Embed Size (px)
Citation preview
APPLICATIONS OF PCR IN MYCOLOGY
Applications of PCR in Mycology
Edited by
P.D. BridgeCABI BIOSCIENCE UK Centre, Egham, UK
D.K. AroraCentre for Advanced Study in Botany, Banaras Hindu University, India
C.A. ReddyDepartment of Microbiology, Michigan State University, East Lansing, USA
R.P. ElanderTechnical Operations Biotechnology Development, Bristol-Myers SquibbCompany, New York, USA
CAB INTERNATIONAL
CAB INTERNATIONAL CAB INTERNATIONALWallingford 198 Madison AvenueOxon OX10 8DE New York, NY 10016-4314UK USA
Tel: +44 (0)1491 832111 Tel: +1 212 726 6490Fax: +44 (0)1491 833508 Fax: +1 212 686 7993E-mail: [email protected] E-mail: [email protected]
© CAB INTERNATIONAL 1998. All rights reserved. Nopart of this publication may be reproduced in any form or byany means, electronically, mechanically, by photocopying,recording or otherwise, without the prior permission of thecopyright owners.
A catalogue record for this book is available from the British Library, London, UK
Library of Congress Cataloging-in-Publication DataApplications of PCR in mycology / edited by P.D. Bridge . . . [et al.].
p. cm.Includes index.ISBN 0–85199–233–1 (alk. paper)1. Mycology. 2. Polymerase chain reaction. I. Bridge, P.D.
QK603.A64 1998579.5––dc21 97–43094
CIP
ISBN 0 85199 233 1
Typeset in 10/12pt Garamond by Solidus (Bristol) Ltd.Printed and bound in the UK by the University Press, Cambridge.
Contents
Contributors vii
Preface xi
Abbreviations xiii
1. Polymerase Chain Reaction in Mycology: an Overview 1V. Edel
2. Gene Cloning Using PCR 21S.P. Goller, M. Gorfer, R.L. Mach and C.P. Kubicek
3. DDRT–PCR for Screening of Fungal Gene Expression 47E.P. Benito and J.A.L. van Kan
4. Interpretation of PCR Methods for Species Definition 63P.D. Bridge and D.K. Arora
5. PCR Applications in Studies of Lichen-forming Fungi 85A. Crespo, O.F. Cubero and M. Grube
6. Applications of PCR for Studying the Biodiversity ofMycorrhizal Fungi 107L. Lanfranco, S. Perotto and P. Bonfante
v
7. PCR Applications in Fungal Phylogeny 125S. Takamatsu
8. PCR Applications to the Taxonomy of EntomopathogenicFungi 153F. Driver and R.J. Milner
9. Application of PCR in Fungal Biotechnology 187W.V. Burnett, S.-J.D. Chiang, J.D. Basch and R.P. Elander
10. Application of PCR in Studying Lignocellulose Degradationby Basidiomycetes 205C.A. Reddy and T.M. D’Souza
11. PCR Methods for the Detection of Mycotoxin-producing Fungi 243R. Geisen
12. PCR Diagnostics in Medical Mycology 267T. Hughes, T.R. Rogers and K. Haynes
13. Applications of PCR in Fungal–Plant Interactions 289E. Ward, A. Tahiri-Alaoui and J.F. Antoniw
14. PCR as a Tool for the Investigation of Seed-borne Disease 309D.A. Pearce
15. Future Directions for PCR in Mycology 325S. Sreenivasaprasad and P.R. Mills
Index 347
vi Contents
Contributors
J.F. Antoniw, Crop and Disease Management Department, Institute forArable Crops Research, Rothamsted, Harpenden, Herts AL5 2JQ, UK
D.K. Arora, Department of Botany, Banaras Hindu University, Varanasi221 005, India
J.D. Basch, Technical Operations Biotechnology Development, Bio/ChemDivision, Bristol-Myers Squibb Company, Syracuse, NY 13221-4755,USA
E.P. Benito, Area de Genetica, Departamento de Microbiologıa y Genetica,Universidad de Salamanca, Edificio Departamental, Avenida del CampoCharro, S/N 37007, Salamanca, Spain
P. Bonfante, Dipartimento di Biologia Vegetale dell’Universita, VialeMattioli 25, I-10125 Torino, Italy
P.D. Bridge, CABI BIOSCIENCES UK Centre, Bakeham Lane, Egham, SurreyTW20 9TY, UK
W.V. Burnett, Technical Operations Biotechnology Development, Bio/ChemDivision, Bristol-Myers Squibb Company, Syracuse, NY 13221-4755,USA
S.-J.D. Chiang, Technical Operations Biotechnology Development, Bio/Chem Division, Bristol-Myers Squibb Company, Syracuse, NY13221-4755, USA
A. Crespo, Departamento de Biologıa Vegetal II, Universidad Complutensede Madrid, Ciudad Universitaria, 28040 Madrid, Spain
O.F. Cubero, Departamento de Biologıa Vegetal II, Universidad Complu-tense de Madrid, Ciudad Universitaria, 28040 Madrid, Spain
T.M. D’Souza, Department of Microbiology and NSF Center for MicrobialEcology, Department of Microbiology, Michigan State University, EastLansing, MI 48824-1101, USA
vii
F. Driver, CSIRO Division of Entomology, GPO Box 1700, Canberra, ACT2601, Australia
V. Edel, INRA-CMSE, Laboratoire de Recherche sur la Flore Pathogene dansle Sol, 17 rue Sully-BV1540 21034 Dijon Cedex, France
R.P. Elander, Technical Operations Biotechnology Development, Bio/ChemDivision, Bristol-Myers Squibb Company, Syracuse, NY 13221-4755,USA
R. Geisen, Bundes Forschungsanstalt fur Ernahrung, Institut fur Hygieneund Toxikologie, Engessertsr. 20, 76131 Karlsruhe, Germany
S.P. Goller, Abteilung fur Mikrobielle Biochemie, Institut fur BiochemischeTechnologie und Mikrobiologie, Technische Universitat Wien, Getreide-markt 9/172.5, A-1060 Wien, Austria
M. Gorfer, Abteilung fur Mikrobielle Biochemie, Institut fur BiochemischeTechnologie und Mikrobiologie, Technische Universitat Wien, Getreide-markt 9/172.5, A-1060 Wien, Austria
M. Grube, Institut fur Botanik, Karl-Franzens-Universitat Graz, 8010 Graz,Austria
K. Haynes, Department of Infectious Diseases, Imperial College of Science,Technology and Medicine, Hammersmith Campus, Du Cane Road,London W12 0NN, UK
T. Hughes, Department of Infectious Diseases, Royal Postgraduate MedicalSchool, Hammersmith Hospital, Du Cane Road, London W12 0NN,UK
J.A.L. van Kan, Department of Phytopathology, Wageningen AgriculturalUniversity, POB 8025, 6700 EE Wageningen, The Netherlands
C.P. Kubicek, Abteilung fur Mikrobielle Biochemie, Institut fur Bio-chemische Technologie und Mikrobiologie, Technische Universitat Wien,Getreidemarkt 9/172.5, A-1060 Wien, Austria
L. Lanfranco, Dipartimento di Biologia Vegetale dell’Universita and Centroi Studio, sulla Micologia del Terreno del CNR, Viale Mattioli 25, I-10125Torino, Italy
R.L. Mach, Abteilung fur Mikrobielle Biochemie, Institut fur BiochemischeTechnologie und Mikrobiologie, Technische Universitat Wien, Getreide-markt 9/172.5, A-1060 Wien, Austria
P.R. Mills, Department of Plant Pathology and Microbiology, HorticultureResearch International, Wellesbourne, Warwick CV35 9EF, UK
R. Milner, CSIRO Division of Entomology, GPO Box 1700, Canberra, ACT2601, Australia
D.A. Pearce, Terrestrial and Freshwater Life Science Division, BritishAntarctic Survey, High Cross, Madingley Road, Cambridge CB3 0ET,UK
S. Perotto, Dipartimento di Biologia Vegetale dell’Universita and Centro iStudio, sulla Micologia del Terreno del CNR, Viale Mattioli 25, I-10125Torino, Italy
C.A. Reddy, Department of Microbiology and NSF Center for Microbial
viii Contributors
Ecology, Michigan State University, East Lansing, MI 48824-1101, USAT.R. Rogers, Department of Infectious Diseases, Imperial College of Science,
Technology and Medicine, Hammersmith Campus, Du Cane Road,London W12 0NN, UK
S. Sreenivasaprasad, Department of Plant Pathology and Microbiology,Horticulture Research International, Wellesbourne, Warwick CV35 9EF,UK
A. Tahiri-Alaoui, Crop and Disease Management Department, Institute forArable Crops Research Rothamsted, Harpenden, Herts AL5 2JQ, UK
S. Takamatsu, Laboratory of Plant Pathology, Faculty of Bioresources, MieUniversity, Tsu 514, Japan
E. Ward, Crop and Disease Management Department, Institute for ArableCrops Research Rothamsted, Harpenden, Herts AL5 2JQ, UK
Contributors ix
Preface
Since the initial report of specific DNA amplification using the polymerasechain reaction (PCR) by Kary Mullis and co-workers in 1985, the number ofdifferent applications of the technique has grown exponentially. The tech-nique is now considered to be indispensible to molecular biology applica-tions in every field of modern biology. The PCR technique is extremelysensitive and makes it possible to greatly amplify selected DNA sequencesfrom very small quantities of template DNA. Its rapid development anddiverse applications have allowed PCR to join other important molecularbiology techniques, such as Southern blotting, gene cloning, pulsed field gelelectrophoresis, etc., and has literally transformed the way that biologiststhink about approaching fundamental and applied biological problems.Indeed, PCR’s capacity to amplify specific segments of DNA represents atechnology that has revolutionized molecular biology.
The purpose of this book is to highlight the many diverse applicationsthat PCR has in basic and applied mycology. The editors have assembled aninternational group of world-renowned mycologists to illustrate the manyapplication areas of PCR to their specialized fields of applied mycology. Itis our hope that the comprehension of this material by the readers willenhance their understanding of the technology and help them to gain newappreciation for the many potential benefits of PCR application.
The text is composed of 15 chapters devoted to PCR principles andapplications in a variety of diverse mycological areas. The opening chapterpresents a brief overview, and the last chapter (Chapter 15) highlightspotential future directions of PCR in mycology. Chapters 2 and 3 cover themany uses of PCR in fungal gene cloning and fungal gene expression. Thematerial presented in Chapter 4 is important because it shows the utility of
xi
PCR in explaining fungal speciation in a more definitive manner. Chapters5–13 demonstrate the diverse application of PCR to studies of lichenmycobionts (Chapter 5), mycorrhizal fungi (Chapter 6), entomopathogenicfungi (Chapter 8), mycotoxin-producing fungi (Chapter 11) and its numer-ous applications in plant–fungal interactions (Chapter 13). Chapter 7presents an interesting review of the use of PCR amplification in helping todetermine fungal phylogeny more accurately. Chapters 9 and 10 highlightpractical applications of PCR in fungal lignocellulose degradation and its usein the development of highly productive strains of industrially importantfungi. Chapters 12 and 14 stress the significance of PCR in medical mycologyand in providing a better understanding of the seed-borne disease state.
We are grateful to the many international authorities and specialists inmycology who have graciously consented to share their perspectives andexpertise on the diverse applications of PCR amplification in their specializedmycological fields. We are also indebted to Tim Hardwick of CABIPUBLISHING for his continuing encouragement and guidance.
R.P. ElanderSeptember 1997
xii Preface
Abbreviations
6-APA 6-aminopenicillanic acidAFLP amplified fragment length polymorphism(s)AG anastomosis groupAM arbuscular mycorrhizalAP-PCR arbitrarily primed PCRBAL bronchoalveolar lavageBLO bacteria-like organismbp base pairsCBH cellobiohydrolasesCDH cellobiose dehydrogenasecDNA complementary DNACTAB cetyl-trimethyl ammonium bromideDAF DNA amplification fingerprintingDD differential displayDDRT–PCR differential display reverse transcription PCRDENS differential extension with nucleotide subsetsDGGE denaturing gradient gel electrophoresisDMSO dimethylsulphoxidedNTPs deoxyribonucleotide triphosphatesds DNA double-stranded DNAECM ectomycorrhizalEIPCR enzymatic inverse PCRELISA enzyme-linked immunosorbent assayERIC enterobacterial repetitive intergenic consensusEST expressed sequence tagGLOX glyoxal oxidase
xiii
GM galactomannanGRAS generally recognized as safeGUS β-glucuronidaseHV highly virulentIA invasive aspergillosisIGS intergenic spacerIPCR inverse PCRISG intraspecific groupITS internal transcribed spacerLA latex agglutinationLA-PCR long and accurate PCRLCR ligase chain reactionLIC ligase-independent cloningLIP lignin peroxidaseLM-PCR ligation-mediated PCRLSU large subunitMNP manganese-dependent peroxidasesmp most parsimoniousmRNA messenger RNANASBA nucleic acid sequence-based amplificationPAH polyaromatic hydrocarbonPCP Pneumocystis carinii pneumoniaPCR polymerase chain reactionPDI protein disulphide isomerasePFGE pulsed-field gel electrophoresisPOAc phenoxyacetic acidPVA penicillin V amidaseQB Q-beta replicaseRACE rapid amplification of cDNA endsRAMS random amplified microsatellitesRAPD random amplified polymorphic DNARDA representational difference analysisrDNA ribosomal DNAREP repetitive extragenic palindromicREP-PCR repetitive-element based PCRRFLP restriction fragment length polymorphismRPCR recombination PCRRT–PCR reverse transcription PCRSCAR sequence characterized amplified regionsSDA strand displacement amplificationSEAD selective enrichment of amplified DNASQPCR semi-quantitative PCRSSCP single-strand conformation polymorphismSSR simple sequence repeatSSU small subunit
xiv Abbreviations
STR short tandem repeatSTS sequence-tagged sitesTB tuberculosisTdT terminal deoxynucleotide transferaseTLC thin-layer chromatographyTm melting temperatureTNV tobacco necrosis virustPA tissue plasminogen activatorTS thymidylate synthaseVNTR variable non-translated repeatsWV weakly virulent
Abbreviations xv
Polymerase Chain Reaction inMycology: an Overview
V. Edel
INRA-CMSE, Laboratoire de Recherche sur la Flore Pathogene dansle Sol, 17 rue Sully-BV1540 21034 Dijon Cedex, France
1.1 Overview of PCR Methods
The polymerase chain reaction (PCR) is a powerful method with widespreadapplications in molecular biology. This enzymatic reaction allows in vitroamplification of specific DNA fragments from complex DNA samples andcan generate microgram quantities of target DNA. Any nucleic acid sequencecan be cloned, analysed or modified, and even rare sequences can be detectedby PCR amplification. Since its development in 1985, the specificity,sensitivity and speed of this technology have led to the development of manymethods for a wide range of biological research areas and for all classes oforganisms. Extensive applications have been found for PCR in many fieldsof mycology, including fungal genetics and systematics, ecology and soilmicrobiology, plant pathology, medical mycology, fungal biotechnology andmany others. Moreover, it is certain that fungal studies will continue toprogress with PCR, as numerous improvements, modifications and newapplications are regularly reported.
1.2 PCR: the Standard Method
1.2.1 Principles of PCR
The polymerase chain reaction allows the exponential amplification ofspecific DNA fragments by in vitro DNA synthesis (Saiki et al., 1985; Mulliset al., 1986; Mullis and Faloona, 1987). The standard method requires a DNAtemplate containing the region to be amplified and two oligonucleotide
1
© CAB INTERNATIONAL 1998. Applications of PCR in Mycology(eds P.D. Bridge, D.K. Arora, C.A. Reddy and R.P. Elander) 1
primers flanking this target region. The amplification is based on the use ofa thermostable DNA polymerase isolated from Thermus aquaticus, calledTaq polymerase (Saiki et al., 1988). All PCR reaction components are mixedand the procedure consists of a succession of three steps which aredetermined by temperature conditions: template denaturation, primerannealing and extension (Fig. 1.1). In the first step, the incubation of thereaction mixture at a high temperature (90–95°C) allows the denaturation ofthe double-stranded DNA template. By cooling the mixture to an annealingtemperature which is typically around 55°C, the target-specific oligonucleo-tide primers anneal to the 5′ end of the two single-stranded templates. For theextension step, the temperature is raised to 72°C and the primer–targethybridizations serve as initiation points for the synthesis of new DNAstrands. The time incubation for each step is usually 1–2 min. This sequenceof three steps corresponds to one cycle of PCR. In the second cycle, thenewly synthesized DNA strands are separated from the original strands bydenaturation and each strand serves again as template in the annealing andextension steps. Theoretically, n cycles of PCR allow a 2n-fold amplificationof the target DNA sequence. Typically, PCR is carried out for 30–40 cycles.As all components including the thermostable DNA polymerase are presentin the PCR mixture from the beginning of the reaction, the amplificationprocedure can be automated and performed in a thermocycler with pro-grammed heating and cooling.
1.2.2 PCR reaction components and conditions
The template DNA, oligonucleotide primers, DNA polymerase and deoxy-ribonucleotide triphosphates (dNTPs) are mixed in an appropriate buffercontaining magnesium ions (as MgCl2). The volume of the reaction mixturegenerally ranges from 25 to 100 µl. Standard conditions for the concentrationof the different components are given in Table 1.1. These allow amplificationof most target sequences but can be optimized for each new PCR application(Innis and Gelfand, 1990). As an example, the starting concentration ofMgCl2 is generally 1.5 mM for amplification with Taq DNA polymerase. Ifsatisfactory PCR results are not obtained, this concentration can beoptimized: a higher MgCl2 concentration will increase the yield of amplifiedproducts but decreases the specificity; a lower MgCl2 concentration increasesthe specificity but decreases the yield. Similarly, the temperature and timeconditions for each step of the reaction, especially the annealing step, shouldbe optimized for each target sequence and primer pair. The annealingtemperature is generally optimized empirically, by increasing the tem-perature until the best result is obtained in terms of amplification yield andspecificity.
Classical PCR amplifications require minimal sequence information fromwhich appropriate primers are selected. Primers are generally 18–28 nucleo-tides in length and are defined according to the DNA sequences flanking the
2 V. Edel
Fig. 1.1. Principle of PCR amplification.
PCR in Mycology: an Overview 3
region to be amplified. Primers are written in the order 5′→3′ (Fig. 1.2). Twoparameters are important for the primer design: the efficiency and thespecificity of amplification. For instance, an important rule is that nocomplementarity between 3′ ends of the primers should exist, to avoidformation of primer-dimers that would decrease the yield of the amplifiedproduct. General concepts for primer design have been described (Dieffenbachet al., 1993; He et al., 1994; Rychlik, 1995). The specificity of primer matchingcan also be improved by adding particular compounds in the reaction mixture
Table 1.1. Standard conditions for PCR amplification: concentration of the different PCRcomponents.
Component Concentration
Template DNA 10–100 ngAmplification buffer 1/10 of final volume (buffer is supplied 10 × concentrated with
the Taq DNA polymerase)MgCl2 0.5–5 mM (typically 1.5 mM)dNTPs 20–200 µM each of dATP, dCTP, dGTP and dTTPPrimer 1 0.1–0.5 µMPrimer 2 0.1–0.5 µMTaq DNA polymerase 0.5–2.5 unitsSterile distilled water To final volumeFinal volume 25–100 µl
Fig. 1.2. Schematic representation of a target DNA region to be amplified by PCR andthe sequence of the corresponding oligonucleotide primers.
4 V. Edel
(Filichkin and Gelvin, 1992) or by using particular experimental conditionssuch as ‘touchdown’ PCR (Don et al., 1991) or ‘hot start’ PCR (Chou et al.,1992). In a touchdown PCR, the first cycle is carried out with an annealingtemperature which is higher than the expected annealing temperature (i.e. 10°Cabove). This temperature is then decreased by 1°C every PCR cycle until a‘touchdown’ at the correct annealing temperature is reached: the remainingcycles are performed at this temperature. In a ‘hot start’ PCR, at least one of theessential components of the PCR reaction is physically separated from theamplification mixture by wax during the initial heat denaturation step. The firstheating step melts the wax and allows complete mixing of all the components.This ‘hot start’ protocol prevents the non-specific binding of primers duringthe initial heat denaturation of the template.
The standard PCR uses Taq DNA polymerase but other thermostableDNA polymerases are available for PCR amplifications. Recombinant DNApolymerases have also been developed recently. The choice of DNApolymerase depends on the PCR application and the properties of thevarious enzymes (Arnheim and Erlich, 1992). As an example, the native TaqDNA polymerase lacks a 3′ → 5′ exonuclease (proofreading) activity andthus produces single base substitution errors at a relatively high rate (Tindalland Kunkel, 1988). By using other thermostable DNA polymerases whichhave this proofreading function, the fidelity of the DNA amplification canbe increased (Cha and Thilly, 1993). Moreover, PCR is classically used toamplify target DNA sequences less than 4000 bp in length, but PCRprotocols have recently been developed to amplify longer DNA fragments(Kainz et al., 1992; Cheng et al., 1994).
1.2.3 Practical considerations in PCR experiments
PCR reactions are classically performed in a final volume of 25–100 µl, inwhich small volumes of each reagent have to be added. These multiplepipetting steps increase the possibility of errors and inaccuracy. As multiplesamples are generally amplified using the same conditions, it is recommendedthat a mix containing all reagents for all samples except the template beprepared, and that this mix is then distributed into individual tubes beforefinally adding the template DNA.
Because of the ability of the PCR to amplify DNA sequences present ata small number of copies, contamination of the template DNA mixture witha foreign source of DNA can result in the amplification of both the target andthe contaminant, especially when non-specific primers are used. Thepresence of PCR products and primers from previous amplifications can alsoresult in carry-over contaminations. In order to detect false-positive amplifi-cations due to contamination, each PCR experiment must include a negativecontrol which contains the same mixture of reagents as the other samples butwithout template DNA, so that no amplification should occur in the negativecontrol. PCR experiments should also include a positive control (with a
PCR in Mycology: an Overview 5
reference template DNA known to amplify) as false-negative amplificationscan also occur because of problems with the thermocycler, the reagents orinhibition of the DNA polymerase.
Some precautionary measures should be taken to minimize the risk ofcontamination in PCR. A first recommendation is to designate a specific areaof the laboratory and a specific set of pipettors for the preparation of PCRreactions and always to use sterile tubes and pipette tips and wear disposablegloves. These precautions can be improved by carrying out PCR reactions ina hood equipped with ultraviolet light and to use UV irradiation of the hoodbefore handling PCR components. Furthermore, the different reagents usedfor PCR can also become contaminated and to avoid this small aliquots ofstock solutions of primers, dNTPs and buffer, and aliquots of sterile watershould be prepared. This will avoid multiple pipetting from the same stocktube, and allows the use of new aliquots if a problem should arise. Otherspecific procedures have also been proposed to minimize contamination ofreactions, such as the use of dUTP instead of dTTP and uracil DNAglycosylase (Longo et al., 1990) or gamma-irradiation (Deragon et al., 1990).
1.2.4 Analysis of PCR products
In many applications, PCR products need only to be visualized. They areseparated electrophoretically according to their size on agarose gels, orpolyacrylamide gels if higher resolution is required, and visualized byethidium bromide or silver staining. More sensitive detection of the PCRproducts can be achieved by hybridization with a specific probe or bylabelling the product either after amplification or directly during PCR usinglabelled dNTPs or primers (Lo et al., 1990; Holtke et al., 1995; Inazuka et al.,1996). Other approaches such as the use of capillary electrophoresis allowproduct analysis to be automated (Martin et al., 1993). Capillary electropho-resis provides a size-selective separation of DNA fragments and results canbe displayed as an electrophoregram. The addition of a standard size ladderof known concentration to the DNA sample to be analysed allows thedetermination of both the size and the quantity of the PCR products.
Once identified, target DNA generated by PCR amplification can befurther characterized by various genetic analyses. Several strategies have beendeveloped for the direct sequencing of PCR-amplified DNA fragments(Bevan et al., 1992; Rao, 1994). Instead of sequencing, denaturing gradient gelelectrophoresis (DGGE) can be used for direct analysis of amplified DNA.This technique is especially useful for the detection of mutations in a targetsequence since it permits the separation of DNA products of the same lengthbut with different nucleotide sequences and can be used to distinguish single-base substitutions (Fisher and Lerman, 1983; Sheffield et al., 1989). Similarly,single-strand conformation polymorphism (SSCP) analysis (Orita et al.,1989; Fujita and Silver, 1994) is a powerful electrophoretic method fordetecting sequence variations and point mutations in amplified products. In
6 V. Edel
contrast to DGGE, SSCP analysis is performed in a polyacrylamide gelunder non-denaturing conditions but DNA samples are denatured prior toelectrophoresis. Variation in PCR products can be shown by restrictionendonuclease digestion. The PCR products obtained from different strainscan be digested with several enzymes and their resulting digests separated byelectrophoresis. If sequence differences are located within restriction sites forparticular enzymes, the digestion of the PCR products with those enzymeswill lead to different electrophoretic patterns. This strategy of PCR–restriction fragment length polymorphism (RFLP) is suitable for screeninglarge samples and is commonly used in taxonomic and ecological studies.
1.3 PCR-derived Methods
Since the first description of the PCR, several modifications of the originalprocedure have been developed. The sensitivity and specificity of the amplifi-cation have been improved by simple modifications of the standard proceduresuch as ‘nested PCR’, in which the PCR product is subjected to a second roundof amplification with a second pair of oligonucleotide primers locatedinternally to the first pair (Dieffenbach et al., 1993). ‘Quantitative PCR’methods allow the estimation of the number of target DNA sequences,generally by competitive PCR with an internal standard (Cross, 1995). Furtherdevelopments which are more than simple variations of the original procedureinclude modifications of the type of template (RNA instead of DNA) or thetype of primers (randomly chosen instead of target-specific primers), and thesehave led to new methods which have increased considerably the range ofapplications of PCR technology. Finally, the recent development of in situ PCRmethods is promising for both diagnosis and genetic analysis.
1.3.1 Reverse transcription–PCR (RT–PCR)
PCR has been adapted to amplify RNA sequences such as mRNA and viralRNA by RT–PCR. Originally, the procedure was based on the reversetranscription (RT) of the RNA into cDNA by a reverse transcriptase priorto amplification by Taq polymerase and standard reaction conditions weredescribed by Kawasaki (1990). Direct RNA amplification with a singleenzyme is also possible by using a particular polymerase (Tth) from Thermusthermophilus (Myers and Gelfand, 1991). This polymerase has a reversetranscriptase activity in the presence of manganese ions and a DNApolymerase activity in the presence of magnesium ions.
RT–PCR is a highly sensitive method that allows the detection and theanalysis of very small amounts of specific RNAs such as previouslyundetectable rare transcripts (Ohan and Heikkila, 1993). Moreover, quantita-tive RT–PCR approaches have been developed for measuring gene expres-sion (Gilliland et al., 1990; Riedy et al., 1995; Gibson et al., 1996).
PCR in Mycology: an Overview 7
1.3.2 Random PCR and other PCR fingerprinting methods
In contrast to ‘classical’ PCR, random PCR approaches do not require anynucleotide sequence information for primer design and allow amplificationof DNA fragments which are of undefined length and sequence. Amongthese approaches, random amplified polymorphic DNA (RAPD) analysis(Williams et al., 1990) was first developed to detect polymorphisms betweenorganisms despite the absence of sequence information, and to producegenetic markers and to construct genetic maps. This method has also beencalled arbitrarily primed PCR (AP-PCR) (Welsh and McClelland, 1990) andDNA amplification fingerprinting (DAF) (Caetano-Anolles et al., 1991).The method is based on the PCR amplification of genomic DNA with asingle short primer with an arbitrary nucleotide sequence. The PCR is carriedout with a low annealing temperature and generates several PCR productswhich produce a band pattern after electrophoretic separation.
Because RAPD assays are generally performed under low stringencyconditions (i.e., low annealing temperatures) with non-specific primers, theyare more sensitive than conventional PCR assays to reaction and thermocycleconditions and thus the concentration of all components in the reactionmixture must be accurately standardized. Moreover, the quality of templateDNA and the brand of Taq DNA polymerase and thermocycler used arealso factors that can affect the reproducibility of RAPD results (MacPhersonet al., 1993; Tommerup et al., 1995).
Another random PCR approach that has recently been developed forDNA fingerprinting and genetic mapping is the amplified fragment lengthpolymorphism (AFLP) technique (Vos et al., 1995). This procedure allowshigh stringency PCR amplification of DNA fragments randomly chosenfrom restriction fragments. In this technology, genomic DNA is firstdigested with a restriction endonuclease and oligonucleotide adaptors areligated to the ends of the restriction fragments. Then, a PCR amplification isperformed using primers which include the adaptor sequence, the part of therestriction site sequence remaining on the fragment, and between one andfive additional nucleotides which are randomly chosen. This step allowsselective amplification of the restriction fragments in which the nucleotidesflanking the restriction site match the additional nucleotides of the primers.The amplified fragments are analysed by denaturing polyacrylamide gelelectrophoresis to generate the fingerprint. The AFLP technique has twomain advantages: it is similar to RAPD in that it analyses the whole genomebut it differs from RAPD in that it uses stringent PCR conditions andproduces results that are very reproducible. AFLP also has high resolutionand the complexity of the AFLP fingerprint can be planned since the numberof resulting fragments depends on the choice of restriction enzyme and thenumber of additional selective nucleotides in the primers.
Other PCR-based methods are intermediate between random PCRapproaches and target-directed amplifications. Indeed, in RAPD analysis,
8 V. Edel
arbitrary primers which are used generally match repeated elements in theDNA since a multiple banding pattern is expected in the resulting PCRfingerprint. PCR fingerprinting methods can also be based on the amplifica-tion with primers defined according to known repeated elements (Meyer etal., 1993a; van Belkum, 1994) and this strategy is also termed interrepeatPCR. Primers can be directed against microsatellites or minisatellites, whichare tandemly repeated motifs of 2–10 bp, or 15–30 bp, respectively (Meyer etal., 1993b), or against other eukaryotic or prokaryotic repeated motifs (vanBelkum et al., 1993). For instance, PCR primers corresponding to entero-bacterial repetitive intergenic consensus (ERIC) sequences and repetitiveextragenic palindromic (REP) elements (Versalovic et al., 1991) can be usedto fingerprint the genome of microorganisms. PCR fingerprinting methodsare now widely used to characterize genetic variations within almost anytype of organism including fungi.
1.3.3 In situ PCR
Biological diagnostics have been greatly advanced by both PCR and in situhybridization. While the main advantage of PCR is its high sensitivity, in situhybridization allows the detection and cytological localization of nucleicacid sequences in whole cells. In situ PCR, resulting from the combinationof PCR and in situ hybridization, is a powerful method for the identificationand localization of rare DNA sequences or RNA sequences (after RT–PCR)in whole cells or tissue samples. In situ PCR methods include the followingsteps: sample fixation, sample permeabilization to allow penetration of PCRreagents, in situ amplification, and visualization of the PCR products by insitu hybridization. Alternatively, PCR products can be visualized directlywhen labelled nucleotides are incorporated during the amplification step;however, the reaction is generally less reliable and less specific by direct insitu PCR than indirect in situ PCR with hybridization (Long et al., 1993).Protocols for PCR – in situ hybridization and RT – in situ PCR have recentlybeen reviewed by Nuovo (1994). In situ PCR has numerous applications inthe identification and localization of specific DNA and RNA sequences inintact cells, disease diagnosis and quantification, and in the analysis ofinfection process and gene expression. Until now, most in situ PCR assaysdeveloped have been concerned with the detection of viral sequences ininfected cells.
1.4 PCR Alternatives
In the last few years, many other methods for nucleic acid amplification havebeen developed, such as the ligase chain reaction (LCR), nucleic acidsequence-based amplification (NASBA), Q-beta replicase (Qβ) amplifica-tion, or strand displacement amplification (SDA). Further details of these
PCR in Mycology: an Overview 9
procedures can be found in Winn-Deen (1996). These can be used instead ofor in combination with PCR, and were generally developed for diagnosticpurposes. For instance, LCR (Barany, 1991; Wiedmann et al., 1994) is a DNAamplification system which involves the use of four oligonucleotide primersand a thermostable DNA ligase. This method, often combined with PCR, isa powerful method for the detection of genetic diseases resulting frommutations since it allows the discrimination of DNA sequences differing inonly a single base pair. The NASBA system (Kievits et al., 1991), wasdeveloped for the detection and amplification of RNA, and requires twoprimers and three different enzymes (reverse transcriptase, T7 RNA poly-merase and RNase H). Unlike PCR, no thermocycler is needed since theNASBA reaction is performed at a constant temperature. Thus, NASBA isparticularly suitable for diagnostic procedures which involve the analysis oflarge numbers of samples in a short time; it has already been applied to thedetection of various viral infections.
1.5 Applications of PCR in Mycology
1.5.1 Starting PCR with fungi
The first stage in PCR is the preparation of the template DNA. Severalprotocols for the extraction of nucleic acids from fungi are available. Someof these allow the isolation of microgram quantities of pure genomic DNA(Garber and Yoder, 1983; Raeder and Broda, 1985; Rogers and Bendich,1988) which is suitable for restriction enzyme analysis and other molecularapplications. However, because only small quantities of starting DNA arerequired for PCR amplification, simplified and rapid procedures cangenerally be used (Lee and Taylor, 1990; Cenis, 1992; Steiner et al., 1995).DNA can also be extracted from complex environmental samples such assoils and plants (Porteous et al., 1994; Volossiouk et al., 1995; Zhou et al.,1996) or clinical samples (Makimura et al., 1994; De Barbeyrac et al., 1996),allowing direct amplification of fungal DNA from the mixed DNA extractsby the use of specific primers. These techniques are particularly useful forecological studies and for the detection of fungi in various samples withoutpreliminary isolation.
1.5.2 Taxonomy and characterization of fungi with PCR
One of the first applications of PCR in mycology was described in 1990 byWhite et al. and concerned the amplification and direct sequencing ofribosomal DNA (rDNA) to establish the taxonomic and phylogeneticrelationships of fungi. rDNA sequences are often used for taxonomic andphylogenetic studies because they are found universally in living cells inwhich they have an important function; thus, their evolution might reflectthe evolution of the whole genome. These sequences also contain both
10 V. Edel
variable and conserved regions, allowing the comparison and discriminationof organisms at different taxonomic levels. The nuclear rDNA in fungi isorganized as an rDNA unit which is tandemly repeated. One unit includesthree rRNA genes: the small nuclear (18S-like) rRNA, the 5.8S rRNA, andthe large (28S-like) rRNA genes. In one unit, the genes are separated by twointernal transcribed spacers (ITS1 and ITS2) and two rDNA units areseparated by the intergenic spacer (IGS). The last rRNA gene (5S) may ormay not be within the repeated unit, depending on the fungal taxa. The 18SrDNA evolves relatively slowly and is useful for comparing distantly relatedorganisms whereas the non-coding regions (ITS and IGS) evolve faster andare useful for comparing fungal species within a genus or strains within aspecies. Some regions of the 28S rDNA are also variable between species.
The development of PCR and the design of primers for the amplificationof the various rDNA regions has considerably facilitated taxonomic studiesof fungi (White et al., 1990). These primers were designed from conservedregions, allowing the amplification of the fragment they flank in most fungi.The ITS primers designed by White et al. (1990) have enabled thedetermination of many ITS sequences from different fungi and these havebeen used to investigate taxonomic and phylogenetic relationships betweenspecies within different genera, such as Colletotrichum (Sreenivasaprasad etal., 1996a), Phytophthora (Lee and Taylor, 1992) and Penicillium (Lobuglioet al., 1993). ITS sequences are generally constant, or show little variationwithin species but vary between species in a genus, and so these sequenceshave been widely used to develop rapid procedures for the identification offungal species by PCR–RFLP analysis (Vilgalys and Hester, 1990; Chen,1992; Edel et al., 1997), and to design species-specific primers (Moukhame-dov et al., 1994; Beck and Ligon, 1995; Sreenivasaprasad et al., 1996b). At theintraspecific level, differentiation of closely related fungal strains can beachieved by comparing more variable DNA regions such as the ribosomalIGS sequences, for which PCR primers have also been designed (Andersonand Stasovski, 1992; Henrion et al., 1992; Edel et al., 1995). MitochondrialrDNA can also be easily analysed among fungi after amplification withconsensus primers (White et al., 1990).
Random PCR approaches are being increasingly used to generatemolecular markers which are useful for taxonomy and for characterizingfungal populations. The main advantage of these approaches is that previousknowledge of DNA sequences is not required, so that any random primercan be tested to amplify any fungal DNA. RAPD primers are chosenempirically and tested experimentally to find RAPD banding patterns whichare polymorphic between the taxa studied. The RAPD method has beensuccessfully used to differentiate and identify fungi at the intraspecific level(Guthrie et al., 1992; Assigbetse et al., 1994; Nicholson and Rezanoor, 1994)and the interspecific level (Lehmann et al., 1992). Similarly, PCR fingerprint-ing with primers that detect hypervariable and repeated sequences has beenused to clarify the taxonomic relationships among both fungal strains and
PCR in Mycology: an Overview 11
species (Meyer et al., 1993b; van Belkum et al., 1993). As both RAPD andinterrepeat PCR amplify DNA from non-specific primers, they need a pureDNA template and cannot be used to detect fungi in mixed samples. Morerecently, AFLP fingerprinting has been developed to evaluate polymorph-isms among various organisms, and this has already been applied to thedetection of inter- and intraspecific genetic variation in fungi (Majer et al.,1996; Mueller et al., 1996). AFLP has several advantages over RAPD in termsof reproducibility and the level of resolution per reaction, and the methodhas great potential for revealing variations among many fungi, especially atthe intraspecific level.
1.5.3 PCR in the detection of fungi
Because of its specificity and sensitivity, PCR is an attractive method for thedetection of fungi. There are already many examples of PCR-based assaysdeveloped for the detection of fungi in both medical and plant pathology.PCR can be used to detect groups of strains, pathotypes, species or highertaxa, provided that specific oligonucleotide primers for these taxa areavailable. Thus, the development of PCR-based detection proceduresrequires knowledge of sequences of at least a part of the target DNA regionin order to design specific primers. The principle of these methods is thealignment of the sequences from target and non-target organisms and theselection of primers with mismatches to the non-target organisms butsufficient homology for efficient priming and amplification of all targetorganisms (Dieffenbach et al., 1993).
DNA sequences which are polymorphic between fungal species, such asITSs, are good candidates for the detection of a species to the exclusion of allother species. For example, differences in ITS sequences have been used todevelop PCR-based assays for the detection of many phytopathogenic fungalspecies in host plants without previous isolation of the fungi (Moukhamedovet al., 1994; Beck and Ligon, 1995; Goodwin et al., 1995; Sreenivasaprasad etal., 1996b). Other sequences of rDNA have been used to design specificprimers, such as 18S rDNA (Di Bonito et al., 1995), 28S rDNA (Fell, 1995)and mitochondrial rDNA (Li et al., 1994). rDNA sequences have also beenused to develop PCR assays for the detection of fungal species in clinicalsamples (Spreadbury et al., 1993; Holmes et al., 1994). As rDNA sequencesare present in high copy number in the fungal genome, their use generallyincreases the sensitivity of a detection assay. Sequences unique to the targetorganisms can be found by other approaches. Specific primers can bedesigned from cloned genomic DNA fragments (Ersek et al., 1994; Doss andWelty, 1995) or from PCR-amplified specific fragments. Indeed, taxon-specific markers generated by RAPD or other PCR-fingerprinting methodscan be cloned and sequenced, and these sequence-characterized amplifiedregions (SCARs) used to design specific primers for detection assays. Anexample of this is the detection of Fusarium species with primers designed
12 V. Edel
from species-specific SCARs derived from RAPDs (Parry and Nicholson,1996; Schilling et al., 1996). Finally, taxon-specific fragments generated byPCR fingerprinting or PCR products with specific sequences can be used asspecific probes in diagnostic assays based on dot-blot hybridizations(Klassen et al., 1996).
PCR amplification methods with specific fungal primers are powerfultools not only in diagnostics but also in ecological studies for monitoringfungi in natural environments, such as water, soil, plant or clinical samples.Furthermore, the development of specific primers has greatly facilitatedstudies on obligate parasites and symbionts. For example, specific amplifica-tion of mycorrhizal fungal DNA can be performed from colonized plantroots (Di Bonito et al., 1995).
1.5.4 Genetic analysis and gene manipulations with PCR
The development of PCR methods has greatly facilitated genetic studies in allorganisms. Many PCR-based methods are suitable for the analysis of geneticvariants and to identify genetic markers. Sequence variation can be identifiedby analysis of a PCR product using RFLP, DGGE or SSCP, or directsequencing and random PCR approaches. The detection of gene mutationssuch as deletions, insertions and even single-base substitutions can be achievedwith the development of highly discriminatory methods for analysing andcomparing PCR products. Polymorphisms detected by PCR and especially byRAPD are also useful for the construction of genetic maps and for geneticlinkage analysis (Erlich and Arnheim, 1992; Tingey and del Tufo, 1993).
Cloning procedures, and thus gene isolation and manipulations, havealso made use of the ability of PCR to produce large amounts of specificDNA fragments from a complex DNA mixture. Cloning of PCR productscan be performed by using PCR primers that include restriction sites, whichsimplify the subsequent insertion and ligation of the cloned DNA fragmentinto the vector. Efficient protocols for cloning and analysis of blunt-endedPCR products have also been described (Costa and Weiner, 1994). Cloningstrategies for genes encoding known proteins can be developed despite theabsence of nucleotide sequence information normally required to designoligonucleotide primers, by using a mixture of degenerate primers consistentwith the amino acid sequence (Compton, 1990). Degenerate primers mayalso be designed on the basis of nucleotide sequence alignment. Furthermore,inverse PCR approaches allow the isolation of DNA fragments which areadjacent to a known sequence (Silver, 1991). PCR strategies also allow invitro gene construction and have greatly simplified site-directed mutagenesis(Weiner and Costa, 1994). For instance, PCR can be performed witholigonucleotide primers that allow both amplification and introduction of amutation in the target sequence. This mutation may be an addition, a deletionor a substitution of nucleotides. The method is powerful enough for thestudy of relationships between the structure of a gene and its function.
PCR in Mycology: an Overview 13
Analysis of gene expression, and detection and quantification of RNAtranscripts can be accomplished by PCR. More recently, differential display(DD) or DDRT–PCR (DD reverse transcription PCR) (Liang and Pardee,1992) has been developed for genetic analyses. This technique allows theidentification of differentially expressed mRNAs and the cloning andcharacterization of their genes, thus permitting the analysis of alteration ofgene expression and the identification of genes that play important roles inbiological and pathological processes (Liang et al., 1993; Goormachtig et al.,1995; Benito et al., 1996).
1.6 Conclusions
PCR procedures, from the standard method to its modifications andimprovements, have greatly simplified DNA technologies. PCR-basedmethods offer so many possibilities that they are now used in almost all areasof life sciences. In mycology, many applications have already been describedin taxonomy, phylogeny, population studies and diagnostics, and someexamples have been reported in this chapter. However, PCR applications arebeing developed in many other fungal studies, including genetic analyses,biotechnology and the analysis of fungal–host interactions in both medicaland plant pathology. The following chapters provide current reviews ofmany research applications of PCR in all these areas of mycology.
References
Anderson, J.B. and Stasovski, E. (1992) Molecular phylogeny of northern hemispherespecies of Armillaria. Mycologia 84, 505–516.
Arnheim, N. and Erlich, H. (1992) Polymerase chain reaction strategy. AnnualReview of Biochemistry 61, 131–156.
Assigbetse, K.B., Fernandez, D., Dubois, M.P. and Geiger, J.-P. (1994) Differentiationof Fusarium oxysporum f. sp. vasinfectum races on cotton by random amplifiedpolymorphic DNA (RAPD) analysis. Phytopathology 84, 622–626.
Barany, F. (1991) The ligase chain reaction in a PCR world. PCR Methods andApplications 1, 5–16.
Beck, J.J. and Ligon, J.M. (1995) Polymerase chain reaction assays for the detectionof Stagonospora nodorum and Septoria tritici in wheat. Phytopathology 85,319–324.
Benito, E.P., Prins, T. and Vankan, J.A.L. (1996) Application of differential displayRT–PCR to the analysis of gene expression in a plant–fungus interaction. PlantMolecular Biology 32, 947–957.
Bevan, I.S., Rapley, R. and Walker, M.R. (1992) Sequencing of PCR-amplified DNA.PCR Methods and Applications 1, 222–228.
Caetano-Anolles, G., Bassam, B.J. and Gresshoff, P.M. (1991) DNA amplificationfingerprinting using very short arbitrary oligonucleotide primers. Biotechnology9, 553–557.
14 V. Edel
Cenis, J.L. (1992) Rapid extraction of fungal DNA for PCR amplification. NucleicAcids Research 20, 2380.
Cha, R.S. and Thilly, W.G. (1993) Specificity, efficiency, and fidelity of PCR. PCRMethods and Applications 3, S18–S29.
Chen, W. (1992) Restriction fragment length polymorphisms in enzymaticallyamplified ribosomal DNAs of three heterothallic Pythium species. Phytopathol-ogy 82, 1467–1472.
Cheng, S., Chang, S.-Y., Gravitt, P. and Respess, R. (1994) Long PCR. Nature 369,684–685.
Chou, Q., Russell, M., Birch, D.E., Raymond, J. and Bloch, W. (1992) Prevention ofpre-PCR mis-priming and primer dimerization improves low-copy-numberamplifications. Nucleic Acids Research 20, 1717–1723.
Compton, T. (1990) Degenerate primers for DNA amplification. In: Innis, M.A.,Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR Protocols. A Guide toMethods and Applications. Academic Press, San Diego, pp. 39–45.
Costa, G.L. and Weiner, M.P. (1994) Protocols for cloning and analysis of blunt-ended PCR-generated DNA fragments. PCR Methods and Applications 3,S95–S106.
Cross, N.C.P. (1995) Quantitative PCR techniques and applications. British Journalof Haematology 89, 693–697.
De Barbeyrac, B., Bebear, C. and Taylor-Robinson, D. (1996) PCR: preparation ofDNA from clinical specimens. Molecular and Diagnostic Procedures in Myco-plasmology II, 61–64.
Deragon, J.-M., Sinnett, D., Mitchell, G., Potier, M. and Labuda, D. (1990) Use of γirradiation to eliminate DNA contamination for PCR. Nucleic Acids Research18, 6149.
Di Bonito, R., Elliott, M.L. and Desjardin, E.A. (1995) Detection of an arbuscularmycorrhizal fungus in roots of different plant species with the PCR. Applied andEnvironmental Microbiology 61, 2809–2810.
Dieffenbach, C.W., Lowe, T.M.J. and Dveksler, G.S. (1993) General concepts for PCRprimer design. PCR Methods and Applications 3, S30–S37.
Don, R.H., Cox, P.T., Wainwright, B.J., Baker, K. and Mattick, J.S. (1991) ‘Touch-down’ PCR to circumvent spurious priming during gene amplification. NucleicAcids Research 19, 4008.
Doss, R.P. and Welty, R.E. (1995) A polymerase chain reaction-based procedure fordetection of Acremonium coenophialum in tall fescue. Phytopathology 85,913–917.
Edel, V., Steinberg, C., Avelange, I., Laguerre, G. and Alabouvette, C. (1995)Comparison of three molecular methods for the characterization of Fusariumoxysporum strains. Phytopathology 85, 579–585.
Edel, V., Steinberg, C., Gautheron, N, and Alabouvette, C. (1997) Evaluation ofrestriction analysis of polymerase chain reaction (PCR)-amplified ribosomalDNA for the identification of Fusarium species. Mycological Research 101,179–187.
Erlich, H.A. and Arnheim, N. (1992) Genetic analysis using the polymerase chainreaction. Annual Review of Genetics 26, 479–506.
Ersek, T., Schoelz, J.E. and English, J.T. (1994) PCR amplification of species-specificDNA sequences can distinguish among Phytophthora species. Applied andEnvironmental Microbiology 60, 2616–2621.
PCR in Mycology: an Overview 15
Fell, J.W. (1995) rDNA targeted oligonucleotide primers for the identification ofpathogenic yeasts in a polymerase chain reaction. Journal of Industrial Micro-biology 14, 475–477.
Filichkin, S.A. and Gelvin, S.B. (1992) Effect of dimethyl sulfoxide concentration onspecificity of primer matching in PCR. BioTechniques 12, 828–830.
Fisher, S.G. and Lerman, L.S. (1983) DNA fragments differing by single base-pairsubstitutions are separated in denaturing gradient gels: correspondence withmelting theory. Proceedings of the National Academy of Sciences USA 80,1579–1583.
Fujita, K. and Silver, J. (1994) Single-strand conformational polymorphism. PCRMethods and Applications 4, S137–S140.
Garber, R.C. and Yoder, O.C. (1983) Isolation of DNA from filamentous fungi andseparation into nuclear, mitochondrial, ribosomal, and plasmid components.Analytical Biochemistry 135, 416–422.
Gibson, U.E.M., Heid, C.A. and Williams, P.M. (1996) A novel method for real timequantitative RT–PCR. Genome Research 6, 995–1001.
Gilliland, G., Perrin, S. and Bunn, H.F. (1990) Competitive PCR for quantitation ofmRNA. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCRProtocols. A Guide to Methods and Applications. Academic Press, San Diego,pp. 60–69.
Goodwin, P.H., Hsiang, T., Xue, B.G. and Liu, H.W. (1995) Differentiation ofGaeumannomyces graminis from other turf-grass fungi by amplification withprimers from ribosomal internal transcribed spacers. Plant Pathology 44,384–391.
Goormachtig, S., Valerio-Lepiniec, M., Szczyglowski, K., Van Montagu, M., Hol-sters, M. and de Bruijn, F.J. (1995). Use of differential display to identify novelSesbania rostrata genes enhanced by Azorhizobium caulinodans infection.Molecular Plant–Microbe Interactions 8, 816–824.
Guthrie, P.A.I., Magill, C.W., Frederiksen, R.A. and Odvody, G.N. (1992) Randomamplified polymorphic DNA markers: a system for identifying and differ-entiating isolates of Colletotrichum graminicola. Phytopathology 82, 832–835.
He, Q., Marjamaki, M., Soini, H., Mertsola, J. and Viljanen, M.K. (1994) Primers aredecisive for sensitivity of PCR. BioTechniques 17, 82–86.
Henrion, B., Le Tacon, F. and Martin, F. (1992) Rapid identification of geneticvariation of ectomycorrhizal fungi by amplification of ribosomal RNA genes.New Phytologist 122, 289–298.
Holmes, A.R., Cannon, R.D., Shepherd, M.G. and Jenkinson, H.F. (1994) Detectionof Candida albicans and other yeasts in blood by PCR. Journal of ClinicalMicrobiology 32, 228–231.
Holtke, H.J., Ankenbauer, W., Muhlegger, K., Rein, R., Sagner, G., Seibl, R. and Walter,T. (1995) The digoxigenin (Dig) system for non-radioactive labelling and detectionof nucleic acids – an overview. Cellular and Molecular Biology 41, 883–905.
Inazuka, M., Tahira, T. and Hayashi, K. (1996) One-tube post-PCR fluorescentlabelling of DNA fragments. Genome Research 6, 551–557.
Innis, M.A. and Gelfand, D.H. (1990) Optimization of PCR. In: Innis, M.A.,Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR Protocols. A Guide toMethods and Applications. Academic Press, San Diego, pp. 3–12.
Kainz, P., Schmiedlechner, A. and Strack, H.B. (1992) In vitro amplification of DNAfragments > 10 kb. Analytical Biochemistry 202, 46–49.
16 V. Edel
Kawasaki, E.S. (1990) Amplification of RNA. In: Innis, M.A., Gelfand, D.H.,Sninsky, J.J. and White, T.J. (eds) PCR Protocols. A Guide to Methods andApplications. Academic Press, San Diego, pp. 21–27.
Kievits, T., van Gemen, B., van Strijp, D., Schukkink, R., Dircks, M., Adriaanse, H.,Malek, L., Sooknanan, R. and Lens, P. (1991) NASBATM isothermal enzymaticin vitro nucleic acid amplification optimized for the diagnosis of HIV-1infection. Journal of Virological Methods 35, 273–286.
Klassen, G.R., Balcerzak, M. and de Cock, A.W.A.M. (1996) 5S ribosomal RNA genespacers as species-specific probes for eight species of Pythium. Phytopathology86, 581–587.
Lee, S.B. and Taylor, J.W. (1990) Isolation of DNA from fungal mycelia and singlespores. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCRProtocols. A Guide to Methods and Applications. Academic Press, San Diego,pp. 282–287.
Lee, S.B. and Taylor, J.W. (1992) Phylogeny of five fungus-like protoctistanPhytophthora species, inferred from the internal transcribed spacers of ribosomalDNA. Molecular Biology and Evolution 9, 636–653.
Lehman, P.F., Lin, D. and Lasker, B.A. (1992) Genotypic identification andcharacterization of species and strains within the genus Candida by usingrandom amplified polymorphic DNA. Journal of Clinical Microbiology 30,3249–3254.
Li, K.-N., Rouse, D.I. and German, T.L. (1994) PCR primers that allow intergenericdifferentiation of ascomycetes and their application to Verticillium spp. Appliedand Environmental Microbiology 60, 4324–4331.
Liang, P. and Pardee, A.B. (1992) Differential display of eukaryotic messenger RNAby means of the polymerase chain reaction. Science 257, 967–971.
Liang, P., Averboukh, L. and Pardee, A.B. (1993) Distribution and cloning ofeukaryotic mRNAs by means of differential display: refinements and optimiza-tion. Nucleic Acids Research 21, 3269–3275.
Lo, Y.-M.D., Mehal, W.Z. and Fleming, K.A. (1990) Incorporation of biotinylateddUTP. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCRProtocols. A Guide to Methods and Applications. Academic Press, San Diego,pp. 113–118.
Lobuglio, K.F., Pitt, J.I. and Taylor, J.W. (1993) Phylogenetic analysis of tworibosomal DNA regions indicates multiple independent losses of a sexualTalaromyces state among asexual Penicillium species in subgenus Biverticillium.Mycologia 85, 592–604.
Long, A.A., Komminoth, P., Lee, E. and Wolfe, H.F. (1993) Comparison of indirectand direct in-situ polymerase chain reaction in cell preparations and tissuesections. Detection of viral DNA, gene rearrangements and chromosomaltranslocations. Histochemistry 99, 151–162.
Longo, M.C., Berninger, M.S. and Hartley, J.L. (1990) Use of uracil DNA glycosylaseto control carry-over contamination in polymerase chain reactions. Gene 93,125–128.
MacPherson, J.M., Eckstein, P.E., Scoles, G.J. and Gajadhar, A.A. (1993) Variabilityof the randon amplified polymorphic DNA assay among thermal cyclers, andeffects of primer and DNA concentration. Molecular and Cellular Probes 7,293–299.
Majer, D., Mithen, R., Lewis, B.G., Vos, P. and Oliver, R.P. (1996) The use of AFLP
PCR in Mycology: an Overview 17
fingerprinting for the detection of genetic variation in fungi. MycologicalResearch 100, 1107–1111.
Makimura, K., Murayama, S.Y. and Yamaguchi, H. (1994) Detection of a wide rangeof medically important fungi by the polymerase chain reaction. Journal ofMedical Microbiology 40, 358–364.
Martin, F., Vairelles, D. and Henrion, B. (1993) Automated ribosomal DNAfingerprinting by capillary electrophoresis of PCR products. Analytical Bio-chemistry 213, 30–37.
Meyer, W., Lieckfeldt, E., Kuhls, K., Freedman, E.Z., Borner, T. and Mitchell, T.G.(1993a) DNA- and PCR-fingerprinting in fungi. In: Pena, S.D.J., Chakraborty,R., Epplen, J.T. and Jeffreys, A.J. (eds) DNA Fingerprinting: State of the Science.Birkhauser Verlag, Basel, pp. 311–320.
Meyer, W., Mitchell, T.G., Freedman, E.Z. and Vilgalys, R. (1993b) Hybridizationprobes for conventional DNA fingerprinting used as single primers in thepolymerase chain reaction to distinguish strains of Cryptococcus neoformans.Journal of Clinical Microbiology 31, 2274–2280.
Moukhamedov, R., Hu, X., Nazar, R.N. and Robb, J. (1994) Use of polymerase chainreaction-amplified ribosomal intergenic sequences for the diagnosis of Verti-cillium tricorpus. Phytopathology 84, 256–259.
Mueller, U.G., Lipari, S.E. and Milgroom, M.G. (1996) Amplified fragment lengthpolymorphism (AFLP) fingerprinting of symbiotic fungi cultured by thefungus-growing ant Cyphomyrmex minutus. Molecular Ecology 5, 119–122.
Mullis, K.B. and Faloona, F.A. (1987) Specific synthesis of DNA in vitro via apolymerase-catalyzed chain reaction. Methods in Enzymology 155, 335–350.
Mullis, K.B., Faloona, F.A., Scharf, S.J., Saiki, R.K., Horn, G.T. and Erlich, H.A.(1986) Specific enzymatic amplification of DNA in vitro: the polymerase chainreaction. Cold Spring Harbor Symposia on Quantitative Biology 51, 263–273.
Myers, T.W. and Gelfand, D.H. (1991) Reverse transcription and DNA amplificationby a Thermus thermophilus DNA polymerase. Biochemistry 30, 7661–7666.
Nicholson, P. and Rezanoor, H.N. (1994) The use of random amplified polymorphicDNA to identify pathotype and detect variation in Pseudocercosporella herpo-trichoides. Mycological Research 98, 13–21.
Nuovo, G.J. (1994) PCR in situ Hybridization. Protocols and Applications, 2nd edn.Raven Press, New York.
Ohan, N.W. and Heikkila, J.J. (1993) Reverse transcription–polymerase chainreaction: an overview of the technique and its applications. BiotechnologyAdvances 11, 13–29.
Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K. and Sekiya, T. (1989) Detectionof polymorphisms of human DNA by gel electrophoresis as single-strandconformation polymorphisms. Proceedings of the National Academy of SciencesUSA 86, 2766–2770.
Parry, D.W. and Nicholson, P. (1996) Development of a PCR assay to detect Fusariumpoae in wheat. Plant Pathology 45, 383–391.
Porteous, L.A., Armstrong, J.L., Seidler, R.J. and Watrud, L.S. (1994) An effectivemethod to extract DNA from environmental samples for polymerase chainreaction amplification and DNA fingerprint analysis. Current Microbiology 29,301–307.
Raeder, U. and Broda, P. (1985) Rapid preparation of DNA from filamentous fungi.Letters in Applied Microbiology 1, 17–20.
18 V. Edel
Rao, V.B. (1994) Direct sequencing of polymerase chain reaction-amplified DNA.Analytical Biochemistry 216, 1–14.
Riedy, M.C., Timm Jr., E.A. and Stewart, C.C. (1995) Quantitative RT–PCR formeasuring gene expression. BioTechniques 18, 70–76.
Rogers, S.O. and Bendich, A.J. (1988) Extraction of DNA from plant tissues. PlantMolecular Biology Manual A6, 1–10.
Rychlik, W. (1995) Priming efficiency in PCR. BioTechniques 18, 84–90.Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and
Arnheim, N. (1985) Enzymatic amplification of β-globin genomic sequences andrestriction site analysis for diagnosis of sickle cell anemia. Science 230,1350–1354.
Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis,K.B. and Erlich, H.A. (1988). Primer-directed enzymatic amplification of DNAwith a thermostable DNA polymerase. Science 239, 487–491.
Schilling, A.G., Moller, E.M. and Hartwig, H.G. (1996) Polymerase chain reaction-based assays for species-specific detection of Fusarium culmorum, F. grami-nearum, and F. avenaceum. Phytopathology 86, 515–522.
Sheffield, V.C., Cox, D.R., Lerman, L.S. and Myers, R.M. (1989) Attachment of a40-base-pair G+C-rich sequence (GC-clamp) to genomic DNA fragments bythe polymerase chain reaction results in improved detection of single-basechanges. Proceedings of the National Academy of Sciences USA 86, 232–236.
Silver, J. (1991) Inverse polymerase chain reaction. In: McPherson, M.J., Quirke, P.and Taylor, G.R. (eds) PCR: a Practical Approach. IRL Press, Oxford,pp. 137–146.
Spreadbury, C., Holden, D., Aufauvre-Brown, A., Bainbridge, B. and Cohen, J.(1993) Detection of Aspergillus fumigatus by polymerase chain reaction. Journalof Clinical Microbiology 31, 615–621.
Sreenivasaprasad, S., Mills, P.R., Meehan, B.M. and Brown, A.E. (1996a) Phylogenyand systematics of 18 Colletotrichum species based on ribosomal DNA spacersequences. Genome 39, 499–512.
Sreenivasaprasad, S., Sharada, K., Brown, A.E. and Mills, P.R. (1996b) PCR-baseddetection of Colletotrichum acutatum on strawberry. Plant Pathology 45,650–655.
Steiner, J.J., Poklemba, C.J., Fjellstrom, R.G. and Elliott, L.F. (1995) A rapid one-tubegenomic DNA extraction process for PCR and RAPD analyses. Nucleic AcidsResearch 23, 2569–2570.
Tindall, K.R. and Kunkel, T.A. (1988) Fidelity of DNA synthesis by the Thermusaquaticus DNA polymerase. Biochemistry 27, 6008–6013.
Tingey, S.V. and del Tufo, J.P. (1993) Genetic analysis with random amplifiedpolymorphic DNA markers. Plant Physiology 101, 349–352.
Tommerup, I.C., Barton, J.E. and O’Brien, P.A. (1995) Reliability of RAPDfingerprinting of three basidiomycete fungi, Laccaria, Hydnangium and Rhi-zoctonia. Mycological Research 99, 179–186.
van Belkum, A. (1994) DNA fingerprinting of medically important microorganismsby use of PCR. Clinical Microbiology Reviews 7, 174–184.
van Belkum, A., Quint, W.G.V., De Pauw, B.E., Melchers, W.J.G. and Meis, J.F. (1993)Typing of Aspergillus species and Aspergillus fumigatus isolates by interrepeatpolymerase chain reaction. Journal of Clinical Microbiology 31, 2502–2505.
Versalovic, J., Koeuth, T. and Lupski, J.R. (1991) Distribution of repetitive DNA
PCR in Mycology: an Overview 19
sequences in eubacteria and application to fingerprinting of bacterial genomes.Nucleic Acids Research 19, 6823–6831.
Vilgalys, R. and Hester, M. (1990) Rapid genetic identification and mapping ofenzymatically amplified ribosomal DNA from several Cryptococcus species.Journal of Bacteriology 172, 4238–4246.
Volossiouk, T., Robb, E.J. and Nazar, R.N. (1995) Direct DNA extraction for PCR-mediated assays of soil organisms. Applied and Environmental Microbiology 61,3972–3976.
Vos, P., Hogers, R., Bleeker, M., Reijans, M., van de Lee, T., Hornes, M., Frijters, A.,Pot, J., Peleman, J., Kuiper, M. and Zabeau, M. (1995) AFLP: a new techniquefor DNA fingerprinting. Nucleic Acids Research 23, 4407–4414.
Weiner, M.P. and Costa, G.L. (1994) Rapid PCR site-directed mutagenesis. PCRMethods and Applications 4, S131–S136.
Welsh, J. and McClelland, M. (1990) Fingerprinting genomes using PCR witharbitrary primers. Nucleic Acids Research 18, 7213–7218.
White, T.J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification and directsequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A.,Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR Protocols. A Guide toMethods and Applications. Academic Press, San Diego, pp. 315–322.
Wiedmann, M., Wilson, W.J., Czajka, J., Luo, J., Barany, F. and Batt, C.A. (1994)Ligase chain reaction (LCR)-overview and applications. PCR Methods andApplications 3, S51–S64.
Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A. and Tingey, S.V. (1990)DNA polymorphisms amplified by arbitrary primers are useful as geneticmarkers. Nucleic Acids Research 18, 6531–6535.
Winn-Deen, E.S. (1996) Automation of molecular genetic methods. Part 2: DNAamplification techniques. Journal of Clinical Ligand Assay 19, 21–26.
Zhou, J., Bruns, M.A. and Tiedje, J.M. (1996) DNA recovery from soils of diversecomposition. Applied and Environmental Microbiology 62, 316–322.
20 V. Edel
Gene Cloning Using PCRSabine P. Goller, Markus Gorfer, Robert L. Machand Christian P. Kubicek
Abteilung fur Mikrobielle Biochemie am Institut fur BiochemischeTechnologie und Mikrobiologie, Technische Universitat Wien,Getreidemarkt 9-172.5, A-1060 Wien, Austria
2.1 Introduction
Since its invention, the polymerase chain reaction (PCR) has revolutionizedthe methodology for cloning genes. To clone a gene of interest, only sequenceinformation of two distinct regions of the gene (or the protein) is needed toenable the design of primers for the amplification of the interveningsequence. Following amplification of a putative gene fragment, the respectivePCR product can be used as a homologous probe for cloning the completegene from a library. PCR has therefore rapidly replaced the previously usedscreening of libraries with oligonucleotide probes. Due to the fast progressin PCR technologies and applications, further developments today enablecloning of a complete gene including 5′- and 3′-untranslated regions by PCRalone. This is particularly important in organisms where the preparation ofgenomic DNA in quantities and qualities sufficient for the construction of agenomic library is difficult. In this chapter we will attempt to review thecurrent state of gene cloning by PCR.
2.2 Tools Required
2.2.1 Available DNA polymerases
Several commercial suppliers offer a variety of thermostable DNA poly-merases which differ in their proofreading activity, thermostability andterminal deoxynucleotide transferase (TdT) activity (i.e., DNA polymeraseswhich add an additional non-templated nucleotide to the 3′-end of a DNA
2
© CAB INTERNATIONAL 1998. Applications of PCR in Mycology(eds P.D. Bridge, D.K. Arora, C.A. Reddy and R.P. Elander) 21
Table 2.1. Features of thermostable DNA polymerases.a,b
Taq Stoffel rTth Pfu Vent Pwo
Optimal extensiontemperature (°C)
75–80 75–80 75–80 72–78 76 72
Extension rate at 72°C(kb min–1)
2–4 2–4 2–4 0.5–1 1 1–2
Reverse transcriptaseactivity
Minimal Minimal Mn2+
dependentMinimal Minimal Minimal
Half-life (min) at 100°C < 5 100 > 120Half-life (min) at 97.5°C 10 20 2Half-life (min) at 95°C 40 80 20 d 400Mg2+-ion PCR optimum
(mM)1–4 2–10 1.5–2.5 1.5–2.5 1–6 1.5–4
pH optimum for PCR(25°C)
9.0 9.0 9.0 > 8.0 8.8 8.8
dNTP PCR optimum(µM each)
40–200 40–200 40–200 100–250 200–400 200
KCl PCR optimum(mM)
50 10 75–100 10 10 25
Primer PCR optimum(µM)
0.1–1 0.1–1 0.1–1 0.1–0.5 0.4 0.3–0.6
Longest PCR product(kb)
> 10 > 10 25 15 7.5
dI-containing primersaccepted
+ – –
5′–3′ exonucleaseactivity
+ – + – – –
3′–5′ exonucleaseactivity
– – – + + +
Error rate(mutation frequencyper base pair percycle × 10-6)
8.0 1.3 2.7 e
Expandase activityc + + + – – –Substrate analogues:
dUTP + + + –deaza-dGTP + + + +biotin-11-dUTP + + + +digoxigenin-dUTP + + +fluorescein-dUTP + + +ddNTP + + +bromo-dUTP +α-thionucleotides + +
Continued on facing page
22 S.P. Goller et al.
strand). This enables the selection of the optimal polymerase for individualapplications (Table 2.1). Polymerases with proofreading activity such as Pfuremove 3′-misincorporated nucleotides and so increase the accuracy of thereaction. Such polymerases may also increase the yield of amplicons asmisincorporated nucleotides can inhibit the activity of the DNA polymerase(Barnes, 1994a). Conversely, proofreading activity can degrade primers(Lundberg et al., 1991; Flaman et al., 1994).
2.2.2 Source of DNA
An extensive search of literature from the past 5 years shows that mostinstances of the use of PCR in the cloning of fungal genes have used genomicDNA as a template. Since neither high quantities nor high quality of DNAare needed, a number of simple and rapid protocols can be used for DNAextraction. Virtually every type of fungal material can be used as a source ofDNA, and procedures have been adopted for mycelia harvested from liquidcultures (Gruber et al., 1990), solid media (Lecellier and Silar, 1994), fruitingbodies, herbarium materials (Bruns et al., 1990) or from archaeologicalspecimens (Rollo et al., 1995).
