikeda Y, Kiyotani K, Yew PY, Kato T, Tamura K, Yap KL, et al. Germline
PARP4 mutations in patients with primary thyroid and breast cancers. Endocrine-
related cancer 2016;23:171-9
36. Hassa PO, Hottiger MO. The diverse biological roles of mammalian PARPS, a
small but powerful family of poly-ADP-ribose polymerases. Frontiers in
bioscience : a journal and virtual library 2008;13:3046-82
144
37. Sonnenblick A, de Azambuja E, Azim HA, Jr., Piccart M. An update on PARP
inhibitors--moving to the adjuvant setting. Nature reviews Clinical oncology
2015;12:27-41
38. Tracy KM, Tye CE, Ghule PN, Malaby HLH, Stumpff J, Stein JL, et al.
Mitotically-Associated lncRNA (MANCR) Affects Genomic Stability and Cell
Division in Aggressive Breast Cancer. Molecular cancer research : MCR
2018;16:587-98
39. Lu W, Xu Y, Xu J, Wang Z, Ye G. Identification of differential expressed
lncRNAs in human thyroid cancer by a genome-wide analyses. Cancer medicine
2018
40. Sinnott B, Ron E, Schneider AB. Exposing the thyroid to radiation: a review of its
current extent, risks, and implications. Endocrine reviews 2010;31:756-73
41. Ron E, Lubin JH, Shore RE, Mabuchi K, Modan B, Pottern LM, et al. Thyroid
cancer after exposure to external radiation: a pooled analysis of seven studies.
Radiation research 1995;141:259-77
42. Shore RE. Issues and epidemiological evidence regarding radiation-induced
thyroid cancer. Radiation research 1992;131:98-111
43. Akin M, Ergen A, Unal A, Bese N. Irradiation doses on thyroid gland during the
postoperative irradiation for breast cancer. Journal of cancer research and
therapeutics 2014;10:942-4
44. Tunio MA, Al Asiri M, Bayoumi Y, Stanciu LG, Al Johani N, Al Saeed EF. Is
thyroid gland an organ at risk in breast cancer patients treated with locoregional
145
radiotherapy? Results of a pilot study. Journal of cancer research and therapeutics
2015;11:684-9
45. Wolny-Rokicka E, Tukiendorf A, Wydmanski J, Roszkowska D, Staniul BS,
Zembron-Lacny A. Thyroid Function after Postoperative Radiation Therapy in
Patients with Breast Cancer. Asian Pacific journal of cancer prevention : APJCP
2016;17:4577-81
46. Sun LM, Lin CL, Liang JA, Huang WS, Kao CH. Radiotherapy did not increase
thyroid cancer risk among women with breast cancer: A nationwide population-
based cohort study. International journal of cancer Journal international du cancer
2015;137:2896-903
47. Clarke M, Collins R, Darby S, Davies C, Elphinstone P, Evans V, et al. Effects of
radiotherapy and of differences in the extent of surgery for early breast cancer on
local recurrence and 15-year survival: an overview of the randomised trials.
Lancet (London, England) 2005;366:2087-106
48. Moskowitz CS, Chou JF, Wolden SL, Bernstein JL, Malhotra J, Novetsky
Friedman D, et al. Breast cancer after chest radiation therapy for childhood
cancer. Journal of clinical oncology : official journal of the American Society of
Clinical Oncology 2014;32:2217-23
49. Guibout C, Adjadj E, Rubino C, Shamsaldin A, Grimaud E, Hawkins M, et al.
Malignant breast tumors after radiotherapy for a first cancer during childhood.
Journal of clinical oncology : official journal of the American Society of Clinical
Oncology 2005;23:197-204
146
50. Semba RD, Delange F. Iodine in human milk: perspectives for infant health.
Nutrition reviews 2001;59:269-78
51. Venturi S. Is there a role for iodine in breast diseases? Breast (Edinburgh,
Scotland) 2001;10:379-82
52. Saenger EL, Thoma GE, Tompkins EA. Incidence of leukemia following
treatment of hyperthyroidism. Preliminary report of the Cooperative
Thyrotoxicosis Therapy Follow-Up Study. Jama 1968;205:855-62
53. Goldman MB, Maloof F, Monson RR, Aschengrau A, Cooper DS, Ridgway EC.
Radioactive iodine therapy and breast cancer. A follow-up study of hyperthyroid
women. American journal of epidemiology 1988;127:969-80
54. Hoffman DA, McConahey WM, Fraumeni JF, Jr., Kurland LT. Cancer incidence
following treatment of hyperthyroidism. International journal of epidemiology
1982;11:218-24
55. Hoffman DA, McConahey WM. Breast cancer following iodine-131 therapy for
hyperthyroidism. Journal of the National Cancer Institute 1983;70:63-7
56. Zhang Y, Liang J, Li H, Cong H, Lin Y. Risk of second primary breast cancer
after radioactive iodine treatment in thyroid cancer: a systematic review and meta-
analysis. Nucl Med Commun 2016;37:110-5
57. Silva-Vieira M, Carrilho Vaz S, Esteves S, Ferreira TC, Limbert E, Salgado L, et
al. Second Primary Cancer in Patients with Differentiated Thyroid Cancer: Does
Radioiodine Play a Role? Thyroid : official journal of the American Thyroid
Association 2017;27:1068-76
147
58. Khan MA, Bhurani D, Agarwal NB. Alteration of Thyroid Function in Indian
HER 2-Negative Breast Cancer Patients Undergoing Chemotherapy. Asian
Pacific journal of cancer prevention : APJCP 2015;16:7701-5
59. de Groot S, Janssen LG, Charehbili A, Dijkgraaf EM, Smit VT, Kessels LW, et
al. Thyroid function alters during neoadjuvant chemotherapy in breast cancer
patients: results from the NEOZOTAC trial (BOOG 2010-01). Breast cancer
research and treatment 2015;149:461-6
60. Huang J, Jin L, Ji G, Xing L, Xu C, Xiong X, et al. Implication from thyroid
function decreasing during chemotherapy in breast cancer patients:
chemosensitization role of triiodothyronine. BMC cancer 2013;13:334
61. Cristofanilli M, Yamamura Y, Kau SW, Bevers T, Strom S, Patangan M, et al.
Thyroid hormone and breast carcinoma. Primary hypothyroidism is associated
with a reduced incidence of primary breast carcinoma. Cancer 2005;103:1122-8
62. Shi XZ, Jin X, Xu P, Shen HM. Relationship between breast cancer and levels of
serum thyroid hormones and antibodies: a meta-analysis. Asian Pacific journal of
cancer prevention : APJCP 2014;15:6643-7
63. Muller I, Kilburn LS, Taylor PN, Barrett-Lee PJ, Bliss JM, Ellis P, et al. TPOAb
and Thyroid Function Are Not Associated with Breast Cancer Outcome: Evidence
from a Large-Scale Study Using Data from the Taxotere as Adjuvant
Chemotherapy Trial (TACT, CRUK01/001). European thyroid journal
2017;6:197-207
148
64. Hercbergs A, Johnson RE, Ashur-Fabian O, Garfield DH, Davis PJ. Medically
induced euthyroid hypothyroxinemia may extend survival in compassionate need
cancer patients: an observational study. The oncologist 2015;20:72-6
65. Martinez-Iglesias O, Garcia-Silva S, Regadera J, Aranda A. Hypothyroidism
enhances tumor invasiveness and metastasis development. PloS one 2009;4:e6428
66. Lechner MG, Vyas CM, Hamnvik OR, Alexander EK, Larsen PR, Choueiri TK,
et al. Hypothyroidism During Tyrosine Kinase Inhibitor Therapy Is Associated
with Longer Survival in Patients with Advanced Nonthyroidal Cancers. Thyroid :
official journal of the American Thyroid Association 2018;28:445-53
67. Shahrara S, Drvota V, Sylven C. Organ specific expression of thyroid hormone
receptor mRNA and protein in different human tissues. Biological &
pharmaceutical bulletin 1999;22:1027-33
68. Kim WG, Cheng SY. Thyroid hormone receptors and cancer. Biochimica et
biophysica acta 2013;1830:3928-36
69. Furuya F, Hanover JA, Cheng SY. Activation of phosphatidylinositol 3-kinase
signaling by a mutant thyroid hormone beta receptor. Proceedings of the National
Academy of Sciences of the United States of America 2006;103:1780-5
70. Martinez-Iglesias O, Garcia-Silva S, Tenbaum SP, Regadera J, Larcher F,
Paramio JM, et al. Thyroid hormone receptor beta1 acts as a potent suppressor of
tumor invasiveness and metastasis. Cancer research 2009;69:501-9
71. Carr FE, Tai PW, Barnum MS, Gillis NE, Evans KG, Taber TH, et al. Thyroid
Hormone Receptor beta (TRbeta) Mediates Runt-Related Transcription Factor 2
149
(Runx2) Expression in Thyroid Cancer Cells: A novel signaling pathway in
thyroid cancer. Endocrinology 2016:en20152046
72. Gillis NE, Taber TH, Bolf EL, Beaudet CM, Tomczak JA, White JH, et al.
Thyroid Hormone Receptor beta Suppression of RUNX2 Is Mediated by Brahma-
Related Gene 1-Dependent Chromatin Remodeling. Endocrinology
2018;159:2484-94
73. Taipaleenmaki H, Browne G, Akech J, Zustin J, van Wijnen AJ, Stein JL, et al.
Targeting of Runx2 by miR-135 and miR-203 Impairs Progression of Breast
Cancer and Metastatic Bone Disease. Cancer research 2015;75:1433-44
74. Pande S, Browne G, Padmanabhan S, Zaidi SK, Lian JB, van Wijnen AJ, et al.
Oncogenic cooperation between PI3K/Akt signaling and transcription factor
Runx2 promotes the invasive properties of metastatic breast cancer cells. Journal
of cellular physiology 2013;228:1784-92
75. Davis PJ, Davis FB, Cody V. Membrane receptors mediating thyroid hormone
action. Trends in endocrinology and metabolism: TEM 2005;16:429-35
76. Rodgers KM, Udesky JO, Rudel RA, Brody JG. Environmental chemicals and
breast cancer: An updated review of epidemiological literature informed by
biological mechanisms. Environmental research 2018;160:152-82
77. Moleti M, Sturniolo G, Di Mauro M, Russo M, Vermiglio F. Female
Reproductive Factors and Differentiated Thyroid Cancer. Frontiers in
endocrinology 2017;8:111
150
78. Gore AC, Chappell VA, Fenton SE, Flaws JA, Nadal A, Prins GS, et al. EDC-2:
The Endocrine Society's Second Scientific Statement on Endocrine-Disrupting
Chemicals. Endocrine reviews 2015;36:E1-e150
79. Del Pup L, Mantovani A, Cavaliere C, Facchini G, Luce A, Sperlongano P, et al.
Carcinogenetic mechanisms of endocrine disruptors in female cancers (Review).
Oncology reports 2016;36:603-12
80. Zhou Z, Zhang J, Jiang F, Xie Y, Zhang X, Jiang L. Higher urinary bisphenol A
concentration and excessive iodine intake are associated with nodular goiter and
papillary thyroid carcinoma. Bioscience reports 2017;37
81. Hoffman K, Lorenzo A, Butt CM, Hammel SC, Henderson BB, Roman SA, et al.
Exposure to flame retardant chemicals and occurrence and severity of papillary
thyroid cancer: A case-control study. Environment international 2017;107:235-42
82. Soto AM, Vandenberg LN, Maffini MV, Sonnenschein C. Does breast cancer
start in the womb? Basic & clinical pharmacology & toxicology 2008;102:125-33
83. Stavreva DA, Varticovski L, Levkova L, George AA, Davis L, Pegoraro G, et al.
Novel cell-based assay for detection of thyroid receptor beta-interacting
environmental contaminants. Toxicology 2016;368-369:69-79
84. Moriyama K, Tagami T, Akamizu T, Usui T, Saijo M, Kanamoto N, et al.
Thyroid hormone action is disrupted by bisphenol A as an antagonist. The Journal
of clinical endocrinology and metabolism 2002;87:5185-90
85. Hanley JP, Jackson E, Morrissey LA, Rizzo DM, Sprague BL, Sarkar IN, et al.
Geospatial and Temporal Analysis of Thyroid Cancer Incidence in a Rural
151
Population. Thyroid : official journal of the American Thyroid Association
2015;25:812-22
86. Blows FM, Driver KE, Schmidt MK, Broeks A, van Leeuwen FE, Wesseling J, et
al. Subtyping of breast cancer by immunohistochemistry to investigate a
relationship between subtype and short and long term survival: a collaborative
analysis of data for 10,159 cases from 12 studies. PLoS medicine
2010;7:e1000279
87. Chavez-Macgregor M, Clarke CA, Lichtensztajn D, Hortobagyi GN, Giordano
SH. Male breast cancer according to tumor subtype and race: a population-based
study. Cancer 2013;119:1611-7
88. Zidan J, Rubenstein W. Effect of adjuvant tamoxifen therapy on thyroid function
in postmenopausal women with breast cancer. Oncology 1999;56:43-5
89. de Araujo LF, Soares JM, Jr., Simoes RS, Calio PL, Oliveira-Filho RM, Simoes
Mde J, et al. Effect of conjugated equine estrogens and tamoxifen administration
on thyroid gland histomorphology of the rat. Clinics (Sao Paulo, Brazil)
2006;61:321-6
90. Mazer NA. Interaction of estrogen therapy and thyroid hormone replacement in
postmenopausal women. Thyroid : official journal of the American Thyroid
Association 2004;14 Suppl 1:S27-34
91. Weiderpass E. Lifestyle and cancer risk. Journal of preventive medicine and
public health 2010;43:459-71
152
92. Sprague BL, Trentham-Dietz A, Egan KM, Titus-Ernstoff L, Hampton JM,
Newcomb PA. Proportion of invasive breast cancer attributable to risk factors
modifiable after menopause. American journal of epidemiology 2008;168:404-11
93. Harvie M, Howell A, Evans DG. Can diet and lifestyle prevent breast cancer:
what is the evidence? American Society of Clinical Oncology educational book /
ASCO American Society of Clinical Oncology Meeting 2015:e66-73
94. Ma J, Huang M, Wang L, Ye W, Tong Y, Wang H. Obesity and risk of thyroid
cancer: evidence from a meta-analysis of 21 observational studies. Medical
science monitor : international medical journal of experimental and clinical
research 2015;21:283-91
95. Schmid D, Ricci C, Behrens G, Leitzmann MF. Adiposity and risk of thyroid
cancer: a systematic review and meta-analysis. Obesity reviews : an official
journal of the International Association for the Study of Obesity 2015;16:1042-54
96. Schmid D, Behrens G, Jochem C, Keimling M, Leitzmann M. Physical activity,
diabetes, and risk of thyroid cancer: a systematic review and meta-analysis.
European journal of epidemiology 2013;28:945-58
97. Leitzmann MF, Brenner A, Moore SC, Koebnick C, Park Y, Hollenbeck A, et al.
Prospective study of body mass index, physical activity and thyroid cancer.
International journal of cancer Journal international du cancer 2010;126:2947-56
98. Hong SH, Myung SK, Kim HS. Alcohol Intake and Risk of Thyroid Cancer: A
Meta-Analysis of Observational Studies. Cancer research and treatment : official
journal of Korean Cancer Association 2017;49:534-47
153
99. Kim WG, Park JW, Willingham MC, Cheng SY. Diet-induced obesity increases
tumor growth and promotes anaplastic change in thyroid cancer in a mouse
model. Endocrinology 2013;154:2936-47
100. Chang CC, Wu MJ, Yang JY, Camarillo IG, Chang CJ. Leptin-STAT3-G9a
Signaling Promotes Obesity-Mediated Breast Cancer Progression. Cancer
research 2015;75:2375-86
101. Lapeire L, Hendrix A, Lambein K, Van Bockstal M, Braems G, Van Den Broecke
R, et al. Cancer-associated adipose tissue promotes breast cancer progression by
paracrine oncostatin M and Jak/STAT3 signaling. Cancer research 2014;74:6806-
19
102. Johansson I, Killander F, Linderholm B, Hedenfalk I. Molecular profiling of male
breast cancer - lost in translation? The international journal of biochemistry & cell
biology 2014;53:526-35
103. Rahbari R, Zhang L, Kebebew E. Thyroid cancer gender disparity. Future
oncology (London, England) 2010;6:1771-9
154
CHAPTER 6: Discussion and Concluding Remarks
6.1. Summary
This dissertation provides insights into the mechanisms by which a tumor
suppressor, TRβ, acts to repress the malignant character of both thyroid and breast
cancer. Phenotypic and transcriptomic characterization of TRβ activity using an
anaplastic thyroid cancer cell line, SW1736, was performed and discussed in chapter 2,
demonstrating that TRβ broadly represses the aggressive malignant phenotype of the
cells. Chapter 3 details the evidence that the TRβ-RUNX2 pathway is active in breast
cancer. RUNX2, a transcription factor that is aberrantly overexpressed in dedifferentiated
tumors and drives cancer progression, was already known to be regulated by TRβ in
thyroid cancer. This provides an example of shared tumor suppressive signaling in breast
and thyroid cells, suggestive that TRβ-mediated tumor suppressive mechanisms are
active across different cell types. Additionally, transcriptomic profiling was performed on
the breast cancer cell line MDA-MB-468 and discussed in chapter 4, where it was
compared with the transcriptomic profiling of TRβ performed in chapter 2. These studies
yielded insights both into how TRβ alters the gene expression program of both of these
cancer cells lines, and also revealed a set of genes regulated by TRβ in both cell types.
Intriguingly, there is a link between breast and thyroid cancer, discussed in chapter 5, and
as a shared tumor suppressor, loss TRβ and TRβ-mediated tumor suppressive signaling
may have a role in the etiology.
155
6.2. Implications
The work presented in this dissertation reveals important mechanistic insights into
TRβ-mediated tumor suppression. This work has uncovered novel signaling networks in
both thyroid and breast cancer types. This includes the discovery that STAT1 signaling is
upregulated by TRβ in thyroid cancer cells and that STAT1 is a potential therapeutic
target. Importantly, TRβ expression and activity induced differentiation markers, and a
decrease in the cancer stem cell subpopulation, in the thyroid cancers. Additionally, the
degree to which TRβ activity in cancer is dependent upon cellular identity was examined.
This includes demonstrating that the T3-TRβ-RUNX2 pathway is active in breast cancer
in addition to thyroid cancer (1), as well as identifying the genes TRβ regulates in basal-
like breast cancer. In the MDA-MB-468 breast cancer cell line, TRβ also induced a more
epithelial-like gene expression profile, evidenced by changes in the PAM50 score,
expression of pro-invasive cytokeratins, and in repression in epithelial-to-mesenchymal
transition (EMT) drivers. Importantly, TRβ induced a more differentiated gene
expression profile in both breast and thyroid cells. Although different genes may be
involved in determining cellular character, this result does suggest that robust TRβ
expression and activity could aid in maintenance of cellular identify to prevent
tumorigenesis.
Additionally, this research allowed for pairing of the transcriptomic and the
phenotypic effects of heightened TRβ expression in MDA-MB-468. Prior research has
revealed that TRβ reduces in vivo growth of tumors arising from this cell line and reduces
the metastatic capacity of the cells (2,3). Critically, T3 levels enhanced the anti-metastatic
capacity of TRβ (3). This dissertation adds to that research by highlighting changes in
156
transcriptomic networks that drive metastasis including the aforementioned cytokeratins
and EMT markers as well as novel induction of genes encoding stearate biosynthetic
enzymes. TRβ-mediated induction of the stearate biosynthesis pathway was observed in
both breast and thyroid cell lines. Although stearate is known to have an anti-tumor role
in breast cancer, demonstrated in vitro (4) and in vivo (5), there are a lack of studies on
the role of this lipid in thyroid cancer. The shared analysis also showed there were
significant changes to gene sets involved in chromatin organization and protein
degradation, consistent with the concept that TRβ acts to restore a homeostatic gene
regulation to a cancer cell and blocks the aberrant transcriptional activity intrinsic to
cancer cells (6).
Interestingly, although the PI3K pathway is a driver of both breast and thyroid
tumors and TRβ is known to directly modulate the activity of the PI3K enzyme complex,
repression of the pathway was only predicted from the SW1736 transcriptomic results.
Regardless, TRβ represses phosphorylation of effectors of the PI3K pathway in a breast
cancer model (7) and TRβ induced a similar repression of AKT phosphorylation in
SW1736 cells. The lack of a predicted PI3K pathway repression in the MDA-MB-468
cells is likely a limitation of using a transcriptomic profile to model pathways that are
largely mediated by post-translational modifications to effector kinases. Additionally, as
a master regulatory pathway, the downstream response from altered PI3K activity is most
likely dependent upon the cellular context, including the mutational profile of a cell,
chromatin organization, and pathway cross-talk.
157
6.3. Future Directions
These studies can be built upon by a deeper investigation into the consequences of
the pathways revealed to be regulated by TRβ. There is not yet a study showing that
overexpression of TRβ in ATC reduces tumor growth in vivo and the SW1736 ATC cell
line I modified to overexpression TRβ would serve this purpose. The transcriptomic
results can inform what pathways to examine in the resultant tumors, including STAT1-
regulated genes, PI3K effectors, thyroid differentiation markers, and epithelial markers.
Another intriguing avenue of research is the aforementioned stearate biosynthetic
pathway. Stearic acid levels of the cells overexpressing TRβ should be measured to
confirm that the pathway is functionally stimulated. Stearate has been investigated as an
anti-tumor agent in breast cancer, but the role of this lipid in thyroid cancer is unknown.
An investigation into the pharmacological properties of stearate on thyroid cancer cells
may provide a novel treatment strategy for advanced cases of thyroid cancer. This
includes measuring proliferation, cellular migration, and apoptosis following stearate
treatment of ATC cells. It would also be of value to test whether blocking stearate
biosynthesis impairs TRβ-T3 mediated tumor suppression. Should there be an effect in
vitro, a mouse model of advanced thyroid cancer should be given a stearate high diet to
determine if the lipid represses tumorigenesis.
TRβ itself may be a target of therapeutic intervention. Although the studies in this
dissertation relied upon stimulation with T3, many TRβ-selective thyromimetics have
been developed (8). Importantly, one of these agents, GC-1, elicited the same
transcriptional response as T3 in a liver cell line that expressed TRβ, but lacked TRα (9).
These agents may be able to stimulate endogenous TRβ and elicit an anti-tumor response.
158
As this analysis has revealed a multitude of pathways relevant to cancer progression, a
rational approach can be taken where TRβ agonists can be combined with modulators of
other pathways to enhance efficacy. Candidate pathways from the research presented in
this dissertation include PI3K inhibitors, interferons, and STAT1 agonists. Additionally,
as Gene Set Enrichment Analysis of the differentially expressed genes shared between
both SW-TRβ and 468-TRβ revealed many chromatin organization pathways were
altered, the efficacy of epigenetic modulators may also be increased with a TRβ agonist.
For example, histone deacetylase and bromodomain inhibitors show promise in both
anaplastic thyroid cancer (10) and breast cancer (11,12).
6.4. Concluding Remarks
The work presented in this dissertation adds to the fields of breast and thyroid
cancer research by revealing novel insights into the molecular activity of a tumor
suppressor. TRβ acts upon multiple pathways and regulates numerous cancer-relevant
phenotypes including proliferation, migration, stemness, and apoptosis. Through the
modulation of many cellular networks, including RUNX2, JAK/STAT, and PI3K, TRβ
drives an anti-tumor gene expression program that blunts the aggressive nature of a
tumor. These results support the potential of TRβ as not only a therapeutic target, but also
a biomarker.
References
1. Carr FE, Tai PW, Barnum MS, Gillis NE, Evans KG, Taber TH, White JH,
Tomczak JA, Jaworski DM, Zaidi SK, Lian JB, Stein JL, Stein GS. Thyroid
159
Hormone Receptor-beta (TRbeta) Mediates Runt-Related Transcription Factor 2
(Runx2) Expression in Thyroid Cancer Cells: A Novel Signaling Pathway in
Thyroid Cancer. Endocrinology. 2016;157(8):3278-3292.
2. Martinez-Iglesias O, Garcia-Silva S, Tenbaum SP, Regadera J, Larcher F,
Paramio JM, Vennstrom B, Aranda A. Thyroid hormone receptor beta1 acts as a
potent suppressor of tumor invasiveness and metastasis. Cancer research.
