Upload
annabelle-smith
View
216
Download
3
Tags:
Embed Size (px)
Citation preview
Everything in you is made of or by proteins!
Protein Examples
Hemoglobin is a protein in your blood that transports oxygen
Collagen is a proteins that makes your cartilage and tendons
Keratin is a protein that makes up your hair & fingernails
Enzymes that break down your food are proteins
DNA is like a code that instructs the cell to make proteins
A gene is a sequence of DNA that carries the code for making one protein
RNA is like DNA except…
DNA – Deoxyribonucleic acid
RNA – Ribonucleic Acid
* 2 strands vs. 1 strand
* Thymine vs. Uracil (others are the same)
* Deoxyribose vs. Ribose
* Nucleus vs. Cytoplasm
Nitrogen Bases
Sugars
&
Phosphates
RNA DNA
Types of RNA
1. mRNA – “messenger” RNA- Carries copies of instructions from DNA for
making amino acids into proteins
2. tRNA – “transfer” RNA- Transfers each amino acid to the ribosome as
specified by the code on mRNA
3. rRNA – “ribosomal” RNA- Makes up part of the ribosome, where
proteins are made
• Both DNA and RNA are involved in protein synthesis
2 parts of protein synthesis:1. Transcription – DNA is converted to RNA
- Occurs in the nucleus
2. Translation – RNA is converted to a protein
- Occurs in the cytoplasm
• Transcription (the 1st part of Protein Synthesis)
• Converts DNA to RNA
• DNA (in the nucleus) needs to send a code to the ribosome (in the cytoplasm)
• Problem: DNA can’t fit through the nuclear pores
• A special “messenger” is used to copy and carry the code…
Transcription Cont’d
• messenger RNA (mRNA) goes into the nucleus and copies the DNA
• Uses enzyme – RNA Polymerase
• DNA AGGTATCGCAGATCGACAGATC
•RNA
UCCAUAGCGUCUAGCUGUCUAG
• The next step is that mRNA moves from the nucleus to the cytoplasm and to the ribosome
Translation (2nd part of protein synthesis)
• Amino acids – building blocks of proteins, carried to
ribosomes by ______________
• Polypeptides – long chains of ____________
• Codon – group of ____ nucleotide bases in mRNA which
carries code for making _______________________
• Ex:
• Anticodon – group of _____ nucleotide bases in tRNA which
is complementary to one ___________________
tRNAAmino Acids
3
3
ONE amino acid
codon
AUG - Methionine
Translation Cont’d
• ____________ attaches to the ribosome
• ____________ carries amino acids to the ribosome and matches them to the coded mRNA message (codon)
• Amino acids bond together, forming a long chain called a ____________________
• Finally, polypeptides fold into various types of proteins and there you have it!
mRNA
tRNA
Polypeptide chain
Translation (the 2nd part of Protein Synthesis)
• Translation – a process that converts mRNA into a protein
• Occurs on the ribosome in the cytoplasm of a cell
• ______________ - building blocks of proteins; join together into long chains called polypeptides
• ____________ - a sequence of 3 bases on mRNA that codes for a single amino acid
• _____________ – sequence of 3 bases on tRNA that is complementary to one mRNA codon
“UCU” is the codon that makes an amino acid called SERINE
Amino acids
Codon
Anticodon
•The tRNA lines up with 3 bases in mRNA (codon)
•tRNA anticodon GAA
•mRNA codon CUU
• Another form of RNA called transfer RNA (tRNA) carries amino acids to the ribosome and matches them to the coded mRNA message
mRNA attaches to the ribosome
•tRNA drops off the amino acid in the correct spot
Any change in the DNA structure (specifically the order of nitrogen bases) is a mutation.
Mutations can be helpful, harmful, or neutral.
Helpful – can create diversity in a population
Harmful – can cause things like cancer
Neutral – can have absolutely no effect at all
A mutagen is something that causes mutations in the DNA (for example: smoking, radiation from the sun etc)
Slooze Worm
An insertion mutation is when a nitrogen base is added to the existing DNA
A deletion mutation is when a nitrogen base is subtracted from the DNA
A substitution mutation is when one nitrogen base is put in place of another.
If our DNA was AATTGGCC
An insertion would be AATTAGGCC
A deletion would be AATGGCC
A substitution would be AAATGGCC
Gene Sequencing – Determining the order of nucleotide bases within a gene
DNA Fingerprinting – technique used in criminal investigations. DNA Fingerprinting takes the DNA out of a cell and separates it. This will allow investigators to distinguish body cells of different individuals (since they are unlikely to have the same DNA)
Cloning – take the DNA out of one of your cells then take the DNA out of a zygote (fertilized egg). Put the DNA from your cell into the zygote.
Genetic engineering is the process of moving genes from the chromosomes of one organism to those of another organism.
Recombinant DNA is formed by joining DNA
molecules.from two different organisms
What would represent the strand of DNA from which the mRNA strand in the diagram was made?
A.CUCAAGUGCUUCB.GAGUUCACGAAGC.GAGTTCACGAAGD.AGACCTGTAGGA
What is the amino acid sequence in the portion of the protein molecule coded for by the piece of mRNA shown in the diagram?
A. Ser-Tyr-Arg-GlyB.Leu-Lys-Cys-PheC.Val-Asp-Pro-HisD.Pro-Glu-Leu-Val