2.2.3 Primer design
Design of primers is one of the key steps in the successful cloning of a gene.However, no absolute rules can be given that will guarantee the amplificationof the desired fragment in sufficient quantities. The following features maybe taken as guidelines for the design of primer pairs: (i) the length of primersshould be between 20 and 30 bases; (ii) the GC content should be around50%, and G and C nucleotides should preferably be randomly distributedwithin the primer. Over-long GC-stretches should be particularly avoided at
Table 2.1 continuedaTaq from Thermus aquaticus; Stoffel, a modified form of recombinant Taq DNApolymerase, with the N-terminal 289 amino acids containing the 5′→3′ exonucleaseactivity removed; Tth, from Thermus thermophilus; Pfu, from Pyrococcus furiosus; Ventfrom Thermococcus littoralis; Pwo from Pyrococcus woesei.bThis table was composed from a number of sources including publications, manuals,catalogues and data sheets (Lundberg et al., 1991; Hu, 1993; Biotechnology catalogue,Perkin Elmer, New Jersey, USA; Promega catalogue, Madison, Wisconsin, USA; Pfu DNAPolymerase Instruction Manual, Stratagene, La Jolla, California, USA, and referencestherein; data sheets for Vent DNA polymerase from NEB, New England, USA; Pwo DNApolymerase from Boehringer Mannheim, Germany). The table is therefore incomplete.cExpandase activity refers to the addition of a non-templated nucleotide to the 3′-end ofblunt-ended DNA molecules.dPfu DNA polymerase remains > 95% active following a 1 h incubation at 95°C.eDue to different assays to estimate the error rate no direct comparison is possible. Theerror rate of Pwo is similar to that of Pfu and Vent polymerases (Cha and Thilly, 1993).
Gene Cloning Using PCR 23
the 3′-end of the primer, as this can cause efficient but unspecific priming atany GC-rich region in the genome (Innis and Gelfand, 1990); (iii) bothprimers should have a similar GC content to minimize differences inannealing at a given temperature; (iv) stretches of poly(dR), poly(dY) andpalindromic sequences should be avoided; (v) the sequences of the twoprimers must not be complementary; (vi) the concentration of both primersin the reaction should be between 0.1 and 0.5 µM. Differences in theconcentration of the two primers should be avoided since this would favourthe amplification of a linear single-stranded fragment.
Several computer programs are available which assist in the calculationof optimal annealing temperatures, GC-contents, secondary structures,primer-dimer formation and other properties of primers (e.g. GENE RUNNER
3.00, Hastings Software, Inc., 1994).Even when the above guidelines are fully considered, primer design is,
however, not straightforward. A given amino acid may be encoded by differenttriplets due to the degenerate nature of the genetic code (see Table 2.2). As aconsequence, a mixture of primers (‘degeneration’) instead of a primer with adefined sequence is required. The degeneracy of the nucleotide triplet encodinga certain amino acid is an important issue in the design of primers: degenerateprimers enable the amplification of related but distinct nucleic acid sequencesas well as of targets for which only amino acid sequences are available (e.g. fromprotein sequence data or from multiple alignment of related sequences fromdifferent organisms). Obviously, the use of protein sequences containingamino acids with little degeneracy is desirable because it provides the greatestspecificity. No general rules can be given for the degree of degeneracy thatallows successful amplification. Even 1024-fold degenerated primers havebeen shown to work well in PCR (Knoth et al., 1988).
Several approaches can be considered for increasing the specificity of theamplification using degenerate primers (Kwok et al., 1994): (i) the primerpools may be synthesized as subsets where one contains either a G or C ata particular position, whereas the other contains either an A or T at the sameposition; (ii) the degeneracy of the mixed primer may be reduced byconsidering the codon bias for translation. For instance, codons having an Ain the third position (e.g. CTA or TTA for leucine) are used only rarely(Table 2.2); (iii) degeneracy at the 3′-end of the primer should be avoided,because single base mismatches may obviate extension; (iv) the inclusion ofdeoxyinosine (I) at some ambigous positions may reduce the complexity ofthe primer pool. Several experiments have suggested that deoxyinosine mightbe an ‘inert’ base (Martin et al., 1985) and its presence in an oligonucleotidesequence probably will not cause any disturbance in DNA duplex formationor result in destabilization of the duplex. However, pairing of dI with thefour different bases is not equal: dI:dC >> dI:dA > dI:dT = dI:dG (Ohtsukaet al., 1985). Furthermore, it has to be taken into account that deoxyinosineoligonucleotides cannot be used with some DNA polymerases, such as Ventor Pfu (Knittel and Picard, 1993).
24 S.P. Goller et al.
Table 2.2. Codon usage in ascomycetous filamentous fungi.
Amnoacida Codon
A. nidulans b
Number %
A. niger b
Number %
N. crassa b
Number %
T. reesei b
Number %
Gly GGG 893 15 178 8 600 9 113 8Gly GGA 1323 22 386 16 910 13 183 14Gly GGT 1710 28 863 36 2267 34 240 18Gly GGC 2091 35 944 40 2981 44 801 60
Glu GAG 3139 59 1019 71 4270 74 433 82Glu GAA 2221 41 414 29 1463 26 98 18Asp GAT 2348 47 691 41 2041 40 227 31Asp GAC 2642 53 991 59 3052 60 510 69
Val GTG 1309 23 498 27 1083 18 205 23Val GTA 532 9 83 5 370 6 34 4Val GTT 1597 28 433 24 1474 25 161 18Val GTC 2167 39 810 44 3075 51 507 56
Ala GCG 1519 20 357 15 1233 15 225 17Ala GCA 1430 19 266 11 763 10 151 12Ala GCT 2109 28 770 32 2061 26 286 22Ala GCC 2460 33 1022 42 3969 49 631 49
Arg AGG 524 10 93 9 849 16 80 13Arg AGA 537 10 80 7 565 11 39 7Ser AGT 831 11 216 9 528 8 66 5Ser AGC 1380 19 531 22 1433 22 316 25
Lys AAG 2930 69 1019 87 4283 84 528 92Lys AAA 1345 31 159 13 818 16 48 8Asn AAT 1296 37 282 22 849 23 151 19Asn AAC 2243 63 984 78 2906 77 632 81
Met ATG 1905 100 493 100 2138 100 261 100Ile ATA 508 11 36 3 322 7 24 4Ile ATT 1656 37 385 29 1538 32 214 33Ile ATC 2354 52 906 68 2881 61 418 64
Thr ACG 1097 20 316 16 1012 18 293 29Thr ACA 1189 22 190 9 724 13 102 10Thr ACT 1356 25 474 23 1055 19 200 20Thr ACC 1720 32 1054 52 2741 50 410 41
Trp TGG 1150 100 412 100 1239 100 244 100End TGA 41 28 15 26 71 34 6 19Cys TGT 431 37 119 34 235 22 56 24Cys TGC 731 63 235 66 825 78 176 76
Continued overleaf
Gene Cloning Using PCR 25
Table 2.2 continued.
Amnoacida Codon
A. nidulans b
Number %
A. niger b
Number %
N. crassa b
Number %
T. reesei b
Number %
End TAG 53 36 16 28 34 16 14 44End TAA 52 36 26 46 103 50 12 37Tyr TAT 939 37 269 24 758 28 132 25Tyr TAC 1600 63 869 76 1939 72 400 75
Leu TTG 1157 14 324 15 1191 15 96 10Leu TTA 496 6 26 1 250 3 5.0 1Phe TTT 1127 34 243 23 940 27 191 38Phe TTC 2148 66 834 77 2491 73 309 62
Ser TCG 1247 17 346 15 1200 18 286 22Ser TCA 1038 14 119 5 515 8 103 8Ser TCT 1418 19 426 18 1036 16 200 16Ser TCC 1526 21 732 31 1885 29 318 25
Arg CGG 887 17 148 14 585 11 71 12Arg CGA 897 17 84 8 428 8 92 16Arg CGT 1062 20 298 28 1026 20 102 17Arg CGC 1445 27 376 35 1807 34 209 35
Gln CAG 2268 62 734 77 2553 71 524 81Gln CAA 1378 38 215 23 1056 29 124 19His CAT 975 45 190 32 678 31 58 17His CAC 1176 55 402 68 1497 69 275 83
Leu CTG 1881 24 664 31 1448 18 365 36Leu CTA 769 10 103 5 409 5 24 2Leu CTT 1662 21 355 17 1509 19 140 14Leu CTC 2016 25 653 31 3094 39 379 38
Pro CCG 1142 23 280 21 985 20 192 22Pro CCA 1103 22 116 9 687 14 102 12Pro CCT 1399 28 365 27 1169 23 216 25Pro CCC 1362 27 601 44 2167 43 346 40
aThree-letter code.bTotal number of genes used in the derivation of this data: Aspergillus nidulans, 146;Aspergillus niger, 57; Neurospora crassa, 208; Trichoderma reesei, 32.
2.2.4 Other reaction components
The PCR reaction requires magnesium-chelated dNTPs in a pH-stabilizedenvironment. The concentration of each of the nucleotides should be in therange of 50–200 µM and should be balanced. Differences in concentration ofthe nucleotides may cause misincorporation and thereby decrease yield and
26 S.P. Goller et al.
fidelity of the PCR (Ehlen and Dubeau, 1989). Most suppliers of thermo-stable DNA polymerases also supply the respective buffers, and hence theiroptimization is usually no problem. Changing the Mg2+-concentration from1 to 10 mM can have dramatic effects on the specificity and yield of anamplification. The presence of EDTA or other metal ion-chelating agents,which are used in some DNA extraction procedures (Moller et al., 1992) andmay therefore be carried over, lowers the effective concentration of Mg2+. Anexcess of dNTPs has the same effect. The concentration of metal chelatorsand total dNTPs should therefore be taken into account when determiningthe final Mg2+ concentration required for PCR.
The use of 1–10% (w/v) dimethylsulphoxide (DMSO) in the PCR assayhas been recommended (Scharf et al., 1986; Chamberlain et al., 1988),because it lowers the melting temperature of the dsDNA and hence facilitatesstrand separation. This may be particularly important in the denaturation ofGC-rich DNA and help to overcome difficulties caused by DNA secondarystructures (Hung et al., 1990). However, the use of DMSO is not generallyrecommended, as it apparently increases the solubility of the mineral oil(frequently used as a protectant against evaporation) in the aqueous phaseand thereby inhibits DNA polymerase (Linz, 1991). An alternative to themineral oil layer is the use of a thermocycler with an integrated heated lid.Use of formamide (1.25–10%) can also facilitate primer–template annealingreactions and lower the denaturing temperature of DNA (Sarkar et al.,1990).
Glycerol is also frequently included in the reaction system (5–20%,w/v), because it may improve the yield of the amplicon by stabilizing theDNA polymerase (Instruction Manual for Pfu DNA Polymerase ; Stratagene,La Jolla, California). A similar stabilization can also be achieved by theaddition of bovine serum albumin (10–100 µg/ml), which has the furtheradvantage of binding fatty acids and phenolic compounds which may inhibitthe PCR (Paabo et al., 1988).
2.2.5 Cycling parameters
In a typical PCR reaction, the double-stranded DNA is denatured byheating the sample to 94–98°C. The primers are allowed to anneal at thecalculated annealing temperature (typically 40–60°C) followed by heatingto the extension temperature (depending on the thermostable DNApolymerase used, 68–76°C). This cycle is repeated 25–40 times. Normally,these cycles are preceded by an initial denaturation step of 1–3 min andfollowed by a final extension step at the chosen extension temperaturefor 5–10 min. To avoid extension of unspecifically annealed primers atlower temperature while setting up the PCR mixture, a ‘hot start’ isrecommended. This means that the enzyme is added to the reactionmixture after the initial denaturation step only. ‘Hot start’ has dis-advantages, however, in that it is laborious when handling many samples
Gene Cloning Using PCR 27
at the same time, and carries the risk of introducing contamination. Asan alternative to ‘hot start’, Taq antibodies can be added to the reactionmixture. The antibody inhibits Taq polymerase during the setting up ofthe reaction mixture only because it is subsequently inactivated at the firstdenaturation step. Denaturation should be as short as possible to avoidinactivation of the thermostable DNA polymerase by prolonged exposureto elevated temperatures. On the other hand, complete denaturation is anabsolute requirement for high efficiency PCR. For most applicationsdenaturation times between 30 s and 1 min are recommended. Thethermostability of different thermostable DNA polymerases varies con-siderably: Pfu DNA polymerase, for instance, is a highly thermostableenzyme, retaining 94–99% of its polymerase activity after 1 h at 95°C.Unlike Taq DNA polymerase, denaturing temperatures up to 98°C canbe used successfully with Pfu DNA polymerase to amplify GC-richregions (Chong et al., 1994; Nielson et al., 1995). The Vent DNApolymerase features a half-life of 6.7 h at 95°C and 1.8 h at 100°C. Taqpolymerase has a half-life of only 40 min at 95°C and 10 min at 97.5°C.
The temperature and length of time required for primer annealingdepend upon the base composition (GC content), length and concentrationof the amplification primers. The melting temperature (Tm) of a given primersequence can easily be calculated by the formula:
Tm (°C) = 2 (NA + NT) + 4 (NG + NC)
where N equals the number of primer adenine (A), thymidine (T), guanidine(G) or cytosine (C) bases. Usually, the applied annealing temperature is 5°Cbelow the calculated Tm, but this has to be optimized individually. Generally,one annealing step should last for about 1 min.
The extension time depends on the length of the target sequence, theextension temperature and the type of thermostable DNA polymerase used.For Taq and Vent polymerase, extension times of 1 min per kb of expectedextension products at 72–75°C are recommended. Pfu DNA polymeraseneeds 2 min per kb at 72°C. Using extension times longer than thosecalculated is not recommended for DNA polymerases possessing proof-reading exonuclease activity, as this would result in the degradation ofprimers not yet annealed. Too-short extension times, on the other hand,would decrease the yield of PCR product. To circumvent problems due tothe lowered activity of DNA polymerase because of repeated denaturationsteps, the extension time can be increased continuously from cycle to cycle.The final extension step is necessary to guarantee that only full length PCRproducts are obtained. After optimization of all parameters, the optimalnumber of cycles depends mainly on the starting concentration of the targetDNA. Too few cycles gives low product yield, whereas too many cyclescan increase the amount and complexity of non-specific backgroundproducts.
28 S.P. Goller et al.
2.3 Amplification from RNA (RT–PCR)
For amplification of RNA, cDNA is first synthesized by reverse tran-scriptase (RT) and then amplified by PCR as the direct amplification of RNAby commercially available thermostable DNA polymerases is not possible(Tth thermostable DNA polymerase has been reported to have reversetranscriptase activity but is not used routinely due to its short half-life; Myersand Gelfand, 1991). In filamentous fungi, RT–PCR is usually applied togenerate the corresponding cDNA of a previously cloned genomic fragmentused for the confirmation of intron boundaries, and to enable theirexpression in both bacteria and yeasts.
In a straightforward approach a cDNA fragment may also be directlyamplified without previous cloning of the respective genomic clone. Thismay be necessary if amplification of a desired gene from genomic DNA isunsuccessful because of the presence of an intron in the sequence region usedfor primer design. Furthermore, the complexity of a reverse-transcribedmRNA pool is lower than that of the complete genome, resulting in a lowerbackground of co-amplified byproducts. This specificity may be furtherincreased by the use of a gene-specific oligonucleotide for reverse transcrip-tion of the mRNA and two gene-specific primers for subsequent PCRamplification (also see Section 2.5.3). The oligonucleotide primer for reversetranscription therefore has to be the most 3′-located of the three oligo-nucleotides.
2.4 RACE: Rapid Amplification of cDNA Ends
The RACE protocol (Frohmann et al., 1988) provides a simple and efficientmethod for the cloning of cDNA from a gene when the sequence of only asingle position in the gene (or protein) is known. The design of the 3′-endprimer is based on the predictable sequence of the poly(A)-tail of eukaryoticmRNA (e.g. oligo-dT), and hence individual sequence information is onlynecessary for the 5′-end. This approach has particular advantages if thesequence of the amino-terminus of a protein can be determined because itbypasses the need to sequence internal peptide fragments of the protein aswell (e.g. Marx et al., 1995). The method consists of two steps, described indetail (Fig. 2.1).
The use of oligo-dT primers with a 5′-adaptor sequence containing cleav-age sites for several restriction enzymes, preferably enzymes with recognitionsites that are found infrequently in genomic DNA such as SfiI, NotI, MluI orXhoI, is recommended (McClelland and Nelson, 1987); this facilitates subse-quent cloning procedures. The first step consists of a reverse transcription ofthe mRNA as described earlier. The resulting first strand cDNA is then eitherpurified from RNA by RNase H digestion or used directly for PCR amplifica-tion with a gene-specific primer and the oligo-dT primer.
Gene Cloning Using PCR 29
For the amplification of the 5′-end of cDNA, the mRNA is reversetranscribed using a gene-specific primer. The product of the first strandcDNA synthesis is then subjected to homopolymer (poly(A)) tailing, usingterminal polynucleotide transferase. This allows the amplification of cDNAby means of a gene-specific primer at the 3′-end in combination with ahomopolymer primer complementary to the tail at the 5′-end of the first
Fig. 2.1. Schematic representation of the RACE protocol. Primers: ****TTTT(dT)17-adaptor, containing recognition sequences for restriction enzymes at the 5′-end.3′amp (amp refers to amplification), specific to gene of interest, complementary to (–)strand. 5RT (RT refers to reverse transcription) and 5′amp, specific to gene of interest,complementary to (+) strand. Open rectangles represent DNA strands actively beingsynthesized; shaded rectangles represent DNA previously synthesized. At each step thediagram is simplified to illustrate only how the new product formed during the previousstep is utilized. A (–) or (+) strand is designated as ‘truncated’ (TR) when it is shorter thanthe original (–) or (+) strand, respectively (Frohman et al., 1988).
30 S.P. Goller et al.
strand cDNA. The specificity and efficiency of the amplification reaction canbe increased by using a second gene-specific primer. Again restrictionenzyme recognition sequences can be incorporated into the primer sequencesto facilitate subsequent cloning strategies.
To obtain a full-length cDNA clone, primers for amplification of 5′ and3′ fragments must be designed to produce overlapping PCR clones. The twoindependent clones can be combined to generate a complete cDNA clone byone additional PCR step using primers hybridizing at the 5′-end of the5′-RACE fragment and at the 3′-end of the 3′-RACE fragment, respectively,using both fragments as templates. Because of the overlapping character ofboth fragments the internal sequences are used as primers in the first cyclesto generate a full-length cDNA clone. This full-length product is furtheramplified by the primers at the extreme 5′- and 3′-ends of the cDNA.Alternatively, classical cloning procedures can be used to join the twoincomplete fragments.
2.5 Specific Applications
2.5.1 Ramp PCR
In Ramp PCR the annealing temperature is lowered from cycle to cycle,usually by 2°C during the first few amplification steps (PCR ApplicationsManual, Boehringer Mannheim, 1995). This can be useful if the annealingtemperature of a given primer cannot be exactly determined, for example,because of a high degree of degeneracy. Ramp PCR can also be applied whenprimers of widely different Tm are used. This is based on the rationale thatannealing must be highly specific especially in the first few cycles, whereaslater cycles are necessary mainly for further amplification.
2.5.2 Long and accurate PCR (LA-PCR)
Amplification of fragments larger than 5 kb by PCR is usually difficultbecause of the misincorporation of nucleotides due to premature terminationof the extension product (Barnes, 1994a). To overcome this limitation, Barnesemployed a mixture of two thermostable DNA polymerases, one that ishighly processive, and one exhibiting a 3′ → 5′ exonuclease activity whichallows ‘proofreading’ of the product. A study of different combinations ofvarious enzymes determined that a mixture of 16 parts KlenTaq (anexonuclease-free mutant of Taq polymerase) to 1 part Pfu polymerase, whichhas a 3′-exonuclease activity, could yield PCR products as large as 35 kb. Themixture was termed KlenTaqLA-16 and is commercially available (as aremany other optimized combinations of two different thermostable DNApolymerases). The differences between classical PCR and LA-PCR are givenin Table 2.3.
Gene Cloning Using PCR 31
2.5.3 PCR with Nested Primers
Even though PCR amplification of a gene with highly degenerate primersshould theoretically lead to a million-fold increase in the abundancy of theamplicon over the amount of DNA originally present, the yields may bemuch lower in practice, and even too low to detect. In many cases the reasonfor this is the presence of components inhibiting DNA polymerization,which necessitate the dilution of the original DNA solution to a very lowlevel. ‘Nested PCR’ overcomes this problem by performing a secondamplification of the accumulated amplicon using primers annealing withinthe previously amplified product (nested primers; Albert and Fenyo, 1990).Since the first amplification also reduces the nucleic acid complexity, thismethod enables a high specificity in the second amplification. Sometimes,only a single internal primer in the second PCR may suffice. Design of anested primer can be based on the addition of as little as three bases to the3′-end of the first stage primers. Because of this specificity, nested PCR canbe carried out with highly degenerate primers (e.g. 8192-fold; Chen andSuttle, 1995).
2.5.4 Inverse PCR
Inverse PCR allows the amplification of DNA regions located outside of apreviously characterized sequence (Ochman et al., 1988; Triglia et al., 1988;Silver and Keerikatte, 1989) and thus enables the direct cloning of a full-
Table 2.3. Comparison of conditions for LA-PCR and classical PCR to amplify a 35 kbfragment from λ-DNA (Barnes, 1994b).
LA-PCR Classical PCR
KlenTaqLA-16 Only one enzymepH 9.2 pH 8.316 mM (NH4)2SO4, no KCl 50 mM KCl50 mM Tris 20 mM Tris–HCl3.5 mM MgCl2 1–2 mM MgCl230–40 s 99°C 60 s 95°C2 ng λ-DNA 20 ng λ-DNA33 µl reaction volume 100 µl reaction volume20 cycles 30 cycles68°C extension temperature 72°C extension temperature33 nucleotide primers 20–22 nucleotide primers11–24 min extension (longer at later cycles) 3–10 min extensionsHot start or Taq antibody start Cold start, no antibodyFilter tips Non-filter tipsUVA + 8 MOPa before template No treatment
a8 MOP, 8-methoxy-psoralen (for inactivation of contaminating DNA).
32 S.P. Goller et al.
length (e.g. containing also the 5′ and 3′ untranslated regions) gene. Thistechnique is based on the simple rationale that digestion of a given region ofDNA with restriction enzymes, and the circularization of the respectivefragments before amplification, allows the use of PCR with primerssynthesized in the opposite orientations to those normally used for PCR(Fig. 2.2). DNA is cleaved by restriction enzymes which have no recognitionsite within the gene fragment of interest. DNA fragments are then ligatedunder conditions that favour the formation of monomeric circles (Collinsand Weissman, 1984). The circularized DNA molecules can then be used forPCR amplification either directly or after precipitation of the template DNAby appropriate salts and ethanol. A similar PCR set-up as described forgenomic DNA can be used.
2.5.5 Ligation-mediated PCR (LM-PCR)
Ligation-mediated PCR (LM-PCR; Muller and Wold, 1989) requires theknowledge of only one primer annealing position; the second primer can bedefined by ligating a unique DNA linker to it. One of the most importantand powerful applications of this method is the rapid cloning of promoters
Fig. 2.2. Application of inverse PCR. The core region is depicted as a jagged line. Filledand open boxes represent the upstream and downstream flanking regions, respectively,and restriction enzyme recognition sites are denoted by triangles. Oligonucleotideprimers constructed to anneal to the core region and the direction of DNA synthesis areshown by arrows. Figure from Ochman et al., (1990) with permission.
Gene Cloning Using PCR 33
and other upstream regulatory elements that control the expression ofmRNA.
DNA is digested separately with restriction enzymes which generateblunt ends (e.g. EcoRV, ScaI, DraI, PvuII, SspI) in order to obtain genomicDNA suitable for addition of the unique linkers. Each batch is thenseparately ligated to the specially designed adaptor. The desired fragment isthen amplified in two steps which are based on the same rationale as nestedPCR. In the first step, primers annealing to the linker sequence and to therespective genomic sequence are used. In the second step, the linker primeris used together with another which overlaps with the first ‘genomic primer’.
2.6 Cloning of PCR Fragments
Several methods for cloning of PCR-generated DNA fragments have alreadybeen published, and only those most routinely used will be described in thischapter. For other methods like ligase-independent cloning (LIC) or uracilDNA-glycosylase (UDG)-treatment of uracil-containing deoxyoligonucleo-tide primers, the reader is referred to the papers by Aslanidis and De Jong(1990) and Nisson et al. (1991). In addition, several new techniques arecurrently being developed (e.g. regularly published in Promega Notes,Promega, Madison, Wisconsin, USA) which renders it impossible to give acomplete list of all available methods.
2.6.1 Incorporation of restriction enzyme sites intodeoxyoligonucleotide primers
Incorporation of recognition sequences for restriction enzymes into theprimers is probably the most widely used method for cloning PCRfragments. The main advantage of this method is that the fragment can becloned into a vector construct at precisely the location desired. Any site notcontained within the fragment itself can be incorporated into the primerdesign. When amplifying an unknown sequence, restriction sites should bechosen which occur infrequently in the genome, such as NotI, SfiI, MluI orXhoI; in addition, recognition sequences for several restriction enzymes canbe incorporated to minimize the chance of cloning an uncomplete PCRfragment because of an internal restriction site.
To guarantee the direction of the cloned insert, different restriction targetsites on each primer are usually used. Adding bases to the 5′-end of the primer isthe simplest approach and has no effect on the PCR reaction (Scharf et al., 1986;Kaufman and Evans, 1990). When creating a restriction site by addition ofsequences to the 5′-end of a primer, it is important to consider that restrictionenzymes are endo- (not exo-) nucleases and thus do not usually cleave at theend of a nucleotide strand. Hence the included restriction site needs to beprolonged by the addition of several bases. To achieve efficient cleavage, three
34 S.P. Goller et al.
additional nucleotide bp are generally sufficient to act as an annealing clamp.However, some enzymes, for example NotI, need at least 10 bases of double-stranded DNA to restrict at its recognition sequence.
One drawback to restriction enzyme site incorporation is the inability toachieve efficient cleavage. Inhibition of digestion can occur because of thepresence of incompatible polymerase buffers and the molar excess of primersleft over from the PCR reaction. Some restriction enzymes are inhibited byrestriction site-containing primers (Blanck et al., 1995) and therefore, it isoften necessary to purify the fragment before restriction enzyme treatment(Table 2.4).
2.6.2 T/A cloning
T/A-cloning relies on the terminal deoxynucleotide transferase activity ofsome of the polymerases used in PCR. Clark (1988) showed that some DNA
Table 2.4. Activities of restriction enzymes in a PCR mix.
Restrictionenzyme
% activity inPCR mix
Restrictionenzyme
% activity inPCR mix
Apa I 100 Mlu I <5Asp700 10 Nae I 0Asp718 100 Nco I 50Avi II 30 Not I 0BamHI 100 Nru I 75BbrPI 100 Pst I 90Bfr I 100 Pvu I <5Bgl II 0 Pvu II 100Cla I 100 Sac I 100Dra I 100 Sal I 0EclXI 0 Sca I <5Eco47III 0 Sma I 100EcoRI 50 SnaBI 50EcoRV 10 Sph I <5HindIII 10 Ssp I 0Hpa I 100 Stu I 30Kpn I 50 Xha I 60Ksp I 0 Xho I >5Mam I 20
Relative activities of restriction enzymes in a PCR mixture(10 mM Tris–HCl, 50 mM KCl, 1.5 mM MgCl2, 200 µMdNTPs, pH 8.3 at 20°C) compared with activity underoptimal conditions (SuRE/Cut buffer Boehringer Mannheim)(Blanck et al., 1995).
Gene Cloning Using PCR 35
polymerases and reverse transcriptases contain a terminal deoxynucleotidyltransferase (TdT) activity that results in the addition of one or morenucleotides at the 3′-ends of blunt-ended DNA molecules, which is bothnucleotide and polymerase specific (Hu, 1993); e.g., Taq DNA polymeraseextends a single dG nucleotide if the 3′-terminal nucleotide on the fragmentis a dG but adds a dA if the 3′-terminal nucleotide is a dC. A 3′-terminal dTnucleotide results in the non-addition of a dT and the addition of a dA.Fragments ending with a dA had an additional dA added to the 3′-ends withextremely low efficiency by polymerases that were found to have the TdTactivity; there appears to be no consistent patterns for which bases wereadded. Pfu DNA polymerase does not show any TdT activity and so thispolymerase cannot be used for amplification of fragments for subsequentcloning.
The vector into which dA-tailed PCR fragments are to be cloned mustcontain a 3′-T overhanging sequence. This can be obtained either byincubating a blunt-ended vector with Taq DNA polymerase and an excess ofdTTP, or by incubating a blunt-ended vector with dideoxythymidine-triphosphate (ddTTP) and terminal transferase (Holton and Graham, 1990);the use of ddTTP ensures the addition of a single dT residue only.
2.6.3 Blunt-end cloning
As with the T/A System, blunt-end cloning does not require the addition ofextra bases to the primer sets. PCR-fragments generated by Taq polymeraseor any other polymerase adding a non-templated nucleotide at the 3′-endmust be treated with Klenow, T4 or Pfu polymerase to generate blunt ends.The vector must also be blunt-ended (e.g., by cutting with EcoRV or SmaI).To improve the efficiency of blunt-end cloning, the use of an optimizedblunt-end ligation buffer is recommended. The direction of fragments afterblunt-end cloning is usually not known, but this drawback can be circum-vented if one of the primers is phosphorylated at the 5′-end, and the otherone is not and therefore still contains the 5′-OH. The vector is cut with thefirst restriction enzyme, then dephosphorylated and afterwards cut with thesecond restriction enzyme to create two different blunt ends; one with a5′-OH, the other with a 5′-phosphate. The ligation of the one-sided-phosphorylated PCR-fragment into the one-sided-dephosphorylated vectorallows unidirectional cloning.
Religation of the vector can be a major problem with blunt end cloningof PCR-fragments, but this can be avoided by the use of the blunt-end-generating restriction endonuclease Srf I together with an appropriate vector.The recognition sequence of SrfI is an 8 bp palindrome. Since it is veryunlikely that such a sequence occurs in the unknown sequence of the geneof interest, Srf I can be added to the ligation mixture where it cleaves anyreligated vector (Simcox et al., 1991; Liu and Schwartz, 1992).
36 S.P. Goller et al.
Table 2.5. Examples of fungal genes cloned by PCR.
Organism Reference Gene name
Primer
*dp ndp
Primer designbased on
aa/seq aa/c dna/c
AspergillusA. niger Inoue et al., 1991 Proteinase A • •A. niger Ehrlich et al., 1993 phyB (phytase gene) • •A niger Jarai et al., 1994 pepD (subtilisin-like protease) • •A. niger Van den Brink et al., 1995 cprA (NADPH cytochrome P450
oxidoreductase)• •
A. oryzae Gomi et al., 1993 pepA (acid protease) • •A. oryzae Lee et al., 1995 nucS (nuclease S1) • •A. fumigatus Sirakova et al., 1994 Metalloproteinase • •A. fumigatus Reichard et al., 1995 pep (aspatic proteinase) • •A. flavus, A. fumigatus Ramesh et al., 1995 mep20 (metalloproteinase) • •A. parasiticus Feng and Leonard, 1995 pksL1 (polyketide synthase) • •A. parasiticus Cary et al., 1995 pecA (polygalacturonase) • •NeurosporaN. crassa Yajima et al., 1991 Photolyase gene • •N. crassa Mauriceville Young and Marzluf, 1991 nmr (negative-acting nitrogen control gene) • •N. crassa Stone et al., 1993 gla-1 (glucoamylase) • •N. crassa Tao and Chen, 1994 eIF-5A (initiation factor 5A) • •N. crassa Yatzkan and Yarden, 1995 pph-1 (2A protein phosphatase) • •N. crassa Maier et al., 1995 GTP-cyclohydrolase I gene • •N. intermedia Young and Marzluf, 1991 nmr (negative-acting nitrogen control gene) • •
Continued overleaf
Table 2.5. continued.
Organism Reference Gene name
Primer
*dp ndp
Primer designbased on
aa/seq aa/c dna/c
N. sitophila Young and Marzluf, 1991 nmr (negative-acting nitrogen control gene) • •PenicilliumP. chrysogenum Marx et al., 1995 paf (antifungal protein) • •P. chrysogenum Haas et al., 1995 nre (nitrogen regulatory protein) • •P. camembertii U-150 Yamaguchi et al., 1991 mdlA (mono- and diacylglycerol lipase) • •TrichodermaT. reesei Barnett et al., 1991 bgl1 (β-glucosidase) • •T. reesei Torronen et al., 1992 xyn1, xyn2 (xylanase I and II) • •T. reesei Strauss et al., 1995 cre1 (carbon catabolite repressor protein) • •T. longibrachiatum Gonzalez et al., 1992 egl1 (endoglucanase I) • •T. harzianum Heidenreich and Kubicek, 1994 pyr4 (ornithine-5′-phosphate decarboxylase) • •OthersAureobasidium pullulans Li and Ljungdhal, 1994 xynA (xylanase A) • •Amanita muscaria Kreuzinger et al., 1996 gpd (glyceraldehyde-3-phosphate
dehydrogenase)• •
Boletus edulis Kreuzinger et al., 1996 gpd (glyceraldehyde-3-phosphatedehydrogenase)
• •Boletus edulis Mehmann et al., 1994 BoeCHS1 (chitin synthase) • •Botrytis cinerea Causier et al., 1994 chs1 (chitin synthase) • •Cantharellus ciarius Mehmann et al., 1994 CacCHS1 (chitin synthase) • •Ceriporiopsis subvermispora Rajakumar et al., 1996 lip (lignin peroxidase) • •
Cochliobolus carbonum Scott-Craig et al., 1990 PGN1 (endopolygalacturonase) • •Cochliobolus carbonum Nikolskaya et al., 1995 cv-2, cv-7, cv-19 (CPS, cyclic peptide
synthase)• •
Cochliobolus carbonum Murphy and Walton, 1996 alp1 (serin protease) • •Cortinarius odorifer Mehmann et al., 1994 CooCHS1, CooCHS2 (chitin synthase) • •Cylindrocladium
macrosporumNikolskaya et al., 1995 cyl-1, cyl-2, cyl-3 (CPS, cyclic peptide
synthase)• •
Diheterosporachlamydosporia
Nikolskaya et al., 1995 dih-1 (CPS, cyclic peptide synthase) • •Elaphomyces muricatus Mehmann et al., 1994 ElmCHS1, ElmCHS2 (chitin synthase) • •Fusarium solani Gonzales-Candelas and
Kolattukudy, 1992pelA (pectate lyase) • •
Fusarium oxysporum Sheppard et al., 1994 Bfam 1, Cfam 1, Cfam 2, Ffam 1, Kfam 1(cellulase family-specific proteins)
• •Hebeloma crustuliniforme Mehmann et al., 1994 HecCHS1 (chitin synthase) • •Hebeloma mesophaeum Mehmann et al., 1994 HemCHS1 (chitin synthase) • •Lactarius deterrimus Mehmann et al., 1994 LcdCHS1 (chitin synthase) • •Lactarius deterrimus Kreuzinger et al., 1996 gpd (glyceraldehyde-3-phosphate
dehydrogenase)• •
Laccaria laccata Mehmann et al., 1994 LalCHS1, LalCHS2 (chitin synthase) • •Orpinomyces sp. Chen et al., 1995 cypB (cyclophilin) • • •Phanerochaete sordida Rajakumar et al., 1996 lip (lignin peroxidase) • •Phycomyces blakesleeanus Maier et al., 1995 GTP-cyclohydrolase I gene • •Pleurotus ostreatus Giardina et al., 1995 pox1 (phenol oxidase) • •Russula adulterina Mehmann et al., 1994 RuaCHS1 (chitin synthase) • •Rhizopogon vulgaris Mehmann et al., 1994 RhvCHS1, RhvCHS2 (chitin synthase) • •Tuber uncinatum Mehmann et al., 1994 TuuCHS1 (chitin synthase) • •Xerocomus badius Mehmann et al., 1994 XebCHS1 (chitin synthase) • •*dp, Degenerate primers; ndp, non-degenerate primers; aa/seq, primer design based on partial amino acid sequences of the purified protein; aa/c, primer design based on one or more amino acidsequences from related proteins from other species; dna/cl, primer design based on one or more DNA sequences from related genes from other species.
2.7 Conclusions
The availability of a range of strategies for PCR cloning has revolutionizedthe cloning of genes from filamentous fungi. Table 2.5 shows a subset of thedata available from Medline summarizing genes cloned by some of the PCRstrategies outlined in this chapter. While this list is certainly not complete, wehave tried to show representative examples for a wide variety genes,indicating how strongly PCR has taken over fungal gene cloning. It is alsoapparent from Table 2.5 that there has been a strong increase in the numberof publications in recent years, indicating that PCR cloning has now becomean established tool in fungal molecular genetics. In addition (and not shownhere), more sophisticated techniques such as differential display and ligation-mediated PCR are being applied increasingly to filamentous fungi. It isanticipated that these advances in methodology will help raise fungalmycology to the status already reached by the molecular genetics ofunicellular pro- and eukaryotes.
References
Albert, J. and Fenyo, E.M. (1990) Simple, sensitive, and specific detection of humanimmunodeficiency virus type I in clinical specimens by polymerase chainreaction with nested primers. Journal of Clinical Microbiology 28, 1560–1564.
Aslanidis, C. and de Jong, P.J. (1990) Ligation-independent cloning of PCR products(LIC-PCR). Nucleic Acids Research 13, 6069–6074.
Barnes, W.M. (1994a) PCR amplification of up to 35 kb DNA with high fidelity andhigh yield from λ bacteriophage templates. Proceedings of the National Academyof Sciences USA 91, 2216–2220.
Barnes, W.M. (1994b) Tips and tricks for long and accurate PCR. Trends inBiochemical Sciences 19, 342.
Barnett, C.C., Berka, R.M. and Fowler, T. (1991) Cloning and amplification of thegene encoding an extracellular β-glucosidase from Trichoderma reesei : evidencefor improved rates of saccharification of cellulosic substrates. Bio/Technology 9,562–567.
Blanck, A., Gluck, B., Wartbichler, R., Bender, S., Poll, M. and Brandl, A. (1995)Activity of restriction enzymes in a PCR mix. Biochemica 2, 16.
Bruns, T.D., Fogel, R. and Taylor, J.W. (1990) Amplification and sequencing of DNAfrom fungal herbarium species. Mycologia 82, 175–184.
Cary, J.W., Brown, R., Cleveland, T.E., Whitehead, M. and Dean, R. 1995. Cloningand characterization of a novel polygalacturonase-encoding gene from Aspergil-lus parasiticus. Gene 153, 129–133.
Causier, B.M., Milling, R.J., Forster, S.G. and Adams, D.J. (1994) Characterization ofchitin synthase from Botrytis cinerea. Microbiology 140, 2199–2205.
Cha, R.S. and Thilly, W.G. (1993. Specificity, efficiency, and fidelity of PCR. PCRMethods and Applications 3, 18–29.
Chamberlain, J.S., Gibbs, R.A., Ranier, J.E., Nguyen, P.N. and Caskey. C.T.(1988) Deletion screening of the Duchenne muscular dystrophy locus via
40 S.P. Goller et al.
multiplex DNA amplification. Nucleic Acids Research 16, 11141–11156.Chen, F. and Suttle, C.A. (1995) Nested PCR with three highly degenerate primers
for amplification and identification of DNA from related organisms. Bio-Techniques 18, 609–611.
Chen, H., Li, X.-L. and Ljungdahl, L.G. (1995) A cyclophilin from the polycentricanaerobic rumen fungus Orpinomyces sp. strain PC-2 is highly homologous tovertebrate cyclophilin B. Proceedings of the National Academy of Sciences USA92, 2587–2591.
Chong, S.S., Eichler, E.E., Nelson, D.L. and Hughes, M.R. (1994) Robust amplifica-tion and ethidium-visible detection of the fragile X syndrome CGG repeat usingPfu polymerase. American Journal of Medical Genetics 51, 522–526.
Clark, J.M. (1988) Novel non-template nucleotide addition reactions catalyzed byprocaryotic and eucaryotic DNA polymerases. Nucleic Acids Research 16,9677–9686.
Collins, F.S. and Weissman S.M. (1984) Directional cloning of DNA fragments at alarge distance from an initial probe: a circularization method. Proceedings of theNational Academy of Sciences USA 81, 6812–6816.
Ehlen, T. and Dubeau, L. (1989) Detection of ras point mutations by polymerasechain reaction using mutation-specific, inosine-containing oligonucleotide pri-mers. Biochemical and Biophysical Research Communications 160, 441–447.
Ehrlich, K.C., Montalbano, B.G., Mullaney, E.J., Dischinger, H.C. and Ullah, A.H.J.(1993) Identification and cloning of a second phytase gene (phyB) fromAspergillus niger (ficuum). Biochemical and Biophysical Research Communica-tions 195, 53–57.
Feng, G.H. and Leonard, T.J. (1995) Characterization of the polyketide synthase gene(pksL1) required for aflatoxin biosynthesis in Aspergillus parasiticus. Journal ofBacteriology 177, 6246–6254.
Flaman, J.M., Fribourg, T., Moreau, V., Charbonnier, F., Martin, C., Ishioka, C.,Friend, S.H. and Iggo, R. (1994) A rapid PCR fidelity assay. Nucleic AcidsResearch 22, 3259–3260.
Frohman, M.A., Dush, M.K. and Martin G.R. (1988) Rapid production of full-lengthcDNAs from rare transcripts: Amplification using a single gene-specific oligonu-cleotide primer. Proceedings of the National Academy of Sciences USA 85,8998–9002.
Gene Runner Version 3.00. Hastings Software, Inc. 1994.Giardina, P., Cannio, R., Martirani, L., Marzullo, L., Palmieri, G. and Sannia, G.
(1995) Cloning and sequencing of a laccase gene from the lignin-degradingbasidiomycete Pleurotus ostreatus. Applied and Environmental Microbiology 61,2408–2413.
Gomi, K., Arikawa, K., Kamiya N., Kitamoto, K. and Kumagai, C. (1993) Cloningand nucleotide sequence of the acid protease-encoding gene (papA) fromAspergillus oryzae. Bioscience, Biotechnology, Biochemistry 57, 1095–1100.
Gonzales-Candelas, L. and Kolattukudy, P.E. (1992) Isolation and analysis of a novelinducible pectate lyase gene from the phytopathogenic fungus Fusarium solani f.sp. pisi (Nectria haematococca, Mating Population VI). Journal of Bacteriology174, 6343–6349.
Gonzalez, R., Ramon, D. and Perez-Gonzalez, J.A. (1992) Cloning, sequence analysisand yeast expression of the egl1 gene from Trichoderma logibrachiatum. AppliedMicrobiology and Biotechnology 38, 370–375.
Gene Cloning Using PCR 41
Gruber, F., Visser, J., Kubicek, C.P. and DeGraaff, L. (1990) The development of aheterologous transformation system for the cellulolytic fungus Trichodermareesei based on a pyrG-negative mutant strain. Current Genetics 18, 71–76.
Haas, H., Bauer, B., Redl, B., Stoffler, G. and Marzluf, G.A. (1995) Molecular cloningand analysis of nre, the major nitrogen regulatory gene of Penicillium chryso-genum. Current Genetics 27, 150–158.
Heidenreich, E.J. and Kubicek, C.P. (1994) Sequence of the pyr4 gene encodingorotidine-5′-phosphate decarboxylase from the biocontrol fungus Trichodermaharzianum. Gene 147, 151–152.
Holton, T.A. and Graham, M.W. (1990) A simple and efficient method for directcloning of PCR products using ddT-tailed vectors. Nucleic Acids Research 19,1156.
Hu, G. (1993) DNA polymerase-catalyzed addition of non-templated extra nucleo-tides to the 3′ end of a DNA fragment. DNA and Cell Biology 12, 763–770.
Hung, T., Mak, K. and Fong, K. (1990) A specific enhancer for polymerase chainreaction. Nucleic Acids Research 18, 4953.
Innis, M.A. and Gelfand, D.H. (1990) Innis, M.A., Gelfand, D.H., Sninsky, J.J. andWhite, T.J. (eds) Optimization of PCRs. In: PCR Protocols: A Guide to Methodsand Applications. Academic Press, San Diego, pp. 3–12.
Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (1990) PCR Protocols, aGuide to Methods and Applications. Academic Press, San Diego, pp. 16, 31 and29.
Inoue, H., Kimura, T., Makabe, O. and Takahashi, K. (1991) The gene and deducedprotein sequences of the zymogen of Aspergillus niger acid proteinase A. Journalof Biological Chemistry 29, 19484–19489.
Jarai, G., Kirchherr, D. and Buxton, F. (1994) Cloning and characterization of thepepD gene of Aspergillus niger which codes for a subtilisin-like protease. Gene139, 51–57.
Kaufman, D.L. and Evans G.A. (1990) Restriction endonuclease cleavage at thetermini of PCR products. BioTechniques 9, 304–306.
Knittel, T. and Picard, D. (1993) PCR with degenerate primers containing deoxy-inosine fails with Pfu DNA polymerase. PCR Methods and Applications 2,346–347.
Knoth, K., Roberds, S., Poteet, C. and Tamkun, M. (1988) Highly degenerate,inosine-containing primers specifically amplify rare cDNA using the polymerasechain reaction. Nucleic Acids Research 22, 10932.
Kreuzinger, N., Podeu, R., Gruber, F., Gobl, F. and Kubicek, C.P. (1996) Identifica-tion of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd(glyceraldehyde-3-phosphate dehydrogenase) genes. Applied and Environmen-tal Microbiology 62, 3432–3438.
Kwok, S., Chang, S.-Y., Sninsky, J.J. and Wang, A. (1994) A guide to the design anduse of mismatched and degenerate primers. PCR Methods and Applications 3,39–47.
Lecellier, G. and Silar, P. (1994) Rapid methods for nucleic acids extraction from Petridish-grown mycelia. Current Genetics 25, 122–123.
Lee, B.R., Kitamoto, K., Yamada, O. and Kumagai, C. (1995) Cloning, character-ization and overproduction of nuclease S1 gene (nucS) from Aspergillus oryzae.Applied Microbiology and Biotechnology 44, 425–431.
Li, X.-L. and Ljungdahhl, L.G. (1994) Cloning, sequencing, and regulation of a
42 S.P. Goller et al.
xylanase gene from the fungus Aureobasidium pullulans Y-2311-1. Applied andEnvironmental Microbiology 60, 3160–3166.
Linz, U. (1991) Protocol optimization and the need for standardization of thepolymerase chain reaction. Methods in Molecular and Cellular Biology 2,98–102.
Liu, Z. and Schwartz, L. (1992) An efficient method for blunt-end ligation of PCRproducts. BioTechniques 12, 28–30.
Lundberg, K.S., Shoemaker, D.D., Adams, M.W.W., Short, J.M., Sorge, J.A. andMathur, E.J. (1991) High-fidelity amplification using a thermostable DNApolymerase isolated from Pyrococcus furiosus. Gene 108, 1–6.
Maier, J., Witter, K., Gutlich, M., Ziegler, I., Werner T. and Ninnemann H. (1995)Homology cloning of GTP-Cyclohydrolase I from various unrelated eukaryotesby reverse transcription-polymerase chain reaction using a general set ofdegenerate primers. Biochemical and Biophysical Research Communications 212,705–711.
Martin, F.H., Castro, M.M., Aboul-ela, F. and Tinoco, I. Jr. (1985) Base pairinginvolving deoxyinosine: implication for probe design. Nucleic Acids Research 13,8927–8938.
Marx, F., Haas, H., Reindl, M., Stoffler, G., Lottspeich, F. and Redl, B. (1995)Cloning, structural organization and expression of the Penicillium chrysogenumpaf gene encoding an abundantly secreted protein with antifungal activity. Gene167, 167–171.
McClelland, M. and Nelson, M. (1987) Cleavage specificity of restriction endonu-cleases: application to megabase mapping of chromosomes. Gene Amplificationand Analysis 5, 257–282.
Mehmann, B., Brunner, I. and Braus, G.H. (1994) Nucleotide sequence of chitinsynthase genes among ectomycorrhizal fungi and its potential use in taxonomy.Applied and Environmental Microbiology 60, 3105–3111.
Moller, E.M., Bahnweg, G., Sandermann, H. and Geiger, H.H. (1992) A simple andefficient protocol for isolation of high molecular weight DNA from filamentousfungi, fruit bodies and infected plant tissues. Nucleic Acids Research 20,6115–6116.
Muller, P.R. and Wold, B. (1989) In vivo footprinting of a muscle specific enhancerby ligation mediated PCR. Science 246, 780–786.
Murphy, J.M. and Walton, J.D. (1996) Three extracellular proteases from Cochlio-bolus carbonum: cloning and targeted disruption of alp1. Molecular Plant–Microbe Interactions 9, 290–297.
Myers, T.W. and Gelfand, D.H. (1991) Reverse transcription and DNA amplificationby a Thermus thermophilus DNA polymerase. Biochemistry 30, 7661–7666.
Nielson, K., Braman, J. and Kretz, K. (1995) High-fidelity long PCR amplificationswith Pfu DNA polymerase. Strategies 8, 26.
Nikolskaya, A.N., Panaccione, D.G. and Walton, J.D. (1995) Identification of peptidesynthetase-encoding genes from filamentous fungi producing host-selectivephytotoxins or analogs. Gene 165, 207–211.
Nisson, P., Rashtchian, A. and Watkins, P. (1991) Rapid and efficient cloning of Alu-PCR products using uracil DNA glycosylase. PCR Methods and Applications 1,120–123.
Ochman, H., Gerber, A.S. and Hartl, D.L. (1988) Genetic applications of an inversepolymerase chain reaction. Genetics 120, 621–625.
Gene Cloning Using PCR 43
Ochman, H., Medhora, M.M., Garza, D. and Hartl, D.L. (1990) Amplification offlanking sequences by inverse PCR. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J.and White, T.J. (eds) PCR Protocols: a Guide to Methods and Applications.Academic Press, San Diego, pp. 219–227.
Ohtsuka, E., Matsuka, S., Ikehara, M., Takahashi, Y. and Matsubara, K. (1985) Analternative approach to deoxyoligonucleotides as hybridization probes byinsertion of deoxyinosine at ambiguous codon positions. Journal of BiologicalChemistry 260, 2605–2608.
Paabo, S., Gifford, J.A. and Wilson, A.C. (1988) Mitochondrial DNA sequence froma 7000-year old brain. Nucleic Acids Research 16, 9775–9787.
Rajakumar, S., Gaskell, J., Cullen, D., Lobos, S., Karahanian, E. and Vicuna, R. (1996)lip-like genes in Phanerochaete sordida and Ceriporiopsis subvermispora, whiterot fungi with no detectable lignin peroxidase activity. Applied and Environmen-tal Microbiology 62, 2660–2663.
Ramesh, M.V., Sirakova, D. and Kolattukudy, P.E. (1995) Cloning and character-ization of the cDNAs and genes (mep20) encoding homolgous metalloprotein-ases from Aspergillus flavus and A. fumigatus. Gene 165, 121–125.
Reichard, U., Monod, M. and Ruchel, R. (1995) Molecular cloning and sequencing ofthe gene encoding an extracellular aspartic proteinase from Aspergillus fumiga-tus. FEMS Microbiology Letters 130, 69–74.
Rollo, F., Sassaroli, S. and Ubaldi, M. (1995) Molecular phylogeny of the fungi of theIceman’s grass clothing. Current Genetics 28, 289–297.
Sarkar, G., Kapelner, S. and Sommer, S. (1990) Formamide can dramatically improvethe specificity of PCR. Nucleic Acids Research 18, 7465.
Scharf, S.J., Horn, G.T. and Erlich, H.A. (1986) Direct cloning and sequence analysisof an enzymatically amplified genomic sequences. Science 233, 1076–1078.
Scott-Craig, J.S., Panaccione, D.G., Cervone, F. and Walton, J.D. (1990) Endopolyga-lacturonase is not required for pathogenicity of Cochliobolus carbonum onmaize. The Plant Cell 2, 1191–1200.
Sheppard, P.O., Grant, F.J., Oort, P.J., Sprecher, C.A., Foster, D.C., Hagen, F.S.,Upshall, A., McKnight, G.L. and O’Hara, P.J. (1994) The use of conservedcellulase family-specific sequences to clone cellulase homologue cDNAs fromFusarium oxysporum. Gene 150, 163–167.
Silver, J. and Keerikatte, V. (1989) Novel use of polymerase chain reaction to amplifycellular DNA adjacent to an integrated provirus. Journal of Virology 63,1924–1928.
Simcox, T., Marsh, S., Gross, E., Lernhard, W., Davis, S. and Simcox, M. (1991) SrfIa new type-II restriction endonuclease that recognizes the octanucleotidesequence, 5′-GCCC/GGGC-3′. Gene 109, 121–123.
Sirakova, T.D., Markaryan, A. and Kolattukudy, P.E. (1994) Molecular cloning andsequencing of the cDNA and gene for a novel elastinolytic metalloproteinasefrom Aspergillus fumigatus and its expression in Escherichia coli. Infection andImmunity 62, 4208–4218.
Stone, P.J., Makoff, A.J., Parish, J.H. and Radford, A. (1993) Cloning and sequenceanalysis of the glucoamylase gene of Neurospora crassa. Current Genetics 24, 205–211.
Strauss, J., Mach, R.L., Zeilinger, S., Hartler, G., Stoeffler, G., Wolschek, M. andKubicek, C.P. (1995) Cre1, the carbon catabolite repressor protein fromTrichoderma reesei. FEBS Letters 376, 103–107.
44 S.P. Goller et al.
Tao, Y. and Chen, K.J. (1994) PCR-based cloning of the full lenght Neurosporaeucaryotic initiation factor 5A cDNA: polyhistidine-targetting and overexpres-sion for protein affinity binding. Biochemical Journal 302, 517–525.
Torronen, A., Mach, R.L., Messner, R., Gonzalez, R., Harkki, A., Kalkinnen, N. andKubicek, C.P. (1992) The two major xylanases from Trichoderma reesei :Characterization of both enzymes and genes. Bio/Technology 10, 1461–1467.
Triglia, T., Peterson M.G. and Kemp D.J. (1988) A procedure for in vitro amplifica-tion of DNA segments that lie outside the boundaries of known sequences.Nucleic Acids Research 16, 8186.
Van den Brink, H.J.M., Van Zeijl, M.J., Brons, J.F., Van den Hondel, C.A.M.J.J. andGorcom, R.F.M. (1995) Cloning and characterization of the NADPH cyto-chrome P450 oxidoreductase gene from the filamentous fungus Aspergillus niger.DNA and Cell Biology 14, 719–729.
Yajima, H., Inoue, H., Oikawa, A. and Yasui, A. (1991) Coning and functionalcharacterization of a eucaryotic DNA photolyase gene from Neurospora crassa.Nucleic Acids Research 19, 5359–5362.
Yamaguchi, S., Mase T. and Takeuchi, K. (1991) Cloning and structure of the mono-and diacylglycerol lipase-encoding gene from Penicillium camembertii U-150.Gene 103, 61–67.
Yatzkan, E. and Yarden, O. (1995) Inactivation of a single-2A phosphoproteinphosphatase is letal in Neurospora crassa. Current Genetics 28, 458–466.
Young, J.L. and Marzluf, G.A. (1991) Molecular comparison of the negative actingnitrogen control gene, nmr, in Neurospora crassa and other Neurospora andfungual species. Biochemical Genetics 29, 447–459.
Gene Cloning Using PCR 45
DDRT–PCR for Screening ofFungal Gene Expression
Ernesto P. Benito1 and Jan A.L. van Kan2
1Area de Genetica. Departamento de Microbiologıa y Genetica,Universidad de Salamanca, Edificio Departamental, Avenida delCampo Charro S/N. 37007, Salamanca, Spain; 2Department ofPhytopathology, Wageningen Agricultural University, POB 8025,6700 EE Wageningen, The Netherlands
3.1 Introduction
Every biological process results from selective expression of the genome.Processes such as cell division and proliferation, differentiation, ageing andresponse to stress situations are governed by modulation of the expression ofspecific genes or sets of genes. Studies on differential gene expression havetherefore attracted much interest and research effort. Until recently, theisolation of differentially expressed genes has largely relied on differentialhybridization (Sargent, 1987) and subtractive hybridization procedures (Leeet al., 1991). These methods are laborious and time-consuming, and usuallyrequire relatively large amounts of starting material. Furthermore, theirsensitivity is limited, only allowing the detection of relatively abundantmRNAs. In 1992 a new procedure for differential gene expression analysiswas described: ‘differential display reverse transcriptase–polymerase chainreaction’ (DDRT–PCR) (Liang and Pardee, 1992). This method makes itfeasible to display the full set of mRNAs in a particular cell type and tocompare expression patterns, either with other cell types or with cellssubjected to other experimental conditions. DDRT–PCR possesses severaladvantages over subtractive and differential hybridization procedures.Firstly, it is quicker because probes for Southern and Northern blot analysisas well as partial sequence information of differentially expressed genes maybe made available in a few days. Secondly, only a small amount of biologicalmaterial is required, making this methodology particularly useful when theamount of starting material is limiting (Zimmermann and Schultz, 1994).Thirdly, the application of PCR increases the sensitivity and thereby allowsthe detection of low abundance mRNAs (Liang and Pardee, 1992). These
3
© CAB INTERNATIONAL 1998. Applications of PCR in Mycology(eds P.D. Bridge, D.K. Arora, C.A. Reddy and R.P. Elander) 47
features all contribute to the power and utility of this method. Since it wasfirst described, refinements have been introduced and the procedure has beenapplied in a wide variety of biological systems (reviewed by Liang andPardee, 1995).
We have applied DDRT–PCR to study gene expression in Botrytiscinerea, a ubiquitous fungal plant pathogen causing important economiclosses in many agricultural crops (Jarvis, 1977). The aim of this research is toinvestigate fungal gene expression in planta during the interaction of B.cinerea with the host plant, tomato (Lycopersicon esculentum). We assumethat mutual signalling during the interaction results in changes in geneexpression both in the fungus (for activation of mechanisms for penetrationand colonization of the host tissue) and in the plant (for activation of defenceresponses). Among the fungal genes whose expression is induced during theinteraction, it is likely that some of the genes are essential for pathogenesis.To this end, it was decided to undertake a systematic comparison of geneexpression of the fungus in planta and during growth in liquid culture. Whenstudying such a system, the limiting factor is the small amount of fungalbiomass in the interaction material, particularly during early stages of theinfection process. Therefore a highly sensitive method, such as PCR, isrequired.
In this chapter we summarize the principles of DDRT–PCR andexperimental parameters that were considered during the development of themethodology. Furthermore we describe its application to the analysis of B.cinerea gene expression in planta. Our results illustrate the high sensitivityand versatility of the method.
3.2 Principles of DDRT–PCR
The differential display procedure is designed for the identification andisolation of genes that are differentially expressed in various cell populationsunder defined conditions. It combines techniques that are commonly appliedin molecular biological research: reverse transcription, PCR and electropho-resis in polyacrylamide gels (Fig. 3.1). In the first step, a subpopulation ofmRNAs is reverse transcribed into cDNA by using an ‘anchored’ 3′ primer,taking advantage of the presence of a poly(A) tail in most eukaryoticmRNAs. The anchored primer consists of a number of thymidine residues(usually 11), which anchor it to the poly(A) tail of the mRNA, plus twoadditional nucleotides at its 3′-extreme which provide the specificity of theannealing. Such a primer anneals selectively to mRNAs containing twonucleotides complementary to those at the 3′-end of the primer immediatelyupstream of the poly(A) tail. In total, 12 anchored primers can be designed(12 different combinations of the last 3′ nucleotides omitting thymidine at thepenultimate position). Thus, 12 cDNA subpopulations need to be generatedif the entire mRNA population is to be analysed. The reduction of template
48 E.P. Benito and J.A.L. van Kan
complexity by using selective anchored primers for cDNA synthesis is anessential step in the procedure.
PCR is subsequently performed on each of the cDNA subpopulations,using the same anchored primer applied in cDNA synthesis in combination
Fig. 3.1. Principles of DDRT–PCR (N = adenosine, guanosine or cytosine; M = anynucleotide).
DDRT–PCR and Fungal Gene Expression 49
with a small (10-mer) upstream primer. Any cDNA species is suitable foramplification by PCR if the distance between the poly(A) tail and theposition at which an upstream primer anneals is smaller than 2–3 kb. For a5′ primer of arbitrary nucleotide sequence, annealing positions (if present)are distributed randomly upstream of the poly(A) tail. The resultingamplified products represent only parts of a particular mRNA species (3′ )and products derived from various mRNAs will differ in length. If PCR isperformed in the presence of a labelled nucleotide (usually [α-33P]dATP), theamplified products can be resolved in a polyacrylamide gel and visualized asdiscrete bands by autoradiography. The band patterns of samples derivedfrom different cell types or from cells cultured in different conditions areanalysed in parallel. Fragments of cDNA representing differentiallyexpressed mRNAs can be recovered from the gel and used to furthercharacterize the corresponding genes.
3.2.1 Considerations for experimental parameters
Since it was first described in 1992, the differential display methodology hasbeen applied to a variety of biological systems. Many groups have adaptedthe original protocol to their particular systems and requirements. Althoughgeneral guidelines can be given, it is our experience that the optimalconditions must be found by each user when applied to a particular system.Below, we will discuss briefly the main variations that can be considered ineach step of the differential display procedure and point out the conditionsthat we have found most appropriate in our system.
Starting material and reverse transcriptionThe most critical factor influencing DDRT–PCR analysis is the quality of thestarting material. Protocols for RNA isolation yielding undegraded andhighly purified RNA should be used (guanidinium thiocyanate-basedprotocols usually give good results). Both total RNA and poly(A)+-RNAcan be used as template for reverse transcription and nearly identical bandpatterns are obtained (Liang et al., 1993). For simplicity, total RNA has beenused in many cases. In our hands, however, better results were obtained usingpoly(A)+-RNA, in terms of both the number of bands produced andreproducibility.
The original protocol made use of anchored primers with two selectivenucleotides for the cDNA synthesis. More recently, protocols have beendescribed which use anchored primers with two selective nucleotides inwhich the penultimate position is degenerate (Liang et al., 1993), or anchoredprimers with only one selective nucleotide (Liang et al., 1994). Such primershave allowed a significant reduction of the number of cDNA synthesisreactions required for each RNA sample. However, the use of such primerswill generate cDNA populations of higher complexity that serve as templatesin the subsequent PCR step, resulting in bands occupying almost every
50 E.P. Benito and J.A.L. van Kan
position of the gel. This makes the analysis of the band patterns morecomplicated. Additionally, as pointed out by Bertioli et al. (1995), a reductionof template complexity will contribute to an increase in the sensitivity of theDDRT–PCR procedure for any particular cDNA species.
Polymerase chain reactionThe experimental conditions used for PCR amplifications of complextemplates in the differential display procedure are different from conditionsapplied in standard PCR applications. In the original protocol (Liang andPardee, 1992), 13 nucleotide-long anchored primers were used in combina-tion with decamers of arbitrary sequence. Low annealing temperatures in thePCR profile are required for annealing of short primers but will also allowmismatches. This appears to be essential for the priming of at least a fractionof the templates. In our hands, temperatures higher than 42°C resulted in adrastic reduction in the number of bands detected while temperatures lowerthan 40°C produced bands occupying nearly every position in the lane. Itwas experimentally determined that the specificity of the amplificationincreases when the dNTP concentration is decreased from 200 µM to 2 µM(Liang and Pardee, 1992). A low dNTP concentration was also essential forlabelling the PCR products to a specific activity high enough for detectionon an autoradiogram.
An average of 120 bands in the size range of 100–600 nucleotides areconsistently detected per primer combination when applied to a highereukaryotic system. Assuming that about 15,000 genes are expressed in ahigher eukaryotic cell, theoretical considerations indicate that at a confidencelevel of 0.95 the entire mRNA population is displayed, when 12 anchoredprimers with two selective nucleotides are used in combination with at least25 upstream primers (Bauer et al., 1993).
Liskens et al. (1995) reported the use of 5′-extended primers as a meansof enhancing the reproducibility of the differential display technique.Primers with a length of 22 nucleotides were used in a PCR profile includinga few initial cycles at low annealing temperatures. At low temperatures, theseprimers behave in a similar way to the decamer primers used in the originaldifferential display protocol, since the sequence at the 3′-extreme determinesthe priming specificity. Subsequent PCR cycles are performed at higherannealing temperatures, resulting in very efficient amplification of theproducts obtained during the first cycles. This procedure should improve thesignal-to-noise ratio of individual bands. The extended primers can bedesigned so that they contain a restriction site at their 5′-end, makingsubsequent manipulations easier.
Separation and retrieval of bandsPolyacrylamide gels provide the resolution needed to analyse the complexmixtures of amplified cDNAs after PCR. Denaturing polyacrylamide gelshave been used in most applications, although for fragments smaller than 200
DDRT–PCR and Fungal Gene Expression 51
nucleotides the band patterns generated are more complex. Many of thebands appear as doublets representing both strands of each fragment as aresult of the denaturing conditions. Non-denaturing polyacrylamide gelshave been used to reduce the complexity of the band patterns (Bauer et al.,1993). We have found that a non-denaturing system gives reproduciblepatterns and is particularly useful when very complex cDNA mixtures are tobe analysed (Benito et al., 1996).
The bands of interest can easily be recovered from the gel by a simpleboiling method (Zimmerman and Schultz, 1994). They should be reamplifiedin reactions containing higher dNTPs concentrations (20 µM) to produceenough DNA for isolation from agarose gels and subsequent cloning.AmpliTaq has most frequently been the enzyme of choice. Because thisenzyme adds a single (non-encoded) adenosine to the 3′-end of most of thereaction products, linearized vectors containing 3′-T overhangs are com-monly used to clone the PCR products. Cloning strategies based on blunt-end ligation of PCR products are also used. The cloned fragments can beused as probes in Northern and Southern blot analyses for the isolation ofthe full length cDNA and genomic copies of the gene from libraries.Furthermore, the sequence of the cloned fragments can yield informationabout the nature of the differentially expressed mRNAs that were detected.
Reproducibility and reliabilityThe DDRT–PCR procedure generates highly reproducible band patternswith the same RNA sample. More than 95% of the bands are detected incommon in duplicate reactions and most of the differences observed concernthe intensity of the bands (Bauer et al., 1993). To maximize the reproducibil-ity and accuracy of the method in a given experiment, the samples to beanalysed should preferably be processed in parallel and in an identicalmanner. This must be done for every step in the procedure, from RNAisolation to electrophoresis. The same buffers and reagents and, wheneverpossible, the same batch of enzymes should be used for the entire procedure.
In spite of all the precautions taken, false-positive bands are frequentlydetected. These include differential bands which fail to detect any mRNA onNorthern blots or bands representing non-induced mRNAs. These bands areusually non-reproducible and can be generated as a result of the large numberof PCR cycles at low stringency temperatures (Liskens et al., 1995).Performing the analysis of every RNA sample in duplicate may help todiscriminate between true- and false-positive bands (Liang et al., 1993).Another source of false-positive bands is the presence of contaminatingchromosomal DNA in the RNA sample co-purified during the extractionprocedure. This is less of a problem when poly(A)+-RNA is used instead oftotal RNA for the DDRT–PCR analysis. A DNaseI treatment can beincluded in the protocol to remove traces of chromosomal DNA (Liang etal., 1993). However, this extra treatment may lead to partial RNA degrada-tion, since DNaseI preparations are never completely free of RNase activity.
52 E.P. Benito and J.A.L. van Kan
3.3 Principles of Differential Display in a Plant–FungalPathogen Interaction
We have applied the DDRT–PCR methodology to the analysis of differentialgene expression in a complex plant–fungus interaction system, Lycopersiconesculentum–B. cinerea. Since two organisms are present in the interaction,cDNAs from both will be detected by differential display (Fig. 3.2). Most ofthese cDNAs represent fungal or plant genes which are constitutivelyexpressed. Their origin can be discriminated if the expression pattern of bothorganisms displayed during the interaction is compared with the expressionpattern of the fungus grown in vitro and with the expression pattern of anon-infected tomato plant. Interaction-specific cDNAs are also detectedwhich represent either fungal genes induced in planta or plant genes inducedin response to the pathogen. Both categories can be discriminated if samplesfrom control infections with a second pathogen are included in thecomparative gene expression analysis.
3.3.1 The pathosystem B. cinerea–tomato
To investigate the infection process of B. cinerea on detached tomato leaveswe first established a standardized inoculation procedure. Experimentalconditions were designed that determine high infection efficiency byinducing high germination rates of conidia on the leaves and synchronicityof the infection in different lesions. Synchronous infection is essential for asuccessful temporal analysis of fungal gene expression in planta. Under theexperimental conditions used, the first symptoms are detectable 20 h post-inoculation (h.p.i.). At this time-point small necrotic lesions start appearingover the leaf surface. The lesions become darker during the following 48 hbut neither the number of lesions nor their size increases. At 72 h.p.i., about1–5% of the total number of lesions start to expand and from these lesionsthe fungus is able to colonize the whole leaf. At about 120–140 h.p.i. total leafnecrosis is observed and the fungus sporulates on the surface of thenecrotized plant tissue. We analysed gene expression of the fungus at twodifferent stages of the infection process: at 16 h.p.i. when no symptom is yetvisible but the fungus has already penetrated the host cells, and at 72 h.p.i.at the onset of the formation of spreading lesions.