2009;69(2):501-509.
3. Martinez-Iglesias O, Garcia-Silva S, Regadera J, Aranda A. Hypothyroidism
enhances tumor invasiveness and metastasis development. PLoS One.
2009;4(7):e6428.
4. Hardy S, El-Assaad W, Przybytkowski E, Joly E, Prentki M, Langelier Y.
Saturated fatty acid-induced apoptosis in MDA-MB-231 breast cancer cells. A
role for cardiolipin. J Biol Chem. 2003;278(34):31861-31870.
5. Evans LM, Toline EC, Desmond R, Siegal GP, Hashim AI, Hardy RW. Dietary
stearate reduces human breast cancer metastasis burden in athymic nude mice.
Clin Exp Metastasis. 2009;26(5):415-424.
6. Bradner JE, Hnisz D, Young RA. Transcriptional Addiction in Cancer. Cell.
2017;168(4):629-643.
7. Park JW, Zhao L, Willingham M, Cheng S-y. Oncogenic mutations of thyroid
hormone receptor β. Oncotarget. 2015;6(10):8115-8131.
8. Elbers LP, Kastelein JJ, Sjouke B. Thyroid Hormone Mimetics: the Past, Current
Status and Future Challenges. Current atherosclerosis reports. 2016;18(3):14.
9. Yuan C, Lin JZ, Sieglaff DH, Ayers SD, Denoto-Reynolds F, Baxter JD, Webb P.
160
Identical gene regulation patterns of T3 and selective thyroid hormone receptor
modulator GC-1. Endocrinology. 2012;153(1):501-511.
10. Saini S, Tulla K, Maker AV, Burman KD, Prabhakar BS. Therapeutic advances in
anaplastic thyroid cancer: a current perspective. Mol Cancer. 2018;17(1):154.
11. Sahni JM, Keri RA. Targeting bromodomain and extraterminal proteins in breast
cancer. Pharmacol Res. 2018;129:156-176.
12. Lee A, Djamgoz MBA. Triple negative breast cancer: Emerging therapeutic
modalities and novel combination therapies. Cancer treatment reviews.
2018;62:110-122.
161
COMPREHENSIVE BIBLIOGRAPHY
Akech, J., Wixted, J. J., Bedard, K., van der Deen, M., Hussain, S., Guise, T. A., . . .
Lian, J. B. (2010). Runx2 association with progression of prostate cancer in
patients: mechanisms mediating bone osteolysis and osteoblastic metastatic
lesions. Oncogene, 29(6), 811-821. doi:10.1038/onc.2009.389
Akin, M., Ergen, A., Unal, A., & Bese, N. (2014). Irradiation doses on thyroid gland
during the postoperative irradiation for breast cancer. J Cancer Res Ther, 10(4),
942-944. doi:10.4103/0973-1482.137991
Alamino, V. A., Mascanfroni, I. D., Montesinos, M. M., Gigena, N., Donadio, A. C.,
Blidner, A. G., . . . Pellizas, C. G. (2015). Antitumor Responses Stimulated by
Dendritic Cells Are Improved by Triiodothyronine Binding to the Thyroid
Hormone Receptor beta. Cancer Res, 75(7), 1265-1274. doi:10.1158/0008-
5472.can-14-1875
Alessi, D. R., James, S. R., Downes, C. P., Holmes, A. B., Gaffney, P. R., Reese, C. B.,
& Cohen, P. (1997). Characterization of a 3-phosphoinositide-dependent protein
kinase which phosphorylates and activates protein kinase Balpha. Curr Biol, 7(4),
261-269. doi:10.1016/s0960-9822(06)00122-9
Ali, A. M., Ansari, J. A. K., El-Aziz, N. M. A., Abozeed, W. N., Warith, A. M. A.,
Alsaleh, K., & Nabholtz, J. M. (2017). Triple Negative Breast Cancer: A Tale of
Two Decades. Anticancer Agents Med Chem, 17(4), 491-499.
doi:10.2174/1871520616666160725112335
Altieri, D. C., Languino, L. R., Lian, J. B., Stein, J. L., Leav, I., van Wijnen, A. J., . . .
Stein, G. S. (2009). Prostate cancer regulatory networks. J Cell Biochem, 107(5),
845-852. doi:10.1002/jcb.22162
An, J. H., Hwangbo, Y., Ahn, H. Y., Keam, B., Lee, K. E., Han, W., . . . Park, Y. J.
(2015). A Possible Association Between Thyroid Cancer and Breast Cancer.
Thyroid, 25(12), 1330-1338. doi:10.1089/thy.2014.0561
Anyetei-Anum, C. S., Roggero, V. R., & Allison, L. A. (2018). Thyroid hormone
receptor localization in target tissues. J Endocrinol, 237(1), R19-r34.
doi:10.1530/joe-17-0708
Apriletti, J. W., Ribeiro, R. C., Wagner, R. L., Feng, W., Webb, P., Kushner, P. J., . . .
Baxter, J. D. (1998). Molecular and structural biology of thyroid hormone
receptors. Clin Exp Pharmacol Physiol Suppl, 25, S2-11. doi:10.1111/j.1440-
1681.1998.tb02293.x
Aranda, A., Martinez-Iglesias, O., Ruiz-Llorente, L., Garcia-Carpizo, V., & Zambrano,
A. (2009). Thyroid receptor: roles in cancer. Trends Endocrinol Metab, 20(7),
318-324. doi:10.1016/j.tem.2009.03.011
Argiris, A., Agarwala, S. S., Karamouzis, M. V., Burmeister, L. A., & Carty, S. E.
(2008). A phase II trial of doxorubicin and interferon alpha 2b in advanced, non-
medullary thyroid cancer. Invest New Drugs, 26(2), 183-188.
doi:10.1007/s10637-007-9091-2
162
Asif, H. M., Sultana, S., Ahmed, S., Akhtar, N., & Tariq, M. (2016). HER-2 Positive
Breast Cancer - a Mini-Review. Asian Pac J Cancer Prev, 17(4), 1609-1615.
doi:10.7314/apjcp.2016.17.4.1609
Astapova, I. (2016). Role of co-regulators in metabolic and transcriptional actions of
thyroid hormone. J Mol Endocrinol, 56(3), 73-97. doi:10.1530/jme-15-0246
Bailey, T. A., Luan, H., Clubb, R. J., Naramura, M., Band, V., Raja, S. M., & Band, H.
(2011). Mechanisms of Trastuzumab resistance in ErbB2-driven breast cancer and
newer opportunities to overcome therapy resistance. J Carcinog, 10, 28.
doi:10.4103/1477-3163.90442
Baloch, Z. W., Harrell, R. M., Brett, E. M., Randolph, G., & Garber, J. R. (2017).
AMERICAN ASSOCIATION OF CLINICAL ENDOCRINOLOGISTS AND
AMERICAN COLLEGE OF ENDOCRINOLOGY DISEASE STATE
COMMENTARY: MANAGING THYROID TUMORS DIAGNOSED AS
NONINVASIVE FOLLICULAR THYROID NEOPLASM WITH PAPILLARY-
LIKE NUCLEAR FEATURES. Endocr Pract, 23(9), 1150-1155.
doi:10.4158/ep171940.Dscr
Baniahmad, A. (2002). Introduction to thyroid hormone receptors. Methods Mol Biol,
202, 1-12. doi:10.1385/1-59259-174-4:01
Bayat Mokhtari, R., Homayouni, T. S., Baluch, N., Morgatskaya, E., Kumar, S., Das, B.,
& Yeger, H. (2017). Combination therapy in combating cancer. Oncotarget,
8(23), 38022-38043. doi:10.18632/oncotarget.16723
Berns, K., Horlings, H. M., Hennessy, B. T., Madiredjo, M., Hijmans, E. M., Beelen, K.,
. . . Bernards, R. (2007). A functional genetic approach identifies the PI3K
pathway as a major determinant of trastuzumab resistance in breast cancer.
Cancer Cell, 12(4), 395-402. doi:10.1016/j.ccr.2007.08.030
Bhat, M. K., Ashizawa, K., & Cheng, S. Y. (1994). Phosphorylation enhances the target
gene sequence-dependent dimerization of thyroid hormone receptor with retinoid
X receptor. Proc Natl Acad Sci U S A, 91(17), 7927-7931.
Blakemore, J., & Naftolin, F. (2016). Aromatase: Contributions to Physiology and
Disease in Women and Men. Physiology (Bethesda), 31(4), 258-269.
doi:10.1152/physiol.00054.2015
Blows, F. M., Driver, K. E., Schmidt, M. K., Broeks, A., van Leeuwen, F. E., Wesseling,
J., . . . Huntsman, D. (2010). Subtyping of breast cancer by
immunohistochemistry to investigate a relationship between subtype and short
and long term survival: a collaborative analysis of data for 10,159 cases from 12
studies. PLoS Med, 7(5), e1000279. doi:10.1371/journal.pmed.1000279
Bolf, E. L., Gillis, N. E., Barnum, M. S., Beaudet, C. M., Yu, G. Y., Tomczak, J. A., . . .
Carr, F. E. (2019). The Thyroid Hormone Receptor-RUNX2 Axis: A Novel
Tumor Suppressive Pathway in Breast Cancer. Horm Cancer.
doi:10.1007/s12672-019-00373-2
Bolf, E. L., Sprague, B. L., & Carr, F. E. (2019). A Linkage Between Thyroid and Breast
Cancer: A Common Etiology? Cancer Epidemiol Biomarkers Prev, 28(4), 643-
649. doi:10.1158/1055-9965.epi-18-0877
Boregowda, R. K., Olabisi, O. O., Abushahba, W., Jeong, B. S., Haenssen, K. K., Chen,
W., . . . Cohen-Solal, K. A. (2014). RUNX2 is overexpressed in melanoma cells
163
and mediates their migration and invasion. Cancer Lett, 348(1-2), 61-70.
doi:10.1016/j.canlet.2014.03.011
Bozorg-Ghalati, F., Hedayati, M., Dianatpour, M., Azizi, F., Mosaffa, N., & Mehrabani,
D. (2017). Effects of a Phosphoinositide-3-Kinase Inhibitor on Anaplastic
Thyroid Cancer Stem Cells. Asian Pac J Cancer Prev, 18(8), 2287-2291.
doi:10.22034/apjcp.2017.18.8.2287
Bradner, J. E., Hnisz, D., & Young, R. A. (2017). Transcriptional Addiction in Cancer.
Cell, 168(4), 629-643. doi:10.1016/j.cell.2016.12.013
Bray, F., Ferlay, J., Soerjomataram, I., Siegel, R. L., Torre, L. A., & Jemal, A. (2018).
Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality
worldwide for 36 cancers in 185 countries. CA Cancer J Clin, 68(6), 394-424.
doi:10.3322/caac.21492
Bresson, C., Keime, C., Faure, C., Letrillard, Y., Barbado, M., Sanfilippo, S., . . . Gonin-
Giraud, S. (2007). Large-scale analysis by SAGE reveals new mechanisms of v-
erbA oncogene action. BMC Genomics, 8, 390. doi:10.1186/1471-2164-8-390
Brown, A. P., Chen, J., Hitchcock, Y. J., Szabo, A., Shrieve, D. C., & Tward, J. D.
(2008). The risk of second primary malignancies up to three decades after the
treatment of differentiated thyroid cancer. J Clin Endocrinol Metab, 93(2), 504-
515. doi:10.1210/jc.2007-1154
Bychkov, A., Jung, C. K., Liu, Z., & Kakudo, K. (2018). Noninvasive Follicular Thyroid
Neoplasm with Papillary-Like Nuclear Features in Asian Practice: Perspectives
for Surgical Pathology and Cytopathology. Endocr Pathol, 29(3), 276-288.
doi:10.1007/s12022-018-9519-6
Cancer Genome Atlas Research, N. (2014). Integrated genomic characterization of
papillary thyroid carcinoma. Cell, 159(3), 676-690.
doi:10.1016/j.cell.2014.09.050
Cao, Z., Sun, B., Zhao, X., Zhang, Y., Gu, Q., Liang, X., . . . Zhao, N. (2017). The
Expression and Functional Significance of Runx2 in Hepatocellular Carcinoma:
Its Role in Vasculogenic Mimicry and Epithelial-Mesenchymal Transition. Int J
Mol Sci, 18(3). doi:10.3390/ijms18030500
Caramelo, O., Silva, C., Caramelo, F., Frutuoso, C., & Almeida-Santos, T. (2019). The
effect of neoadjuvant platinum-based chemotherapy in BRCA mutated triple
negative breast cancers -systematic review and meta-analysis. Hered Cancer Clin
Pract, 17, 11. doi:10.1186/s13053-019-0111-y
Caron-Jobin, M., Mauvoisin, D., Michaud, A., Veilleux, A., Noel, S., Fortier, M. P., . . .
Mounier, C. (2012). Stearic acid content of abdominal adipose tissues in obese
women. Nutr Diabetes, 2, e23. doi:10.1038/nutd.2011.19
Carr, F. E., Tai, P. W., Barnum, M. S., Gillis, N. E., Evans, K. G., Taber, T. H., . . . Stein,
G. S. (2016b). Thyroid Hormone Receptor beta (TRbeta) Mediates Runt-Related
Transcription Factor 2 (Runx2) Expression in Thyroid Cancer Cells: A novel
signaling pathway in thyroid cancer. Endocrinology, en20152046.
doi:10.1210/en.2015-2046
Cerami, E., Gao, J., Dogrusoz, U., Gross, B. E., Sumer, S. O., Aksoy, B. A., . . . Schultz,
N. (2012). The cBio cancer genomics portal: an open platform for exploring
164
multidimensional cancer genomics data. Cancer Discov, 2(5), 401-404.
doi:10.1158/2159-8290.Cd-12-0095
Chakravarty, D., Santos, E., Ryder, M., Knauf, J. A., Liao, X. H., West, B. L., . . . Fagin,
J. A. (2011). Small-molecule MAPK inhibitors restore radioiodine incorporation
in mouse thyroid cancers with conditional BRAF activation. J Clin Invest,
121(12), 4700-4711. doi:10.1172/jci46382
Chang, C. C., Wu, M. J., Yang, J. Y., Camarillo, I. G., & Chang, C. J. (2015). Leptin-
STAT3-G9a Signaling Promotes Obesity-Mediated Breast Cancer Progression.
Cancer Res, 75(11), 2375-2386. doi:10.1158/0008-5472.can-14-3076
Chavez-Macgregor, M., Clarke, C. A., Lichtensztajn, D., Hortobagyi, G. N., & Giordano,
S. H. (2013). Male breast cancer according to tumor subtype and race: a
population-based study. Cancer, 119(9), 1611-1617. doi:10.1002/cncr.27905
Cheang, M. C., Chia, S. K., Voduc, D., Gao, D., Leung, S., Snider, J., . . . Nielsen, T. O.
(2009). Ki67 index, HER2 status, and prognosis of patients with luminal B breast
cancer. J Natl Cancer Inst, 101(10), 736-750. doi:10.1093/jnci/djp082
Chen, J. D., Umesono, K., & Evans, R. M. (1996). SMRT isoforms mediate repression
and anti-repression of nuclear receptor heterodimers. Proc Natl Acad Sci U S A,
93(15), 7567-7571. doi:10.1073/pnas.93.15.7567
Cheng, S.-Y., Leonard, J. L., & Davis, P. J. (2010). Molecular Aspects of Thyroid
Hormone Actions. Endocrine Reviews, 31(2), 139-170. doi:10.1210/er.2009-0007
Cheng, S. Y. (2000). Multiple mechanisms for regulation of the transcriptional activity of
thyroid hormone receptors. Rev Endocr Metab Disord, 1(1-2), 9-18.
doi:10.1023/a:1010052101214
Cheung, K. J., Gabrielson, E., Werb, Z., & Ewald, A. J. (2013). Collective invasion in
breast cancer requires a conserved basal epithelial program. Cell, 155(7), 1639-
1651. doi:10.1016/j.cell.2013.11.029
Chi, H. C., Chen, S. L., Tsai, C. Y., Chuang, W. Y., Huang, Y. H., Tsai, M. M., . . . Lin,
K. H. (2016). Thyroid hormone suppresses hepatocarcinogenesis via DAPK2 and
SQSTM1-dependent selective autophagy. Autophagy, 12(12), 2271-2285.
doi:10.1080/15548627.2016.1230583
Chibon, F., de Mascarel, I., Sierankowski, G., Brouste, V., Bonnefoi, H., Debled, M., . . .
MacGrogan, G. (2009). Prediction of HER2 gene status in Her2 2+ invasive
breast cancer: a study of 108 cases comparing ASCO/CAP and FDA
recommendations. Mod Pathol, 22(3), 403-409. doi:10.1038/modpathol.2008.195
Chiellini, G., Apriletti, J. W., Yoshihara, H. A., Baxter, J. D., Ribeiro, R. C., & Scanlan,
T. S. (1998). A high-affinity subtype-selective agonist ligand for the thyroid
hormone receptor. Chem Biol, 5(6), 299-306.
Cicatiello, A. G., Ambrosio, R., & Dentice, M. (2017). Thyroid hormone promotes
differentiation of colon cancer stem cells. Mol Cell Endocrinol, 459, 84-89.
doi:10.1016/j.mce.2017.03.017
Clarke, M., Collins, R., Darby, S., Davies, C., Elphinstone, P., Evans, V., . . . Wang, Y.
(2005). Effects of radiotherapy and of differences in the extent of surgery for
early breast cancer on local recurrence and 15-year survival: an overview of the
randomised trials. Lancet, 366(9503), 2087-2106. doi:10.1016/s0140-
6736(05)67887-7
165
Cohen, K., Flint, N., Shalev, S., Erez, D., Baharal, T., Davis, P. J., . . . Ashur-Fabian, O.
(2014). Thyroid hormone regulates adhesion, migration and matrix
metalloproteinase 9 activity via alphavbeta3 integrin in myeloma cells.
Oncotarget, 5(15), 6312-6322. doi:10.18632/oncotarget.2205
Cristofanilli, M., Yamamura, Y., Kau, S. W., Bevers, T., Strom, S., Patangan, M., . . .
Hortobagyi, G. N. (2005). Thyroid hormone and breast carcinoma. Primary
hypothyroidism is associated with a reduced incidence of primary breast
carcinoma. Cancer, 103(6), 1122-1128. doi:10.1002/cncr.20881
Dace, A., Zhao, L., Park, K. S., Furuno, T., Takamura, N., Nakanishi, M., . . . Cheng, S.
(2000). Hormone binding induces rapid proteasome-mediated degradation of
thyroid hormone receptors. Proc Natl Acad Sci U S A, 97(16), 8985-8990.
doi:10.1073/pnas.160257997
Dai, Z., Guo, F., Wu, F., Xu, H., Yang, C., Li, J., . . . Li, Y. (2014). Integrin alphavbeta3
mediates the synergetic regulation of core-binding factor alpha1 transcriptional
activity by gravity and insulin-like growth factor-1 through phosphoinositide 3-
kinase signaling. Bone, 69, 126-132. doi:10.1016/j.bone.2014.09.018
Davies, L., & Welch, H. G. (2014). Current thyroid cancer trends in the United States.
JAMA Otolaryngol Head Neck Surg, 140(4), 317-322.
doi:10.1001/jamaoto.2014.1
Davis, P. J., Davis, F. B., & Cody, V. (2005). Membrane receptors mediating thyroid
hormone action. Trends Endocrinol Metab, 16(9), 429-435.
doi:10.1016/j.tem.2005.09.007
Davis, P. J., Davis, F. B., Mousa, S. A., Luidens, M. K., & Lin, H. Y. (2011). Membrane
receptor for thyroid hormone: physiologic and pharmacologic implications. Annu
Rev Pharmacol Toxicol, 51, 99-115. doi:10.1146/annurev-pharmtox-010510-
100512
Davis, P. J., Goglia, F., & Leonard, J. L. (2016). Nongenomic actions of thyroid
hormone. Nat Rev Endocrinol, 12(2), 111-121. doi:10.1038/nrendo.2015.205
de Araujo, L. F., Soares, J. M., Jr., Simoes, R. S., Calio, P. L., Oliveira-Filho, R. M.,
Simoes Mde, J., . . . Baracat, E. C. (2006). Effect of conjugated equine estrogens
and tamoxifen administration on thyroid gland histomorphology of the rat. Clinics
(Sao Paulo), 61(4), 321-326.
de Groot, S., Janssen, L. G., Charehbili, A., Dijkgraaf, E. M., Smit, V. T., Kessels, L. W.,
. . . Kroep, J. R. (2015). Thyroid function alters during neoadjuvant chemotherapy
in breast cancer patients: results from the NEOZOTAC trial (BOOG 2010-01).
Breast Cancer Res Treat, 149(2), 461-466. doi:10.1007/s10549-014-3256-4
Del Pup, L., Mantovani, A., Cavaliere, C., Facchini, G., Luce, A., Sperlongano, P., . . .
Berretta, M. (2016). Carcinogenetic mechanisms of endocrine disruptors in
female cancers (Review). Oncol Rep, 36(2), 603-612. doi:10.3892/or.2016.4886
Denver, R. J., Ouellet, L., Furling, D., Kobayashi, A., Fujii-Kuriyama, Y., & Puymirat, J.
(1999). Basic transcription element-binding protein (BTEB) is a thyroid hormone-
regulated gene in the developing central nervous system. Evidence for a role in
neurite outgrowth. The Journal of biological chemistry, 274(33), 23128-23134.
doi:10.1074/jbc.274.33.23128
166
DeSantis, C., Ma, J., Bryan, L., & Jemal, A. (2014). Breast cancer statistics, 2013. CA
Cancer J Clin, 64(1), 52-62. doi:10.3322/caac.21203
Desbois, C., Aubert, D., Legrand, C., Pain, B., & Samarut, J. (1991). A novel mechanism
of action for v-ErbA: abrogation of the inactivation of transcription factor AP-1
by retinoic acid and thyroid hormone receptors. Cell, 67(4), 731-740.
doi:10.1016/0092-8674(91)90068-a
Doan, T. B., Graham, J. D., & Clarke, C. L. (2017). Emerging functional roles of nuclear
receptors in breast cancer. J Mol Endocrinol, 58(3), R169-R190.
doi:10.1530/JME-16-0082
Dong, L., Lu, J., Zhao, B., Wang, W., & Zhao, Y. (2018). Review of the possible
association between thyroid and breast carcinoma. World J Surg Oncol, 16(1),
130. doi:10.1186/s12957-018-1436-0
Dralle, H., Machens, A., Basa, J., Fatourechi, V., Franceschi, S., Hay, I. D., . . . Sherman,
S. I. (2015). Follicular cell-derived thyroid cancer. Nat Rev Dis Primers, 1,
15077. doi:10.1038/nrdp.2015.77
Durante C, H. N., Baudin E, Leboulleux S, Hartl D, Travagli JP, Caillou B, Ricard M,
Lumbroso JD, De Vathaire F, Schlumberger M. . (2006). Long-term outcome of
444 patients with distant metastases from papillary and follicular thyroid
carcinoma: benefits and limits of radioiodine therapy. . J Clin Endocrinol Metab,
91(8), 2892-2899.
Elbers, L. P., Kastelein, J. J., & Sjouke, B. (2016). Thyroid Hormone Mimetics: the Past,
Current Status and Future Challenges. Curr Atheroscler Rep, 18(3), 14.
doi:10.1007/s11883-016-0564-7
Evans, L. M., Toline, E. C., Desmond, R., Siegal, G. P., Hashim, A. I., & Hardy, R. W.
(2009). Dietary stearate reduces human breast cancer metastasis burden in
athymic nude mice. Clin Exp Metastasis, 26(5), 415-424. doi:10.1007/s10585-
009-9239-x
Fallahi, P., Ferrari, S. M., Piaggi, S., Luconi, M., Cantini, G., Gelmini, S., . . . Antonelli,
A. (2018). The paramount role of cytokines and chemokines in papillary thyroid
cancer: a review and experimental results. Immunol Res, 66(6), 710-722.
doi:10.1007/s12026-018-9056-x
Fan, L., Strasser-Weippl, K., Li, J. J., St Louis, J., Finkelstein, D. M., Yu, K. D., . . .