3.3.2 Sensitivity of the DDRT–PCR procedure
In order to determine whether it is possible to detect fungal gene expression inplanta at these time-points, we estimated the proportion of fungal biomass inleaves during the infection process over time. B. cinerea was inoculated ontomato leaves which were sampled at different times after inoculation. Equalamounts of RNA extracted from these samples were electrophoresed, blottedand hybridized with a probe derived from the B. cinerea β-tubulin (tubA) gene,
DDRT–PCR and Fungal Gene Expression 53
which is assumed to be expressed constitutively (E.P. Benito and J.A.L. vanKan, unpublished results). The intensities of the signals detected at differenttime-points were compared with the intensity of the signal obtained on RNAextracted from a B. cinerea liquid culture in vitro. This intensity ratio providesan estimation of the proportion of fungal RNA/interaction RNA, andtherefore of fungal biomass in the interaction material, during the infection. Asshown in Fig. 3.3A, this proportion is about 3–5% at the time-points analysed.
Fig. 3.2. Schematic representation of a ‘differential display’ gel indicating the origins ofthe bands expected when applying DDRT–PCR to the analysis of a plant–fungalpathogen interaction.
54 E.P. Benito and J.A.L. van Kan
Using DDRT–PCR, is it possible to detect and discriminate fungalmRNAs within such a complex mRNA mixture containing only 3–5% offungal mRNA? We investigated this question by performing a reconstructionexperiment. mRNA from B. cinerea in vitro liquid cultures and from healthytomato leaves were reverse transcribed using anchor primer RT3. The plant
Fig. 3.3. (A) Estimation of the proportion of fungal biomass on infected tomato leavesduring the infection process. Lanes: B.c., total RNA extracted from B. cinerea cultured invitro; L.e., non-infected tomato leaves; I.B.c., B. cinerea-infected tomato leaves sampled atthe indicated time-points (h.p.i.) 0.20 pg of each RNA sample were separated byacrylamide gel electrophoresis, blotted on to a nylon membrane and hybridized with a B.cinerea β-tubulin (tubA) gene. The values used to generate the graph in the lower part ofthe figure represent the relative intensities of the signal obtained with each time-pointsample in comparison with the signal obtained with the B. cinerea in vitro-culturedsample. The same filter was probed with a radish 18S rDNA probe (clone pRG3) (Grelletet al., 1989) to demonstrate equal loading. (B) Sensitivity of the DDRT–PCR procedure.cDNAs synthesized with primer RT3 on mRNAs from healthy tomato leaves and B.cinerea grown in vitro were mixed and subjected to PCR amplification using the sameanchored primer in combination with the 10-mer primer P35. Each lane shows theamplified products obtained using different proportions (ratios indicated above each lane)of tomato–B. cinerea cDNA mixtures as templates. Reproduced from Benito et al. (1996)by permission of Kluwer Academic Publishers.
DDRT–PCR and Fungal Gene Expression 55
cDNA and serial dilutions of the fungal cDNA were mixed and PCR wasperformed. As shown in Fig. 3.3B, most of the bands detected using cDNAsfrom healthy leaves (lane 1:0) and cDNAs from B. cinerea grown in vitro(lane 0:1) as template in PCR, are also detected in a single lane when equalamounts of both cDNAs are mixed and used as template (lane 1:1). WhencDNA from B. cinerea grown in vitro is diluted in relation to cDNA fromhealthy leaves, the intensity of the bands representing B. cinerea cDNAsdecreases with increasing dilution, while the intensity of the bands represent-ing plant cDNAs remains constant (lanes 1:1/10–1:1/100). Even at thehighest dilution tested, several B. cinerea cDNA-derived bands are stilldetectable. In the sample with the 1/30 dilution factor a large proportion ofbands representing B. cinerea cDNAs are detected. Since the amount offungal cDNA in this sample is comparable to that from an infected leaf inwhich 3% of the interaction mRNA is from B. cinerea, we assumed that theDDRT–PCR procedure was sensitive enough to apply to our experimentalsystem. However, it must be noted that the weakest bands detected in the B.cinerea in vitro-grown sample are not detected in the reconstruction sample,suggesting that some fungal mRNAs expressed at a low level in planta maybe overlooked.
3.3.3 Analysis of the expression pattern in the B. cinerea–tomatointeraction
We initiated the analysis of B. cinerea in planta gene expression. Asmentioned above, samples from control interaction systems are required todiscriminate fungal genes induced in planta from plant genes induced inresponse to the pathogen. A useful control interaction in our experimentalapproach should mimic as much as possible the plant defence responseinduced by B. cinerea. For this purpose, we used two different pathogens: thefungus Phytophthora infestans and tobacco necrosis virus (TNV). On tomatoleaves, P. infestans induces necrotic spots that appear in the centre of water-soaked areas at about 50–55 h.p.i., whereas TNV induces small necrotic spotsat 70 h.p.i. For both control pathogens, samples were collected shortly beforesymptoms became detectable: 40 h.p.i. for P. infestans-infected leaves and 60h.p.i. for TNV-infected leaves.
A first set of experiments was performed in order to determine the bestconditions for DDRT–PCR analysis and to test the validity of our experi-mental approach on a limited number of samples: B. cinerea-infected tomatoleaves collected at 16 h.p.i.; B. cinerea cultured in vitro; non-infected tomatoleaves; and P. infestans-infected tomato leaves.
Figure 3.4A shows a representative example of a differential display gelobtained. In all experiments duplicate reactions were included of the B.cinerea–tomato interaction samples (using cDNAs derived from two inde-pendent reverse transcriptase reactions) to reduce the number of false-positive bands. An average of 100–120 bands were detected in lanes from
56 E.P. Benito and J.A.L. van Kan
plant cDNA samples, while 70–80 bands were detected in samples derivedfrom B. cinerea grown in vitro. About 15–20% of the latter bands were alsodetected in the B. cinerea–tomato interaction lane for most of the primercombinations. Figure 3.4B shows in detail the patterns obtained with a givenprimer combination. In addition to the bands representing constitutively
Fig. 3.4. (A) Example of a ‘differential display’ gel. mRNA samples were reversetranscribed with anchored primer RT2 and PCR amplifications were performed using thesame anchored primer in combination with eight different upstream primers (P1–P8). Foreach primer combination samples are as indicated in (B). (B) Detail of the band patternsobtained by ‘differential display’ with primers RT2 and P1 using cDNAs derived frommRNAs obtained from: I.P.i., P. infestans–tomato interaction 40 h.p.i.; I.B.c., B. cinerea–tomato interaction 16 h.p.i. (duplicate reactions, 16 h-1 and 16 h-2); L.e., healthy tomatoleaves; B.c., B. cinerea grown in vitro. The arrows indicate interaction-specific bands.Reproduced from Benito et al. (1996) by permission of Kluwer Academic Publishers.
DDRT–PCR and Fungal Gene Expression 57
expressed mRNAs from B. cinerea and tomato, novel bands are detected insamples derived from B. cinerea-infected tomato leaves (indicated byarrows). Some of these bands are also detected in samples from P. infestans-infected tomato leaves (arrows 2 and 3) and probably represent plant defencegenes induced in response to both pathogens. Other bands are apparentlyspecific to the B. cinerea–tomato interaction and are candidates to representB. cinerea mRNAs induced in planta (arrow 1).
In view of the fact that interaction-specific bands were detected, theanalysis was extended including mRNA samples derived from B. cinerea-infected tomato leaves collected 72 h.p.i. and from TNV-infected tomatoleaves as a second control interaction system. In total, 52 primer combina-tions were used (two anchored primers and 26 upstream primers) in theseexperiments and 22 B. cinerea–tomato interaction-specific fragments weredetected. About 4000 B. cinerea cDNA fragments derived from genesexpressed in vitro were displayed, of which 700–800 were also detected ininteraction samples. Since we have examined only two out of the 12 possiblecDNA subpopulations, the entire analysis should yield about 4000–5000 B.cinerea cDNA fragments derived from genes expressed in planta.
3.3.4 Further characterization of bands of interest
Further characterization of ‘differential’ bands detected by DDRT–PCRincludes confirmation of differential expression by Northern blot analysisand cloning to obtain sequence information. In an interaction between twoorganisms, the origin of the differentially displayed bands needs to bedetermined. To this end, these bands were recovered from the gel,reamplified, labelled and hybridized to a Southern blot containing HindIIIdigests of genomic DNA from tomato and from B. cinerea (we have foundthat labelling by PCR is a much more effective procedure for labelling smallDNA fragments such as those obtained in DDRT–PCR analysis thanlabelling by ‘random priming’). Four fragments hybridizing with genomicDNA of B. cinerea were selected for further analysis. It is commonlyobserved in differential display analysis that single bands represent severalmolecular species of the same size (Callard et al., 1994; Li et al., 1994). Totest this possibility the fragments hybridizing with B. cinerea genomic DNAwere cloned and inserts from individual plasmids were used to confirm thehybridization pattern on Southern blots. Only inserts reproducing thehybridization pattern originally obtained were used for in planta geneexpression analysis on a time-course Northern blot. Two of the fourfragments tested appeared to be homogeneous while the other two weremixtures of at least two different DNA fragments: only one of the fragmentsreproduced the initial hybridization pattern whereas the second onehybridized neither to B. cinerea nor to plant genomic DNA. Northern blotanalysis confirmed differential expression in planta for three of the cDNAsdetected and these are currently characterized in detail. The fourth one did
58 E.P. Benito and J.A.L. van Kan
not detect any signal on the Northern blot, probably due to a low levelof expression.
When large numbers of ‘differential’ fragments are to be tested,alternative screening procedures based on ‘mass’ analysis can be performed(Mou et al., 1994). Duplicate filters containing equal amounts of the cDNAfragments of interest are probed with labelled total genomic DNA todetermine the origin of the cDNAs isolated and with labelled cDNAsynthesized using mRNAs isolated from the sources under investigation.Many fragments can be processed simultaneously in this way. However, themethod has limitations since frequently, as mentioned above, differentialbands represent a mixture of DNA sequences. In this situation, positivecDNAs expressed at low levels can be overlooked.
Sequencing of the cloned fragments can provide information about thenature of the fragments detected through database searches. According to theprinciple of the differential display procedure, the fragments displayedrepresent the 3′ extreme of the mRNA molecules. Usually the two primersused to amplify a particular fragment are found at the extremes, therebyproviding information about the orientation of the fragment. A limitation ofthe procedure is that the amplified fragments are relatively small and onlyrepresent a (largely untranslated) part of the mRNA, thus restricting theusefulness of the sequence information obtained (Sompayrac et al., 1995).Furthermore, fragments often arise as a result of amplification primed byonly one of the two primers used in the PCR (Guimaraes et al., 1995). Suchfragments are likely to represent internal regions of the cDNA molecules. Ineither case, the reamplified fragments can be used as probes to isolate the fulllength cDNA and genomic copies of the genes of interest.
3.4 Perspectives
As predicted by Liang and Pardee in 1992, the differential displaymethodology has found a broad range of applications. The potential of themethodology is enormous. As originally described, the method is onlyqualitative (Liang and Pardee, 1992), but modifications have been proposedwhich would make the method semiquantitative, with potential applicationsin diagnostic procedures (Bauer et al., 1993; Guimaraes et al., 1995).Moreover, it is not limited to the comparison of two mRNA samples, likesubtraction-based methods. Instead it allows the comparison of multiplemRNA samples, for instance in the analysis of spatial or temporal geneexpression (tissue-specific expression, different developmental stages)(Utans et al., 1994; Guimaraes et al., 1995). Furthermore, its sensitivity ishigh, although this is controversial. Bertioli et al. (1995) presentedexperimental data suggesting that differential display shows a strong biastowards high copy number mRNAs. Guimaraes et al. (1995), on thecontrary, demonstrated that DDRT–PCR is able to detect low abundance
DDRT–PCR and Fungal Gene Expression 59
mRNAs. Our results support the high level of sensitivity of the method,since induced mRNAs were detected within a subpopulation of mRNAswhich constitutes only 3–5% of the total infected leaf mRNA population(Benito et al., 1996).
Differential display has become the method of choice to detect andisolate differentially expressed genes in many biological systems, mainlyhigher eukaryotes. Both basic and applied (clinical and medical) areas ofresearch have benefited from DDRT–PCR in mammalian systems (Utanset al., 1994; Zimmermann and Schultz, 1994; Liskens et al., 1995; Yeatmanand Mao, 1995) and several groups have reported its successful applicationin plants (Goormachtig et al., 1995; Sharma and Davis, 1995; van der Knaapand Kende, 1995; Wilkinson et al., 1995). Our work presents one of thefirst reports on the application of DDRT–PCR to the analysis of differentialgene expression in a lower eukaryote, such as a phytopathogenic fungus.Fungi have been used as model systems in fundamental (genetics,biochemistry) and applied (biotechnology, phytopathology, biomedicine)areas of research in the last decades. Information derived from fungalsystems has provided significant contributions to the understanding of morecomplex higher eukaryotic systems. Undoubtedly, DDRT–PCR will be auseful tool when applied to the analysis of differential gene expression inprocesses of basic interest like mating, morphogenesis and dimorphism.Appleyard et al. (1995) have demonstrated the potential of the differentialdisplay methodology for the isolation of genes of biotechnological interestfrom a filamentous fungus, Gibberella fujikuroi. Chen et al. (1996) usedthe method to examine the alteration of gene expression of the chestnutblight fungus (Cryphonectria parasitica) when infected with a virulence-attenuating hypovirus. We have successfully applied this methodology tothe analysis of differential gene expression in a plant–fungus interaction anddemonstrated that it possesses enough sensitivity to analyse fungal geneexpression in planta. Provided the appropriate controls are included, plantdefence genes induced by a pathogen can also be identified (Benito et al.,1996), demonstrating the versatility of the methodology. Such a procedureenables the study of several aspects of plant–pathogen interactions. It isforeseeable that the DDRT–PCR methodology will find numerousapplications in mycology.
Acknowledgements
We are grateful to Dr Arturo P. Eslava, Dr Paul H. Goodwin and Ir Theo W.Prins for critical reading of the manuscript. E.P.B. is recipient of an ECfellowship under the framework of the Training and Mobilitity of Research-ers Programme (contract no. ERBFMBICT960969).
60 E.P. Benito and J.A.L. van Kan
References
Appleyard, V.C.L., Unkles, S.E., Legg, M. and Kinghorn, J.R. (1995) Secondarymetabolite production in filamentous fungi displayed. Molecular and GeneralGenetics 247, 338–342.
Bauer, D., Muller, H., Reich, J., Riedel, H., Ahrenkiel, V., Warthoe, P. and Strauss, M.(1993) Identification of differentially expressed mRNA species by an improveddisplay technique (DDRT–PCR). Nucleic Acids Research 21, 4272–4280.
Benito, E.P., Prins, T. and van Kan, J.A.L. (1996) Application of differential displayRT–PCR to the analysis of gene expression in a plant–fungus interaction. PlantMolecular Biology 32, 947–957.
Bertioli, D.J., Schlichter, U.H.A., Adams, M.J., Burrows, P.R., Steinbiß, H-H. andAntoniw, J.F. (1995) An analysis of differential display shows a strong biastowards high copy number mRNAs. Nucleic Acids Research 23, 4520–4523.
Callard, D., Lescure, B. and Mazzolini, L. (1994) A method for the elimination offalse positives generated by the mRNA differential display technique. Bio-Techniques 16, 1096–1103.
Chen, B., Gao, S., Choi, G.H. and Nuss, D.L. (1996) Extensive alteration of fungalgene transcript accumulation and elevation of G-protein-regulated cAMP levelsby a virulence-attenuating hypovirus. Proceedings of the National Academy ofSciences USA 93, 7996–8000.
Goormachtig, S., Valerio-Lepiniec, M., Szczyglowsky, K., van Montagu, M., Hol-sters, M. and de Bruijn, F.J. (1995) Use of differential display to identify novelSesbania rostrata genes enhanced by Azorhizobium caulinodans infection.Molecular Plant–Microbe Interactions 6, 715–721.
Grellet, F., Delcasso-Tremousaygue, D. and Delseny, M. (1989) Isolation andcharacterization of an unusual repeated sequence from the ribosomal intergenicspacer of the crucifer Sisymbrium irio. Plant Molecular Biology 12, 695–706.
Guimaraes, M.J., Lee, F., Zlotnik, A. and McClanahan, T. (1995) Differential displayby PCR: novel findings and applications. Nucleic Acids Research 23, 1832–1833.
Jarvis, W. (1977) Botryotinia and Botrytis Species: Taxonomy, Physiology andPathogenicity. Canada Department of Agriculture. Monograph 15, 195 pp.
Lee, S.W., Tomasetto, C. and Sager, R (1991) Positive selection of candidate tumorsuppressor genes by subtractive hybridization. Proceedings of the NationalAcademy of Sciences USA 88, 2825–2829.
Li, F., Barnathan, E.S. and Kariko, K. (1994) Rapid method for screening and cloningcDNAs generated in differential display, application of Northern blot affinitycapturing of cDNAs. Nucleic Acids Research 22, 1764–1765.
Liang, P. and Pardee, A.B. (1992) Differential display of eukaryotic messenger RNAby means of the polymerase chain reaction. Science 257, 967–971.
Liang, P. and Pardee, A.B. (1995) Recent advances in differential display. CurrentOpinions in Immunology 7, 274–280.
Liang, P., Averboukh, L. and Pardee, A.B. (1993) Distribution and cloning ofeukaryotic mRNAs by means of differential display: refinements and optimiza-tions. Nucleic Acids Research 21, 3269–3275.
Liang, P., Zhu, W., Zhang, X., Guo, Z., O’Connell, R.P., Averboukh, L., Wang, F. andPardee, A.B. (1994) Differential display using one-base anchored oligo-dTprimers. Nucleic Acids Research 22, 5763–5764.
DDRT–PCR and Fungal Gene Expression 61
Liskens, M.H.K., Feng, J., Andrews, W.H., Enlow, B.E., Soati, S.M., Tonkin, L.A.,Funk, W.D. and Villeponteau, B. (1995) Cataloging altered gene expression inyoung and senescent cells using enhanced differential display. Nucleic AcidsResearch 23, 3244–3251.
Mou, L., Miller, H., Li, J., Wang, E. and Chalifour, L.(1994) Improvements to thedifferential display method for gene analysis. Biochemical and BiophysicalResearch Communications 199, 564–569.
Sargent, T.D. (1987) Isolation of differentially expressed genes. In: Berger, S.L. andKimmel, A.R. (eds.), Methods in Enzymology, Vol. 152. Guide to MolecularCloning Techniques. Academic Press, San Diego, pp. 423–432.
Sharma, Y.K. and Davis, K.R.(1995) Isolation of a novel Arabidopsis ozone-inducedcDNA by differential display. Plant Molecular Biology 29, 91–98.
Sompayrac, L., Jane, S., Burn, T.C., Tenen, D.G. and Danna, K.J. (1995) Overcominglimitations of the mRNA differential display technique. Nucleic Acids Research22, 4738–4739.
Utans, U., Liang, P., Wyner, L.R., Karnovsky, M.J. and Russel, M.E. (1994) Chroniccardiac rejection: identification of five upregulated genes in transplanted heartsby differential mRNA display. Proceedings of the National Academy of SciencesUSA 91, 6463–6467.
van der Knaap, E. and Kende, H. (1995) Identification of a gibberellin-induced genein deepwater rice using differential display of mRNA. Plant Molecular Biology28, 589–592.
Wilkinson, J.Q., Lanahan, M.B., Conner, T.W. and Klee, H.J. (1995) Identification ofmRNAs with enhanced expression in ripening strawberry fruit using polymerasechain reaction differential display. Plant Molecular Biology 27, 1097–1108.
Yeatman, T.J. and Mao, W. (1995) Identification of a differentially-expressed messageassociated with colon cancer liver metastasis using an improved method ofdifferential display. Nucleic Acids Research 23, 4007–4008.
Zimmermann, J.W. and Schultz, R.M. (1994) Analysis of gene expression in thepreimplantation mouse embryo: use of the mRNA differential display. Proceed-ings of the National Academy of Sciences USA 91, 5456–5460.
62 E.P. Benito and J.A.L. van Kan
Interpretation of PCRMethods for SpeciesDefinition
P.D. Bridge1 and D.K. Arora2
1CABI BIOSCIENCES UK Centre, Bakeham Lane, Egham, Surrey,TW20 9TY, UK; 2Department of Botany, Banaras Hindu University,Varanasi 221 005, India
4.1 Introduction
The introduction of molecular biological techniques has been a major forcein the areas of systematics and population biology of filamentous fungi.Unlike the development of taxonomy with bacteria and yeasts, biochemicaltechniques did not become fully established in the systematics of filamentousfungi, and so the changes that brought about the movement from morpho-logical to molecular characteristics have been very significant. The introduc-tion of PCR-based methods has significantly increased the level of activity infungal systematics. The simplicity of the techniques, coupled with the generaluse of particular regions of the genome, has resulted in many importantadvances in our understanding of taxonomic groupings as well as theevolutionary histories and functional properties associated with them.Hawksworth (1991) and Hawksworth et al. (1995) stated that there were72,000 accepted fungal species, and that this number was growing rapidly;only 17% of these were represented in culture collections. One potentialapplication of PCR-based techniques is their utility in situations where thesample size is small, and so techniques developed for dried specimens andenvironmental samples provide opportunities to obtain information on theother 83%. Extraction and amplification of dried material from referencecollections is now a relatively straightforward procedure (Taylor and Swann,1994; Savolainen et al., 1995) and provides many opportunities for examiningboth current and earlier species concepts and variability.
The major PCR-based techniques that have been considered at thespecies level for fungi are those developed from the rRNA gene cluster andthe random amplification of polymorphic DNA. In addition, some workers
4
© CAB INTERNATIONAL 1998. Applications of PCR in Mycology(eds P.D. Bridge, D.K. Arora, C.A. Reddy and R.P. Elander) 63
have considered other conserved and variable gene regions such as chitinsynthase. The literature available for systematic applications of PCR tofungal systematics continues to grow rapidly and it is unlikely that anyreview can be entirely comprehensive and timely. However, we haveattempted to put together, in this chapter, some general examples of recentdevelopments in this area.
4.2 Species Definitions
Species concepts vary considerably across the range of filamentous fungi, andin many cases may be considered unsatisfactory. They have not, however,attracted the same attention as species concepts in some other organisms. Incases where a meiotic stage of the life cycle can be clearly defined, biologicalspecies can be described which are reproductively isolated (Jeffrey, 1973).However, this description is not available for the majority of fungi, whichhistorically have been classified into morphological or phenetic species(Hawksworth et al., 1995). In some cases ecological species have beendescribed, based on adaption to a particular niche, or in plant pathologysome species have been defined mainly on host disease symptoms or hostassociation. Morphological, ecological and pathological species are all,therefore, defined from phenetic characters, most of which will relate directlyto functional and structural attributes. PCR amplification provides informa-tion on DNA sequences and so allows the testing of hypotheses aboutstructure and relationships within phenetically defined species.
In some cases, information on DNA sequences may reinforce existingphenetic species groupings, and the species in these cases can be described aspolythetic (Hawksworth et al., 1996). However, DNA sequence informationcan also provide valuable insights into the evolutionary history of pheneticspecies, and this can be important in species where the major functionalcharacters available relate to some aspect of their environmental niche, suchas in ecological species.
4.3 Ribosomal DNA Gene Cluster
The DNA sequences that encode ribosomal RNAs have been extensivelyused to study the taxonomic relationships and genetic variations in fungi(Bruns et al., 1992; Hibbert, 1992). The ribosomal RNA gene cluster is foundin both nuclei and mitochondria, and consists of highly conserved andvariable regions which include the genes for the small 5.8S, and large rRNAsubunits (White et al., 1990). The fungal nuclear rRNA genes are arrangedas tandem repeats with several hundred copies per genome. The conservedsequences found in the large subunit (LSU) and small subunit (SSU) geneshave been exploited to study the many relationships among distantly related
64 P.D. Bridge and D.K. Arora
fungi (e.g., Gaudet et al., 1989; Bowman et al., 1992a,b; Bruns et al., 1992).The spacer regions between the subunits, called the internal transcribedspacers (ITS), and between the gene clusters, called the intergenic spacers(IGS), are considerably more variable than the subunit sequences, and havebeen used widely in studies on the relationships among species within asingle genus or among infraspecific populations (Buchko and Klassen, 1990;Spreadbury et al., 1990; Nazar et al., 1991; Taylor and White, 1991; Andersonand Stasovski, 1992; Baura et al., 1992; Kim et al., 1992; Lee and Taylor, 1992;O’Donnell, 1992; Molina et al., 1993; Erlands et al., 1994, Li et al., 1994;Buscot et al., 1996).
4.3.1 Spacer regions
There are now many examples of the use of either RFLP or sequencedifferences in the different spacer regions for discriminating between closelyrelated species within a fungal genus. Three genera where there have beenresults that highlight this approach are Verticillium, Rhizoctonia andFusarium.
4.3.2 ITS region
The ITS consist of two non-coding variable regions that are located withinthe rDNA repeats between the highly conserved small subunit, the 5.8Ssubunit, and the large subunit rRNA genes. The ITS region is a particularlyuseful area for molecular characterization studies in fungi for four mainreasons: (i) the ITS region is relatively short (500–800 bp) and can be easilyamplified by PCR using universal single primer pairs that are complementaryto conserved regions within the rRNA subunit genes (White et al., 1990); (ii)the multicopy nature of the rDNA repeat makes the ITS region easy toamplify from small, dilute or highly degraded DNA samples (Gardes andBruns, 1993); (iii) the ITS region may be highly variable among morpho-logically distinct species (Gardes and Bruns, 1991; Gardes et al., 1991; Bauraet al., 1992; Chen et al., 1992; Lee and Taylor, 1992; Gardes and Bruns, 1993)and so ITS-generated RFLP restriction data can be used to estimate geneticdistances and provide characters for systematic and phylogenetic analysis(Bruns et al., 1991); and (iv) PCR-generated ITS species-specific probes canbe produced quickly, without the need to produce a chromosomal library(Sreenivasaprasad et al., 1996) and many researchers have selected sequencesfrom the ITS region to develop species-specific probes because the sequencesoccur in multiple copies and tend to be similar within and variable betweenfungal species.
PCR-amplified rRNA ITS sequences have been used for the character-ization, identification and detection of Verticillium albo-atrum and V.dahliae (Nazar et al., 1991). In this study the identification of distinct clustersof non-homologous nucleotides in both the ITS1 and ITS2 regions enabledthe design of specific primers that provided a reliable identification/detection
PCR for Species Definition 65
method of these two important plant pathogens (Nazar et al., 1991). Thesame principle was used by Moukhamedov et al. (1993) who used sequencesfrom amplified regions of the 5.8–28S ITS regions to differentiate V. tricorpusfrom other species of Verticillium. The 5.8S sequences were found to beconserved among these species of Verticillium, but ITS regions of V. tricorpuswere sufficiently distinct to allow species-specific primer sets to be con-structed which allowed the identification of V. tricorpus from both isolatesin culture and from infected potato stems. The PCR-based protocolsdeveloped by these workers also permitted the quantification of the pathogenin diseased field plants.
The genus Rhizoctonia consists of a taxonomically diverse group ofspecies that differ in many significant features, including their sexual andasexual stages (Sneh et al., 1996). Within the important phytopathologicalspecies R. solani, further intra-specific groups have been designated on thebasis of anastomosis (anastomosis groups; AGs). Anastomosis grouping is aconvenient way of classifying isolates of the species. However, the process istime-consuming and positive results can be difficult to detect; in addition,misidentification can occur due to the varied frequency of hyphal anastomo-sis behaviour. The rRNA genes in Rhizoctonia have been examined inrelation to the different AG-types in order to develop diagnostic protocols,and to evaluate the characters for phylogenetic relationships (Cubeta et al.,1996). Originally, RFLP analysis of nuclear rDNA was undertaken withprobes and Southern blotting (Jabaji-Hare et al., 1990; Vilgalys and Gon-zales, 1990), and more recently, PCR-amplified rRNA has been found to beuseful in examining the genetic relatedness within different AGs of R. solaniand binucleate species of Rhizoctonia (Kanematsu and Naito, 1995; Liu et al.,1995; Vigalys and Cubeta, 1994; Hyakumachi et al., 1998). One example ofthese studies is the restriction analysis of amplified ITS1, ITS2 and 5.8SrDNA regions of several R. solani subgroups representing AG1 and AG2undertaken by Liu and Sinclair (1992, 1993). These workers identified sixsubgroups within AG1 and five within AG2 on the basis of their ITS-RFLPs.Recently, Liu et al. (1995) constructed restriction maps from amplifiedproducts by digestion of the 18S, ITS1, ITS2 and 5.8S rRNA regions of 25R. solani subgroups. However, at this time most subgroups within R. solaniremain largely unresolved. Boysen et al. (1996) used an asymmetric PCRtechnique on the ITS1, ITS2 and 5.8S rDNA regions with nine AG4 R. solaniisolates. These data were used in a phylogenetic analysis which identifiedthree subgroups within AG4. Mazzola et al. (1996) developed species-specific primers for the detection of R. oryzae by comparing ITS1 and ITS2sequences from R. oryzae and R. solani AG1, -5, -6 and -8. These primerswere specific to R. oryzae but not to R. solani or binucleate species. Thistechnique was then used for the detection of R. oryzae from infected wheattissues and to differentiate the infection caused by R. solani AG8 on the samehost plant. Hyakumachi et al. (1998) studied the genetic diversity amongthree subgroups of R. solani (AG-2-2, IIIB, IV and LP) using a cloned rDNA
66 P.D. Bridge and D.K. Arora
probe and RFLP of rDNA-ITS regions. They found that these AGsubgroups could be differentiated from the RFLPs of the amplified ITSregions.
The genus Fusarium is heterogeneous and the identification of individualspecies is based on morphological or biochemical criteria which can in somecases be difficult and confusing. Edel et al. (1996) differentiated severalstrains of F. oxysporum at the species level by RFLP analysis of a region ofITS and a variable domain of the 28S rDNA. Recently, Schilling et al. (1996)evaluated sequence variation in the ITS regions of F. avenaceum, F.culmorum and F. graminearum in order to distinguish between the threespecies. They found that the ITS sequences of F. culmorum and F.graminearum were not polymorphic enough to allow the construction ofspecies-specific primers; however, sufficient sequence variation was found inthe ITS1 and ITS2 regions of F. culmorum and F. graminearum to distinguishthem from F. avenaceum.
4.3.3 IGS region
In contrast to the ITS region, fewer studies have considered the IGS region.Arora et al. (1996) used RFLP derived from the IGS, located between therRNA gene clusters, to determine variability within the species Verticilliumchlamydosporium and other closely related species. They found that therewas, in general, a low level of heterogeneity in this region within species, andthat distinct IGS types could be associated with particular species. The IGSregion has also been investigated in Fusarium and Appel and Gordon (1995)found heterogeneity in this region in F. oxysporum on the basis of RFLPs ofthe PCR amplified product. Further studies on the IGS region have beenundertaken with Pythium ultimum, where length heterogeneity was found tobe due to subrepeat arrays (Klassen and Buchko, 1990). Similar longsubrepeats have also been reported in the IGS from Puccinia graminins, V.albo-atrum and V. dahliae (Kim et al., 1992; Morton et al., 1995). In P.ultimum heterogeneity in the number of conserved subrepeats was foundbetween isolates of the species (Klassen and Buchko, 1990; Buchko andKlassen, 1990), whereas in the Verticillium species there was some within-isolate variation of the less conserved subrepeats, but their overall structureand organization could be used to distinguish between the species (Mortonet al., 1995).
4.3.4 Identification and diagnosis
As already mentioned, the rDNA ITS regions have been examined from awide range of fungi in addition to the three examples given above, and oneof the most common taxonomic uses of the information obtained has beenthe development of species-specific probes and primers. The region has, forexample, been used in the taxonomy of Oomycetes, where restriction
PCR for Species Definition 67
patterns from amplified ITS and SSU products have been used to differ-entiate species of Pythium (Chen, 1992; Chen et al., 1992). Levesque et al.(1994) also used a DNA fragment from the ITS region to develop a species-specific probe for P. ultimum for routine identification. In addition, withinthe Oomycetes, Lee and Taylor (1992) have sequenced the ITS1 region fromthree species of Phytophthora and synthesized species-specific oligonucleo-tide probes derived from the non-homologous sequences.
Species-specific primers were also developed by Tisserat et al. (1994) forthe diagnosis of turfgrass patch diseases caused by Ophiosphaerella herpo-tricha and O. korrae without the need to first isolate and culture the fungusfrom the diseased tissues. Kageyama et al. (1997) have used species-specificprimers derived from ITS sequences to detect P. ultimum in naturallyinfected seedlings. Bunting et al. (1996) used ITS1 sequences to examine therelationship of Magnaporthe poae to other species in the genus that hadsimilar growth or phytopathogenic characteristics. Poupard et al. (1993) usedamplified ITS regions in their characterization of Pseudocercosporella herpo-trichoides isolates. Intraspecific variability in ITS and SSU sequences withinthe genus Gremmeniella was studied by Bernier et al. (1994). A rapididentification method was developed by Vilgalys and Hester (1990) for theidentification of Cryptococcus species from restriction patterns of ITS andother rDNA regions. Highly sensitive diagnostic assays have also beendeveloped for Leptosphaeria maculans based on ITS sequence polymorphism(Xue et al., 1992). PCR–RFLP of ITS has also allowed the discrimination ofTuber species (Henrion et al., 1994), the identification of species within theGaeumannomyces–Phialophora complex (Ward and Akrofi, 1994), Sclero-tinia species (Carbone and Kohn, 1993), Cylindrocarpon heteronema (Brownet al., 1993) and Penicillium species (Lobuglio et al., 1993). One furtherexample of a genus where extensive use has been made of the ITS region atthe species level is Colletotrichum. Sherriff et al. (1994) compared a range ofisolates of Colletotrichum species on the basis of a 886 bp region of the LSUand the ITS2 regions, and were able to use this information to distinguishbetween individual species. Further extensive species characterization hasbeen undertaken in this genus, leading to the development of a number ofspecies-specific primers (see Sreenivasaprasad et al., 1992).
At a different taxonomic level, universal primers have been developedfrom rDNA sequences which are specific for major groups of fungi. Gardesand Bruns (1993) designed two taxon-selective primers (ITS1-F and ITS4-B)from the ITS region which were specific to fungi and basidiomycetesrespectively. The primer ITS-4B when combined with universal ITS1 primersor with fungal-specific primer ITS-1F, differentiated basidiomycetes fromascomycetes. Primers ITS1-F/ITS4-B were useful for the detection ofbasidiomycete ectomycorrhizae in rust infected tissues and could be used tostudy both the distribution of rusts on alternate hosts and ectomycorrhizalcommunities. In a separate study Hopfer et al. (1993) used fungal-specificprimers from the SSU for the diagnosis of fungi in human clinical samples.
68 P.D. Bridge and D.K. Arora
The examples detailed here are just a few of the rDNA derived species-specific primers that have been developed to date, and subunit and ITSsequences are likely to continue to be a major tool in molecular identificationstrategies. Sequence databases are growing rapidly and the approachesdiscussed here, when combined with sufficient reference data, will providemajor insights into the population structures of fungal communities and thedetection of fungi from the environment.
4.4 Other Gene-based Approaches
Although much of the recent molecular research into fungal taxonomy hasbeen based on the rRNA gene cluster, other gene sequences have been usedboth to group fungi at species level and to develop specific probes. Theamplification and analysis of many functional genes are dealt with in detailelsewhere in this volume; however, two examples which demonstrate the useof these techniques in taxonomic studies are detailed here. Mehmann et al.(1994) used sequence variation in the chitin synthase genes of someectomycorrhizal fungi. They found numerous introns within the genes, andused the deduced amino acid sequences to distinguish between species andgenera. In another gene-based study, Donaldson et al. (1995) used amplifica-tion products from the H3, H4 and β-tubulin genes of Fusarium strainsassociated with conifers. They used RFLP of these products to group isolatesat species level, and also found some heterogeneity within species.
4.5 RAPD and Other Fingerprinting Methods
The random amplified polymorphic DNA (RAPD) fingerprinting assaydetects small inverted nucleotide sequence repeats throughout the genomicDNA (Welsh and McClelland, 1990; Williams et al., 1990). In RAPD–PCR,amplification involves only single primers of arbitrary nucleotide sequence.The principle of RAPD assays are discussed in detail by Hadrys et al. (1992)and Tingey and del Tufo (1993). In brief, a single primer binds to the genomicDNA on two different priming sites in an inverted orientation; amplificationbetween these points results in a discrete product. As each primer can beexpected to amplify several discrete loci in the genome the final result isgenerally a profile of amplification products of varying sizes. In addition, atthe primer attachment stage in the amplification the annealing temperature iskept low which also encourages a degree of primer mismatching, andincreases the potential number of amplification products. RAPD–PCR hasmany advantages: (i) no prior information for DNA sequence is needed. Theprotocol is relatively simple and quick and only nanogram quantities ofDNA are required to give a PCR product; (ii) the technique is preferredwhen the genotypes of a large number of species, population or pathotypes
PCR for Species Definition 69
have to be discriminated. RAPD markers can also be used to analyse thegenotypes of fusion products and parents at different taxonomic levels; (iii)this is a good tool for creating genetic maps (Judelson et al., 1995) and hasproved to be an efficient method for the identification of molecular markers(Tingey and del Tufo, 1993); and (iv) the technique is suitable for studyingpopulation genetics and has been successfully used to differentiate amongspecies and strains within species of plants, bacteria, animals and fungi (seeWilliams et al., 1990).
RAPD–PCR assays have been used extensively to define fungal popula-tions at species, infraspecific, race and strain levels. In general, most studieshave concentrated on infraspecific grouping, although others have beendirected at the species level. Some examples of RAPD–PCR at species levelinclude the production of species-specific probes and primers from RAPDdata for Fusarium oxysporum f. sp. dianthi, Phytophora cinnamomi, Tubermagnatum and Glomus mosseae (Dobrowolski and O’Brien, 1993; Lan-franco et al., 1993, 1995; Manulis et al., 1994). In some RAPD–PCR studies,band patterns have been used to differentiate both within and betweenindividual species, as exemplified by species of Metarhizium and Candida(Lehmann et al., 1992; Bridge et al., 1997a).
In general, RAPD–PCR has been used most widely to discriminate at aninfraspecific level, particularly in the determination of distinct infraspecificgroups such as anastomosis groups in Rhizoctonia solani (Duncans et al.,1993) and pathogen groups (Crowhurst, 1991; Levey et al., 1991; Guthrie etal., 1992; Assigbetse et al., 1994; Bidochka et al., 1994; Burmester andWostemeyer, 1994; Nicholson and Rezanoor, 1994; Yates-Siilata et al., 1995;Bridge et al., 1997a; Maurer et al., 1997). Another application of RAPD–PCRhas been in the determination of individual strains within a particularpopulation, some examples being toxin-producing strains of Aspergillusflavus (Bayman and Cotty, 1993), and in strain authentication in species ofTrichoderma (Fujimori and Okuda 1994; Schlick et al., 1994).
Single, simple repetitive primers have been designed to amplify themicrosatellite regions of fungal chromosomal DNA (Meyer et al., 1992;Schlick et al., 1994; Bridge et al., 1997b). In most applications these primershave given similar levels of specificity to those seen with RAPD, and soresults have been used to group fungi at infraspecific levels (e.g. Bridge et al.,1997a). However, in some instances microsatellite-primed PCR has beenused to generate species-specific patterns, and one recent example of this isthe work on morels by Buscot et al. (1996) who found considerablehomogeneity from both mono- and polysporic isolates of individual species.Further repetitive sequences have been examined for use in fungal system-atics, including primers derived from the M13 bacteriophage internal repeat,and the bacterial repetitive extragenic palindromic (REP) and enterobacterialrepetitive intergenic consensus (ERIC) sequences (Hulton et al., 1991;Versalovic et al., 1991; Meyer et al., 1992). These primers have so far provideddifferentiation at the infraspecific level, allowing differentiation of closely
70 P.D. Bridge and D.K. Arora
related isolates within single species (Edel et al., 1995; Arora et al., 1996;Bridge et al., 1997b).
4.6 Interpretation of Data
As will already be apparent, a variety of different DNA sequences have beenamplified and used in the determination of fungal species. The informationavailable from these studies also varies widely, with some studies presentingfull sequences, while others have suggested partially characterized oruncharacterized DNA fragments as species markers (Carbone and Kohn,1993; Mehmann et al., 1994; Ward and Akrofi, 1994; Faris-Mokaiesh et al.,1996). Most filamentous fungi cannot be grouped into traditional biologicalspecies, and the species epithet has been applied at different population levelsbetween and within different genera. As a result, the degree of variabilityobserved within one species will not necessarily be comparable with thatfound in another. This is not surprising given the large differences inevoloutionary age among filamentous fungi, and this can be clearly demon-strated by comparing the variability observed within specific pathogens,which may be recently evolved, such as species of Colletotrichum (Sreeniva-saprasad et al., 1992), and the variability in presumably long-establishedsaprobic species such as lichen-forming fungi (Gargas and Taylor, 1995).These differences in variability within populations, therefore, make it verydifficult to select any one molecular technique as the definitive method fordefining fungal species. In practice what is occurring within mycology is agradual refinement and redefinition of some species with various criteria, inconjunction with other, often phenotypic, properties.
This redefinition will be particularly useful in matching anamorph andteleomorph states, as most DNA sequences can be expected to be consistentbetween the two states. In cases where an anamorph–teleomorph connectionis suspected this may be confirmed by comparitive sequence analysis ofamplified products as in the placing of Sporothrix schenckii within Ophio-stoma (Berbee and Taylor, 1992), or as has been demonstrated withSclerotinia and Sclerotium which showed 98% sequence homology in theITS1 region of rDNA (Carbone and Kohn, 1993).
4.6.1 Sample size
As the level of variability for any particular molecular characteristic willdiffer between species, the size of the population considered can be extremelyimportant. In some cases the sample size will be limited by the number ofisolates available, and in other instances the cosmopolitan nature of thefungus may require the collection of a wide range of isolates from differenthosts and geographic locations. Examples of this latter case are Fusariumoxysporum and Beauveria bassiana, which are widespread pathogens of
PCR for Species Definition 71
vascular plants and insects, respectively. Within both of these species PCR-based methods have been used to identify host specific populations (Kelly etal., 1994; Neuveglise et al., 1994; Bentley et al., 1995: Maurer et al., 1997), andthese would need to be represented in any definition of the species. PCR-based methods have also been used to define much more restrictedpopulations such as Pneumocystis carinii (Liu et al., 1992), and againsequence differences have been identified between populations from differ-ent hosts (Wakefield et al., 1990). The method of analysis used for the datashould be appropriate to the sample size and spread, and studies based onmany isolates of one species and few representatives of many others mayrequire careful consideration.
4.6.2 RAPD and other fingerprinting methods
RAPD band patterns and other DNA fingerprinting techniques have beenused to define some fungal species, and in these studies species-specificbands, or combinations of bands, have been described. In these techniquesthere is the assumption that bands with identical mobility and stainingintensity are of the same or very similar sequence. In general this is notalways known, and a further problem is the lack of knowledge as to whetherthe marker bands consist of coding or non-coding sequences, and as towhether they may represent genes that could be regarded as under selection.There is now some evidence in other organisms that RAPD bands may notbe entirely random and that different bands may be homologous (Rieseberg,1996).
Other features that must be considered when using fingerprintingmethods to define species are the potential for random mutation at thefingerprint loci and the sensitivity of the target sequences to crossover andsegregation during meiosis (Wu and Magill, 1995). Both of these events havebeen reported in fungi and may lead to different patterns being obtainedfrom parents and progeny. However, the stability of some fingerprintingmethods within some asexually (mitotically) reproducing fungal species hasbeen established, and fingerprinting methods may, in many cases, givespecies-specific bands or band patterns (Dobrowolski and O’Brien, 1993;Potenza et al., 1994).
4.6.3 Amplification and analysis of the rRNA gene cluster
There have been many applications of the rRNA gene cluster at the species levelwith filamentous fungi, ranging from simple size comparisons to extensivesequence analyses. Interpretation of these data is, however, not alwaysstraightforward as there can be considerable variations between differentfungal species. As previously mentioned, the species Fusarium oxysporumconsists of many different host plant-specific special forms, subdivided intopathogenic races and vegetative compatibility groups. PCR amplification ofthe ITS region of the rRNA gene cluster, and subsequent RFLP analysis, has
72 P.D. Bridge and D.K. Arora
been used within this species to designate subspecific groups (Oullet andSeifert, 1993; Kelly et al., 1994; Bentley et al., 1995). However, within the genusColletotrichum, species have been delineated on the basis of very smalldifferences in these sequences (Mills et al., 1992; Sreenivasaprasad et al., 1992).
The interpretation of rRNA data in fungal taxonomy is further compli-cated by the presence of introns within the subunit genes. Many insertionsites have been described in both the large and small subunits and these havebeen described as possibly important factors in the evolution of fungi(Neuveglise and Brygoo, 1994; Gargas and DePriest, 1996).
A further important consideration concerns the type and copy numberof the rRNA gene cluster itself. While this gene cluster is often described as‘multi-copy’, in that it may be found in many different parts of the totalfungal genome, the different occurrences are not due to recent copying, anda mutation in one copy will not necessarily be present at all sites. Thisoccurrence is generally accepted to be prevented by concerted evolution,which maintains the homogeneity of the gene cluster and spacer regions(Hillis and Dixon, 1991; Appel and Gordon, 1995). However, there is a small,but increasing, number of publications which suggests that more than oneform of the rRNA genes may exist within a single organism. This occurrencehas previously been described in a variety of organisms including bacteria,nematodes, insects and mammals (Zijlstra et al., 1995; Kuo et al., 1996;Rainey et al., 1996) and has recently been reported for filamentous andlichen-forming fungi, where some copies of the rRNA gene cluster aresuspected to contain sequence differences and can include insertionsequences (DePriest, 1993; Harlton et al., 1995; Sanders et al., 1995). Thesignificance of these events in the interpretation of data for fungal taxonomyhas not yet been fully investigated. In addition, the likelihood of detectingsuch occurrences, given the competitive nature and concentration depend-ency of the PCR reaction has not been widely considered.
There is an additional single copy rRNA gene cluster located on the mito-chondrial DNA of fungi. This region has also been used to develop specificprobes and PCR primers for the identification of fungal species (Gardes et al.,1991; Wakefield et al., 1991; Li et al., 1994). As a ‘single copy’ gene this would befree from the complications of different forms being present, and, as mitochon-drial DNA is generally transmitted by uniparental inheritance, the gene wouldbe expected to be largely free of recombination effects.
Although the above are important considerations which may be relevantin some areas, many species-specific probes and primers have been designedfor fungi from rRNA gene and spacer sequences.
4.7 Numerical Methods for Representing Species
Numerical methods for representing species can be divided very broadly intotwo groups: those that are used merely to group similar organisms (phenetic);
PCR for Species Definition 73
and those that imply some path or measure of evolution (phylogenetic)(Sneath, 1993).
The development of PCR-based techniques has resulted in the avail-ability of considerable amounts of DNA sequence data that can be used fordirect taxonomic purposes. However, the raw data as obtained in thesestudies can be considered as being phenetic rather than phylogenetic, as theactual data collected are a series of observed (genomic) properties. In orderto be correctly termed phylogenetic some measure of time would berequired, and this is inferred through the subsequent analyses, rather thandirectly recorded with the data (Sneath, 1993). As sequence data or bandpatterns can be treated as phenetic characters, then many of the well-established numerical taxonomy techniques can be utilized to identify orsubdivide species groups. Phylogenetic techniques are covered in detailelsewhere in this volume.
Most non-phylogenetic analyses of fungal data have been based oncomparing band patterns from RFLP, RAPD or simple repetitive primerapproaches (Assigbetse et al., 1994; Pipe et al., 1995; Fungaro et al., 1996;Mordue et al., 1996; Waalwijk et al., 1996). In these analyses, individualbands are considered as equivalent independent characters and so bandpatterns are usually converted into binary tables. Similarities are derivedfrom established coefficients, and the relationships between isolates are mostcommonly represented as dendrograms. There are, however, two importantfactors that must be taken into account in this type of analysis, the first is therelevance of matching negative characters, and the second is the suitability ofa hierarchical representation.
4.7.1 Similarity coefficients
The majority of dendrograms derived from fungal DNA fragments havebeen derived with one of three coefficients, the simple matching coefficient,Jaccard’s coefficient and Nei and Li’s genetic distance. The last two ofthese coefficients do not consider matching negative results, that is, theydo not consider the absence of a particular band in two organisms as asimilarity, unlike the simple matching coefficient where matching positiveand negative results are considered equally (Sneath and Sokal, 1973; Neiand Li, 1979; Bridge, 1992). The validity of considering matching negativecharacters has been discussed on many occasions (see Sneath and Sokal,1973; Abbott et al., 1985) but it is perhaps worth further considerationfor solely gel-derived data. When numerical methods are not used andgel patterns are compared by eye the operator will use the presence andabsence of bands to designate patterns. Therefore, the inclusion ofmatching negatives within a numerical system may be considered asrepresentative of this, and shape coefficients such as the correlationcoefficient have been used in this way in automated gel comparison
74 P.D. Bridge and D.K. Arora
software. However, in taxonomic studies matching negative characters maybe acceptable when the characters themselves are relevant and comparisonis meaningful. This may be the case where band patterns are derived fromRFLP data, and absence of bands can be directly related to sequenceinformation at the restriction site. However, when bands are of unknownorigin, such as in RAPD studies, then their relevance cannot be quantified,and it would seem most appropriate to use coefficients that discountmatching negatives.
4.7.2 Representation
As described above, numerical values are often clustered to givedendrograms, and it is important to consider the appropriateness of thisapproach. Cluster analysis will always result in the linking of all organisms,no matter how closely or distantly related. One consequence of this isthe tendency of markers or distantly related organisms to cluster togetheras they are similar in that they are different from the rest of the organisms(see Sneath and Sokal, 1973). This situation can arise when the majorityof the isolates used in a study belong to a single group, and the remainderare members of different taxa. A further complication can occur withaveraging methods such as UPGMA, where the average value obtainedfrom similar values (closely related isolates) is representative of the truesimilarity, whereas average values obtained from widely different values(distantly related isolates) may not be truly representative (see Abbott etal., 1985). The practical outcome of these occurrences is that clusteranalysis is very good at determining relationships within groups andbetween closely related groups, but may not give an accurate representationof more distant relationships. Where data have been obtained from manymembers of one or several closely related taxa, cluster anlaysis will bean appropriate technique. However, when several members of a singlespecies are compared with small numbers of other species, cluster analysismay not be appropriate.
An alternative to cluster analysis is the use of one of the non-hierarchicalmultivariate techniques such as principal component or principal coordinateanalyses. These techniques place organisms on the basis of the overallvariability contained within the data, and in contrast to clustering, thesetechniques provide a more faithful representation of inter-group relation-ships (see Sneath and Sokal, 1973; Alderson, 1985). Ordination techniqueshave, therefore, advantages in determining relationships between species,particularly where there may be wide differences in similarity values.Ordination techniques have not been widely used with fungal PCR data,although one of the few such studies published has shown that ordinationwas superior to cluster analysis in arriving at final species level groupings(Bridge et al., 1997a).
PCR for Species Definition 75
4.8 Conclusions
PCR-based methods offer many new tools that are directly applicable tofungal systematics at the species level. These tools can be used to delimit andto determine relationships among species, either by direct comparison orthrough phylogenetic analyses. PCR-based methods have given a greaterinsight into molecular variability within fungi and have highlighted the needto consider carefully sampling strategies and sample sizes, prior to makingtaxonomic decisions. This insight has also shown that molecular variabilityis not constant within different fungal species, and levels of both homo- andheterogeneity will vary depending upon the species studied. Perhapssurprisingly, the introduction of PCR-based techniques has not led to awidespread revision of fungal species names and concepts, and in many casesexisting species concepts have been reinforced. However, the wide range ofmolecular heterogeneity found in some species has led to the suggestion thatthere may be many more ‘cryptic’ and undescribed species within existingcollections. Where PCR-based methods will have a very significant impact isin the study of the 83% of known species that do not grow in culture, andthe hope is that these techniques may, in future, provide many answers tobasic questions in systematics and biodiversity that are currently unan-swered.
References
Abbott, L.A., Bisby, F.A. and Rogers, D.J. (1985) Taxonomic Analysis in Biology.Columbia University Press, New York.
Alderson, G. (1985) The application and relevance on nonhierarchic methods inbacterial taxonomy. In: Goodfellow, M., Jones, D. and Priest, F.G. (eds)Computer-assisted Bacterial Systematics, Academic Press, London, pp. 227–263.
Anderson, J.B. and Stasorski, E. (1992) Molecular phylogeny of Northern Hemi-sphere species of Armillaria. Mycologia 84, 505–576.
Appel, D.J. and Gordon, T.R. (1995) Intraspecific variation within populations ofFusarium oxysporum based on RFLP analysis of the intergenic spacer region ofthe rDNA. Experimental Mycology 19, 120–128.
Arora, D.K., Hirsch, P.R. and Kerry, B.R. (1996) PCR-based molecular discrimina-tion of Verticillium chlamydosporium isolates. Mycological Research 100,801–809.
Assigbetse, K.B., Fernandez, D., Dubois, M.P. and Geiger, J.-P. (1994) Differentiationof Fusarium oxysporum f. sp. vasinfectum races on cotton by random amplifiedpolymorphic DNA (RAPD) analysis. Phytopathology 84, 622–626.
Baura, G., Szaro, T.M. and Bruns, T.D. (1992) Gatrosuillus laricinus is a repeatderivative of Suillus grevellei: molecular evidence. Mycologia 84, 592–597.
Bayman, P. and Coty, P.J. (1993) Genetic diversity in Aspergillus flavus: associationwith aflatoxin production and morphology. Canadian Journal of Botany 71,23–31.
76 P.D. Bridge and D.K. Arora
Bentley, S., Pess, K.G. and Dale, J.L. (1995) Genetic variation among a worldwidecollection of isolates of Fusarium oxysporum f. sp. cubense analysed by RAPD–PCR fingerprinting. Mycological Research 99, 1378–1384.
Berbee, M.L. and Taylor, J.W. (1992) 18S ribosomal RNA gene sequence charactersplace the human pathogen Sporothrix schenckii in the genus Ophiostoma.Experimental Mycology 16, 87–91.
Bernier, L., Hamelin, R.C. and Ouellete, G.B. (1994) Comparison of ribosomal DNAlength and restriction site polymorphsims in Gremmeniella and Ascocalyxisolates. Applied and Environmental Microbiology 60, 1279–1286.
Bidochka, M.J., McDonald, M.A. St Leger, R.J. and Roberts, D.W. (1994) Differ-entiation of species and strains of entomopathogenic fungi by random amplifica-tion of polymorphic DNA (RAPD). Current Genetics 25, 107–113.
Bowman, B.H., Taylor, J.W., Browilee, A.G., Lee, J., Lu, S. and White, T.J. (1992a)Molecular evolution of the fungi: relationship of basidiomycetes, ascomycetesand chytridiomycetes. Molecular Biology and Evolution 9, 285–296.
Bowman, B.H., Taylor, J.W. and White, T.J. (1992b) Molecular evolution of the fungi:human pathogens. Molecular Biology and Evolution 9, 893–904.
Boysen, M., Bojra, M., del Moral C., Salzar, O. and Rubio, V. (1996) Identificationat strain level of Rhizoctonia solani AG4 isolates by direct sequence ofasymmetric PCR products of the ITS regions. Current Genetics 29, 174–181.
Bridge, P.D. (1992) Classification. In: Fry, J.C. (ed.) Biological Data Analysis: aPractical Approach, IRL Press, Oxford, pp. 219–242.
Bridge, P.D., Prior, C., Sagbohan, J., Lomer, C.J., Carey, M. and Buddie, A. (1997a)Molecular characterization of isolates of Metarhizium from locusts and grass-hoppers. Biodiversity and Conservation 6, 177–189.
Bridge, P.D., Pearce, D.A., Rivera, A. and Rutherford, M.A. (1997b) VNTR derivedoligonucleotides as PCR primers for population studies in filamentous fungi.Letters in Applied Microbiology 24, 426–430.
Brown, A.E., Muthumeenakshi, S., Sreenivasaprasad, S., Mills, P.R. and Swinburne,T.R. (1993) A PCR primer-specific to Cylindrocarpon heteronema for detectionof the pathogen in apple wood. FEMS Microbiology Letters 108, 117–120.
Bruns, T.D., White, T.J. and Taylor, J.W. (1991) Fungal molecular systematics. AnnualReview of Ecology and Systematics 22, 525–564.
Bruns, T.D., Vilgalys, R., Barns, S.M., Gonzalez, D., Hibbert, D.S., Lane, D.J., Simon,L, Stickel, S., Szaro, T.M., Weisburg, W.G. and Sogin, M.L. (1992) Evolutionaryrelationships within fungi: analysis of nuclear small subunit rRNA sequences.Molecular Phylogeny and Evolution 1, 231–241.
Buchko, J. and Klassen, G.R. (1990) Detection of length hetrogeneity in theribosomal DNA of Pythium ultimum by PCR amplification of the intergenicregion. Current Genetics 18, 203–205.
Bunting, T.E., Plumley, K.A., Clarke, B.B. and Hillman, B.I. (1996) Identification ofMagnaporthe poae by PCR and examination of its relationship to other fungi byanalysis of their nuclear rDNA ITS1 regions. Phytopathology 86, 389–404.
Burmester, A. and Wostemeyer, J. (1994) Variability in genome organization of thezygomycete Parasitella parasitica. Current Genetics 26, 456–460.
Buscot, F., Wipf, D., Di Battista, C., Munch, J.-C., Botton, B. and Martin, F. (1996)DNA polymorphism in morels: PCR–RFLP analysis of the ribosomal DNAspacers and microsatellite-primed PCR. Mycological Research 100, 63–71.
Carbone, I. and Kohn, L.M. (1993) Ribosomal DNA sequence divergence within
PCR for Species Definition 77
internal transcribed spacers 1 of the Sclerotiniaceae. Mycologia 85, 415–427.Chen, W. (1992) Restriction fragment length polymorphism in enzymatically
amplified ribosomal DNAs of three heterothallic Pythium species. Phytopathol-ogy 82, 1467–1472.
Chen, W., Hoy, J.W. and Schneider, R.W. (1992) Species-specific polymorphism intranscribed ribosomal DNA of five Pythium species. Experimental Mycology 16,22–34.
Crowhurst, R.N., Hawthorne, B.T., Rikkerink, E.H.A. and Templeton, M.D. (1991)Differentiation of Fusarium solani f. sp. Curcubitae races 1 and 2 by randomamplification of polymorphic DNA. Current Genetics 20, 391–396.
Cubeta, M.A., Vilgayus, R. and Gonzalez, D. (1996) Molecular analysis of ribosomalRNA genes in Rhizoctonia fungi. In: Sneh, B., Jabaji-Hare, S., Neate, S. andDijst, G. (eds) Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology,Pathology and Disease Control. Kluwer Academic Press, Dordrecht, pp. 81–86.
DePriest, P.T. (1993) Small subunit rDNA variation in a population of lichen fungidue to optional group I introns. Gene 134, 67–74.
Dobrowolski, M.P. and O’Brien, P.A. (1993) Use of RAPD–PCR to isolate a speciesspecific DNA probe for Phytophora cinnamomi. FEMS Microbiology Letters113, 43–48.
Donaldson, G.C., Ball, L.A., Axelrood, P.E. and Glass, N.L. (1995) Primer sets toamplify conserved genes from filamentous ascomycetes are useful in differ-entiating Fusarium species associated with conifers. Applied and EnvironmentalMicrobiology 61, 1331–1340.
Duncans, S., Barton, J.E. and O’Brien, P.A. (1993) Analysis of variation in isolates ofRhizoctonia solani by random amplified polymorphic DNA assay. MycologicalResearch 97, 1075–1082.
Edel, V., Steinberg, C., Avelange, I., Laguerre, G. and Alabouvette, C. (1995)Comparison of three molecular methods for the characterization of Fusariumoxysporum strains. Phytopathology 85, 579–585.
Edel, V., Steinberg, C., Goutheron, N. and Alabouvette, C. (1996) Differentiation ofFusarium species by restriction fragment length polymorphism analysis of PCR-amplified ribosomal DNA. First International Fusarium Biocontrol Workshop.Beltsville Agricultural Research Center, USA, p. 21.
Faris-Mokaiesh, S., Boccara, M., Denis J.-B., Derrien, A. and Spire, D. (1996)Differentiation of the Ascochyta complex fungi of pea by biochemical andmolecular markers. Current Genetics 29, 182–190.
Fujimori, F. and Okuda, T. (1994) Application of the random amplified polymorphicDNA using the polymerase chain reaction for efficient elimination of duplicatestrains in microbial screening. I. Fungi. Journal of Antibiotics (Tokyo) 47,173–182.
Fungaro, M.H.P., Vieira, M.L.C., Pizzirani-Kleiner, A.A. and de Azevedo, J.L. (1996)Diversity among soil and insect isolates of Metarhizium anisopliae var. anisopliaedetected by RAPD. Letters in Applied Microbiology 22, 389–392.
Gardes, M. and Bruns, T.D. (1991) Rapid characterization of ectomycorrhizae usingRFLP pattern of their PCR amplified-ITS. Mycological Society Newsletter 41,14.
Gardes, M. and Bruns, T.D. (1993) ITS primers with enhanced specificity forbasidiomycetes application to the identification of mycorrhizae and rusts.Molecular Ecology 2, 113–118.
78 P.D. Bridge and D.K. Arora
Gardes, M, White, T.J., Fortin, J.A., Bruns, T.D. and Taylor J.W. (1991) Identificationof indigenous and introduced symbiotic fungi in ectomycorrhizae by amplifica-tion of nuclear and mitochondrial ribosomal DNA. Canadian Journal of Botany69, 180–190.
Gargas, A. and DePriest, P.T. (1996) A nomenclature for fungal PCR primers withexamples from intron-containing SSU rDNA. Mycologia 88, 745–748.
Gargas, A., DePriest, P.T. and Taylor, J.W. (1995) Positions of multiple insertions inSSU rDNA of lichen-forming fungi. Molecular Biology and Evolution 12,208–218.
Gaudet, J., Julien, J., Lafay, J.F. and Brygoo, Y. (1989) Phylogeny of some Fusariumspecies, as determined by large subunits rRNA sequence comparison. MolecularBiology and Evolution 6, 227–242.
Guthrie, P.A.I., Magill, C.W., Frederiksen, R.A. and Odvordy, G.N. (1992) Randomamplified polymorphic DNA markers: a system for identifying and differ-entiating isolates of Colletotrichum graminicola. Phytopathology 82, 832–835.
Hadrys, H., Balick, M. and Schiewater, B. (1992) Applications of random ampli-fied polymorphic DNA (RAPD) in molecular ecology. Molecular Ecology 1,55–63.
Harlton, C.E. and Levesque, C.A. and Punja, Z.K. (1995) Genetic diversity inSclerotium (Athelia) rolfsii and related species. Phytopathology 85, 1269–1281.
Hawksworth, D.L. (1991) The fungal dimension of biodiversity: magnitude, sig-nificance and conservation. Mycological Research 95, 641–655.
Hawksworth, D.L., Kirk, P.M., Sutton, B.C. and Pegler, D.N. (1995) Ainsworth andBisby’s Dictionary of the Fungi, 8th edn. CAB International, Wallingford.
Henrion, B., Chevalier, G. and Martin, F. (1994) Typing truffle species by PCRamplification of ribosomal DNA spacers. Mycological Research 98, 37–43.
Hibbert, D.S. (1992) Ribosomal RNA and fungal systematics. Transactions of theMycological Society of Japan 33, 533–556.
Hillis, D.M. and Dixon, M.T. (1991) Ribosomal DNA: molecular evolution andphylogenetic inference. Quarterly Reviews in Biology 66, 411–453.
Hopfer, R.L., Walden, P., Setterquist, S. and Highsmith, W.E. (1993) Detection anddifferentiation of fungi in clinical specimens using polymerase chain reaction(PCR) amplification and restriction enzyme analysis. Journal of Medical andVeterinary Mycology 31, 65–75.
Hulton, C.S.J., Higgins, C.F. and Sharp, P.M. (1991) ERIC sequences: a novel familyof repetitive elements in the genomes of Escherichia coli, Salmonella typhimu-rium and other enterobacteria. Molecular Microbiology 5, 825–834.
Hyakumachi, M., Mushika, T., Ogiso, Y., Toda, T., Kageyama, K. and Tsuge, T. (1998)Characterization of a new cultural type LP of Rhizoctonia solani AG2-2 isolatedfrom warm season turfgrasses, and its genetic differentiation from other culturaltypes. Plant Pathology (in Press).
Jabaji-Hare, S.H., Meller, Y., Gill, S. and Charest, P.M. (1990) Investigation of geneticrelatedness among anastomosis groups of Rhizoctonia solani using cloned DNAprobes. Canadian Journal of Plant Pathology 12, 393–404.
Jeffrey, C. (1973) Biological Nomenclature, 2nd edn. Edward Arnold, London.Judelson, H.S., Spielman, L.J. and Shattock, R.C. (1995) Genetic mapping and non-
Mendelian segregation of mating type loci in the oomycete, Phytophthorainfestans. Genetics 141, 503–512.
Kageyama, K., Ohyama, A. and Hyalcumach, M. (1997) Detection of Pythium
PCR for Species Definition 79
ultimum using polymerase chain reaction with species-specific primers. PlantDisease 81, 1155–1160.
Kanematsu, S. and Naito, S. (1995) Genetic characterization of Rhizoctonia solani AG2-3 by analysing restriction fragment length polymorphism of nuclear ribosomalDNA internal transcribed spacers. Annals of the Phytopathological Society ofJapan 61, 18–21.
Kelly, A., Alcala-Jimenez, A.R., Bainbridge, B.W., Heale, J.B., Perez-Artes, E. andJimenez-Dıaz, R.M. (1994) Use of genetic fingerprinting and random amplifiedpolymorphic DNA to characterize pathotypes of Fusarium oxysporum f.sp.ciceris infecting chickpea. Phytopathology 84, 1293–1298.
Kim, W.K., Zuerucha, T. and Klassen, G.R. (1992) A region of heterogeneity adjacentto 5S ribosomal RNA genes of cereal rusts. Current Genetics 22, 101–105.
Klassen, G.R. and Buchko, J. (1990) Subrepeat structure of the intergenic region inthe ribosomal DNA of the oomycetous fungus Pythium ultimum. CurrentGenetics 17, 125–127.
Kuo, B.A., Gonzalez, I.L., Gillespie, D.A. and Sylvester, J.E. (1996) Humanribosomal RNA variants from a single individual and their expression indifferent tissues. Nucleic Acids Research 24, 4817–4824.
Lanfranco, L., Wyss, P., Marzachi, C. and Bonfante, P. (1993) DNA probes for theidentification of the ectomycorrhizal fungus Tuber magnatum Pico. FEMSMicrobiology Letters 114, 245–251.
Lanfranco, L. Wyss, P, Marzachi, C. and Bonfante, P. (1995) Generation of RAPD–PCR primers for the identification of isolates of Glomus mosseae, an arbuscularmycorrhizal fungus. Molecular Ecology 4, 61–68.
Lee, S.B. and Taylor, J.W. (1992) Phylogeny of five fungus-like protoctistanPhytophthora species, inferred from the internal transcribed spacers of ribosomalDNA. Molecular Biology and Evolution 9, 636–653.
Lehmann, P.F., Lin, D. and Lasker, B.A. (1992) Genotypic identification andcharacterization of species and strains within the genus Candida by usingrandom amplified polymorphic DNA. Journal of Clinical Microbiology 30,3249–3254.
Levesque, C.A., Vrain, C.T. and deBoer, S.H. (1994) Development of a species-specific probe for Pythium ultimum using amplified ribosomal DNA. Phytopa-thology 84, 874–878.
Levy, M., Romao, J., Marchetti, M.A. and Hamer, J.E. (1991) DNA with a dispersedrepeated sequence resolves pathotype diversity in the rice blast fungus. The PlantCell 3, 95–105.
Li, K.N., Rouse, D.I. and German, T.L. (1994) PCR primers that allow intergenericdifferentiation of ascomycetes and their application to Verticillium spp. Appliedand Environmental Microbiology 60, 4324–4331.
Liu, Y., Rocourt, M., Pan, S., Liu, C. and Leibowitz, M.J. (1992) Sequence andvariability of the 5.8S and 26S rRNA genes of Pneumocystis carinii. Nucleic AcidsResearch 20, 3763–3772.
Liu, Z.L. and Sinclair, J.B. (1992) Genetic diversity of Rhizoctonia solani anastomosisgroup 2. Phytopathology 82, 778–787.
Liu, Z.L. and Sinclair, J.B. (1993) Differentiation of intraspecific groups withinanastomosis group I of Rhizoctonia solani species complex. Mycologia 85,797–800.
Liu, Z.L., Domier, L.L. and Sinclair, J.B. (1995) Polymorphism of genes coding for
80 P.D. Bridge and D.K. Arora
nuclear 18S rRNA indicates genetic distinctness of anastomosis group 10 fromother groups in Rhizoctonia species complex. Applied and EnvironmentalMicrobiology 61, 2659–2664.
Lobuglio, K.F., Pitt, J.I. and Taylor, J.W. (1993) Phylogenetic analysis of tworibosomal DNA regions indicates multiple independent losses of a sexualTalaromyces state among asexual Penicillium species in subgenus Biverticillium.Mycologia 85, 592–604.
Manulis, S., Kogan, N., Reuven, M. and Ben-Yephet, Y. (1994) Use of RAPDtechnique for identification of Fusarium oxysporum f. sp. dianthi from carnation.Phytopathology 84, 98–101.
Maurer, P., Couteaudier, Y., Girard, P.A., Bridge, P.D. and Riba, G. (1997) Geneticdiversity of Beauveria bassiana (Bals.) Vuill. and relatedness to host insect range.Mycological Research 101, 159–164.
Mazzola, M., Wong, O.T. and Cook, R.J. (1996) Virulence of Rhizoctonia oryzae andR. solani AG-8 on wheat and detection of R. oryzae in plant tissues by PCR.Phytopathology 86, 354–360.
Mehmann, B., Brunner, I. and Braus, G.H. (1994) Nucleotide sequence variation ofchitin synthase genes among ectomycorrhizal fungi and its potential use intaxonomy. Applied and Environmental Microbiology 60, 3105–3111.
Meyer, W., Morawetz, R., Borner, T. and Kubicek, C.P. (1992) The use of DNA-fingerprint analysis in the classification of some species of the Trichodermaaggregate. Current Genetics 21, 27–30.
Mills, P.R., Sreenivasaprasad, S. and Brown, A.E. (1992) Detection and differentiationof Colletotrichum gloeosporiodes isolates using PCR. FEMS Microbiology Letters98, 137–144.
Molina, F.I., Jong, S. and Huffman, J.L. (1993) PCR amplification of the 3 externaltranscribed and intergenic spacers of the ribosomal DNA repeat unit in threespecies of Saccharomyces. FEMS Microbiology Letters 108, 259–264.
Mordue, J.E.M., Banniza, S., Bridge, P.D. and Rutherford, M.A. (1996) Integratedbiochemical, cultural and numerical methods. In: Sneh, B., Jabaji-Hare, S., Neate,S. and Dijst, G. (eds) Rhizoctonia Species: Taxonomy, Molecular Biology,Ecology, Pathology and Disease Control. Kluwer Academic, Dordrecht,pp. 87–98.
Morton, A., Tabrett, A.M., Carder, J.H. and Barbara, D.J. (1995) Sub-repeatsequences in the ribosomal RNA intergenic regions of Verticillium alboatrumand V. dahliae. Mycological Research 99, 257–266.
Moukhamedov, R., Hu, X., Nazar, R.N. and Robb, J. (1993) Use of polymerase chainreaction-amplified ribosomal intergenic sequences for the diagnosis of Verti-cillium tricorpus. Phytopathology 84, 256–259.
Nazar, R.N., Hu, X, Schmidt, J., Culham, D. and Robb, J. (1991) Potential use ofPCR amplified ribosomal intergeneic sequences in the detection and differ-entiation of Verticillium wilt pathogen. Physiological and Molecular PlantPathology 39, 1–11.
Nei, M. and Li, W.H. (1979) Mathematical model for studying genetic variation interms of restriction endonucleases. Proceedings of the National Academy ofSciences USA 76, 5269–5273.
Neuveglise, C., Brygoo, Y. (1994) Identification of group-I introns in the 28S rDNAof the entomopathogenic fungus Beauveria brogniartii isolated from insects.Current Genetics 27, 38–45.
PCR for Species Definition 81
Neuveglise, C., Brygoo, Y., Vercambre, B. and Riba, G. (1994) Comparative analysisof molecular and biological characteristics of strains of Beauveria brongniartiiisolates from insects. Mycological Research 98, 322–328.
Nicholson, P. and Rezanoor, H.N. (1994) The use of random amplified polymorphicDNA to identify pathotype and detect variation in Pseudocercosporella herpo-trichoides. Mycological Research 98, 13–21.
O’Donnel, K.L. (1992) Ribosomal DNA internal transcribed spacers are highlydivergent in the phytopathogenic ascomycetes Fusarium sambucinum (Gibber-ella pulicaris). Current Genetics 22, 213–220.
Ouellet, T. and Seifert, K.A. (1993) Genetic characterization of Fusarium grami-nearum strains using RAPD and PCR amplification. Phytopathology 83,1003–1007.
Pipe, N.D., Chandler, D., Bainbridge, B.W. and Heale, J.B. (1995) Restrictionfragment length polymorphisms in the ribosomal RNA gene complex of isolatesof the entomopathogenic fungus Metarhizium anisopliae. Mycological Research99, 485–491.
Potenza, L., Amicucci, A., Rossi, I., Palma, F., DeBellis, R., Cardoni, P. and Stocchi,V. (1994) Identification of Tuber magnatum pico DNA markers by RAPDanalysis. Biotechnology Techniques 8, 93–98.
Poupard, P. Simonet, P., Carelier, N. and Bardin, R. (1993) Molecular characterizationof Pseudocercosporella herpotrichoides isolates by amplification of ribosomalDNA internal transcribed spacers. Plant Pathology 42, 873–881.
Rainey, F.A., Ward-Rainey, N.L., Janssen, P.H., Hippe, H. and Stackebrandt, E.(1996) Clostridium paradoxum DSM7308T contains multiple 16S rRNA geneswith heterogeneous intervening sequences. Microbiology 142, 2087–2095.
Riesberg, L.H. (1996) Homology among RAPD fragments in interspecific compar-isons. Molecular Ecology 5, 99–105.
Sanders, I.R., Alt, M., Groppe, K., Boller, T. and Wiemken, A. (1995) Identificationof ribosomal DNA polymorphisms among and within spores of the Glomales:application to studies on the genetic diversity of arbuscular mycorrhizal fungalcommunities. New Phytologist 130, 419–427.
Savolainen, V., Cuenoud, P., Spichiger, R., Martınez, M.D.P., Crevecoeur, M. andManen, J. (1995) The use of herbarium specimens in DNA phylogenetics;evaluation and improvement. Plant Systematics and Evolution 197, 87–98.
Schlick, A., Kuhls, K., Meyer, W., Lieckfeldt, E., Borner, T. and Messner, K. (1994)Fingerprinting reveals gamma-ray induced mutations in fungal DNA: implica-tions for identification of patent strains of Trichoderma harzianum. CurrentGenetics 26, 74–78.
Sherriff, C., Whelan, M.J., Arnold, G.M., Lafay, J.F., Brygoo, Y. and Bailey, J. (1994)Ribosomal DNA sequence analysis reveals new species groupings in the genusColletotrichum. Experimental Mycology 18, 121–131.
Shilling, A.G., Moller, E.M. and Geiger, H.H. (1996) Polymerase chain reaction-based assays for species-specific detection of Fusarium culmorum, F. grami-nearum and F. acenaceum. Phytopathology 86, 515–522.
Sneath, P.H.A. (1993) A proposal on metrics for identification using nucleic acidsequences. FEMS Microbiology Letters 106, 1–8.
Sneath, P.H.A. and Sokal, R.R. (1973) Numerical Taxonomy. W.H. Freeman, SanFrancisco.
Sneh, B., Jabaji-Hare, S, Neate, S. and Dijst, G (eds) (1996) Rhizoctonia species:
82 P.D. Bridge and D.K. Arora
Taxonomy, Molecular Biology, Ecology, Pathology, and Disease Control. KluwerAcademic Press, Dordrecht, p. 578.
Spreadbury, C.L., Bainbridge, B.W. and Cohen, J. (1990) Restriction fragment lengthpolymorphisms in isolates of Aspergillus fumigatus probed with part of theintergenic spacers region from the ribosomal RNA genes complex of Aspergillusnidulans. Journal of General Microbiology 136, 1991–1994.
Sreenivasaprasad, S., Brown, A.E. and Mills, P.R. (1992) DNA sequence variation andinterrelationships among Colletotrichum species causing strawberry anthrac-nose. Physiological and Molecular Plant Pathology 41, 265–281.
Taylor, J.W. and Swann, E.C. (1994) DNA from herbarium specimens. In: Herrman,B. and Hummel, S. (eds) Ancient DNA. Springer Verlag, Berlin.
Taylor, J.W. and White, T.J. (1991) Molecular evolution of nuclear and mitochondrialribosomal DNA region in Neurospora and other Sordariceae and comparisonwith the mushroom, Laccaria. Fungal Genetics Newsletter 38, 26.
Tingey, S.V. and del Tufo, J.P. (1993) Genetic analysis with random amplifiedpolymorphic DNA markers. Plant Physiology 101, 349–352.
Tisserat, N.A., Hulbert, S.H. and Sauer, K.M. (1994) Selective amplification of rDNAinternal transcribed spacer region to detect Ophiosphaerella korrae and O.herpotricha. Phytopathology 84, 478–482.
Versalovic, J., Koeuth, T. and Lupski, J.R. (1991) Distribution of repetitive DNAsequences in eubacteria and application to fingerprinting of bacterial genomes.Nucleic Acids Research 19, 6823–6831.
Vilgalys, R. and Cubeta, M.A. (1994) Molecular systematics and population biologyof Rhizoctonia. Annual Review of Phytopathology 32, 132–155.
Vilgalys, R. and Gonzalez, D. (1990) Ribosomal DNA restriction fragment-lengthpolymorphisms in Rhizoctonia solani. Phytopathology 80, 151–158.
Vilgalys, R. and Hester, M. (1990) Rapid genetic identification and mapping ofenzymatically amplified ribosomal DNA from several Cryptococcus species.Journal of Bacteriology 172, 4238–4246.
Waalwijk, C., de Koning, J.R.A., Baaven, R.P. and Gams, W. (1996) Discordantgroupings of Fusarium spp. from sections Elegans, Liseola and Dlaminia basedon ribosomal ITS1 and ITS2 sequences. Mycologia 88, 361–368.
Wakefield, A.E., Pixley, F.J., Banerji, S., Sinclair, K., Miller, R.F., Moxon, E.R. andHopkin, J.M. (1990) Amplification of mitochondrial ribosomal RNA sequencesfrom Pneumocystis carinii DNA of rat and human origin. Molecular Bio-chemistry and Parasitology 43, 69–76.
Wakefield, A.E., Guiver, L., Miller, R.F. and Hopkin, J.M. (1991) DNA amplificationon induced sputum samples for diagnosis of Pneumocystis carinii pneumonia.Lancet 337, 1378–1379.
Ward, E. and Akrofi, A.Y. (1994) Identification of fungi in the Gaeumannomyces-Phialophora complex by RFLPs of PCR-amplified ribosomal DNAs. Myco-logical Research 98, 219–224.
Welsh, J. and McClelland, M. (1990) Fingerprinting genomes using PCR witharbitrary primers. Nucleic Acids Research 18, 7213–7218.
White, T.J., Bruns, T., Lee, S. and Taylor, J.W. (1990) Amplification and directsequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A.,Gelgard, D.H., Sninsky, J.J. and White, T.J. (eds) PCR Protocols: A Guide toMethods and Applications. Academic Press, New York, pp. 315–322.
Williams, J.G.K., Kubeik, A.R., Livak, K.J., Rafalski, J.A. and Tingey, S.V. (1990)
PCR for Species Definition 83
DNA polymorphisms amplified by arbitrary primers are useful as geneticmarkers. Nucleic Acids Research 20, 303–306.
Wu, B.C. and Magill, C.W. (1995) Spontaneous mutations at fingerprint loci in clonallineages of the rice blast fungus. Experimental Mycology 19, 86–90.
Wyss, P. and Bonfante, P. (1993) Amplification of genomic DNA of arbuscular-mycorrhizal (AM) fungi by PCR using short arbitrary primers. MycologicalResearch 97, 1351–1357.
Xue, B. Goodwin, P.H. and Annis, S.L. (1992) Pathotype identification of Lepto-sphaeria maculans with PCR and oligonucleotide primers from ribosomalinternal transcribed spacer sequences. Physiological and Molecular Plant Pathol-ogy 41, 179–188.
Yates-Siilata, Sanders, D.M. and Keath, E.J. (1995) Genetic diversity in clinicalisolates of the dimorphic fungus Blastomyces dermatitidis detected by PCR-based random amplified polymorphic DNA assay. Journal of Clinical Micro-biology 33, 2171–2175.
Zijlstra, C., Lever, A.E.M., Uenk, B.J. and Van Silfhout, C.H. (1995) Differencesbetween ITS regions of isolates of root-knot nematodes Meloidogyne hapla andM. chitwoodi. Phytopathology 85, 1231–1237.
84 P.D. Bridge and D.K. Arora
PCR Applications in Studiesof Lichen-forming Fungi
A. Crespo1, O.F. Cubero1 and M. Grube2
1Departamento de Biologıa Vegetal II, Universidad Complutense deMadrid, Ciudad Universitaria, 28040 Madrid, Spain; 2Institut furBotanik, Karl-Franzens-Universitat Graz, 8010 Graz, Austria
5.1 Introduction
Analysis of DNA from lichens was rare prior to the development of PCR-based techniques. In early molecular applications, Blum and Keshevarov(1986, 1992) used total DNA hybridization to estimate the relationship of thegenera Umbilicaria and Lasallia. Isolation and agarose gel electrophoresis ofDNA from various cultured mycobionts was carried out by Ahmadjian et al.(1987). With the introduction of PCR (Mullis and Faloona, 1987) during thelast decade the situation changed completely and nucleic acids became easilyaccessible sources of new characters. Today, PCR is an important tool formolecular investigations of mycobiont phylogeny and population genetics.
In this chapter we present an overview of the recent progress of PCRapplications in the study of lichen-forming fungi. Because lichens are asymbiotic association of a fungus and an alga, they require specialconsiderations for molecular studies. To date, most molecular work withlichens has been carried out with nuclear ribosomal genes of the fungalpartner (mycobiont). This chapter, therefore, focuses on the mycobiont:in the first part we emphasize the specific features of lichens and theirsignificance for DNA isolation and PCR techniques; an overview ofphylogenetic approaches to lichens is followed by a section on insertionsand introns in ribosomal genes of mycobiont DNA; and the remainderof our contribution concentrates on population studies and miscellaneousPCR applications.
5
© CAB INTERNATIONAL 1998. Applications of PCR in Mycology(eds P.D. Bridge, D.K. Arora, C.A. Reddy and R.P. Elander) 85
5.2 Characteristic Features of Lichens
As emphasized in the Dictionary of the Fungi (Hawksworth et al., 1995),lichens are a biological and not a systematic group of fungi. Hawksworth andHonegger (1994) provided the definition of a lichen as ‘an ecologicallyobligated, stable mutualism between an exhabitant fungal partner and aninhabitant population of extracellularly located unicellular or filamentousalgal or cyanobacterial cells’. Lichens are not the only possible fungal/algalor fungal/cyanobacterial symbioses (Table 5.1) but they signify one of themost successful multibiont associations with a worldwide distribution.
Lichens are particularly remarkable in the diverse morphological featuresshown by the composite organism. The thalli of certain lichens are among themost complex structures to have evolved in fungi (Douglas, 1994). The fungalpartners in lichens are not known to occur in a free-living form, rather theydominate the overall morphology of the vegetative and fertile structures of thesymbiotic associations. Nevertheless, there is an interplay between thepartners during ontogeny, as different morphologies of thalli may develop bythe interaction of a single fungus with cyanobacteria or with green algae (Jamesand Henssen, 1976). Another characteristic feature of almost all lichens is thelongevity of the thalli and/or the fruiting bodies. Consequently, the long-termexposure to environmental conditions and the complex organization of thallimay result in a high degree of plasticity of lichens.
The scientific name that is applied to the lichen association strictly refersto the fungal partner alone (ICBN, art. 13.1d; Greuter et al., 1994). Hence,
Table 5.1. Different forms of fungal/algal symbioses. From Hawksworth (1988).
Number of bionts Examples
Two-biont symbiosesMycobiont as inhabitant Mycophycobioses
Fungal parasites of algaeMycobiont as exhabitant Lichens
Three-biont symbiosesTwo photobionts: one mycobiont Cephalodia
Blue-green/green morphotypesAlgicolous lichensBryophilous lichens
Two mycobionts: one photobiont Lichenicolous fungiMechanical hybrids
Four-biont symbiosesThree photobionts: one mycobiont CephalodiaTwo photobionts: two mycobionts Lichenicolous lichensThree mycobionts: one photobiont Fungi on lichenicolous fungi
Five or more biont symbioses Mechanical hybrids
86 A. Crespo et al.
the classification and systematics of lichens refer to the relationships amonglichen-forming fungi, independent of their symbiotic photosynthetic part-ners, which have separate algal or cyanobacterial names. The combinedassociation has no name and naming a lichen is synonymous to naming thefungal partner in a lichen association. As a consequence of this, molecularsystematic studies have focused on the lichen mycobiont.
5.3 General Remarks on Molecular Work with Lichens
The molecular study of lichen symbioses has been impeded by severalproblems. Both mechanical isolation of sufficient starting material and axeniccultivation of lichen-forming fungi were cumbersome and impracticalapproaches for earlier molecular studies. Through the application of PCR, itis now possible to undertake investigations with minute amounts of living oreven herbarium material. However, several points must be kept in mind inmolecular studies: (i) lichens often grow in dense associations with otherindividuals or other species. Additionally, they may often be difficult toseparate from their substrate. Therefore, lichen material intended for DNAisolations must be examined carefully to avoid exogenous contaminants, suchas substrate particles (e.g. bryophytes) or DNA from other fungi (see Petriniet al., 1990). In addition, an important source of undesired DNA may be theoccurrence of inhabitant lichenicolous fungi. The algal or cyanobacterialpartner is usually not problematic if discrimatory DNA isolation or PCRtechniques are used; (ii) lichens are well known for their ability to synthesizehigh amounts of diverse secondary compounds including polysaccharides.High concentrations of various polysaccharides may inhibit the efficiency ofPCR and so isolation techniques must be optimized to eliminate secondarycompounds in general and polysaccharides in particular; (iii) PCR anomaliesmay occur when working with the rDNA of mycobionts. A pair of primers,which works well for many other isolations, may not always amplify thetarget region even if fresh material is used. Conversely, multiple PCRproducts may occur even when contamination by other fungal species can beexcluded. These phenomena may be due to the presence of optionalinsertions at priming sites. Because insertions are frequently found in rDNAof mycobionts, they require further consideration and will be described ingreater detail later.
5.4 DNA Isolation and PCR Amplification from Lichens
As indicated briefly above, careful dissection of lichen material is importantto eliminate DNA of other organisms in general, and that of fungalcohabitants in particular. Both lichenicolous fungi, of which there are about1000 described species, and lichenicolous lichens, frequently occur on or in
Study of Lichen-forming Fungi 87
lichens as parasites or commensals (Hawksworth et al., 1995). Microscopicexamination prior to dissection of material may confirm the quality of thestarting material. Amplification of genomic material from the photosyntheticpartner can be circumvented by two approaches. First, fungal material maybe isolated mechanically from the lichen thallus, or second, oligonucleotideprimers are selected which exclusively amplify fungal DNA.
5.4.1 Mechanical isolation of fungal material
Purely fungal structures are almost always present in lichens. These includehymenia in fruiting bodies, or pycnidia, thalloconidia, rhizines, rhizino-morphs, cilia, medullae, and cortical structures (Fig. 5.1). Successful isola-tions from podetia (DePriest and Been, 1992), basidiomata (Lutzoni andVilgalys, 1995a), ascomata (Grube et al., 1995) and rhizines (Crespo et al.,1997a) have been described.
5.4.2 Discriminatory molecular techniques
The most elegant and common approach to amplifying mycobiont DNA isby using fungal-specific oligonucleotides as PCR primers. Using this
Fig. 5.1. Examples of algal-free material used for molecular studies with lichenmycobionts. (A) Decorticated podetium of Cladonia. (B) Chondroid medulla of Usnea. (C)Ascomatal structures. (D) Cortical layers, medulla, and rhizines. (E) Mycobiont cultures.
88 A. Crespo et al.
approach, it is possible to isolate DNA from the total lichen, including thealgal/cyanobacterial partner without time-consuming dissection of fungalmaterial. Under appropriate PCR conditions, it is often sufficient to haveonly one fungal-specific primer in the primer pair. About nine fungal-specificprimers suitable for work with lichens have already been designed bycomparative analysis of small subunit (SSU) rDNA sequences (Gargas andTaylor, 1992; Gardes and Bruns, 1993; Gargas and DePriest, 1996). Theseprimers also allow selective amplification of fungal internal transcribedspacer (ITS) regions. To date, in the lichen-forming fungi, the nuclear largesubunit (LSU) rRNA gene is currently being investigated with fungal-specific primers (P. Clerc, Geneve, 1995, personal communication; M. Grube,unpublished work).
Standard DNA isolation protocols which are useful for a wide range offungi, for example that described by Lee and Taylor (1990), may not beoptimal for certain lichens. DNA extraction from lichens must consider thehigh concentration of polysaccharides present in many species. Armaleo andClerc (1991) used column purification in their DNA isolation protocols toeliminate PCR and restriction enzyme inhibitors. Their method II alsoincluded an enzymatic treatment for the degradation of polysaccharides.More recently, addition of CTAB (cetyl-trimethyl ammonium bromide) tothe extraction buffer has proved to be very efficient for DNA isolation fromlichens (Armaleo and Clerc, 1995; Crespo et al., 1997a). A protocol describedby Grube et al. (1996) relies on the selective affinity of DNA to glass powderand was used to isolate DNA from ascomata.
Optimal yield of isolated DNA is generally achieved with fresh lichenmaterial. However, fresh material is not always accessible and herbariumcollections may provide important material for molecular studies. It has beendemonstrated that intact DNA can be isolated from mushrooms that havebeen stored in herbaria for several decades (Bruns et al., 1990; Taylor andSwann, 1994). The DNA degradation rate of herbarium material variesamong different lichens and it is usually difficult to get sufficient DNA ofUsnea species if the sample is more than 10 years old (data not shown),whereas it has been possible to get considerable amounts of PCR productfrom DNA of a 30-year-old specimen of Multiclavula mucida (GenBank acc.no. 23542; Gargas et al., 1995a).
Usually, PCR conditions follow manufacturer’s guidelines but they maybe optimized depending on primer sequence and target sequence length.Addition of compounds such as dimethyl sulphoxide to the PCR buffer isnot considered to improve results. A large number of primers are nowavailable for the PCR amplification of nuclear ribosomal genes of fungi(Gargas and DePriest, 1996; Lutzoni and Vilgalys, 1995a) and a standardizednomenclature for these has been proposed by Gargas and DePriest (1996).Such primers are complementary to the conserved regions of the SSU rDNA,and also to the 5′ region of the LSU rDNA and all have successfully beenapplied to the PCR amplification of SSU, ITS regions and LSU rDNA of
Study of Lichen-forming Fungi 89
lichen-forming fungi. However, 12 of the primers span positions of optionalinsertions and may fail to amplify if an insertion is disrupting a priming site(Gargas and DePriest, 1996). In such cases, it is advisable to amplify thetarget region with a different pair of primers. The primers used for PCR mayalso be applied for the direct sequencing of amplification products. Today,cycle sequencing has become the most popular technique for obtainingsequences from PCR products of lichen-forming fungi, and automatedsequencing systems now allow sequence information to be obtained in arelatively short time.
5.5 Molecular Evolution in Lichens
About 13,500 or two-fifths of all ascomycetes occur as lichens and 13 of the46 orders of ascomycetes include lichen-forming fungi (Hawksworth et al.,1995). Investigation of phylogenetic relationships among lichen-formingfungi is therefore important for a better understanding of fungal evolution ingeneral. The integration of lichen-forming mycobionts into the system ofEumycota has been particularly considered by molecular studies on thephylogenetic origins of the lichen symbioses, and an Eumycota phylogenybased on parsimony analysis of SSU rDNA sequences has been constructedby Gargas et al. (1995a). In this study five origins of lichenization weredetected within the true fungi. Two origins of the lichen state were found inthe ascomycetes where the lichen habit arose in groups with both sapro-phytic and parasitic relatives. Ongoing research is concentrating on arefinement of the Eumycota phylogeny by including other lichen groups(Gargas and DePriest, 1996).
Molecular-phylogenetic studies focusing on the SSU rDNA gene havealso been carried out at various lower taxonomic levels. These are of specialsignificance in groups where morphological characters are limited, orconvergent morphological evolution is expected. Wedin (1996) has presenteda phylogenetic hypothesis of four families of Caliciales. He demonstratedthat representatives of Sphaerophoraceae form a monophyletic group withinthe Lecanorales. However, the core group of Caliciales including Caliciaceae,Mycocaliciaceae and Sphinctrinaceae was not monophyletic. Whereas Cal-iciaceae form a separate monophyletic group within the Lecanorales, the twoother families appear as a monophyletic group basal to a clade formed byrepresentatives of Eurotiales and Onygenales. Stenroos and DePriest (1996)provided a phylogeny of stipitate lichens encompassing Cladoniaceae,Cladiaceae, Siphulaceae, and Stereocaulaceae. According to their hypothesis,these families form a monophyletic group within the Lecanorales. Tehler(1995a, 1995b) and Myllis and Tehler (1996) carried out a phylogeneticanalysis of Arthoniales and emphasized that some groups based on morpho-logical data were corroborated by molecular results whereas others wereclearly not. Eriksson and Strand (1995) studied the relationships of Solorina,
90 A. Crespo et al.
Peltigera and Nephroma and found that Solorina and Peltigera were closelyrelated and should be kept in the same family, Peltigeraceae, whereasNephroma was distinct and that its placement in a separate family, Nephro-mataceae, was supported by molecular characters. Marsh et al. (1994)investigated the cladistic relationships within the family Ramalinaceae. Thepreliminary analyses contributed to the understanding of generic concepts inRamalinaceae and showed that Dievernia and Ramalinopsis were moreclosely related to each other than either is to Nieblia.
Søchting and Lutzoni (1996) investigated the SSU rDNA variation in theTeloschistaceae. They showed that the genus Xanthoria is polyphyletic andincludes lineages related to Caloplaca subgen. Gasparrinia and subfruticoseCaloplaca species. A phylogenetic analysis of the Umbilicariaceae wasundertaken by Bobrova and Ivanova (1996). According to their hypothesis,Lasallia does not form a sister group to Umbilicaria. The latter appears to beparaphyletic, contradictory to the current morphological concept. Lutzoniand Vilgalys (1995a) and Lutzoni (1996) undertook a phylogenetic analysisof Omphalina, including lichen-forming and free-living species. Thesequence data based on ITS and LSU rDNA data suggested that the lichen-forming Omphalina species are a monophyletic group.
With the increasing number of sequences available, several otherchallenging issues of lichen evolution can be addressed by molecularmethods. For example, the taxonomic position of sterile or otherwise poorlyunderstood species can now be evaluated. Hoffmann (1996) analysed DNAfrom the sterile lichen Normandina pulchella and from co-occurringperithecia referred to as Lauderlindsaya borreri. The latter is sometimesregarded as the fertile stage of Normandina. The preliminary results suggestthat Normandina is an ascomycete genus, but different from the lichenico-lous Lauderlindsaya.
A classic debate in lichenology regarding the reproductive mechanismsand their impact on species evolution has been developed through thediscussion about species pairs or ‘Artenpaare’ (Poelt 1970; Culberson andCulberson, 1973; Tehler 1982) and reviewed by Mattsson and Lumbsch(1989). Species pairs are parallel taxa with similar thallus morphology, whereone taxon is fertile and the other is sterile, propagating via soredia, isidia oranalogous organs. The relationships between species pairs have been investi-gated using ITS sequences (Lohtander and Tehler, 1996). A cladistic analysisof Dendrographa species suggests that the apomictic strains in this genusoriginated repeatedly from a fertile primary species (A. Tehler, Salzburg,1996, personal communication).
Recently, efforts have been made to combine molecular and morpho-logical evidence in lichen phylogenetic studies (Eriksson and Strand, 1995;Lutzoni and Vilgalys, 1995a, b; Tehler, 1995a, b; Lutzoni, 1997). The topol-ogy of phylogenetic trees from morphological and molecular data sets maydiffer significantly and there are several strategies that may be used to obtainsingle phylogenies. The taxonomic congruence method involves separate
Study of Lichen-forming Fungi 91
analyses of different data sets and subsequent consensus analysis, whereas themethod of total evidence uses both data sets in a combined analysis. Tehler(1995b) discussed the logical difficulties of applying taxonomic congruenceand demonstrated the limitations of this method in a phylogenetic analysisof the Arthoniales. Alternatively, Lutzoni and Vilgalys (1995b) proposed thatdata sets should be analysed separately and be tested if any conflict arosebetween them. As trees are constructed from samples of data, one importantreason for topological differences may be sampling error. If the differencescan be explained by sampling error, the morphological and molecular datasets may be combined in phylogenetic analyses. Available tests for evaluatingheterogeneity between data sets (e.g. Rodrigo’s test, T-PTP test, and Kishinoand Hasegawa test) have been compared by Lutzoni and Vilgalys (1995b).They showed that only the method of Rodrigo et al. (1993) explicitlyaddressed the question of sampling error.
5.6 Insertions and Introns
It has already been mentioned that PCR results are dependent on thepresence or absence of insertions at oligonucleotide priming sites (Gargasand DePriest, 1996). Such insertion sequences, which may differ in length,are found at a high frequency in the ribosomal genes of the mycobiont andthey may increase the length of the SSU rDNA by as much as 100%. To date,17 insertion positions have been described from the nuclear SSU rDNA, and13 of them are known from lichen-forming fungi (Table 5.2). Seven insertionpositions are so far known from the nuclear LSU rDNA, although only oneof them is also found in lichen mycobionts. Multiple insertions may be foundin a single species, and seven insertions have been found in the SSU rDNAof Lecanora dispersa (Gargas et al., 1995b).
Many of these insertions can be classified as group I introns (subgroupIC; Michel and Westhof, 1990) by sequence analysis. In a pioneering work,DePriest and Been (1992) showed that group I introns have a variabledistribution in the rDNA of the Cladonia chlorophaea complex. Asdetailed later, this variability is of importance for lichen population studies.
When transcribed, group I introns share a common secondarystructure and, by their intricate RNA folding, they may act as ribozymes,which catalyse their own excision from their host genes. DePriest and Been(1992) pointed out that the group I introns present in C. chlorophaea donot splice under standard in vitro conditions typically used for self-splicingexperiments with other group I introns. This phenomenon is in accordancewith a lack of structural elements that are usually found in self-splicingintrons (Jaeger et al., 1996; Lehnert et al., 1996). For example, onecharacteristic feature of introns at positions 1046, 1199, 1210, 1389, and1516 from Cladonia is a relatively short P5 region. This character is alsofound in homologous introns of other lichen-forming fungi, e.g. in
92 A. Crespo et al.
Table 5.2. Presence of insertions in nuclear SSU rDNA (based on Gargas et al., 1995b; Grube et al., 1996, and aunpublished data). Positions areaccording to E. coli numbering.
Insertion position 114 287 323 392 516 531 789 943 956 1046 1052 1199 1210 1389 1506 1512 1516
Lichen-forming fungi + + – + + – + + – + – + + + +a + +Other organisms – – + – + + – + + + + + – – + + –
Fig. 5.2. Putative secondary structure of a group IC intron at position 1210 in the nuclearSSU rDNA of Lecanora muralis. Representation according to Cech et al. (1994).
94 A. Crespo et al.
Lecanora (Fig. 5.2). DePriest and Been (1992) suggested that trans actingfactors are required for correct splicing because the Cladonia introns aremissing in mature rRNA.
In addition to group I introns, an increasing number of relatively shortinsertions of less than 100 nucleotides in length has been described in lichen-forming and free-living fungi (Rogers et al., 1993; Untereiner et al., 1995;Grube et al., 1996). These short insertions are located at known intronpositions, and some of them disrupt essential regions of mature rRNA.Rogers et al. (1993) showed, by RT–PCR, that short insertions are cut outfrom mature transcripts, although the splicing mechanisms remain unclear.Gargas et al. (1995b) used the term degenerate introns for short insertionsand Grube et al. (1996) suggested that they may be the vestiges of initiallycomplete introns, which lack the P3–P9 regions.
Phylogenetic relationships of various insertion site lineages of intronshave been investigated for green algae by Bhattacharya et al. (1994, 1996),who showed an apparent monophyly of introns at positions 1506 and 1512,respectively. Generally, the introns at homologous positions have almostidentical sequences in the conserved regions of the catalytic core. Increasedsequence variation is, however, observed at peripheral regions. The sequenceof the P2 region, considered as a spacer by Peyman (1994), and the P9 regionare the most variable parts of the introns. Additionally, by analysing theknown lichen introns, Bhattacharya et al. (1996) suggested that the closerrelationships of introns at position 1199 and 287 and of introns at position1210 and 1389 may be due to an ancient lateral transfer of an intron. Thisview is underlined by similarities of the 5′ flanking regions and the P10pairing in each of the lineages.
We prepared a preliminary phylogenetic analysis of introns at position1516, which are frequently found in Lecanorales (Fig. 5.3). Introns at this posi-tion from various representatives of Lecanorales can be aligned and parsimonyanalysis shows partial incongruency with the current classification of thelichens studied. The Cladonia introns appeared together with introns fromLecanora and Parmelia. This branch represented a sister group to introns fromPhysconia. According to the current concept of the Lecanorales, Cladoniawould be a basal clade in this selection of taxa. The incongruency might be dueto horizontal transfer of introns within the Lecanorales. This is also consistentwith the theory of ‘late introns’, i.e. introns which are inserted secondarily intoa particular position during rDNA evolution (see DePriest 1995). As introns ineach of the genera group together it is probable that horizontal transfer ofdivergent introns is an ancient or rare event in Lecanorales. Conversely, there isevidence for a considerable rate of intron mobility within populations of asingle species (see below).
It is still unclear whether introns are evenly distributed throughout theribosomal repeat. It has repeatedly been observed that more than onefragment is amplified even from DNA of a single thallus (unpublished work).That these phenomena are due to the presence of lichenicolous fungi can be
Study of Lichen-forming Fungi 95
excluded by microscopic examination. On the other hand it is possible thata lichen thallus is occasionally composed of more than one individual sincefusion of different lichen thalli and mechanical hybridization can be observedoccasionally in nature (see below). Alternatively, DePriest (1993a, b), Gargaset al. (1995b) and Crespo et al. (1997a) mentioned that more than one repeattype had been found even in single individuals of mycobionts. Gargas et al.(1995b) stated that the variable occurrence of insertions in the rDNA-repeatmay produce anomalous PCR amplifications. We occasionally observe thateven in those cases where a single intron-containing product was amplified,an intron-less product is obtained when a primer is used that spans the intronposition, and which does not, therefore, amplify repeat units that contain theintron (unpublished results; see Gargas and DePriest, 1996). The reasons forthese phenomena are unclear; however this is a challenging issue for futureresearch. It is also important in this context to consider that the number ofrDNA repeat units may change during vegetative growth (Pukkila andSkrzynia, 1993) and that meiotic recombination of rDNA is suppressed incertain fungi (Cassidy et al., 1984; Russell et al., 1988).
Fig. 5.3. Phylogenetic analysis of introns at position 1516 from various representatives ofthe Lecanorales. Strict consensus tree from three most parsimonious trees found usingthe branch and bound algorithm of the PAUP program (Swofford, 1991). The Tetrahymenathermophila intron (Tt.LSU) was used as an outgroup.
96 A. Crespo et al.
5.7 Genetic Variability of Populations
Lichen species may exhibit a high degree of morphological variation (Poelt,1994). In many cases, this variation is apparently due to different ecologicalconditions. On the other hand, numerous examples are known wheresignificantly different morphotypes of the same species grow side-by-side(Poelt, 1994). This indicates that certain phenotypic variation is also inheritedas a genetic trait, which is also the case for chemical polymorphisms(Culberson et al., 1988). However, whereas there is now evidence thatsecondary compounds are produced by the mycobiont alone, it has not beenestimated how much of the morphological variation may be attributed todifferent populations of photobionts within a lichen thallus. Independentgenetic characters are therefore of great importance for lichen populationstudies.
Ribosomal DNA offers characters for direct investigation of mycobiontpopulations. Great variability of fungal rDNA within a lichen populationwas first demonstrated by DePriest and Been (1992). A single mat (about thesize of a hand) of C. chlorophaea was composed of 13 different genotypes.A detailed analysis of these genotypes was presented by DePriest (1994) byusing restriction site patterns and Southern hybridization. The sharing ofrestriction patterns suggests that some chemotypes may be polymorphismsof a single species in the C. chlorophaea complex. Significant size polymor-phism of PCR products already show that this tremendous variation is dueto the variable occurrence of insertions. Sequence analysis indicates that mostinsertions are group I introns in the coding regions of the rDNA.
DePriest (1995) used the information of the different genotypes toaddress questions of intron mobility in the C. chlorophaea complex. Thephylogenetic hypothesis based on rDNA types suggests that it is mostparsimonious to consider that both insertion and deletion of group I intronsoccur in rDNA of C. chlorophaea.
In different species of lichens, the heterogeneity of populations mayvary. Whereas single mats of C. chlorophaea consist of many SSU rDNAgenotypes, individual mats of Cladina subtenuis are genetically uniform(Beard and DePriest, 1996). However, different mats of Cladina may beassigned to various genotypes. Three size classes of PCR products from the3′ region of the SSU rDNA were detected among separate mats due to thepresence of optional group I introns. Different PCR size-classes have alsobeen described in a population study of Parmelia sulcata (Crespo et al.,1997b, 1998). In this study, PCR products from the ITS regions including theterminal region of the SSU and LSU rDNA were amplified. A significantincrease in product size – of c. 200 nucleotides – was due to the presence ofan intron at position 1516 in P. sulcata. Similar size variations were alsoobserved in the related species Parmelia saxatilis (Fig. 5.4). In Physconia, thefrequency of group I introns at position 1516 varied among different species(Cubero and Crespo, 1996). However, no correlation has yet been observed
Study of Lichen-forming Fungi 97
between the different intron frequencies and morphological variation, sexualmechanisms or ecological amplitude of species.
LaGreca (1996) presented a population study on the Ramalina amer-icana complex, which included morphologically identical but chemicallydifferent races. Cladistic analysis of ITS sequence data suggested that thespecies complex consisted of two distinct groups. This grouping was alsocorrelated with differences in chemical diversity and geographic distribution.The two groups were also supported by analyses of a second data set basedon sequences of introns at position 1516 in the nuclear SSU rDNA.
An alternative approach to the study of lichen populations is possibleusing the random amplification of polymorphic DNA (RAPD) technique(Williams et al., 1990). Short primers are used to randomly amplify fragmentswhich are interpreted as genetic markers. This technique may be applied toestimate variation over complete genomes. The only available RAPD studywith lichens (Cubero et al., 1995) showed complex banding patterns withsignificant differences between populations from distant sites (Fig. 5.5).Further work is needed to evaluate the significance of RAPD analysis forpopulation studies in lichens.
5.8 Miscellaneous Molecular Studies
Some miscellaneous studies address further issues of molecular lichenology.Glacier-covered lichens may serve as a source of ancient DNA. Gargas et al.
Fig. 5.4. Length variation of PCR products from Parmelia saxatilis. Lanes 1 and 7, 100 bpladder; lane 2, a specimen from Spain (Casa de Campo); lanes 3 and 4, material fromEngland (New Forest, Hampshire); lanes 5 and 6, specimens from England (Sheffield). Lane5 shows a significantly larger product (850 nucleotides) due to the presence of a group Iintron.
98 A. Crespo et al.
(1994) have isolated DNA from specimens of Umbilicaria cylindrica thatwere recently exposed after the glacier receded. Radiocarbon dating sug-gested that this material had been under the ice for 1300 years. SuccessfulPCR amplification of DNA was possible from such apparently wellpreserved material. Therefore mummified lichens can be used to investigatesequence variation over historical time periods.
Armaleo and Clerc (1991) analysed different photomorphs of singlelichen-forming fungi in the genera Pseudocyphellaria and Sticta. Fragments2.2 kb in length were amplified from the 5′ region of nuclear LSU rDNA.The products were then digested by restriction enzymes. Subsequent agarosegel analysis of the restriction fragments showed a ‘near identity’ of thedifferent photomorphs. The similarity of the restriction patterns can beinterpreted as molecular evidence that the corresponding photomorphsbelong to the same fungal species.
PCR product length may also be used to detect distinct genetic individualsin lichen associations. Both partners of the lichen symbiosis may consist ofmore than one individual. This was suggested by indirect evidence frommorphological and isozyme analyses (summarized by Fahselt, 1996) andmechanical hybridization between different initial thalli is a common explana-tion for such multisymbioses (see Fig. 5.10 in Honegger, 1996). Fahselt (1996)suggested that if intrathalline electrophoretic differences are generated bymultiple symbionts, it is likely that they are related to the mycobiont, since
Fig. 5.5. Random amplification of polymorphic DNA (RAPD) from Parmelia saxatilis(Cubero et al., 1995). Lanes 1 and 2, specimens from Antarctica (South Settlands,Livingston Island); lanes 3, 4 and 5, specimens from Spain (Sierra de Aillon); lanes 6, 7 and8, specimens from Spain (Avila, Sierra de Gredos).
Study of Lichen-forming Fungi 99
fungal biomass predominates in lichen thalli. Further evidence for thishypothesis is found by rDNA size polymorphisms within thalli of P. sulcata.Multiple amplification products were found with a frequency of 7% (n = 261thalli; A. Crespo, unpublished work) in single thalli using fungal-specificprimers (ITS1F and ITS4; Gardes and Bruns, 1993). PCR products of differentlength have been amplified from DNA isolations along a gradient through athallus (Fig. 5.6). These data may indicate that more than one fungal rDNAgenotype is present in a single thallus of P. sulcata.
5.9 Conclusions
PCR is a powerful technique for the investigation of the genetic variation innuclear rRNA genes of lichen-forming fungi. The newly available sequenceanalyses contribute much to our understanding of lichen phylogeny. Morerepresentatives of the different orders of ascomycetes will be sequenced andthis will clarify our views on the evolutionary origins of lichenization.
Investigations at lower taxonomic levels will improve our knowledgeabout evolution within and among lichen populations, species, genera, andfamilies. It is now possible to link genetic information with that ofmorphological and chemical characters to study convergent evolution indifferent groups of lichen-forming fungi.
The frequency of insertions and introns is regarded as a useful character forpopulation studies on lichens. The sequence diversity of mycobiont intronswill also offer new information about the molecular evolution of ribozymes.
Future work will include investigations of various, yet poorly exploited
Fig. 5.6. PCR products of different length within a single thallus of Parmelia sulcata. Lanes1–4 show PCR products from isolations along a gradient through a thallus 3 cm indiameter. Lanes 5 and 10 are used as spacers. Lanes 6–9 show uniform PCR productsfrom four isolations along a gradient through a second thallus. Lanes 11–14 show uniformbut longer PCR products from four isolations along a gradient through a third thallus. Thethree specimens were from Casa de Campo, Madrid, Spain.
100 A. Crespo et al.
genes. The ITS regions, LSU rDNAs and protein genes will be importantadditional sources of characters for phylogenetic studies. Beside furtherstudies on ribosomal genes, a major challenge for the next years will be tostudy directly the genes which contribute to the tremendous chemicaldiversity of lichen compounds. Armaleo and Miao (1996), Miao and Davies(1998) and Miao et al. (1996) have already made advances in this direction.
Acknowledgements
The support and advice of D.L. Hawksworth in the review of thismanuscript is gratefully acknowledged. The authors are grateful to L. Jaegerfor revision of the folding of the Lecanora muralis intron. We thank U. Arupfor help in the laboratory and L.L.G. Sancho and U. Trinkaus for commentson the manuscript. This work was supported by ANT 94-0905, AMB94-1209, APC-0020 and PB 93-1129-C0201 from the Ministerio de Educaciony Ciencia, Spain and by P11806-GEN from the Fonds zur Forderung derWissenschaftlichen Forschung, Austria.
References
Ahmadjian,V., Chadeganipour, M., Koriem, A.M. and Paracer, S. (1987) DNA andprotoplast isolations from lichens and lichen symbionts. Lichen Physiology andBiochemistry 2, 5–15.
Armaleo, D. and Clerc, P. (1991) Lichen chimeras: DNA analysis suggests that onefungus forms two morphotypes. Experimental Mycology 15, 1–10.
Armaleo, D. and Clerc, P. (1995) A rapid and inexpensive method for the purificationof DNA from lichens and their symbionts. Lichenologist 27, 207–213.
Armaleo, D. and Miao, V. (1996) Towards a molecular analysis of lichen polyketidebiosynthesis. IAL3 Abstracts, Salzburg, 92 pp.
Beard, K.H. and DePriest, P.T. (1996) Genetic variation within and among mats of thereindeer lichen, Cladina subtenuis (des Abb.) Hale and W.Culb. Lichenologist 28,171–182.
Bhattacharya, D., Surek, B., Rusing, M., Damberger, S. and Melkonian, M. (1994)Group I introns are inherited through common ancestry in the nuclear-encodedrDNA of Zygnematales (Charophyceae). Proceedings of the National Academyof Sciences USA 91, 9916–9920.
Bhattacharya, D., Friedl, T. and Damberger, S. (1996) Nuclear-encoded rDNA groupI introns; origin and phylogenetic relationships of insertion site lineages in thegreen algae. Molecular Biology and Evolution 13, 978–989.
Blum, O.B. and Kashevarov, G.P. (1986) The DNA homologies as a proof of thelegitimacy of the establishment of the lichen genus Lasallia Merat (Umbilicar-iaceae). Doklady Akademii Nauk Ukrainskoi SSR, Ser. B 1986, 61–64 (inRussian).
Blum, O.B. and Kashevarov, G.P. (1992) The DNA homologies as a proof of thelegitimacy of the establishment of the lichen genera Lasallia Merat, Cladina
Study of Lichen-forming Fungi 101
(Nyl.) Harm. and Pseudevernia Zopf. In: Karnefelt, I. (ed.) IAL2 Abstracts,Lund, p. 1.
Bobrova, V.K. and Ivanova, N.V. (1996) The distribution of group I introns in theSSU rDNA among the representatives of the lichen family Umbilicariaceae.IAL3 Abstracts, Salzburg, p. 98.
Bruns, T.D., Fogel, R. and Taylor, J.W. (1990) Amplification and sequencing of DNAfrom fungal herbarium specimens. Mycologia 82(2), 175–184.
Cassidy, J.R., Moore, D., Lu, B.C. and Pukkila, P.J. (1984) Unusual organization andlack of recombination in the ribosomal RNA genes of Coprinus cinereus.Current Genetics 8, 607–613.
Cech, T.R., Damberger, S.H. and Gutell, R.R. (1994) Representation of the secondaryand tertiary structure of group I introns. Structural Biology 1, 273–280.
Crespo, A., Bridge, P.D. and Hawksworth, D.L. (1997a) Amplification of fungalrDNA-ITS regions from non-fertile specimens of the lichen-forming genusParmelia. Lichenologist 29(3), 275–282.
Crespo, A., Bridge, P.D., Cubero, O.F. and Hawksworth, D.L. (1997b) Determina-tion of genotypic variability in the lichen-forming fungus Parmelia sulcata.Bibliotheca Lichenologica (in press).
Crespo, A., Bridge, P.D., Hawksworth, D.L., Grube, M. and Cubero, O.F. (1998)Recolonization by one of three rRNA genotypes of Parmelia sulcata followingSO2 amelioration. Botanical Journal of the Linnaean Society 68, 73–79.
Cubero, O.F. and Crespo, A. (1996) Genetic variability in populations of Physconiaenteroxantha (Nyl.) Poelt. IAL3 Abstracts, Salzburg, p. 151.
Cubero, O.F., Crespo, A. and Ochando, M.D. (1995) Aplicacion de la tecnica deRAPD a estudios en lıquenes. Resumenes del XI Simposium Nacional deBotanica Criptogamica, Santiago de Compostela, p. 231.
Culberson, W.L and Culberson, C.F. (1973) Parallel evolution in lichen-formingfungi. Science 180, 196–198.
Culberson, C.F., Culberson, W.l. and Johnson, A. (1988) Gene flow in lichens.American Journal of Botany 75, 1135–1139.
DePriest, P.T. and Been, M.D. (1992) Numerous group I introns with variabledistribution in the ribosomal DNA of a lichen fungus. Journal of MolecularBiology 228, 315–321.
DePriest, P.T. (1993a) Small subunit rDNA variation in a population of lichen fungidue to optional group I introns. Gene 134, 67–74.
DePriest, P.T (1993b) Molecular innovations in lichen systematics: The use ofribosomal and intron nucleotide sequences in the Cladonia chlorophaea com-plex. The Bryologist 96, 314–325.
DePriest, P.T. (1994) Variation in the Cladonia chlorophaea complex II: ribosomalDNA variation in a southern Appalachian population. The Bryologist97, 117–126.
DePriest, P.T. (1995) Phylogenetic analyses of the variable ribosomal DNA of theCladonia chlorophaea complex. Cryptogamic Botany 5, 60–70.
Douglas, A.E. (1994) Symbiotic Interactions. Oxford University Press, Oxford.Eriksson, O.E. and Strand, A. (1995) Relationships of the genera Nephroma, Peltigera
and Solorina (Peltigerales, Ascomycota) inferred from 18S rDNA sequences.Systema Ascomycetum 14(1), 33–38.
Fahselt, D. (1996) Individuals, populations and population ecology. In: Nash III, T.H.(ed.) Lichen Biology. Cambridge University Press, Cambridge, pp. 181–198.
Gardes, M. and Bruns, T.D. (1993) ITS primers with enhanced specificity for
102 A. Crespo et al.
basidiomycetes. Application to the identification of mycorrhizae and rust.Molecular Ecology 2, 113–118.
Gargas, A. and DePriest (1996) A nomenclature for fungal PCR primers withexamples from intron-containing SSU rDNA. Mycologia 88, 745–748.
Gargas, A. and Taylor, J.W. (1992) Polymerase chain reaction (PCR) primers foramplifying and sequencing nuclear 18S rDNA from lichenized fungi. Mycologia84, 589–592.
Gargas, A., DePriest, P.T. and Ivanova, N. (1994) Glacier-covered lichens: sources ofancient DNA. IMC5 Abstracts. Vancouver, p. 69.
Gargas, A., DePriest, P.T., Grube, M. and Tehler, A. (1995a) Multiple origins of lichensymbioses in fungi suggested by SSU rDNA phylogeny. Science 268, 1492–1495.
Gargas, A., DePriest, P.T. and Taylor, J.W. (1995b) Positions of multiple insertions inSSU rDNA of lichen-forming fungi. Molecular Biology and Evolution 12,208–218.
Greuter, W., Barrie, F.R., Burdet, H.M., Chaloner, W.G., Demoulin, V., Hawksworth,D.L., Jørgensen, P.M., Nicolson, D.H., Silva, P.C., Trehane, P. and McNeill, J.(1994) International Code of Botanical Nomenclature (Tokyo Code). Adopted bythe Fifteenth International Botanical Congress, Yokohama. August–September1993. [Regnum Vegetabile 131] Koeltz Scientific Books, Konigstein.
Grube, M., DePriest, P.T., Gargas, A. and Hafellner, J. (1995) DNA isolation fromlichen ascomata. Mycological Research 99, 1321–1324.
Grube, M., Gargas, A. and DePriest, P.T. (1996) A small insertion in the SSU rDNAof the lichen fungus Arthonia lapidicola is a degenerate group I intron. CurrentGenetics 29, 582–586.
Hawksworth, D.L. (1988) The variety of fungal–algal symbioses, their evolutionarysignificance, and the nature of lichens. Botanical Journal of the Linnaean Society96, 3–20.
Hawksworth, D.L. and Honegger, R. (1994) The lichen thallus: a symbiotic andphenotype of nutritionally specialized fungi and its response to gall producers.In: Williams, M.A.J. de. (ed.) Plant Galls: Organisms, Interactions, Populations.Clarendon Press, Oxford.
Hawksworth, D.L., Kirk, P.M., Sutton, B.C. and Pegler, D.N. (1995) Ainsworth andBisby’s Dictionary of the Fungi. CAB International, Wallingford.
Hoffmann, N. (1996) SSU rDNA sequence data support Normandina pulchella as asterile ascomycete. IAL3 Abstracts. Salzburg. p. 106.
Honegger, R. (1996) Morphogenesis. In: Nash III, T.H. (ed.) Lichen Biology.Cambridge University Press, Cambridge, pp. 65–87.
Jaeger, L., Michel, F. and Westhof, E. (1996) The structure of group I ribozymes.Nucleic Acids and Molecular Biology 10, 33–51.
James, H.M. and Henssen, A. (1976) The morphological and taxonomic significanceof cephalodia. In: Brown, D.H., Hawksworth, D.L. and Bailey, R.H. (eds)Lichenology: Progress and Problems. Academic Press, London.
LaGreca, S. (1996) A phylogenetic evaluation of chemical variation in the Ramalinaamericana complex and a preliminary molecular phylogeny for the genusRamalina. IAL3 Abstracts. Salzburg. p. 112.
Lee, S.B. and Taylor, J.W. (1990) Isolation of DNA from fungal mycelia and singlespores. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCRProtocols: a Guide to Methods and Applications. Academic Press, San Diego,pp. 282–287.
Study of Lichen-forming Fungi 103
Lehnert, V., Jaeger, L., Michel, F. and Westhof, E. (1996) New loop–loop tertiaryinteractions in self-splicing introns of subgroup IC and ID: a complete 3D modelof the Tetrahymena thermophila ribozyme. Chemistry and Biology, 993–1009.
Lohtander, K. and Tehler, A. (1996) Species pair studies in Dirina and Dendrographabased on molecular data. IAL3 Abstracts. Salzburg, p. 114.
Lutzoni, F. and Vilgalys, R. (1995a) Omphalina (Basidiomycota, Agaricales) as amodel system for the study of coevolution in lichens. Cryptogamic Botany 5,71–81.
Lutzoni, F. and Vilgalys, R. (1995b) Integration of morphological and molecular datasets in estimating fungal phylogenies. Canadian Journal of Botany 73 (suppl. 1),S649–S659.
Lutzoni, F. (1996) Phylogeny of lichen- and non-lichen-forming omphalinoidmushrooms and the utility of testing for combinability among multiple data sets.Systematic Biology 46, 373–406.
Marsh, J., DePriest, P.T., Gargas, A. and Nash III, T. (1994) A cladistic analysis of thegenera of the lichen family Ramalinaceae based on 18S rDNA sequences. IMC5Abstracts. Vancouver. p. 133.
Mattsson, J. and Lumbsch, H.T. (1989) The use of species pair concept in lichentaxonomy. Taxon 38(2), 238–241.
Miao, V. and Davies, J. (1998) Molecular diversity of polyketide biosynthesis genesin lichens. In: Baltz, R.H. and Hegeman, G.D. (eds) Proceedings of GMBIM-6,American Society for Microbiology (in press).
Miao, V., Glass, N.L. and Lee, A. (1996) A genetic approach to understand polyketidemetabolism in lichens. IAL3 Abstracts. Salzburg. p. 36.
Michel, F. and Westhof, E. (1990) Modelling of the three-dimensional architecture ofgroup I catalytic introns based on comparative sequence analysis. Journal ofMolecular Biology 216, 581–606.
Mullis, K.B. and Faloona, F.A. (1987) Specific synthesis of DNA in vitro via apolymerase-catalysed chain reaction. Methods in Enzymology 155, 355–350.
Myllis, L. and Tehler, A. (1996) A phylogeny of Arthoniales based on SSU rDNAdata. IAL3 Abstracts. Salzburg. p. 120.
Petrini, O., Hake, U. and Dreyfuss, M.M. (1990) An analysis of fungal communitiesisolated from fruticose lichens. Mycologia 82, 444–451.
Peyman, A. (1994) P2 functions as a spacer in the Tetrahymena ribozyme. NucleicAcids Research 22, 1383–1388.
Poelt, J. (1970) Das Konzept der Artenpaare bei den Flechten. Vortrage aus demGesamtgebiet der Botanik herausgegeben von der deutschen botanischen Gesell-schaft, n.s. 4, 187–198.
Poelt, J. (1994) Different species types in lichenized ascomycetes. In: Hawksworth,D.L. (ed.) Ascomycete Systematics: Problems and Perspectives in the Nineties.Plenum Press, New York.
Pukkila, P.J. and Skrzynia, C. (1993) Frequent changes in the number of reiteratedribosomal RNA genes throughout the life cycle of the basidiomycete Coprinuscinereus. Genetics 133, 203–211.
Rodrigo, A.G., Kelly-Borges, M., Bergquist, P.R. and Bergquist, P.L. (1993) Arandomisation test of the null hypothesis that two cladograms are sampleestimates of a parametric phylogenetic tree. New Zealand Journal of Botany 31,257–268.
Rogers, S.O., Yan, Z.H., Shinohara, M., LoBuglio, K.F. and Wang, C.J.K. (1993)
104 A. Crespo et al.
Messenger RNA intron in the nuclear 18S ribosomal RNA gene of deuter-omycetes. Current Genetics 23, 338–342.
Russell, P.J., Petersen, R. and Wagner, S. (1988) Ribosomal DNA inheritance andrecombination in Neurospora crassa. Molecular General Genetics 211, 541–544.
Søchting, U. and Lutzoni, F. (1996) Phylogenetic relationships among members of theTeloschistaceae based on the nuclear ribosomal small subunit. IAL3 Abstracts.Salzburg. p. 126.
Stenroos, S. and DePriest, P.T. (1996) Phylogeny of the lichen families Cladoniaceae,Cladiaceae, Siphulaceae and Stereocaulaceae: evidence from nuclear rDNAsequences. IAL3 Abstracts. Salzburg. p. 88.
Swofford, D.L. (1991) PAUP: Phylogenetic Analysis using Parsimony, Version 3.1.Computer program distributed by the Illinois Natural History Survey, Cham-paign, Illinois.
Taylor, J.W. and Swann, E.C. (1994) DNA from herbarium specimens. In: Herrman,B. and Hummel, S. (eds) Ancient DNA. Springer-Verlag, Berlin.
Tehler, A. (1982) The species pair concept in lichenology. Taxon 31, 708–714.Tehler, A. (1995a) Arthoniales phylogeny as indicated by morphological and rDNA
sequence data. Cryptogamic Botany 5, 82–97. Tehler, A. (1995b) Morphological data, molecular data, and total evidence in
phylogenetic analysis. Canadian Journal of Botany 73 (suppl. 1), S667–S676.Untereiner, W.A., Straus, N.A. and Malloch, D. (1995) A molecular-
morphotaxonomic approach to the systematics of the Herpotrichiellaceae andallied black yeasts. Mycological Research 99, 897–913.
Wedin, M. (1996) Phylogeny and evolution of Caliciales s.lat. as shown by ribosomalDNA sequences. IAL3 Abstracts. Salzburg. p. 10.
Williams, J.G.K., Kubelik, A.R., Lavak, K.J., Rafalski, J.A. and Tingey, S.V. (1990)DNA polymorphisms amplified by arbitrary primers are useful as geneticmarkers. Nucleic Acids Research 18, 6531–6535.
Study of Lichen-forming Fungi 105
Applications of PCR forStudying the Biodiversity ofMycorrhizal Fungi
L. Lanfranco, S. Perotto and P. Bonfante
Dipartimento di Biologia Vegetale dell’Universita and Centro diStudio sulla Micologia del Terreno del CNR, Viale Mattioli 25,I-10125 Torino, Italy
6.1 Introduction
Mycorrhizal fungi are a heterogeneous group of about 6000 speciesbelonging to the Zygo-, Asco- and Basidiomycotina. They are grouped intoa number of different types depending on their morphological relationshipswith the host plants, which comprise about 240,000 plant species.Mycorrhizal fungi occupy different niches during their life cycle: they residein the rhizosphere as spores, hyphae and propagules, they occupy therhizoplane during their interaction with the root, and finally develop insidethe root tissues during the symbiotic phase (Bianciotto and Bonfante, 1998).Despite the diversity of the taxa involved, mycorrhizal fungi sharesubstantial features. They live in close association with the roots andaccomplish their life cycle due to the establishment of symbioticrelationships. During the interaction, a bidirectional transfer of mineralnutrients and carbon occurs, ensuring a continuous flow of nutrientsbetween the partners (Smith and Read, 1997). There is extensive literatureon the molecular, cellular and physiological aspects of mycorrhizal fungi(Allen 1992; Gianinazzi and Schuepp, 1994; Bonfante and Perotto, 1995;Martin et al., 1995; Harrison, 1997). The positive effects of mycorrhizalfungi on plant nutrition, health and soil stability have valuable agro-biotechnological importance for low-input agriculture. However, previousknowledge of the biological diversity of mycorrhizal fungi in therhizosphere is important to the potential exploitation of these fungi in agro-biotechnological systems. For example, the physiological traits andeffectiveness of mycorrhizal fungi differ widely, depending on theirtaxonomic position and (at a lower rank) on the individual isolate. PCR-
6
© CAB INTERNATIONAL 1998. Applications of PCR in Mycology(eds P.D. Bridge, D.K. Arora, C.A. Reddy and R.P. Elander) 107
based techniques have been used to provide molecular tools for theidentification of both endo- and ectomycorrhizal fungi when theirmorphological characters are ambiguous or missing. They have also beenused to examine relations between closely related species and populationsof a single species, a level of resolution usually beyond the reach of classicmorphological studies.
6.2 Molecular Tools to Study Biodiversity
According to Bruns and Gardes (1993), the ideal region of choice for PCRamplification should be: (i) present in all fungi of interest; (ii) easy to amplify;(iii) preferentially amplified from fungi, when plant and fungal DNAs aremixed; and (iv) variable enough to enable probes to be designed for severaltaxonomic hierarchies (species, genera, families). Genes coding for ribosomalRNA (rDNA) satisfy many of these criteria, and have been extensivelyanalysed. Repeated copies of rDNA genes are present in the genome of bothprokaryotes and eukaryotes. They are highly conserved and composed ofdifferent regions (Fig. 6.1). The ribosomal coding regions are the bestconserved, the internal transcribed spacers (ITS) display a certain degree ofvariation, and the intergenic spacers (IGS) are the most variable regions.Amplification of these regions is normally followed by restriction fragmentlength polymorphism (RFLP) analysis of the PCR-generated fragments.
Other PCR-based techniques have also been used to study the bio-diversity of mycorrhizal fungi. Random amplification of polymorphic DNA(RAPD) is based on the use of short oligonucleotides of random sequence.This technique has proved to be a powerful tool in revealing geneticdifferences between closely related organisms, and has been extensively usedin ecological studies to investigate the biodiversity of natural populations(Hadrys et al., 1992; Foster et al., 1993).
PCR amplification of regions containing microsatellites has been lesscommonly used in mycorrhizal research. Microsatellites are a special class oftandem repeats that involve a base motif of 1–10 bp repeated up to 100 times(Tautz, 1993) and dispersed over many genomic loci. They are present ineukaryotic genomes and have been used in individual identification, parent-age testing, population genetic studies, genome mapping and in the screening
Fig. 6.1. Scheme showing a rDNA repeat. The positions corresponding to the annealingsites for several primers are shown by arrows.
108 L. Lanfranco et al.
of genomic libraries. Their exceptionally high mutation rate makes micro-satellites very informative for determining relationships between closelyrelated species (Bowcock et al., 1994; Goldestein and Clark, 1995).
The aim of this chapter is to review the recent literature on PCRtechniques applied to mycorrhizal symbionts, and to discuss their implica-tions in soil microbial ecology.
6.3 PCR-based Methods to Investigate Population Dynamicsof Ectomycorrhizal Fungi
More than 5000 species of ectomycorrhizal (ECM) fungi are associated withthe secondary roots of Gymnosperms and Angiosperms (Molina et al., 1992).One of the major objectives of current research is to understand the structureand dynamics of these fungal communities (Dahlberg and Stenlid, 1995).ECM fungi in fact display a great diversity even in small monoculture forests,which are typically occupied by 20–35 species (Bruns, 1995). Prior to theintroduction of PCR methods, community studies focused on the presenceof sporocarps with the assumption that their production reflected theabundance of symbiotic mycelia (Dahlberg and Stenlid, 1995). The presenceof ECM fungi can also be evaluated through their morphological identifica-tion on mycorrhizal root apices: however, caution should be used because theextent of intraspecific morphological variations between taxa and in the sametaxon on different hosts or in different environments is not well known(Egger, 1995). The PCR methods have advantages when applied to any stagein the life cycle of a mycorrhizal fungus including fruiting bodies, mycor-rhizas, extraradical mycelia and isolated mycelia growing in vitro.
The nuclear and mitochondrial genes encoding structural rRNAs havebeen used to identify ECM fungi (Gardes et al., 1991). Bruns and Gardes(1993) designed probes by the alignment of partial sequences of themitochondrial large subunit rRNA gene (mt-LSU), which were specific forseveral taxa within the suilloid group of the Boleta. The probes were targetedat Suillus, Rhizopogon, and Gomphidius, and their specificity was determinedby testing their ability to hybridize to PCR amplified fragments from 84basidiomycete species. The probes were mostly useful in the identification ofsuilloid fungi at the generic level.
The original universal primers designed by White et al. (1990) to amplifythe nuclear ITS region have been followed by primers for the amplificationof specific taxa. Gardes and Bruns (1993) designed two taxon selectiveprimers intended to be specific for fungi (ITS1-F) and Basidiomycetes (ITS4-B) respectively, though they can often amplify plant DNA. One limitationin the use of the ITS region is that the level of intraspecific variability is notuniform for all species. On the other hand, the ITS region is, in general,sufficiently variable to allow the clear discrimination between distantlyrelated species and related genera. The increasing number of available
Study of Mycorrhizal Fungi 109
sequences of ribosomal genes has also allowed the construction of phyloge-netic trees. For example Kretzer et al. (1996) have revised the genus Suillusby analysing 38 isolates belonging to many species. On this basis, theyproposed a phylogenetic tree and suggested interesting relationships betweenthe EMF and their host plants.
The development of PCR-based protocols has initiated many pro-grammes for the investigation of the extent of biological diversity in fieldconditions. In a study carried out in a Norwegian spruce forest in Sweden,Erland (1995) used the universal primers ITS1 and ITS4 to amplify the ITSregion from DNA extracted from mycorrhizal tips. Five major RFLPpatterns were found from the amplified products and one was identified astypical of Tylospora fibrillosa. This fungus was present in at least 21% of themycorrhizal roots tested, and was regarded as one of the most abundantmycorrhizal fungi. Similarly, Karen et al. (1996) compared RFLP patterns ofITS products amplified from mycorrhizal roots with those obtained fromfruiting bodies of reference species. In this investigation, the fruiting bodyinventory indicated that the clear-cut planted forest had the lowest diversityand species richness, despite the fact that it showed the highest number offruiting bodies. A forest of 150- to 200-year-old trees produced less fruitingbodies, but examination of mycorrhizal tips revealed several species whichdid not form epigeous fruiting bodies. In conclusion, the results suggestedthat forestry management affects fruiting body diversity more than mycor-rhizal diversity (Karen et al., 1996). Another interesting study of naturalECM populations was performed by Gardes and Bruns (1996). Theyexamined the species diversity of a community in a forest of Pinus muricatain order to determine the above- and below-ground correspondence, interms of species composition, spatial frequency and abundance. ITS-RFLP,taxon-specific oligonucleotide probes, and sequence analysis were applied tofruiting bodies and mycorrhizal tips sampled over a 4-year period. Over 45fungal species were identified and grouped according to three patterns: (i)some, such as Russula xerampelina, were well represented both above andbelow ground; (ii) some, such as Suillus pungens, were mostly found asepigeous fruiting bodies; (iii) some, such as Russula amoenolens were notrepresented in the above-ground species. These results demonstrated thatECM fungal species change their resource allocation towards the productionof either fruiting bodies or ectomycorrhizae in the same environment.Moreover, it is clear that there is no correspondence between above- andbelow-ground fungal structures (Gardes and Bruns, 1996).
The fate of an introduced ECM strain has been followed in a long-standing study by the group of Martin and Le Tacon, who monitored thepresence of Laccaria bicolor strain S238N, an isolate known to improve thegrowth of Douglas fir and Norwegian spruce in nurseries. To evaluate thecompetitivity and persistence of the isolate after transplantation, the myco-trophic status of the forest trees was examined morphologically anddetermined by ribotyping between 1 and 10 years after planting out. Laccaria
110 L. Lanfranco et al.
was present in 90% of the mycorrhizal tips after 1 year, but in only 3% after4 years, since it had been widely replaced by local strains. However, in otherforest sites, Laccaria persisted for at least 10 years. These results showed thatthe destiny of an inoculated strain depends on the host plant, the presence ofcompetitive local strains, and/or the climatic conditions (Henrion et al.,1994b; Di Battista et al., 1996; Selosse et al., 1996).
In southern Europe, truffles have been the subject of intense applicationstudies since the 1970s due to the outstanding commercial value of somespecies (Chevalier, 1994). Identification of truffles during their symbioticphase is one of the major topics in this kind of research. The fruiting bodiesare usually identified on the basis of the structure of the peridium and gleba,size and shape of their spores and asci, and their wall ornamentation.However, these features are lost when the hyphae of the mantle and Hartignet develop on the plant root. Many fruiting bodies have been easilyidentified with primers which amplify the ITS regions (Henrion et al., 1994a;Lanfranco et al., 1995a; Paolocci et al., 1995), whereas many difficultiesremain when mycorrhizal roots are considered. ITS primers often amplifyplant DNA and, therefore, can give rise to complex patterns (Mello et al.,1996).