Goss, P. E. (2014). Breast cancer in China. Lancet Oncol, 15(7), e279-289.
doi:10.1016/s1470-2045(13)70567-9
Ferrari, N., McDonald, L., Morris, J. S., Cameron, E. R., & Blyth, K. (2013). RUNX2 in
mammary gland development and breast cancer. J Cell Physiol, 228(6), 1137-
1142. doi:10.1002/jcp.24285
Flamant, F., Cheng, S. Y., Hollenberg, A. N., Moeller, L. C., Samarut, J., Wondisford, F.
E., . . . Refetoff, S. (2017). Thyroid Hormone Signaling Pathways: Time for a
More Precise Nomenclature. Endocrinology, 158(7), 2052-2057.
doi:10.1210/en.2017-00250
Fondell, J. D., Ge, H., & Roeder, R. G. (1996). Ligand induction of a transcriptionally
active thyroid hormone receptor coactivator complex. Proc Natl Acad Sci U S A,
93(16), 8329-8333. doi:10.1073/pnas.93.16.8329
167
Foulkes, W. D., Smith, I. E., & Reis-Filho, J. S. (2010). Triple-negative breast cancer. N
Engl J Med, 363(20), 1938-1948. doi:10.1056/NEJMra1001389
Foulkes, W. D., Stefansson, I. M., Chappuis, P. O., Begin, L. R., Goffin, J. R., Wong, N.,
. . . Akslen, L. A. (2003). Germline BRCA1 mutations and a basal epithelial
phenotype in breast cancer. J Natl Cancer Inst, 95(19), 1482-1485.
doi:10.1093/jnci/djg050
Furuya, F., Hanover, J. A., & Cheng, S. Y. (2006). Activation of phosphatidylinositol 3-
kinase signaling by a mutant thyroid hormone beta receptor. Proc Natl Acad Sci U
S A, 103(6), 1780-1785. doi:10.1073/pnas.0510849103
Gandrillon, O., Jurdic, P., Benchaibi, M., Xiao, J. H., Ghysdael, J., & Samarut, J. (1987).
Expression of the v-erbA oncogene in chicken embryo fibroblasts stimulates their
proliferation in vitro and enhances tumor growth in vivo. Cell, 49(5), 687-697.
doi:10.1016/0092-8674(87)90545-9
Gao, J., Aksoy, B. A., Dogrusoz, U., Dresdner, G., Gross, B., Sumer, S. O., . . . Schultz,
N. (2013). Integrative analysis of complex cancer genomics and clinical profiles
using the cBioPortal. Sci Signal, 6(269), pl1. doi:10.1126/scisignal.2004088
Gao, J. J., & Swain, S. M. (2018). Luminal A Breast Cancer and Molecular Assays: A
Review. Oncologist, 23(5), 556-565. doi:10.1634/theoncologist.2017-0535
Garcia-Silva, S., & Aranda, A. (2004). The thyroid hormone receptor is a suppressor of
ras-mediated transcription, proliferation, and transformation. Mol Cell Biol,
24(17), 7514-7523. doi:10.1128/MCB.24.17.7514-7523.2004
Ghoncheh, M., Pournamdar, Z., & Salehiniya, H. (2016). Incidence and Mortality and
Epidemiology of Breast Cancer in the World. Asian Pac J Cancer Prev, 17(S3),
43-46. doi:10.7314/apjcp.2016.17.s3.43
Gillis, N. E., Taber, T. H., Bolf, E. L., Beaudet, C. M., Tomczak, J. A., White, J. H., . . .
Carr, F. E. (2018). Thyroid Hormone Receptor beta Suppression of RUNX2 Is
Mediated by Brahma-Related Gene 1-Dependent Chromatin Remodeling.
Endocrinology, 159(6), 2484-2494. doi:10.1210/en.2018-00128
Giuliani, C., Bucci, I., & Napolitano, G. (2018). The Role of the Transcription Factor
Nuclear Factor-kappa B in Thyroid Autoimmunity and Cancer. Front Endocrinol
(Lausanne), 9, 471. doi:10.3389/fendo.2018.00471
Glass, C. K., & Rosenfeld, M. G. (2000). The coregulator exchange in transcriptional
functions of nuclear receptors. Genes Dev, 14(2), 121-141.
Goldgar, D. E., Easton, D. F., Cannon-Albright, L. A., & Skolnick, M. H. (1994).
Systematic population-based assessment of cancer risk in first-degree relatives of
cancer probands. J Natl Cancer Inst, 86(21), 1600-1608.
Goldman, M. B., Maloof, F., Monson, R. R., Aschengrau, A., Cooper, D. S., & Ridgway,
E. C. (1988). Radioactive iodine therapy and breast cancer. A follow-up study of
hyperthyroid women. Am J Epidemiol, 127(5), 969-980.
Gore, A. C., Chappell, V. A., Fenton, S. E., Flaws, J. A., Nadal, A., Prins, G. S., . . .
Zoeller, R. T. (2015). EDC-2: The Endocrine Society's Second Scientific
Statement on Endocrine-Disrupting Chemicals. Endocr Rev, 36(6), E1-e150.
doi:10.1210/er.2015-1010
Greenup, R., Buchanan, A., Lorizio, W., Rhoads, K., Chan, S., Leedom, T., . . . Shelley
Hwang, E. (2013). Prevalence of BRCA mutations among women with triple-
168
negative breast cancer (TNBC) in a genetic counseling cohort. Ann Surg Oncol,
20(10), 3254-3258. doi:10.1245/s10434-013-3205-1
Grontved, L., Waterfall, J. J., Kim, D. W., Baek, S., Sung, M. H., Zhao, L., . . . Cheng, S.
Y. (2015). Transcriptional activation by the thyroid hormone receptor through
ligand-dependent receptor recruitment and chromatin remodelling. Nat Commun,
6, 7048. doi:10.1038/ncomms8048
Gu, G., Gelsomino, L., Covington, K. R., Beyer, A. R., Wang, J., Rechoum, Y., . . .
Fuqua, S. A. (2015). Targeting thyroid hormone receptor beta in triple-negative
breast cancer. Breast Cancer Res Treat, 150(3), 535-545. doi:10.1007/s10549-
015-3354-y
Guan, X., Ma, F., Fan, Y., Zhu, W., Hong, R., & Xu, B. (2015). Platinum-based
chemotherapy in triple-negative breast cancer: a systematic review and meta-
analysis of randomized-controlled trials. Anticancer Drugs, 26(8), 894-901.
doi:10.1097/cad.0000000000000260
Guibout, C., Adjadj, E., Rubino, C., Shamsaldin, A., Grimaud, E., Hawkins, M., . . . de
Vathaire, F. (2005). Malignant breast tumors after radiotherapy for a first cancer
during childhood. J Clin Oncol, 23(1), 197-204. doi:10.1200/jco.2005.06.225
Guigon, C. J., Kim, D. W., Zhu, X., Zhao, L., & Cheng, S. Y. (2010). Tumor suppressor
action of liganded thyroid hormone receptor beta by direct repression of beta-
catenin gene expression. Endocrinology, 151(11), 5528-5536.
doi:10.1210/en.2010-0475
Guigon, C. J., Zhao, L., Lu, C., Willingham, M. C., & Cheng, S. Y. (2008). Regulation of
beta-catenin by a novel nongenomic action of thyroid hormone beta receptor. Mol
Cell Biol, 28(14), 4598-4608. doi:10.1128/mcb.02192-07
Guigon, C. J., Zhao, L., Willingham, M. C., & Cheng, S. Y. (2009). PTEN deficiency
accelerates tumour progression in a mouse model of thyroid cancer. Oncogene,
28(4), 509-517. doi:10.1038/onc.2008.407
Gupta, A., Cao, W., & Chellaiah, M. A. (2012). Integrin alphavbeta3 and CD44 pathways
in metastatic prostate cancer cells support osteoclastogenesis via a Runx2/Smad
5/receptor activator of NF-kappaB ligand signaling axis. Mol Cancer, 11, 66.
doi:10.1186/1476-4598-11-66
Habib, N. A., Wood, C. B., Apostolov, K., Barker, W., Hershman, M. J., Aslam, M., . . .
et al. (1987). Stearic acid and carcinogenesis. Br J Cancer, 56(4), 455-458.
doi:10.1038/bjc.1987.223
Han, L., Zan, Y., Huang, C., & Zhang, S. (2019). NELFE promoted pancreatic cancer
metastasis and the epithelialtomesenchymal transition by decreasing the
stabilization of NDRG2 mRNA. Int J Oncol, 55(6), 1313-1323.
doi:10.3892/ijo.2019.4890
Hanley, J. P., Jackson, E., Morrissey, L. A., Rizzo, D. M., Sprague, B. L., Sarkar, I. N., &
Carr, F. E. (2015). Geospatial and Temporal Analysis of Thyroid Cancer
Incidence in a Rural Population. Thyroid, 25(7), 812-822.
doi:10.1089/thy.2015.0039
Hardy, S., El-Assaad, W., Przybytkowski, E., Joly, E., Prentki, M., & Langelier, Y.
(2003). Saturated fatty acid-induced apoptosis in MDA-MB-231 breast cancer
169
cells. A role for cardiolipin. J Biol Chem, 278(34), 31861-31870.
doi:10.1074/jbc.M300190200
Hartmann, K. (2015). Thyroid Disorders in the Oncology Patient. J Adv Pract Oncol,
6(2), 99-106.
Harvie, M., Howell, A., & Evans, D. G. (2015). Can diet and lifestyle prevent breast
cancer: what is the evidence? Am Soc Clin Oncol Educ Book, e66-73.
doi:10.14694/EdBook_AM.2015.35.e66
Hassa, P. O., & Hottiger, M. O. (2008). The diverse biological roles of mammalian
PARPS, a small but powerful family of poly-ADP-ribose polymerases. Front
Biosci, 13, 3046-3082.
Hassan, M. M., Kaseb, A., Li, D., Patt, Y. Z., Vauthey, J. N., Thomas, M. B., . . .
Abbruzzese, J. L. (2009). Association between hypothyroidism and hepatocellular
carcinoma: a case-control study in the United States. Hepatology, 49(5), 1563-
1570. doi:10.1002/hep.22793
Haugen, B. R., Alexander, E. K., Bible, K. C., Doherty, G. M., Mandel, S. J., Nikiforov,
Y. E., . . . Wartofsky, L. (2016). 2015 American Thyroid Association
Management Guidelines for Adult Patients with Thyroid Nodules and
Differentiated Thyroid Cancer: The American Thyroid Association Guidelines
Task Force on Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid,
26(1), 1-133. doi:10.1089/thy.2015.0020
Hercbergs, A., Johnson, R. E., Ashur-Fabian, O., Garfield, D. H., & Davis, P. J. (2015).
Medically induced euthyroid hypothyroxinemia may extend survival in
compassionate need cancer patients: an observational study. Oncologist, 20(1),
72-76. doi:10.1634/theoncologist.2014-0308
Herman, G. E. (1898). A CASE OF RECURRENT CANCER OF THE BREAST
TREATED BY OÖPHORECTOMY AND THYROID EXTRACT. The Lancet,
151(3902), 1612-1613. doi:https://doi.org/10.1016/S0140-6736(01)78249-9
Heublein, S., Mayr, D., Meindl, A., Angele, M., Gallwas, J., Jeschke, U., & Ditsch, N.
(2015). Thyroid Hormone Receptors Predict Prognosis in BRCA1 Associated
Breast Cancer in Opposing Ways. PLoS One, 10(6), e0127072.
doi:10.1371/journal.pone.0127072
Hiroi, Y., Kim, H. H., Ying, H., Furuya, F., Huang, Z., Simoncini, T., . . . Liao, J. K.
(2006). Rapid nongenomic actions of thyroid hormone. Proc Natl Acad Sci U S A,
103(38), 14104-14109. doi:10.1073/pnas.0601600103
Hoffman, D. A., & McConahey, W. M. (1983). Breast cancer following iodine-131
therapy for hyperthyroidism. J Natl Cancer Inst, 70(1), 63-67.
Hoffman, D. A., McConahey, W. M., Fraumeni, J. F., Jr., & Kurland, L. T. (1982).
Cancer incidence following treatment of hyperthyroidism. Int J Epidemiol, 11(3),
218-224.
Hoffman, K., Lorenzo, A., Butt, C. M., Hammel, S. C., Henderson, B. B., Roman, S. A., .
. . Sosa, J. A. (2017). Exposure to flame retardant chemicals and occurrence and
severity of papillary thyroid cancer: A case-control study. Environ Int, 107, 235-
242. doi:10.1016/j.envint.2017.06.021
170
Hong, S. H., Myung, S. K., & Kim, H. S. (2017). Alcohol Intake and Risk of Thyroid
Cancer: A Meta-Analysis of Observational Studies. Cancer Res Treat, 49(2), 534-
547. doi:10.4143/crt.2016.161
Horlein, A. J., Naar, A. M., Heinzel, T., Torchia, J., Gloss, B., Kurokawa, R., . . . et al.
(1995). Ligand-independent repression by the thyroid hormone receptor mediated
by a nuclear receptor co-repressor. Nature, 377(6548), 397-404.
doi:10.1038/377397a0
Hresko, R. C., & Mueckler, M. (2005). mTOR.RICTOR is the Ser473 kinase for
Akt/protein kinase B in 3T3-L1 adipocytes. J Biol Chem, 280(49), 40406-40416.
doi:10.1074/jbc.M508361200
Hu, Z. Y., Xiao, H., Xiao, M., Tang, Y., Sun, J., Xie, Z. M., & Ouyang, Q. (2018).
Inducing or Preventing Subsequent Malignancies for Breast Cancer Survivors?
Double-edged Sword of Estrogen Receptor and Progesterone Receptor. Clin
Breast Cancer. doi:10.1016/j.clbc.2018.04.009
Huang, J., Harris, E. J., & Lorch, J. H. (2019). Treatment of Aggressive Thyroid Cancer.
Surg Pathol Clin, 12(4), 943-950. doi:10.1016/j.path.2019.08.004
Huang, J., Jin, L., Ji, G., Xing, L., Xu, C., Xiong, X., . . . Kong, L. (2013). Implication
from thyroid function decreasing during chemotherapy in breast cancer patients:
chemosensitization role of triiodothyronine. BMC Cancer, 13, 334.
doi:10.1186/1471-2407-13-334
Ibrahimpasic, T., Ghossein, R., Carlson, D. L., Nixon, I., Palmer, F. L., Shaha, A. R., . . .
Ganly, I. (2014). Outcomes in patients with poorly differentiated thyroid
carcinoma. J Clin Endocrinol Metab, 99(4), 1245-1252. doi:10.1210/jc.2013-
3842
Ikeda, Y., Kiyotani, K., Yew, P. Y., Kato, T., Tamura, K., Yap, K. L., . . . Grogan, R. H.
(2016). Germline PARP4 mutations in patients with primary thyroid and breast
cancers. Endocr Relat Cancer, 23(3), 171-179. doi:10.1530/erc-15-0359
Inman, C. K., & Shore, P. (2003). The osteoblast transcription factor Runx2 is expressed
in mammary epithelial cells and mediates osteopontin expression. J Biol Chem,
278(49), 48684-48689. doi:10.1074/jbc.M308001200
Iqbal, N., & Iqbal, N. (2014). Human Epidermal Growth Factor Receptor 2 (HER2) in
Cancers: Overexpression and Therapeutic Implications. Mol Biol Int, 2014,
852748. doi:10.1155/2014/852748
Iravani, A., Solomon, B., Pattison, D. A., Jackson, P., Ravi Kumar, A. S., Kong, G., . . .
Hicks, R. J. (2019). Mitogen-activated protein kinase pathway inhibition for re-
differentiation of radioiodine-refractory differentiated thyroid cancer: an evolving
protocol. Thyroid. doi:10.1089/thy.2019.0143
Ishizuka, T., & Lazar, M. A. (2003). The N-CoR/histone deacetylase 3 complex is
required for repression by thyroid hormone receptor. Mol Cell Biol, 23(15), 5122-
5131. doi:10.1128/mcb.23.15.5122-5131.2003
Jerzak, K. J., Cockburn, J., Pond, G. R., Pritchard, K. I., Narod, S. A., Dhesy-Thind, S.
K., & Bane, A. (2015). Thyroid hormone receptor alpha in breast cancer:
prognostic and therapeutic implications. Breast Cancer Res Treat, 149(1), 293-
301. doi:10.1007/s10549-014-3235-9
171
Johansson, I., Killander, F., Linderholm, B., & Hedenfalk, I. (2014). Molecular profiling
of male breast cancer - lost in translation? Int J Biochem Cell Biol, 53, 526-535.
doi:10.1016/j.biocel.2014.05.007
Joosse, S. A., Hannemann, J., Spotter, J., Bauche, A., Andreas, A., Muller, V., & Pantel,
K. (2012). Changes in keratin expression during metastatic progression of breast
cancer: impact on the detection of circulating tumor cells. Clin Cancer Res, 18(4),
993-1003. doi:10.1158/1078-0432.Ccr-11-2100
Joseph, K. R., Edirimanne, S., & Eslick, G. D. (2015). The association between breast
cancer and thyroid cancer: a meta-analysis. Breast Cancer Res Treat, 152(1), 173-
181. doi:10.1007/s10549-015-3456-6
Jung, H. K., Park, S., Kim, N. W., Lee, J. E., Kim, Z., Han, S. W., . . . Lee, J. (2017).
Development of second primary cancer in Korean breast cancer survivors. Ann
Surg Treat Res, 93(6), 287-292. doi:10.4174/astr.2017.93.6.287
Kadamur, G., & Ross, E. M. (2013). Mammalian phospholipase C. Annu Rev Physiol, 75,
127-154. doi:10.1146/annurev-physiol-030212-183750
Kamel, D., Gray, C., Walia, J. S., & Kumar, V. (2018). PARP Inhibitor Drugs in the
Treatment of Breast, Ovarian, Prostate and Pancreatic Cancers: An Update of
Clinical Trials. Curr Drug Targets, 19(1), 21-37.
doi:10.2174/1389450118666170711151518
Kast, K., Link, T., Friedrich, K., Petzold, A., Niedostatek, A., Schoffer, O., . . .
Wimberger, P. (2015). Impact of breast cancer subtypes and patterns of metastasis
on outcome. Breast Cancer Res Treat, 150(3), 621-629. doi:10.1007/s10549-015-
3341-3
Kato, Y., Ying, H., Willingham, M. C., & Cheng, S. Y. (2004). A tumor suppressor role
for thyroid hormone beta receptor in a mouse model of thyroid carcinogenesis.
Endocrinology, 145(10), 4430-4438. doi:10.1210/en.2004-0612
Khan, M. A., Bhurani, D., & Agarwal, N. B. (2015). Alteration of Thyroid Function in
Indian HER 2-Negative Breast Cancer Patients Undergoing Chemotherapy. Asian
Pac J Cancer Prev, 16(17), 7701-7705.
Kilfoy, B. A., Zheng, T., Holford, T. R., Han, X., Ward, M. H., Sjodin, A., . . . Zhang, Y.
(2009). International patterns and trends in thyroid cancer incidence, 1973-2002.
Cancer Causes Control, 20(5), 525-531. doi:10.1007/s10552-008-9260-4
Kim, D. W., Zhao, L., Hanover, J., Willingham, M., & Cheng, S. Y. (2012). Thyroid
hormone receptor beta suppresses SV40-mediated tumorigenesis via novel
nongenomic actions. Am J Cancer Res, 2(5), 606-619. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/22957312
Kim, W. G., & Cheng, S. Y. (2013). Thyroid hormone receptors and cancer. Biochim
Biophys Acta, 1830(7), 3928-3936. doi:10.1016/j.bbagen.2012.04.002
Kim, W. G., Park, J. W., Willingham, M. C., & Cheng, S. Y. (2013). Diet-induced
obesity increases tumor growth and promotes anaplastic change in thyroid cancer
in a mouse model. Endocrinology, 154(8), 2936-2947. doi:10.1210/en.2013-1128
Kim, W. G., Zhao, L., Kim, D. W., Willingham, M. C., & Cheng, S. Y. (2014). Inhibition
of tumorigenesis by the thyroid hormone receptor beta in xenograft models.
Thyroid, 24(2), 260-269. doi:10.1089/thy.2013.0054
172
Kim, W. G., Zhu, X., Kim, D. W., Zhang, L., Kebebew, E., & Cheng, S. Y. (2013).
Reactivation of the silenced thyroid hormone receptor beta gene expression delays
thyroid tumor progression. Endocrinology, 154(1), 25-35. doi:10.1210/en.2012-
1728
Kitahara, C. M., Platz, E. A., Freeman, L. E. B., Hsing, A. W., Linet, M. S., Park, Y., . . .
Berrington de González, A. (2011). Obesity and Thyroid Cancer Risk among U.S.
Men and Women: A Pooled Analysis of Five Prospective Studies. Cancer
Epidemiology Biomarkers & Prevention, 20(3), 464-472. doi:10.1158/1055-
9965.epi-10-1220
Kollar, A., Kvarta-Papp, Z., Egri, P., & Gereben, B. (2016). Different Types of
Luciferase Reporters Show Distinct Susceptibility to T3-Evoked Downregulation.
Thyroid, 26(1), 179-182. doi:10.1089/thy.2015.0398
Kress, E., Skah, S., Sirakov, M., Nadjar, J., Gadot, N., Scoazec, J. Y., . . . Plateroti, M.
(2010). Cooperation between the thyroid hormone receptor TRalpha1 and the
WNT pathway in the induction of intestinal tumorigenesis. Gastroenterology,
138(5), 1863-1874. doi:10.1053/j.gastro.2010.01.041
Kuo, J. H., Chabot, J. A., & Lee, J. A. (2016). Breast cancer in thyroid cancer survivors:
An analysis of the Surveillance, Epidemiology, and End Results-9 database.
Surgery, 159(1), 23-29. doi:10.1016/j.surg.2015.10.009
La Vecchia, C., Malvezzi, M., Bosetti, C., Garavello, W., Bertuccio, P., Levi, F., &
Negri, E. (2015). Thyroid cancer mortality and incidence: a global overview. Int J
Cancer, 136(9), 2187-2195. doi:10.1002/ijc.29251
Lachmann, A., Xu, H., Krishnan, J., Berger, S. I., Mazloom, A. R., & Ma'ayan, A.
(2010). ChEA: transcription factor regulation inferred from integrating genome-
wide ChIP-X experiments. Bioinformatics, 26(19), 2438-2444.
doi:10.1093/bioinformatics/btq466
Lambertini, M., Ponde, N. F., Solinas, C., & de Azambuja, E. (2017). Adjuvant
trastuzumab: a 10-year overview of its benefit. Expert Rev Anticancer Ther,
17(1), 61-74. doi:10.1080/14737140.2017.1264876
Landa, I., Ibrahimpasic, T., Boucai, L., Sinha, R., Knauf, J. A., Shah, R. H., . . . Fagin, J.
A. (2016). Genomic and transcriptomic hallmarks of poorly differentiated and
anaplastic thyroid cancers. The Journal of Clinical Investigation, 126(3), 1052-
1066. doi:10.1172/JCI85271
Landa, I., Pozdeyev, N., Korch, C., Marlow, L. A., Smallridge, R. C., Copland, J. A., . . .
Schweppe, R. E. (2019). Comprehensive Genetic Characterization of Human
Thyroid Cancer Cell Lines: A Validated Panel for Preclinical Studies. Clin
Cancer Res, 25(10), 3141-3151. doi:10.1158/1078-0432.Ccr-18-2953
Lapeire, L., Hendrix, A., Lambein, K., Van Bockstal, M., Braems, G., Van Den Broecke,
R., . . . De Wever, O. (2014). Cancer-associated adipose tissue promotes breast
cancer progression by paracrine oncostatin M and Jak/STAT3 signaling. Cancer
Res, 74(23), 6806-6819. doi:10.1158/0008-5472.can-14-0160
Larson, S. M., Osborne, J. R., Grewal, R. K., & Tuttle, R. M. (2017). Redifferentiating
Thyroid Cancer: Selumetinib-enhanced Radioiodine Uptake in Thyroid Cancer.
Mol Imaging Radionucl Ther, 26(Suppl 1), 80-86. doi:10.4274/2017.26.suppl.09
173
Lechner, M. G., Vyas, C. M., Hamnvik, O. R., Alexander, E. K., Larsen, P. R., Choueiri,
T. K., & Angell, T. E. (2018). Hypothyroidism During Tyrosine Kinase Inhibitor
Therapy Is Associated with Longer Survival in Patients with Advanced
Nonthyroidal Cancers. Thyroid, 28(4), 445-453. doi:10.1089/thy.2017.0587
Lee, A., & Djamgoz, M. B. A. (2018). Triple negative breast cancer: Emerging
therapeutic modalities and novel combination therapies. Cancer Treat Rev, 62,
110-122. doi:10.1016/j.ctrv.2017.11.003
Lee, Y. T. (1983). Breast carcinoma: pattern of metastasis at autopsy. J Surg Oncol,
23(3), 175-180.
Leitzmann, M. F., Brenner, A., Moore, S. C., Koebnick, C., Park, Y., Hollenbeck, A., . . .
Ron, E. (2010). Prospective study of body mass index, physical activity and
thyroid cancer. Int J Cancer, 126(12), 2947-2956. doi:10.1002/ijc.24913
Li, C., Zhao, X., Toline, E. C., Siegal, G. P., Evans, L. M., Ibrahim-Hashim, A., . . .
Hardy, R. W. (2011). Prevention of carcinogenesis and inhibition of breast cancer
tumor burden by dietary stearate. Carcinogenesis, 32(8), 1251-1258.
doi:10.1093/carcin/bgr092
Li, D. D., Zhang, Y. F., Xu, H. X., & Zhang, X. P. (2015). The role of BRAF in the
pathogenesis of thyroid carcinoma. Front Biosci (Landmark Ed), 20, 1068-1078.
Li, H., Zhang, B., Ding, M., Lu, S., Zhou, H., Sun, D., . . . Gan, X. (2019). C1QTNF1-
AS1 regulates the occurrence and development of hepatocellular carcinoma by
regulating miR-221-3p/SOCS3. Hepatol Int, 13(3), 277-292. doi:10.1007/s12072-
019-09944-5
Li, J., Lin, Q., Yoon, H. G., Huang, Z. Q., Strahl, B. D., Allis, C. D., & Wong, J. (2002).
Involvement of histone methylation and phosphorylation in regulation of
transcription by thyroid hormone receptor. Mol Cell Biol, 22(16), 5688-5697.
doi:10.1128/mcb.22.16.5688-5697.2002
Li, J., Wu, Q. M., Wang, X. Q., & Zhang, C. Q. (2017). Long Noncoding RNA
miR210HG Sponges miR-503 to Facilitate Osteosarcoma Cell Invasion and
Metastasis. DNA Cell Biol, 36(12), 1117-1125. doi:10.1089/dna.2017.3888
Li, J., Xi, Y., Li, W., McCarthy, R. L., Stratton, S. A., Zou, W., . . . Barton, M. C. (2017).
TRIM28 interacts with EZH2 and SWI/SNF to activate genes that promote
mammosphere formation. Oncogene, 36(21), 2991-3001.
doi:10.1038/onc.2016.453
Liaw, D., Marsh, D. J., Li, J., Dahia, P. L., Wang, S. I., Zheng, Z., . . . Parsons, R. (1997).
Germline mutations of the PTEN gene in Cowden disease, an inherited breast and
thyroid cancer syndrome. Nat Genet, 16(1), 64-67. doi:10.1038/ng0597-64
Lim, H., Devesa, S. S., Sosa, J. A., Check, D., & Kitahara, C. M. (2017). Trends in
thyroid cancer incidence and mortality in the united states, 1974-2013. JAMA,
317(13), 1338-1348. doi:10.1001/jama.2017.2719
Lin, H. Y., Glinsky, G. V., Mousa, S. A., & Davis, P. J. (2015). Thyroid hormone and
anti-apoptosis in tumor cells. Oncotarget, 6(17), 14735-14743.
doi:10.18632/oncotarget.4023
Lin, H. Y., Tang, H. Y., Shih, A., Keating, T., Cao, G., Davis, P. J., & Davis, F. B.
(2007). Thyroid hormone is a MAPK-dependent growth factor for thyroid cancer
174
cells and is anti-apoptotic. Steroids, 72(2), 180-187.
doi:10.1016/j.steroids.2006.11.014
Lin, H. Y., Zhang, S., West, B. L., Tang, H. Y., Passaretti, T., Davis, F. B., & Davis, P. J.
(2003). Identification of the putative MAP kinase docking site in the thyroid
hormone receptor-beta1 DNA-binding domain: functional consequences of
mutations at the docking site. Biochemistry, 42(24), 7571-7579.
doi:10.1021/bi0273967
Lin, K. H., Ashizawa, K., & Cheng, S. Y. (1992). Phosphorylation stimulates the
transcriptional activity of the human beta 1 thyroid hormone nuclear receptor.
Proc Natl Acad Sci U S A, 89(16), 7737-7741.
Lin, K. H., Shieh, H. Y., Chen, S. L., & Hsu, H. C. (1999). Expression of mutant thyroid
hormone nuclear receptors in human hepatocellular carcinoma cells. Molecular
carcinogenesis, 26(1), 53-61. doi:10.1002/(sici)1098-2744(199909)26:1<53::aid-
mc7>3.0.co;2-z
Lin, Y. H., Huang, Y. H., Wu, M. H., Wu, S. M., Chi, H. C., Liao, C. J., . . . Lin, K. H.
(2013). Thyroid hormone suppresses cell proliferation through endoglin-mediated
promotion of p21 stability. Oncogene, 32(33), 3904-3914.
doi:10.1038/onc.2013.5
Liu, L., Li, D., Chen, Z., Yang, J., Ma, Y., Cai, H., . . . Zhang, X. (2017). Wild-Type P53
Induces Sodium/Iodide Symporter Expression Allowing Radioiodide Therapy in
Anaplastic Thyroid Cancer. Cell Physiol Biochem, 43(3), 905-914.
doi:10.1159/000481640
Liu, P., Cheng, H., Roberts, T. M., & Zhao, J. J. (2009). Targeting the phosphoinositide
3-kinase pathway in cancer. Nat Rev Drug Discov, 8(8), 627-644.
doi:10.1038/nrd2926
Liu, Y. Y., Kogai, T., Schultz, J. J., Mody, K., & Brent, G. A. (2012). Thyroid hormone
receptor isoform-specific modification by small ubiquitin-like modifier (SUMO)
modulates thyroid hormone-dependent gene regulation. J Biol Chem, 287(43),
36499-36508. doi:10.1074/jbc.M112.344317
Ljubas, J., Ovesen, T., & Rusan, M. (2019). A Systematic Review of Phase II Targeted
Therapy Clinical Trials in Anaplastic Thyroid Cancer. Cancers (Basel), 11(7).
doi:10.3390/cancers11070943
Lopez-Mateo, I., Alonso-Merino, E., Suarez-Cabrera, C., Park, J. W., Cheng, S. Y.,
Alemany, S., . . . Aranda, A. (2020). Thyroid Hormone Receptor beta Inhibits
Self-Renewal Capacity of Breast Cancer Stem Cells. Thyroid, 30(1), 116-132.
doi:10.1089/thy.2019.0175
Lu, C., Zhu, X., Willingham, M. C., & Cheng, S. Y. (2012). Activation of tumor cell
proliferation by thyroid hormone in a mouse model of follicular thyroid
carcinoma. Oncogene, 31(16), 2007-2016. doi:10.1038/onc.2011.390
Lu, W., Xu, Y., Xu, J., Wang, Z., & Ye, G. (2018). Identification of differential
expressed lncRNAs in human thyroid cancer by a genome-wide analyses. Cancer
Med. doi:10.1002/cam4.1627
Lu, Z., Li, Y., Che, Y., Huang, J., Sun, S., Mao, S., . . . He, J. (2018). The TGFbeta-
induced lncRNA TBILA promotes non-small cell lung cancer progression in vitro
175
and in vivo via cis-regulating HGAL and activating S100A7/JAB1 signaling.
Cancer Lett, 432, 156-168. doi:10.1016/j.canlet.2018.06.013
Luen, S., Virassamy, B., Savas, P., Salgado, R., & Loi, S. (2016). The genomic landscape
of breast cancer and its interaction with host immunity. Breast, 29, 241-250.
doi:10.1016/j.breast.2016.07.015
Luo, J., Hendryx, M., Nassir, R., Cheng, T. D., Lane, D., & Margolis, K. L. (2017).
Benign breast disease and risk of thyroid cancer. Cancer Causes Control, 28(9),
913-920. doi:10.1007/s10552-017-0918-7
Lynch, R. A., Etchin, J., Battle, T. E., & Frank, D. A. (2007). A small-molecule enhancer
of signal transducer and activator of transcription 1 transcriptional activity
accentuates the antiproliferative effects of IFN-gamma in human cancer cells.
Cancer Res, 67(3), 1254-1261. doi:10.1158/0008-5472.Can-06-2439
Ma, J., Huang, M., Wang, L., Ye, W., Tong, Y., & Wang, H. (2015). Obesity and risk of
thyroid cancer: evidence from a meta-analysis of 21 observational studies. Med
Sci Monit, 21, 283-291. doi:10.12659/msm.892035
Martin, L. A., Ribas, R., Simigdala, N., Schuster, E., Pancholi, S., Tenev, T., . . .
Dowsett, M. (2017). Discovery of naturally occurring ESR1 mutations in breast
cancer cell lines modelling endocrine resistance. Nat Commun, 8(1), 1865.
doi:10.1038/s41467-017-01864-y
Martin, N. P., Marron Fernandez de Velasco, E., Mizuno, F., Scappini, E. L., Gloss, B.,
Erxleben, C., . . . Armstrong, D. L. (2014). A rapid cytoplasmic mechanism for
PI3 kinase regulation by the nuclear thyroid hormone receptor, TRbeta, and
genetic evidence for its role in the maturation of mouse hippocampal synapses in
vivo. Endocrinology, 155(9), 3713-3724. doi:10.1210/en.2013-2058
Martinez-Iglesias, O., Garcia-Silva, S., Regadera, J., & Aranda, A. (2009).
Hypothyroidism enhances tumor invasiveness and metastasis development. PLoS
One, 4(7), e6428. doi:10.1371/journal.pone.0006428
Martinez-Iglesias, O., Garcia-Silva, S., Tenbaum, S. P., Regadera, J., Larcher, F.,
Paramio, J. M., . . . Aranda, A. (2009). Thyroid hormone receptor beta1 acts as a
potent suppressor of tumor invasiveness and metastasis. Cancer Res, 69(2), 501-
509. doi:10.1158/0008-5472.can-08-2198
Martinkovich, S., Shah, D., Planey, S. L., & Arnott, J. A. (2014). Selective estrogen
receptor modulators: tissue specificity and clinical utility. Clin Interv Aging, 9,
1437-1452. doi:10.2147/cia.S66690
Matsunaga, H., Sasaki, S., Suzuki, S., Matsushita, A., Nakamura, H., Nakamura, H. M., .
. . Suda, T. (2015). Essential Role of GATA2 in the Negative Regulation of Type
2 Deiodinase Gene by Liganded Thyroid Hormone Receptor beta2 in Thyrotroph.
PLoS One, 10(11), e0142400. doi:10.1371/journal.pone.0142400
Maughan, K. L., Lutterbie, M. A., & Ham, P. S. (2010). Treatment of breast cancer. Am
Fam Physician, 81(11), 1339-1346.
Mavinakere, M. S., Powers, J. M., Subramanian, K. S., Roggero, V. R., & Allison, L. A.
(2012). Multiple novel signals mediate thyroid hormone receptor nuclear import
and export. J Biol Chem, 287(37), 31280-31297. doi:10.1074/jbc.M112.397745
176
Maximov, P. Y., Lee, T. M., & Jordan, V. C. (2013). The discovery and development of
selective estrogen receptor modulators (SERMs) for clinical practice. Curr Clin
Pharmacol, 8(2), 135-155.
Mazer, N. A. (2004). Interaction of estrogen therapy and thyroid hormone replacement in
postmenopausal women. Thyroid, 14 Suppl 1, S27-34.
doi:10.1089/105072504323024561
McDonald, L., Ferrari, N., Terry, A., Bell, M., Mohammed, Z. M., Orange, C., . . . Blyth,
K. (2014). RUNX2 correlates with subtype-specific breast cancer in a human
tissue microarray, and ectopic expression of Runx2 perturbs differentiation in the
mouse mammary gland. Dis Model Mech, 7(5), 525-534.
doi:10.1242/dmm.015040
McTiernan, A., Weiss, N. S., & Daling, J. R. (1987). Incidence of thyroid cancer in
women in relation to known or suspected risk factors for breast cancer. Cancer
Res, 47(1), 292-295.
Meissl, K., Macho-Maschler, S., Muller, M., & Strobl, B. (2017). The good and the bad
faces of STAT1 in solid tumours. Cytokine, 89, 12-20.
doi:10.1016/j.cyto.2015.11.011
Moleti, M., Sturniolo, G., Di Mauro, M., Russo, M., & Vermiglio, F. (2017). Female
Reproductive Factors and Differentiated Thyroid Cancer. Front Endocrinol
(Lausanne), 8, 111. doi:10.3389/fendo.2017.00111
Molina, M. A., Saez, R., Ramsey, E. E., Garcia-Barchino, M. J., Rojo, F., Evans, A. J., . .
. Clinton, G. M. (2002). NH(2)-terminal truncated HER-2 protein but not full-
length receptor is associated with nodal metastasis in human breast cancer. Clin
Cancer Res, 8(2), 347-353.
Molinaro, E., Romei, C., Biagini, A., Sabini, E., Agate, L., Mazzeo, S., . . . Elisei, R.
(2017). Anaplastic thyroid carcinoma: from clinicopathology to genetics and
advanced therapies. Nature Reviews Endocrinology, 13, 644.
doi:10.1038/nrendo.2017.76
Moriyama, K., Tagami, T., Akamizu, T., Usui, T., Saijo, M., Kanamoto, N., . . . Nakao,
K. (2002). Thyroid hormone action is disrupted by bisphenol A as an antagonist. J
Clin Endocrinol Metab, 87(11), 5185-5190. doi:10.1210/jc.2002-020209
Moskowitz, C. S., Chou, J. F., Wolden, S. L., Bernstein, J. L., Malhotra, J., Novetsky
Friedman, D., . . . Oeffinger, K. C. (2014). Breast cancer after chest radiation
therapy for childhood cancer. J Clin Oncol, 32(21), 2217-2223.
doi:10.1200/jco.2013.54.4601
Mucci, L. A., Hjelmborg, J. B., Harris, J. R., Czene, K., Havelick, D. J., Scheike, T., . . .
Kaprio, J. (2016). Familial Risk and Heritability of Cancer Among Twins in
Nordic Countries. Jama, 315(1), 68-76. doi:10.1001/jama.2015.17703
Muller, I., Kilburn, L. S., Taylor, P. N., Barrett-Lee, P. J., Bliss, J. M., Ellis, P., . . .
Dayan, C. M. (2017). TPOAb and Thyroid Function Are Not Associated with
Breast Cancer Outcome: Evidence from a Large-Scale Study Using Data from the
Taxotere as Adjuvant Chemotherapy Trial (TACT, CRUK01/001). Eur Thyroid J,
6(4), 197-207. doi:10.1159/000460246
177
Murugan, A. K., Dong, J., Xie, J., & Xing, M. (2011). Uncommon GNAQ, MMP8,
AKT3, EGFR, and PIK3R1 mutations in thyroid cancers. Endocr Pathol, 22(2),
97-102. doi:10.1007/s12022-011-9155-x
Nagata, Y., Lan, K. H., Zhou, X., Tan, M., Esteva, F. J., Sahin, A. A., . . . Yu, D. (2004).
PTEN activation contributes to tumor inhibition by trastuzumab, and loss of
PTEN predicts trastuzumab resistance in patients. Cancer Cell, 6(2), 117-127.
doi:10.1016/j.ccr.2004.06.022
Nagayama, Y., Shimamura, M., & Mitsutake, N. (2016). Cancer Stem Cells in the
Thyroid. Front Endocrinol (Lausanne), 7, 20. doi:10.3389/fendo.2016.00020
Nakajima, K., Tazawa, I., & Yaoita, Y. (2018). Thyroid Hormone Receptor α- and β-
Knockout Xenopus tropicalis Tadpoles Reveal Subtype-Specific Roles During
Development. Endocrinology, 159(2), 733-743. doi:10.1210/en.2017-00601
Naoum, G. E., Morkos, M., Kim, B., & Arafat, W. (2018). Novel targeted therapies and
immunotherapy for advanced thyroid cancers. Mol Cancer, 17(1), 51.
doi:10.1186/s12943-018-0786-0
Ngeow, J., Sesock, K., & Eng, C. (2017). Clinical Implications for Germline PTEN
Spectrum Disorders. Endocrinol Metab Clin North Am, 46(2), 503-517.
doi:10.1016/j.ecl.2017.01.013
Ni, Y., He, X., Chen, J., Moline, J., Mester, J., Orloff, M. S., . . . Eng, C. (2012).
Germline SDHx variants modify breast and thyroid cancer risks in Cowden and
Cowden-like syndrome via FAD/NAD-dependant destabilization of p53. Hum
Mol Genet, 21(2), 300-310. doi:10.1093/hmg/ddr459
Nielsen, S. M., White, M. G., Hong, S., Aschebrook-Kilfoy, B., Kaplan, E. L., Angelos,
P., . . . Grogan, R. H. (2016). The Breast-Thyroid Cancer Link: A Systematic
Review and Meta-analysis. Cancer Epidemiol Biomarkers Prev, 25(2), 231-238.
doi:10.1158/1055-9965.epi-15-0833
Nikiforova, M. N., Wald, A. I., Roy, S., Durso, M. B., & Nikiforov, Y. E. (2013).
Targeted Next-Generation Sequencing Panel (ThyroSeq) for Detection of
Mutations in Thyroid Cancer. The Journal of Clinical Endocrinology and
Metabolism, 98(11), E1852-E1860. doi:10.1210/jc.2013-2292
Niu, D. F., Kondo, T., Nakazawa, T., Oishi, N., Kawasaki, T., Mochizuki, K., . . . Katoh,
R. (2012). Transcription factor Runx2 is a regulator of epithelial-mesenchymal
transition and invasion in thyroid carcinomas. Lab Invest, 92(8), 1181-1190.
doi:10.1038/labinvest.2012.84
Nowsheen, S., & Yang, E. S. (2012). The intersection between DNA damage response
and cell death pathways. Exp Oncol, 34(3), 243-254.
Osborne, C. K., & Schiff, R. (2011). Mechanisms of endocrine resistance in breast
cancer. Annu Rev Med, 62, 233-247. doi:10.1146/annurev-med-070909-182917
Paakinaho, V., Presman, D. M., Ball, D. A., Johnson, T. A., Schiltz, R. L., Levitt, P., . . .
Hager, G. L. (2017). Single-molecule analysis of steroid receptor and cofactor
action in living cells. Nat Commun, 8, 15896. doi:10.1038/ncomms15896
Pande, S., Browne, G., Padmanabhan, S., Zaidi, S. K., Lian, J. B., van Wijnen, A. J., . . .
Stein, G. S. (2013). Oncogenic cooperation between PI3K/Akt signaling and
transcription factor Runx2 promotes the invasive properties of metastatic breast
cancer cells. J Cell Physiol, 228(8), 1784-1792. doi:10.1002/jcp.24339
178
Papachristou, D. J., Papachristou, G. I., & Papaefthimiou, O. A. (2005). The MAPK-AP-
1/-Runx2 signalling axes are implicated in chondrosarcoma pathobiology either
independently or via up-regulation of VEGF. Histopathology, 47, 565-574.
Park, J. W., Zhao, L., & Cheng, S. Y. (2013). Inhibition of estrogen-dependent
tumorigenesis by the thyroid hormone receptor beta in xenograft models. Am J
Cancer Res, 3(3), 302-311.
Park, J. W., Zhao, L., Webb, P., & Cheng, S.-y. (2014). Src-dependent phosphorylation at
Y406 on the thyroid hormone receptor β confers the tumor suppressor activity.
Oncotarget, 5(20), 10002-10016.
Park, J. W., Zhao, L., Willingham, M., & Cheng, S. Y. (2015). Oncogenic mutations of
thyroid hormone receptor beta. Oncotarget, 6(10), 8115-8131.
doi:10.18632/oncotarget.3466
Park, J. W., Zhao, L., Willingham, M. C., & Cheng, S.-y. (2017). Loss of tyrosine
phosphorylation at Y406 abrogates the tumor suppressor functions of the thyroid
hormone receptor β. Molecular Carcinogenesis, 56(2), 489-498.
doi:10.1002/mc.22511
Park, S., Zhu, J., Altan-Bonnet, G., & Cheng, S. Y. (2019). Monocyte recruitment and
activated inflammation are associated with thyroid carcinogenesis in a mouse
model. Am J Cancer Res, 9(7), 1439-1453.
Parker, B. S., Rautela, J., & Hertzog, P. J. (2016). Antitumour actions of interferons:
implications for cancer therapy. Nat Rev Cancer, 16(3), 131-144.
doi:10.1038/nrc.2016.14
Parker, J. S., Mullins, M., Cheang, M. C., Leung, S., Voduc, D., Vickery, T., . . . Bernard,
P. S. (2009). Supervised risk predictor of breast cancer based on intrinsic
subtypes. J Clin Oncol, 27(8), 1160-1167. doi:10.1200/jco.2008.18.1370
Perone, Y., Farrugia, A. J., Rodriguez-Meira, A., Gyorffy, B., Ion, C., Uggetti, A., . . .
Magnani, L. (2019). SREBP1 drives Keratin-80-dependent cytoskeletal changes
and invasive behavior in endocrine-resistant ERalpha breast cancer. Nat Commun,
10(1), 2115. doi:10.1038/s41467-019-09676-y
Perou, C. M., Sorlie, T., Eisen, M. B., van de Rijn, M., Jeffrey, S. S., Rees, C. A., . . .
Botstein, D. (2000). Molecular portraits of human breast tumours. Nature,
406(6797), 747-752. doi:10.1038/35021093
Perrier, N. D., Brierley, J. D., & Tuttle, R. M. (2018). Differentiated and anaplastic
thyroid carcinoma: Major changes in the American Joint Committee on Cancer
eighth edition cancer staging manual. CA Cancer J Clin, 68(1), 55-63.
doi:10.3322/caac.21439
Petrelli, F., Coinu, A., Borgonovo, K., Cabiddu, M., Ghilardi, M., Lonati, V., & Barni, S.
(2014). The value of platinum agents as neoadjuvant chemotherapy in triple-
negative breast cancers: a systematic review and meta-analysis. Breast Cancer
Res Treat, 144(2), 223-232. doi:10.1007/s10549-014-2876-z
Plateroti, M., Kress, E., Mori, J. I., & Samarut, J. (2006). Thyroid hormone receptor
alpha1 directly controls transcription of the beta-catenin gene in intestinal
epithelial cells. Mol Cell Biol, 26(8), 3204-3214. doi:10.1128/mcb.26.8.3204-
3214.2006
179
Ponde, N. F., Lambertini, M., & de Azambuja, E. (2016). Twenty years of anti-HER2
therapy-associated cardiotoxicity. ESMO Open, 1(4), e000073.
doi:10.1136/esmoopen-2016-000073
Porlan, E., Vidaurre, O. G., & Rodriguez-Pena, A. (2008). Thyroid hormone receptor-
beta (TR beta 1) impairs cell proliferation by the transcriptional inhibition of
cyclins D1, E and A2. Oncogene, 27(19), 2795-2800. doi:10.1038/sj.onc.1210936
Pozdeyev, N., Gay, L. M., Sokol, E. S., Hartmaier, R., Deaver, K. E., Davis, S., . . .