Strategies can be developed to allow the exclusive amplification of fungalDNA from species of interest. For example, sequences of ITS fragmentsamplified from fruiting bodies have been analysed in order to design specificprimers which permit the exclusive detection of the fungus of interest (Melloet al., 1997) (Fig. 6.2). These specific sequences generally work at the specieslevel, but only when the degree of intraspecific variation of the ITS region islow, as has already been demonstrated for some truffle species (Guillemaudet al., 1996).
PCR amplification of single copy genes is an alternative approach. Forexample, Kreuzinger et al. (1996) have successfully used this method on a1.2 kb fragment of the gene encoding glyceraldehyde-3-phosphate de-hydrogenase. The amplified fragments from Boletus, Lactarius, and Amanitawere distinguished by RFLP analysis and Southern blot hybridization, whilefluorescent DNA probes could easily be used in slot-blot experiments. Thisapproach is an original way for quickly developing inexpensive probes todetect ECM fungi of ecological and economic value.
6.4 Arbuscular Mycorrhizal Fungi: from the Developmentof Specific Probes to Ecological and Genetic Analysis
Arbuscular mycorrhizal (AM) fungi are obligate endosymbionts that colo-nize the roots of almost 80% of land plants. They belong to the OrderGlomales (Morton and Benny, 1990), and consist of least 150 species, usuallyidentified by their spore morphology (Walker, 1992). Simon et al. (1992,1993a, b) were the first to apply PCR techniques to AM fungi in a study of
Study of Mycorrhizal Fungi 111
the nuclear gene encoding the small subunit rRNA. From the complete 18Ssequence of two AM species (Glomus intraradices and Gigaspora margarita),they designed a primer (VANS1) that only amplified Glomales species, whenused in combination with universal primers. This combination has success-fully amplified the fungal DNA in mycorrhizal roots colonized by Glomusvesiculiferum (Simon et al., 1992). When more 18S sequences from other AMspecies became available, family specific primers were also designed and usedon mycorrhizal roots. The amplified products were then subjected to single-strand conformational polymorphism (SSCP) analysis to detect sequencedifferences (Simon et al., 1993b).
The sequence data of the small ribosomal subunit from 12 isolates of
Fig. 6.2. Design of specific primers for Tuber species. (A) Amplification products withITS1 and ITS4 primers on DNA extracted from the fruiting bodies of ten Tuber species.Lanes: 1, pBR 322 digested with HinfI; 2, T. magnatum; 3, T. borchii; 4, T. maculatum; 5,T. melanosporum; 6, T. macrosporum; 7, T. rufum; 8, T. aestivum; 9, T. brumale; 10, T.excavatum; 11, T. ferrugineum; 12, no DNA. (B) On the basis of the ITS sequence,specific primers were designed for T. borchii and used to amplify a single band of 432 bpfrom fruiting bodies (lane 2), ectomycorrhizae (lane 3) and mycelium (lane 4). Noamplification is obtained from other truffle species (lanes 5–11).
112 L. Lanfranco et al.
glomalean fungi have been used to map the phylogenetic relationshipsbetween AM fungi (Simon, 1996). The results confirmed the validity of thetaxonomic grouping and allowed Simon et al. (1993a) to construct amolecular clock, by estimating the divergence times between glomaleanfamilies and genera.
The development of molecular markers for the identification of individ-ual spores has been an important step for investigating species diversity ofAM fungi in the rhizosphere of natural communities (Clapp et al., 1995;Sanders et al., 1995, 1996; Dodd et al., 1996). Sanders et al. (1995) developeda protocol for PCR amplification with the universal primers ITS1 and ITS4,followed by RFLP to characterize the ITS region from single AM fungusspores. The ITS region, which is approximately 600 bp long, showed cleardifferences between species only after RFLP; the restriction patterns werereproducible for individual spores of a given species. However, when thetechnique was applied to spores from a Swiss grassland, the results weremuch more complex: ten individual spores belonging to the same morpho-logical Glomus group produced ten different patterns, suggesting a highgenetic diversity between individual spores.
Clapp et al. (1995) used PCR and genus-specific primers designed from18S rDNA to investigate the fungal composition of mycorrhizal rootscollected in the field. They introduced the selective enrichment of amplifiedDNA (SEAD) technique, based on the principle of subtractive hybrid-ization, to remove interfering plant-derived DNA. Three genera of AMfungi, Acaulospora, Scutellospora and Glomus, were detected in bluebellroots. While the presence of the first two genera was expected on the basisof the spores found in the soil around the roots, Glomus spores were veryrare in the rhizosphere, suggesting that the presence of an endophytic fungusdoes not always correlate with the presence of propagules.
Alternative PCR-based strategies have been devised to identify AMfungi during the sporal and symbiotic phases. Short arbitrary oligonucleo-tides were used as primers for the amplification of DNA extracted fromspores of AM fungi in RAPD experiments (Wyss and Bonfante, 1993;Lanfranco et al., 1997). RAPD analysis is a very sensitive tool for thedetection of genetic differences between individuals. A non-polymorphicband was identified as a marker for eight isolates of Glomus mosseae. Thefragment (about 650 bp long) was cloned and sequenced, and a pair ofspecific primers were designed (Lanfranco et al., 1995b). These specificallyamplified not only the DNA from G. mosseae spores, but also from roots ofpea, clover, leek and onion plants when they were colonized by G. mosseaeisolates. In addition, they allowed G. mosseae to be distinguished from theclosely related species G. coronatum: interestingly, the two species were notdistinguishable by ITS amplification techniques (Fig. 6.3) (Dodd et al.,1996).
Highly repeated sequences are also widespread in the fungal genome.Their presence has been demonstrated in AM fungi by two approaches:
Study of Mycorrhizal Fungi 113
Longato and Bonfante (1997) have used primers designed on microsatellitesequences, such as (CT)8 , (GACA)4 , (TGTC)4 , to obtain species-specificamplification profiles. This approach has proved to be a reliable andtechnically simple method for assaying genetic variability. Zeze et al. (1996)have isolated a highly repeated sequence from a partial genomic library of
Fig. 6.3. Genome analysis on AM fungi. (A) Amplification products with ITS1 and ITS4primers on DNA extracted from AM fungi. A single band of about 500–560 bp wasobtained when the following isolates were investigated: 1, Glomus coronatum; 2, G.mosseae; 3, G. versiforme; 4, G. flavisporum; 5, Gigaspora margarita. Different patternswere obtained after RFLP analysis with HinfI. (B) RAPD analysis performed using theprimers OPA-7, OPA-11 and OPA-18 (Operon Technologies, USA) on: 1, Glomuscoronatum; 2, G. mosseae; 3, Gigaspora margarita. Highly polymorphic patterns, whichallow a clear separation between G. coronatum and G. mosseae were obtained. M,λ DNA digested with HindIII and EcoRI (from Dodd et al., 1996 by permission of NewPhytologist, Cambridge University Press).
114 L. Lanfranco et al.
Scutellospora castanea. This DNA fragment has been shown to be specific forthis species by Southern blot hybridization, and by PCR assays witholigonucleotides derived from the sequence.
Molecular markers targeted to the ribosomal genes have provided newinformation. Sanders et al. (1995) have shown that a single spore of G.mosseae contains at least two different ITS sequences. Moreover, a third ITSvariant has been found by Franken and Gianinazzi-Pearson (1996) bysequencing a ribosomal clone from a genomic phage library of G. mosseae.Lloyd-MacGilp et al. (1996) have made it clear that ITS heterogeneity isnormal within Glomus spores. They obtained two sequences from singlespores of three G. mosseae isolates and one isolate of G. dimorphicum, andthree sequences from a single G. coronatum spore. Interestingly, the sequencedivergence between isolates from distant continents is scarcely greater thanthat within single spores. The authors concluded that the sequence variantshave evolved over a long time-scale relative to the rate at which these fungispread across the world.
Some recent data obtained from the Gigasporaceae have shown a similarsituation for this family. Three ITS sequences have been identified by cloningthe amplified ITS fragment from Gigaspora margarita (L. Lanfranco,unpublished work), although it should be noted that these were obtainedfrom a multispore DNA preparation. More compelling is the finding ofdifferent 18S sequences in a single spore of Scutellospora collected in an oakwoodland in the north of England (J.P. Clapp, unpublished work, cited bySanders et al., 1996). These results show a high level of genetic variability ingenes belonging to the same genome (Sanders et al., 1996) and in organismsthought to be asexual. The many questions they raise have been discussed indetail by Sanders et al. (1996) who suggest that the multinucleate spores andhyphae of Glomales may be the products of heterokaryotic processes, andthe variability of ITS sequence may be related to asexual reproduction.
In conclusion, PCR-based molecular markers for the identification ofAM fungi allow both the investigation of their biodiversity in the rhizo-sphere and within the roots, and the elaboration of a phylogenetic frame-work. These methods have also opened the way to an understanding of AMfungal genetics.
6.5 PCR-based Methods to Analyse the Complexity ofEricoid Mycorrhizal Fungal Populations
Ericaceous plants associate with soil fungi to form a distinctive type ofmycorrhiza, termed ericoid mycorrhiza (Perotto et al., 1995). The specificfeatures of this symbiosis make ericoid mycorrhizal plants successful incolonizing low-mineral, acidic organic soils high in toxic metal ions, wherea crucial role in plant nutrition has been ascribed to the saprotrophiccapabilities of the mycorrhizal endophyte. The endophytes isolated so far
Study of Mycorrhizal Fungi 115
belong to the ascomycetes, although basidiomycetes have been observed byelectron microscopy inside naturally colonized roots (Bonfante, 1980). Fewfungal species have been identified as partners of this mycorrhiza: Hymeno-scyphus ericae was the first (Read, 1974), and several Oidiodendron specieshave also been demonstrated to be mycorrhizal in several parts of Europeand North America (Couture et al., 1983; Dalpe, 1986; Douglas et al., 1989;Perotto et al., 1996a). However, the taxonomic position of most isolates isunknown, because they do not form identifiable reproductive structures.Isolates of H. ericae are usually hard to identify, as they often grow as sterilemycelia in pure culture.
Investigation of the genetic diversity of ericoid fungi has greatlybenefited from PCR techniques as a means of overcoming the difficulties ofmorphological identification. By coupling molecular methods and traditionaltaxonomy, new tools have been provided for the study of ericoid mycor-rhizal fungi. PCR–RFLP analysis of different regions of the ribosomal geneshas been used to investigate the identity and diversity of ericoid fungi.Examination of the small subunit of the ribosomal genes of the hyphomyceteScytalidium vaccinii revealed its close taxonomic relationship with H. ericae(Egger and Siegler, 1993), while RFLP analysis of the ITS region amplifiedfrom mycelia colonizing Calluna vulgaris roots has demonstrated that theroot of a single plant harbours several populations of mycorrhizal and non-mycorrhizal fungi (Perotto et al., 1996a). Investigation of mycelia isolatedfrom Gaultheria shallon roots (Monreal et al., 1996) has also revealed thecontemporary presence of fungi with different ITS restriction patterns.
RAPD analysis has enabled a higher resolving power to be used in theinvestigation of the genetic polymorphism of isolates sharing the same ITS-RFLP pattern (Perotto et al., 1996a). Results of PCR amplification withabout ten random primers on about 80 mycorrhizal mycelia isolated from C.vulgaris growing in five neighbouring sites have shown a high polymorphismin Oidiodendron maius isolates, even those derived from the same plant, anda lower variability within populations of sterile mycelia (Fig. 6.4). These dataindicate that the root system of a single plant of C. vulgaris is a complexmosaic where several populations of mycorrhizal fungi coexist, each repre-sented by a variable number of genetically distinct individuals (Perotto et al.,1996a). The ecological significance of this promiscuous association is notclear. However, several ericoid isolates produce specific isoforms of extrac-ellular enzymes useful for nutrition in vitro (Perotto et al., 1997). Thus, anassociation with several fungi may be a way of broadening the metaboliccapabilities of mycorrhizal roots in the exploitation of difficult substrates.
Analysis of ribosomal genes in ericoid fungi has revealed an unusualfeature in their organization in many isolates. Amplification using universalprimers designed to both the 18S and the 28S subunits has yielded DNAfragments which were often much larger in size than expected (Egger et al.,1995; Perotto et al., 1996b). Sequencing of these fragments has revealed thatthis discrepancy was due to the insertion of group I introns.
116 L. Lanfranco et al.
Group I introns have four conserved regions involved in the formationof secondary structures that are important for splicing. These elements arequite rare in the nuclear ribosomal genes of eukaryotes. They occursporadically in a few fungal species and in algae, but their role has not beenelucidated (Johansen et al., 1996). Interestingly, they are abundant in thepolyphyletic group of lichen-forming fungi (Gargas et al., 1995).
The distribution and sequence of group I introns are highly variable inericoid fungi. One intron element inserted in the region towards the 3′ endof the small ribosomal subunit in H. ericae is well characterized (Egger et al.,1995) and a number of additional insertions have been found in this and otherericoid fungal isolates (Perotto, unpublished work), suggesting that this maybe a common feature. Although their role is not known, introns certainlyincrease the genetic diversity of ericoid fungi.
In conclusion, PCR-based techniques are a powerful tool for the studyof ericoid fungi: the identification of isolates through specific fingerprintingmethods is quickly overcoming the lack of morphological characters oftenencountered with these fungi.
6.6 The Interactions between Mycorrhizal Fungi andEndosymbiotic Bacteria
External hyphae of mycorrhizal fungi encounter many other soil micro-organisms in the rhizosphere, and a network of interactions is created(Azcon-Aguilar and Barea, 1992). PCR has also been of great assistance inthis field, particularly in the investigation of the interactions between
Fig. 6.4. DNA fingerprints of Oidiodendron maius isolates after PCR–RAPD amplificationusing short arbitrary primer OPA-14. Isolates may be divided into several groups on thebasis of their DNA banding.
Study of Mycorrhizal Fungi 117
mycorrhizal fungi and bacteria. The surface of both ECM and AM fungi canbe colonized by soil bacteria that use the hyphae as a specific substrate(Bianciotto et al., 1996a; Schelkle et al., 1996). Furthermore, the cytoplasmof AM fungi harbours structures called bacteria-like organisms (BLO).Identification of these bacterial endosymbionts has been hampered becausethey cannot be grown on cell-free media. Amplification and partial sequenc-ing of the 16S rDNA region of endosymbiotic bacteria, followed by databasesearches for sequence similarity and phylogenetic analyses, have nowunambiguously placed the symbiont of Gigaspora margarita among thepseudomonads of rRNA group II (Bianciotto et al., 1996b). The endo-symbiont was identified as a member of the genus Burkholderia. Thesequence of the gene coding for the small subunit rRNA has been used todesign two primers (BLOf and BLOr) specific for the Burkholderiaendosymbiont of Gi. margarita. These primers were tested for theirspecificity on a number of free-living bacteria, and then used on restingspores, external mycelium and clover roots mycorrhized with Gi. margaritain order to follow the fate of BLOs during the fungal life cycle. Spores ofdifferent origins belonging to Glomaceae, Gigasporaceae and Acaulospor-aceae, were analysed by confocal microscopy using a fluorescent dye specificfor the visualization of bacteria to determine whether other AM fungipossess bacterial endosymbionts. In addition, PCR amplifications witheubacterial primers (704f/1495r) and with BLOf/BLOr were performed onDNA preparations from spores of different isolates. All spores, with oneexception, contained intracellular bacteria, although their number and shapegreatly differed among the different species. In addition, the BLOf/BLOrprimers were found to amplify only a DNA fragment from Gigasporaceaespores (Bianciotto et al., 1996c).
In conclusion, these experiments suggest that intracellular bacteria arenot a sporadic phenomenon but may be a general feature of AM spores. Theirpresence raises many questions about their role in mycorrhizal functions andabout evolutionary processes and it has been suggested that they may beorganelle precursors (Holzman, 1996).
6.7 Areas that Need Further Developments
Despite the huge progress of recent years, many problems remain unre-solved; most of these are of a technical nature. For example, it is importantto improve the level of amplification for samples collected in the field; atpresent this level is unsatisfactory (Harris, 1996). This is probably caused bythe presence of inhibitory substances.
Another important point that has rarely been tackled is the quantificationof DNA in the samples. Simon et al. (1992) were the first to propose a protocolfor estimation of the amount of AM fungi living inside the plant roots byamplifying the sample with different concentrations of an internal standard.
118 L. Lanfranco et al.
Edwards et al. have developed an alternative protocol and tested the possibilityof evaluating the effect of rhizosphere bacteria on the development of AMfungi (S.G. Edwards, A.H. Fitter and J.P.W. Young, 1997, personal commu-nication). A more precise scenario of the competitive colonization of roots bymycorrhizal fungi will only be available when it is possible to quantify thepresence of one fungal genome with respect to another.
6.8 Conclusions
The development of PCR-based techniques has allowed us to better definethe presence and role of mycorrhizal fungi in the rhizosphere, which is acomplex niche where microorganisms develop and interact with each other.Because of PCR-based techniques (Fig. 6.5), many crucial questions aboutphylogenesis, identification and polymorphisms of mycorrhizal fungi havebegun to be answered. For example, the extent of diversity in naturalpopulations has been probed and shown to be greater than previouslythought. Several symbiotic fungi are often present, not only in the sameenvironment, but on the same root irrespective of its size. The thin roots ofEricales are a good illustration of this phenomenon. The dynamics of theresident fungal population have also been directly evaluated, as well as thefate of introduced strains selected for their physiological properties. It is clearthat the ability of these strains to survive depends on the environment, as wellas on their interactions with other soil microorganisms.
Fig. 6.5. A flow chart showing the most important PCR-based strategies that have beenused to investigate the genome of mycorrhizal fungi.
Study of Mycorrhizal Fungi 119
The genetics of mycorrhizal fungi is still in its infancy, particularly in thecase of AM fungi, which are intractable organisms due to their obligatebiotrophic nature. PCR-based techniques have allowed us to investigatethese organisms inside the roots, to elaborate a phylogenetic framework andto give an insight into their genetics for the first time. Molecular tools haverevealed an unexpected level of variability in the ribosomal genes inindividual isolates. The discovery of several introns in the ribosomal genes ofericoid mycorrhizal fungi suggests similar conclusions, as such features arealso a source of genetic variability.
Further technical developments are still needed to solve specific prob-lems in mycorrhizal research. However, despite these current limitationsPCR-based techniques have so far provided an invaluable contribution to thedefinition of the mycorrhizal fungal dimension in the rhizosphere.
Acknowledgements
Experimental results discussed in this review are based on researches fundedby the following Italian and European projects: (i) Target Project: Bio-tecnologia della micorrizazione (CNR-Italian Regions); (ii) Special Project,Biodiversita in Aree del Mediterraneo, INC-CNR; (iii) Special project:Diagnostici (MIRAAF); (iv) ECC Biotechnology Project (IMPACT Project,Contract No BIO2-CT93-0053); (v) ECC AIR Project (MYCOMED,Contract N. AIR2-CT94-1149).
References
Allen, M.F. (1992) Mycorrhizal Functioning. Chapman and Hall, New York London.Azcon-Aguilar, C. and Barea, J.M. (1992) Interactions between mycorrhizal fungi and
other rhizosphere microorganisms. In: Allen, M.F. (ed.) Mycorrhizal Function-ing. Chapman and Hall, New York, pp. 163–198.
Bianciotto, V. and Bonfante, P. (1998) Presymbiotic versus symbiotic phase inarbuscular endomycorrhizal fungi. In: Varma, A. and Hock, B. (eds) Mycorrhiza2nd edn. Springer Verlag, Berlin, (in press).
Bianciotto, V., Minerdi, D., Perotto, S. and Bonfante, P. (1996a) Cellular interactionsbetween arbuscular mycorrhizal fungi and rhizosphere bacteria. Protoplasma193, 123–131.
Bianciotto, V., Bandi, C., Minerdi, D., Sironi, M., Tichy, H.V. and Bonfante, P. (1996b)An obligately endosymbiotic fungus itself harbors obligately intracellularbacteria. Applied and Enviromental Microbiology 62, 3005–3010.
Bianciotto, V., Bandi, C., Minerdi, D., Sironi, M. and Bonfante, P. (1996c) Spores ofdifferent isolates of arbuscular mycorrhizal fungi contain intracellular bacteria.Abstracts of the 6th International Fungal Spore Conference. UniversitatKonstanz. August 25–29.
Bonfante P. (1980) Occurrence of a basidiomycete in living cells of mycorrhizal hair
120 L. Lanfranco et al.
roots of Calluna vulgaris. Transactions of the British Mycological Society 75,320–325.
Bonfante, P. and Perotto, S. (1995) Strategies of arbuscular mycorrhizal fungi wheninfecting host plants. New Phytologist (Tansley Review, N.82) 130, 3–21.
Bowcock, A.M., Ruizlinares, A., Tomfohrde, J., Minch, E., Kidd, J.R. and Cavalli-Sforza, L.L. (1994) High resolution of human evolutionary trees with polymor-phic microsatellites. Nature 368, 455–457.
Bruns, T.D. (1995) Thoughts on the processes that maintain local species diversity ofectomycorrhizal fungi. Plant and Soil 170, 63–73.
Bruns, T.D. and Gardes, M. (1993) Molecular tools for the identification ofectomycorrhizal fungi-taxon-specific oligonucleotide probes for suilloid fungi.Molecular Ecology 2, 233–242.
Chevalier, G. (1994) Evolution des recherches sur les plants mycorhizes par la truffeet perspectives de development. Giornale Botanico Italiano 128, 7–18.
Clapp, J.P., Young, J.P.W., Merryweather, J.W. and Fitter, A.H. (1995) Diversity offungal symbionts in arbuscular mycorrhizas from a natural community. NewPhytologist 130, 259–265.
Couture, M., Fortin J. A. and Dalpe, Y. (1983) Oidiodendron griseum Robak: anendophyte of ericoid mycorrhiza in Vaccinium spp. New Phytologist 95,375–380.
Dalhlberg, A. and Stenlid, J. (1995) Spatiotemporal patterns in ectomycorrhizalpopulations. Canadian Journal of Botany 73 (1), S1222–S1230.
Dalpe, Y. (1986) Axenic synthesis of ericoid mycorrhiza in Vaccinium angustifoliumait. by Oidiodendron species. New Phytologist 103, 391–396.
Di Battista, C., Bouchard, D., Genere, B., Martin, F. and Le Tacon, F. (1996) Monitoringthe persistence of the ectomycorrhizal basidiomycete Laccaria bicolor S238N onDouglas fir and Norway Spruce in nursery and forest sites by PCR. Abstracts of theFirst International Conference on Mycorrhizae. Berkeley, p. 42.
Dodd, J.C., Rosendahl, S., Giovannetti, M., Broome, A., Lanfranco, L. and Walker,C. (1996) Inter- and intraspecific variation within the morphologically-similararbuscular mycorrhizal fungi, Glomus mosseae and Glomus coronatum. NewPhytologist 133, 113–122.
Douglas, G.C., Heslin, M.C. and Reid, C. (1989) Isolation of Oidiodendron maiusfrom Rhododendron and ultrastructural characterization of synthesized mycor-rhizas. Canadian Journal of Botany 67, 2206–2212.
Egger, K.N. (1995) Molecular analysis of ectomycorrhizal fungal communities.Canadian Journal of Botany 73(1), S1415–S1422.
Egger, K.N. and Siegler, L. (1993) Relatedness of the ericoid endophytes Scytalidiumvaccinii and Hymenoscyphus ericae inferred from analysis of ribosomal DNA.Mycologia 85, 219–230.
Egger, K.N., Osmond, G. and Goodier, J.L. (1995) Sequence and putative secondarystructure of group I intron in the nuclear encoded ribosomal RNA genes of thefungus Hymenoscyphus ericae. Biochimica et Biophysica Acta 1261, 275–278.
Erland (1995) Abundance of Tylospora fibrillosa ectomycorrhizas in a south SwedishSpruce forest measured by RFLP analysis of the PCR-amplified rDNA ITSregion. Mycological Research 99, 1425–1428.
Foster, L.M., Kozak, K.R., Loftus, M.G., Stevens, J.J. and Ross, I.K. (1993) Thepolymerase chain reaction and its application to filamentous fungi. MycologicalResearch 97, 769–781.
Study of Mycorrhizal Fungi 121
Franken, P. and Gianinazzi-Pearson, V. (1996) Construction of genomic phagelibraries of the arbuscular mycorrhizal fungi Glomus mosseae and Scutellosporacastanea and isolation of ribosomal genes. Mycorrhiza 6, 167–173.
Gardes, M. and Bruns, T.D. (1993) ITS primers with enhanced specificity forBasidiomycetes: application to identification of mycorrhizae and rusts. Molec-ular Ecology 2, 113–118.
Gardes, M. and Bruns, T.D. (1996) Community structure of ectomycorrhizal fungi ina Pinus muricata forest: above and below-ground views. Canadian Journal ofBotany 74, 1572–1583.
Gardes, M., White, T.J., Fortin, J.A., Bruns, T.D. and Taylor, J.W. (1991) Identifica-tion of indigenous and introduced symbiotic fungi in ectomycorrhizae byamplification of nuclear and mitocondrial ribosomal DNA. Canadian Journal ofBotany 69, 180–190.
Gargas, A., DePriest, P. and Taylor, J.W. (1995) Position of multiple insertions in SSUrDNA of lichen-forming fungi. Molecular Biological Evolution 12, 208–218.
Gianinazzi, S. and Schuepp, H. (1994) Impact of Arbuscular Mycorrhizas onSustainable Agriculture and Natural Ecosystems. Birkhauser Verlag, Basel.
Goldestein, D.B. and Clark, A.G. (1995) Microsatellites variation in North Americanpopulations of Drosophila melanogaster. Nucleic Acids Research 19, 3882–3886.
Guillemaud, T., Raymond, M., Callot, G., Cleyet-Marel, J.C. and Fernandez, D.(1996) Variability of nuclear and mitochondrial ribosomal DNA of a trufflespecies (Tuber aestivum). Mycological Research 100, 547–550.
Harris, W.J. (1996) Simultaneous detection of microorganisms in soil suspensionbased on PCR amplification of bacterial 16S rRNA fragments. BioTechniques 21,463–471.
Harrison, M. (1997) Vesicular-arbuscular mycorrhizal symbiosis, an undergroundsymbiosis. Trends in Plant Science 2, 54–60.
Hadrys, H., Balick, M. and Schierwater, B. (1992) Applications of random amplifiedpolymorphic DNA (RAPD) in molecular ecology. Molecular Ecology 1, 55–63.
Henrion, B., Chevalier, G. and Martin, F. (1994a) Typing truffle species by PCRamplification of the ribosomal DNA spacers. Mycological Research 98, 37–43.
Henrion, B., Di Battista, C., Bouchard, D., Vairelles, D., Thompson, B. D., Le Tacon,F. and Martin, F. (1994b) Monitoring the persistance of Laccaria bicolor as anendomycorrhizal symbiont of nursery-grown douglas fir by PCR of the rDNAintergenic spacer. Molecular Ecology 3, 571–580.
Holzman, D. (1996) Bacteria in fungi may be organelle precursors. American Societyof Microbiology News 62, 621–622.
Karen, O., Dahlberg, A., Finlay, R., Jonsson, L., Jonsson, M. and Nylund, J.E. (1996)Diversity of ectomycorrhizal fungi- managed vs unmanaged forests. Abstracts ofthe First International Conference on Mycorrhizae. Berkeley. p.69.
Kretzer, A., Li, YN., Szaro, T. and Bruns, T.D. (1996) Internal transcribed spacersequences from 38 recognized of Suillus sensu lato phylogenetic and taxonomicimplications. Mycologia 88(5), 776–785.
Kreuzinger, N., Podeu, R., Gruber, F., Gobl, F. and Kubicek, C.P. (1996) Identifica-tion of some ectomycorrhizal basidiomycetes by PCR amplification of theirGDP (glyceraldehyde-3-phosphate dehydrogenase) genes. Applied and Envi-ronmental Microbiology 62, 3432–3438.
Johansen, S., Muscarella, D.E. and Vogt, V.M. (1996) Insertion elements in ribosomalDNA. In: Zimmermann, R.A., Dahlberg, A.E. (eds) Ribosomal RNA: Structure,
122 L. Lanfranco et al.
Evolution, Processing and Function in Protein Biosynthesis. CRC Press, BocaRaton, pp. 89–110.
Lanfranco, L., Arlorio, M., Matteucci, A. and Bonfante, P. (1995a) Truffles – Their lifecycle and molecular characterization. In: Stocchi, V., Bonfante, P. and Nuti, M.(eds) Biotechnology of Ectomycorrhizae. Plenum Press, New York, pp. 139–149.
Lanfranco, L., Wyss, P., Marzachi’, C. and Bonfante, P. (1995b) Generation ofRAPD–PCR primers for the identification of isolates of Glomus mosseae, anarbuscular mycorrhizal fungus. Molecular Ecology 4, 61–68.
Lanfranco, L., Perotto, S., Longato, S., Mello, A., Cometti, V. and Bonfante, P. (1997)Molecular approaches to investigate biodiversity in mycorrhizal fungi. In:Varma, A. (ed.) Manual for Mycorrhizae. Springer Verlag, Berlin (in press).
Lloyd-MacGilp, S.A., Chambers, S.M., Dodd, J.C., Fitter, A.H., Walker, C. andYoung, J.P.W. (1996) Diversity of the ribosomal internal transcribed spacerswithin and among isolates of Glomus mosseae and related mycorrhizal fungi.New Phytologist 133, 103–111.
Longato, S. and Bonfante, P. (1997) Molecular identification of mycorrhizal fungiby direct amplification of microsatellite regions. Mycological Research 101,425–432.
Martin, F., Laurent, P., de Carvalho, D., Burgess, T., Murphy, P., Nehls, U. and Tagu,D. (1995) Fungal gene expression during ectomycorrhiza formation. CanadianJournal of Botany 73 (1), S541–S547.
Mello, A., Nozenzo, C., Meotto, F. and Bonfante, P. (1996) Rapid typing of trufflemycorrhizal roots by PCR amplification of the ribosomal DNA spacers.Mycorrhiza 6, 417–422.
Mello, A., Garnero, L., Longato, S., Perotto, S. and Bonfante, P. (1997) Rapid typingof Tuber borchii mycorrhizae by PCR amplification with specific primers.Abstracts of the 19th Fungal Genetics Conference. California. March 1997.
Molina, R., Massicotte, H. and Trappe, J.M. (1992) Specificity phenomena inmycorrhizal symbioses: community – ecological consequences and practicalimplications. In: Allen, M.F. (ed.) Mycorrhizal Functioning. Chapman and Hall,New York, pp. 357–417.
Monreal M., Berch S., Barbee, M. and Pirseyed, M. (1996) Identification of ericoidmycorrhizal fungi using molecular methods. Abstracts of the First InternationalConference on Mycorrhizae. Berkeley. p. 88.
Morton, J.B. and Benny, G.L. (1990) Revised classification of arbuscular mycorrhizalfungi (Zygomycetes): a new order, Glomales, two new suborders, Glomineaeand Gigasporineae, and two new families, Acaulosporaceae and Gigasporaceae,with an emendation of Glomaceae. Mycotaxon 37, 471–491.
Paolocci, F., Angelini, P., Cristofari, E., Granetti, B. and Arcioni, S. (1995)Identification of Tuber spp. and corresponding ectomycorrhizae throughmolecular markers. Journal of Science Food and Agriculture 69, 511–517.
Perotto, S., Peretto, R., Faccio, A., Schubert, A., Varma, A. and Bonfante, P. (1995)Ericoid mycorrhizal fungi: cellular and molecular bases of their interactions withthe host plant. Canadian Journal of Botany 73 (suppl), S557–S568.
Perotto, S., Actis-Perino, E., Perugini, J. and Bonfante, P. (1996a) Molecular diversityof fungi from ericoid mycorrhizal roots. Molecular Ecology 5, 123–131.
Perotto, W.S., Bandi, C., Young, P. and Bonfante P. (1996b) Identification of intronsin the nuclear ribosomal genes of ericoid mycorrhizal fungi. Abstracts of the FirstInternational Conference on Mycorrhizae. Berkeley. p. 96.
Study of Mycorrhizal Fungi 123
Perotto, S., Cometti, V., Coisson, J.D. and Bonfante, P. (1997) Production of pectin-degrading enzymes by ericoid mycorrhizal fungi. New Phytologist 135, 151–162.
Read, D.J. (1974) Pezizella ericae sp. nov., the perfect state of a typical mycorrhizalendophyte of the Ericaceae. Transactions of the British Mycological Society 63,381–383.
Sanders, I.R., Alt, M., Groppe, K., Boller, T. and Wiemken, A. (1995) Identificationof ribosomal DNA polymorphisms among and within spores of the Glomales:application to studies on the genetic diversity of arbuscular mycorrhizal fungalcommunities. New Phytologist 130, 419–427.
Sanders, I.R., Clapp, J.P. and Wiemken, A. (1996) The genetic diversity of arbuscularmycorrhizal fungi in natural ecosystems – a key to understanding the ecologyand functioning of the mycorrhizal symbiosis. New Phytologist 133, 123–134.
Schelkle, M., Ursic, M., Farquhar, M. and Peterson, L. (1996) The use of laserscanning confocoal microscopy to characterize mycorrhizas of Pinus strobus L.and to localize associated bacteria. Mycorrhiza 6, 431–440.
Selosse, M.A., Jacquot, D., Martin, F. and Le Tacon, F. (1996) Genetic structure ofLaccaria spp. populations: ten-years’ persistence without introgression of anintroduced strain in natural populations. Abstracts of the First InternationalConference on Mycorrhizae. Berkeley. p.108.
Simon, L. (1996) Phylogeny of the Glomales: deciphering the past to understand thepresent. New Phytologist 133, 95–101.
Simon, L., Lalonde, M. and Bruns, T.D. (1992) Specific amplification of 18S fungalribosomal genes from vesicular-arbuscular endomycorrhizal fungi colonizingroots. Applied and Environmental Microbiology 58, 291–295.
Simon, L., Bousquet, J., Levesque, R.C. and Lalonde, M. (1993a) Origin ofendomycorrhizal fungi and coincidence with vascular land plants. Nature 363,67–69.
Simon, L., Levesque, R.C. and Lalonde, M. (1993b) Identification of endomycor-rhizal fungi colonizing roots by fluorescent Single-Strand ConformationPolymorphism-Polymerase Chain Reaction. Applied and Environmental Micro-biology 59, 4211–4215.
Smith, S. E. and Read, D.J. (1997) Mycorrhizal Symbiosis. Academic Press, London.Tautz, D. (1993) Notes on the definition and nomenclature of tandemly repetitive
DNA sequences. In: Pena S.D.J., Chakraborty, R., Epplen J.T. and Jeffreys, A.J.(eds) DNA Fingerprinting: State of Science. Birkhauser, Basel, pp. 21–28.
Walker, C. (1992) Systematics and taxonomy of the arbuscular endomycorrhizal fungi(Glomales) – a possible way forward. Agronomie 12, 887–897.
White, T.J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification and directsequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A.,Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR Protocols. A Guide toMethods and Applications. Academic Press, San Diego, pp. 315–322.
Wyss, P. and Bonfante, P. (1993) Amplification of genomic DNA of arbuscular-mycorrhizal (AM) fungi by PCR using short arbitrary primers. MycologicalResearch 97, 1351–1357.
Zeze, A., Hosny, M., Gianinazzi-Pearson, V. and Dulieu, H. (1996) Characterizationof a highly repeated DNA sequence (SC1) from the arbuscular mycorrhizalfungus Scutellospora castanea and its detection in planta. Applied and Environ-mental Microbiology 62, 2443–2448.
124 L. Lanfranco et al.
PCR Applications in FungalPhylogeny
S. Takamatsu
Laboratory of Plant Pathology, Faculty of Bioresources, MieUniversity, Tsu 514, Japan
7.1 Introduction
Historically, the phylogeny of fungi has been inferred from variousphenotypic characters, e.g. morphological, physiological and developmentalcharacters, and/or chemical components such as secondary metabolites.The recent development of molecular techniques has enabled the derivationof fungal phylogenies based on the analyses of proteins or nucleic acids,e.g. isozyme analysis, DNA–DNA hybridization, electrophoretic karyo-typing, restriction fragment length polymorphism (RFLP), and DNAsequencing. However, these molecular techniques have been difficult toapply to obligate parasites from which only small amounts of fungalmaterials are available, or to rare taxa which are available only as herbariumspecimens. The polymerase chain reaction (PCR) developed in the mid1980s (Saiki et al., 1985; Mullis et al., 1986; Mullis and Faloona, 1987)made possible the amplification of particular nucleotide sequences fromvery small amounts of starting materials. In addition, relatively impureDNA extracts can be used for PCR. PCR-based techniques have enabledthe construction of molecular phylogenies for obligate parasites and raretaxa, and as PCR techniques have led to simplified molecular procedures,they have also increased the availability of phylogenetic studies for manyfungi. This chapter reviews some of the recent advances that have beenmade through the application of PCR methods to phylogenetic studiesof fungi.
7
© CAB INTERNATIONAL 1998. Applications of PCR in Mycology(eds P.D. Bridge, D.K. Arora, C.A. Reddy and R.P. Elander) 125
7.2 Sequence Analysis from Small Samples
7.2.1 DNA extraction
A number of methods have been developed for the rapid isolation of fungalDNA (Biel and Parrish, 1986; Zolan and Pukkila, 1986; Taylor and Natvig,1987; Lee et al., 1988; Moller et al., 1992). Most of these are applicableto molecular phylogenetic analysis when large amounts of fungal materialscan be obtained. However, a small amount of starting material is requiredfor PCR-based sequence analysis, and sufficient single-copy genomicsequences can be routinely amplified from 1 µg of total DNA (Saiki etal., 1988). Lee and Taylor (1990) simplified an earlier method for totalDNA isolation and used it for the amplification of multicopy genes fromsmall quantities of fungal materials (Lee et al., 1988). They reported thatrDNA sequences could be successfully amplified from a single spore ofNeurospora tetrasperma. In molecular phylogenetic analysis, sequence dataare often required from herbarium collections, especially when theyconcern rare taxa. Bruns et al. (1990) applied Lee and Taylor’s methodto 35 collections of dried fungal materials stored under a variety ofconditions for 1–50 years. They successfully amplified the mitochondriallarge subunit rRNA gene from all of the specimens, and 16 specimenswere subsequently sequenced.
Walsh et al. (1991) developed a method utilizing a chelating resin forextracting DNA from forensic-type samples for PCR. The method wassimple, rapid, did not include organic solvents and did not require multipletube transfers. This method has proved applicable to the extraction of DNAfrom small amounts of fungal materials, and Hirata and Takamatsu (1996)have used the method to obtain the rDNA internal transcribed spacer (ITS)regions from several obligately parasitic powdery mildew fungi.
7.2.2 PCR amplification
A variety of oligonucleotide primers have been designed for the amplificationof rDNA sequences from a wide range of fungal materials (e.g. White et al.,1990). Amplification using these primer sets, followed by direct sequencinghas considerably shortened the time required to perform phylogeneticstudies.
In addition to universal primers, many kinds of primer sets for theamplification of rDNA have been developed for particular groups of fungi;two examples of this are lichenized fungi (Gargas and Taylor, 1992) and slimemoulds (Rusk et al., 1995).
In most cases simple thermal cycling parameters have proved sufficientto amplify rDNA sequences; however, two sequential reactions using nestedprimers can improve the efficiency of amplification from small quantities ofDNA (Hirata and Takamatsu, 1996).
126 S. Takamatsu
7.2.3 Sequence analysis
Two methods are in general use for sequencing PCR-amplified DNAfragments. One procedure involves cloning. Although cloning procedureshave become more straightforward, considerable effort is still requiredespecially when obtaining sequence data from large numbers of individuals.Another disadvantage of the cloning methods is that mutations can beintroduced by the DNA polymerase during synthesis. Taq DNA polymeraselacks editing functions and incorporates an incorrect nucleotide at a rate of2 × 10–4 nucleotides per PCR cycle. This rate of misincorporation translatesinto an overall error frequency of one per 400 bp after 30 cycles ofamplification (Saiki et al., 1988). However, conditions can be optimized toreduce this error frequency to less than one substituion in 15,000 bp (Gelfandand White, 1990). As a result a consensus sequence, based on several clonedPCR products, has to be determined for each sample in order to distinguishmutations present in the original sequence from any random misincorpora-tion of nucleotides introduced by the polymerase during PCR.
The second procedure involves direct sequencing of PCR productwithout cloning. This generates a consensus sequence at each nucleotide andminimizes possible errors from misincorporation. Since the procedure doesnot involve the cloning of the PCR product, the time required forcomparative sequencing studies is significantly reduced. As a result, directsequencing is being widely used for phylogenetic studies based on DNAsequences (Lott et al., 1993; Morales et al., 1993; Zambino and Szabo, 1993;Saenz et al., 1994; Nishida and Sugiyama, 1994).
7.2.4 Construction of phylogenetic trees
Many computer packages have been developed for phylogenetic studies, andsix of the more widely used are described here.
CLUSTAL W
The program CLUSTAL W (Thompson et al., 1994) has a multiple sequencealignment function that works well with large numbers of either nucleic acidor protein sequences. The program also constructs phylogenetic trees by theneighbour-joining method of Saitou and Nei (1980), but does not draw thetree. Confidence intervals on the tree are calculated using a bootstrapprocedure similar to that described by Felsenstein (1985).
MACCLADE
MACCLADE (Maddison and Maddison, 1992) is a program for analysingcharacter evolution. It has a graphical spreadsheet editor for entering andediting data matrices, a tree window for viewing and manipulating trees,charting facilities, and other features. Although MACCLADE does not have asophisticated search algorithm to find the best tree, it can be complementedby PAUP (see below) as the two packages are compatible.
Applications in Fungal Phylogeny 127
MEGA
MEGA (molecular evolutionary genetics analysis; Kumar et al., 1993) is aphylogeny inference package that utilizes various distance methods andparsimony. Various other statistics are included for the analysis of DNA,RNA and protein sequence data.
PAUP
PAUP version 3 (Swofford, 1993) is probably the most sophisticated programfor inferring phylogenies using parsimony analysis, with many options andgood compatibility with MACCLADE. Version 3 itself is currently notavailable, but the new program, PAUP version 4, will be released in thesummer of 1998. Version 4 will include parsimony, distance matrix, invar-iants, and maximum likelihood methods.
PHYLIP
PHYLIP (Felsenstein, 1989) includes programs for parsimony, distance matrix,and maximum likelihood methods for a variety of data types, includingmolecular sequences (DNA and protein), gene frequencies, continuouscharacters, discrete (0, 1) characters and restriction sites. It also includesprograms for plotting phylogenies and consensus trees.
PUZZLE
PUZZLE is a package that uses maximum likelihood to reconstruct phyloge-netic trees from sequence data. It implements a fast tree search algorithm(quartet puzzling; Strimmer and von Haeseler, 1996) that allows analysis oflarge data sets and automatically assigns estimations of support to eachinternal branch. Rate heterogeneity is incorporated in all models of substitu-tion. All model parameters including rate heterogeneity can be estimatedfrom the data by maximum likelihoods. PUZZLE also computes pairwisemaximum likelihood distances as well as branch lengths for user specifiedtrees, and offers a novel method, likelihood mapping, to investigate thesupport of internal branches without computing an overall tree.
7.3 Methods for Phylogenetic Analysis
7.3.1 DNA sequence analysis
DNA sequence analysis has become the most useful method for inferringphylogenetic relationships between organisms. Bruns et al. (1990) describedthe benefits of using DNA sequences for phylogenetic analysis as being ‘thelarge number of characters compared can substantially increase the resolvingpower’. One can also observe the mode of sequence variation, that is, whether achange is a transversion or transition, silent or selected, and one can measurethe degree of nucleotide bias; results from different laboratories can be
128 S. Takamatsu
compared directly, and the publication of sequences and their deposition inelectronic databases (GenBank, EMBL and DDBJ) allows the confirmation ofresults and their application to other taxa without the need to obtain strains orclones, or to repeat experiments. Some DNA regions which have proved usefulfor sequence analysis for phylogenetic studies are described below.
Nuclear and mitochondrial rDNAThe nuclear rRNA genes (rDNA) of eukaryotes are arranged in tandemlyrepeated clusters with each cluster containing the genes for the small subunit(18S), 5.8S, and large subunit (25–28S) rRNA (Gerbi, 1985). These genesshow little sequence divergence between closely related species and are usefulfor phylogenetic studies among distantly related organisms (Jorgensen andCluster, 1988; Bruns et al., 1991; Hillis and Dixon, 1991; Illingworth et al.,1991; Taylor et al., 1993). Studies of the secondary structure of the rRNAhave shown that eukaryotic large subunit rRNAs are composed of aconserved ‘core’ that has a similar secondary structure to prokaryoticrRNAs, and interspersed ‘divergent domains’ that appear to have noprokaryotic homologue (Michot et al., 1984; Hillis and Davis, 1987; Michotand Bachellerie, 1987). DNA sequences of the divergent domains of thenuclear large subunit rDNA are useful for determining phylogenies ofrelatively closely related organisms. Within each repeat, the conservedregions are separated by two internal transcribed spacers (ITS), which showhigher rates of divergence (Jorgensen and Cluster, 1988; Ritland et al., 1993;Schlotterer et al., 1994). A third spacer, the large intergenic spacer (IGS), isfound between the 3′ end of the 28S and the 5′ end of the 18S genes. Thesespacer regions evolve faster than the subunit genes and can be useful forstudying closely related organisms, such as among species within a genus oramong populations (Jorgensen and Cluster, 1988; Bruns et al., 1991; Ritlandet al., 1993; O’Donnell, 1992; Hsiao et al., 1994, 1995; Yan et al., 1995;Kusaba and Tsuge, 1994, 1995). The mitochondrial rRNA genes evolveapproximately 16 times faster than the nuclear rDNA (Bruns and Szaro,1992), and so are useful for phylogenetic studies at an intermediatetaxonomic level (Bruns et al., 1991; Simon et al., 1994).
Protein genesProtein coding genes have some advantages over rRNA genes and spacers inthat the alignment of the sequence is less problematic (Bruns et al., 1991).Protein sequences also lend themselves to differential weighting of bases bycodon position, and third position sites can provide a relatively good estimateof the neutral substitution rate. Elongation factor-1a protein genes (Hase-gawa et al., 1993; Baldauf and Palmer, 1993; Nordnes et al., 1994), actin genes(Baldauf and Palmer, 1993; Fletcher et al., 1994), β-tubulin genes (Baldaufand Palmer, 1993; Edlind et al., 1996), glyceraldehyde-3-phosphate dehy-drogenase genes (Martin et al., 1993), and nitrate reductase genes (Zhou andKleinhofs, 1996) have been used for phylogenetic analyses of eukaryotes
Applications in Fungal Phylogeny 129
including fungi. Actin genes (Cox et al., 1995; Wery et al., 1996), chitinsynthase genes (Mehmann et al., 1994; Karuppayil et al., 1996), elongationfactor-1a protein genes (Shearer, 1995), β-tubulin genes (Li and Edlind,1994), and orotidine 5′-monophosphate decarboxylase genes (Radford, 1993)have been used in fungal studies. However, none of these, with the exceptionof chitin synthase was PCR-mediated, as universal primers have not yet beendeveloped for most of these genes.
7.3.2 PCR–RFLP
RFLP analysis has been a useful tool in phylogenetic studies with a variety oforganisms (Michelmore and Hulbert, 1987; Bruns et al., 1991). RFLP of ampli-fied fragments (PCR–RFLP) is now widely used for both fungal phylogenyand taxonomy (Chen, 1992; Liu and Sinclair, 1992; Bernier et al., 1994; Bun-yard et al., 1994, 1996; Hopple and Vilgalys, 1994; Appel and Gordon, 1995;Donaldson et al., 1995; Erland, 1995; Harrington and Wingfield, 1995; Sappalet al., 1995; Buscot et al., 1996; Chiu et al., 1996; Edel et al., 1996; Guillemaud etal., 1996; Waalwijk et al., 1996; Leal et al., 1997). PCR–RFLP is a simple andinexpensive method compared with traditional RFLP or sequence analyses asit avoids the need for blotting, probing and/or sequencing. ITS or IGS regionshave mainly been used for PCR–RFLP as these regions are highly polymorphicand can be easily amplified by PCR using universal primers.
7.3.3 RAPD and AP-PCR
Random amplification of polymorphic DNA (RAPD; Williams et al., 1990)or arbitrarily primed polymerase chain reaction (AP-PCR; Welsh andMcClelland, 1990) is a simple and rapid method for detecting geneticdiversity. Genetic diversity is assessed by amplification at low stringencywith a single short primer of arbitrary sequence. The technique has been usedto detect genetic variations among strains or isolates within a species(Goodwin and Annis, 1991; Cooke et al., 1996; Hseu et al., 1996; Boyd andCarris, 1997; Jeng et al., 1997; Maurer et al., 1997; Pei et al., 1997;Jungehulsing and Tudzynski, 1997). The amplification conditions need to berigorously standardized in order to obtain reproducible and consistentresults, as the fragment pattern obtained is highly sensitive to concentrationsof Mg2+, DNA polymerase, primers and template DNAs, and to cyclingtemperatures (Bruns et al., 1991).
7.4 PCR-derived Phylogenetic Studies
7.4.1 Broad ranging studies
Bruns et al. (1992) used 18S rDNA sequences to investigate evolutionaryrelationships within the fungi. The inferred tree topologies were in general
130 S. Takamatsu
agreement with traditional classifications in that the Chytridiomycota andZygomycota were recovered as basal groups within the kingdom, theAscomycota and Basidiomycota appeared as a derived monophyletic group,relationships within the Ascomycota were concordant with traditional ordersand divided the hemi- and euascomycetes into distinct lineages, and theBasidiomycota was divided into two groups, the holobasidiomycetes andphragmobasidiomycetes.
Berbee and Taylor (1993, 1995) calibrated the rate of 18S rDNAsequence change by relating the normalized per cent substitution associatedwith phylogenetic events to fungal fossils, the ages of fungal hosts, and theages of symbionts. Their calculations suggested that fungal 18S rDNAundergoes substitutions at about 1% per lineage per 100 million years. Basedon these calculations these authors suggested that the terrestrial fungidiverged from the chytrids approximately 550 million years ago, and thatascomycetes split from basidiomycetes approximately 400 million years ago,after plants invaded the land. Similarly, mushrooms, many ascomycetousyeasts, and common fungi in the genera Penicillium and Aspergillus may haveevolved after the origin of angiosperm plants, during the last 200 millionyears. Simon et al. (1993) used a different set of ecological and fossilcalibrations to estimate the origin of the vesicular–arbuscular mycorrhizae at353–462 million years ago.
Van der Auwera et al. (1994, 1995) and van der Auwera and de Wachter(1996) studied the phylogenetic relationship of oomycetes, hyphochy-triomycetes, and chytridiomycetes based on the sequences of rDNAincluding the 28S rRNA gene from Phytophthora megasperma, Hyphochyt-rium catenoides, and Blastocladiella emersonii. Their results showed: (i) thehyphochytriomycetes formed a monophyletic group with the oomycetes andheterokont algae, and that they were probably the closest relatives of theoomycetes, and (ii) that the chytridiomycetes were true fungi and notprotists. Within the fungal clade, B. emersonii formed the first line ofdivergence, and the oomycete and hyphochytriomycete cluster appeared asa sister group of the fungal clade. These authors suggested that a possiblecommon ancestor of the fungi, straenopiles, and alveolates, may have been azoosporic fungus, which would mean that zoosporic fungi were paraphyleticinstead of polyphyletic as previously suggested.
7.4.2 Filamentous ascomycetes
Nishida and Sugiyama (1993) sequenced the 18S rDNA from Taphrinawiesneri and Saitoella complicata in order to determine the phylogeneticplacement of the major groups of higher fungi. They suggested that therewere at least two major evolutionary lineages in the ascomycetes, and that T.wiesneri and S. complicata form a monophyletic branch that diverged priorto the separation of other ascomycetes. Nishida and Sugiyama (1994)sequenced the 18S rDNA from T. populina and Protomyces lactucae-debilis
Applications in Fungal Phylogeny 131
and compared these sequences with 75 sequences from other ascomycetes.Their phylogenetic analysis divided the Ascomycota into three majorlineages: the hemiascomycetes, the euascomycetes, and a new line whichincluded Taphrina and Protomyces, which they called the archiascomycetes.
Eurotiales and related speciesThe genera Penicillium and Aspergillus have been the subject of severalphylogenetic analyses (LoBuglio et al., 1993, 1994; Peterson, 1993; Pitt, 1993;Verweij et al., 1995). Berbee et al. (1995) used 18S, 5.8S rDNA and ITSsequences to test whether Penicillium was monophyletic and to examine itsrelationship with the ascomycete family Trichocomaceae. Their resultsshowed that Penicillium was not a monophyletic genus. The phylogenetictrees constructed by them showed Eupenicillium javanicum (which has aPenicillium anamorph) grouping with Neosartorya fischeri and Eurotiumrubrum (which have Aspergillus anamorphs), rather than with Talaromycesflavus var. macrosporus or Talaromyces bacillisporus, two species withPenicillium anamorphs. Conversely, the genus Aspergillus was recovered asan apparently monophyletic group.
Phylogenetic relationships between strictly mitotic species in the genusPenicillium and Aspergillus, and closely related meiotic species have beenconsidered based on sequences from the mitochondrial small subunit rDNA,and the nuclear ITS and 5.8S rDNA (LoBuglio et al., 1993; Geiser et al.,1996). In both cases meiotic and strictly mitotic taxa were often recoveredclustered together, indicating that multiple independent losses of teleo-morphs had occurred in both genera.
Verweij et al. (1995) investigated the phylogenetic placement of fourspecies of Aspergillus based on 18S rDNA sequences. The species sequencedshowed a very close intergeneric relationship to species of the generaPaecilomyces and Penicillium, and also to Eurotium rubrum and Monascuspurpureus.
18S rDNA sequences were used by Bowman et al. (1992, 1996) toinvestigate possible relationships between four species of human pathogenicfungi placed in the Onygenales, and seven non-pathogenic fungi that werethought to be their nearest relatives on the basis of morphological features.The result showed that the pathogens were interspersed among the non-pathogenic fungi, which suggested that pathogenicity had arisen multiplywithin this group. The phylogenetic relationship of several humanpathogenic fungi in Onygenales was also investigated by Harmsen et al.(1995).
PyrenomycetesThere are two main views on the classification of the Clavicipitales within theunitunicated perithecial ascomycetes. One is that the Clavicipitales is a sistergroup to the Hypocreales, and the other is that it is a member of, or a nearrelative to, the Xylariales. The 18S rDNA sequences support the placement
132 S. Takamatsu
of the Clavicipitales as a monophyletic sister group to the Hypocreales(Spatafora and Blackwell, 1993).
Acremonium is generally considered to be a highly polyphyletic form-genus which includes the clavicipitaceous grass endophytes. Glenn et al.(1996) used 18S rDNA sequences to investigate relationships within Acre-monium, and they found that the genus was polyphyletic, with affiliations toat least three ascomycetous orders. Most of the species examined from thesections Acremonium, Gliomastix, and Nectrioidea appeared related to theHypocreaceae, and the grass endophytes of sect. Albolanosa, and other taxafrom the Clavicipitaceae formed a monophyletic group derived from withinthe Hypocreales. The thermophilic Acremonium alabamense, however,appeared to be derived from within the Sordariales. In order to eliminatesome of the heterogeneity within Acremonium, while also emphasizing theunique biological, morphological, and ecological characteristics of the grassendophytes, they proposed that the anamorphs of Epichloe and closelyrelated asexual grass endophytes be reclassified into the new form-genusNeotyphodium. Within the genus Epichloe, Schardl et al. (1991) usedsequences of the ITS regions to examine relationships between E. typhina andits anamorphs, including endophytic mycosymbionts of various grasses ofthe subfamily Pooideae. These results indicated that the non-pathogenicendophytes have not necessarily co-evolved with their host species and thatthey arose from E. typhina on multiple occasions.
Rehner and Samuels (1994) used eukaryotic-specific divergent regions of18S rDNA to investigate the phylogeny of Gliocladium. Their resultsindicated that Gliocladium was polyphyletic and that G. penicillioides, G.roseum, and Trichoderma virens (G. virens) were genetically distinct.Rakotonirainy et al. (1994) used two divergent regions of 28S rDNA toinvestigate phylogenetic relationships within the genus Metarhizium, one ofthe most ubiquitous entomogenous fungal genera. The results obtained fromsequence analysis were also confirmed by isoenzyme polymorphisms.
Partial sequences of 18S and 28S rDNA were used by Seifert et al. (1997)to suggest that Spicellum roseum and Trichothecium roseum formed a singlemonophyletic group allied to the Hypocreales, although they found sistergroup relationships to be unclear.
Phylogenetic relationships within four species of Phialophora wereconsidered by Yan et al. (1995) from RFLPs and sequence analysis of the 5.8Sand ITS rDNA of 51 isolates. Clustering based on similarity values producedgroups that were consistent with morphological species designations in eachcase. Bryan et al. (1995) assessed the relatedness of a number of Gaeumanno-myces and Phialophora isolates by comparison of 18S, 5.8S rDNA and ITSsequences. They found that G. graminis var. tritici, G. graminis var. avenae,and G. graminis var. graminis could be distinguished from each other bynucleotide sequence differences in the ITS regions. The G. graminis var. triticiisolates can be further subdivided into R and N isolates [correlating withability (R) or inability (N) to infect rye]. Isolates of Magnaporthe grisea
Applications in Fungal Phylogeny 133
included in the analysis showed a surprising degree of relatedness tomembers of the Gaeumannomyces–Phialophora complex.
Hausner et al. (1993) used partial 18S and 28S rDNA sequences in aphylogenetic analysis of Ophiostoma. 18S rDNA sequence data suggestedthat Ophiostoma should remain the sole genus of the Ophiostomataceae,although there was not sufficient information for parsimony analysis togenerate tree topologies with consistently high levels of statistical support.The sequences of the 5′ terminus of the 28S rDNA were also determined toexamine phylogenetic relationships within the genus, and these data failed tosupport the subdivision of the genus based on either ascospore characters orthe nature of the anamorph.
Sherriff et al. (1994) used 28S rDNA and ITS sequences to investigate therelatedness of a range of isolates of Colletotrichum, selected to represent themajor morphological forms of the genus. They found that the speciesinvestigated could be divided into two groups. The first group, consisting ofC. lindemuthianum, C. malvarum, C. orbiculare, and C. trifolii, was distinctfrom all the other species, and their DNA was highly homologous. Theyconcluded that this group may represent a single species. The second groupconsisted of isolates of C. gloeosporioides which showed greater divergencein their DNA sequences than those of the first group, and it was concludedthat isolates included within C. gloeosporioides represented more than onespecies. Sherriff et al. (1995) also compared sequences of ITS2 regions ofisolates of C. graminicola from maize, sorghum and Rottboellia. The resultsindicated that the isolates from maize represented a species which wasdistinct from the isolates obtained from sorghum and Rottboellia. Theyrecommended that the isolates from maize should be regarded as C.graminicola, and that those from sorghum and Rottboellia should beconsidered C. sublineolum.
Guadet et al. (1989), Peterson (1991) and O’Donnell (1993) investigatedthe phylogenetic relationships of Fusarium species using partial sequences ofthe 28S rDNA. Both Guadet’s and O’Donnell’s data showed Gibberella tobe monophyletic, and O’Donnell suggested that Nectria was paraphyleticand that Fusarium was polyphyletic. O’Donnell (1992) also showed thatthere was a high degree of intraspecific variation in the ITS sequences of F.sambucinum. Edel et al. (1996) characterized 87 strains belonging to 18species of Fusarium by PCR–RFLP analysis of ITS regions and variabledomains of the 28S rDNA. Data from the RFLP analysis showed 23 rDNAhaplotypes among the strains investigated. The groupings obtained by therestriction analysis were, on the whole, in agreement with other molecularand morphological classification criteria.
Waalwijk et al. (1996a, b) compared 13 species from Fusarium sectionsElegans, Liseola and Dlaminia using the DNA sequences and RFLPs of thetwo ITS regions. These studies showed that although the ITS1 data weresimilar for most species (except F. beomiforme and F. polyphialidicum),species grouping based on the ITS2 sequences formed two distinct clusters
134 S. Takamatsu
that did not coincide with the section boundaries. O’Donnell and Cigelnik(1997) used a cladistic analysis of sequences obtained from multiple unlinkedloci to consider the evolutionary history of the Gibberella fujikuroi complex.Gene phylogenies inferred from the mitochondrial small subunit rDNA,nuclear 28S rDNA, and the β-tubulin gene were generally concordant,providing strong support for a fully resolved phylogeny of all biological andmost morphological species. However, a discordant gene tree was obtainedfrom the ITS2 region. Ingroup taxa within the ITS2 gene tree formed twogroups, designated type I and type II as reported by Waalwijk et al. (1996a).Interestingly, sequence analysis demonstrated that every strain tested fromthe ingroup species had both types of ITS2. Only the major ITS2 type,however, was discernible when PCR products were amplified and sequenceddirectly with conserved primers, and the minor ITS2 type was only recoveredwhen ITS2 type-specific primers were used. Distribution of the major ITS2type within the species lineages showed a homoplastic pattern of evolution,and so obscured true phylogenetic relationships. O’Donnell and Cigelnik(1997) suggested that the ancestral ITS2 types may have arisen following anancient interspecific hybridization or gene duplication which occurred priorto the evolutionary radiation of the G. fujikuroi complex.
Appel and Gordon (1995, 1996) used RFLP analysis and partial sequencesof the rDNA IGS region to investigate relationships among isolates ofFusarium oxysporum, including F. oxysporum f. sp. melonis and non-pathogenic strains. They found that the IGS haplotype and sequence correlatedwith vegetative compatibility group (VCG) and mtDNA haplotype in mostisolates within F. oxysporum f. sp. melonis, but could not be used to differ-entiate among races. However, a race 1 isolate which was associated with VCG0131 had greater affinity with VCG 0134 based on both mtDNA andIGS haplotype. Two IGS sequence types were found in this race 1 isolate,one suggesting an affiliation with VCG 0131 and the other similar to isolatesin VCG 0134. Appel and Gordon (1996) suggested this result may indicate pastsomatic or sexual interactions between F. oxysporum f. sp. melonis, VCGs 0131and 0134. Non-pathogenic isolates that were vegetatively compatible with thepathogenic ones were not closely related to the pathogen based on IGSsequence data, and so non-pathogenic and pathogenic isolates may sharecommon alleles at vegetative compatibility loci by coincidence rather thanbecause of recent clonal derivation from a common ancestor.
DiscomycetesEvolutionary relationships of apothecial ascomycetes (discomycetes) havebeen examined from 18S rDNA sequences (Gargas and Taylor, 1995). Theyobtained a most parsimonious tree that supported the monophyly of theorders Pezizales, Leotiales, and Lecanorales. However, there was no supportfor monophyly of the representative Caliciales.
Gargas et al. (1995) reported the presence of insertions (group I introns)in the nuclear small subunit rDNA of lichen-forming fungi. Of the 11
Applications in Fungal Phylogeny 135
insertion positions they reported, six positions were known only from thelichen-forming fungi. They considered the possible phylogenetic significanceand distribution of insertions in eukaryotic organisms.
O’Donnell et al. (1997) examined the phylogenetic relationships amongascomycetous truffles and true and false morels based on sequences from 18Sand 28S rDNA. Parsimony analysis of the combined data set gave a singlemost parsimonious tree, indicating that the hypogeous ascomycetous truffleand truffle-like taxa studied represent at least five independent lineageswithin the Pezizales.
Phylogenetic relationships between the genera Plicaria and Peziza havebeen examined from sequences of the rDNA ITS1 region, the divergent D1and D2 domains of the 28S subunit, and a region near the 5′ terminus of the18S subunit (Norman and Egger, 1996). Parsimony analysis showed thatPlicaria was a monophyletic group. However, several Peziza taxa that shareda number of morphological characters with Plicaria were closely related. Theauthors suggested that Plicaria should be recognized as a separate genus,although Peziza is paraphyletic if Plicaria is maintained. A phylogeneticanalysis has also been made of Sarcoscypha species (Sarcoscyphaceae, Pezi-zales), based on ITS sequences (Harrington and Potter, 1997).
Carbone and Kohn (1993) sequenced the ITS1 region from 40 isolates ofSclerotiniaceae and three outgroup isolates in Leotiaceae in a study of thephylogenetic relationships among the Sclerotiniaceae. Their results sup-ported their hypothesis that there was a sclerotial lineage, and suggested thatthis lineage had evolved relatively recently. However, they could not resolvethe phylogenetic relationships among the non-sclerotial taxa due to theirhighly divergent ITS1 sequences.
LoculoascomycetesBerbee (1996) sequenced the 18S rDNA of 16 species from seven families inthe loculoascomycete orders Pleosporales, Dothideales, and Chaetothyrialesin an examination of evolution within the order.
Leptosphaeria maculans is an important plant pathogen and isolates fromBrassica spp. can be divided into two pathotypes: highly virulent (HV) andweakly virulent (WV) (McGee and Petrie, 1978). In addition to pathoge-nicity, HV and WV isolates differ in cultural characters and toxin production(Koch et al., 1989), and are also distinguishable by RAPD (Goodwin andAnnis, 1991; Schafer and Wostemeyer, 1992), RFLPs (Koch et al., 1991), andelectrophoretic karyotyping (Taylor et al., 1991). Xue et al. (1992) andMorales et al. (1993) independently sequenced the 5.8S rDNA and ITSregions from HV and WV isolates. Although the 5.8S rDNA sequences wereidentical between the HV and WV isolates, both ITS sequences were verydivergent. Morales et al. (1993) showed that each pathogenicity group wasstatistically different from each other and that the WV isolates were moreclosely related to the Thlaspi isolates than to the HV isolates. Xue andGoodwin (1994) found insertions in domain V of the mitochondrial large
136 S. Takamatsu
rDNA of L. maculans. Most of the inserted sequence was highly homolo-gous (90%) between pathotypes, indicating that they were closely related,but the insertion in the WV pathotype had an additional 49 bp at the 3′terminus of the insert. The 49 bp region contained a repetitive 7 bp sequenceand had a higher GC content than the rest of the insert. The phylogeneticrelationships among several Leptosphaeria species have been determinedfrom the sequences of the 18S and 5.8S rDNA and ITS regions (Morales etal. 1995), and Khashnobish and Shearer (1996) used both morphologicalcharacters and ITS2 and partial 28S rDNA sequences to investigate phyloge-netic relationships in some Leptosphaeria and Phaeosphaeria species. Theyshowed that the Phaerosphaeria species formed a natural group whileLeptosphaeria sensu lato was paraphyletic.
Jasalavich et al. (1995) investigated the phylogenetic relationshipsbetween three Alternaria species pathogenic to crucifers, A. alternata, andPleospora herbarum from the sequences of 18S and 5.8S rDNA subunits andthe ITS regions. They showed that all of the Alternaria species were closelyrelated, and that Pleospora also appeared to be more closely related toAlternaria than to Leptosphaeria. Kusaba and Tsuge (1995) sequenced theITS of some Alternaria species, including seven that were known to producehost-specific toxins. Phylogenetic analysis of the sequence data by theneighbour-joining method showed that the seven toxin-producing fungiformed a monophyletic group together with A. alternata. Conversely, thespecies of Alternaria that were clearly distinguishable from A. alternata bymorphological features were also clearly separated from A. alternata on thebasis of their ITS sequences. Based on these findings, and previous work(Kusaba and Tsuge, 1994), the authors suggested that isolates of Alternariawhich produced host-specific toxins were pathogenic variants of the singlevariable species A. alternata.
Other filamentous ascomycetesThe Erysiphales (powdery mildews) have been classified in both thePyrenomycetes and the Plectomycetes on the basis of their morphologicalfeatures. However, analysis of their 18S rDNA sequence has shown that theyare distinct from both groups (Saenz et al., 1994).
Phylogenetic relationships of the imperfect mycorrhizal fungus Ceno-coccum geophilum within ascomycetes have been considered from 18SrDNA sequences (LoBuglio et al., 1996). Parsimony and distance analysesplaced C. geophilum as a basal, intermediate lineage between the twoLoculoascomycete orders, the Pleosporales and the Dothidiales, stronglysuggesting that Elaphomyces was of Plectomycete origin. This result contra-dicted the original hypothesis that Elaphomyces was the closest relative of C.geophilum, and also suggested that there were at least four independentlineages of mycorrhizal fungi among the ascomycetes included in the study.
Nishida et al. (1993) demonstrated that there were two group I intronsin the 18S rRNA coding region of Protomyces inouyei (archiascomycetes).
Applications in Fungal Phylogeny 137
Comparison of the two introns of P. inouyei with those of other group Iintron-containing higher fungi showed that intron A of P. inouyei waslocated in the same position as an intron in Pneumocystis carinii, while intronB occupied an insertion site also found in Ustilago maydis. They suggestedthese group I introns may be subject to horizontal transfer.
7.4.3 Basidiomycetes
Swann and Taylor (1993) sequenced the 18S rDNA from nine basidiomy-cetes and aligned them with ten other basidiomycetes and three ascomycetesequences. The phylogentic tree showed that the basidiomycetes fell intothree major lineages: the Ustilaginales smuts, simple septate basidiomycetes,and hymenomycetes which formed a basal unresolved trifurcation. Suh andSugiyama (1994) also suggested that there were three lineages in thebasidiomycetes.