Bowles, D. W. (2018). Genetic Analysis of 779 Advanced Differentiated and
Anaplastic Thyroid Cancers. Clin Cancer Res, 24(13), 3059-3068.
doi:10.1158/1078-0432.Ccr-18-0373
Prat, A., Parker, J. S., Karginova, O., Fan, C., Livasy, C., Herschkowitz, J. I., . . . Perou,
C. M. (2010). Phenotypic and molecular characterization of the claudin-low
intrinsic subtype of breast cancer. Breast Cancer Res, 12(5), R68.
doi:10.1186/bcr2635
Pratap, J., Javed, A., Languino, L. R., van Wijnen, A. J., Stein, J. L., Stein, G. S., & Lian,
J. B. (2005). The Runx2 osteogenic transcription factor regulates matrix
metalloproteinase 9 in bone metastatic cancer cells and controls cell invasion. Mol
Cell Biol, 25(19), 8581-8591. doi:10.1128/MCB.25.19.8581-8591.2005
Prinzi, N., Baldini, E., Sorrenti, S., De Vito, C., Tuccilli, C., Catania, A., . . . Ulisse, S.
(2014). Prevalence of breast cancer in thyroid diseases: results of a cross-sectional
study of 3,921 patients. Breast Cancer Res Treat, 144(3), 683-688.
doi:10.1007/s10549-014-2893-y
Puzianowska-Kuznicka, M., Krystyniak, A., Madej, A., Cheng, S.-Y., & Nauman, J.
(2002). Functionally Impaired TR Mutants Are Present in Thyroid Papillary
Cancer. The Journal of Clinical Endocrinology & Metabolism, 87(3), 1120-1128.
doi:10.1210/jcem.87.3.8296
Rahbari, R., Zhang, L., & Kebebew, E. (2010). Thyroid cancer gender disparity. Future
Oncol, 6(11), 1771-1779. doi:10.2217/fon.10.127
Rahib, L., Smith, B. D., Aizenberg, R., Rosenzweig, A. B., Fleshman, J. M., & Matrisian,
L. M. (2014). Projecting cancer incidence and deaths to 2030: the unexpected
burden of thyroid, liver, and pancreas cancers in the United States. Cancer Res,
74(11), 2913-2921. doi:10.1158/0008-5472.Can-14-0155
Raj-Kumar, P. K., Liu, J., Hooke, J. A., Kovatich, A. J., Kvecher, L., Shriver, C. D., &
Hu, H. (2019). PCA-PAM50 improves consistency between breast cancer
intrinsic and clinical subtyping reclassifying a subset of luminal A tumors as
luminal B. Sci Rep, 9(1), 7956. doi:10.1038/s41598-019-44339-4
Rampurwala, M., Wisinski, K. B., & O'Regan, R. (2016). Role of the androgen receptor
in triple-negative breast cancer. Clin Adv Hematol Oncol, 14(3), 186-193.
Reddy, A., Dash, C., Leerapun, A., Mettler, T. A., Stadheim, L. M., Lazaridis, K. N., . . .
Roberts, L. R. (2007). Hypothyroidism: a possible risk factor for liver cancer in
patients with no known underlying cause of liver disease. Clin Gastroenterol
Hepatol, 5(1), 118-123. doi:10.1016/j.cgh.2006.07.011
Roberts, R., Hodson, L., Dennis, A. L., Neville, M. J., Humphreys, S. M., Harnden, K.
E., . . . Frayn, K. N. (2009). Markers of de novo lipogenesis in adipose tissue:
180
associations with small adipocytes and insulin sensitivity in humans.
Diabetologia, 52(5), 882-890. doi:10.1007/s00125-009-1300-4
Rodgers, K. M., Udesky, J. O., Rudel, R. A., & Brody, J. G. (2018). Environmental
chemicals and breast cancer: An updated review of epidemiological literature
informed by biological mechanisms. Environ Res, 160, 152-182.
doi:10.1016/j.envres.2017.08.045
Ron, E., Lubin, J. H., Shore, R. E., Mabuchi, K., Modan, B., Pottern, L. M., . . . Boice, J.
D., Jr. (1995). Thyroid cancer after exposure to external radiation: a pooled
analysis of seven studies. Radiat Res, 141(3), 259-277.
Saenger, E. L., Thoma, G. E., & Tompkins, E. A. (1968). Incidence of leukemia
following treatment of hyperthyroidism. Preliminary report of the Cooperative
Thyrotoxicosis Therapy Follow-Up Study. Jama, 205(12), 855-862.
Sahni, J. M., & Keri, R. A. (2018). Targeting bromodomain and extraterminal proteins in
breast cancer. Pharmacol Res, 129, 156-176. doi:10.1016/j.phrs.2017.11.015
Saini, S., Tulla, K., Maker, A. V., Burman, K. D., & Prabhakar, B. S. (2018). Therapeutic
advances in anaplastic thyroid cancer: a current perspective. Mol Cancer, 17(1),
154. doi:10.1186/s12943-018-0903-0
Samatar, A. A., & Poulikakos, P. I. (2014). Targeting RAS-ERK signalling in cancer:
promises and challenges. Nat Rev Drug Discov, 13(12), 928-942.
doi:10.1038/nrd4281
Sampath, H., & Ntambi, J. M. (2005). The fate and intermediary metabolism of stearic
acid. Lipids, 40(12), 1187-1191. doi:10.1007/s11745-005-1484-z
Sanchez Calle, A., Kawamura, Y., Yamamoto, Y., Takeshita, F., & Ochiya, T. (2018).
Emerging roles of long non-coding RNA in cancer. Cancer Sci, 109(7), 2093-
2100. doi:10.1111/cas.13642
Sancisi, V., Borettini, G., Maramotti, S., Ragazzi, M., Tamagnini, I., Nicoli, D., . . .
Ciarrocchi, A. (2012). Runx2 isoform I controls a panel of proinvasive genes
driving aggressiveness of papillary thyroid carcinomas. J Clin Endocrinol Metab,
97(10), E2006-2015. doi:10.1210/jc.2012-1903
Sanders, E. M., Jr., LiVolsi, V. A., Brierley, J., Shin, J., & Randolph, G. W. (2007). An
evidence-based review of poorly differentiated thyroid cancer. World J Surg,
31(5), 934-945. doi:10.1007/s00268-007-9033-3
Santarpia, L., Bottai, G., Kelly, C. M., Gyorffy, B., Szekely, B., & Pusztai, L. (2016).
Deciphering and Targeting Oncogenic Mutations and Pathways in Breast Cancer.
Oncologist, 21(9), 1063-1078. doi:10.1634/theoncologist.2015-0369
Sap, J., Muñoz, A., Damm, K., Goldberg, Y., Ghysdael, J., Leutz, A., . . . Vennström, B.
(1986). The c-erb-A protein is a high-affinity receptor for thyroid hormone.
Nature, 324(6098), 635-640. doi:10.1038/324635a0
Sase, T., Suzuki, T., Miura, K., Shiiba, K., Sato, I., Nakamura, Y., . . . Sasano, H. (2012).
Runt-related transcription factor 2 in human colon carcinoma: a potent prognostic
factor associated with estrogen receptor. Int J Cancer, 131(10), 2284-2293.
doi:10.1002/ijc.27525
Scaltriti, M., Rojo, F., Ocana, A., Anido, J., Guzman, M., Cortes, J., . . . Baselga, J.
(2007). Expression of p95HER2, a truncated form of the HER2 receptor, and
181
response to anti-HER2 therapies in breast cancer. J Natl Cancer Inst, 99(8), 628-
638. doi:10.1093/jnci/djk134
Schiavon, G., Hrebien, S., Garcia-Murillas, I., Cutts, R. J., Pearson, A., Tarazona, N., . . .
Turner, N. C. (2015). Analysis of ESR1 mutation in circulating tumor DNA
demonstrates evolution during therapy for metastatic breast cancer. Sci Transl
Med, 7(313), 313ra182. doi:10.1126/scitranslmed.aac7551
Schmid, D., Behrens, G., Jochem, C., Keimling, M., & Leitzmann, M. (2013). Physical
activity, diabetes, and risk of thyroid cancer: a systematic review and meta-
analysis. Eur J Epidemiol, 28(12), 945-958. doi:10.1007/s10654-013-9865-0
Schmid, D., Ricci, C., Behrens, G., & Leitzmann, M. F. (2015a). Adiposity and risk of
thyroid cancer: a systematic review and meta-analysis. Obesity Reviews, 16(12),
1042-1054. doi:10.1111/obr.12321
Schmidt, E. D., Cramer, S. J., & Offringa, R. (1993). The thyroid hormone receptor
interferes with transcriptional activation via the AP-1 complex. Biochem Biophys
Res Commun, 192(1), 151-160. doi:10.1006/bbrc.1993.1394
Seidlin, S. M., Marinelli, L. D., & Oshry, E. (1946). Radioactive iodine therapy; effect on
functioning metastases of adenocarcinoma of the thyroid. J Am Med Assoc,
132(14), 838-847. doi:10.1001/jama.1946.02870490016004
Selzer, E., Wilfing, A., Sexl, V., & Freissmuth, M. (1994). Effects of type I-interferons
on human thyroid epithelial cells derived from normal and tumour tissue. Naunyn
Schmiedebergs Arch Pharmacol, 350(3), 322-328. doi:10.1007/bf00175039
Semba, R. D., & Delange, F. (2001). Iodine in human milk: perspectives for infant health.
Nutr Rev, 59(8 Pt 1), 269-278.
Shahrara, S., Drvota, V., & Sylven, C. (1999). Organ specific expression of thyroid
hormone receptor mRNA and protein in different human tissues. Biol Pharm Bull,
22(10), 1027-1033.
Shao, M. M., Chan, S. K., Yu, A. M., Lam, C. C., Tsang, J. Y., Lui, P. C., . . . Tse, G. M.
(2012). Keratin expression in breast cancers. Virchows Arch, 461(3), 313-322.
doi:10.1007/s00428-012-1289-9
Shao, N., Yuan, K., Zhang, Y., Yun Cheang, T., Li, J., & Lin, Y. (2018). Identification of
key candidate genes, pathways and related prognostic values in ER-
negative/HER2-negative breast cancer by bioinformatics analysis. J buon, 23(4),
891-901.
Shi, X. Z., Jin, X., Xu, P., & Shen, H. M. (2014). Relationship between breast cancer and
levels of serum thyroid hormones and antibodies: a meta-analysis. Asian Pac J
Cancer Prev, 15(16), 6643-6647.
Shi, Y., Li, X., Ran, L., Arshad, B., Li, H., Xu, Z., . . . Kong, L. Q. (2017). Study on the
status of thyroid function and thyroid nodules in chinese breast cancer patients.
Oncotarget, 8(46), 80820-80825. doi:10.18632/oncotarget.20542
Shore, R. E. (1992). Issues and epidemiological evidence regarding radiation-induced
thyroid cancer. Radiat Res, 131(1), 98-111.
Siegel, R. L., Miller, K. D., & Jemal, A. (2017). Cancer Statistics, 2017. CA Cancer J
Clin, 67(1), 7-30. doi:10.3322/caac.21387
Siegel, R. L., Miller, K. D., & Jemal, A. (2018). Cancer statistics, 2018. CA Cancer J
Clin, 68(1), 7-30. doi:10.3322/caac.21442
182
Silva-Vieira, M., Carrilho Vaz, S., Esteves, S., Ferreira, T. C., Limbert, E., Salgado, L.,
& Leite, V. (2017). Second Primary Cancer in Patients with Differentiated
Thyroid Cancer: Does Radioiodine Play a Role? Thyroid, 27(8), 1068-1076.
doi:10.1089/thy.2016.0655
Singh, A. B., Sharma, A., & Dhawan, P. (2010). Claudin family of proteins and cancer:
an overview. J Oncol, 2010, 541957. doi:10.1155/2010/541957
Singh, T. D., Jeong, S. Y., Lee, S. W., Ha, J. H., Lee, I. K., Kim, S. H., . . . Jeon, Y. H.
(2015). Inverse Agonist of Estrogen-Related Receptor gamma Enhances Sodium
Iodide Symporter Function Through Mitogen-Activated Protein Kinase Signaling
in Anaplastic Thyroid Cancer Cells. J Nucl Med, 56(11), 1690-1696.
doi:10.2967/jnumed.115.160366
Sinnott, B., Ron, E., & Schneider, A. B. (2010). Exposing the thyroid to radiation: a
review of its current extent, risks, and implications. Endocr Rev, 31(5), 756-773.
doi:10.1210/er.2010-0003
Sisley, K., Curtis, D., Rennie, I., & Rees, R. (1993). Loss of heterozygosity of the thyroid
hormone receptor B in posterior uveal melanoma. In (Vol. 3, pp. 457-461).
Melanoma Res.
Song, Q. K., Wang, X. L., Zhou, X. N., Yang, H. B., Li, Y. C., Wu, J. P., . . . Lyerly, H.
K. (2015). Breast Cancer Challenges and Screening in China: Lessons From
Current Registry Data and Population Screening Studies. Oncologist, 20(7), 773-
779. doi:10.1634/theoncologist.2014-0351
Sonnenblick, A., de Azambuja, E., Azim, H. A., Jr., & Piccart, M. (2015). An update on
PARP inhibitors--moving to the adjuvant setting. Nat Rev Clin Oncol, 12(1), 27-
41. doi:10.1038/nrclinonc.2014.163
Soto, A. M., Vandenberg, L. N., Maffini, M. V., & Sonnenschein, C. (2008). Does breast
cancer start in the womb? Basic Clin Pharmacol Toxicol, 102(2), 125-133.
doi:10.1111/j.1742-7843.2007.00165.x
Sprague, B. L., Trentham-Dietz, A., Egan, K. M., Titus-Ernstoff, L., Hampton, J. M., &
Newcomb, P. A. (2008). Proportion of invasive breast cancer attributable to risk
factors modifiable after menopause. Am J Epidemiol, 168(4), 404-411.
doi:10.1093/aje/kwn143
Stan, D., Loprinzi, C. L., & Ruddy, K. J. (2013). Breast cancer survivorship issues.
Hematol Oncol Clin North Am, 27(4), 805-827, ix. doi:10.1016/j.hoc.2013.05.005
Stavreva, D. A., Varticovski, L., Levkova, L., George, A. A., Davis, L., Pegoraro, G., . . .
Hager, G. L. (2016). Novel cell-based assay for detection of thyroid receptor beta-
interacting environmental contaminants. Toxicology, 368-369, 69-79.
doi:10.1016/j.tox.2016.08.012
Strait, K. A., Zou, L., & Oppenheimer, J. H. (1992). Beta 1 isoform-specific regulation of
a triiodothyronine-induced gene during cerebellar development. Molecular
endocrinology (Baltimore, Md.), 6(11), 1874-1880.
doi:10.1210/mend.6.11.1282672
Subbiah, V., Kreitman, R. J., Wainberg, Z. A., Cho, J. Y., Schellens, J. H. M., Soria, J.
C., . . . Keam, B. (2018). Dabrafenib and Trametinib Treatment in Patients With
Locally Advanced or Metastatic BRAF V600-Mutant Anaplastic Thyroid Cancer.
J Clin Oncol, 36(1), 7-13. doi:10.1200/jco.2017.73.6785
183
Sun, K., Montana, V., Chellappa, K., Brelivet, Y., Moras, D., Maeda, Y., . . . Sladek, F.
M. (2007). Phosphorylation of a conserved serine in the deoxyribonucleic acid
binding domain of nuclear receptors alters intracellular localization. Mol
Endocrinol, 21(6), 1297-1311. doi:10.1210/me.2006-0300
Sun, L. M., Lin, C. L., Liang, J. A., Huang, W. S., & Kao, C. H. (2015). Radiotherapy did
not increase thyroid cancer risk among women with breast cancer: A nationwide
population-based cohort study. Int J Cancer, 137(12), 2896-2903.
doi:10.1002/ijc.29667
Sun, X., Wei, L., & Chen, Q. (2009). HDAC4 represses vascular endothelial growth
factor expression in chondrosarcoma by modulating RUNX2 activity. The Journal
of biological chemistry, 284, 21881-21890. Retrieved from
http://dx.doi.org/10.1074/jbc.M109.019091
Sun, Y., Jin, S. D., Zhu, Q., Han, L., Feng, J., Lu, X. Y., . . . Guo, R. H. (2017). Long
non-coding RNA LUCAT1 is associated with poor prognosis in human non-small
lung cancer and regulates cell proliferation via epigenetically repressing p21 and
p57 expression. Oncotarget, 8(17), 28297-28311. doi:10.18632/oncotarget.16044
Surveillance, Epidemiology, and End Results (SEER) Program (www.seer.cancer.gov)
Research Data (1975-2016). (Released April 2019, based on the November 2018
submission). In: National Cancer Institute, DCCPS, Surveillance Research
Program.
Suzuki, H., Willingham, M. C., & Cheng, S. Y. (2002). Mice with a mutation in the
thyroid hormone receptor beta gene spontaneously develop thyroid carcinoma: a
mouse model of thyroid carcinogenesis. Thyroid, 12(11), 963-969.
doi:10.1089/105072502320908295
Swierczynski, J., Mitchell, D. A., Reinhold, D. S., Salati, L. M., Stapleton, S. R.,
Klautky, S. A., . . . Goodridge, A. G. (1991). Triiodothyronine-induced
accumulations of malic enzyme, fatty acid synthase, acetyl-coenzyme A
carboxylase, and their mRNAs are blocked by protein kinase inhibitors.
Transcription is the affected step. J Biol Chem, 266(26), 17459-17466.
Tagami, T., Madison, L. D., Nagaya, T., & Jameson, J. L. (1997). Nuclear receptor
corepressors activate rather than suppress basal transcription of genes that are
negatively regulated by thyroid hormone. Mol Cell Biol, 17(5), 2642-2648.
doi:10.1128/mcb.17.5.2642
Taipaleenmaki, H., Browne, G., Akech, J., Zustin, J., van Wijnen, A. J., Stein, J. L., . . .
Lian, J. B. (2015). Targeting of Runx2 by miR-135 and miR-203 Impairs
Progression of Breast Cancer and Metastatic Bone Disease. Cancer Res, 75(7),
1433-1444. doi:10.1158/0008-5472.can-14-1026
Tao, Z., Shi, A., Lu, C., Song, T., Zhang, Z., & Zhao, J. (2015). Breast Cancer:
Epidemiology and Etiology. Cell Biochem Biophys, 72(2), 333-338.
doi:10.1007/s12013-014-0459-6
Teymourzadeh, A., Mansouri, S., Farahmand, L., Hosseinzade, A., & Majidzadeh, A. K.
(2017). ER-alpha36 Interactions With Cytosolic Molecular Network in Acquired
Tamoxifen Resistance. Clin Breast Cancer, 17(6), 403-407.
doi:10.1016/j.clbc.2017.03.013
184
Thormeyer, D., & Baniahmad, A. (1999). The v-erbA oncogene (review). Int J Mol Med,
4(4), 351-358.
Ting, Y. T., Bhat, M. K., Wong, R., & Cheng, S. (1997). Tissue-specific stabilization of
the thyroid hormone beta1 nuclear receptor by phosphorylation. J Biol Chem,
272(7), 4129-4134.
Ting, Y. T., & Cheng, S. Y. (1997). Hormone-activated phosphorylation of human beta1
thyroid hormone nuclear receptor. Thyroid, 7(3), 463-469.
Torre, L. A., Siegel, R. L., Ward, E. M., & Jemal, A. (2016). Global Cancer Incidence
and Mortality Rates and Trends--An Update. Cancer Epidemiol Biomarkers Prev,
25(1), 16-27. doi:10.1158/1055-9965.epi-15-0578
Tracy, K. M., Tye, C. E., Ghule, P. N., Malaby, H. L. H., Stumpff, J., Stein, J. L., . . .
Lian, J. B. (2018). Mitotically-Associated lncRNA (MANCR) Affects Genomic
Stability and Cell Division in Aggressive Breast Cancer. Mol Cancer Res, 16(4),
587-598. doi:10.1158/1541-7786.mcr-17-0548
Traina, T. A., Miller, K., Yardley, D. A., Eakle, J., Schwartzberg, L. S., O'Shaughnessy,
J., . . . Cortes, J. (2018). Enzalutamide for the Treatment of Androgen Receptor-
Expressing Triple-Negative Breast Cancer. J Clin Oncol, 36(9), 884-890.
doi:10.1200/jco.2016.71.3495
Tunio, M. A., Al Asiri, M., Bayoumi, Y., Stanciu, L. G., Al Johani, N., & Al Saeed, E. F.
(2015). Is thyroid gland an organ at risk in breast cancer patients treated with
locoregional radiotherapy? Results of a pilot study. J Cancer Res Ther, 11(4),
684-689. doi:10.4103/0973-1482.167613
Uhlen, M., Fagerberg, L., Hallstrom, B. M., Lindskog, C., Oksvold, P., Mardinoglu, A., .
. . Ponten, F. (2015). Proteomics. Tissue-based map of the human proteome.
Science, 347(6220), 1260419. doi:10.1126/science.1260419
Uzair, I. D., Conte Grand, J., Flamini, M. I., & Sanchez, A. M. (2019). Molecular Actions
of Thyroid Hormone on Breast Cancer Cell Migration and Invasion via
Cortactin/N-WASP. Front Endocrinol (Lausanne), 10, 139.
doi:10.3389/fendo.2019.00139
Van Fossen, V. L., Wilhelm, S. M., Eaton, J. L., & McHenry, C. R. (2013). Association
of thyroid, breast and renal cell cancer: a population-based study of the
prevalence of second malignancies. Ann Surg Oncol, 20(4), 1341-1347.
doi:10.1245/s10434-012-2718-3
Venturi, S. (2001). Is there a role for iodine in breast diseases? Breast, 10(5), 379-382.
doi:10.1054/brst.2000.0267
Verga Falzacappa, C., Petrucci, E., Patriarca, V., Michienzi, S., Stigliano, A., Brunetti,
E., . . . Misiti, S. (2007). Thyroid hormone receptor TRbeta1 mediates Akt
activation by T3 in pancreatic beta cells. J Mol Endocrinol, 38(1-2), 221-233.
doi:10.1677/jme.1.02166
Wahba, H. A., & El-Hadaad, H. A. (2015). Current approaches in treatment of triple-
negative breast cancer. Cancer Biol Med, 12(2), 106-116.
doi:10.7497/j.issn.2095-3941.2015.0030
Wang, D., Xia, X., Liu, Y., Oetting, A., Walker, R. L., Zhu, Y., . . . Yen, P. M. (2009).
Negative Regulation of TSHα Target Gene by Thyroid Hormone Involves
185
Histone Acetylation and Corepressor Complex Dissociation. Molecular
Endocrinology, 23(5), 600-609. doi:10.1210/me.2008-0389
Wang, H., Guan, Z., He, K., Qian, J., Cao, J., & Teng, L. (2017). LncRNA UCA1 in anti-
cancer drug resistance. Oncotarget, 8(38), 64638-64650.
doi:10.18632/oncotarget.18344
Wang, Y., He, X., Yu, Q., & Eng, C. (2013). Androgen receptor-induced tumor
suppressor, KLLN, inhibits breast cancer growth and transcriptionally activates
p53/p73-mediated apoptosis in breast carcinomas. Hum Mol Genet, 22(11), 2263-
2272. doi:10.1093/hmg/ddt077
Webb, P. (2004). Selective activators of thyroid hormone receptors. Expert Opin Investig
Drugs, 13(5), 489-500. doi:10.1517/13543784.13.5.489
Weiderpass, E. (2010). Lifestyle and cancer risk. Journal of preventive medicine and
public health, 43(6), 459-471. doi:10.3961/jpmph.2010.43.6.459
Weinberger, C., Thompson, C. C., Ong, E. S., Lebo, R., Gruol, D. J., & Evans, R. M.
(1986). The c-erb-A gene encodes a thyroid hormone receptor. Nature,
324(6098), 641-646. doi:10.1038/324641a0
Wilkinson, J. R., & Towle, H. C. (1997). Identification and characterization of the AF-1
transactivation domain of thyroid hormone receptor beta1. J Biol Chem, 272(38),
23824-23832. doi:10.1074/jbc.272.38.23824
Wiltshire, J. J., Drake, T. M., Uttley, L., & Balasubramanian, S. P. (2016). Systematic
Review of Trends in the Incidence Rates of Thyroid Cancer. Thyroid, 26(11),
1541-1552. doi:10.1089/thy.2016.0100
Wolny-Rokicka, E., Tukiendorf, A., Wydmanski, J., Roszkowska, D., Staniul, B. S., &
Zembron-Lacny, A. (2016). Thyroid Function after Postoperative Radiation
Therapy in Patients with Breast Cancer. Asian Pac J Cancer Prev, 17(10), 4577-
4581.
Wortel, I. M. N., van der Meer, L. T., Kilberg, M. S., & van Leeuwen, F. N. (2017).
Surviving Stress: Modulation of ATF4-Mediated Stress Responses in Normal and
Malignant Cells. Trends Endocrinol Metab, 28(11), 794-806.
doi:10.1016/j.tem.2017.07.003
Wu, K. K. (2006). Analysis of protein-DNA binding by streptavidin-agarose pulldown.
Methods Mol Biol, 338, 281-290. doi:10.1385/1-59745-097-9:281
Wu, Y., & Koenig, R. J. (2000). Gene regulation by thyroid hormone. Trends Endocrinol
Metab, 11(6), 207-211.
Xin, Q. L., Qiu, J. T., Cui, S., Xia, G. L., & Wang, H. B. (2016). Transcriptional
activation of nuclear estrogen receptor and progesterone receptor and its
regulation. Sheng Li Xue Bao, 68(4), 435-454.
Xing, M. (2005). BRAF mutation in thyroid cancer. Endocr Relat Cancer, 12(2), 245-
262. doi:10.1677/erc.1.0978
Xing, M. (2013). Molecular pathogenesis and mechanisms of thyroid cancer. Nat Rev
Cancer, 13(3), 184-199. doi:10.1038/nrc3431
Xing, M., Westra, W. H., Tufano, R. P., Cohen, Y., Rosenbaum, E., Rhoden, K. J., . . .
Ladenson, P. W. (2005). BRAF mutation predicts a poorer clinical prognosis for
papillary thyroid cancer. J Clin Endocrinol Metab, 90(12), 6373-6379.
doi:10.1210/jc.2005-0987
186
Yadav, R. K., Chae, S. W., Kim, H. R., & Chae, H. J. (2014). Endoplasmic reticulum
stress and cancer. J Cancer Prev, 19(2), 75-88. doi:10.15430/jcp.2014.19.2.75
Yamada, D., Fujikawa, K., Kawabe, K., Furuta, T., Nakada, M., & Takarada, T. (2018).
RUNX2 Promotes Malignant Progression in Glioma. Neurochem Res, 43(11),
2047-2054. doi:10.1007/s11064-018-2626-4
Yang, X. Z., Cheng, T. T., He, Q. J., Lei, Z. Y., Chi, J., Tang, Z., . . . Cui, S. Z. (2018).
LINC01133 as ceRNA inhibits gastric cancer progression by sponging miR-106a-
3p to regulate APC expression and the Wnt/beta-catenin pathway. Mol Cancer,
17(1), 126. doi:10.1186/s12943-018-0874-1
Yang, Y., Zhao, Y., Hu, N., Zhao, J., & Bai, Y. (2019). lncRNA KIAA0125 functions as
a tumor suppressor modulating growth and metastasis of colorectal cancer via
Wnt/beta-catenin pathway. Cell Biol Int. doi:10.1002/cbin.11196
Ye, L., Li, Y. L., Mellstrom, K., Mellin, C., Bladh, L. G., Koehler, K., . . . Malm, J.
(2003). Thyroid receptor ligands. 1. Agonist ligands selective for the thyroid
receptor beta1. J Med Chem, 46(9), 1580-1588. doi:10.1021/jm021080f
Yen, C.-F., Wang, H.-S., Lee, C.-L., & Liao, S.-K. (2014). Roles of integrin-linked
kinase in cell signaling and its perspectives as a therapeutic target. Gynecology
and Minimally Invasive Therapy, 3(3), 67-72.
Yen, P. M. (2001). Physiological and molecular basis of thyroid hormone action. Physiol
Rev, 81(3), 1097-1142.
Yin, L., & Wang, Z. Y. (2016). Roles of the ER-alpha36-EGFR/HER2 positive
regulatory loops in tamoxifen resistance. Steroids, 111, 95-99.
doi:10.1016/j.steroids.2016.01.019
Yuan, C., Lin, J. Z., Sieglaff, D. H., Ayers, S. D., Denoto-Reynolds, F., Baxter, J. D., &
Webb, P. (2012). Identical gene regulation patterns of T3 and selective thyroid
hormone receptor modulator GC-1. Endocrinology, 153(1), 501-511.
doi:10.1210/en.2011-1325
Zhang, D. Y., Zou, X. J., Cao, C. H., Zhang, T., Lei, L., Qi, X. L., . . . Wu, D. H. (2018).
Identification and Functional Characterization of Long Non-coding RNA
MIR22HG as a Tumor Suppressor for Hepatocellular Carcinoma. Theranostics,
8(14), 3751-3765. doi:10.7150/thno.22493
Zhang, L., Wu, Y., Liu, F., Fu, L., & Tong, Z. (2016). Characteristics and survival of
patients with metachronous or synchronous double primary malignancies: breast
and thyroid cancer. Oncotarget, 7(32), 52450-52459.
doi:10.18632/oncotarget.9547
Zhang, N., Jin, W., Zhou, S., Yang, J. D., Harmsen, W. S., Giama, N. H., . . . Roberts, L.
R. (2018). Hypothyroidism is associated with worse outcomes of hepatocellular
carcinoma patients after liver transplantation. Cancer Med, 7(12), 5870-5878.
doi:10.1002/cam4.1797
Zhang, X. K., Wills, K. N., Husmann, M., Hermann, T., & Pfahl, M. (1991). Novel
pathway for thyroid hormone receptor action through interaction with jun and fos
oncogene activities. Mol Cell Biol, 11(12), 6016-6025.
doi:10.1128/mcb.11.12.6016
Zhang, Y., Liang, J., Li, H., Cong, H., & Lin, Y. (2016). Risk of second primary breast
cancer after radioactive iodine treatment in thyroid cancer: a systematic review
187
and meta-analysis. Nucl Med Commun, 37(2), 110-115.
doi:10.1097/mnm.0000000000000419
Zhao, D., & Dong, J. T. (2018). Upregulation of Long Non-Coding RNA DRAIC
Correlates with Adverse Features of Breast Cancer. Noncoding RNA, 4(4).
doi:10.3390/ncrna4040039
Zheng, G., Yu, H., Hemminki, A., Forsti, A., Sundquist, K., & Hemminki, K. (2017).
Familial associations of female breast cancer with other cancers. Int J Cancer,
141(11), 2253-2259. doi:10.1002/ijc.30927
Zhou, Z., Zhang, J., Jiang, F., Xie, Y., Zhang, X., & Jiang, L. (2017). Higher urinary
bisphenol A concentration and excessive iodine intake are associated with nodular
goiter and papillary thyroid carcinoma. Biosci Rep, 37(4).
doi:10.1042/bsr20170678
Zhu, X., Zhao, L., Park, J. W., Willingham, M. C., & Cheng, S. Y. (2014). Synergistic
signaling of KRAS and thyroid hormone receptor beta mutants promotes
undifferentiated thyroid cancer through MYC up-regulation. Neoplasia, 16(9),
757-769. doi:10.1016/j.neo.2014.08.003
Zhu, X. G., Zhao, L., Willingham, M. C., & Cheng, S. Y. (2010). Thyroid hormone
receptors are tumor suppressors in a mouse model of metastatic follicular thyroid
carcinoma. Oncogene, 29(13), 1909-1919. doi:10.1038/onc.2009.476
Zidan, J., & Rubenstein, W. (1999). Effect of adjuvant tamoxifen therapy on thyroid
function in postmenopausal women with breast cancer. Oncology, 56(1), 43-45.
doi:10.1159/000011928
Zimmermann, M. B. (2009). Iodine deficiency. Endocr Rev, 30(4), 376-408.
doi:10.1210/er.2009-0011
Zimmermann, M. B., & Galetti, V. (2015). Iodine intake as a risk factor for thyroid
cancer: a comprehensive review of animal and human studies. Thyroid Res, 8, 8.
doi:10.1186/s13044-015-0020-8
188
Appendix A
Supplemental Materials for Chapter 2
189
Appendix A-1: Antibody Table
Antibody Manufacturer Protein Species
SAB4300042 Millipore-Sigma pAKT (S142) Rabbit
CST9167
Cell Signaling
Technology STAT1 Mouse
CST9167
Cell Signaling
Technology JAK1 Mouse
MA5-15739
ThermoFisher
Scientific β-Actin Mouse
CST14220
Cell Signaling
Technology Caspase-3 Rabbit
CST964
Cell Signaling
Technology
Cleaved
Caspase-3 Rabbit
CST9542
Cell Signaling
Technology PARP Rabbit
CST5625
Cell Signaling
Technology Cleaved PARP Rabbit
190
Appendix A-2: Primer Table
Gene Forward Oligo Reverse Oligo
MYC AGCGACTCTGAGGAGGGAACAA GTGGGCTGTGAGGAGGTTTG
CDKN1A GCAGACCAGCATGACAGATTT CTGGACTTCGAGCAAGAGATG
TNFSF10 CCGTCAGCTCGTTAGAAAGATGAT TGTGTTGCTTCTTCCTCTGGT
APOL6 CCTGTTCAAAGGCCACCCTA TCAAATGATTTTCTTCTCTCCACGG
TAP1 GCCTTGTTCCGAGAGCTGAT AATGGCCATCTCCCCAAGAG
IRF1 CTTCCAGGTGTCACCCATGC CCATCCACGTTTGTTGGCTG
GAPDH ATGTTCGTCATGGGTGTGAA TGTGGTCATGAGTCCTTCCA
191
Appendix A-3: TRβ Repressed PI3K Signaling.
Appendix A-3. A-I) Expression of cluster 1 differentially expressed genes in the ILK signaling IPA
pathway. All genes were repressed by T3 and the level of most of these genes was repressed in the SW-
TRβ-T3 condition compared to SW-EV-T3. (n=3, * p<0.05, n.s. p>0.05) B) AKT phosphorylation was
repressed upon overexpression of TRβ in SW1736 cells. (representative blot of 3 experiments)
192
Appendix A-4: Significantly Altered Pathways between SW-EV-T3 and SW-TRβ-T3 as
determined by Ingenuity Pathway Analysis.
Ingenuity Canonical Pathways -log(p-value) Ratio z-score
LPS/IL-1 Mediated Inhibition of RXR Function 7.75E+00 1.25E-01 -1.265
VDR/RXR Activation 3.88E+00 1.41E-01 0.378
Prostanoid Biosynthesis 3.70E+00 4.44E-01 2
Interferon Signaling 3.53E+00 1.94E-01 2.646
Dopamine Degradation 3.16E+00 2.00E-01 0
Aryl Hydrocarbon Receptor Signaling 3.08E+00 9.79E-02 -0.816
Cardiac Hypertrophy Signaling (Enhanced) 2.91E+00 6.57E-02 0.365
STAT3 Pathway 2.83E+00 9.63E-02 -0.333
SPINK1 Pancreatic Cancer Pathway 2.81E+00 1.33E-01 -2.828
Tryptophan Degradation X (Mammalian, via Tryptamine) 2.71E+00 2.00E-01 -1.342
Inhibition of Matrix Metalloproteases 2.55E+00 1.54E-01 -1.342
Sirtuin Signaling Pathway 2.54E+00 7.19E-02 -0.229
Intrinsic Prothrombin Activation Pathway 2.38E+00 1.43E-01 1.633
Oxidative Ethanol Degradation III 2.34E+00 2.11E-01 0
Osteoarthritis Pathway 2.24E+00 7.51E-02 0.775
Colorectal Cancer Metastasis Signaling 2.19E+00 7.09E-02 2.5
Putrescine Degradation III 2.18E+00 1.90E-01 -1
Dermatan Sulfate Biosynthesis (Late Stages) 2.18E+00 1.30E-01 0
Ethanol Degradation IV 2.03E+00 1.74E-01 0
p53 Signaling 1.99E+00 9.18E-02 0.378
Neuroprotective Role of THOP1 in Alzheimer's Disease 1.97E+00 8.62E-02 3
Wnt/β-catenin Signaling 1.92E+00 7.51E-02 0
Sumoylation Pathway 1.86E+00 8.74E-02 0.333
LXR/RXR Activation 1.85E+00 8.26E-02 0.707
Leukocyte Extravasation Signaling 1.80E+00 7.04E-02 2.111
Death Receptor Signaling 1.72E+00 8.79E-02 1.414
Endocannabinoid Neuronal Synapse Pathway 1.69E+00 7.81E-02 1.667
HMGB1 Signaling 1.69E+00 7.23E-02 0.632
Dermatan Sulfate Biosynthesis 1.67E+00 1.02E-01 0
Production of Nitric Oxide and Reactive Oxygen Species in Macrophages 1.63E+00 6.88E-02 0.832
PCP pathway 1.61E+00 9.84E-02 0.816
ILK Signaling 1.59E+00 6.77E-02 -0.277
Ethanol Degradation II 1.54E+00 1.25E-01 0
Apelin Adipocyte Signaling Pathway 1.53E+00 8.64E-02 1.134
Chondroitin Sulfate Biosynthesis (Late Stages) 1.51E+00 1.04E-01 0.447
Superpathway of Melatonin Degradation 1.49E+00 9.23E-02 0
IL-8 Signaling 1.46E+00 6.50E-02 1.941
193
FGF Signaling 1.43E+00 8.24E-02 -1.134
Serotonin Degradation 1.43E+00 8.96E-02 0
Noradrenaline and Adrenaline Degradation 1.41E+00 1.14E-01 -1
Type II Diabetes Mellitus Signaling 1.41E+00 6.99E-02 -0.447
B Cell Receptor Signaling 1.36E+00 6.45E-02 0.905
IL-6 Signaling 1.36E+00 7.14E-02 0.707
Glioblastoma Multiforme Signaling 1.36E+00 6.63E-02 0.302
Opioid Signaling Pathway 1.35E+00 6.00E-02 0.258
194
Appendix A-5: Significantly Altered Hallmark and Gene Ontology Gene Set Enrichment
Analysis Pathways between SW-EV-T3 and SW-TRβ-T3.
PATHWAY NAME SIZE ES NES Nominal p-value
HALLMARK IL2 STAT5 SIGNALING 34 0.549212 1.993116 0
HALLMARK INTERFERON ALPHA RESPONSE 36 0.507281 1.866105 0
HALLMARK INTERFERON GAMMA RESPONSE 62 0.457168 1.82303 0
HALLMARK ANDROGEN RESPONSE 28 0.447349 1.576111 0.018626
HALLMARK KRAS SIGNALING DN 26 0.445573 1.555294 0.030588
HALLMARK APOPTOSIS 33 0.42514 1.528914 0.032768
HALLMARK MYOGENESIS 33 0.424435 1.525912 0.037246
HALLMARK KRAS SIGNALING UP 46 0.422374 1.647219 0.011892
HALLMARK HYPOXIA 50 0.420136 1.633861 0.012876
GO REGULATION OF ANION TRANSPORT 16 0.647537 1.961926 0
GO ENSHEATHMENT OF NEURONS 15 0.63384 1.888172 0
GO NEGATIVE REGULATION OF IMMUNE RESPONSE 18 0.623441 1.982653 0
GO MATERNAL PROCESS INVOLVED IN FEMALE PREGNANCY 15 0.605408 1.842508 0.002528
GO NEGATIVE REGULATION OF CELL MORPHOGENESIS INVOLVED IN DIFFERENTIATION 15 0.599959 1.807874 0.003802
GO REGULATION OF G PROTEIN COUPLED RECEPTOR SIGNALING PATHWAY 17 0.589212 1.8504 0.001261
GO NEGATIVE REGULATION OF NEURON PROJECTION DEVELOPMENT 22 0.585012 1.913372 0
GO REGULATION OF AXONOGENESIS 23 0.58306 1.934126 0
GO AXON EXTENSION 16 0.580806 1.76497 0.008706
GO ANTIGEN PROCESSING AND PRESENTATION OF PEPTIDE ANTIGEN VIA MHC CLASS I 19 0.580567 1.84078 0.002421
GO REGULATION OF NEUROLOGICAL SYSTEM PROCESS 15 0.578919 1.743862 0.007673
GO POSITIVE REGULATION OF MULTI ORGANISM PROCESS 16 0.569209 1.734695 0.011598
GO NEGATIVE REGULATION OF IMMUNE EFFECTOR PROCESS 16 0.568819 1.760847 0.002541
GO POSITIVE REGULATION OF PEPTIDE SECRETION 29 0.565288 1.986042 0
GO CHLORIDE TRANSPORT 18 0.563822 1.753195 0.005096
GO REGULATION OF EXTENT OF CELL GROWTH 16 0.558058 1.694238 0.009792
GO POSITIVE REGULATION OF PROTEIN KINASE B SIGNALING 19 0.553993 1.769344 0.008495
GO NEGATIVE REGULATION OF VIRAL PROCESS 19 0.551946 1.739828 0.007194
GO INORGANIC ANION TRANSPORT 23 0.547105 1.845404 0.002364
195
GO NEURON PROJECTION EXTENSION 17 0.545537 1.688651 0.007326
GO RESPONSE TO TYPE I INTERFERON 23 0.541304 1.824775 0
GO LONG CHAIN FATTY ACID METABOLIC PROCESS 19 0.540457 1.722342 0.008696
GO POSITIVE REGULATION OF CHEMOTAXIS 15 0.536159 1.616078 0.019704
GO REGULATION OF DNA TEMPLATED TRANSCRIPTION IN RESPONSE TO STRESS 16 0.53267 1.62916 0.018657
GO TUMOR NECROSIS FACTOR SUPERFAMILY CYTOKINE PRODUCTION 18 0.532292 1.696899 0.01233
GO PRODUCTION OF MOLECULAR MEDIATOR OF IMMUNE RESPONSE 19 0.52714 1.676789 0.008557
GO NEGATIVE REGULATION OF CELL PROJECTION ORGANIZATION 26 0.526901 1.794707 0.001174
GO NEGATIVE REGULATION OF VIRAL GENOME REPLICATION 15 0.526274 1.602835 0.022444
GO RESPONSE TO HEAT 15 0.525898 1.560976 0.040973
GO PRIMARY ACTIVE TRANSMEMBRANE TRANSPORTER ACTIVITY 18 0.525452 1.671375 0.012579
GO ANCHORED COMPONENT OF MEMBRANE 23 0.52515 1.750417 0.004684
GO POSITIVE REGULATION OF AUTOPHAGY 17 0.523293 1.648211 0.012469
GO ATPASE ACTIVITY COUPLED TO MOVEMENT OF SUBSTANCES 20 0.522145 1.708004 0.004831
GO ANTIGEN PROCESSING AND PRESENTATION OF PEPTIDE ANTIGEN 25 0.519054 1.806069 0.004684
GO ENDOTHELIAL CELL PROLIFERATION 18 0.51824 1.630316 0.009721
GO FATTY ACID BIOSYNTHETIC PROCESS 25 0.517154 1.790263 0.002326
GO MEMBRANE FUSION 16 0.515827 1.560734 0.026895
GO UNSATURATED FATTY ACID METABOLIC PROCESS 18 0.515356 1.620658 0.024297
GO RESPONSE TO TEMPERATURE STIMULUS 23 0.514636 1.738781 0.010817
GO POSITIVE REGULATION OF ERK1 AND ERK2 CASCADE 18 0.509508 1.608124 0.021066
GO RESPONSE TO FIBROBLAST GROWTH FACTOR 18 0.507422 1.586456 0.026087
GO POST TRANSLATIONAL PROTEIN MODIFICATION 33 0.50568 1.819322 0.001143
GO ICOSANOID METABOLIC PROCESS 17 0.503684 1.550899 0.036993
GO NEGATIVE REGULATION OF NEURON DIFFERENTIATION 32 0.502984 1.815329 0.003417
GO INORGANIC ANION TRANSMEMBRANE TRANSPORTER ACTIVITY 20 0.500421 1.617689 0.01444
GO CYTOKINE METABOLIC PROCESS 19 0.499549 1.60804 0.027981
GO POSITIVE REGULATION OF TRANSPORTER ACTIVITY 17 0.499204 1.551982 0.0425
GO T CELL RECEPTOR SIGNALING PATHWAY 20 0.498825 1.617687 0.02457
GO RESPONSE TO VITAMIN 16 0.497992 1.517769 0.042875
196
GO SERINE HYDROLASE ACTIVITY 25 0.496751 1.690443 0.008323
GO NEGATIVE REGULATION OF DEFENSE RESPONSE 26 0.494931 1.70787 0.009456
GO VESICLE LOCALIZATION 19 0.493067 1.580967 0.021546
GO DEFENSE RESPONSE TO BACTERIUM 21 0.492649 1.62172 0.014493
GO MACROAUTOPHAGY 25 0.491718 1.66188 0.015495
GO REGULATION OF PRODUCTION OF MOLECULAR MEDIATOR OF IMMUNE RESPONSE 17 0.489345 1.544081 0.03198
GO POSITIVE REGULATION OF LEUKOCYTE MIGRATION 19 0.488579 1.539014 0.043684
GO METALLOPEPTIDASE ACTIVITY 20 0.488505 1.604386 0.021713
GO POSITIVE REGULATION OF SECRETION 49 0.48764 1.910219 0
GO RAB GTPASE BINDING 18 0.486209 1.535886 0.041872
GO REGULATION OF LEUKOCYTE MIGRATION 28 0.485348 1.709499 0.006849
GO REGULATION OF VIRAL LIFE CYCLE 26 0.484676 1.651607 0.012731
GO IRON ION BINDING 20 0.48405 1.547183 0.034105
GO ENDOPEPTIDASE REGULATOR ACTIVITY 28 0.483351 1.703125 0.009368
GO REGULATION OF RESPONSE TO BIOTIC STIMULUS 19 0.482561 1.559634 0.027947
GO TUMOR NECROSIS FACTOR MEDIATED SIGNALING PATHWAY 19 0.4806 1.538006 0.041463
GO ANTIGEN PROCESSING AND PRESENTATION 28 0.479264 1.688396 0.00576
GO NIK NF KAPPAB SIGNALING 22 0.478409 1.597187 0.02974
GO NEGATIVE REGULATION OF CYTOKINE PRODUCTION 41 0.477304 1.81826 0.001098
GO SITE OF POLARIZED GROWTH 19 0.476715 1.516823 0.039663
GO PEPTIDASE REGULATOR ACTIVITY 32 0.475629 1.709681 0.007042
GO REGULATION OF SYMBIOSIS ENCOMPASSING MUTUALISM THROUGH PARASITISM 27 0.474584 1.647228 0.008037
GO TYPE I INTERFERON PRODUCTION 21 0.474526 1.553489 0.020581
GO NEGATIVE REGULATION OF DEVELOPMENTAL GROWTH 21 0.474124 1.528637 0.031863
GO DEVELOPMENTAL CELL GROWTH 23 0.473638 1.573811 0.026474
GO DEVELOPMENTAL GROWTH INVOLVED IN MORPHOGENESIS 27 0.470821 1.643117 0.016
GO ANTIGEN RECEPTOR MEDIATED SIGNALING PATHWAY 26 0.469483 1.61903 0.019883
GO T CELL PROLIFERATION 23 0.468407 1.57022 0.02497
GO SPROUTING ANGIOGENESIS 24 0.467069 1.546203 0.031616
GO REGULATION OF BLOOD PRESSURE 33 0.466682 1.67405 0.005701
GO SPECIFIC GRANULE 19 0.466117 1.510681 0.045056
GO HEART PROCESS 25 0.463807 1.57181 0.029621
GO AXON DEVELOPMENT 60 0.463489 1.876637 0
GO VOLTAGE GATED ION CHANNEL ACTIVITY 22 0.463471 1.501311 0.045949
197