AgaricalesHibbett et al. (1995) investigated the phylogenetic relationships of theshiitake mushroom from ITS sequences. Their ingroup consisted of sevenisolates of Lentinus edodes, nine isolates of L. lateritia, and five isolates ofL. novaezelandieae. They found four independent lineages of shiitake inAsia–Australasia, and this provided some support for the morphologicallybased species concepts. There was a strong correlation between thegeographic origins of the isolates within each lineage, and a biogeographicinterpretation of the ITS tree suggested that the centre of origin for shiitakein the Asia–Australasia region was in the South Pacific. Chiu et al. (1996)studied the genetic diversity of cultivated strains of shiitake used in Chinausing AP-PCR, RAPD and PCR–RFLP of ITS regions. The resultsindicated that cultivated strains of shiitake in China are genetically veryhomogeneous, very like cultivated strains of Agaricus bisporus andVolvariella volvacea.
Hibbett and Vilgalys (1993) also investigated the phylogenetic relation-ships of Lentinus, using morphological characters and sequences from thedivergent regions of the 28S rDNA. They found that although Lentinus sensuPegler was not monophyletic, the genus consisted of three separate mono-phyletic groups. These largely corresponded to Neolentinus, Panus, andLentinus sensu stricto, with the latter apparently derived from the Poly-poraceae, suggesting that lamellae are products of convergent evolution.
The confused taxonomy of the genus Armillaria has precluded a clearunderstanding of the biology of the major species. Anderson and Stasovski(1992) have used IGS sequences to investigate the phylogenetic relationshipsof several northern hemisphere species of Armillaria. The majority ofnorthern hemisphere species were found to be closely related to one another,relative to A. mellea and A. tabescens. The majority of the northernhemisphere species were divided into two groups, one composed of A.
138 S. Takamatsu
ostoyae, A. gemina and A. borealis, and the other consisting of A. lutea, A.calvescens, A. cepistipes, A. sinapina, species IX and species X.
Hinkle et al. (1994) determined the complete 16S-like rRNA codingregions of the fungal symbiont of five genera of attine (leaf-cutting) ants andtwo free-living fungi. The phylogenetic tree generated from this data placedthe attine fungal symbionts as homobasidiomycetes in the order Agaricales.Comparison of the topology of the attine fungal symbiont phylogenetic treewith a tree based on attine ant morphology suggested that there had been along co-evolution of leaf-cutting attine ants and their fungal symbionts.
Phylogenetic relationships within the coprinoid taxa and some closerelatives have been studied from PCR–RFLP of nuclear large subunit rDNAand the ITS2 region (Hopple and Vilgalys, 1994). These authors suggestedthat the genus Coprinus was at least paraphyletic and probably polyphyleticand that Psathyrella was derived from within Coprinus. The results alsosuggested that the two secotioid taxa were closely related to Coprinuscomatus and that Bolbitius was a sister genus to Coprinus.
Bunyard et al. (1996) used PCR–RFLP of the 26S and 5S rDNA, and theIGS between the 26S and 5S rDNA for a phylogenetic study of Agaricusspecies. They found that the most closely related species to A. bisporus wereA. excellens, A. chionodermus and A. caroli.
GastromycetesITS regions from 47 isolates belonging to 38 recognized species of Suillussensu lato have been sequenced in a phylogenetic analysis using parsimonyas well as distance methods (Kretzer et al., 1996). The results suggested thatthe genera Boletinus and Fuscoboletinus, that are often considered within S.sensu lato, were not monophyletic, and that isolates of Suillus granulatusderived from either North America or Europe and Asia are polyphyletic andmay represent at least two different species. This study also showed thatwithin Suillus sensu lato, mycorrhizal associations with Larix were aprimitive association and that host changes to Pinus and Pseudotsugaoccurred only once. Baura et al. (1992) used ITS sequences to propose thatGastrosuillus laricinus was a recent derivative of Suillus grevillei.
AphyllophoralesThe phylogenetic relationships within Ganoderma and the G. lucidumspecies complex have been considered from sequences of ITS regions and thedivergent domain D2 of the 25S rDNA (Moncalvo et al., 1995a, b).Parsimony analysis of this data identified six lineages in the G. lucidumcomplex. It was suggested that each lineage represented one or more putativespecies, however, there was little correlation between rDNA gene phylogenyand morphology within the species complex. Hseu et al. (1996) alsoattempted to differentiate isolates of the G. lucidum complex using RAPDanalysis. However, data from RAPDs did not distinguish the same clades asITS and it seems likely that while ITS sequences can be used to identify
Applications in Fungal Phylogeny 139
species within the G. lucidum complex, RAPDs can be used to differentiatebetween isolates which have identical ITS sequences.
PCR–RFLP analyses have been used for phylogenetic studies andspecies identification with several kinds of mushrooms and ectomycorrhizae.Gardes et al. (1991) considered variations in the length, RFLP, and primarysequence of the PCR-amplified ITS regions and mitochondrial large subunitrDNA ingroupings of ectomycorrhizal fungi, particularly in the genusLaccaria.
UredinalesRelatively few molecular phylogenies have been proposed for the rust fungi.Zambino and Szabo (1993) used the sequences of ITS regions to investigatephylogenetic relationships among strains and formae speciales of Pucciniacoronata, P. graminis, P. recondita and other cereal and grass rusts and relatedspecies. They showed that isolates of P. graminis and P. coronata fromvarious hosts each consisted of a distinct cluster, but that strains of the P.recondita species complex isolated from various hosts did not. In compar-isons among formae speciales of P. graminis and P. coronata, the formaespeciales that had identical ITS sequences were those that were alreadyknown to be closely related by crossing, isozyme, and host range studies.However, in some cases the relationships among formae speciales based onsequence data contradicted the current taxonomy of the cereal rusts.
Chen et al. (1993) considered the relationship between variation invirulence and RAPD patterns in 115 single-uredospore isolates from 23collections of P. striiformis. They found there was little apparent associationbetween virulence and RAPD patterns, indicating that the RAPD poly-morphisms were independent of virulence.
Other basidiomycetesEleven anastomosis groups (AG 1–10 and AG BI) have been recognized inRhizoctonia solani, and 25 intraspecific groups (ISGs) have been recognizedwithin these on the basis of isoenzymes and ITS polymorphisms (Liu andSinclair, 1992, 1993; Liu et al., 1993). Liu et al. (1995) found four majorgroups from RFLP analysis of 18S rDNA of 161 isolates of the 25 ISGs, andmaximum parsimony and likelihood analyses showed that AG 10 isolateswere distinct and only distantly related to the majority of the other AGs.
7.4.4 Zygomycetes
Phylogenetic studies on zygomycetes are comparatively rare compared withthose on other fungal groups. Nagahama et al. (1995) determined the 18SrDNA sequences for four representative species of the Entomophthoralesand the trichomycete Smittium culisetae. Their analysis included ten pre-viously published reference sequences and showed that the seven zygomy-cete species investigated formed four clusters. The four entomophthoralean
140 S. Takamatsu
species were recovered in two clusters, with Basidiobolus ranarum in onecluster with Chytridium, Spizellomyces and Neocallimastix, while theremaining three entomophoralean species, Conidiobolus coronatus, Entomo-phthora muscae and Zoophthora radicans, formed a second cluster withMucor. Glomus etunicatum was found to be a basal clade to the ascomycetesand basidiomycetes, and Smittium culisetae was placed close to the diver-gence of Entomophthorales from the chytrid–Glomus–ascomycete–basidiomycete clade. The results also suggested that flagellae had been lostindependently in several lineages in the tree and that there was considerablephylogenetic divergence within the chytrids.
Geosiphon pyriforme is the only known example of endocytobiosisbetween a fungus and a cyanobacterium. Gehrig et al. (1996) used 18S rDNAsequences to investigate the taxonomic and evolutionary relationships of G.pyriforme to fungi forming arbuscular mycorrhiza (Glomales). The Glo-males, including Geosiphon, formed a single clade distinct from groups ofzygomycetes and G. pyriforme was placed at the ancestral base of theGlomales. Geosiphon is able to form a ‘primitive’ symbiosis with a unicellularphotoautotrophic organism, and based on their phylogeny the authorssuggested that a hypothetical association of a Glomus-like fungus with agreen alga may have occurred as a stage in the evolution of the land plants.
7.4.5 Oomycetes, Hyphochytriomycetes
The PCR–RFLP of the nuclear large subunit rDNA, ITS regions, andmitochondrial large subunit rDNA of three heterothallic Pythium species, P.heterothallicum, P. splendens and P. sylvaticum, were determined by Chen(1992). The ITS of both P. heterothallicum and P. splendens was about 850bp long, and the ITS for P. sylvaticum was about 1020 bp long; each lengthvariant showed distinct RFLP banding patterns. A phylogenetic analysisbased on the variable restriction sites in the ITS region showed that theheterothallic species did not form a monophyletic group, suggesting thatheterothallism does not represent a distinct species lineage in the genus.
Briard et al. (1995) determined the nucleotide sequences of a divergentregion of 28S rDNA from 23 species of Pythiaceae, and compared these toassess phylogenetic relationships. Although a high level of diversity wasfound within Pythium, Phytophthora appeared to be very homogeneous.They found that there was a strict correlation between groups of specieswithin Pythium defined by molecular taxonomy and those defined on thebasis of the morphology of sporangia.
The sequences of the ITS regions from Phytophthora species have beenindependently determined by several authors. Lee and Taylor (1992) usedITS sequences in a phylogenetic study of five Phytophthora species: P.palmivora, P. megakarya, P. capsici, P. citrophthora and P. cinnamomi. Theirresults showed that cacao isolates of P. capsici and P. citrophthora wereclosely related, that P. palmivora and P. megakarya shared a common
Applications in Fungal Phylogeny 141
lineage, and that P. cinnamomi was only distantly related to the other species.Crawford et al. (1996) used rDNA sequences in an evolutionary analysis of15 Phytophthora species. Analysis of papillate, semi-papillate and non-papillate species showed that sporangium papillation had phylogeneticsignificance, with the three morphological groups each forming separateclusters. Within the P. megasperma species complex, separate evolutionarylines were identified for P. medicaginis, P. trifolii and P. sojae, speciesformerly regarded as a formae speciales of P. megasperma. This findingconfirmed their recent reclassification as biological species. P. macro-chlamydospora from soybean, which has only been observed in Australia,was found to be closely related to P. sojae, indicating a possible commonancestry. Cooke et al. (1996) used the RAPD analysis and rDNA sequencesin a phylogenetic study of group I species of Phytophthora. The RAPDbanding patterns separated P. iranica and P. clandestina from the otherPhytophthora species, P. idaei, P. pseudotsugae and P. cactorum. Collar rotisolates from apple placed in P. cactorum clustered separately from straw-berry crown rot isolates, while isolates from raspberry appeared to haveaffinities with both clusters.
7.5 Conclusions
Our knowledge of fungal phylogeny is rapidly being increased by PCR-mediated studies. As described above, most of these studies have been based onnuclear or mitochondrial rRNA genes, because conserved rRNA codingregions and variable spacer regions are present within a rDNA repeat, whichenables the design of universal primers suitable for a wide range of fungi.However, recently, the use of sequences obtained from protein genes hasincreased. Sequence data obtained from different DNA regions will berequired in future to construct more precise phylogenetic trees. While moststudies described in this chapter have focused on fungal systematics, molecularphylogenetic study is also useful to infer morphological, ecological andphysiological evolution (Berbee and Taylor, 1995). Furthermore, if the genesdirectly related to morphological, ecological and physiological phenotypeswere identified and sequenced, then comparative analyses of these genes wouldmake it possible to investigate how these phenotypes have evolved.
References
Anderson, J.B. and Stasovski, E. (1992) Molecular phylogeny of northern hemispherespecies of Armillaria. Mycologia 84, 505–516.
Appel, D.J. and Gordon, T.R. (1995) Intraspecific variation within populations ofFusarium oxysporum based on RFLP analysis of the intergenic spacer region ofthe rDNA. Experimental Mycology 19, 120–128.
142 S. Takamatsu
Appel, D.J. and Gordon, T.R. (1996) Relationships among pathogenic and non-pathogenic isolates of Fusarium oxysporum based on the partial sequence of theintergenic spacer region of the ribosomal DNA. Molecular Plant–MicrobeInteractions 9, 125–138.
Baldauf, S.L. and Palmer, J.D. (1993) Animals and fungi are each other’s closestrelatives: Congruent evidence from multiple proteins. Proceedings of theNational Academy of Sciences USA 90, 11558–11562.
Baura, G., Szaro, T.M. and Bruns, T.D. (1992) Gastrosuillus laricinus is a recentderivative of Suillus grevillei: molecular evidence. Mycologia 84, 592–597.
Berbee, M.L. (1996) Loculoascomycete origins and evolution of filamentous ascomy-cete morphology based on 18S rRNA gene sequence data. Molecular Biology andEvolution 13, 462–470.
Berbee, M.L. and Taylor, J.W. (1993) Dating the evolutionary radiations of the truefungi. Canadian Journal of Botany 71, 1114–1127.
Berbee, M.L. and Taylor, J.W. (1995) From 18S ribosomal sequence data to evolutionof morphology among the fungi. Canadian Journal of Botany 73 (suppl. 1),S677–S683.
Berbee, M.L., Yoshimura, A., Sugiyama, J. and Taylor, J.W. (1995) Is Penicilliummonophyletic? An evaluation of phylogeny in the family Trichocomaceae from18S, 5.8S and ITS ribosomal DNA sequence data. Mycologia 87, 210–222.
Bernier, L., Hamelin, R.C. and Ouellette, G.B. (1994) Comparison of ribosomalDNA length and restriction site polymorphisms in Gremmeniella and Ascocalyxisolates. Applied and Environmental Microbiology 60, 1279–1286.
Biel, S.W. and Parrish, F.W. (1986) Isolation of DNA from fungal mycelia andsclerotia without use of density gradient ultracentrifugation. Analytical Bio-chemistry 154, 21–25.
Bowman, B.H., Taylor, J.W. and White, T.J. (1992) Molecular evolution of the fungi:human pathogens. Molecular Biology and Evolution 9, 893–904.
Bowman, B.H., White, T.J. and Taylor, J.W. (1996) Human pathogenic fungi and theirclose nonpathogenic relatives. Molecular Phylogenetics and Evolution 6, 89–96.
Boyd, M.L. and Carris, L.M. (1997) Molecular relationships among varieties of theTilletia fusca (T. bromi) complex and related species. Mycological Research 101,269–277.
Briard, M., Dutertre, M., Rouxel, F. and Brygoo, Y. (1995) Ribosomal RNA sequencedivergence within the Pythiaceae. Mycological Research 99, 1119–1127.
Bruns, T.D. and Szaro, T.M. (1992) Rate and mode differences between nuclear andmitochondrial small-subunit rRNA genes in mushrooms. Molecular Biology andEvolution 9, 836–855.
Bruns, T.D., Fogel, R. and Taylor, J.W. (1990) Amplification and sequencing of DNAfrom fungal herbarium specimens. Mycologia 82, 175–184.
Bruns, T.D., White, T.J. and Taylor, J.W. (1991) Fungal molecular systematics. AnnualReview of Ecology and Systematics 22, 525–564.
Bruns, T.D., Vilgalys, R., Barns, S.M., Gonzalez, D., Hibbett, D.S., Lane, D.J., Simon,L., Stickel, S., Szaro, T.M., Weisburg, W.G. and Sogin, M.L. (1992) Evolutionaryrelationships within the fungi: analysis of nuclear small subunit rRNA sequen-ces. Molecular Phylogenetics and Evolution 1, 231–241.
Bryan, G.T., Daniels, M.J. and Osbourn, A.E. (1995) Comparison of fungi within theGaeumannomyces–Phialophora complex by analysis of ribosomal DNA sequen-ces. Applied and Environmental Microbiology 61, 681–689.
Applications in Fungal Phylogeny 143
Bunyard, B.A., Nicholson, M.S. and Royse, D.J. (1994) A systematic assessment ofMorchella using RFLP analysis of the 28S ribosomal RNA gene. Mycologia 86,762–772.
Bunyard, B.A., Nicholson, M.S. and Royse, D.J. (1996) Phylogeny of the genusAgaricus inferred from restriction analysis of enzymatically amplified ribosomalDNA. Fungal Genetics and Biology 20, 243–253.
Buscot, F., Wipf, D., Battista, C.D., Munch, J.-C., Botton, B. and Martin, F. (1996)DNA polymorphism in morels: PCR–RFLP analysis of the ribosomal DNAspacers and microsatellite-primed PCR. Mycological Research 100, 63–71.
Carbone I. and Kohn, L.M. (1993) Ribosomal DNA sequence divergence withininternal transcribed spacer 1 of the Sclerotiniaceae. Mycologia 85, 415–427.
Chen, W. (1992) Restriction fragment length polymorphisms in enzymaticallyamplified ribosomal DNAs of three heterothallic Pythium species. Phytopathol-ogy 82, 1467–1472.
Chen, X.M., Line, R.F. and Leung, H. (1993) Relationship between virulencevariation and DNA polymorphism in Puccinia striiformis. Phytopathology 83,1489–1497.
Chiu, S.-W., Ma, A.-M., Lin, F.-C. and Moore, D. (1996) Genetic homogeneity ofcultivated strains of shiitake (Lentinula edodes) used in China as revealed by thepolymerase chain reaction. Mycological Research 100, 1393–1399.
Cooke, D.E.L., Kennedy, D. M., Guy, D.C., Russell, J., Unkles, S.E. and Duncan,J.M. (1996) Relatedness of group I species of Phytophthora as assessed byrandomly amplified polymorphic DNA (RAPDs) and sequences of ribosomalDNA. Mycological Research 100, 297–303.
Cox, G.M., Rude, T.H., Dykstra, C.C. and Perfect, J.R. (1995) The actin gene fromCryptococcus neoformans: structure and phylogenetic analysis. Journal ofMedical and Veterinary Mycology 33, 261–266.
Crawford, A.R., Bassam, B.J., Drenth, A., Maclean, D.J. and Irwin, J.A.G. (1996)Evolutionary relationships among Phytophthora species deduced from rDNAsequence analysis. Mycological Research 100, 437–443.
Donaldson, G.C., Ball, L.A., Axelrood, P.E. and Glass, N.L. (1995) Primer setsdeveloped to amplify conserved genes from filamentous ascomycetes are usefulin differentiating Fusarium species associated with conifers. Applied and Envi-ronmental Microbiology 61, 1331–1340.
Edel, V., Steinberg, C., Gautheron, N. and Alabouvette, C. (1996) Evaluation ofrestriction analysis of polymerase chain reaction (PCR)-amplified ribosomalDNA for the identification of Fusarium species. Mycological Research 101,179–187.
Edlind, T.D., Li, J., Visvesvara, G.S., Vodkin, M.H., McLaughlin, G.L. and Katiyar,S.K. (1996) Phylogenetic analysis of β-tubulin sequences from amitochondrialprotozoa. Molecular Phylogenetics and Evolution 5, 359–367.
Erland, S. (1995) Abundance of Tylospora fibrillosa ectomycorrhizas in a SouthSwedish spruce forest measured by RFLP analysis of the PCR-amplified rDNAITS region. Mycological Research 99, 1425–1428.
Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using thebootstrap. Evolution 39, 783–791.
Felsenstein, J. (1989) PHYLIP-phylogeny inference package (version 3.2). Cladistics 5,164–166.
Fletcher, L.D., McDowell, J.M., Tidwell, R.R., Meagher, R.B. and Dykstra, C.C.
144 S. Takamatsu
(1994) Structure, expression and phylogenetic analysis of the gene encoding actinI in Pneumocystis carinii. Genetics 137, 743–750.
Gardes, M., White, T.J., Fortin, J.A., Bruns, T.D. and Taylor, J.W. (1991) Identifica-tion of indigenous and introduced symbiotic fungi in ectomycorrhizae byamplification of nuclear and mitochondrial ribosomal DNA. Canadian Journalof Botany 69, 180–190.
Gargas, A. and Taylor, J.W. (1992) Polymerase chain reaction (PCR) primers foramplifying and sequencing nuclear 18S rDNA from lichenized fungi. Mycologia84, 589–592.
Gargas, A. and Taylor, J.W. (1995) Phylogeny of Discomycetes and early radiationsof the apothecial Ascomycotina inferred from SSU rDNA sequence data.Experimental Mycology 19, 7–15.
Gargas, A., DePriest, P.T. and Taylor, J.W. (1995) Positions of multiple insertions inSSU rDNA of lichen-forming fungi. Molecular Biology and Evolution 12,208–218.
Gehrig, H., Schussler, A. and Kluge, M. (1996) Geosiphon pyriforme, a fungusforming endocytobiosis with Nostoc (Cyanobacteria), is an ancestral member ofthe Glomales: evidence by SSU rRNA analysis. Journal of Molecular Evolution43, 71–81.
Geiser, D.M., Timberlake, W.E. and Arnold, M.L. (1996) Loss of meiosis inAspergillus. Molecular Biology and Evolution 13, 809–817.
Gelfand, D.H. and White, T.J. (1990) Thermostable DNA polymerases. In: Innis,M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR Protocols: a Guideto Methods and Applications. Academic Press, New York, pp. 129–141.
Gerbi, S.A. (1985) Evolution of ribosomal DNA. In: MacIntyre, R.J. (ed.) MolecularEvolutionary Genetics. Plenum, New York, pp. 419–517.
Glenn, A.E., Bacon, C.W., Price, R. and Hanlin, R.T. (1996) Molecular phylogeny ofAcremonium and its taxonomic implications. Mycologia 88, 369–383.
Goodwin, P.H. and Annis, S.L. (1991) Rapid identification of genetic variation andpathotype of Leptosphaeria maculans by random amplified polymorphic DNAassay. Applied and Environmental Microbiology 57, 2482–2486.
Guadet, J., Julien, J., Lafay, J.F. and Brygoo, Y. (1989) Phylogeny of some Fusariumspecies, as determined by large-subunit rRNA sequence comparison. MolecularBiology and Evolution 6, 227–242.
Guillemaud, T., Raymond, M., Callot, G., Cleyet-Marel, J.-C. and Fernandez, D.(1996) Variability of nuclear and mitochondrial ribosomal DNA of a trufflespecies (Tuber aestivum). Mycological Research 100, 547–550.
Harmsen, D., Schwinn, A., Weig, M., Broker, E.-B. and Heesemann, J. (1995) Phylo-geny and dating of some pathogenic keratinophilic fungi using small subunit ribo-somal RNA. Journal of Medical and Veterinary Mycology 33, 299–303.
Harrington, F.A. and Potter, D. (1997) Phylogenetic relationships within Sarcoscyphabased upon nucleotide sequences of the internal transcribed spacer of nuclearribosomal DNA. Mycologia 89, 258–267.
Harrington, T.C. and Wingfield, B.D. (1995) A PCR-based identification method forspecies of Armillaria. Mycologia 87, 280–288.
Hasegawa, M., Hashimoto, T., Adachi, J., Iwabe, N. and Miyata, T. (1993) Earlybranchings in the evolution of eukaryotes: ancient divergence of entamoeba thatlacks mitochondria revealed by protein sequence data. Journal of MolecularEvolution 36, 380–388.
Applications in Fungal Phylogeny 145
Hausner, G., Reid, J. and Klassen, G.R. (1993) On the phylogeny of Ophiostoma,Ceratocystis s.s., and Microascus, and relationships within Ophiostoma basedon partial ribosomal DNA sequences. Canadian Journal of Botany 71,1249–1265.
Hibbett, D.S. and Vilgalys, R. (1993) Phylogenetic relationships of Lentinus(Basidiomycotina) inferred from molecular and morphological characters. Sys-tematic Botany 18, 409–433.
Hibbett, D.S., Fukumasa-Nakai, Y., Tsuneda, A. and Donoghue, M.J. (1995)Phylogenetic diversity in shiitake inferred from nuclear ribosomal DNAsequences. Mycologia 87, 618–638.
Hillis, D.M. and Davis, S.K. (1987) Evolution of the 28S ribosomal RNA gene inanurans: regions of variability and their phylogenetic implications. MolecularBiology and Evolution 4, 117–125.
Hillis, D.M. and Dixon, M.T. (1991) Ribosomal DNA: molecular evolution andphylogenetic inference. The Quarterly Review of Biology 66, 411–453.
Hinkle, G., Wetterer, J.K., Schultz, T.R. and Sogin, M.L. (1994) Phylogeny of theattine ant fungi based on analysis of small subunit ribosomal RNA genesequences. Science 266, 1695–1697.
Hirata, T. and Takamatsu, S. (1996) Nucleotide sequence diversity of rDNA internaltranscribed spacers extracted from conidia and cleistothecia of several powderymildew fungi. Mycoscience 37, 283–288.
Hopple, J.S., Jr. and Vilgalys, R. (1994) Phylogenetic relationships among coprinoidtaxa and allies based on data from restriction site mapping of nuclear rDNA.Mycologia 86, 96–107.
Hseu, R.-S., Wang, H.-H., Wang, H.-F. and Moncalvo, J.-M. (1996) Differentiationand grouping of isolates of the Ganoderma lucidum complex by randomamplified polymorphic DNA-PCR compared with grouping on the basis ofinternal transcribed spacer sequences. Applied and Environmental Microbiology62, 1354–1363.
Hsiao, C., Chatterton, N.J., Asay, K.H. and Jensen, K.B. (1994) Phylogeneticrelationships of 10 grass species: an assessment of phylogenetic utility of theinternal transcribed spacer region in nuclear ribosomal DNA in monocots.Genome 37, 112–120.
Hsiao, C., Chatterton, N.J., Asay, K.H. and Jensen, K.B. (1995) Phylogeneticrelationships of the monogenomic species of the wheat tribe, Triticeae (Poaceae),inferred from nuclear rDNA (internal transcribed spacer) sequences. Genome38, 211–223.
Illingworth, C.A., Andrews, J.H., Bibeau, C. and Sogin, M.L. (1991) Phylogeneticplacement of Athelia bombacina, Aureobasidium pullulans, and Colletotrichumgloeosporioides inferred from sequence comparisons of small-subunit ribosomalRNAs. Experimental Mycology 15, 65–75.
Jasalavich, C.A., Morales, V.M., Pelcher, L.E. and Seguin-Swartz, G. (1995) Compar-ison of nuclear ribosomal DNA sequences from Alternaria species pathogenic tocrucifers. Mycological Research 99, 604–614.
Jeng, R.S., Dumas, M., Liu, F.H., Wang, C.L. and Hubbes, M. (1997) DNA analysisof Cylindrocladium floridanum isolates from selected forest nurseries. Myco-logical Research 101, 285–291.
Jorgensen, R.A. and Cluster, P.D. (1988) Modes and tempos in the evolution ofnuclear ribosomal DNA: new characters for evolutionary studies and new
146 S. Takamatsu
markers for genetic and population studies. Annals of the Missouri BotanicalGarden 75, 1238–1247.
Jungehulsing, U. and Tudzynski, P. (1997) Analysis of genetic diversity in Clavicepspurpurea by RAPD markers. Mycological Research 101, 1–6.
Karuppayil, S.M., Peng, M., Mendoza, L., Levins, T.A. and Szaniszlo, P.J. (1996)Identification of the conserved coding sequences of three chitin synthase genesin Fonsecaea pedrosoi. Journal of Medical and Veterinary Mycology 34,117–125.
Khashnobish, A.K. and Shearer, C.A. (1996) Phylogenetic relationships in someLeptosphaeria and Phaeosphaeria species. Mycological Research 100, 1355–1363.
Koch, E., Badawy, H.M.A. and Hoppe, H.H. (1989) Differences between aggressiveand nonaggressive single spore lines of Leptosphaeria maculans in culturalcharacteristics and phytotoxin production. Journal of Phytopathology 124,52–62.
Koch, E., Song, K., Osborn, T.C. and Williams, P.H. (1991) Relationship betweenpathogenicity and phylogeny based on restriction fragment length polymor-phism in Leptosphaeria maculans. Molecular Plant–Microbe Interactions 4,341–349.
Kretzer, A., Li, Y., Szaro, T. and Bruns, T.D. (1996) Internal transcribed spacersequences from 38 recognized species of Suillus sensu lato: phylogenetic andtaxonomic implications. Mycologia 88, 776–785.
Kumar, S., Tamura, K. and Nei, M. (1993) MEGA: Molecular Evolutionary GeneticsAnalysis, ver. 1.01. Pennsylvania State University, University Park, Pennsylvania.
Kusaba, M. and Tsuge, T. (1994) Nuclear ribosomal DNA variation and pathogenicpecialization in Alternaria fungi known to produce host-specific toxins. Appliedand Environmental Microbiology 60, 3055–3062.
Kusaba, M. and Tsuge, T. (1995) Phylogeny of Alternaria fungi known to producehost-specific toxins on the basis of variation in internal transcribed spacers ofribosomal DNA. Current Genetics 28, 491–498.
Leal, S.C.M., Bertioli, D.J., Butt, T.M., Carder, J.H., Burrows, P.R. and Peberdy, J.F.(1997) Amplification and restriction endonuclease digestion of the Pr1 gene forthe detection and characterization of Metarhizium strains. Mycological Research101, 257–265.
Lee, S.B. and Taylor, J.W. (1990) Isolation of DNA from fungal mycelia and singlespores. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCRProtocols: A Guide to Methods and Applications. Academic Press, New York,pp. 282–287.
Lee, S.B. and Taylor, J.W. (1992) Phylogeny of five fungus-like protoctistanPhytophthora species, inferred from the internal transcribed spacers of ribosomalDNA. Molecular Biology and Evolution 9, 636–653.
Lee, S.B., Milgroom, M.G. and Taylor, J.W. (1988) A rapid, high yield mini-prepmethod for isolation of total genomic DNA from fungi. Fungal GeneticsNewsletter 35, 23–24.
Li, J. and Edlind, T. (1994) Phylogeny of Pneumocystis carinii based on β-tubulinsequence. The Journal of Eukaryotic Microbiology 41, S97.
Liu, Z.L. and Sinclair. J.B. (1992) Genetic diversity of Rhizoctonia solani anastomosisgroup 2. Phytopathology 82, 778–787.
Liu, Z.L. and Sinclair, J.B. (1993) Differentiation of intraspecific groups withinanastomosis group 1 of Rhizoctonia solani using ribosomal DNA internal
Applications in Fungal Phylogeny 147
transcribed spacer and isozyme comparisons. Canadian Journal of PlantPathology 15, 272–280.
Liu, Z.L., Domier, L.L. and Sinclair, J.B. (1993) ISG-specific ribosomal DNA polymor-phism of the Rhizoctonia solani species complex. Mycologia 85, 795–800.
Liu, Z.L., Domier, L.L. and Sinclair, J.B. (1995) Polymorphism of genes coding fornuclear 18S rRNA indicates genetic distinctiveness of anastomosis group 10from other groups in the Rhizoctonia solani species complex. Applied andEnvironmental Microbiology 61, 2659–2664.
LoBuglio, K.F., Pitt, J.I. and Taylor, J.W. (1993) Phylogenetic analysis of tworibosomal DNA regions indicates multiple independent losses of a sexualTalaromyces state among asexual Penicillium species in subgenus Biverticillium.Mycologia 85, 592–604.
LoBuglio, K.F., Pitt, J.I. and Taylor, J.W. (1994) Independent origins of thesynnematous Penicillium species, P. duclauxii, P. clavigerum, and P. vulpinum,as assessed by two ribosomal DNA regions. Mycological Research 98, 250–256.
LoBuglio, K.F., Berbee, M.L. and Taylor, J.W. (1996) Phylogenetic origins of theasexual mycorrhizal symbiont Cenococcum geophilum Fr. and other mycorrhizalfungi among the ascomycetes. Molecular Phylogenetic and Evolution 6, 287–294.
Lott, T.J., Kuykendall, R.J. and Reiss, E. (1993) Nucleotide sequence analysis of the5.8S rDNA and adjacent ITS2 region of Candida albicans and related species.Yeast 9, 1199–1206.
Maddison, W.P. and Maddison, D.R. (1992) MacClade: Analysis of Phylogeny andCharacter Evolution, ver. 3. Sinauer Associates, Sunderland, Massachusetts.
Martin, W., Brinkmann, H., Savonna, C. and Cerff, R. (1993) Evidence for a chimericnature of nuclear genomes: Eubacterial origin of eukaryotic glyceraldehyde-3-phosphate dehydrogenase genes. Proceedings of the National Academy ofSciences USA 90, 8692–8696.
Maurer, P., Couteaudier, Y., Girard, P.A., Bridge, P.D. and Riba, G. (1997) Geneticdiversity of Beauveria bassiana and relatedness to host insect range. MycologicalResearch 101, 159–164.
McGee, D.C. and Petrie, G.A. (1978) Variability of Leptosphaeria maculans inrelation to blackleg of oilseed rape. Phytopathology 68, 625–630.
Mehmann, B., Brunner, I. and Braus, G.H. (1994) Nucleotide sequence variation ofchitin synthase genes among ectomycorrhizal fungi and its potential use intaxonomy. Applied and Environmental Microbiology 60, 3105–3111.
Michelmore, R.W. and Hulbert, S.H. (1987) Molecular markers for genetic analysisof phytopathogenic fungi. Annual Review of Phytopathology 25, 383–404.
Michot, B. and Bachellerie, J.-P. (1987) Comparisons of large subunit rRNAs revealsome eukaryote-specific elements of secondary structure. Biochimie 69, 11–23.
Michot, B., Hassouna, N. and Bachellerie, J.-P. (1984) Secondary structure of mouse28S rRNA and general model for the folding of the large rRNA in eukaryotes.Nucleic Acids Research 12, 4259–4279.
Moller, E.M., Bahnweg, G., Sandermann, H. and Geiger, H.H. (1992) A simple andefficient protocol for isolation of high molecular weight DNA from filamentousfungi, fruit bodies, and infected plant tissues. Nucleic Acids Research 20,6115–6116.
Moncalvo, J.-M., Wang, H.-H. and Hseu, R.-S. (1995a) Phylogenetic relationships inGanoderma inferred from the internal transcribed spacers and 25S ribosomalDNA sequences. Mycologia 87, 223–238.
148 S. Takamatsu
Moncalvo, J.-M., Wang, H.-F. and Hseu, R.-S. (1995b) Gene phylogeny of theGanoderma lucidum complex based on ribosomal DNA sequences. Comparisonwith traditional taxonomic characters. Mycological Research 99, 1489–1499.
Morales, V.M., Pelcher, L.E. and Taylor, J.L. (1993) Comparison of the 5.8S rDNAand internal transcribed spacer sequences of isolates of Leptosphaeria maculansfrom different pathogenicity groups. Current Genetics 23, 490–495.
Morales, V.M., Jasalavich, C.A., Pelcher, L.E., Petrie, G.A. and Taylor, J.L. (1995)Phylogenetic relationships among several Leptosphaeria species based on theirribosomal DNA sequences. Mycological Research 99, 593–603.
Mullis, K.B. and Faloona, F.A. (1987) Specific synthesis of DNA in vitro via apolymerase-catalyzed chain reaction. Methods in Enzymology 155, 335–350.
Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G. and Erlich, H. (1986) Specificenzymatic amplification of DNA in vitro : the polymerase chain reaction. ColdSpring Harbor Symposia on Quantitative Biology 51, 263–273.
Nagahama, T., Sato, H., Shimazu, M. and Sugiyama, J. (1995) Phylogenetic divergenceof the entomophthoralean fungi: evidence from nuclear 18S ribosomal RNAgene sequences. Mycologia 87, 203–209.
Nishida, H. and Sugiyama, J. (1993) Phylogenetic relationships among Taphrina,Saitoella, and other higher fungi. Molecular Biology and Evolution 10, 431–436.
Nishida, H. and Sugiyama, J. (1994) Archiascomycetes : detection of a major newlineage within the Ascomycota. Mycoscience 53, 361–366.
Nishida, H., Blanz, P.A. and Sugiyama, J. (1993) The higher fungus Protomycesinouyei has two group I introns in the 18S rRNA gene. Journal of MolecularEvolution 37, 25–28.
Norman, J.E. and Egger, K.N. (1996) Phylogeny of the genus Plicaria and itsrelationship to Peziza inferred from ribosomal DNA sequence analysis. Myco-logia 88, 986–995.
Nordnes, S., Krauss, S. and Johansen, T. (1994) cDNA sequence of zebrafish(Brachydanio rerio) translation elongation factor-1a: molecular phylogeny ofeukaryotes based on elongation factor-1a protein sequences. Biochimica etBiophysica Acta 1219, 529–532.
O’Donnell, K. (1992) Ribosomal DNA internal transcribed spacers are highlydivergent in the phytopathogenic ascomycete Fusarium sambucinum (Gibberellapulicaris). Current Genetics 22, 213–220.
O’Donnell, K. (1993) Fusarium and its near relatives. In: Reynolds, D.R. and Taylor,J.W. (eds) The Fungal Holomorph: Mitotic, Meiotic and Pleomorphic Speciationin Fungal Systematics. CAB International, Wallingford, pp. 225–233.
O’Donnell, K. and Cigelnik, E. (1997) Two divergent intragenomic rDNA ITS2 typeswithin a monophyletic lineage of the fungus Fusarium are nonorthologous.Molecular Phylogenetics and Evolution 7, 103–116.
O’Donnell, K., Cigelnik, E., Weber, N.S. and Trappe, J.M. (1997) Phylogeneticrelationships among ascomycetous truffles and the true and false morels inferredfrom 18S and 28S ribosomal DNA sequence analysis. Mycologia 89, 48–65.
Pei, M.H., Whelan, M.J., Halford, N.G. and Royle, D.J. (1997) Distinction betweenstem- and leaf-infecting forms of Melampsora rust on Salix viminalis usingRAPD markers. Mycological Research 101, 7–10.
Peterson, S.W. (1991) Phylogenetic analysis of Fusarium species using ribosomalRNA sequence comparisons. Phytopathology 81, 1051–1054.
Peterson, S.W. (1993) Molecular genetic assessment of relatedness of Penicillium
Applications in Fungal Phylogeny 149
subgenus Penicillium. In: Reynolds, D.R. and Taylor, J.W. (eds) The FungalHolomorph: Mitotic, Meiotic and Pleomorphic Speciation in Fungal Systematics.CAB International, Wallingford, pp. 121–128.
Pitt, J.I. (1993) Speciation and evolution in Penicillium and related genera. In:Reynolds, D.R. and Taylor, J.W. (eds) The Fungal Holomorph: Mitotic, Meioticand Pleomorphic Speciation in Fungal Systematics. CAB International, Wall-ingford, pp. 107–113.
Radford, A. (1993) A fungal phylogeny based upon orotidine 5′-monophosphatedecarboxylase. Journal of Molecular Evolution 36, 389–395.
Rakotonirainy, M.S., Cariou, M.L., Brygoo, Y. and Riba, G. (1994) Phylogeneticrelationships within the genus Metarhizium based on 28S rRNA sequences andisozyme comparison. Mycological Research 98, 225–230.
Rehner, S.A. and Samuels, G.J. (1994) Taxonomy and phylogeny of Gliocladiumanalysed from nuclear large subunit ribosomal DNA sequences. MycologicalResearch 98, 625–634.
Ritland, C.E., Ritland, K. and Straus, N.A. (1993) Variation in the ribosomal internaltranscribed spacers (ITS1 and ITS2) among eight taxa of the Mimulus guttatusspecies complex. Molecular Biology and Evolution 10, 1273–1288.
Rusk, S.A., Spiegel, F.W. and Lee, S.B. (1995) Design of polymerase chain reactionprimers for amplifying nuclear ribosomal DNA from slime molds. Mycologia 87,140–143.
Saenz, G.S., Taylor, J.W. and Gargas, A. (1994) 18S rRNA gene sequences andsupraordinal classification of the Erysiphales. Mycologia 86, 212–216.
Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. andArnheim, N. (1985) Enzymatic amplification of β-globin genomic sequences andrestriction site analysis for diagnosis of sickle cell anemia. Science 230,1350–1354.
Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis,K.B. and Erlich, H.A. (1988) Primer-directed enzymatic amplification of DNAwith a thermostable DNA polymerase. Science 239, 487–491.
Saitou, N. and Nei, M. (1987) The neighbor-joining method: a new method forreconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406–425.
Sappal, N.P., Jeng, R.S., Hubbes, M. and Liu, F. (1995) Restriction fragment lengthpolymorphisms in polymerase chain reaction amplified ribosomal DNAs ofthree Trichogramma (Hymenoptera: Trichogrammatidae) species. Genome 38,419–425.
Schafer, C. and Wostemeyer, J. (1992) Random primer dependent PCR differentiatesaggressive from non-aggressive isolates of the oilseed rape pathogen Phomalingam (Leptosphaeria maculans). Journal of Phytopathology 136, 124–136.
Schardl, C.L., Liu, J.-S., White, J.F. Jr., Finkel, R.A., An, Z. and Siegel, M.R. (1991)Molecular phylogenetic relationships of nonpathogenic grass mycosymbiontsand clavicipitaceous plant pathogens. Plant Systematics and Evolution 178,27–41.
Schlotterer, C., Hauser, M.-T., von Haeseler, A. and Tautz, D. (1994) Comparativeevolutionary analysis of rDNA ITS regions in Drosophila. Molecular Biologyand Evolution 11, 513–522.
Seifert, K.A., Louis-Seize, G. and Savard, M.E. (1997) The phylogenetic relationshipsof two trichothecene-producing hyphomycetes, Spicellum roseum and Tricho-thecium roseum. Mycologia 89, 250–257.
150 S. Takamatsu
Shearer, Jr., G. (1995) Cloning and analysis of cDNA encoding an elongation factor1a from the dimorphic fungus Histoplasma capsulatum. Gene 161, 119–123.
Sherriff, C., Whelan, M.J., Arnold, G.M., Lafay, J.-F., Brygoo, Y. and Bailey, J.A.(1994) Ribosomal DNA sequence analysis reveals new species groupings in thegenus Colletotrichum. Experimental Mycology 18, 121–138.
Sherriff, C., Whelan, M.J., Arnold, G.M. and Bailey, J.A. (1995) rDNA sequenceanalysis confirms the distinction between Colletotrichum graminicola and C.sublineolum. Mycological Research 99, 475–478.
Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. and Flook, P. (1994)Evolution, weighting, and phylogenetic utility of mitochondrial gene sequencesand a compilation of conserved polymerase chain reaction primers. Annals of theEntomological Society of America 87, 651–701.
Simon, L., Bousquet, J., Levesque, R.C. and Lalonde, M. (1993) Origin anddiversification of endomycorrhizal fungi and coincidence with vascular landplants. Nature 363, 67–69.
Spatafora, J.W. and Blackwell, M. (1993) Molecular systematics of unitunicateperithecial ascomycetes: the Clavicipitales–Hypocreales connection. Mycologia85, 912–922.
Strimmer, K. and von Haeseler, A. (1996) Quartet puzzling: a quartet maximum-likelihood method for reconstructing tree topologies. Molecular Biology andEvolution 13, 964–969.
Suh, S.-O. and Sugiyama, J. (1994) Phylogenetic placement of the basidiomycetousyeasts Kondoa malvinella and Phodosporidium dacryoidum, and the anamorphicyeast Sympodiomycopsis paphiopedili by means of 18S rRNA gene sequenceanalysis. Mycoscience 35, 367–375.
Swann, E.C. and Taylor, J.W. (1993) Higher taxa of basidiomycetes: an 18S rRNAgene perspective. Mycologia 85, 923–936.
Swofford, D.L. (1993) Phylogenetic Analysis Using Parsimony (PAUP version 3.1.1).Illinois Natural History Survey, Champaign, Illinois.
Taylor, J.L., Borgmann, I. and Seguin-Swartz, G. (1991) Electrophoretic karyotypingof Leptosphaeria maculans differentiates highly virulent from weakly virulentisolates. Current Genetics 19, 273–277.
Taylor, J.W. and Natvig, D. (1987) Isolation of fungal DNA. In: Fuller, M.S. andJaworski, A. (eds) Zoosporic Fungi in Teaching and Research. South-easternPublishing Corporation, Athens, Georgia, pp. 252–258.
Taylor, J.W., Bowman, B.H., Berbee, M.L. and White, T.J. (1993) Fungal modelorganisms: phylogenetics of Saccharomyces, Aspergillus, and Neurospora. Sys-tematic Biology 42, 440–457.
Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTAL W: improving thesensitivity of progressive multiple sequence alignment through sequence weight-ing, positions-specific gap penalties and weight matrix choice. Nucleic AcidsResearch 22, 4673–4680.
Van der Auwera, G., Chapelle, S. and De Wachter, R. (1994) Structure of the largeribosomal subunit RNA of Phytophthora megasperma, and phylogeny of theoomycetes. FEBS Letters 338, 133–136.
Van der Auwera, G., De Baere, R., Van de Peer, Y., De Rijk, P., Van den Broeck, I.and DeWachter, R. (1995) The phylogeny of the Hyphochytriomycota as deducedfrom ribosomal RNA sequences of Hyphochytrium catenoides. MolecularBiology and Evolution 12, 671–678.
Applications in Fungal Phylogeny 151
Van der Auwera, G. and De Wachter, R. (1996) Large-subunit rRNA sequence of thechytridiomycete Blastocladiella emersonii, and implications for the evolution ofzoosporic fungi. Journal of Molecular Evolution 43, 476–483.
Verweij, P.E., Meis, J.F.G.M., Van den Hurk, P., Zoll, J., Samson, R.A. and Melchers,W.J.G. (1995) Phylogenetic relationships of five species of Aspergillus and relatedtaxa as deduced by comparison of sequences of small subunit ribosomal RNA.Journal of Medical and Veterinary Mycology 33, 185–190.
Waalwijk, C., de Koning, J.R.A., Baayen, R.P. and Gams, W. (1996a) Discordantgroupings of Fusarium spp. from sections Elegans, Liseola and Dlaminia basedon ribosomal ITS1 and ITS2 sequences. Mycologia 88, 361–368.
Waalwijk, C., Baayen, R.P., de Koning, J.R.A. and Gams, W. (1996b) RibosomalDNA analyses challenge the status of Fusarium sections Liseola and Elegans.Sydowia 48, 90–104.
Walsh, P.S., Metzger, D.A. and Higuchi, R. (1991) Chelex 100 as a medium for simpleextraction of DNA for PCR-based typing from forensic material. BioTechniques10, 506–513.
Welsh, J. and McClelland, M. (1990) Fingerprinting genomes using PCR witharbitrary primers. Nucleic Acids Research 18, 7213–7218.
Wery, J., Dalderup, M.J.M., Linde, J.T., Boekhout, T. and van Ooyen, A.J.J. (1996)Structural and phylogenetic analysis of the actin gene from the yeast Phaffiarhodozyma. Yeast 12, 641–651.
White, T.J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification and directsequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A.,Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR Protocols: a Guide toMethods and Applications. Academic Press, New York, pp. 315–322.
Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A. and Tingey, S.V. (1990)DNA polymorphisms amplified by arbitrary primers are useful as geneticmarkers. Nucleic Acids Research 18, 6531–6535.
Xue, B. and Goodwin, P.H. (1994) Insertions and G-C rich DNA sequences in themitochondrial large ribosomal subunit of Leptosphaeria maculans. MycologicalResearch 98, 445–452.
Xue, B., Goodwin, P.H. and Annis, S.L. (1992) Pathotype identification of Lep-tosphaeria maculans with PCR and oligonucleotide primers from ribosomalinternal transcribed spacer sequences. Physiological and Molecular Plant Pathol-ogy 41, 179–188.
Yan, Z.H., Rogers, S.O. and Wang, C.J.K. (1995) Assessment of Phialophora speciesbased on ribosomal DNA internal transcribed spacers and morphology. Mycolo-gia 87, 72–83.
Zambino, P.J. and Szabo, L.J. (1993) Phylogenetic relationships of selected cereal andgrass rusts based on rDNA sequence analysis. Mycologia 85, 401–414.
Zhou, J. and Kleinhofs, A. (1996) Molecular evolution of nitrate reductase genes.Journal of Molecular Evolution 42, 432–442.
Zolan, M.E. and Pukkila, P.J. (1986) Inheritance of DNA methylation in Coprinuscinereus. Molecular and Cellular Biology 6, 195–200.
152 S. Takamatsu
PCR Applications to theTaxonomy ofEntomopathogenic Fungi
F. Driver and R.J. Milner
CSIRO, Division of Entomology, GPO Box 1700, Canberra, ACT2601, Australia
8.1 Introduction
The extent of biodiversity within fungi is often underestimated: there areover 72,000 described species and the total number of species in the worldmay be as many as 1.5 million (Hawksworth, 1995). It is more widely knownthat insects are a highly diverse component of the animal kingdom with largenumbers of undescribed species and it is estimated that a total of 10 millionspecies of insect exist. Given that 5% of these insects are attacked by aspecific fungus then it might be expected that there are 500,000 species offungi as symbionts, commensals or pathogens of insects (Hawksworth,1991). The diversity of association between insects and fungi has recentlybeen reviewed by Lawrence and Milner (1996) and Murrin (1996). Whileover 750 species of fungi have been described as being pathogens of insects,only a small proportion of these have been intensively studied, mainlybecause they attack pest insects and are, therefore, of interest as biologicalcontrol agents. The different types of fungi which are pathogenic on insectsand the detailed ecology of some of these have been reviewed by Glare andMilner (1991).
There are two basic approaches to the use of pathogens for biologicalcontrol of insects. A pathogen can be introduced into an area where it doesnot naturally occur in the hope of achieving long-term classical biologicalcontrol. The other strategy is to mass-produce the pathogen for repeated usein an area as a biological insecticide. In both cases, it is important to knowthe genetic make-up of the isolate of the fungus being released into the field.Increasingly scientists are finding that PCR methodologies are useful in theseapplied programmes. This increased knowledge of the genetic make-up of
8
© CAB INTERNATIONAL 1998. Applications of PCR in Mycology(eds P.D. Bridge, D.K. Arora, C.A. Reddy and R.P. Elander) 153
isolates is being applied to track the distribution of artificially releasedisolates in the field, to understand the host specificity profile of an isolate andfor protection of intellectual property. The obvious implications for a greaterunderstanding of the taxonomy of the pathogens involved is often a side-benefit, and not a prime objective of the research.
In this chapter, we review the use of PCR for study of the taxonomy ofentomopathogenic fungi and use as a case study our own research onMetarhizium. Finally we offer some conclusions and outline some of thefuture directions for this research. For a more general treatment of theapplications of molecular biology to entomopathogenic fungi the reader isreferred to Khachatourians (1996), and the application of biotechnology tothe development of mycoinsecticides has been covered by Hegedus andKhachatourians (1995).
8.2 Recent Studies on PCR of Entomophthorales
The largest and most successful group of insect pathogenic fungi is the 150or so species within the order Entomophthorales of the subdivision Zygomy-cetina. Most of these fungi were once placed in a single large genus,Entomophthora, but now some nine genera are generally recognized:Conidiobolus, Entomophaga, Entomophthora, Eryniopsis, Neozygites, Ery-nia, Zoophthora, Strongwellsea and Massospora. Some species can be grownon simple media and have been investigated as biological insecticides butmost are too fastidious for this application. Unfortunately the species mosteffective as biological control agents are very widely distributed (along withtheir hosts) and so opportunities for introductions are rare.
Nagahama et al. (1995) examined the phylogenetic relationships betweenthe entomophthoran genera, Zoophthora, Entomophthora and Conidiobolusand other zygomycetes such as Mucor, Glomus, Smittium and Basidiobolus bycomparing sequences of the 18S RNA gene. Phylogenetic trees were developedusing neighbour-joining (Saitou and Nei, 1987) or parsimony (Swofford, 1993)and the robustness of the branches was assessed using bootstrap analysis(Felsenstein, 1985). The two trees both showed that the three insect pathogenicgenera were distinct but closely related; Mucor was the most closely relatedfree-living genus. More studies of this type are needed to cover a wider range ofgenera and isolates. The results may help to clarify, for example, thecontroversial distinction between Erynia and Zoophthora.
Three species which have been introduced into other countries eitheraccidentally or deliberately are Entomophaga maimaiga into the USA(Andreadis and Weseloh, 1990), Zoophthora radicans into Australia (Milneret al., 1982), and Entomophaga grylli into both Australia (Milner, 1985) andthe USA (Carruthers and Onsager, 1993). PCR studies of all these specieshave been published in addition to those on the ubiquitous aphid pathogenErynia neoaphidis (syn. Pandora neoaphidis).
154 F. Driver and R.J. Milner
The gypsy moth, Lymantria dispar, is an important pest of forests in theUSA. In 1989, extensive mortality of caterpillars occurred in the north-eastUSA and the causative organism was provisionally identified as a member ofthe Entomophaga aulicae complex, an entomophthoran pathogen of a varietyof species of Lepidoptera in North America. Hajek et al. (1990) usedallozymes and RFLP to compare 20 isolates of E. aulicae from a variety ofhosts in the USA and Canada, with six isolates of E. maimaimga, amorphologically similar fungus from the L. dispar in Japan, and three isolatesof the new fungus from gypsy moth caterpillars infected in the north-eastUSA. Hajek et al. (1996b) have extended these studies using PCR productsfrom two primers as well as RFLP used previously. rDNA primers for the18S and 25S genes were used to amplify 200 bp of the 3′ end of the 18S geneand 1100 bp of the 5′ end of the 25S gene. The results supported the splittingof E. aulicae into three groups based on RFLP analysis (Walsh et al., 1990)and showed that a new isolate obtained from Orygia vetusta, a lymantriidclosely related to the gypsy moth, belonged to group 2 E. aulicae and wasdistinct from E. maimaiga from the gypsy moth in the USA and Japan.Unfortunately the original host of the group 2 E. aulicae reference strain isnot known for certain but is thought to be a Heliothis sp. These data providestrong evidence that there are four cryptic species within the E. aulicaecomplex in the USA which are ecologically separated by attacking differenthosts. Only one of these species, E. maimaiga, has been characterized andnamed.
Recent PCR studies on two other apparently broad host-range entomo-phthoran fungi, Zoophthora radicans and Erynia neoaphidis, have alsodemonstrated that these are species complexes. Hodge et al. (1995) usedRAPDs to compare 38 isolates from a variety of hosts around the world. Theaim of the study was to determine whether or not seven isolates of thisfungus, originally from Serbia and field-released near Ithaca, New York (forbiological control of the potato leafhopper, Empoasca fabae) had becomeestablished. The results gave a high level of correlation between isolates fromSerbia and those subsequently isolated from field-release sites at Ithaca. Moreinteresting was the finding that aphid-derived isolates were distinct fromboth the ciccadelid isolates and from isolates derived from Lepidoptera. Inall some ten groups could be distinguished on the basis of RAPD patterns.Further work is needed to determine the taxonomic implications of theseresults. They support previous studies which proposed host-specific groupswithin Z. radicans (Milner and Mahon, 1985; Glare et al., 1987). Thesuccessful introduction of a strain of Z. radicans into Australia from Israel forthe control of the spotted alfalfa aphid, Therioaphis trifollii f. maculata, wasundertaken on the understanding that isolates already present in Australia onLepidoptera, Diptera and Hymenoptera, were unable to attack aphids(Milner et al., 1982).
The relationships within Zoophthora spp. were further investigated byHajek et al. (1996a) who investigated the origin of an outbreak of Zoophthora
Taxonomy of Entomopathogenic Fungi 155
phytonomi in North American alfalfa weevils, Hypera punctata. Similarmethods, using RAPDs, were used to those of Hodge et al. (1995). Theresults clearly delineated two distinct groups within Z. phytonomi, both ofwhich were distinct from two isolates of Z. radicans from a lepidopteran anda homopteran which gave identical patterns. The authors postulated that oneof the two genotypes may be ‘new’ to North America, either because ofimportation from Europe or through genomic change (e.g. by mutation).They found that spore size, traditionally a key taxonomic character, was toovariable to be of any taxonomic value.
In a similar study, Rohel et al. (1997) compared RAPD patterns for 31isolates of the Erynia neoaphidis complex. As with the E. aulicae complex,only a single species Er. kondoiensis had been formally recognized anddescribed as a distinct species. Er. kondoiensis was distinguished from Er.neoaphidis on the basis of allozymes, spore size and ecological factors(Milner et al., 1983). Rohel et al. (1997) showed that the Er. neoaphidiscomplex clearly displays size polymorphism in the internally transcribedspacer (ITS) region. RAPD data showed that there were four major groupswithin the 31 isolates studied. The majority of isolates, which were fromaphid hosts in France and other countries, were placed in group 1100, twoisolates from non-aphid hosts in Mexico were group 575, the Er. kondoiensisisolate from Acyrthosiphon kondoi in Australia plus two other isolates fromAphis sp. in Mexico and Acyrthosiphon pisum in Brazil constituted group1000, and seven isolates all from aphids in France constituted group 1450.Both groups 1000 and 1450 had smaller conidia than the (probably ‘typical’)Er. neoaphidis group 1100, and they grew more rapidly on artificial media.Further ecological and molecular studies are needed to determine thedifferences between these groups, especially groups 1100 and 1450, both ofwhich occur on a range of aphid species in France. The two isolates fromnon-aphid hosts are likely to constitute a distinct species.
8.3 Recent Studies on PCR of Ascomycota
A large number of species of fungi from the Ascomycota have been describedas pathogens of insects including the genera Cordyceps, Torrubiella andNectria. Recent molecular research has focused on the Ascosphaera spp.which cause the disease known as chalkbrood in bees (Bissett et al., 1996). Luet al. (1996) found that RAPD patterns could be used to detect the infectionin leafcutter bees and to distinguish between bees infected with A. aggregataand those infected with A. larvis. They reported that a quick ‘vortexing’method for extracting DNA was effective for use in RAPD analysis. All theprimers except one gave clear banding patterns and these were consistentbetween infected cadavers and those from pure cultures; while uninfectedinsects gave quite different patterns. There were obvious differences inbanding patterns between insects infected with either species of Ascosphaera
156 F. Driver and R.J. Milner
and non-sporulating cadavers gave banding patterns similar to those fromsporulating cadavers. Lu et al. (1996) concluded that this method provides arapid and accurate identification of the infection in leafcutter bees and thatspecies-specific ITS primers would provide a more reliable way of recogniz-ing species.
Recently five new species of Ascosphaera have been described from beematerial in Australia, using traditional taxonomic methods (Anderson andGibson, 1997), taking the total of known species to 25. They also compared20 of these species using sequence analysis of the ITS1 and ITS2 regions(Anderson et al., 1997). The methodology used was essentially that adoptedfor Metarhizium by Curran et al. (1994). Sequences were found to beremarkably uniform within species and small differences between specieswere therefore considered important and diagnostic. The ITS1 region wasfound to be more variable than the ITS2 region. Four distinct groups weredetected which correlate with morphological data. For example, the eightspecies clustered with A. apis all have large, blackish spore cysts, withellipsoidal to subcylindrical ascospores that are small or of average size.Because of the limited differences in morphology, the molecular data wereused as the primary character for separating some species, e.g. A. sub-cuticulata from A. aggregata. Interestingly these clusters did not correlatewith the host taxonomy, though there was some evidence that thesaprophytic/parasitic life cycle correlated with these clusters. The results ofAnderson et al. (1997) also support the conclusions of Berbee and Taylor(1992, 1995) who found, using sequence data from the nuclear 18S rDNAgene, that Ascosphaera and Eremascus are closely related genera.
8.4 Recent Studies on PCR of Mitosporic Fungi
8.4.1 Verticillium spp.
One of the first fungi to be commercialized as a mycoinsecticide wasVerticillium lecanii for control of aphids (trade-named Vertalec) and forwhiteflies (trade-named Mycotal). Various species of insect pathogenic fungiwere synomized under the name V. lecanii by Gams (1971). Jun et al. (1991)tested the validity of this revision using a range of morphological, physio-logical and biochemical characters to establish the taxonomic relationshipsbetween 64 isolates of Verticillium spp. They found that isolates of V. lecaniiclustered according to their source and suggested that further work usingenzyme patterns and DNA composition might support the case forseparating entomopathogenic, fungicolous and plant-pathogenic isolates intodistinct taxa. Typas et al. (1992) used RFLPs and found that three isolates ofV. lecanii from aphids (two species) and whitefly (one species) clusteredtogether and were distinct from six plant pathogenic species. Roberts et al.(1995) used RAPDs to compare V. lecanii with plant pathogenic species V.
Taxonomy of Entomopathogenic Fungi 157
albo-atrum and V. dahliae and concluded that V. lecanii was highly variableand quite distinct from the other two Verticillium species. Other workerssuch as Nazir et al. (1991) have used sequence data of the ITS region todifferentiate between species and strains within plant-pathogenic members ofthe genus. These data suggest that V. lecanii could be incorrectly named andthat it could be separated into a number of varieties/species which wereecologically distinct.
Mor et al. (1996) analysed 36 isolates, mostly from insects and identifiedas V. lecanii, using RAPDs. Unlike Jun et al. (1991) the isolates did notcluster according to source, nor was there any correlation with geographicallocation or virulence for the whitefly, Bemisia tabaci. They conclude ‘itappears that virulence determinants of V. lecanii are also unrelated topolymorphic DNA pattern as expressed by RAPDs’.
8.4.2 Paecilomyces spp.
Two species of Paecilomyces, P. farinosus and P. fumosoroseus, are importantas natural control agents of insects and are being evaluated as potentialmycoinsecticides. A third species, P. lilacinus, is used as a biological controlagent for plant parasitic nematodes in the Philippines.
Tigano-Milani et al. (1995b, 1995c) have been investigating variationwithin these species using RAPDs. The first of these studies (Tigano-Milaniet al., 1995a) was concerned with P. lilacinus and compared the bandingpatterns of 28 isolates identified as P. lilacinus, mainly from soil andnematode material in Brazil, with the banding patterns of P. fumosoroseus(two isolates), P. farinosus (three isolates) and P. amoenoroseus (one isolate).The polyacrylamide gels showed considerable variation within P. lilacinusand enabled a large number of bands to be scored resulting in 293 scorablecharacters. Cluster analysis with P. fumosoroeus as the outgroup gave a largenumber of clusters with two isolates, code-named CG301 and CG190, beingparticularly divergent. The tRNA phylogenic tree gave a smaller number ofclusters based on the 112 scorable characters. Interestingly, one isolate of P.farinosus clustered in the middle of the P. lilacinus isolates while CG190 wasclustered with an isolate of P. amoenoroseus and one of P. farinosus. It wasconcluded that P. farinosus was not monophyletic. However apparently noattempt was made to determine whether or not CG190, isolated from thesoil, was pathogenic for insects. While these results clearly indicate a highdegree of variability within P. lilacinus and suggest that polyacrylamide gelsare potentially useful for genetic fingerprinting of strains, the phylogeneticconclusions are open to question. Do the tRNA genes have adequateinformation content to allow the drawing of phylogenetic conclusions? Werethe closely related strains of P. fumoroseus suitable as outgroups?
Identical methods were applied by Tigano-Milani et al. (1995b) to study27 P. fumosoroeus isolates, of which 15 came from B. tabaci, in comparisonwith one strain of P. lilacinus and nine strains of Paecilomyces not assigned
158 F. Driver and R.J. Milner
to species. As with P. lilacinus, the RAPD patterns revealed a high degree ofgenetic divergence between strains. Cluster analysis placed the P. fumosor-oseus isolates into three groups. Group 1 isolates were morphologicallysimilar and resembled the typical P. fumosoroeus, and group 2 isolates weremore polymorphic and this group contained most of the B. tabaci isolates.Group 1 included isolate CG170 derived from the PFR-97 pilot productbeing produced by ECO-tek in the USA. The group 3 isolates were highlydivergent from what can be regarded as normal. This is similar to thesituation in Metarhzium where it is also a species aggregate (see case studybelow). The phylogenetic analysis based on the tRNA primers did not clarifythe situation because group 1 and group 2 isolates often clustered together,again suggesting that the data may be unsuitable for this type of analysis.
8.4.3 Beauveria spp.
Agostino Bassi is credited with being the first scientist to demonstrate thata disease was caused by a microorganism, when in 1835 he infectedsilkworms with Beauveria bassiana. Since that time, members of the genusBeauveria have been intensively studied all over the world. A diverse rangeof isolates sharing the essential features of Beauveria have been described andsome six species are generally recognized at present: B. bassiana, B.brongniartii, B. amorpha, B. vermiconia, B. velata and B. caledonica (Glareand Inwood, 1997). Distinguishing features of Beauveria include con-idiophores which produce one-celled conidia in whorls or dense clusters ofsympodial, short or globose or flask-shaped conidial cells with apicaldenticulate rachi. Generally, isolates are insect pathogens which producecadavers covered in white mycelium and conidia sometimes formingpronounced coremia. B. calendonica, described from moorland soil inScotland (Bissett and Widden, 1988), is the only species not known to bepathogenic to insects and may be entirely saprophytic.
Prior to the development of PCR, Rakotonirainy et al. (1991) sequenceda 500 bp segment of the 28S RNA gene of nine isolates of B. bassiana andcompared them with Fusarium and Tolypocladium. The data confirmed thatthese Tolypocladia should not be synomized with Beauveria. Kosir et al.(1991) used RFLP banding patterns to differentiate two isolates of B.bassiana, one a virulent isolate and the other a derived mutant of much lowervirulence. Pfeifer et al. (1993) analysed a mitochondrial gene of B. bassianaisolate GK2016 using restriction enzymes, gene probe hybridization andDNA sequence comparisons. They found the mtDNA to be circular and28.5 kbp in length. By using probes from other organisms, they were able toproduce a restriction enzyme map. They were unable to find any introns andconcluded that the sequence was more similar to that of Aspergillus nidulansthan to two other species, Podospora anserina and Neurospora crassa.
The first application of PCR was by Bidochka et al. (1993) whocompared RAPD patterns of 24 isolates of Metarhizium and Beauveria from
Taxonomy of Entomopathogenic Fungi 159
grasshoppers. Using three primers and analysing the data by means of themethod of Nei and Li (1979), they found considerable variability within M.anisopliae but 12 ‘acridid’ isolates clustered together and showed much lessvariability. These were referred to as M. flavoviride because they includedARSEF 2023, an isolate described as M. flavoviride var. minus by Rombachet al. (1986) (see below). Isolates of the two Metarhizium species were foundto be more similar to each other than to B. bassiana. This study clearlyshowed the potential of RAPDs for identifying species and strains ofentomopathogenic fungi.
Contrasting approaches to using RAPDs for studying variation withinBeauveria are shown in recent papers: Maurer et al. (1997) have confirmedthe existence of host-dependent clusters while Glare and Inwood (1997) havefound evidence of a distinct New Zealand group of B. bassiana isolates. The36 isolates studied by Maurer et al. (1997) were all classified as B. bassianaon the basis of conidial morphology and were derived from pyralids (mostlythe European corn borer, Ostrinia nubilalis), curculionids (mostly Sitonaspp.) and four isolates from chrysomelids. Isolates were from Europe, LatinAmerica, South America and Africa. RAPD and RFLP analyses were usedand the isolates were bioassayed against European corn borer and the weevilS. lineatus. The results for the European corn borer isolates were particularlyconvincing. Twelve of the 13 most virulent isolates originated from thisinsect, and when analysed they clustered together with the one exception:isolate Bb231 from Sitona, which clustered closer to the corn borer isolatesand was only slightly pathogenic for S. lineatus. The curculionid isolateswere more variable but also tended to cluster together. This study shows thatgenetic fingerprinting, using RAPDs or a similar method, can be a powerfultool for screening isolates to detect those highly virulent for a particular pest.Maurer et al. (1997) also compare two dendograms produced for the RAPDand RFLP data using an unweighted pair-group algorithm and found thatthese dendograms showed a remarkable degree of congruity. However, theauthors correctly point out problems of using a hierarchical method forplacing isolates in groups with implied relatedness.
The difficulties posed by identifying isolates of Beauveria based onmorphological characters led Glare and Inwood (1997) to use molecular toolsto compare isolates from New Zealand with those from other countries.They compared 26 isolates, most of which were classified as B. bassiana orB. brongniartii, on the basis of conidial morphology. Other isolates studiedwere single isolates of B. amorpha, B. caledonica and B. velata of the ARSEFcollection, one isolate with curved conidia from Chile referred to as B.vermiconia and an isolate of Akanthomyces sp. from Australia which wasused as an outgroup in the analysis. DNA was extracted and analysed byRAPDs and by RFLPs of the ITS region. Neither RAPD patterns nor RFLPbanding from the ITS region separated out B. bassiana and B. brongniartii.The RAPD analysis provided many more differences in scorable bands andusing these data three clusters were apparent: B. bassiana from New Zealand
160 F. Driver and R.J. Milner
and other countries plus two overseas B. brongniartii, a second clustercontaining only New Zealand isolates of B. bassiana, and a final clustercontaining only B. brongniartii from New Zealand and other countries. Theother four species clustered together with the Akanthomyces sp. outgroup.However, as discussed by Maurer et al. (1997), it is difficult to drawphylogenetic conclusions from this type of analysis. The RFLP patterns gaveless variation but supported the conclusion that there was a ‘New Zealand’genotype of B. bassiana which clustered with B. amorpha, B. caledonica andB. vermiconia. The second major cluster contained all the other B. bassianaplus B. brongniartii isolates. An interesting speculation in this paper is thatthe two genetically distinct groups of B. bassiana found in New Zealandrepresent an indigenous (‘New Zealand’) form and a post-European settle-ment group. It is also interesting that B. brongniartii might have beensuccessfully introduced from France in the 1890s.