GO INTERFERON GAMMA PRODUCTION 23 0.463215 1.554114 0.019139
GO NEGATIVE REGULATION OF NERVOUS SYSTEM DEVELOPMENT 39 0.463096 1.773813 0.005556
GO ADHERENS JUNCTION ORGANIZATION 19 0.462314 1.505994 0.04896
GO ESTABLISHMENT OF ORGANELLE LOCALIZATION 31 0.462252 1.644556 0.011338
GO NEGATIVE REGULATION OF DNA BINDING TRANSCRIPTION FACTOR ACTIVITY 21 0.460942 1.493413 0.047847
GO REGULATION OF MULTI ORGANISM PROCESS 49 0.458686 1.799577 0
GO PEPTIDASE ACTIVITY 70 0.454856 1.874579 0
GO T CELL DIFFERENTIATION 37 0.454637 1.690113 0.005537
GO REGENERATION 38 0.453457 1.704756 0.005574
GO CELL CHEMOTAXIS 33 0.453449 1.629858 0.01373
GO CATION CHANNEL ACTIVITY 28 0.451402 1.560146 0.028802
GO OXIDOREDUCTASE ACTIVITY ACTING ON PAIRED DONORS WITH INCORPORATION OR REDUCTION OF MOLECULAR OXYGEN 24 0.449344 1.516543 0.043728
GO CYTOKINE RECEPTOR BINDING 27 0.448833 1.575743 0.021004
GO REGULATION OF EXTRINSIC APOPTOTIC SIGNALING PATHWAY 23 0.447673 1.506763 0.040237
GO NEGATIVE REGULATION OF APOPTOTIC SIGNALING PATHWAY 24 0.446991 1.531891 0.039673
GO GOLGI VESICLE TRANSPORT 28 0.444335 1.548446 0.024166
GO NEGATIVE REGULATION OF MULTI ORGANISM PROCESS 27 0.444207 1.5553 0.03169
GO ORGANELLE LOCALIZATION 38 0.4434 1.631574 0.010297
GO REGULATION OF LEUKOCYTE PROLIFERATION 27 0.440103 1.52778 0.036824
GO REGULATION OF CHEMOTAXIS 28 0.439815 1.541717 0.030588
GO REGULATION OF AUTOPHAGY 31 0.439697 1.583541 0.015784
GO POSITIVE REGULATION OF I KAPPAB KINASE NF KAPPAB SIGNALING 28 0.439203 1.556501 0.020548
GO LIPID MODIFICATION 31 0.438909 1.577764 0.017222
GO FATTY ACID METABOLIC PROCESS 33 0.438108 1.592505 0.022497
GO NEGATIVE REGULATION OF CELL DEVELOPMENT 40 0.438 1.662895 0.003371
GO NEURON PROJECTION GUIDANCE 39 0.437973 1.648987 0.005701
GO ATPASE ACTIVITY COUPLED 29 0.436629 1.551395 0.021378
GO PROCESS UTILIZING AUTOPHAGIC MECHANISM 47 0.435348 1.682766 0.002155
GO INTERFERON GAMMA MEDIATED SIGNALING PATHWAY 24 0.433353 1.47067 0.042755
GO REGULATION OF RESPONSE TO CYTOKINE STIMULUS 28 0.433071 1.530637 0.027491
GO CELLULAR RESPONSE TO OXYGEN LEVELS 33 0.432858 1.553396 0.031285
198
GO INTERACTION WITH HOST 26 0.432622 1.477209 0.0454
GO NEGATIVE REGULATION OF PEPTIDASE ACTIVITY 37 0.431201 1.57793 0.016704
GO DEFENSE RESPONSE TO VIRUS 45 0.430754 1.672151 0.006623
GO REGULATION OF CELL MORPHOGENESIS INVOLVED IN DIFFERENTIATION 36 0.430047 1.589398 0.015801
GO NEGATIVE REGULATION OF PROTEOLYSIS 42 0.429535 1.626882 0.007761
GO REGULATION OF EPITHELIAL CELL MIGRATION 38 0.428413 1.601131 0.01
GO CELL MORPHOGENESIS INVOLVED IN NEURON DIFFERENTIATION 62 0.42811 1.745418 0
GO NEGATIVE REGULATION OF CELL GROWTH 29 0.427938 1.51795 0.030928
GO SECRETORY GRANULE MEMBRANE 31 0.426612 1.521126 0.034091
GO ENDOPEPTIDASE ACTIVITY 52 0.424232 1.670582 0.005405
GO CIRCULATORY SYSTEM PROCESS 66 0.421578 1.711263 0.003188
GO EXTRINSIC APOPTOTIC SIGNALING PATHWAY 32 0.421395 1.507483 0.036405
GO SYNAPTIC MEMBRANE 34 0.420783 1.54822 0.029579
GO I KAPPAB KINASE NF KAPPAB SIGNALING 36 0.420671 1.563163 0.025785
GO VIRAL LIFE CYCLE 43 0.419689 1.603734 0.012876
GO MONOCARBOXYLIC ACID BIOSYNTHETIC PROCESS 34 0.419144 1.544815 0.030405
GO INFLAMMATORY RESPONSE 86 0.417094 1.754796 0
GO HORMONE METABOLIC PROCESS 42 0.416015 1.573177 0.013115
GO MULTI MULTICELLULAR ORGANISM PROCESS 43 0.415174 1.596705 0.01547
GO ZINC ION BINDING 78 0.415007 1.733993 0
GO DEVELOPMENTAL GROWTH 78 0.414935 1.74156 0.003128
GO PROTEIN MATURATION 32 0.413693 1.491014 0.039773
GO LEUKOCYTE MIGRATION 63 0.412795 1.662624 0.00106
GO CELLULAR COMPONENT DISASSEMBLY 46 0.412364 1.603382 0.016234
GO TRANSITION METAL ION BINDING 111 0.411783 1.795982 0
GO LYMPHOCYTE DIFFERENTIATION 47 0.411123 1.590951 0.012088
GO CELL PART MORPHOGENESIS 70 0.410375 1.690601 0.005247
GO POSITIVE REGULATION OF ESTABLISHMENT OF PROTEIN LOCALIZATION 42 0.40872 1.566964 0.019956
GO REGULATION OF PEPTIDASE ACTIVITY 56 0.404615 1.618099 0.007487
GO GATED CHANNEL ACTIVITY 35 0.403899 1.477755 0.046083
GO STEM CELL DIFFERENTIATION 39 0.403838 1.515103 0.030939
GO ORGANIC CYCLIC COMPOUND CATABOLIC PROCESS 49 0.403782 1.566806 0.01652
GO RESPONSE TO VIRUS 56 0.396453 1.587233 0.008538
GO REGULATION OF INNATE IMMUNE RESPONSE 55 0.396233 1.572975 0.005342
GO DEFENSE RESPONSE TO OTHER ORGANISM 64 0.395039 1.609834 0.007361
GO REGULATION OF VASCULATURE 55 0.394666 1.563828 0.018182
199
DEVELOPMENT
GO MEMBRANE ORGANIZATION 76 0.394447 1.660607 0.001041
GO NEGATIVE REGULATION OF HYDROLASE ACTIVITY 54 0.393359 1.575005 0.012862
GO REGULATION OF RESPONSE TO EXTERNAL STIMULUS 93 0.392555 1.662111 0.001037
GO REGULATION OF CELL ACTIVATION 67 0.391265 1.605231 0.005236
GO RESPONSE TO OXYGEN LEVELS 53 0.391191 1.54535 0.02063
GO REGULATION OF PEPTIDE SECRETION 52 0.390138 1.522617 0.022508
GO ACTIVE TRANSMEMBRANE TRANSPORTER ACTIVITY 53 0.389852 1.545007 0.021436
GO RESPONSE TO INTERFERON GAMMA 39 0.388208 1.461169 0.048943
GO PASSIVE TRANSMEMBRANE TRANSPORTER ACTIVITY 49 0.38816 1.52367 0.025527
GO ENDOPLASMIC RETICULUM LUMEN 45 0.387492 1.482298 0.035676
GO REGULATION OF LYMPHOCYTE ACTIVATION 52 0.385666 1.510442 0.019334
GO REGULATION OF NEURON PROJECTION DEVELOPMENT 57 0.385644 1.552919 0.016895
GO SYNAPTIC SIGNALING 57 0.385247 1.543757 0.015038
GO NEGATIVE REGULATION OF MULTICELLULAR ORGANISMAL PROCESS 162 0.384751 1.715059 0.001008
GO MONOCARBOXYLIC ACID METABOLIC PROCESS 67 0.383666 1.557665 0.005269
GO RECEPTOR REGULATOR ACTIVITY 57 0.383656 1.540213 0.022532
GO ORGANIC ACID BIOSYNTHETIC PROCESS 47 0.382345 1.500053 0.03337
GO NEGATIVE REGULATION OF IMMUNE SYSTEM PROCESS 59 0.380784 1.518625 0.024758
GO REGULATION OF SECRETION 89 0.380389 1.604804 0.005118
GO RESPONSE TO BACTERIUM 75 0.379729 1.569967 0.011494
GO NEGATIVE REGULATION OF CELL ADHESION 47 0.379591 1.46074 0.027927
GO REGULATION OF NEURON DIFFERENTIATION 79 0.378575 1.585397 0.005171
GO TISSUE MIGRATION 48 0.376939 1.460763 0.039258
GO REGULATION OF CELL PROJECTION ORGANIZATION 75 0.376254 1.548828 0.011628
GO REGULATION OF APOPTOTIC SIGNALING PATHWAY 47 0.375635 1.459788 0.033696
GO CATION TRANSMEMBRANE TRANSPORTER ACTIVITY 63 0.373926 1.521393 0.020299
GO NEURON DIFFERENTIATION 147 0.373014 1.688197 0
GO TAXIS 77 0.370249 1.548929 0.015756
GO T CELL ACTIVATION 63 0.370225 1.530367 0.023305
GO NEGATIVE REGULATION OF CELL DIFFERENTIATION 91 0.369482 1.574338 0.004119
GO SECRETORY GRANULE 95 0.369293 1.593146 0.003099
GO INTERSPECIES INTERACTION BETWEEN 76 0.369035 1.549359 0.013528
200
ORGANISMS
GO PROTEOLYSIS 174 0.368969 1.670815 0
GO NEURON DEVELOPMENT 115 0.368273 1.622731 0.002041
GO IMMUNE RESPONSE REGULATING SIGNALING PATHWAY 59 0.36504 1.45923 0.027572
GO REGULATION OF CELL CELL ADHESION 61 0.361323 1.472242 0.02766
GO REGULATION OF CELL MORPHOGENESIS 58 0.360867 1.441276 0.041314
GO RESPONSE TO BIOTIC STIMULUS 123 0.359989 1.582911 0.002039
GO ANION TRANSPORT 82 0.359777 1.533712 0.012422
GO CALCIUM ION BINDING 76 0.35963 1.51665 0.017801
GO DEFENSE RESPONSE 208 0.35824 1.642828 0.001001
GO REGULATION OF SYSTEM PROCESS 67 0.357123 1.45438 0.02935
GO PEPTIDE SECRETION 70 0.357055 1.472403 0.019895
GO ENZYME INHIBITOR ACTIVITY 53 0.355563 1.418072 0.047468
GO CYTOKINE MEDIATED SIGNALING PATHWAY 119 0.355429 1.565876 0.001017
GO NEUROGENESIS 181 0.353864 1.606674 0
GO CELL SURFACE 107 0.352718 1.535428 0.007172
GO KINASE BINDING 71 0.352442 1.468891 0.025343
GO REGULATION OF CELL DEVELOPMENT 106 0.352033 1.537332 0.012195
GO AMEBOIDAL TYPE CELL MIGRATION 65 0.351985 1.448039 0.035789
GO CELL BODY 65 0.3507 1.439895 0.043524
GO LYMPHOCYTE ACTIVATION 83 0.349816 1.470141 0.028361
GO REGULATION OF SIGNALING RECEPTOR ACTIVITY 70 0.349332 1.444291 0.034006
GO RESPONSE TO WOUNDING 95 0.345693 1.503966 0.018462
GO REGULATION OF IMMUNE RESPONSE 112 0.34521 1.489822 0.01433
GO TRANSMEMBRANE TRANSPORTER ACTIVITY 132 0.34427 1.530914 0.003043
GO IMMUNE EFFECTOR PROCESS 146 0.344127 1.542292 0.00304
GO CYTOKINE PRODUCTION 102 0.343976 1.481774 0.013265
GO INNATE IMMUNE RESPONSE 119 0.343949 1.502394 0.007202
GO VACUOLE 86 0.343637 1.465123 0.014568
GO REGULATION OF DEFENSE RESPONSE 91 0.343565 1.481777 0.015576
GO CELL MORPHOGENESIS INVOLVED IN DIFFERENTIATION 86 0.343448 1.461047 0.028866
GO NERVOUS SYSTEM PROCESS 110 0.341946 1.505712 0.008138
GO GOLGI MEMBRANE 87 0.341716 1.469958 0.023958
GO SECRETORY VESICLE 114 0.340686 1.474996 0.011202
GO POSITIVE REGULATION OF CELL ADHESION 61 0.340118 1.403317 0.036765
GO EXOCYTOSIS 103 0.339306 1.46334 0.019368
GO POSITIVE REGULATION OF IMMUNE RESPONSE 88 0.33867 1.453083 0.022751
GO NEGATIVE REGULATION OF RESPONSE TO STIMULUS 205 0.338208 1.549161 0.001002
GO NEGATIVE REGULATION OF SIGNALING 173 0.337418 1.502875 0.002022
GO NEGATIVE REGULATION OF 133 0.337235 1.486214 0.005071
201
DEVELOPMENTAL PROCESS
GO RESPONSE TO CYTOKINE 169 0.337159 1.537006 0
GO ION TRANSMEMBRANE TRANSPORTER ACTIVITY 99 0.336881 1.447841 0.023736
GO TRANSPORTER ACTIVITY 154 0.335972 1.513632 0.003021
GO GROWTH 113 0.335854 1.454196 0.020471
GO REGULATION OF NERVOUS SYSTEM DEVELOPMENT 104 0.33569 1.446955 0.026694
GO WOUND HEALING 73 0.335517 1.398873 0.049215
GO ENDOPLASMIC RETICULUM PART 170 0.334757 1.527149 0.002016
GO NEGATIVE REGULATION OF CATALYTIC ACTIVITY 91 0.332704 1.434678 0.028896
GO HYDROLASE ACTIVITY ACTING ON ACID ANHYDRIDES 89 0.331295 1.408093 0.038342
GO REGULATION OF CELLULAR COMPONENT MOVEMENT 135 0.330072 1.459029 0.014242
GO REGULATION OF PROTEOLYSIS 82 0.32977 1.39046 0.046973
GO NUCLEAR OUTER MEMBRANE ENDOPLASMIC RETICULUM MEMBRANE NETWORK 136 0.329528 1.452296 0.016113
GO NEURON PART 156 0.328785 1.470799 0.008065
GO RESPONSE TO ABIOTIC STIMULUS 133 0.3277 1.455192 0.007092
GO POSITIVE REGULATION OF INTRACELLULAR SIGNAL TRANSDUCTION 118 0.325479 1.414209 0.021191
GO POSITIVE REGULATION OF TRANSPORT 112 0.321815 1.408163 0.019527
GO REGULATION OF CELL ADHESION 109 0.319826 1.389924 0.038815
GO CELL PROJECTION ORGANIZATION 151 0.318468 1.451611 0.010091
GO NEGATIVE REGULATION OF MOLECULAR FUNCTION 126 0.317113 1.39259 0.027356
GO ORGANIC ACID METABOLIC PROCESS 121 0.316831 1.379301 0.029323
GO CELL CELL ADHESION 99 0.315904 1.363538 0.045596
GO NEURON PROJECTION 121 0.315453 1.374605 0.031568
GO CARDIOVASCULAR SYSTEM DEVELOPMENT 113 0.314171 1.367531 0.033673
GO CYTOPLASMIC VESICLE PART 162 0.313193 1.412517 0.014141
GO GOLGI APPARATUS PART 115 0.313143 1.36674 0.0409
GO TRANSMEMBRANE TRANSPORT 187 0.313142 1.411586 0.011078
GO GOLGI APPARATUS 183 0.312356 1.418048 0.013078
GO SIGNAL TRANSDUCTION BY PROTEIN PHOSPHORYLATION 111 0.311314 1.370082 0.037717
GO REGULATION OF TRANSPORT 199 0.311207 1.423575 0.007021
GO ORGANONITROGEN COMPOUND CATABOLIC PROCESS 123 0.309866 1.359883 0.039594
GO SIGNALING RECEPTOR BINDING 184 0.308256 1.400347 0.019095
GO SMALL MOLECULE METABOLIC PROCESS 222 0.308192 1.424631 0.007
GO INTRINSIC COMPONENT OF PLASMA 182 0.307087 1.385017 0.01712
202
MEMBRANE
GO SECRETION 200 0.306801 1.401896 0.009027
GO REGULATION OF ANATOMICAL STRUCTURE MORPHOGENESIS 156 0.306351 1.367079 0.019173
GO IDENTICAL PROTEIN BINDING 186 0.303694 1.394577 0.015091
GO POSITIVE REGULATION OF SIGNALING 227 0.303549 1.409608 0.005015
GO REGULATION OF RESPONSE TO STRESS 164 0.303474 1.37639 0.01506
GO REGULATION OF CELL DIFFERENTIATION 229 0.298762 1.381317 0.009018
GO ION TRANSPORT 191 0.298041 1.367587 0.022066
GO ENDOPLASMIC RETICULUM 230 0.297184 1.379726 0.014042
GO WHOLE MEMBRANE 186 0.297139 1.359234 0.03009
GO BIOLOGICAL ADHESION 187 0.296793 1.349621 0.023023
GO MOLECULAR FUNCTION REGULATOR 179 0.296147 1.356645 0.022133
GO REGULATION OF INTRACELLULAR SIGNAL TRANSDUCTION 212 0.290747 1.322498 0.029146
GO REGULATION OF IMMUNE SYSTEM PROCESS 187 0.289403 1.32808 0.037149
GO APOPTOTIC PROCESS 221 0.286938 1.316483 0.031093
GO POSITIVE REGULATION OF MULTICELLULAR ORGANISMAL PROCESS 230 0.285401 1.322074 0.02505
GO PROTEIN PHOSPHORYLATION 228 0.281398 1.306697 0.023046
GO CHROMOSOME 65 -0.24549 -1.48646 0
GO PROTEIN HETERODIMERIZATION ACTIVITY 60 -0.25648 -1.59191 0
GO CHROMOSOME ORGANIZATION 69 -0.26622 -1.70404 0.020833
GO CHROMATIN 46 -0.28284 -1.61245 0.037975
GO EPIDERMAL CELL DIFFERENTIATION 32 -0.3013 -1.51752 0.024793
GO NUCLEAR CHROMOSOME 45 -0.31441 -1.86593 0
GO DIGESTIVE SYSTEM DEVELOPMENT 20 -0.31951 -1.44865 0.045714
GO ORGANIC ACID TRANSMEMBRANE TRANSPORT 23 -0.32554 -1.56623 0.029586
GO REGULATION OF CHROMOSOME ORGANIZATION 20 -0.32851 -1.48071 0.031847
GO RNA METABOLIC PROCESS 86 -0.34762 -2.40766 0
GO REGULATION OF EPITHELIAL CELL DIFFERENTIATION 21 -0.34878 -1.54034 0.039773
GO MALE GAMETE GENERATION 29 -0.35003 -1.70536 0.006993
GO GENE SILENCING BY RNA 21 -0.36279 -1.58384 0.03352
GO MESODERM DEVELOPMENT 19 -0.37763 -1.57562 0.041451
GO REGULATION OF DNA METABOLIC PROCESS 16 -0.3806 -1.54878 0.032787
GO POSITIVE REGULATION OF MYELOID CELL DIFFERENTIATION 16 -0.38795 -1.60227 0.033333
GO OXIDOREDUCTASE ACTIVITY ACTING ON CH OH GROUP OF DONORS 19 -0.38807 -1.66139 0.012121
GO CHROMATIN ASSEMBLY OR DISASSEMBLY 21 -0.39308 -1.72442 0.030303
GO REGULATION OF NUCLEOBASE CONTAINING COMPOUND METABOLIC PROCESS 30 -0.41285 -2.09342 0
203
GO UBIQUITIN LIKE PROTEIN LIGASE ACTIVITY 15 -0.41406 -1.6046 0.027027
GO CELLULAR RESPONSE TO REACTIVE OXYGEN SPECIES 16 -0.41808 -1.69832 0.009615
GO AMINO ACID TRANSMEMBRANE TRANSPORT 18 -0.41848 -1.73785 0.015
GO METHYLATION 25 -0.45065 -2.18152 0
GO RIBONUCLEOPROTEIN COMPLEX BIOGENESIS 21 -0.46656 -2.02903 0
GO MACROMOLECULE METHYLATION 17 -0.47267 -2.0032 0
GO CHROMATIN ASSEMBLY 19 -0.48615 -2.09289 0
GO DNA PACKAGING 19 -0.48615 -2.06391 0
GO MEGAKARYOCYTE DIFFERENTIATION 18 -0.49739 -2.02943 0
GO DNA CONFORMATION CHANGE 21 -0.50933 -2.28077 0
GO CATALYTIC ACTIVITY ACTING ON RNA 27 -0.51663 -2.55498 0
GO PROTEIN DNA COMPLEX SUBUNIT ORGANIZATION 23 -0.53245 -2.3819 0
GO NUCLEOSOME ORGANIZATION 18 -0.55132 -2.40781 0
GO PROTEIN DNA COMPLEX 28 -0.5582 -2.77188 0
GO REGULATION OF GENE SILENCING 16 -0.56221 -2.29416 0
GO NCRNA PROCESSING 18 -0.58002 -2.39072 0
GO REGULATION OF MEGAKARYOCYTE DIFFERENTIATION 15 -0.59517 -2.32157 0
GO NCRNA METABOLIC PROCESS 27 -0.62592 -3.11261 0
GO DNA PACKAGING COMPLEX 24 -0.66429 -3.02316 0
GO TELOMERE ORGANIZATION 16 -0.69624 -2.78713 0
GO TRNA METABOLIC PROCESS 15 -0.70427 -2.7583 0
204
Appendix A-6: RNA-sequencing of the TRβ-Regulated Transcriptome Reveals a
Transcription Factor Network.
Appendix A-6. A) Chromatin Enrichment Analysis (ChEA) of differential expression clusters was
performed to evaluate which transcription factor networks were overrepresented in each cluster. B)
Multiple transcription factors elucidated by ChEA were also differentially expressed.
205
Appendix A-7: TRβ Regulates Expression of lncRNAs.
Appendix A-7. A) A pairwise comparison between SW-EV-T3 and SW-TRβ-T3 revealed differential
expression of both mRNAs and lncRNAs (log2(foldchange)>2 and p<0.05). A total of 350 mRNAs and 28
lncRNAs were differentially expressed. B) Expression levels of the differentially expressed lncRNAs in
transcripts per million reads.
206
Appendix A-8: TRβ Regulates Key Cell Cycle Regulators.
Appendix A-8. RNA-sequencing data revealed statistically significant increase of the anti-proliferative
gene CDKN1A and repression the pro-proliferative gene MYC. n=3, ** p<0.01, *** p<0.001
207
Appendix A-9: TRβ Induced a more Differentiated Phenotype.
Appendix A-9. RNA-sequencing data revealed statistically significant increase of the epithelial marker
CDH1 and repression of the mesenchymal marker VIM. Although SNAI1 was expressed, no significant
changes in expression were observed. n=3, * p<0.05, ***** p<0.0001
208
Appendix A-10: Reintroduction of TRβ altered Thyroid Differentiation Markers.
Appendix A-10. Thyroid differentiation markers were significantly induced in SW-TRβ cells treated with
T3 (n=3, * p<0.05).
209
Appendix A-11: Reintroduction of TRβ Increased Expression of interferon/JAK1/STAT1
Pathway Effectors.
Appendix A-11. A-C) Following 24 hours of treatment with T3 or vehicle, protein levels in SW-EV and
SW-TRβ were assessed by western blot. TRβ induced expression of JAK1 and STAT1. Representative
western blot depicted. (*p<0.05, n=6) D) STAT1 and IRF1 regulated genes were induced upon
overexpression of TRβ and T3 treatment. (n=6, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001).
210
Appendix B
Supplemental Materials for Chapter 3
211
Appendix B-1: Primers and Oligonucleotides
Oligonucleotide Sequence Purpose
VEGFA Forward CCTTGCTGCTCTACCTCCAC qPCR
VEGFA Reverse CCATGAACTTCACCACTTTCG qPCR
THRA Forward AGGTCACCAGATGGAAGCG qPCR
THRA Reverse AGTGATAACCAGTTGCCTTGTC qPCR
GAPDH Forward ATGTTCGTCATGGGTGTGAA qPCR
GAPDH Reverse TGTGGTCATGAGTCCTTCCA qPCR
RUNX2 Forward CAGCCCCAACTTCCTGTG qPCR
RUNX2 Reverse CCGGAGCTCAGCAGAATAAT qPCR
MMP9 Forward CCTGGAGACCTGAGAACCATC qPCR
MMP9 Reverse CCACCCGAGTGTAACCATAGC qPCR
RUNX2 P1 Forward GGACAGCAAGAAGTCTCTGGTT qPCR
RUNX2 P1 Reverse GATGCCATAGTCCCTCCTTTTT qPCR
Cyclin D1 Forward GCTGCGAAGTGGAAACCATC qPCR
Cyclin D1 Reverse CCTCCTTCTGCACACATTTGAA qPCR
THRB Forward GGCGCAGCACGTTGAAAAAT qPCR
THRB Reverse CACATCATCVATGGTCCAGATGG qPCR
RUNX2 P1 Forward GATCTCACTTTACTTAAGAGTACTGTGAGGTCACAAACCACATGATTCTGCCTCTCCAGTAAA
DNA Pulldown
RUNX2 P1 Reverse GATCTTTACTGGAGAGGCAGAATCATGTGGTTTGTGACCTCACAGTACTCTTAAGTAAAGTGA
DNA Pulldown
RUNX2 P1 Mutant Forward GATCTCACTTTACTTAAGAGTACTGTGATTTCGCAAACCACATGATTCTGCCTCTCCAGTAAA
DNA Pulldown
RUNX2 P1 Mutant Reverse GATCTTTACTGGAGAGGCAGAATCATGTGGTTTGCGAAATCACAGTACTCTTAAGTAAAGTGA
DNA Pulldown
THRA Cloning Forward ACAAAAGCTTATGGAACAGAAGCCAAGCAAGG
THRA Cloning
THRA Cloning Reverse CACAGGATCCTTAGACTTCCTGATCCTCAAAG
THRA Cloning
212
Appendix B-2: Antibodies
Antibody Manufacturer Target Purpose
MA5-15739 Thermo Fisher Scientific β-Actin Immunoblot
SC-390715 Santa Cruz Biotechnology
RUNX2 Immunoblot
PA1-211A Thermo Fisher Scientific TRα Immunoblot
MA1-216 Thermo Fisher Scientific TRβ Immunoblot
AB53170 Abcam TRβ Immunoblot
PA5-29684 Thermo Fisher Scientific TRβ ChIP
31887 Pierce Scientific N/A (IgG) ChIP
213
Appendix B-3: Repression of RUNX2 by Thyroid Hormone
Appendix A-3. Breast cell lines MCF10A and MDA-MB-231 were treated for 24 hours with 10-8 M T3
and RUNX2 expression was measured by immunoblot. T3 significantly repressed RUNX2 expression in
both cell lines.
214
Appendix C
Supplemental Materials for Chapter 4
215
Appendix C-1: Mycoplasma PCR Primers.
Forward Primers Reverse Primers
CGCCTGAGTAGTACGTTCGC GCGGTGTGTACAAGACCCGA
CGCCTGAGTAGTACGTACGC GCGGTGTGTACAAAACCCGA
TGCCTGAGTAGTACATTCGC GCGGTGTGTACAAACCCCGA
TGCCTGGGTAGTACATTCGC
CGCCTGGGTAGTACATTCGC
CGCCTGAGTAGTATGCTCGC
216
Appendix C-2: Reintroduction of TRβ to MDA-MB-468 cells.
Appendix C-2. MDA-MB-468 cells were transfected with either an empty vector (EV) or a vector that
expresses wild type TRβ. Overexpression of TRβ was confirmed by western blot.
217
Appendix C-3: Significantly Altered Hallmark and Gene Ontology Gene Set Enrichment
Analysis Pathways between 468-EV-T3 and 468-TRβ-T3.
PATHWAY NAME SIZE ES NES Nominal p-value
HALLMARK INFLAMMATORY RESPONSE 22 -0.37732 -1.94494 0.003185
HALLMARK EPITHELIAL MESENCHYMAL TRANSITION 28 -0.32683 -1.87006 0.003663
HALLMARK TNFA SIGNALING VIA NFKB 21 -0.37503 -1.87435 0.00641
HALLMARK UV RESPONSE DN 18 -0.38381 -1.82522 0.008427
GO POSITIVE REGULATION OF ORGANELLE ORGANIZATION 26 0.41754 1.846908 0.006739
GO CELLULAR LIPID METABOLIC PROCESS 47 0.334884 1.760693 0.009235
GO POSITIVE REGULATION OF IMMUNE RESPONSE 35 0.358501 1.781869 0.009736
GO MEMBRANE ORGANIZATION 32 0.371835 1.770413 0.010825
GO REGULATION OF VESICLE MEDIATED TRANSPORT 33 0.352438 1.723024 0.012195
GO PASSIVE TRANSMEMBRANE TRANSPORTER ACTIVITY 21 0.407297 1.720896 0.014793
GO POSITIVE REGULATION OF RNA BIOSYNTHETIC PROCESS 47 0.312377 1.65367 0.016667
GO REGULATION OF CELL MORPHOGENESIS 31 0.365325 1.745347 0.017931
GO IMMUNE RESPONSE REGULATING SIGNALING PATHWAY 24 0.394224 1.697102 0.019971
GO POSITIVE REGULATION OF DEFENSE RESPONSE 27 0.372784 1.67321 0.022472
GO ENDOCYTOSIS 26 0.37337 1.651849 0.024793
GO LIPID METABOLIC PROCESS 64 0.282495 1.667814 0.025063
GO GATED CHANNEL ACTIVITY 15 0.456657 1.680443 0.025185
GO ACTIVATION OF INNATE IMMUNE RESPONSE 19 0.425724 1.735362 0.0279
GO REGULATION OF IMMUNE RESPONSE 48 0.304758 1.640261 0.030223
GO ACTIVATION OF IMMUNE RESPONSE 25 0.367587 1.62691 0.036111
GO REGULATION OF ANATOMICAL STRUCTURE MORPHOGENESIS 67 0.266734 1.595238 0.037783
GO REGULATION OF INNATE IMMUNE RESPONSE 24 0.389231 1.66464 0.038407
GO POSITIVE REGULATION OF CELLULAR COMPONENT ORGANIZATION 61 0.272602 1.56971 0.038557
GO FATTY ACID METABOLIC PROCESS 16 0.41946 1.611667 0.047267
GO MEMBRANE REGION 22 0.357972 1.539507 0.047955
GO VASCULAR PROCESS IN CIRCULATORY SYSTEM 22 0.370112 1.566991 0.048023
GO REGULATION OF CELL ADHESION 46 0.283399 1.518403 0.048969
218
GO IMPORT INTO CELL 34 0.314766 1.541387 0.049007
GO SKIN DEVELOPMENT 34 -0.58441 -3.50755 0
GO CORNIFICATION 19 -0.7207 -3.49877 0
GO KERATINIZATION 20 -0.69499 -3.46765 0
GO EPIDERMAL CELL DIFFERENTIATION 24 -0.66195 -3.43124 0
GO INTERMEDIATE FILAMENT CYTOSKELETON 19 -0.69527 -3.3382 0
GO EPIDERMIS DEVELOPMENT 33 -0.54663 -3.31345 0
GO EPITHELIAL CELL DIFFERENTIATION 54 -0.44889 -3.14855 0
GO CYTOSKELETAL PART 50 -0.41402 -2.89313 0
GO SUPRAMOLECULAR COMPLEX 44 -0.40219 -2.85011 0
GO EPITHELIUM DEVELOPMENT 79 -0.3363 -2.63464 0
GO POLYMERIC CYTOSKELETAL FIBER 29 -0.46637 -2.58778 0
GO STRUCTURAL MOLECULE ACTIVITY 56 -0.33447 -2.51667 0
GO NEGATIVE REGULATION OF PEPTIDASE ACTIVITY 22 -0.44831 -2.29491 0
GO NEGATIVE REGULATION OF HYDROLASE ACTIVITY 30 -0.37157 -2.14747 0
GO ENDOPEPTIDASE REGULATOR ACTIVITY 16 -0.46235 -2.10286 0
GO AGING 19 -0.42386 -2.10265 0.003205
GO VIRAL LIFE CYCLE 18 -0.44284 -2.08896 0
GO INTERSPECIES INTERACTION BETWEEN ORGANISMS 30 -0.37515 -2.07692 0
GO REGULATION OF ENDOTHELIAL CELL MIGRATION 20 -0.40504 -2.0139 0.006536
GO NEGATIVE REGULATION OF PROTEOLYSIS 26 -0.36542 -2.00984 0
GO COAGULATION 20 -0.40744 -2.0017 0
GO NEGATIVE REGULATION OF LOCOMOTION 23 -0.39279 -1.9916 0.010101
GO RESPONSE TO BIOTIC STIMULUS 71 -0.25196 -1.97639 0
GO NEGATIVE REGULATION OF CATALYTIC ACTIVITY 48 -0.28653 -1.97566 0.009091
GO NEGATIVE REGULATION OF CELL MOTILITY 22 -0.37524 -1.91946 0.006711
GO PEPTIDASE REGULATOR ACTIVITY 19 -0.39199 -1.90271 0.013514
GO REGULATION OF NEUROTRANSMITTER LEVELS 17 -0.42162 -1.88871 0
GO POSITIVE REGULATION OF VASCULATURE DEVELOPMENT 25 -0.34693 -1.85027 0.006431
GO BLOOD VESSEL ENDOTHELIAL CELL MIGRATION 15 -0.42133 -1.84962 0.01791
GO RESPONSE TO VIRUS 24 -0.35377 -1.84828 0.010563
GO POSITIVE REGULATION OF ENDOTHELIAL CELL MIGRATION 17 -0.40436 -1.84612 0.031546
GO CELL JUNCTION ASSEMBLY 23 -0.35777 -1.83409 0.006969
219
GO REGULATION OF SYMBIOSIS ENCOMPASSING MUTUALISM THROUGH PARASITISM 16 -0.41376 -1.81229 0.008746
GO ENZYME INHIBITOR ACTIVITY 25 -0.33106 -1.80354 0.003344
GO TISSUE MIGRATION 29 -0.31383 -1.80289 0.013201
GO NEGATIVE REGULATION OF MOLECULAR FUNCTION 57 -0.24111 -1.80152 0.009434
GO REGULATION OF EPITHELIAL CELL MIGRATION 24 -0.34598 -1.80133 0.022727
GO ENDOTHELIAL CELL MIGRATION 23 -0.35127 -1.77876 0.014235
GO DEFENSE RESPONSE TO VIRUS 17 -0.38976 -1.76128 0.018127
GO NEGATIVE REGULATION OF TRANSCRIPTION BY RNA POLYMERASE II 29 -0.3079 -1.75908 0.016
GO NEGATIVE REGULATION OF RESPONSE TO EXTERNAL STIMULUS 25 -0.32238 -1.75072 0.02807
GO DEFENSE RESPONSE 104 -0.20076 -1.74875 0
GO NEGATIVE REGULATION OF TRANSPORT 30 -0.29859 -1.72403 0.01581
GO POSITIVE REGULATION OF EPITHELIAL CELL MIGRATION 18 -0.37175 -1.71627 0.024768
GO REGULATION OF MULTI ORGANISM PROCESS 28 -0.30311 -1.69656 0.022951
GO AXON 33 -0.28497 -1.69618 0.015385
GO NEGATIVE REGULATION OF CELL DIFFERENTIATION 31 -0.28297 -1.68274 0.02214
GO CELL JUNCTION ORGANIZATION 26 -0.31073 -1.68257 0.025926
GO ENZYME REGULATOR ACTIVITY 51 -0.23892 -1.67848 0.018182
GO REGULATION OF PEPTIDASE ACTIVITY 32 -0.27741 -1.67461 0.019531
GO NEGATIVE REGULATION OF PROTEIN METABOLIC PROCESS 61 -0.22471 -1.6743 0.010753
GO HEPARIN BINDING 17 -0.36739 -1.67375 0.027027
GO REGULATION OF HYDROLASE ACTIVITY 66 -0.22101 -1.66495 0.010309
GO REGULATION OF TRANSMEMBRANE RECEPTOR PROTEIN SERINE THREONINE KINASE SIGNALING PATHWAY 18 -0.34998 -1.64962 0.024316
GO TRANSMEMBRANE RECEPTOR PROTEIN SERINE THREONINE KINASE SIGNALING PATHWAY 23 -0.31389 -1.61431 0.030612
GO DEPHOSPHORYLATION 15 -0.37662 -1.61256 0.043478
GO POSITIVE REGULATION OF DEVELOPMENTAL PROCESS 98 -0.1883 -1.60936 0.019481
GO RESPONSE TO WOUNDING 42 -0.23897 -1.595 0.03861
GO NEGATIVE REGULATION OF DEVELOPMENTAL PROCESS 47 -0.233 -1.56332 0.030172
GO REGULATION OF BODY FLUID LEVELS 39 -0.24598 -1.55248 0.038911
GO RESPONSE TO RADIATION 17 -0.33301 -1.54114 0.047945
GO MOLECULAR FUNCTION REGULATOR 102 -0.17351 -1.52187 0.026316
220
GO RESPONSE TO DRUG 57 -0.21043 -1.48429 0.049774
GO NEGATIVE REGULATION OF RESPONSE TO STIMULUS 90 -0.17652 -1.45039 0.041916
221
Appendix C-3: Significantly Altered Gene Ontology Gene Set Enrichment Analysis
Pathways between 468-EV-T3 and 468-TRβ-T3 Using Shared Differentially Expressed
Genes.
PATHWAY NAME SIZE ES NES Nominal p-value
GO PEPTIDASE ACTIVITY 18 0.573847 1.72028 0.009153
GO RESPONSE TO GROWTH FACTOR 15 0.566824 1.630316 0.019608
GO BEHAVIOR 18 0.532005 1.582079 0.020478
GO REGULATION OF PROTEOLYSIS 15 0.529535 1.535544 0.034158
GO REGULATION OF NEURON DIFFERENTIATION 18 0.522837 1.574351 0.017202
GO RESPONSE TO BACTERIUM 18 0.517076 1.529227 0.030033
GO CELL SURFACE 21 0.508689 1.578421 0.02718
GO REGULATION OF SECRETION 22 0.508067 1.601615 0.023179
GO POSITIVE REGULATION OF TRANSPORT 25 0.50146 1.598127 0.017699
GO REGULATION OF RESPONSE TO STRESS 30 0.5014 1.665553 0.005348
GO SECRETORY GRANULE 23 0.497511 1.55795 0.030668
GO INFLAMMATORY RESPONSE 22 0.493079 1.534242 0.023077
GO REGULATION OF PROTEIN LOCALIZATION 22 0.48783 1.513206 0.034483
GO ENZYME LINKED RECEPTOR PROTEIN SIGNALING PATHWAY 19 0.487414 1.48511 0.045913
GO PROTEOLYSIS 39 0.484836 1.680512 0.006336
GO PLASMA MEMBRANE REGION 28 0.482214 1.610188 0.011879
GO RESPONSE TO ABIOTIC STIMULUS 27 0.477453 1.563998 0.016287
GO NERVOUS SYSTEM PROCESS 27 0.477135 1.552331 0.028078
GO RESPONSE TO ENDOGENOUS STIMULUS 35 0.474273 1.598648 0.019792
GO REGULATION OF NERVOUS SYSTEM DEVELOPMENT 24 0.47253 1.488514 0.044469
GO SECRETORY VESICLE 27 0.471191 1.520926 0.025974
GO RESPONSE TO HORMONE 23 0.467318 1.464294 0.043285
GO RESPONSE TO DRUG 28 0.463248 1.521577 0.031049
GO RESPONSE TO LIPID 32 0.44958 1.5278 0.02234
GO REGULATION OF INTRACELLULAR SIGNAL TRANSDUCTION 45 0.429039 1.515355 0.024819
GO REGULATION OF TRANSPORT 37 0.423213 1.465962 0.046561
GO NEGATIVE REGULATION OF RESPONSE TO STIMULUS 42 0.415829 1.465677 0.039501
GO NEURON DIFFERENTIATION 39 0.414326 1.463045 0.048168
GO NEGATIVE REGULATION OF SIGNALING 33 0.411966 1.401268 0.049841
GO SECRETION 47 0.409263 1.468127 0.031217
GO PROTEIN HETERODIMERIZATION ACTIVITY 23 -0.33414 -1.56859 0
GO CELLULAR PROTEIN CONTAINING COMPLEX ASSEMBLY 21 -0.3407 -1.61937 0.018349
GO CHROMATIN ORGANIZATION 23 -0.51729 -2.46573 0
222
GO CHROMOSOME ORGANIZATION 24 -0.53515 -2.62044 0
GO PROTEIN DNA COMPLEX 19 -0.78795 -3.67323 0
GO DNA PACKAGING COMPLEX 18 -0.83713 -3.70015 0
223
Appendix C-4: Significantly Altered Gene Ontology Gene Set Enrichment Analysis
Pathways between SW-EV-T3 and SW-TRβ-T3 Using Shared Differentially Expressed
Genes.
PATHWAY NAME SIZE ES NES Nominal p-value
GO PEPTIDASE ACTIVITY 18 0.578812 2.075959 0.002304
GO POSITIVE REGULATION OF CATABOLIC PROCESS 15 0.56707 1.950009 0
GO INFLAMMATORY RESPONSE 22 0.531233 2.058922 0.001129
GO CYTOKINE PRODUCTION 24 0.50329 1.965671 0.003275
GO REGULATION OF IMMUNE RESPONSE 24 0.500027 1.966478 0
GO REGULATION OF CELLULAR CATABOLIC PROCESS 18 0.482722 1.787873 0.01049
GO RESPONSE TO BACTERIUM 18 0.478485 1.760672 0.008102
GO ORGANOPHOSPHATE METABOLIC PROCESS 15 0.471951 1.619419 0.031991
GO POSITIVE REGULATION OF SECRETION 15 0.471343 1.643262 0.028037
GO REGULATION OF DEFENSE RESPONSE 16 0.46267 1.641106 0.027381
GO INNATE IMMUNE RESPONSE 19 0.460688 1.715514 0.019653
GO REGULATION OF CATABOLIC PROCESS 20 0.447717 1.70786 0.013857
GO POSITIVE REGULATION OF IMMUNE RESPONSE 19 0.446869 1.676469 0.020833
GO RESPONSE TO BIOTIC STIMULUS 22 0.437278 1.688847 0.022198
GO DEFENSE RESPONSE 39 0.435436 1.921073 0.001063
GO NEGATIVE REGULATION OF IMMUNE SYSTEM PROCESS 17 0.431539 1.567853 0.04
GO REGULATION OF RESPONSE TO EXTERNAL STIMULUS 19 0.430565 1.603309 0.039306
GO PROTEOLYSIS 39 0.426857 1.883387 0.002139
GO IMMUNE EFFECTOR PROCESS 29 0.411864 1.688592 0.010834
GO REGULATION OF RESPONSE TO STRESS 30 0.406382 1.715006 0.010823
GO NEGATIVE REGULATION OF MULTICELLULAR ORGANISMAL PROCESS 38 0.402177 1.777883 0.005313
GO POSITIVE REGULATION OF IMMUNE SYSTEM PROCESS 26 0.397518 1.569866 0.042999
GO RESPONSE TO ABIOTIC STIMULUS 27 0.39345 1.599698 0.03352
GO POSITIVE REGULATION OF TRANSPORT 25 0.387458 1.534851 0.045606
GO ORGANONITROGEN COMPOUND CATABOLIC PROCESS 27 0.38228 1.570028 0.039735
GO NEGATIVE REGULATION OF RNA BIOSYNTHETIC PROCESS 31 -0.22538 -1.55937 0.035294
GO CATION TRANSMEMBRANE TRANSPORT 15 -0.34706 -1.65136 0.018405
GO NUCLEAR CHROMATIN 21 -0.36151 -2.11366 0
GO NUCLEAR CHROMOSOME 21 -0.36151 -2.02312 0.007692
GO MYELOID CELL DIFFERENTIATION 17 -0.36896 -1.8677 0.019231
224
GO CHROMATIN 27 -0.37138 -2.3174 0
GO RNA BINDING 16 -0.37834 -1.92114 0
GO CHROMOSOME 30 -0.3803 -2.56913 0
GO CELLULAR PROTEIN CONTAINING COMPLEX ASSEMBLY 21 -0.38587 -2.22366 0
GO PROTEIN HETERODIMERIZATION ACTIVITY 23 -0.41697 -2.5619 0
GO CHROMATIN ORGANIZATION 23 -0.53561 -3.03361 0
GO PROTEIN DNA COMPLEX 19 -0.70431 -3.69231 0
GO DNA PACKAGING COMPLEX 18 -0.83062 -4.52266 0
225
Appendix C-5: Gene Sets Regulating Chromatin Structure and Protein Degradation Are
Regulated by TRβ in Breast and Thyroid Cancer Cells.
Appendix C-5. Gene Ontology pathways altered by TRβ overexpression included chromatin remodeling
and proteolytic genes in A) MDA-MB-468 and B) SW1736 cells.
226
Appendix D
List of Abbreviations
227
2-(1,8-Naphthyridin-2-ly)phenol (2-NP)
3-Phosphoinositide Dependent Protein Kinase-1 (PDK1)
Anaplastic Thyroid Cancer (ATC)
Androgen Receptor (AR)
Area Under the Curve (AUC)
Aromatase Inhibitor (AI)
Chromatin Immunoprecipitation (ChIP)
Chromatin Immunoprecipitation Enrichment Analysis (ChEA)
Diacylglycerol (DAG)
Differentially Expressed Gene (DEG)
DNA-Binding Domain (DBD)
Endocrine Disrupting Chemical (EDC)
Epidermal Growth Factor (EGF)
Epithelial to Mesenchymal Transition (EMT)
Estrogen Receptor (ER)
Fibroblastic Growth Factor (FGF)
Follicular Thyroid Cancer (FTC)
Gene Set Enrichment Analysis (GSEA)
Guanidine Diphosphate (GDP)
Guanidine Triphosphate (GTP)
Heat Shock Proteins (HSP)
Hepatocellular Carcinoma (HCC)
Inositol 1,4,5-Trisphosphate (IP3)
228
Integrin-Linked Kinase (ILK)
Ligand-Binding Domain (LBD)
Long-Noncoding RNA (LncRNA)
Mammalian Target of Rapamycin Complex 2 (MTORC2)
Matrix Metalloprotease (MMP)
Mitogen Activated Protein Kinase (MAPK)
Nuclear Export Signals (NES)
Nuclear Hormone Receptor (NR)
Nuclear Localization Signal (NLS)
Nuclear Receptor Coactivator 1 (NCOA1)
Nuclear Receptor Co-Repressor (NCOR)
Nucleotide Excision Repair (NER)
Papillary Thyroid Cancer (PTC)
Phosphatase and Tensin Homolog (PTEN)
Phosphatidylinositol (3,4,5)-Trisphosphate (PIP3)
Phosphatidylinositol 4,5-Bisphosphate (PIP2)
Phosphoinositide 3-Kinase (PI3K)
Phospholipase C (PLC)
Poly (ADP-Ribose) Polymerase (PARP)
Poly (ADP-Ribose) Polymerase 1 (PARP1)
Poorly Differentiated Thyroid Cancer (PDTC)
Principle Component Analysis-Based Iterative PAM50 Subtyping (PCA-PAM50)
Progesterone Receptor (PR)
229
Protein Kinase C (PKC)
Quantitative Real-Time PCR (qRT-PCR)
Radioactive Iodide (RAI)
Receptor Tyrosine Kinase (RTK)
Retinoid X Receptor (RXR)
Selective Estrogen Receptor Modulator (SERM)
Silencing Mediator for Retinoid or Thyroid-Hormone Receptors (SMRT)
Small Ubiquitin-Like Modifier (SUMO)
Sodium-Iodide Symporter (NIS)
Succinate Dehydrogenase Complex (SDHx)
Thyroid Differentiation Score (TDS)
Thyroid Hormone Receptor (TR)
Thyroid Hormone Receptor Alpha (TRα)
Thyroid Hormone Receptor Beta (TRβ)
Thyroid Hormone Response Element (TRE)
Thyroid Stimulating Hormone (TSH)
Thyroxine (T4)
Triiodothyronine (T3)
Vitamin D Receptor Interacting Protein/Thyroid Hormone Receptor-Associated Protein
(DRIP/TRAP)