Hegedus and Khachatourians (1993) used the restriction enzyme Sau 3Ato generate a number of small randomized DNA fragments and then useddot-blots to test the specificity of these fragments for B. bassiana. Severalfragments, ranging in size from 1180 to 2700 bp were found to hybridize toDNA from B. bassiana but not B. brongniatii, B. caledonica, B. densa, M.anisopliae, and several other species of entomopathogenic and non-entomopathogenic fungi. These results were extended in a later paper(Hegedus and Khachatourians, 1996) in which the use of combinations ofthree primers (P1, P3 and P5) as species-specific probes was described. ThePCR products derived from the P1–P3 primer set were then studied usingsingle-strand conformation analysis. This enabled identification of a specificstrain of B. bassiana.
Polymorphism of the ITS region as detected using RFLPs was also usedby Neuveglise et al. (1994) to compare isolates of B. brongniartii fromHaplochelus marginalis. This study, while confirming the high degreee ofvariability within the ITS region of B. brongniartii, found a remarkabledegree of congruence with isolates from H. marginalis having similar RFLPpatterns and being the only isolates to be virulent for this scarab host. Anunrooted tree computed by the PAUP program (Swofford, 1993) shows thatthis group of B. brongniartii from H. marginalis forms a distinct cluster,closely related to other B. brongniartii, but more distantly related fromclusters containing isolates of B. brongniartii from Melolontha melolonthaand isolates of B. bassiana. A complete sequence for the ITS and 5.8S RNAcoding gene for two isolates of B. bassiana has recently been published byShih et al. (1995).
The first report of a group 1 intron in an entomopathogenic fungus wasby Neuveglise and Brygoo (1994) when they found three insertion elementseach 350–450 bp in the 28S ribosomal RNA gene of B. brongniartii. In afurther study of 37 isolates of B. brongniartii, two isolates of B. bassiana andone isolate of Metarhizium anisopliae, Neuveglise et al. (1997) reported 14variant forms of introns in four different positions. Isolates from H.
Taxonomy of Entomopathogenic Fungi 161
marginalis all showed one of three patterns, another pattern was unique toisolates from M. melolontha and eight further patterns were from isolatesfrom other hosts including the M. anisopliae isolate and the two B. bassianaisolates. Interestingly with plant parasitic fungi, similar introns have beenfound in the host and the fungus (Nishida and Sugiyama, 1995) suggestingthat there may have been intron transfer during evolution from host topathogen in the Haplochelus–B. brongniartii model.
Another promising method for genetic fingerprinting of strains is the useof teleomeric polymorphisms (Viaud et al., 1996). The teleometric sequencewas cloned from another fungus, Botrytis cinerea and used to analyse nineisolates of B. bassiana. RFLP banding patterns of the amplified DNAshowed that most French isolates from the European corn borer were similar,and those from other insects gave distinct fingerprints. Glare has confirmedthat teleomeric fingerprinting is a useful tool for comparing isolates ofBeauveria spp (T.R. Glare, Christchurch, 1997, personal communication).Viaud et al. (1996) found that chromosome number varied between seven andeight among these isolates and that there were significant chromosomallength polymorphisms within B. bassiana.
In conclusion, recent PCR studies have shown:
1. That there is considerable genetic diversity within the two main species,B. bassiana and B. brongniartii and that various methods such as RAPD(Bidochka et al., 1993; Glare and Inwood, 1997; Maurer et al., 1997),teleomeric fingerprinting (Viande et al., 1996) and RFLPs (Neuveglise et al.,1994; Glare and Inwood, 1997) are useful for distinguishing betweenisolates;2. That the morphological characters are unreliable (St Leger et al., 1992a)and in particular the distinction between B. bassiana and B. brongniartii isnot supported. However, it could be that a distinction should be madebetween ‘true’ B. brongniatii from strains of B. bassiana which tended toform more cylindrical conidia (T.R. Glare, Christchurch, 1997, personalcommunication);3. That phylogenetic relationships are most reliably determined by RFLPstudies using the ITS region (Neuveglise et al., 1994; Glare and Inwood,1997). However, this work now needs to be extended to sequence data fromthis region. Limited results to date suggest that B. bassiana and B.brongniartii are closely related and that four other species are distinct butcorrectly placed within the Beauveria genus. B. bassiana-specific geneprobes have been developed (Hegedus and Khatchatourians, 1996) but havenot yet been tested by other workers. Another species, Microhilum onco-perae is very closely related to B. bassiana and its taxonomic position needsto be reassessed (Riba et al., 1994);4. That there is no geographical clustering within the B. bassiana–B.brongniartii complex other than suggestion of a distinct genotype of B.bassiana found only in New Zealand (Glare and Inwood, 1997);
162 F. Driver and R.J. Milner
5. That there is evidence of co-evolved host-associated genotypes, shownpreviously for isolates from coffee berry borer (Bridge et al., 1990), with thescarabs Haplochelus marginalis (Neuveglise et al., 1994), and Melolonthamelolontha, the Sitona weevils and the pyralid, Ostrinia nubilalis (Maurer etal., 1997);6. That isolates of Beauveria may contain group 1 introns which can be usedto distinguish between isolates (Neuveglise et al., 1994, 1997).
8.5 A Case Study: Variation in Metarhizium spp.
8.5.1 Introduction
‘Green muscardine disease’ is one of the most frequently found fungal diseasesof insects and occurs worldwide. The causative agent is a Hyphomycete funguswhich produces uninuclear, haploid, phialidic conidia in chains. These conidiaare usually green and cover the cadaver, hence the ‘green muscardine’appearance. In nature, the fungus is found only on infected insects or asdormant conidia in the soil but, in the laboratory, it is easily grown on a widerange of media. No sexual stage is known, however some genetic exchange ispossible by means of a parasexual cycle (Al Aidroos, 1980).
The genus Metarhizium was erected to cover all isolates of greenmuscardine fungus and the first species was M. anisopliae from Russia.It was named after its scarab host – Anisoplia austriaca (Zimmermann,1993). Since then various new names have been erected for other strainswhich differed from M. anisopliae often in minor ways such as colourof the conidia. The currently accepted taxonomy owes much to papersby Tulloch (1976) and Rombach et al. (1987). Three species are recognized,distinguished by the morphology of the conidia, the conidiophores andthe growth characteristics. M. anisopliae has green, elongate and oftenslightly waisted conidia produced on parallel-sided conidiophores. Thereare two varieties, var. anisopliae with smaller conidia 5–7 × 2–3 µm, andvar. majus with conidia approximately twice that size (it has been suggestedthat these conidia are diploids; Samuels et al., 1989). M. flavoviride isslower-growing, lighter green in colour and has swollen conidia borne onswollen conidiophores. Again two varieties are recognized, var. flavoviridewith larger conidia 7–9 × 4.5–5.5 µm, and var. minus with conidia 4.5–7.0× 2–3 µm. The third species, M. album, has almost white conidia andgrows on plates on a subhymenial zone of inflated hyphal bodies. Theconidia are swollen and measure 3–6 × 1.5–2.5 µm.
Besides these three species, isolates of which are available from manyculture collections, four additional species of Metarhizium have beendescribed from China: M. pingshaeme Chen and Guo, M. cylindrosporaeChen and Guo, M. guizhousense Chen and Guo (Guo et al., 1986), and M.taii Liang and Liu, and its teleomorph Cordeyceps taii (Liang et al., 1991).
Taxonomy of Entomopathogenic Fungi 163
Since the publication of the Rombach et al. (1987) key, our knowledgeof diversity within Metarhizium has increased greatly due to new strainsbeing found and the use of biochemical and molecular techniques to providenew taxonomic characters. Morphological studies have shown that thedistinction between M. anisopliae with cylindrical phialides and conidia andM. flavoviride with its swollen phialides and ovoid conidia is difficult toapply, and some isolates can display both forms depending on factors suchas cultural conditions and age of culture (Glare et al., 1996). In addition,detailed measurements of conidia have failed to show a distinction betweenthese two species (T.R. Glare, Christchurch, 1997, personal communication).Various authors have used RAPDs to establish differences between strainsfrom sugar cane insects (Fegan et al., 1993) from cercopids and the soil inBrazil (Tigano-Milani et al., 1995c; Fungaro et al., 1996), from differentcountries (Leal et al., 1994a), from acridid compared with other hosts (Cobband Clarkson, 1993; Bridge et al., 1993; Bidochka et al., 1993), and fromNew Zealand (Glare et al., 1997). Similar studies by RFLPs on rDNA havealso shown high levels of diversity between isolates (Pipe et al., 1995). Usingallozymes combined with a number of other characters, St Leger et al.(1992b) detected ‘cryptic’ species within M. anisopliae. Rath et al. (1995)using germination temperature profiles (McCammon and Rath, 1994) andcarbohydrate utilization patterns described a new cold-temperature variety,M. anisopliae var. frigidum. A powerful method for identifying strains,useful for direct determination in infected insects, is the use of primerswhich detect polymorphisms in the Pr1 gene and RFLP to produce scorablebands (Leal et al., 1996). Recently Bailey et al. (1996) have describedintrons in the large subunit of nuclear ribosomal RNA genes fromM. anisopliae.
The present case study aims to extend that of Curran et al. (1994) to helpresolve some of the problems with the current taxonomy of Metarhizium.These problems include:
1. Should the three specific names, M. anisopliae, M. flavoviride and M.album be retained and if so, how are they to be defined given that themorphological basis has been shown to be invalid? A radical solution,already proposed, is that M. flavoviride and M. album should be synomizedwith M. anisopliae which would then be subdivided into a number ofvarieties (Milner et al., 1994);2. What is the correct name for the genetically distinct group of isolates fromacridid hosts now known as M. flavoviride group 3 (Bridge et al., 1997)? Thefirst of these isolates (ARSEF 2023) was isolated from an acridid in theGalapagos Islands and described primarily on the basis of conidial morphol-ogy as M. flavoviride var. minus (Rombach et al., 1986). Another isolate(ARSEF 324) was isolated from Austracris guttulosa from Australia andnamed M. anisopliae (St Leger et al., 1992b), again on the basis of conidialmorphology. It has since been shown to be almost identical genetically to
164 F. Driver and R.J. Milner
ARSEF 2023 and a number of other so-called acridid isolates from manycountries in Africa, as well as Madagascar, Brazil and Australia (Bidochka etal., 1994). Bidochka et al. (1994) revised their opinion of ARSEF 324, and onthe basis of PCR-amplified banding patterns described it as M. flavoviride.These isolates are all very similar when studied using RAPDs, isozymes andprotease production, yet are quite distinct from isolates of M. flavoviridefrom the soil or from leafhoppers in the Philippines and the Solomon Islands(Bridge et al., 1997);3. What is the taxonomic validity of M. anisopliae var. frigidum (Rath et al.,1995)?4. Another group of isolates, like the acridid group, which are geneticallydistinct from all others studied have been identified from New Zealand(Curran et al., 1994; Rakotonirany et al., 1994; Glare et al., 1997). What is thecorrect taxonomic placement for these isolates?
Therefore in this study, we attempt to redefine the phylogenetic, and byinference, the taxonomic relationships of the major morphological speciesclusters in Metarhizium. We correlated RAPD banding patterns withsequence data from the ITS and 5.8S rDNA. Here we report on phylogeneticestimates made by parsimony and distance using the ITS and the 5.8S regionof the rDNA. The following is a summary of this work which is publishedin detail elsewhere (Driver et al., 1998).
8.5.2 Methods
IsolatesThe 26 representative isolates used in this study are given in Table 8.1.Another 95 isolates have also been sequenced but did not provide significantadditional data. The isolates were chosen either because they are the subjectof on-going CSIRO research to develop a range of mycoinsecticides based onMetarhizium spp. (Milner and Jenkins, 1996), or because they are important(such as isolates derived from type material) for a comprehensive under-standing of genetic diversity within Metarhizium spp.
ITS amplification and sequencingPCR (Saiki et al., 1988) was used to amplify the region of the ribosomalrepeat from the 3′ end of the 16S rDNA to the 5′ end of the 28S rDNA,spanning the ITS1, the 5.8S rDNA and the ITS2. Primer sequences andreaction conditions were those described by Curran et al. (1994). Sequencingreactions were done using the Prism Ready Reaction DyeDeoxy TerminatorCycle Sequencing mix from Applied Biosystems Inc. (ABI) Australia.
RAPD amplifications and analysisThe presence or absence of RAPD band patterns was scored visually inorder to correlate any relationships with ITS sequence data without anyattempt to produce an hierarchic arrangement of clusters. RAPD groups
Taxonomy of Entomopathogenic Fungi 165
Table 8.1. List of representative isolates used for case study on Metarhizium.
Clade Morphological species FI numberOtherdesignation Host
Geographicalorigin Reference
1 M. album FI-MaF ARSEF 1941 Nephotetti viresens (Homoptera) Philippines Rombach et al. (1997)M. album FI-1165 ARSEF 1942 Nephotetti viresens (Homoptera) Philippines Rombach et al. (1997)
2 M. flavoviride var. minus FI-1173 ARSEF 2948 Unknown (Homoptera) Brazil Humber (1992)M. anisopliae var. anisopliae FI-152 Lepidiota consobrina (Coleoptera) Australia
3 M. anisopliae var. anisopliae FI-698 F10 Unknown (Lepidoptera) New Zealand Glare et al. (in press)M. anisopliae ‘var. frigidum’ FI-1124 DAT-F220 Soil Australia Rath et al. (1995)M. anisopliae ‘var. frigidum’ FI-1125 DAT-F368 Soil Australia Rath et al. (1995)
4 M. anisopliae var. anisopliae FI-72 IMI 177416 Pemphigus treherni (Homoptera) Britain IMI (1982)
5 M. flavoviride var. minus FI-1172 ARSEF 1764 Nilaparvata lugens (Homoptera) Philippines Rombach et al. (1986)M. flavoviride var. minus FI-403 ARSEF 2037 Nilaparvata lugens (Homoptera) Philippines Rombach et al. (1986)
6 M. flavoviride var. flavoviride FI-1170 ARSEF 2025 Soil Germany Gams and Roszypal(1973)
M. flavoviride var. flavoviride FI-405 ARSEF 1184 Otiorrhynchus sulcatus (Coleoptera) France Rombach et al. (1986)M. flavoviride var. flavoviride FI-402 ARSEF 2024 Otiorrhynchus sulcatus (Coleoptera) France Rombach et al. (1986)M. anisopliae ‘var. frigidum’ FI-38 DAT-F001 Adoryphorus couloni (Coleoptera) Australia Yip et al. (1992)
7 M. flavoviride var. minus FI-1216 ARSEF 2023 Acridid (Orthoptera) Galapagos Islands Rombach et al. (1986)M. anisopliae var. anisopliae FI-985 ARSEF 324 Austracris guttulosa (Orthoptera) Australia St Leger et al. (1992)M. flavoviride FI-987 IMI 330189 Ornithacris cavoisi (Orthoptera) Niger Bridge et al. (1993)M. flavoviride FI-1028 IMI 324673 Zonocerus variegatus (Orthoptera) Tanzania Bridge et al. (1993)
8 M. anisopliae var. anisopliae FI-1042 Dermolepida albohirtum (Coleoptera) AustraliaM. anisopliae var. anisopliae FI-147 Lepidiota consobrina (Coleoptera) Australia
9 M. anisopliae var. anisopliae FI-1029 IMI 168777ii Schistocerca gregaria (Orthoptera) Eritrea Tulloch (1976)M. anisopliae var. anisopliae FI-1034 IIBC I91-614 Patanga succincta (Orthoptera) Thailand Bidochka et al. (1994)M. anisopliae var. anisopliae FI-1099 ARSEF 445 Teleogryllus commodus (Orthoptera) Australia Bridge et al. (1993)
10 M. anisopliae var. majus FI-388 ARSEF 1914 Oryctes rhinoceros (Coleoptera) Philippines Humber (1992)M. anisopliae var. majus FI-389 ARSEF 2151 Oryctes rhinoceros (Coleoptera) Indonesia Humber (1992)
* Beauveria bassiana FI-297 Soil Australia* Paecilomyces sp. FI-360 Inopus rubriceps (Diptera) Australia* Paecilomyces sp. FI-442 Inopus rubriceps (Diptera) Australia
*Outgroups.
were assigned on the basis of perfectly identical, or nearly identical, bandingpatterns (Fig. 8.1).
Analysis of rDNA sequencesSequences for complementary strands were checked and the resultingsequences aligned using CLUSTAL W (T. Gibson, D. Higgins, J. Thompson,EMBL, Heidelberg, Germany, May 1994) at default settings. The alignmentwas checked visually and minor adjustments made manually. The alignment
Fig. 8.1. RAPD–PCR banding patterns using two primers, OP-H01 and OP-F06. Panels Aand B, lanes 1–17: 100 bp ladder; FI-1216 (ARSEF 2023, clade 7); FI-152, 1173 (clade 2);FI-403, 1172 (clade 5); FI-405, 402, 1170, 38 (clade 4); Fi-72, 1101 (clade 6); FI-698,699, 702, 1125, 1126 (clade 2); and panel B only FI-1165 (M. album, clade 1). Panels Band C illustrate the genetic homogeneity of acridid strains (clade 7), lanes 1–15: 100 bpladder; FI-1216 (Galapagos Islands); FI-1189, 1190, 1191, 1192, 1193 (Brazil); FI-1067,983, 984, 986 (Benin); FI-987 (Niger); FI-1028 (Tanzania); and FI-985 (ARSEF 324), 1155(Australia).
168 F. Driver and R.J. Milner
was translated into #NEXUS format for analysis using PAUP4d52-53 (betatest version of PAUP; Swofford, 1997).
The partition homogeneity test (Farris et al., 1995) as implemented inPAUP indicated no incongruence amongst the ITS1, 5.8S and ITS2 regions ofthe molecule. Subsequently the regions were analysed separately andtogether, but final phylogenetic results are based on the combined data. TheITS1 region (positions 14–219 in the file) contained 71 parsimony informa-tive positions, the 5.8S region (positions 220–377) contained seven, and theITS2 region (positions 378–604) contained 80. With alignment gaps treatedas missing data and with no differential weighting of transversions againsttransitions, parsimony analysis of either the whole data set or the ITS1 regionidentified in excess of 40,000 most parsimonious (mp) trees, apparently on asingle TBR-branch-swapper defined island. Separate analysis of the ITS2region produced a lesser number of mp trees, the strict consensus of whichwas consistent with the strict consensus of the ITS1 or whole data set trees(Fig. 8.2). Some branches are supported by several synapomorphic changes.The large number of trees results from the lack of informative character statechanges within certain clades (primarily single point deletions in a number ofM. anisopliae isolates).
8.5.3 Results
The RAPD–PCR banding patterns showed a high level of diversity even withinsome clades, for example clade 9 which contains a very large number of isolatesnormally classified as M. anisopliae var. anisopliae. Small changes in ITSsequence, e.g. single point mutations or deletions with respect to the type-strain of M. anisopliae var. anisopliae, are often accompanied by dramaticallydifferent RAPD patterns with most primers. Low levels of sequence diver-gence in most other clades of isolates, including var. majus and the acrididisolates, were mirrored by much smaller levels of polymorphism in theirRAPD banding patterns (Fig. 8.1, panels A, B, C and D).
The size of the ITS1, 5.8S and ITS2 PCR product (excluding primersequences) varied from 506 bp for FI-1029, the type material of M. anisopliaevar. anisopliae, to 573–4 bp for the two isolates of M. album. The size of thisregion is comparable to that reported for other entomopathogenic fungi(Neuveglise et al., 1994; Anderson et al., 1997). Size polymorphisms for thisregion which could be detected on agarose gels, were most evident betweenisolates from var. anisopliae, var. majus and B-type strains of Metarhizium,clades 8, 9 and 10 which ranged from 505 to 510 bp, compared with all othermaterial examined, including the acridid isolates. These larger ITS fragments,542–544 bp in acridid isolates, 530–551 bp for all varieties of M. flavoviride,545–546 bp for New Zealand isolates and 552–558 bp for the two isolatesfrom clade 2 in the phylogenetic tree, generally arose from longer, morevariable sequences in the ITS1. Interisolate variation was very low in allrecognized varieties of Metarhizium, and newly identified clusters with most
Taxonomy of Entomopathogenic Fungi 169
FI-297
FI-360
FI-442
FI-1165
FI-152
FI-1173
FI-1025
FI-1026
FI-698
FI-72
FI-1172
FI-403
FI-38
FI-402
FI-405
FI-1170
FI-1216
FI-985
FI-1028
FI-147
FI-1042
FI-379
FI-1029
FI-550
FI-330
FI-1027
FI-163
FI-203
FI-23
FI-328
FI-358
FI-114
FI-208
FI-1034
FI-1114
FI-700
FI-1031
FI-1056
FI-388
FI-389
CLADE 1
CLADE 2
CLADE 3
CLADE 4
CLADE 5
CLADE 6
CLADE 7
CLADE 8
CLADE 9
CLADE 10
100
100
99
55 100 90
82
95
98
98
80
60
65
90
95
100
65
80
Beauveria bassiana
Paecilomyces sp.
M. album
M. flavoviride var. nov.
M. flavoviride var. nov.
M. flavoviride var. minus
M. flavoviride var. flavoviride
M. anisopliae var. nov.
M. anisopliae var. nov.
M. anisopliae var. anisopliae
M. anisopliae var. majus
***
***
Fig. 8.2. Phylogeny of Metarhizium spp.: strict consensus of a maximum parsimonyanalysis. The numbers at branches are the bootstrap values (100 replicates), and ***indicates a T-PTP value of 0.01. Isolate designations are given in Table 8.1.
170 F. Driver and R.J. Milner
isolates exhibiting only single point mutations, or small insertions ordeletions, which were generally confined to ‘hot spots’ of variation.
The strict consensus tree of length 394 steps from the whole data set,original alignment, with uncorrected distances, is shown as Fig. 8.2.Bootstrap tests (Felsenstein, 1985) were used to quantify the support fornodes in the consensus of mp trees. Taxon groups distinguished only byparsimony-uninformative state changes (i.e. isolates differing by only singlepoint deletions) were combined into single nodes. Bootstrap analysis wasbased on 100 bootstrap replicates each with ten random-addition-sequencestarting trees and keeping no more than 50 trees at each replicate, to samplethe range of parsimonious trees for each resampling of the data matrix.Bootstrap proportions > 50% are shown in Fig. 8.2 where the monopoly ofclades 7–10 (M. anisopliae) is supported.
Topologically constrained permutation tail probability (T-PTP) tests(Faith, 1991) under both equal-weighting and 2:1 transversion:transitionweighting confirmed the apparent monopoly of the M. anisopliae clades andclades 4 and 5 (M. flavoviride). These clusters are not due to chance alone(PTP = 0.01). The acridoid isolates, FI-985, FI-986 and FI-1028, appear as aclade 7 closely related to clades 9 and 10 which are typical M. anisopliae atbootstrap support > 95%, rendering M. flavoviride paraphyletic. T-PTP wasused to test this clustering against a conflicting hypothesis that the acrididisolates should cluster within a monophyletic clade of M. flavoviride. Forthis test, the M. anisopliae clades were reduced to their basal node and thegroup M. anisopliae + clade 7 isolates subjected to T-PTP tests both formonophyly and non-monophyly. A prior hypothesis of monophyly couldnot be falsified (PTP = 0.01). A prior hypothesis of non-monophyly couldbe falsified (PTP = 1.00). The data are sufficient to accept the formerhypothesis and reject the latter.
Clade 6 includes isolate FI-38 which is now a commercial productin Australia (BioGreen ) under the name M. anisopliae, clusters withinM. flavoviride var. flavoviride on all mp trees. That placement is supportedby bootstrap values > 80% on the intervening branches. To confirm theprior hypothesis, a placement within the M. anisopliae clade could befalsified on these data, and T-PTPs for monophyly of clade 4 + M.anisopliae isolates were conducted. A prior hypothesis of monophyly couldbe falsified (PTP = 1.00). A prior hypothesis of non-monophyly couldnot be falsified (PTP = 0.01). These tests confirm placement of FI-38 withinclade 6 (M. flavoviride).
The ITS region has been used extensively for fungal taxonomy (reviewedby Seifert et al., 1995), and it is very useful for identifying species clusters,as well as differentiating strains that are ecologically distinct (Nazir et al.,1991). Sequence data from this region (Driver et al., 1998), have provided asound framework for a taxonomic revision of the three accepted species ofMetarhizium, despite the lack of resolution in the base of the tree. Processessuch as gene conversion may result in the loss of clear patterns of descent in
Taxonomy of Entomopathogenic Fungi 171
distant relationships, and reticulation and not synapomorphies arise in thecomparisons of sequences (Brower and DeSalle, 1994). The results show thatthe worldwide genetic diversity, as presently known, can be circumscribedby ten clades. In most cases these clades correspond to either morpho-logically recognized varieties, or clusters of isolates which have beenidentified by other molecular or biochemical markers. It is likely that mostnew isolates found in the future will be unequivocally placed in one of theseclades. However the taxonomy is flexible and new clades may be added if thesequence data justify creation of additional clades. A key question is whatlevel of nucleotide divergence should be attributed to define taxonomic rankat species and varietal levels? Nucleotide divergence for the ITS regionbetween morphologically defined species in Metarhizium ranges between 14and 18%, whilst divergence between recognized varieties within species doesnot exceed 5%. Levels of nucleotide divergence for clusters of isolates fromacridoid hosts in New Zealand blur the margins between species and varietallimits. Paired clusters of isolates of clade 7/anisopliae, clade 7/flavoviride andclade 7/album show levels of nucleotide divergence of 9.4%, 17.2% and16.5% respectively, whilst paired clusters of isolates from clade 3/anisopliae,clade 3/flavoviride, and clade 3/album are in the range 11.3%, 6.9% and9.1% respectively. Cladistics requires that species represent monophyleticgroups (Wiley et al., 1991) but there are no guidelines on taxonomic ranking(Seifert et al., 1995).
As far as possible, it is proposed that existing species names be retainedand any new names proposed will be at the variety level. Therefore the nameM. album is retained and is now defined as applying only to isolates whichfit into clade 1. At present we consider clades 2–6 to contain varieties of M.flavoviride while clades 7–10 contain varieties of M. anisopliae. Whereappropriate, new varietal names have been proposed for some of these clades(Driver et al., 1998). However for some clades, we have too few isolates andtherefore too little data, on genetic diversity within the clade, to justify avarietal name at this time. It is likely that as our knowledge of these cladesincreases, especially with regard to ecological factors such as host special-ization, the taxonomy will become clearer, leading to some clades beingelevated to new species.
8.6 Descriptions of the Clades
Most taxonomic decisions are implicitly based on the biological speciesconcept of actually or potentially interbreeding populations that are repro-ductively isolated, a view that has been widely accepted by mycologists(Seifert et al., 1995). It has been suggested that anamorphic species not beconsidered as species at all, and that the term be reserved for organisms thatundergo meiosis (Perkins, 1991). In practice, morphologically definedspecies infer the potential to interbreed (Volger and Desalle, 1994). Such
172 F. Driver and R.J. Milner
biological species concepts of actual or inferred breeding populations todelimit taxa are not directly applicable to Metarhizium. The molecular datagive qualified support for the existing morphological-based taxonomy, if weaccept that species represent monophyletic groups. The combination ofmolecular, biochemical and morphological markers make a case for phyloge-netically defined species or ‘evolutionary significant’ groups (Volger andDesalle, 1994).
Clade 1 – Metarhizium albumThe only isolates identified as belonging to this clade were isolates ARSEF1941 and ARSEF 1942, both of which were described by Rombach et al.(1987) from infected leafhoppers in the Philippines. Besides the apparent hostspecificity of this clade, other characters are the small ovoid to ellipsoidconidia measuring 4–6 × 1.5–2.5 µm, the growth of a bulging mass of hyphalbodies rather than mycelium prior to sporulation and the lack of laterallyadhering conidia forming prismatic columns. The pale brown colour of thespores is also characteristic although this is of doubtful taxonomic sig-nificance.
Clade 2 – Metarhizium flavovirideThis is an unusual clade containing just two rather diverse isolates. The first,FI-1173 (ARSEF 2948) on an homopteran from Brazil was identified as M.flavoviride var. minus by Humber (1992), however all the other isolates ofthis variety from leafhoppers and related insects in the Philippines andSolomon Islands (Rombach et al., 1986) are clustered in clade 5.Morphologically these isolates are all very similar and come from similarhosts, thus it is surprising that one of the isolates should be genetically sodistinct. Even more surprising is that FI-152, isolated from a scarab inAustralia, and morphologically resembling M. anisopliae var. anisopliae,should also cluster into this clade. FI-152 and FI-1173 show RAPD–PCRpatterns which clearly distinguish them from other isolates of M. flavoviridevar. minus. More work is needed to clarify this clade and to determine ifthere are ecological and/or morphological characteristics which are sharedby these isolates, and to collect other isolates from nature which might fitinto this clade.
Clade 3 – Metarhizium flavovirideThis clade contains quite a large number of isolates, many from NewZealand, which have been recognized as distinct by several workers (Riba etal., 1990; Curran et al., 1994; Glare et al., 1997). Our study has shown thatisolates from this clade also occur in Australia (described as Strain 2 by Yipet al., 1992) and that they have been included as part of a group of low-temperature isolates called M. anisopliae var. frigidum by Rath et al. (1995).These authors recognized that some isolates were as distinct from M.anisopliae var. anisopliae as they were from M. flavoviride and that they may
Taxonomy of Entomopathogenic Fungi 173
represent a new species. Morphologically, isolates from this clade havecylindrical conidia and correspond to the short-spored form of M. anisopliaedescribed from New Zealand (Glare et al., 1997). All isolates in this cladegrow well at low temperatures (10°C and below), infect soil insects or havebeen isolated from the soil and attack soil insects (both scarab larvae andlepidopterous caterpillars).
Clade 4 – Metarhizium flavovirideThis is another small clade containing just two isolates with identicalcollection data except the date. Both isolates were from infected root aphidsin Norfolk, UK (Foster, 1975), and they have cylindrical green conidiamorphologically resembling M. anisopliae var. anisopliae. However theygrow well at low temperatures and cluster with M. flavoviride ; consequently,we regard that as the correct specific name. More isolates representing thisclade are needed before it can be formally given a varietal name and it ispossible that a search for Metarhizium infection on other root aphids mayreveal additional isolates.
Clade 5 – Metarhizium flavoviride var. minusIn our study only two isolates FI-403 and FI-1172 (ARSEF 2037 and ARSEF1764), both morphologically identified as Metarhizium flavoviride var.minus and obtained from infected leafhoppers, were included within thisclade. One of these, FI-403 (ARSEF 2037) was identified by Rombach et al.(1985) as the type-isolate of this variety. These isolates fit the descriptiongiven by Rombach and were collected in the Philippines and the SolomonIslands suggesting a narrow host range and geographical distribution.
Clade 6 – Metarhizium flavoviride var. flavovirideThis clade contains FI-405 (ARSEF 2025) which was derived from thematerial used by Gams and Roszypal (1973) for their original description ofM. flavoviride. It also contains other isolates described by Rombach et al.(1986) as M. flavoviride var. flavoviride. These isolates have large, somewhatswollen conidia which form a pale green conidial mat in culture and comefrom the soil or from soil-inhabiting beetles. All these isolates grow well atlow temperatures. Rath et al. (1995) included FI-38 in M. anisopliae var.frigidum and this isolate, along with a number of other soil-derived isolates,has an ITS sequence similar to FI-405 (ARSEF 2025), unequivocallyidentifying these isolates as M. flavoviride var. flavoviride. RAPD–PCRbanding patterns show a high degree of homogeneity and conservation withthe northern European isolates suggesting that this clade probably has a verywide geographical distribution. Rath et al. (1995) provide a nearest-neighbour dendogram based on their carbohydrate data which showed thatFI-38 (DAT F001) clustered nearer to M. flavoviride than to M. anisopliae.Our data support this finding and it is therefore proposed that the correctidentity of this isolate is M. flavoviride var. flavoviride.
174 F. Driver and R.J. Milner
Clade 7 – Metarhizium anisopliaeThis clade contains all of the acridoid isolates described as ‘M. flavoviridegroup 3’ (Bridge et al., 1997). Our data supports and extends that of Bridgeet al. (1993), Cobb and Clarkson (1993), Bidochka et al. (1993) and Bridgeet al. (1997), in showing that these isolates are genetically quite uniform andare quite distinct from the type material of both accepted varieties of M.flavoviride. Bootstrapping and T-PTP tests give strong support for thephylogenetic signal that unites these isolates to the major evolutionary linethat gives rise to M. anisopliae rather than M. flavoviride. Therefore, wepropose that the correct identity is as a new variety of M. anisopliae whichwill be described elsewhere (F. Driver, unpublished work).
The isolates in this clade have all been isolated from acridid grass-hoppers. Interestingly other orthopteran hosts such as crickets are notsusceptible and in nature are attacked (exclusively) by isolates from clade 9.In our experience, grasshoppers are more often infected in nature by isolatesfrom clade 9 but these isolates are less virulent than the rarer clade 7 isolates(Bateman et al., 1996).
Most isolates from clade 7 produce small ovoid conidia which wouldidentify them as M. flavoviride var. minus. For example, FI-1216 (ARSEF2023) from the Galapagos Islands described under that name by Rombach etal. (1985). Other isolates, though, have larger spores which can be almostcylindrical (FI-985, ARSEF 324). All isolates share some unusual character-istics such as the ability to sporulate internally and to grow well attemperatures up to 40°C (Welling et al., 1994).
Clade 8 – Metarhizium anisopliaeThis is another clade with only a small number of known isolates. All knownisolates have cylindrical spores and produce a profuse layer of green conidiain culture, and have been isolated from scarab larvae in Queensland,Australia. Using allozyme data St Leger et al. (1992b) were able to showconsiderable inter-isolate variation and the existence of cryptic ‘species’ or,probably more correctly, cryptic varieties within M. anisopliae. This clusterof isolates has previously been described as B-type isolates of M. anisopliae(Curran et al., 1994), and probably correspond to those of pathogenicitygroup 1 for Lepidiota spp; or RAPD group A, described by Fegan et al.(1993). More needs to be known about this clade; however, the sequence dataclearly separates it from clades 7 and 9.
Clade 9 – Metarhizium anisopliae var. anisopliaeThe type material of Metarhizium anisopliae var. anisopliae as describedby Tulloch (1976) is FI-1029 (IMI168777ii) and this isolate therefore formsthe basis for this clade. This clade includes the vast majority of isolatesfound in nature and is genetically highly diverse. St Leger et al. (1992b)demonstrated the existence of clonal population structures in M. anisopliae.Distinct groups can be identified within the clade: for example, a number
Taxonomy of Entomopathogenic Fungi 175
of isolates from the black field cricket, Teleogryllus commodus, in Australia,share identical ITS sequence data and have very similar RAPD patterns(Milner et al., 1996). Isolates generally have cylindrical conidia, 5–7 µmlong which form green conidia in columns of chains. They normally growpoorly outside the range 15–32°C, although recently two cold temperatureactive isolates have been found in soil samples taken at MacQuarie Island(Roddam and Rath, 1997), confirming that cold activity is a homoplasiouscharacter.
Clade 10 – Metarhizium anisopliae var. majusA typical isolate from this clade is FI-401 (ARSEF 1946) which conforms tothe description by Tulloch (1976). Isolates are readily identified on the basisof the very large conidia, usually over 10 µm long, and rapidly growingcolonies producing dark green conidia; they are most frequently foundattacking dynastine beetles in tropical countries. Our results support thoseof other workers (St Leger et al., 1992b; Leal et al., 1994b) showing thatgenetically this clade differs less from M. anisopliae var. anisopliae isolates inclade 9 than do other isolates such as those in clade 8 (B-type), which are alsocurrently described as var. anisopliae.
8.7 Discussion
Morphological characters are generally complex and may involve theexpression of many genes. Traditional fungal systematics assesses thephenotype for reliable characters that should result in the recognition ofhomologous features with alternate character states that may be evaluatedcladistically (Brower and Desalle, 1994; Seifert et al., 1995). The skill of theresearcher resides in the ability to ‘assign characters successfully to theappropriate level of analysis’ (Brower and Desalle, 1994). The reproducibilityand impartiality of sequence-based systematics has made an importantcontribution to fungal taxonomy. Although species concepts based solely ona single gene region have been considered insufficient and too trivial to berepresentative of all characters (Seifert et al., 1995), gene regions such as theITS are being heavily relied upon to discriminate and define new species insuch genera as Ascosphera (Anderson and Gibson, 1997), and the edibleshiitake mushroom Lentinula (Hibbert et al., 1995), as well as phytopatho-genic fungi such as Colletotrichum (Sherriff et al., 1994). 18S ribosomal DNAsequence data have been used to estimate ascomycete relationships, andphylogenetic trees from such data sets are highly resolved, and generallyconsistent with morphological evolutionary events like forcible sporedischarge (Berbee and Taylor, 1995). Lutzoni and Vilgalys (1995) integratedmolecular and morphological data sets to estimate fungal phylogenies inlichenized and non-lichenized Omphalina species. Homogeneity testing ofthe 28S large subunit ribosomal DNA sequences and the morphological
176 F. Driver and R.J. Milner
characters showed that the two data sets were sampling the same phyloge-netic history and could be combined.
Such studies go to the heart of the matter, that is, the conflict of gene treesand the evolution of a segment of DNA and the ‘true’ course of evolution ofthe organism. Brower and Desalle (1994) consider such concerns about genetree versus species tree problems to be overstated, and except for recentlydiverged or hybridizing taxa, ancestral polymorphism and lineage sortingcannot result in strong support for an incongruent topology. Congruencebetween cladograms derived from different gene regions or other availablecharacters into a total evidence approach such as described above providesstrong statistical support and circumvents the problem. The gene region ofchoice is critically important in maximizing the phylogenetic signal-to-noiseratio. Reviews by Simon et al. (1994) on the utility of mitochondrial genesequences, and Brower and DeSalle (1994) on using nuclear gene regions,raise important issues about the taxonomic rank at which particular genes areuseful.
8.7.1 How can the taxonomy be made more user friendly?
A major problem with a taxonomic scheme which is dependent to a largeextent on molecular data is that it is difficult to provide easily applieddiagnostic characters for identification. While some clades will be easy toidentify others, such as clade 2, are impossible at the present time except bymolecular methods. Published molecular methods for species recognitionsuch as the probes devised by Bidochka et al. (1994) and Leal et al. (1994b)cannot be applied since they did not include all available type material,consequently there is uncertainty about the true identity of the isolates whichthey used as, for example, M. flavoviride var. flavoviride. Only the Gams andRoszypal (1973) strain, ARSEF 2025, can be regarded as M. flavoviride var.flavoviride sensu stricto. Consequently these methods need to be reassessedin the light of the results of our study.
While our work suggests that the most rigorous way to identify cladesis by sequence determination of the ITS regions, it has also been shown thatthese correlate strongly with RAPD patterns, in the same manner that ITS-RFLP patterns have been shown to correlate with RAPD patterns inBeauveria (Maurer et al., 1997). It is therefore suggested that clades beidentified by using either RFLP analysis of the ITS region, or RAPD–PCRpatterns established by primers such as OP-H01 or OP-A03 which give riseto fewer polymorphic fragments against a set of ‘standard’ isolates. It issuggested that the first isolate listed under each clade in Table 8.1 be used asthe standards or type material. These are mostly ARSEF isolates and it ishoped that the other isolates will be deposited prior to publication of thetaxonomic revision (Driver et al., 1998).
Taxonomy of Entomopathogenic Fungi 177
8.8 Conclusions and Future Work
Molecular methods involving PCR techniques are now accepted as being akey element in research on entomogenous fungi and some information, assummarized in this chapter, is available about most groups. However, it isstill an infant technology which means that there are still substantial gaps inour knowledge: for example, clarification of strain variation in the Entomo-phthora muscae complex, a common worldwide pathogen of flies, is neededand may shed light on differences between countries in the ecology of thesepathogens. In addition, there are new techniques, and improvements toexisting techniques, which have yet to be applied to entomogenous fungi.Taxonomic problems, such as those highlighted in the case study onMetarhizium spp., could be further resolved by an analysis of mitochondrialgenes (as initiated by Junior and Martinez-Rossi, 1995) or nuclear proteincoding genes such as the Pr1 protease gene used by Leal et al. (1996) for strainidentification. Other techniques which have either not been applied or onlyused to a limited extent include random amplified microsatellites (RAMS;Hantula and Muller, 1997) and amplified fragment length polymorphisms(AFLP; Majer et al., 1996). The presence of double-stranded RNA andisometric virus-like particles in M. anisopliae was first announced by Leal etal. (1994a) and has recently been confirmed by Bogo et al. (1996). Similarviruses may be present also in Beauveria bassiana (Osborne and Rhodes,1994). However, their possible significance in terms of virulence is unknown.In fact, very little is known of virulence genes in entomogenous fungi,though the Pr1 gene is involved in M. anisopliae (St Leger et al., 1996) andprobably similar genes occur in some other entomogenous fungi (Leal et al.,1996). With the increased use of these fungi in pest control there will be moreattention given to virulence factors and the development of geneticallyimproved, hypervirulent, isolates as reported recently by St Leger et al.(1995).
Acknowledgements
The authors would like to thank the numerous colleagues who suppliedisolates of Metarhizium spp. for their taxonomic study and especially DrRichard Humber (USDA, Ithaca, New York), Dr Paul Bridge (CABIBIOSCIENCE UK Centre, Egham, UK), Dr Tigano-Milani (EMBRAPA,Brazil), Dr Andrew Rath (BioCare Pty Ltd, Sydney, Australia), Dr DaveHoldom (CTPM, Brisbane, Australia), and Dr Travis Glare (AgResearch,Christchurch, New Zealand). Our work on Metarhizium has been greatlyassisted by discussions with many colleagues including Dr Chris Prior(Royal Horticultural Society, London, UK), Drs Paul Bridge and JohnCurran (CSIRO, Canberra, Australia), Dr Travis Glare (AgResearch,Christchurch, New Zealand) and Dr Gisbert Zimmermann (Institute for
178 F. Driver and R.J. Milner
Biological Control, Darmstadt, Germany). Finally Dr John Truemann hasbeen invaluable in generously devoting his time and skill to analysing oursequence data on Metarhizium spp. The research on Metarhizium has beenfunded, in part, by the Rural Industries Research and DevelopmentCorporation (RIRDC).
References
Al Aidroos, K. (1980) Demonstration of parasexual cycle in the entomopathogenicfungus Metarhizium anisopliae. Canadian Journal of Genetics and Cytology 22,309–314.
Anderson, D.L. and Gibson, N. (1997) New species and isolates of spore-cyst fungi(Plectomycetes: Ascosphaerales) from Australia. Australian Systematic Botany(in press).
Anderson, D.L., Gibbs, A.J. and Gibson, N.L. (1997) Identification and phylogenyof spore-cyst fungi (Plectomycetes: Ascospaerales) using ribosomal DNAsequences. Mycological Research (in press).
Andreadis, T.G. and Weseloh, R.M. (1990) Discovery of Entomophaga maimaga inNorth American gypsy moth, Lymantria dispar. Proceedings of the NationalAcademy of Sciences, USA 87, 2461–2465.
Bailey, A.M., Kershaw, M.J., Hunt, B.A., Paterson, I.C., Charnely, A.K., Reynolds,S.E. and Clarkson, J.M. (1996) Cloning and sequence analysis of an intron-containing domain from a peptide synthetase-encloding gene of the entomo-pathogenic fungus Metarhizium anisopliae. Gene 173, 195–197.
Bateman, R., Carey, M., Batt, D., Prior, C., Abraham, Y., Moore, D., Jenkins, N. andFenlon, J. (1996) Screening for virulent isolates of entomopathogenic fungiagainst desert locust, Schistocerca gregaria (Forskal). Biocontrol Science andTechnology 6, 549–560.
Berbee, M.L. and Taylor, J.W. (1992) Two Ascomycete classes based on fruiting bodycharacters and ribosomal DNA sequence. Molecular Biology and Evolution 9,278–284.
Berbee, M.L. and Taylor, J.W. (1995) From 18S ribosomal sequence data to evolutionof morphology among the fungi. Canadian Journal of Botany 73 (suppl. 1),S677–S683.
Bidochka, M.J., McDonald, M.A., St Leger, R.A. and Roberts, D.W. (1993) Differ-entiation of species and strains of entomopathogenic fungi by random amplifiedpolymorphic DNA (RAPD). Current Genetics 21, 107–113.
Bissett, J. and Widden, P. (1988) A new species of Beauveria isolated from Scottishmoorland soil. Canadian Journal of Botany 66, 361–362.
Bissett, J., Duke, G. and Goettel, M. (1996) Ascosphaera acerosa sp. nov. isolated fromalfalfa leafcutting bee, with a key to species of Ascosphaera. Mycologia 88,797–803.
Bogo, M.R., Queiroz, M.V., Silva, D.M., Gimenez, M.P., Azevedo, J.L. and Schrank,A. (1996) Double-stranded RNA and isometric virus-like particles in theentomopathogenic fungus Metarhizium anisopliae. Mycological Reseach 100,1468–1472.
Bridge, P.D., Abraham, Y.J., Cornish, M.C., Prior, C. and Moore, D. (1990) The
Taxonomy of Entomopathogenic Fungi 179
chemotaxonomy of Beauveria bassiana (Deuteromycetina: Hyphomycetes)isolates from coffee berry borer Hypothenemus hampei (Coleoptera: Scolytidae).Mycopathologia 111, 85–90.
Bridge, P.D., Williams, M.A.J., Prior, C. and Patterson, R.R.M. (1993) Morphological,biochemical and molecular characteristics of Metarhizium anisopliae and M.flavoviride. Journal of General Microbiology 139, 1163–1169.
Bridge, P.D., Prior, C., Sogbohan, J., Lomer, C.M., Carey, M. and Buddie, A. (1997)Molecular characterization of isolates of Metarhizium from locusts and grass-hoppers. Biodiversity and Conservation 5, 177–189.
Brower, A.V.Z. and DeSalle, R. (1994) Practical and theoretical considerations for thechoice of a DNA sequence region in insect systematics, with a short review ofpublished studies using nuclear gene regions. Annals of the Entomological Societyof America 87 (6), 702–716.
Carruthers, R.I. and Onsager, J.A. (1993) Perspectives on the use of exotic naturalenemies for biological control of pest grasshoppers (Orthoptera: Acrididae).Environmental Entomology 22, 885–903.
Cobb, B.D. and Clarkson, J.M. (1993) Detection of molecular variation in the insectpathogenic fungus Metarhizium using RAPD–PCR. FEMS Microbiology Letters112, 319–324.
Curran, J., Driver, F., Ballard, J.W.O. and Milner, R.J. (1994) Phylogeny ofMetarhizium : sequence analysis of the internally transcribed and 5.8S region ofthe ribosomal DNA repeat. Mycological Research 98, 547–552.
Driver, F., Milner, R.J. and Trueman, J.W.H. (1998) A taxonomic revision ofMetarhizium based on a phylogenetic analysis of ribosomal DNA sequence data.Mycological Research (in press).
Faith, D.P. (1991) Cladistic permutation tests for monophyly and non-monophyly.Systematic Zoology 40, 366–375.
Fegan, M., Manners, J.M., MacLean, D.J., Irwin, J.A.G., Samuels, K.D.Z., Holdom,D.G. and Li, D.P. (1993) Random amplified polymorphic DNA markers reveala high degree of genetic diversity in the entomopathogenic fungus Metarhiziumanisopliae var. anisopliae. Journal of General Microbiology 139, 2075–2081.
Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using bootstrap.Evolution 39, 783–791.
Foster, W.A. (1975) Life history and population biology of an intertidal aphid,Pemphigus trehernei Foster. Transactions of the Royal Entomological Society 127,192–207.
Fungaro, F.H.P., Vieira, M.L.C., Pizzirani-Kleiner, A.A. and Azevedo, de J.L. (1996)Diversity among soil and insect isolates of Metarhizium anisopliae var. anisopliaedetected by RAPD. Letters in Applied Microbiology 22, 389–392.
Gams, W. (1971) Cephalosporium-artige Schimmelpilze (Hyphomycetes). G. Fisher,Stuttgart.
Gams, W. and Roszypal, J. (1973) Metarhizium flavoviride n. sp. isolated from insectsand the soil. Acta Botanica Neerlandica 22, 518–521.
Glare, T.R. and Inwood, A.J. (1997) Morphological and genetic characteristics ofBeauveria spp. from New Zealand. Mycological Research (in press).
Glare, T.R. and Milner, R.J. (1991) Ecology of entomopathogenic fungi. In: Arora,D.K., Ajello, L. and Mukerji, K.G. (eds) Handbook of Applied Mycology, Vol. 2,Humans, Animals and Insects. Marcel Dekker, New York, pp. 547–612.
Glare, T.R., Milner, R.J., Chilvers, G.A., Mahon, R.J. and Brown, V.W. (1987)
180 F. Driver and R.J. Milner
Taxonomic implications of intraspecific variation amongst isolates of the aphidpathogenic fungi, Zoophthora radicans Brefeld and Z. phalloides Batko (Zygo-mycetes: Entomophthoraceae). Australian Journal of Botany 37, 49–67.
Glare, T.R., Milner, R.J. and Beaton, C.D. (1996) Variation in Metarhizium, a genusof fungal pathogens attacking Orthoptera: is phialide morphology a usefultaxonomic criterion? Journal of Orthopteran Research 5, 19–27.
Glare, T.R., Inwood, A., van der Wielen, P. and Nelson, T. (1997) Indentification ofnovel strains of Beauveria and Metarhizium in New Zealand. In: Jackson, T.A.and Glare, T.R. (eds) Proceedings 3rd International Workshop on MicrobialControl of Soil Dwelling Pests. AgResearch, Lincoln, pp. 39–49.
Guo, H.-L., Ye, B.-L., Yue, Y.-Y., Chen, Q.-T. and Fu, C.-S. (1986) Three new speciesof Metarhizium. Acta Mycologica Sinica 5, 177–184 (in Chinese).
Hajek, A.E., Humber, R.A., Elkinton, J.S., May, B., Walsh, S.R.A. and Silver, J.C.(1990) Allozyme and restriction fragment length polymorphisms confirmEntomophaga maimaga responsible for 1989 epizootics in North Americangypsy moth populations. Proceedings of the National Academy of Sciences USA87, 6979–6982.
Hajek, A.E., Hodge, K.T., Liebherr, J.K., Day, W.H. and Vandenberg, J.D. (1996a)Use of RAPD analysis to trace the origin of the weevil pathogen Zoophthoraphytonomi in North America. Mycological Research 100, 349–355.
Hajek, A.E., Walsh, S.R.A., Strong, D.R. and Silver, J.C. (1996b) A disjunctCalifornian strain of Entomophaga aulicae infecting Orgyia vetusta. Journal ofInvertebrate Pathology 68, 260–268.
Hantula, J. and Muller, M.M. (1997) Variation within Gremmeniella abietina inFinland and other countries as determined by Random Amplified Microsatellites(RAMS). Mycological Research 101(2), 169–175.
Hawksworth, D.L. (1991) The fungal dimension of biodiversity: magnitude, sig-nificance, and conservation. Mycological Research 95, 641–655.
Hawksworth, D.L., Kirk, P.M., Sutton, B.C. and Pegler, D.N. (1995) Ainsworth andBisby’s Dictionary of the Fungi, 8th edn. CAB International, Wallingford.
Hegedus, D.D. and Khachatourians, G.G. (1993) Construction of cloned DNAprobes for specific detection of the entomopathogenic fungus Beauveriabassiana in grasshoppers. Journal of Invertebrate Pathology 62, 233–240.
Hegedus, D.D. and Khachatourians, G.G. (1995) The impact of biotechnology onhyphomycetous fungi as insect control agents. Biotechnology Advances 13,455–490.
Hegedus, D.D. and Khatchatourians, G.G. (1996) Identification and differentiationof the entomopathogenic fungus Beauveria bassiana using polymerase chainreaction and single-strand conformation polymorphism analysis. Journal ofInvertebrate Pathology 67, 289–299.
Hibbert, D.S., Nakai, Y.F., Tsuneda, A. and Donoghue, M.J. (1995) Phylogenicdiversity in shiitake inferred from nuclear DNA sequences. Mycologia 87,618–638.
Hodge, K.T., Sawyer, A.J. and Humber, R.A. (1995) RAPD–PCR for identificationof Zoophthora radicans isolates in biological control of the potato leafhopper.Journal of Invertebrate Pathology 65, 1–9.
Humber, R.A. (1992) Collection of Entomopathogenic Fungal Cultures: Catalogue ofStrains, 1992. US Department of Agriculture, Agriculture Research Service,ARS-110.
Taxonomy of Entomopathogenic Fungi 181
Jun, Y., Bridge, P.D. and Evans, H.C. (1991) An integrated approach to the taxonomyof the genus Verticillium. Journal of General Microbiology 137, 1437–1444.
Junior, H.A.P. and Martinez-Rossi, N.M. (1995) Restriction endonuclease analysis ofmitochondrial DNA of Metarhizium anisopliae strains. Brazilian Journal ofGenetics 18, 369–372.
Khachatourians, G.G. (1996) Biochemistry and molecular biology of entomopatho-genic fungi. In: Howard, D.H. and Miller, J.D. (eds) The Mycota, Vol. 6, Animaland Human Relationships. Springer-Verlag, Berlin, pp. 3331–3363.
Kosir, J.M., MacPherson, J.M. and Khachatourians, G.G. (1991) Genomic analysis ofa virulent and less virulent strain of the entomopathogenic fungus, Beauveriabassiana, using restriction fragment length polymorphisms. Canadian Journal ofMicrobiology 37, 534–541.
Lawrence, J. and Milner, R.J. (1996) Associations between arthropods and fungi. In:Fungi of Australia, Vol. 1B, Introduction – Fungi in the Environment. AustralianBiological Resources Study, Canberra, pp. 137–202.
Leal, S.C.M., Bertioli, D.J., Butt, T.M. and Peberdy, J.F. (1994a) Characterisation ofisolates of the entomopathogenic fungus Metarhizium anisopliae by RAPD–PCR. Mycological Research 98, 1077–1081.
Leal, S.C.M., Bertioli, D.J., Ball, B.V. and Butt, T.M. (1994b) Presence of double-stranded RNAs and virus-like particles in the entomopathogenic fungusMetarhizium anisopliae. Biocontrol Science and Technology 4, 89–94.
Leal, S.A.C.M., Bertioli, D.J., Butt, T.M., Cardner, J.H., Burrows, P.R. and Peberdy,J.F. (1997) Amplification and restriction endonuclease digestion of the Pr1 genefor the detection and characterization of Metarhizium strains. MycologicalResearch 101, 257–265.
Liang, Z.-Q., Liu, A.-Y. and Liu, J.-L. (1991) A new species of the genus Cordycepsand its Metarhizium anamorph. Acta Sinica 10, 257–262 (in Chinese).
Lu, R., Goerzen, D.W. and Rank, G. (1996) Use of RAPD analysis for in situidentification of Ascosphaera aggregata and Ascosphaera larvis in larval cadaversof the alfalfa leafcutting bee, Megachile rotundata. Journal of InvertebratePathology 68, 78–83.
Lutzoni, F. and Vilgalys, R. (1995) Integration of morphological and molecular datasets in estimating fungal phylogenies. Canadian Journal of Botany 73 (suppl. 1),S649–S659.
Majer, D., Mithen, R., Lewis, B.G., Vos, P. and Oliver, R.P. (1996) The use of AFLPfingerprinting for the detection of genetic variation in fungi. MycologicalResearch 100, 1107–1111.
Maurer, P., Couteaudier, Y., Girard, P.A., Bridge, P.D. and Riba, G. (1997) Geneticdiversity of Beauveria bassiana and relatedness to insect host range. MycologicalResearch 101, 159–164.
McCammon, S.A. and Rath, A.C. (1994) Separation of Metarhizium anisopliae strainsby temperature dependent germination rates. Mycological Research 98,1253–1257.
Milner, R.J. (1985) Field tests of a strain of Entomophaga grylli from the USA forbiocontrol of the Australian wingless grasshopper, Phaulacridium vittatum. In:Proceedings of the 4th Australasian Conference on Grassland InvertebratePathology, Canterbury, New Zealand, 13–15 May 1985, pp. 255–261.
Milner, R.J. and Jenkins, K. (1996) Metarhizium : a versatile mycoinsecticide of thefuture. Professional Pest Manager 1, 32–36.
182 F. Driver and R.J. Milner
Milner, R.J. and Mahon, R.J. (1985) Strain variation in Zoophthora radicans, apathogen on a variety of insect hosts in Australia. Journal of the AustralianEntomological Society 24, 195–198.
Milner, R.J., Soper, R.S. and Lutton, G.G. (1982) Field release of an Israeli strain ofEntomophthora sphaerosperma Fresenius for biological control of Therioaphistrifolii f. maculata Monell. Journal of Invertebrate Pathology 21, 113–118.
Milner, R.J., Mahon, R.J. and Brown, W.V. (1983) A taxonomic study of the Erynianeoaphidis Remaudiere & Keller (Zygomycetes: Entomophthoraceae) group ofpathogenic fungi, together with a description of the new species, Eryniakondoiensis. Australian Journal of Botany 31, 173–188.
Milner, R.J., Driver, F., Curran, J., Glare, T.R., Prior, C., Bridge, P.D. andZimmermann, G. (1994) Recent problems with the taxonomy of the genusMetarhizium, and a possible solution. Proceedings of the VIth InternationalColloquium of Invertebrate Pathology and Microbial Control, Montpellier, 28August–2 September, 1994, pp. 109–110.
Milner, R.J., Miller, L., Lutton, G.G. and Driver, F. (1996) Biological control of theblack field cricket, Teleogryllus commodus Walker (Orthoptera: Gryllidae), usingthe fungal pathogen Metarhizium anisopliae (Metsch.) Sorokin (Deuteromy-cotina: Hyphomycetes). Plant Protection Quarterly 11, 9–13.
Mor, H., Gindin, G., Ben Ze’ev, I.S., Raccah, B., Geschtovt, N.U. and Ajtkhozhina,N. (1996) Diversity among isolates of Verticillium lecanii as expressed by DNApolymorphism and virulence towards Bemisia tabaci. Phytoparastica 24,111–118.
Murrin, F. (1996) Fungi and insects. In: Howard, D.H. and Miller J.D. (eds) TheMycota, Vol. 6, Human and Animal Relationships. Springer-Verlag, Berlin,pp. 365–388.
Nagahama, T., Sato, H., Shimazu, M. and Sugiyama, J. (1995) Phylogenetic divergenceof the entomophthoralean fungi: Evidence from nuclear 18S ribosomal RNAgene sequences. Mycologia 87, 203–209.
Nazir, R.N., Hu, X., Schidt, J., Culham, D. and Robb, J. (1991) Potential use of PCR-amplified ribosomal intergenic sequences in the detection and differentiation ofVerticillium wilt pathogens. Physiological and Molecular Plant Pathology 39,1–11.
Nei, M. and Li, W.H. (1979) Mathematical model for studying genetic variation interms of restriction endonucleases. Proceedings of the National Academy ofSciences USA 76, 38–45.
Neuveglise, C. and Brygoo, Y. (1994) Identification of group-I introns in the 28SrDNA of the entomopathogenic fungus Beauveria brongniartii isolated frominsects. Current Genetics 27, 38–45.
Neuveglise, C., Brygoo, Y., Vercambre, B. and Riba, G. (1994) Comparative analysisof molecular and biological characteristics of strains of Beauveria brongniartiiisolated from insects. Mycological Research 98, 322–328.
Neuveglise, C., Brygoo, Y. and Riba, G. (1997) 28S rDNA group I introns: a powerfultool for identification of Beauveria brongniartii strains. Molecular Ecology 6,373–381.
Nishida, H. and Sugiyama, J. (1995) A common group I intron between a plantparasitic fungus and its host. Molecular Biology and Evolution 12, 883–886.
Osborne, D. and Rhodes, D. (1994) Presence of double stranded RNA elementsin Beauveria bassiana. Proceedings of the Vth International Colloquium of
Taxonomy of Entomopathogenic Fungi 183
Invertebrate Pathology and Microbial Control, Montpellier, 28 August–2September 1994, p. 113.
Perkins, D.D. (1991) In: Bennet, J.W. and Lasure, L.L. (eds) More Gene Manipula-tions in Fungi. Academic Press, New York, pp. 3–26.
Pfeifer, T.A., Hegedus, D.D. and Khachatourians, G.G. (1993) The mitochondrialgenome of the entomopathogenic fungus Beauveria bassiana: analysis of theribosomal RNA region. Canadian Journal of Microbiology 39, 25–31.
Pipe, N.D., Chandler, D., Bainbridge, B.W. and Heale, J.B. (1995) Restrictionfragment length polymorphisms in the ribosomal RNA gene complex of isolatesof the entomopathogenic fungus Metarhizium anisopliae. Mycological Research99, 485–491.
Rakotonirainy, M.S., Dutertre, M., Brygoo, Y. and Riba, G. (1991) rRNA sequencecomparison of Beauveria bassiana, Tolypocladium cylindrosporum and Tolypo-cladium extinguens. Journal of Invertebrate Pathology 57, 17–22.
Rakotonirainy, M.S., Dutertre, M. Brygoo, Y. and Riba, G. (1994) Phylogenicrelationships within the genus Metarhizium based on 28S rRNA sequences andisozyme comparisons. Mycological Research 98, 225–230.
Rath, A.C., Carr, C.J. and Graham, B.R. (1995) Characterisation of Metarhiziumanisopliae strains by carbohydrate utilization (AP150CH). Journal of Inverte-brate Pathology 65, 152–161.
Riba, G., Rakotonirainy, M. and Brygoo, Y. (1990) Phylogenetic relationships withinthe genus Metarhizium. In: Pinnock, D.E. (ed.) Proceedings and Abstracts of theVth International Colloquium on Invertebrate Pathology and Microbial Con-trol. Society for Invertebrate Pathology, Adelaide, pp. 125–131.
Riba, G., Couteaudier, Y., Maurer, P. and Neuveglise, C. (1994) Molecular methodsoffer new challenge for fungal bioinsecticides. In: Proceedings of the 27th AnnualMeeting of the Society for Invertebrate Pathology. Montpellier, 28 August–2September, pp. 16–22.
Roberts, D.M., Bainbridge, B.W., Evans, H.C. and Heale, J.B. (1995) Genomeanalysis in isolates of Verticillium, V. albo-atrum, V. dahliae and V. lecanii.Phytoparasitica 23, 40.
Roddam, L.F. and Rath, A.C. (1997) Isolation and characterization of Metarhiziumanisopliae and Beauveria bassiana from Subantarctic Macquarie Island. Journalof Invertebrate Pathology 69, 285–288.
Rohel, E., Couteaudier, Y., Paperiok, B., Cavelier, N. and Dedryver, C.A. (1997)Ribosomal internal transcribed spacer size variation correlated with RAPD–PCR pattern polymorphisms in the entomopathogenic fungus Erynia neoaphidisand some closely related species. Mycological Research 101, 573–579.
Rombach, M.C., Humber, R.A. and Roberts, D.W. (1986) Metarhizium flavoviridevar. minus var. nov., a pathogen of plant- and leafhoppers on rice in Philippinesand Solomon Islands. Mycotaxon 27, 87–92.
Rombach, M.C., Humber, R.A. and Evans, H.C. (1987) Metarhizium album a fungalpathogen of leaf- and planthoppers of rice. Transactions of the British Myco-logical Society 37, 37–45.
Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis,K.B. and Erlich, H.A. (1988) Primer-directed enzymatic amplification of DNAwith a thermostable DNA polymerase. Science 239, 487–491.
Saitou, N. and Nei, M. (1987) The neighbor-joining method: a new method forreconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406–425.
184 F. Driver and R.J. Milner
Samuels, K.D.Z., Heale, J.B. and Llewellyn, M. (1989) Characteristics relating to thepathogenicity of Metarhizium anisopliae towards Niliparvata lugens. Journal ofInvertebrate Pathology 53, 25–31.
Seifert, K.A., Wingfield, B.D. and Wingfield, M.J. (1995) A critique of DNA sequenceanalysis in the taxonomy of filamentous Ascomycetes and ascomycetousanamorphs. Canadian Journal of Botany 73 (suppl. 1), S760–S767.
Sherriff, C., Whelan, M.J., Arnold, G.M., Lafay, J.F., Brygoo, Y. and Bailey, J.A.(1994) Ribosomal DNA sequence analysis reveals new species groupings in thegenus Colletotrichum. Experimental Mycology 18, 121–138.
Shih, H.L., Lin, C.P., Liou, R.F. and Tzean, S.S. (1995) Complete nucleotide sequenceof Beauveria bassiana 5.8S RNA coding gene and flanking internal transcribedspacers. DNA Sequence – The Journal of Sequencing and Mapping 5, 381–383.
Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. and Flook, P. (1994)Evolution weighting and phylogenetic utility of mitochondrial gene sequencesand a compilation of conserved polymerase chain reactions primers. Annals ofthe Entomological Society of America 87, 651–701.
St Leger, R.J., Allee, L.L., May, B., Staples, R.C. and Roberts, D.W. (1992a)Worldwide distribution of genetic variation among isolates of Beauveria spp.Mycological Research 96, 1007–1015.
St Leger, R.J., May, B., Allee, L.L., Frank, D.C., Staples, R.C. and Roberts, D.W.(1992b) Genetic differences in allozymes and in formation of infection structuresamong isolates of the entomopathogenic fungus Metarhizium anisopliae. Journalof Invertebrate Pathology 60, 89–101.
St Leger, R.J., Joshi, L., Bidochka, N.J. and Roberts, D.W. (1995) Construction of animproved mycoinsecticide overexpressing a toxic protease. Proceedings of theNational Academy of Sciences, USA 93, 6349–6345.
Swofford, D.L. (1993) PAUP, Phylogenetic analysis using parsimony, version 3.1.1.Computer program distributed by the Illinois Natural History Survey, Cham-paign, Illinois.
Swofford, D.L. (1997) PAUP, phylogenetic analysis using parsimony, beta version 4.Computer program distributed by the Illinois Natural History Survey, Cham-paign, Illinois.
Tigano-Milani, M.S., Samson, R.A., Martins, I. and Sobral, B.W.S. (1995a) DNAmarkers for differentiating isolates of Paecilomyces lilacinus. Microbiology 141,239–245.
Tigano-Milani, M.S., Honeycutt, R.J., Lacey, L.A., Assis, R., McClelland, M. andSobral, B.W.S. (1995b) Genetic variability of Paecilomyces fumosoroseus isolates asrevealed by molecular markers. Journal of Invertebrate Pathology 65, 274–282.
Tigano-Milani, M.S., Gomes, A.C.M.M. and Sobral, B.W.S. (1995c) Genetic variabil-ity among Brazilian isolates of the entomopathogenic fungus Metarhiziumanisopliae. Journal of Invertebrate Pathology 65, 206–210.
Tulloch, M. (1976) The genus Metarhizium. Transactions of the British MycologicalSociety 66, 407–411.
Typas, M.A., Griffen, A.M., Bainbridge, B.W. and Heale, J.B. (1992) Restrictionfragment length polymorphisms in mitochondrial DNA and ribosomal RNAgene complexes as an aid to the characterization of species and sub-speciespopulations in the genus Verticillium. FEMS Microbiological Letters 95,157–162.
Viaud, M., Couteaudier, Y., Levis, C. and Riba, G. (1996) Genome organisation in
Taxonomy of Entomopathogenic Fungi 185
Beauveria bassiana: electrophoretic karyotype, gene mapping, and teleomericfingerprinting. Fungal Genetics and Biology 20, 175–183.
Volger, A.P. and Desalle, R. (1994) Diagnosing units of conservation management.Conservation Biology 8(2), 354–363.
Walsh, S.R.A., Tyrrell, D., Humber, R.A. and Silver, J.C. (1990) DNA restrictionlength polymorphisms in the rDNA repeat unit of Entomophaga. ExperimentalMycology 14, 381–392.
Welling, M., Nachtigall, G. and Zimmermann, G. (1994) Metarhizium spp. isolatesfrom Madagascar: morphology and effect of high temperature on growth andinfectivity to the migratory locust, Locusta migratoria. Entomophaga 39,351–361.
Wiley, E.O., Siegel-Causey, D., Brooks, D.R. and Funk, V.A. (1991) The completecladist. A primer of phylogenetic procedures. University of Kansas Museum ofNatural History Special Publication 19, 1–158.
Yip, H., Rath, A.C. and Koen, T.B. (1992) Characterization of Metarhiziumanisopliae isolates from Tasmanian pasture soils and their pathogenicity toredheaded cockchafer (Coleoptera: Scarabaeidae: Adoryphorus couloni). Myco-logical Research 96(2), 92–96.
Zimmermann, G. (1993) The entomopathogenic fungus Metarhizium anisopliae andits potential as a biological control agent. Pesticide Science 37, 375–379.
186 F. Driver and R.J. Milner
Application of PCR in FungalBiotechnology
W.V. Burnett, S.-J.D. Chiang, J.D. Basch andR.P. Elander
Biotechnology Development, Bristol-Myers Squibb Company,Syracuse, NY 13221-4755, USA
9.1 Introduction
Filamentous fungi have been utilized for decades in the commercialproduction of enzymes, antibiotics, and speciality chemicals. Fungi areunparalleled as producers of secreted proteins; Aspergillus niger, for example,produces glucoamylase at 20 g l–1. Since the development of transformationmethods for filamentous fungi, genetic engineering technology has beenapplied to fungal systems for the production of heterologous proteins.Members of the genus Aspergillus, Fusarium and Neurospora in particular,have been employed as hosts for the high level secretion of recombinantproteins (Peberdy, 1994; Van den Hombergh et al., 1996). In this chapter, wewill discuss the application of various PCR techniques for the character-ization, cloning and expression of heterologous genes in industrially impor-tant filamentous fungi. Characterization of fungal strains and transformants,as well as the development of suitable fungal hosts for the expression oftherapeutic human proteins, will also be discussed.
9.2 Cloning of Conserved Genes by PCR
Several approaches have been used to isolate genes from filamentous fungi(Goosen et al., 1992). A number of fungal genes were cloned bycomplementation of auxotrophic mutants of Escherichia coli or Sacchar-omyces cerevisiae. This approach is limited because fungal expressionsignals may not be recognized by the host transcriptional or translationalmachinery, and many fungal genes have introns which cannot be processed
9
© CAB INTERNATIONAL 1998. Applications of PCR in Mycology(eds P.D. Bridge, D.K. Arora, C.A. Reddy and R.P. Elander) 187
properly to make a functional mRNA in E. coli or yeast. Isolation offungal genes by complementation of auxotrophic fungal mutants is limitedby the low DNA transformation efficiency in filamentous fungal specieswith the exception of Aspergillus nidulans and Neurospora crassa. A‘reverse genetics’ approach has been used successfully in the cloning ofmany fungal β-lactam biosynthetic genes (Skatrud, 1992). This approachbegins with the purification of the desired enzyme, determination of apartial amino acid sequence, and synthesis of oligonucleotide probes basedon the amino acid sequence. A genomic DNA library of this fungal speciesis then constructed in E. coli and screened for clones that hybridize tothe DNA probes. Sequencing of the cloned DNA is used to confirm thatthe DNA sequence matches the known amino acid sequence. For geneswhich are sufficiently conserved, gene isolation can be achieved in a shortperiod of time by heterologous hybridization with a probe generated fromits counterpart gene from another organism. Alternatively, degenerateoligonucleotide primers synthesized from the conserved regions of theavailable genes, are used to amplify a genomic or a cDNA fragment thatcan be used as a probe for cloning of the entire gene. This approach hasbeen used successfully for the cloning of the cDNA of the NADPH-cytochrome P450 reductase gene (cpr) from Schizosaccharomyces pombe(Miles, 1992) as well as the genomic cpr gene from A. niger (Van denBrink et al., 1995), and the cDNA clone of the protein disulphideisomerase gene from A. niger (Malpricht et al., 1996).
9.2.1 Cloning of a gene from genomic DNA
The NADPH-cytochrome P450 reductase (CPR) serves as an electron donorfor the activity of all eukaryotic non-mitochondrial cytochrome P450 mono-oxygenase enzymes. These enzymes catalyse the oxidation of lipophilicchemicals by the addition of one atom of molecular oxygen to the substratemolecule, such as the conversion of benzoic acid to p-hydroxy-benzoic acid.Genomic and cDNA clones of the cpr gene have been isolated from yeast, rat,rabbit and human genomes. The amino acid sequence of trout and pig CPRhave also been determined from the purified protein. Comparison of thededuced amino acid sequences of these proteins shows two highly conservedregions. Miles (1992) used degenerate oligonucleotide primers, based onthese conserved sequences, to amplify a 309 bp fragment of the cpr gene fromSc. pombe and used it as a probe to identify a cDNA clone of the cpr gene.Van den Brink et al. (1995) used a similar approach to generate a 1.4 kbpPCR-amplified DNA probe and cloned a genomic fragment containing theentire coding region with the 5′ promoter and 3′ untranslated regions of thecpr gene from A. niger. This method should be generally applicable to thecloning of cpr genes from diverse sources when hybridization with heterolo-gous probes fails.
188 W.V. Burnett et al.
9.2.2 Cloning of a gene from mRNA
Protein disulphide isomerase (PDI) catalyses the formation, reduction, andisomerization of disulphide bonds in the process of maturation and foldingof nascent polypeptide chains in the cell. Comparison of amino acidsequences of PDI proteins from a number of organisms indicates that thePDI enzyme has two highly conserved active sites. Malpricht et al. (1996)cloned the PDI cDNA sequences from total RNA isolated from mycelia ofA. niger NRRL3 in three steps. First, they used two degenerate primersderived from the conserved regions of the two active sites to amplify a 158 bpPCR fragment from single-stranded cDNA which had been transcribed fromA. niger total RNA. This PCR fragment was cloned and sequenced to verifyits identity with the published PDI protein sequences. From the sequenceinformation, a specific 27-mer primer was used as a 5′ primer in a 3′-rapidamplification of cDNA ends (RACE) PCR with single-stranded cDNA andoligo-dT primer to yield a longer cDNA fragment. This fragment consists ofthe above 158 bp fragment sequence and all of the 3′ sequences extending tothe poly(A)-tail (Frohman et al., 1988). The 5′ end of the gene, upstream ofthe sequenced region, was subsequently cloned by inverse PCR (IPCR)(Huang et al., 1990). Double-stranded cDNA was prepared from full-lengthmRNA and self-ligated to generate circular templates for PCR. Primers wereprepared which were complementary to the 5′ and 3′ ends of the previouslyamplified cDNA fragment, but oriented outward so that they would amplifythe uncharacterized portion of the template. After 25 cycles of PCR, a DNAfragment containing sequences from the 5′ end of the mRNA was synthe-sized and characterized. By using IPCR, it was possible to determine thesequence of the 5′ region of a specific mRNA molecule without knowing thesequence of the 5′ end in advance. An alternative approach is to use5′-RACE. Single-stranded cDNA is synthesized from mRNA and C-tailedusing terminal deoxynucleotidyl transferase and dCTP. This serves as atemplate for PCR using oligo-dG and a gene-specific primer. Either methodallows full-length cDNA fragments to be generated even with limitednucleotide sequence information (Frohman et al., 1988; Zilberberg andGurevitz, 1993).
9.3 Expression Vector Construction
Interest in the use of filamentous fungi for the production of both industrialenzymes and therapeutic proteins has increased significantly in recent years.Because fungi can produce large quantities of secreted proteins and manyfungal strains are now generally recognized as safe, they can potentially serveas ideal hosts for the expression of heterologous genes. To accomplish this,a transformation protocol must be developed which allows foreign DNA tobe introduced into the host in either an integrated or autonomous form.
PCR in Fungal Biotechnology 189
Then, an expression vector must be constructed which provides the gene ofinterest with additional DNA sequences to allow its expression in the fungalhost. These sequences typically include:
• a strong transcriptional promoter (preferably regulated);
• suitable restriction sites near the promoter to insert heterologous genes;
• a transcriptional terminator;
• a selectable marker.
Optionally, the vector may contain a secretion signal sequence or part ofa highly expressed endogenous protein (generally from the gene which isnaturally associated with the strong promoter), allowing a foreign gene to beeither secreted or expressed as a fusion protein.
PCR is particularly useful in the construction of new expression vectorssince most of the components can be derived from existing vectors, butrequire several changes in the flanking restriction sites. The followingexample from our laboratory demonstrates how we have easily constructeda rather complex expression system for Fusarium oxysporum by PCR.
In the course of developing an enzymatic method to convert penicillinV to 6-aminopenicillanic acid, research scientists at Bristol-Myers Squibbdiscovered a strain of F. oxysporum which produces substantial quantities(1–2 g l–1) of a penicillin V amidase (PVA) enzyme (Fig. 9.1). Expression ofthe PVA gene is induced by the presence of phenoxyacetic acid (POAc), andthe protein is secreted into the medium. To increase production of theenzyme, we cloned the PVA gene and approximately 2 kb of flankingsequences into a vector that contained a phleomycin resistance gene for theselection of fungal transformants. When the transforming plasmid wasinserted into the chromosome of a different F. oxysporum strain (f. sp.lycopersici, ATCC 16322) which has very little endogenous PVA activity andno DNA sequences homologous to the PVA gene, the transformantsproduced over 1 g l–1 of active enzyme. When the host was transformed witha vector containing a tandem repeat (two copies) of the PVA gene, theexpression increased to 10 g l–1 (Chiang et al., 1996). The protein wassecreted and its expression remained POAc-inducible. These characteristicshave led us to believe that the PVA promoter and gene can be converted intoa component of a valuable expression system in Fusarium.
Because the two-copy PVA gene vector produces much higher levels ofexpression, we decided to create a Fusarium expression system with twocomponent plasmids for the easy construction of two-gene expression vectors.One component, pWB20 (the ‘cassette’ vector, Fig. 9.2), allows a heterologousgene to be inserted into the PVA gene at a variety of locations. Depending uponthe insertion site, the gene can be expressed directly, or fused to the PVAsecretion signal sequence, or expressed as a fusion protein. After the gene isinserted, an expression cassette containing the gene plus the PVA promoter andtranscriptional terminator can be cut out with either of two restrictionenzymes (EcoRI or XbaI). A second component, pSJC62 (the ‘resistance’
190 W.V. Burnett et al.
vector, Fig. 9.2), contains the gene coding for phleomycin resistance and uniqueEcoRI and XbaI restriction sites on opposite sides of the gene. Two copies ofthe expression cassette can be inserted into these sites on pSJC62 to generatefour different combinations. These copies are not true tandem repeats sincethey are separated by the phleomycin resistance gene. In order to generatetandem repeats we engineered an overlapping dam-methylation site (GATC)at one of the XbaI sites of the pWB20 cassette vector. The vector is initiallygrown in a dam– E. coli host so that the cassette can be cut out with XbaI. Afterthe first copy of the cassette is inserted into the pSJC62 resistance vector, it isgrown in a dam+ E. coli host which prevents cleavage of one of the XbaI sites.A second copy of the expression cassette is now easily inserted into the oneremaining XbaI site to produce a true tandem repeat.
The cassette vector, pWB20 was created from the vector pFO20, whichcontains the PVA gene plus 1.2 kb of upstream (promoter region) and 0.8 kb ofdownstream (transcriptional terminator region) DNA sequences inserted intothe popular cloning vector pUC19. To convert pFO20 to pWB20, it wasnecessary to remove six restriction sites, add four new restriction sites (onewith an overlapping dammethylation site), and to modify the translation start
Fig. 9.1. Enzymatic conversion of penicillin V to 6-aminopenicillanic acid (6-APA).
Fig. 9.2. Plasmid maps of pWB20 and pSJC62.
PCR in Fungal Biotechnology 191
site. Although introducing this number of changes appears daunting, it waseasily accomplished by PCR with carefully designed primers. The strategy isoutlined in Fig. 9.3. Firstly, an NcoI site was removed from the transcriptionalterminator by digestion, filling-in, and religation. Next, PCR primers weremade to amplify either the promoter region or the coding and terminatorregions. The primers were 29–33 bp long and their 3′ ends provided 14–19 basesof homology to the PVA gene. The 5′ sequences of the primers were designed tocreate all of the new restriction sites needed for pWB20. For the annealing stepof the PCR, the Tm is about 50°C when the template is the pFO20 vector (sinceonly the 3′ end of the primer hybridizes). After the initial rounds of PCR,however, the newly synthesized template will be complementary to the entireprimer and the Tm will increase to 80–90°C. To optimize the specificity of thePCR, it was carried out in two stages. Firstly, a PCR with an annealingtemperature of 48°C was run for six cycles to generate a small amount of newlysynthesized template. This was followed by a two-step PCR (94° and 70°C) for35 cycles to amplify the fragments. The PCR-generated fragments were thendigested with restriction enzymes to produce ‘sticky’ ends and ligated into amodified pUC19 vector (pUC19EB) which had most of the polylinker regionremoved. The resulting pWB20 vector is now being developed to expressheterologous genes in its Fusarium host.
9.4 Site-directed Mutagenesis by PCR
After an expression vector (usually a plasmid) has been constructed, it is oftendesirable to introduce mutations into the vector either to alter the properties ofan expressed gene product or to increase its level of expression. In some cases,the desired mutation will be very specific (for example, the introduction of newrestriction sites or changing a single amino acid at the active site of an enzyme).In other cases, it may be preferable to introduce random mutations into a smallregion of the vector (for example, when trying to increase the strength of apromoter). In either case, the most convenient way to mutagenize specific sitesor regions of the vector is by PCR. Several of the most commonly usedprocedures will be described below.
9.4.1 Introduction of specific mutations
All of the procedures to create non-random mutations begin with thesynthesis of PCR primers which contain the desired mutation. Either aregion of the plasmid or the entire plasmid is amplified, and the vectorcontaining the mutation is reconstructed.
Inverse PCR (IPCR) and enzymatic inverse PCR (EIPCR)An easy way to mutagenize a circular plasmid, inverse PCR proceduresrequire only two primers to the complementary strands of the plasmid.
192 W.V. Burnett et al.
Their 5′ ends are adjacent to each other, and one of the primers containsthe desired mutation (Helmsley et al., 1989). PCR with these primers willamplify the entire plasmid as a linear molecule, and this can then berecircularized with T4 DNA ligase and transformed into an E. coli host.Because the ends of the molecule are not always precisely blunt, it is oftennecessary to sequence the junction to confirm that no additional mutationshave been introduced. A better way to accurately recircularize the plasmidis to use overlapping complementary primers containing a unique restrictionsite and digest the ends with the restriction enzyme before ligation (EIPCR).If a unique restriction site is located close enough to the mutation site,complementary primers containing both the restriction site and themutation can be used for the PCR. Even if there are no restriction sitesclose to the mutation site, a unique class 2s restriction site whose recognitionsite is 5′ to the cutting site can be added as a 5′ extension to both primers
Fig. 9.3. pWB20 Construction strategy.
1. Cut pFO20 with Nco I, fill in, and religate (= pFO20∆Nco). [Removes unwanted Nco Isite from the PVA terminator region.]
2. Cut pUC19 with EcoRI + HindIII, add a linker, and ligate (= pUC19EB). Cut the plasmidwith EcoRI and remove 5′-phosphates. [Removes all of the polylinker region, keepingonly the EcoRI site and adding a Bgl II site.]
3. PCR the promoter region of pFO20∆Nco and cut the product with EcoRI + Nco I.[Adds an EcoRI and Xba I (with overlapping dam methylation) site to the 5′ end andan Nco I site at the translation start site.]
4. PCR the coding and terminator region of pFO20∆Nco and cut the product withEcoRI + Nco I. [Adds an EcoRI and Xba I site to the 3′ end, an Nco I site at thetranslation start site, and adds one amino acid to the N terminus of PVA.]
5. Ligate the three fragments from steps 2–4. [If the correct fragments come together,pWB20 is produced. The correct construct is identified by restriction analysis.]
PCR in Fungal Biotechnology 193
(Stemmer and Morris, 1992). Digestion of the amplified DNA with the class2s restriction enzyme removes the recognition site and leaves com-plementary overhangs which are part of the original plasmid sequence.When ligated into a circle, the new plasmid is identical to the old one exceptfor the introduced mutations.
Recombination PCR (RPCR)Similar to IPCR, an entire plasmid is amplified with complementary primerswhich contain the desired mutation. Instead of recircularizing the plasmid invitro, the linear DNA is transfected directly into competent E. coli cells(Jones and Howard, 1991). The host cells (including recA– strains) containrecombinational repair enzymes which can recircularize the plasmid in vivo.Although initially simpler than IPCR or EIPCR, some errors can beintroduced during this recombination, so further characterization of theplasmid is often advisable.
Overlap PCRIntroducing a mutation into the middle of a linear fragment of DNA requiresfour PCR primers. Two primers are complementary to the ends of thefragment, and two are complementary to each other and contain the desiredmutation. Initially, two separate PCRs are carried out which amplify the twohalves of the fragment. If the overlapping region containing the mutation alsocontains a unique restriction site, the two fragments can simply be digestedwith the enzyme and ligated together. If not, one alternative is to add a class2s restriction site to the 5′ ends of the primers containing the mutation(Tomic et al., 1990). When digested with the enzyme, the recognition sites areremoved and the complementary overhangs contain only sequences from theoriginal DNA fragment plus the mutation. A second alternative is to allowthe overlapping region of the two fragments to prime each other in a thirdPCR reaction (Ho et al., 1989). The two halves of the fragment are combinedwith the two primers which are complementary to the ends of the originalDNA fragment and the PCR is repeated to regenerate the original fragmentwith the desired mutation. This approach can also be used to fuse togethertwo unrelated gene fragments.
9.4.2 Introduction of random mutations (mutagenic PCR)
Depending upon the application, it may be preferable to introduce randommutations over a small region of an expression vector rather than create alarger number of plasmids with specific mutations. Mutagenic PCR takesadvantage of the fact that native Taq DNA polymerase has an unusually higherror rate (approximately 10–4 per nucleotide incorporated). This rate can befurther increased by manipulating the concentration of MgCl2, MnCl2, anddNTP in the PCR reaction mix (Cadwell and Joyce, 1995). By carrying outa mutagenic PCR on a small region of an expression vector and subsequently
194 W.V. Burnett et al.
subcloning the fragment back into the vector, a large number of randommutations in a small region of the plasmid can easily be generated.
9.5 Characterization of High-producing Industrial Strains
Fungi have been employed in the fermentation industry for over 100 years.Traditional strain improvement methods such as random mutagenesis andselection have led to tremendous increases in the productivity of theseorganisms. The genetic changes that have resulted in these improvements,however, remain largely uncharacterized. PCR applications such as reversetranscription PCR (RT–PCR) and differential display RT–PCR (DDRT–PCR) enable us to identify genes which have altered expression levels inhigher-producing organisms. Identifying these mutations enables the devel-opment of rational strategies for the genetic engineering of these strains forfurther improvements in productivity. Furthermore, knowledge gainedregarding the genetic changes in one strain improvement programme mayalso help to speed productivity improvements of other related products.PCR can then be used for the identification and characterization of thesegenetically engineered fungi.
9.5.1 Characterization and quantitation of mRNA
RT–PCR is a technique for analysing gene expression by specific amplifica-tion of cDNA which has been synthesized from mRNA (reverse transcrip-tion). It can be used simply to detect the presence of a specific RNAtranscript, or when a competitive template of a known quantity is added tothe reaction, RT–PCR can be used to quantitate expression levels in RNAsamples. The competitive template should be as similar to the cDNA targetas possible. A cloned genomic fragment provides a good competitor if thePCR primers are chosen so that they span an intron. The amplified productscan then be distinguished by the difference in size between the genomic andcDNA sequences. The advantage of RT–PCR over Northern blotting is thata smaller amount of total RNA of a lesser quality is required and furtherpurification of poly(A)-tailed mRNA is not necessary. This is particularlyhelpful when dealing with fungal organisms from which RNA is difficult toextract.
In the case of the β-lactam antibiotics produced by Penicillium chrysoge-num and Acremonium chrysogenum, most of the genes involved specificallyin the biosynthetic pathway have been cloned (Martin et al., 1994). In thehigher producing strains, accumulation of beneficial mutations has increasedthe expression of these genes dramatically. Mutations in promoter regionscan increase expression levels and alter the pattern of regulation that thesegenes display. Mutations in the coding region can affect the activity of theβ-lactam biosynthetic enzymes, resulting in increased productivity of the
PCR in Fungal Biotechnology 195
organism. One approach for analysing the mutations accumulated throughthe course of strain improvement uses PCR to amplify a defined region ofgenomic DNA from a number of different strains followed by a non-isotopicRNase cleavage assay to locate mutations (Myers et al., 1985). This techniquelocates the position of mutations so that sequencing can be limited to regionswhere mutations have been previously been identified. PCR primersdesigned to amplify a genomic region of 100–1000 bp in length are used toamplify a specific promoter or coding region from a wild-type or earlydevelopment ‘reference strain’ and from higher-producing strains. Theseamplified products can be cloned into a vector between two differentbacteriophage promoters. Separate sense and antisense transcripts can begenerated by adding one of two different bacteriophage RNA polymerases.The sense strand amplified from the reference strain is annealed to theantisense transcripts generated from the high-producing strains. Mismatchesin the complementary RNA templates will result in positions susceptible toRNase cleavage. By sizing the products on an agarose gel, the positions ofthese mismatches can be mapped, indicating the location of mutationsincurred during strain improvement.
9.5.2 Differential display of fungal mRNA
The comparison of gene expression in fungal cells at various stages ofdifferentiation has traditionally been performed by subtractive hybridization(Zimmerman et al., 1980). This technique is time consuming and requires theisolation of high quality mRNA. DDRT–PCR was developed to analyse abroad spectrum of expressed genes and to detect differences in expressionlevels between cell types (Appleyard et al., 1995). DDRT–PCR relies on the useof short random primers that non-specifically amplify fragments (<1000 bp) ofcDNA. Differences in the expression of various genes can be determined bycomparison of the DNA banding pattern observed upon amplification ofdifferent RNA samples. For example, antibiotics are produced by fungalorganisms as secondary metabolites; specific conditions such as environmentalstress are required for antibiotic production. DDRT–PCR of RNA isolatedfrom cultures grown at either logarithmic phase (trophophase) or producingphase (idiophase) can be used to identify the genes that are expressed during thesynthesis of antibiotics. These genes, related to antibiotic synthesis, are goodtargets for cloning and overexpression (Usher et al., 1992). For a company witha long history of strain improvement, analysis of high- and low-producingstrains by this method can determine the genetic changes resulting in higherproductivity. The DDRT–PCR and RT–PCR techniques are described indetail in other chapters of this book.
9.5.3 Characterization of transformants and integration sites
PCR is useful for identifying and characterizing fungal transformants.Because many selection systems for fungal transformation are not 100%
196 W.V. Burnett et al.
selective, abortive transformants due to the transitory uptake of transformingDNA can outgrow the selection. Fungal transformation in industrialapplications is almost exclusively integrative. Therefore, to identify truetransformants, genomic DNA is first isolated from putative transformantsand a dot-blot or PCR amplification of the integrated DNA is performed.Nowak et al. (1995) used PCR to confirm that a linear DNA fragment whichcontains a mutant tubulin gene and lacks any bacterial sequences can conferresistance to benomyl and is sufficient for transformation of Acremoniumchrysogenum.
The expression level of a heterologous gene which has been integratedinto a fungal chromosome is often determined by the site of integration aswell as by any regulatory sequences on the expression vector. A geneintegrated into a transcriptional ‘hot spot’ can express at higher levels thanthe same gene inserted elsewhere on the chromosome. If a putative hot spotis identified after the random insertion of a vector, it may be desirable toisolate the flanking sequences from the host chromosome. These sequencescould then be added to future expression vectors to direct integration to thehot spot by homologous recombination. Inverse PCR can be used to amplifythe host DNA sequences flanking integrated transforming DNA. A South-ern blot of the genomic DNA is first performed to identify restrictionfragments which contain the integrated DNA and flanking genomic DNA.Sometimes a single fragment will contain both the upstream and downstreamsequences, otherwise two separate fragments may be used for amplificationof each flanking region. Once the restriction enzyme is chosen, genomicDNA is digested, diluted, and ligated so that the restriction fragmentscircularize. This material will serve as the template for the amplification.Unlike standard PCR where the primers are designed so that they amplifythe sequences between them, primers for inverse PCR are designed to extendtheir template in outward directions. When annealed to the circular template,these primers will amplify a fragment that contains the sequences flankingthe primers until they join at the restriction site used for cleavage of thegenomic DNA. This amplified product can then be cloned and sequenced.
9.6 Future Applications
9.6.1 Efficient secretion of heterologous proteins
The efficiency of protein secretion is protein-specific and recombinantproteins are often difficult to secrete at high levels in fungal hosts. The effortat Genencor to produce bovine chymosin in A. nidulans and A. awamoridemonstrated that transcription was not a limiting factor in chymosinproduction but that secretion may have been inefficient (Ward et al., 1990).The productivity and secretion of the chymosin protein was significantlyimproved by engineering a fusion protein product which links the cDNA
PCR in Fungal Biotechnology 197
encoding bovine prochymosin in frame to the last codon of the A. awamoriglycoamylase gene. The produced chymosin is autocatalytically released atpH 2 from the fusion protein after secretion (Ward et al., 1990). This workdemonstrated that secretion of the fusion protein is more efficient than forheterologous protein alone. If autocatalytic release does not occur in thefungal system, a cleavable linker peptide can be engineered between theproteins to allow separation of the products for purification. Site-specificmutagenesis by PCR or overlap PCR (Pont-Kingdon, 1994) can be used inthe construction of fusion vectors and the generation of a cleavable linker.
9.6.2 Host improvement for heterologous gene expression
The ability of filamentous fungi to secrete large quantities of protein hasmade them an attractive host for the production of recombinant proteins. Forthe proper expression of therapeutic human proteins in filamentous fungi,several aspects need to be considered in addition to the efficient expressionof heterologous genes:
• stability of the secreted preteins in the fermentation media;
• glycosylation pattern/ biological activity of the secreted proteins;
• ‘generally regarded as safe’ (GRAS) strain development.
Proteinase-deficient mutantsA recombinant protein secreted into the fermentation medium may bedegraded by extracellular fungal proteinases. The aspartic proteinase of A.awamori had been shown to degrade secreted bovine chymosin and the geneencoding this enzyme was cloned (Berka et al., 1990). Deletion of the nativeaspartic proteinase gene in A. awamori resulted in a significant reduction inoverall extracellular proteinase activity. The production of chymosin wasimproved seven-fold by combining expression in the proteinase-deficientmutant with a classical strain improvement programme (Dunn-Coleman etal., 1991). Based on the deduced amino acid sequence, A. awamori asparticproteinase shares homology with other fungal aspartic proteinases (Berka etal., 1990). Cloning of conserved protease genes in other fungal hosts by PCRcould be performed as discussed earlier. Aspartic proteinase-deficientmutants could then be constructed by gene disruption or deletion. A numberof genes encoding other fungal proteinases have been isolated (Van denHombergh et al., 1996), and some of these genes are highly conserved infungi. Cloning of these genes can be facilitated by PCR and used to constructproteinase-deficient mutants.
Glycosylation engineeringThe correct carbohydrate composition of many human therapeutic proteinsis essential in vivo for their solubility, stability, and biological activity, as wellas to avoid recognition by the human immune system. The recombinantmammalian proteins produced in yeast usually have a large number of
198 W.V. Burnett et al.
mannose residues (hyperglycosylation) which alter their serum half-life andantigenicity in mammals (MacKays, 1987). The glycosylated recombinantmammalian proteins produced in filamentous fungi usually co-migrate withthe natural protein in SDS–PAGE gels, indicating no excess glycosylation.Upshall et al. (1987) have shown that human tissue plasminogen activator(tPA) produced in A. nidulans is correctly processed at the amino terminusand is not over-glycosylated. Ward et al. (1992) have also demonstrated thatrecombinant human lactoferrin expressed in A. oryzae has the same level ofglycosylation as the authentic lactoferrin present in human milk. However,the nature and chemical composition of the carbohydrates added to theserecombinant proteins derived from different fungal expression systems havenever been characterized. When the cDNA encoding tPA was expressed bya strong fungal promoter in A. nidulans, the recombinant tPA protein wasoverglycosylated (Upshall et al., 1991). The authors suggested that in thehigh-yielding transformants, the translation of mRNA proceeds faster thanthe ability of the host cell to process and to translocate the proteinextracellularly. The intracellular accumulation of this protein in the Golgiapparatus results in the continued addition of excess carbohydrate side-chains. A similar observation of over-glycosylation of recombinant proteinshas been observed in the high-level expression of an aspartic proteinasederived from Rhizomucor miehei in A. oryzae, although the biologicalactivity was not affected (Christensen et al., 1988). Therefore, in order toachieve the correct level of glycosylation, high-level expression of mamma-lian glycoproteins is not always desirable.
There is an increasing understanding of the biosynthetic pathways ofprotein glycosylation and the relationship between glycosylation and thebiological activity of various proteins (Stanley, 1992; Jenkins and Curling,1994). With this basic knowledge, a filamentous fungal host can beengineered by removing the fungal glycosyltransferases and adding thedesired mammalian glycosyltransferases. Cloning, inactivation, and replace-ment of these genes can be achieved by applying PCR technology. Recently,Borsig et al. (1995) have demonstrated the expression of a functional humanα-2,6(N)-sialyltransferase enzyme in S. cerevisiae. Theoretically, the samegene could be expressed in filamentous fungal cells.
GRAS strain developmentFor the production of recombinant proteins or metabolites by fungalorganisms, it is important to use a fungal host which has a GRAS status. Oneof the most important factors that is required to recognize a fungal strain assafe is the absence of mycotoxins which are toxic to humans, animals, orplants. A number of fungal strains used for antibiotic and food industries areconsidered GRAS strains by the Food and Drug Administration (FDA) inthe United States. These include A. awamori, A. oryzae, A. chrysogenum, P.chrysogenum and Fusarium graminerarum A3/5. If a mycotoxin-producingfungus must be used to produce a desirable product, the cloning and
PCR in Fungal Biotechnology 199
subsequent inactivation of genes encoding for one or more key enzymes inthe mycotoxin biosynthetic pathway could be used to generate new GRASstrains. PCR will undoubtedly serve as a key technology for cloning andcharacterizing these genes.
9.7 Summary
This chapter details the many uses of PCR technology in the geneticengineering of industrial fungi for the commercial production of antibiotics,enzymes, secreted proteins and speciality chemicals. One of the majoractivities of industrial biotechnology process improvement laboratories is tooverexpress the desired antibiotic, enzyme, or therapeutic protein usingmodern genetic engineering strategies through the construction of efficientexpression vectors. PCR technology appears to be particularly useful in thedevelopment of improved vectors since most of the essential expressioncomponents are derived from existing vectors but require changes in flankingrestriction sites. One of the highlights of this chapter is a detailed descriptionof how PCR technology was used to overproduce penicillin V amidase(PVA) in engineered strains of F. oxysporum. When this host was trans-formed with a vector containing a tandem repeat representing two copies ofthe PVA gene, a nearly ten-fold improvement in enzyme production wasnoted.
PCR has also been shown to be a convenient procedure to mutagenizespecific regions of an expression vector. Examples are described for theintroduction of specific mutations using IPCR and EIPCR. The utility ofRPCR, overlap PCR, and the use of PCR for the introduction of randommutations have also been highlighted in this chapter.
Another important application of PCR in fungal biotechnology is its use incharacterizing high-producing industrial strains. Traditional strain improve-ment methodologies, including random mutagenesis and directed selection,have resulted in significant over-production of commercial metabolites.However, the genetic basis for these improvements remains largely uncharac-terized. PCR strategies, including RT–PCR and differential DDRT–PCR,enable biotechnologists to identify discrete genes that may be tied to increasedexpression in higher-producing strains. These altered genes now provide forrational strategies for further improvements in strain productivity.
PCR applications will play even more important roles in future fungalbiotechnology research and development programmes. Strategies have beendescribed in this chapter on the efficient secretion of bovine chymosinthrough the fusion of the chymosin gene to the last codon of the Aspergillusawamori glucoamylase gene. Site-directed mutagenesis by PCR can beutilized for the generation of fusion vectors and cleavable linker proteinproducts. Lastly, future uses of PCR and site-directed mutagenesis includethe development of potential commercial, non-toxin-producing GRAS
200 W.V. Burnett et al.
fungal strains for the development of proteinase-deficient fungal isolates andfor the development of fungal strains producing proteins with desirablechanges in their protein glycosylation process.
References
Appleyard, V.C.L., Unkles, S.E., Legg, M. and Kinghorn, J.R. (1995) Secondarymetabolite production in filamentous fungi displayed. Molecular and GeneralGenetics 247, 338–342.
Berka, R.M., Ward, M., Wilson, L.J., Hayenga, K.J., Kodama, K.H., Carlomagno, L.P.and Thompson, S.A. (1990) Molecular cloning and deletion of the gene encodingaspergillopepsin A from Aspergillus awamori. Gene 86, 153–162.
Borsig, L., Ivanov, S.X., Herrmann, G.F., Kragl, U., Wandrey, C. and Berger, E.G.(1995). Scaled-up expression of human α2,6(N)sialyltransferase in Sacchar-omyces cerevisiae. Biochemical and Biophysical Research Communications 210,14–20.
Cadwell, R.C. and Joyce, G.F. (1995) Mutagenic PCR. In: Dieffenbach, C.W. andDvesker, G.S. (eds) PCR Primer – a Laboratory Manual. Cold Spring HarborLaboratory Press, Cold Spring Harbor, New York, pp. 583–589.
Chiang, S-J., Burnett, W.V. and Tonzi, S.M. (1996) Penicillin V amidohydrolase genefrom Fusarium oxysporum. U.S. Patent 5,516,679.
Christensen, T., Woeldike, H., Boel, E., Mortensen, S.B., Hjortshoej, K., Thim, L. andHansen, M.T. (1988) High level expression of recombinant genes in Aspergillusoryzae. Bio/Technology 6, 1419–1422.
Dunn-Coleman, N.S., Bloebaum, P., Berka, R.M., Bodie, E.A., Robinson, N.,Armstrong, G., Ward, M., Przetak, M., Carter, G.L., LaCost, R., Wilson, L.J.,Kodama, K.H., Baliu, E.F., Bower, B., Lasma, M. and Heinsohn, H. (1991)Commercially viable levels of chymosin production by Aspergillus. Bio/Technology 9, 976–981.
Frohman, M.A., Dush, M.K. and Martin, G.R. (1988) Rapid production of full-lengthcDNAs from rare transcripts: amplification using a single gene-specific oligo-nucleotide primer. Proceedings of the National Academy of Sciences USA 85,8998–9002.
Goosen, T., Bos, C.J. and van den Broek, H. (1992) Transformation and genemanipulation in filamentous fungi: An overview. In: Arora, D.K., Elander, R.P.and Mukerji, K.G. (eds) Handbook of Applied Mycology Volume 4: FungalBiotechnology. Marcel Dekker, New York, pp. 151–195.
Helmsley, A., Arnheim, N., Toney, M.D., Cortopassi, G. and Galas, D.J. (1989) Asimple method for site-directed mutagenesis using the polymerase chain reac-tion. Nucleic Acids Research 17, 6545–6551.
Ho, S.N., Hunt, H.D., Horton, R.M., Pullen, J.K. and Pease, L.R. (1989) Site-directedmutagenesis by overlap extension using the polymerase chain reaction. Gene 77,51–59.
Huang, S.H., Hu, Y., Wu, C. and Holcenberg, J. (1990) A simple method for directcloning cDNA sequence that flanks a region of known sequence from total RNAby applying the inverse polymerase chain reaction. Nucleic Acids Research 18,1922.
PCR in Fungal Biotechnology 201
Jenkins, N. and Curling, E.M.A. (1994) Glycosylation of recombinant proteins:problems and prospects. Enzyme and Microbial Technology 16, 354–364.
Jones, D.H. and Howard, B.H. (1991) A rapid method for recombination and site-specific mutagenesis by placing homologous ends on DNA using polymerasechain reaction. BioTechniques 10, 62–66.
MacKay, V.L. (1987) Secretion of heterologous proteins in yeast. In: Stewart, G.G.,Russell, I., Klein, R.D. and Hiebach, R.R. (eds) Biochemistry and MolecularBiology of Industrial Yeasts. CRC Press, Boca Raton, Florida, pp. 27–36.
Malpricht, S., Thamm, A. and Khanh, N.Q. (1996) Cloning of cDNA for the proteindisulfide isomerase from Aspergillus niger strain NRRL3 using PCR. Bio-technology Letters 18, 445–450.
Martin, J.F., Guitierrez, S., Fernandez, F.J., Velasco, J., Fierro, F., Marcos, A.T. andKosalkova, K. (1994) Expression of genes and processing of enzymes for thebiosynthesis of penicillins and cephalosporins. Antonie van Leeuwenhoek 65,227–243.
Myers, R.M., Larin, Z. and Maniatis, T. (1985) Detection of single base susbstitutionsby ribonuclease cleavage of mimatches in RNA:DNA duplexes. Science 230,1242–1246.
Miles, J.S. (1992) Structurally and functionally conserved regions of cytochromeP-450 reductase as targets for DNA amplification by the polymerase chainreaction: cloning and nucleotide sequence of the Schizosaccharomyces pombecDNA. Biochemical Journal 287, 195–200.
Nowak, C., Radzio, R. and Kuck, U. (1995) DNA-mediated transformation of afungus employing a vector devoid of bacterial DNA sequences. AppliedMicrobiology and Biotechnology 43, 1077–1081.
Peberdy, J.F. (1994) Protein secretion in filamentous fungi – trying to understand ahighly productive black box. Trends in Biotechnology 12, 50–57.
Pont-Kingdon, G. (1994) Construction of chimeric molecules by a two steprecombinant PCR method. BioTechniques 16, 1010–1011.
Skatrud, P.L. (1992) Genetic engineering of β-lactam antibiotic biosynthetic pathwaysin filamentous fungi. Trends in Biotechnology 10, 324–329.
Stanley, P. (1992) Glycosylation engineering. Glycobiology 2, 99–107.Stemmer, W.P.C. and Morris, S.K. (1992) Enzymatic inverse PCR: a restriction site
independent, single-fragment method for high-efficiency, site-directed mutage-nesis. BioTechniques 13, 214–220.
Tomic, M., Sunjevaric, I., Savtchenko, E.S. and Blumenberg, M. (1990) A rapid andsimple method for introducing specific mutations into any position of DNAleaving all other positions unaltered. Nucleic Acids Research 18, 1656.
Upshall, A., Kumar, A.A., Bailey, M.C., Parker, M.D., Favreau, M.A., Lewison, K.P.,Joseph, M.L., Maraganore, J.M. and McKnight, G.L. (1987) Secretion of activehuman tissue plasminogen activator from the filamentous fungus Aspergillusnidulans. Bio/Technology 5, 1301–1304.
Upshall, A., Kumar, A.A., Kaushansky, K. and McKnight, G.L. (1991) Molecularmanipulation of and heterologous protein secretion from filamentous fungi. In:Leong, S.A. and Berka, R.M. (eds) Molecular Industrial Mycology: Systems andApplication for Filamentous Fungi. Marcel Dekker, New York, pp. 31–44.
Usher, J., Hughes, D.W., Lewis, M.A. and Chiang, S-J. D. (1992) Determination ofrate-limiting step(s) in the biosynthetic pathways leading to penicillin andcephalosporin. Journal of Industrial Microbiology 10, 157–163.
202 W.V. Burnett et al.
Van den Brink, H.M., van Zeijl, C.M.J., Brons, J.F., van den Hondel, C.A.M.J.J. andvan Gorcom, R.F.M. (1995) Cloning and characterization of the NADPHcytochrome P450 oxidoreductase gene from the filamentous fungus Aspergillusniger. DNA and Cell Biology 14, 719–729.
Van den Hombergh, J.P.T.W., ven de Vondervoort, P.J.I. and Visser, J. (1996) Improvethe efficiency of protein expression by fungi. Chemtech 26, 30–36.
Ward, M., Wilson, L.J., Kodama, K.H., Rey, M.W. and Berka, R.M. (1990) Improvedproduction of chymosin in Aspergillus by expression as a glucoamylase-chymosin fusion. Bio/Technology 8, 435–440.
Ward, P.P., Lo, J-Y., Duke, M., May, G.S., Headon, D.R. and Conneely, O.M. (1992)Production of biologically active recombinant human lactoferrin in Aspergillusoryzae. Bio/Technology 10, 784–789.
Zilberberg, N. and Gurevitz, M. (1993) Rapid isolation of full length cDNA clonesby ‘inverse PCR’: purification of a scorpion cDNA family encodingα-neurotoxins. Analytical Biochemistry 209, 203–205.
Zimmerman, C.R., Orr, W.C., Leclerc, R.F., Barnard, E.C. and Timberlake, W.E.(1980) Molecular cloning and selection of genes regulated in Aspergillusdevelopment. Cell 21, 709–715.
PCR in Fungal Biotechnology 203
Application of PCR in StudyingLignocellulose Degradation byBasidiomycetes
C.A. Reddy and T.M. D’Souza
Department of Microbiology and NSF Center for Microbial Ecology,Michigan State University, East Lansing, MI 48824-1101, USA
10.1 Introduction
Lignin, cellulose and hemicellulose are the major structural polymers of plantbiomass comprising, respectively, 45%, 20–30% and 20–30% of the dryweight of woody plants (Kirk and Farrell, 1987; Boominathan and Reddy,1992). Because of the importance of lignocellulose as a renewable resourcefor the production of paper products, feeds, chemicals and fuels, there hasbeen a considerable amount of research in recent years on the fungaldegradation of lignocellulose (Kirk and Farrell, 1987; Boominathan andReddy, 1992). Among the fungi, wood-rot basidiomycetes are considered themost efficient degraders of lignocellulose. White-rot fungi completelymineralize the three major lignocellulose polymers to CO2, whereas thebrown-rot fungi efficiently decompose cellulose and hemicellulose compo-nents of wood but mineralize lignin only to a limited extent (Kirk andFarrell, 1987; Reddy, 1993; Reddy and D’Souza, 1994). Earlier researchfocused extensively on lignocellulose degradation by the white-rot basidio-mycete Phanerochaete chrysosporium (Kirk and Farrell, 1987; Boominathanand Reddy, 1992; Cullen and Kersten, 1992; Gold and Alic, 1993). However,there has been a growing interest recently in studying lignocellulosedegrading systems of other wood-rot basidiomycetes (Higuchi, 1993; deJong et al., 1994; Hatakka, 1994; Tuor et al., 1995).
An increasing number of researchers are currently utilizing molecularbiological approaches to study fungal lignocellulose degradation (Cullen andKersten, 1992; Reddy, 1993; Gold and Alic, 1993; Reddy and D’Souza, 1994).With the advent of the polymerase chain reaction (PCR) and its associatedmethodologies (Saiki et al., 1985; Mullis and Faloona, 1987; Innis et al., 1990;
10
© CAB INTERNATIONAL 1998. Applications of PCR in Mycology(eds P.D. Bridge, D.K. Arora, C.A. Reddy and R.P. Elander) 205
Steffan and Atlas, 1991; Bej and Mahbubani, 1992; Dieffenbach and Dveksler,1995), many researchers are using PCR-based strategies to better understandthe physiology and molecular biology of fungal lignocellulose degradationand this is the focus of this review. A broad overview of the PCR techniquesis presented first and is followed by a review of the applications of PCRmethodology. The latter includes the detection, isolation and character-ization of genes involved in lignocellulose degradation as well as studies onthe expression of these genes under varying environmental conditions.
10.2 Extraction of Nucleic Acids for PCR Amplification
10.2.1 From fungal mycelia
Most methods for DNA isolation from mycelia involve an initial lysis stepusing freeze–thaw cycles (Garber and Yoder, 1983), or by grinding themycelia. Grinding is done with dry ice (Wahleithner et al., 1996), liquidnitrogen (Raeder and Broda, 1988; Lee and Taylor, 1990; Graham et al.,1994), liquid nitrogen and glass beads (Rao and Reddy, 1984), or glass beadsonly (van Vaerenbergh et al., 1995). This is followed by the use of phenol/chloroform/isoamyl alcohol extraction of the DNA and precipitation at ahigh salt concentration with isopropanol or ethanol (Sambrook et al., 1989).Gentle lysis of the mycelial cells by enzymatic hydrolysis (Black et al., 1989;Li and Ljungdahl, 1994) results in more intact DNA, but the yield is lower(van Vaerenbergh et al., 1995). Moreover, for use in PCR, mechanicalshearing of the genomic DNA during isolation is not a major concernprovided that the resulting DNA is ~10–20 kbp in size (Sogin, 1990; vanVaerenbergh et al., 1995). However, in cases where the same DNApreparations are used for both PCR and library construction, the DNAneeds to be relatively pure. This is accomplished by extraction with phenol(Ashktorab and Cohen, 1992), cetyltrimethylammonium bromide (Kim etal., 1990; Graham et al., 1994), or by using affinity chromatography (e.g.Qiagen tip-500 mini-columns from Qiagen Inc., Los Angeles) (Wahleithneret al., 1996). In a recent study comparing various methods for extraction ofDNA for PCR, it was reported that relatively pure DNA was needed evenfor PCR applications in order to remove inhibitors of Taq polymerase,especially from DNA samples of certain pigmented fungi (van Vaerenberghet al., 1995). These researchers also found that the use of glass beads for DNAisolation reduced the amount of contaminating polysaccharides and inhibi-tors, and suggested that the freeze–thaw-based method for DNA isolationwas superior to the other methods tested.
Fungal RNA isolation for use in PCR is based on standard protocolsusing a guanidinium isothiocyanate step (Lucas et al., 1977; Chirgwin et al.,1979; Timberlake and Barnard, 1981; Sims et al., 1988; Sambrook et al., 1989),followed by ethanol precipitation in the presence of high concentration of
206 C.A. Reddy and T.M. D’Souza
salt (Sambrook et al., 1989; James et al., 1992), or isolation using affinity-based systems (Li and Ljungdahl, 1994; Wahleithner et al., 1996). Poly(A)-RNA is isolated from total RNA preparations using affinity column systemscontaining oligo-dT-cellulose (de Boer et al., 1987; Sambrook et al., 1989;Johnston and Aust, 1994a; Tempelaars et al., 1994), or magnetic beads(Brooks et al., 1993; Broda et al., 1995; Lamar et al., 1995).
10.2.2 From soil
Approaches used for the isolation of total DNA from soil, for PCRamplification of the fungal DNA component, are similar to those usedfor isolation and PCR amplification of soil bacterial DNA describedpreviously (reviewed in Bej and Mahbubani, 1992; Picard et al., 1992;Tebbe and Vahjen, 1993; More et al., 1994; Selenska-Pobell, 1995; Van Elsasand Smalla, 1995). Johnston and Aust (1994b) used DNA extractionfollowed by PCR amplification for detecting fungal DNA in soils spikedwith basidiomycetes. However, detection limits were low when comparedto the use of template DNA isolated from pure cultures; this could bedue to interference with the PCR amplification of the fungal DNA bythe contaminating humic acids and DNA from other soil organisms(Tebbe and Vahjen, 1993; Tsai and Olson, 1993). In addition, clay in thesoil can bind DNA and reduce the yield (Ogram et al., 1987). Anotherapproach used is first to extract fungal cells from the soil and then extractthe DNA; however, this approach is found to be less efficient (Hilger andMyrold, 1991). Recently, Thorn et al. (1996) described a procedure inwhich they used a selective medium for isolating diverse groups of soilbasidiomycetes. However, it is not known what proportion of the totalbasidiomycetes in soil were isolated by this method. DNA isolated fromselected pure cultures of soil basidiomycetes, utilizing the procedure ofThorn et al. (1996), is currently being used in PCR for the isolation oflaccase and lip gene sequences (C.A. Reddy and T.M. D’Souza, unpub-lished work).
10.3 PCR Amplification Methods used in Studies onLignocellulose Degradation
A number of papers have been published recently on the use of PCRmethodology for a variety of studies on lignocellulose degradation bybasidiomycetes. These studies include the detection, isolation and character-ization of partial or complete lignocellulose degradative genes, the analysis ofallele segregation, and gene expression under varying environmental condi-tions. PCR procedures used in these studies include DNA-PCR, RT–PCR,competitive RT–PCR, and inverse PCR. In this section, we provide a briefdescription of these procedures.
Study of Lignocellulose Degradation 207
10.3.1 DNA-PCR
Replication of both strands of a target DNA sequence using a reactionmixture consisting of a thermostable DNA polymerase, forward and reverseoligonucleotide primers, the four deoxynucleotide triphosphates (dNTPs),magnesium ions and an appropriate template DNA is the standard procedureused for DNA-PCR (Saiki et al., 1985). The outcome is an exponentialamplification of the specific target fragment, depending on the number ofcycles of amplification performed (Saiki et al., 1985; Mullis and Faloona,1987; Saiki et al., 1988; Vahey et al., 1995). Recent technologies have refinedthis basic PCR procedure to make it simpler and more efficient, resulting inenhanced amplification fidelity, higher specificity and minimizing DNAcontamination problems.
In studies on lignocellulose degradation by fungi, conventional DNA-PCR procedures have been used to isolate and characterize lignin peroxidase(Johnston and Aust, 1994b; Collins and Dobson, 1995; Rajakumar et al.,1996; Schneider et al., 1996), manganese peroxidase (Asada et al., 1995),laccase (Giardina et al., 1995; Wahleithner et al., 1996; Yaver et al., 1996;D’Souza et al., 1996), cellobiohydrolase (Covert et al., 1992; Tempelaars etal., 1994), cellulase (Chow et al., 1994) and xylanase (Li and Ljungdahl, 1994)genes, as well as to analyse the allelic segregation patterns of some of thesegenes (Gaskell et al., 1992, 1994, 1995). The procedure has also been used toinvestigate the expression of lignocellulose degradative genes under varyingenvironmental conditions (Covert et al., 1992; Brooks et al., 1993; Reiser etal., 1993; Broda et al., 1995; Gaskell et al., 1995; Rajakumar et al., 1996) asdescribed in later sections in this chapter.
10.3.2 RT–PCR
RNA can also serve as a template for PCR amplification after conversion tocDNA (Todd et al., 1987; Veres et al., 1987). RNA-PCR, or RT–PCR(reverse transcriptase–PCR) as it is more popularly known, is a modifiedPCR procedure designed for analysing RNA transcripts. RT–PCR is moresensitive than other methods used for RNA analysis, such as Northernhybridization, S-1 nuclease analysis, RNase A protection assay and in situhybridization (Kawasaki, 1990). The first step in this procedure is thesynthesis of cDNA from RNA using reverse transcriptase. First strandcDNA is synthesized using either total RNA or mRNA as template.Random hexamers, the downstream primer, or oligo-dT can be used asprimers, although the use of random hexamers consistently gives betteramplification than the other two primers (Kawasaki, 1990). Since single RNAmolecules can be amplified efficiently, even relatively crude RNA prepara-tions can be used as the starting template for RT–PCR. The newlysynthesized first strand cDNA is then used as a template for PCR, and thetarget fragment is amplified. In cases where the downstream primer is usedfor first-strand cDNA synthesis, it is necessary to add only the upstream
208 C.A. Reddy and T.M. D’Souza
primer to the reaction mixture. However, both primers should be used forPCR in cases where random hexamers or oligo-dT primers were used in thefirst-strand cDNA synthesis (Ausubel et al., 1995). Contaminating DNAserving as the template is a common problem encountered in RT–PCR.Solutions to this problem include the use of primers positioned in separateexons (Kawasaki, 1990), or RNase-free DNase I digestion to remove thecontaminating DNA (Ausubel et al., 1995).
In studies on lignocellulose degradation by basidiomycetes, theRT–PCR technique has been used in the isolation of lignin peroxidase(Rajakumar et al., 1996), manganese peroxidase (Matsubara et al., 1996),laccase (Giardina et al., 1995) and cellobiohydrolase (Covert et al., 1992)genes. The RT–PCR procedure has also been used in allele segregationstudies (Gaskell et al., 1995), and to investigate the expression of ligno-cellulose genes under different environmental conditions (Covert et al., 1992;Brooks et al., 1993; Johnston and Aust, 1994a; Broda et al., 1995; Gaskell etal., 1995; Lamar et al., 1995; Bogan et al., 1996b).
10.3.3 Competitive RT–PCR
Competitive RT–PCR is a technique that is commonly used for quantificationof specific mRNA species (Gilliland et al., 1990). This procedure involvesco-amplification of a competing template that uses the same primers as thosefor the target cDNA, but the amplified products can be distinguished fromeach other as described below. Competitive templates can be either cDNA witha new restriction site, or genomic DNA containing an intron in the region to beamplified; the amplified product of the competitive template can then bedifferentiated from the amplified product of the target DNA based on size.PCR amplification with genomic DNA as the competitive template may not beas efficient as that using cDNA because of the size increase and changes induplex melting temperature (Gilliland et al., 1990). Target cDNA should beco-amplified with serial dilutions of competitor DNA of known concentra-tion. Since a change in any of the variables (such as polymerase, dNTPs, Mg2+,template DNA and primers) will affect the yield of target cDNA and thecompetitive template equally, relative ratios of the two should be preservedduring amplification. The target cDNA concentration can then be estimatedby direct scanning of ethidium bromide-stained gels or by measuring theradioactivity from incorporated radiolabelled dNTPs. Since the startingconcentration of the competitive template is known, the initial concentrationof the target cDNA can be determined fairly accurately. For example, it hasbeen claimed that less than 1 pg of target cDNA from 1 ng of total mRNA canbe accurately quantified using this procedure (Gilliland et al., 1990).
The competitive RT–PCR procedure has been employed in studying theexpression of lignin peroxidase (Stewart et al., 1992; Lamar et al., 1995),manganese peroxidase (Bogan et al., 1996a) and cellobiohydrolase (Lamar etal., 1995) genes.
Study of Lignocellulose Degradation 209
10.3.4 Inverse PCR
DNA sequences that are outside of the target DNA sequence flanked by thePCR primers can also be amplified by a modification of the basic PCRprocedure designated ‘inverse PCR’. In this approach, the template isdigested with a restriction enzyme that cuts outside the region to beamplified; the restricted template is then circularized by ligation, and theregion outside the target sequence is amplified using primer sequences in theopposite orientation to those used for the initial PCR (Ochman et al., 1988;Triglia et al., 1988; Silver and Keerikatte, 1989). The inverse PCR method hasbeen extremely useful in studying upstream and downstream regions of atarget DNA segment, without the need to use conventional cloningtechniques. It can also be used to prepare hybridization probes to identifyand orient adjacent/overlapping clones isolated from a DNA library (Och-man et al., 1990). The inverse PCR technique has been used in isolating thecellobiohydrolase gene (Tempelaars et al., 1994).
10.4 Applications of PCR in Studies on LignocelluloseDegradation by Basidiomycetes
10.4.1 Detection, isolation, and characterization of genes involved inlignocellulose degradation
Wood-rot basidiomycetes are efficient degraders of the lignocellulose com-plex. The key enzymes involved are lignin peroxidases (LIP), manganese-dependent peroxidases (MNP), laccases, cellulases and xylanases. Several LIP(H1, H2, H6, H7, H8, and H10), and MNP (H3, H4, H5, and H9) isozymesproduced by Phanerochaete chrysosporium, the prototype organism forstudies on lignin degradation, have been described (Kirk and Farrell, 1987;Boominathan and Reddy, 1992; Cullen and Kersten, 1992; Gold and Alic,1993). Recent studies have used PCR techniques to obtain a better under-standing of the genes involved in lignocellulose degradation by P. chrysospo-rium, as well as a number of other wood-rot basidiomycetes.
Lignin peroxidase genesJohnston and Aust (1994a) designed oligonucleotide primers H8I (forward)and H8II (reverse), corresponding to positions starting at 252 and 868 in theLIP H8 gene (Smith et al., 1988) of P. chrysosporium BKM-F 1767, for thedetection of LIP H8 mRNA by RT–PCR (Table 10.1). Sequencing of a 402bp PCR product verified the presence of H8 mRNA under N-limited orN-sufficient culture conditions. In another study, Johnston and Aust (1994b)used the same primers to detect P. chrysosporium in soil by PCR amplifica-tion using total DNA isolated from soil as the template. This resulted in theamplification of a 616 bp PCR fragment. However, they report that themethod for detecting P. chrysosporium BKM-F 1767 using the H8 gene
210 C.A. Reddy and T.M. D’Souza
primers was not as sensitive as that using the internal transcribed spacer (ITS)region of fungal ribosomal DNA (see Table 10.6).
Collins and Dobson (1995) described a method for PCR amplificationand cloning of lip gene sequences from four different white-rot fungi,including P. chrysosporium ATCC 32629, Chrysosporium lignosum PM1,Coriolus versicolor 290, and Bjerkandera adusta DSM 3375. Genomic DNAwas used as the template, with oligonucleotide primers corresponding to theconserved amino acid motifs present in the distal and proximal histidineregions of several P. chrysosporium LIP isozymes (Table 10.1). PCR-amplified products, ranging between 600 and 700 bp, were sequenced andfound to have a nucleotide similarity of 70–80%. One of the PCR productswas also found to have a 90% similarity with GLG5, which encodes the LIPisozyme H10 (Gaskell et al., 1991).
PCR-amplification procedures were also used to determine the possiblepresence of lip gene sequences in genomic DNA of two white-rot basidiomy-cetes Ceriporiopsis subvermispora and Phanerochaete sordida, which werenot known to produce LIPs (Rajakumar et al., 1996). Degenerate oligo-nucleotide primers were prepared corresponding to amino acid motifssurrounding an essential histidine residue highly conserved in LIPs but notin MNPs (Table 10.1). Three genomic clones, two from C. subvermispora,and one from P. sordida, were obtained after cloning of the PCR-amplifiedproducts. These clones showed 92.6–95.6% amino acid similarity to lip A,which encodes the LIP isozyme H8 in P. chrysosporium (Gaskell et al.,1994).
Schneider et al. (1996) used oligonucleotide primers specific for theH8-encoding LPOA gene of P. chrysosporium BKM-F 1767 (Holzbaur andTien, 1988) to PCR-amplify a 1590 bp fragment, designated HG3, from thegenomic DNA of this organism. Cloning and sequencing of HG3 showedthat it is related to, but distinct from, LPOA (Holzbaur and Tien, 1988) andGLG3 (Naidu and Reddy, 1990), both of which are known to encode LIP H8in P. chrysosporium, and that HG3 is possibly a non-allelic variant of the P.chrysosporium BKM-F 1767 LIP H8 gene.
Manganese-dependent peroxidase genesAsada et al. (1995) amplified mnp gene-specific sequences from genomicDNA and cDNA of Pleurotus ostreatus using PCR. Synthetic 30- to 32-merprimers (sequences not shown) that match the exon sequences around theproximal and distal His residues of the MNP of P. chrysosporium were usedto obtain PCR products pcr1 using genomic DNA as the template, and pcr2using cDNA as the template. Both pcr1 and pcr2 were cloned and sequenced.A subsequent PCR, using cDNA as the template, and a 32-mer upstreamprimer (sequence not shown) corresponding to the N-terminal amino acidsequence of the purified MNP, and a 30-mer downstream primer (sequencenot shown) corresponding to a region near the 3′-end of pcr2, yielded a thirdPCR product, designated pcr3. Comparison of the deduced amino acid
Study of Lignocellulose Degradation 211
Table 10.1. Primers used for PCR amplification of lignin peroxidase-encoding genomic DNA and cDNA sequences.
Genea OrganismPCRb
procedure 5′ Primer 3′ Primer
Amplifiedproduct(bp)b Referenceb
LPOA
(LIP H8)
Phanerochaete chrysosporium
BKM-F 1767
DNA-PCR1
RT–PCR2
TGAGGCGCACGAGTCGATTCGTCT
(H8I)
GACAAGCTCGAGCTCCTCGAACTC
(H8II)
6161, 4022 Johnston and
Aust (1994a1,
b2)
lip P. chrysosporium ATCC
32699, Chrysosporium
lignorum PM1, Coriolus
versicolor 290, Bjerkandera
adusta DSM 3375
DNA-PCR T
TTCCACGATGCCATCGC
CT G T
T
GCAGCAATAGAATGGGC
C G CG G C
500–700 Collins and
Dobson (1995)
lip P. sordida HHB-8922,
Ceriporiopsis subvermispora
L14807
DNA-PCR C A A
GCCTCGTGCCCGAGCCCTTCC
T T T G G
T
AGCTGCGTCTCGATGAAGAACTG
A A C
208–312 Rajakumar et al.
(1996)
HG3
(LIP H8)
P. chrysosporium
BKM-F 1767
DNA-PCR ACTAAGCTTGAGCGGACATGGCCTT-
CAAGCA
CGCTGGATCCTATGGCATCATTTAAGCACC 1590 Schneider et al.
(1996)
lipA
(LIP H8)
P. chrysosporium
BKM-F 1767
RT–PCR GCAGCTATCTCTCTCGCTCT TCCCAGTTCTTCGTCGAG 683, 1012 Stewart et al.
(1992); Lamar
et al. (1995)
lipB
(LIP H8)
P. chrysosporium
BKM-F 1767
RT–PCR GCAGCGATTTCCCTCGCACT TCCCAGTTCTTCGTCGAG 683, 1006 Stewart et al.
(1992)
GLG5, lipC
(LIP H10)
P. chrysosporium
BKM-F 1767
RT–PCR GCTGTTCTTACCGCCGCTCT TCCCAGTTCTTCGTCGAG 677, 999 Stewart et al.
(1992); Lamar
et al. (1995)
GLG4,
lipD
(LIP H2)
P. chrysosporium
BKM-F 1767
RT–PCR CAGCCCTCTCCGTCGCCCTG TCCCAGTTCTTCGTCGAG 685, 1000 Stewart et al.
(1992); Lamar
et al. (1995)
lipE
(LIP H8)
P. chrysosporium
BKM-F 1767
RT–PCR TCGCCGCGATCACCGTCGCC TCCCAGTTCTTCGTCGAG 685, 1006 Lamar et al.
(1995)
0282
(LIP H2)
P. chrysosporium
BKM-F 1767
RT–PCR GCGGCTATCTCTCTTGCGCT TCCCAGTTCTTCGTCGAG 683, 1020 Stewart et al.
(1992)
V4
(LIP H2)
P. chrysosporium
BKM-F 1767
RT–PCR GCCATCGCGATCTCTCCC GACAAAGAATTGCGTATC 479, 694 Stewart et al.
(1992)
LIG1
(LIP H8)
P. chrysosporium
ME446 (ATCC 34541)
RT–PCR GCCGCAATTTCTCTTGCTCTTTCCA
[UMG#90019]
TACATCGAACCACGCGCACGATGATT
[UMG#90020]
1233, 1264,
1783, 1794
Brooks et al.
(1993)3; Broda
et al. (1995)4
LIG2
(LIP H8)
P. chrysosporium
ME446 (ATCC 34541)
RT–PCR CATCGCAATTTCGCCCGCCATG-
GAGGCA
ACCTTCTGAACGAATGGCTTCTGGAGC 179, 222 Broda et al.
(1992)
LIG3
(LIP H8)
P. chrysosporium
ME446 (ATCC 34541)
RT–PCR TATTGCCATCTCTCCTGCTATGGAGGCC ATGTTAGGGTGGAAGTTGGGCTCGATG 126, 179 Broda et al.
(1995)
LIG4
(LIP H8)
P. chrysosporium
ME446 (ATCC 34541)
RT–PCR GTGCGCCTGGTTCCCCATTCTGCAG AATTGGTCTCGATAGTATCGAAGAC 222, 350 Broda et al.
(1995)
LIG5c
(LIP H2)
P. chrysosporium
ME446 (ATCC 34541)
RT–PCR TTGCCCCGACGGCGTGCACAC
[UMG#90084]
GGTCTCGATCGAGGAGAAGGTAATGATC
[UMG#90081]
2353, 3553,
2224, 3504
Brooks et al.
(1993)3; Broda
et al. (1995)4
LIG6
(LIP ?)
P. chrysosporium
ME446 (ATCC 34541)
RT–PCR GACCTGCTCGAACGGCAAGGTCGTCC CATGATAGAACCATCGGCGCCTCGC 222, 350 Broda et al.
(1995)
lip P. chrysosporium
BKM-F 1767 (ATCC 24725)
DNA-PCR GGAATTCCACGATGCNATCGC
CT T
[Oligo D]
T G CG G C
AACTGCAGCAGCAATAGAATGTGC
C G
[Oligo P]
Not given Reiser et al.
(1995)
lipI
(LIP H2)
P. chrysosporium
ME446
RT–PCR TATATGCCTCTGAGCTCCTG ACGTCTGTCTAGAAGTATGC 683, 1020 Gaskell et al.
(1995)
lip P. sordida
HHB-8922
RT–PCR C A A
GCCTCGTGCCCGAGCCCTTCC
T T T G G
CGACTCAGAGCTACTTCTTGA ~200, ~310 Rajakumar et al.
(1996)
lip C. subvermispora
L14807
RT–PCR TTGTGCCGGAGCCGTTCC GAAGAACTGGGAGTCGAA No product Rajakumar et al.
(1996)
lipA
(LIP H8)
P. chrysosporium
BKM-F 1767
RT–PCR TCCATCGCAATTTCGCCC ACACGGTTGATGATTTGG 301,
not given
Bogan et al.
(1996b)
lipB
(LIP H8)
P. chrysosporium
BKM-F 1767
RT–PCR GCTATTGCCATCTCTCCT ACACGAGCGATGATCTGG 301,
not given
Bogan et al.
(1996b)
lipC
(LIP H10)
P. chrysosporium
BKM-F 1767
RT–PCR GCCATCGCTATCTCTCCC ACACGGTCGATGATTTGG 298,
not given
Bogan et al.
(1996b)
continued overleaf
Table 10.1 continued.
Genea OrganismPCRb
procedure 5′ Primer 3′ Primer
Amplifiedproduct(bp)b Referenceb
lipD
(LIP H2)
P. chrysosporium
BKM-F 1767
RT–PCR TCCATCGCTATCTCGCCC ATGCGAGCGAGAACCTGA 301,
not given
Bogan et al.
(1996b)
lipE
(LIP H8)
P. chrysosporium
BKM-F 1767
RT–PCR TCCATCGCCATCTCGCCC ACGCGGGCGATGATCTGG 301,
not given
Bogan et al.
(1996b)
lipF
(LIP ?)
P. chrysosporium
BKM-F 1767
RT–PCR TGCCCTTGAGTCTCAAGG ACGCGAGAGATGATGTGG 301,
not given
Bogan et al.
(1996b)
lipG
(LIP H8)
P. chrysosporium
BKM-F 1767
RT–PCR TCGATCGCCATCTCGCCC ACACGCTCGATGAGCTGG 301,
not given
Bogan et al.
(1996b)
lipH
(LIP H8)
P. chrysosporium
BKM-F 1767
RT–PCR GCAATTGCCATCTCGCCC ACACGGTTAATGAGCTGG 301,
not given
Bogan et al.
(1996b)
lipI
(LIP H2)
P. chrysosporium
BKM-F 1767
RT–PCR TCTATCGCTATCTCTCCC ACACGGCTGATGATTTGA 301,
not given
Bogan et al.
(1996b)
lipJ
(LIP H2)
P. chrysosporium
BKM-F 1767
RT–PCR GCCATCGCGATCTCTCCC ACCCGAGCCAGGATTTGA 298,
not given
Bogan et al.
(1996b)
aLignin peroxidase isozymes encoded by the given lip genes (Kirk and Farrell, 1987; Boominathan and Reddy, 1992; Cullen and Kersten, 1992; Gold andAlic, 1993) are given in parentheses.bSuperscripts in the ‘PCR procedure’ and ‘Amplified product’ columns refer to the corresponding superscripts in the ‘Reference’ column.cThe upstream and downstream sequences of the primers for LIG5 were erroneously switched in Table 1 of Broda et al (1995). These sequences are showncorrectly in this Table and in Brooks et al (1993).
sequence of pcr3 to the N-terminal amino acid sequences of MNPs revealedthat it was part of an MNP gene. Using the cassette–primer PCR techniqueand a high fidelity Takara EX Taq polymerase, full-length sequences ofgenomic DNA and cDNA of the mnp gene were then obtained, cloned,sequenced and analysed. Their results showed that the P. ostreatus mnp geneis more closely related to the P. chrysosporium lip genes, with respect tosequence similarity and intron/exon organization, than to the mnp genes ofthis organism.
Full-length mnp genes were also obtained using PCR with primers(Table 10.2) corresponding to the region of the translational start and stopcodons of mnp genes of P. chrysosporium BKM-F 1767 (Bogan et al., 1996a).These PCR-amplified MNP gene products served as templates in com-petitive RT–PCR experiments to analyse mnp transcripts of P. chrysosporiumBKM-F 1767 during bioremediation of soils contaminated with poly-aromatic hydrocarbons (PAH) (described in section 10.4.3).
Matsubara et al. (1996) performed RT–PCR of poly(A)-RNA from thelignin-degrading deuteromycete IZU-154. DNA primers were synthesizedcorresponding to amino acid sequences around distal and proximal histidineresidues in mnp genes of P. chrysosporium (Table 10.2). The resulting PCRfragments, approximately 400 bp in size, were isolated and labelled withdigoxigenin using the DIG DNA labelling kit (Boehringer Mannheim), andwere used to screen the cDNA library of IZU-154. Eight positive cloneswere obtained and separated into two groups based on restriction enzymemapping and partial nucleotide sequences. Two cDNAs (IZ-MnP1 andIZ-MnP2), representative of the two groups, were further analysed. Thecoding sequences of IZ-MnP1 and IZ-MnP2 were 1152 bp (384 amino acids)and 1155 bp (385 amino acids), respectively, and showed 96.2% nucleotideand 95.1% amino acid similarities to each other. Also, IZ-MnP1 showed72.5% nucleotide and 79% amino acid similarity to P. chrysosporium mnp1cDNA (Pribnow et al., 1989).
Laccase genesLaccase, in addition to its role in lignin biodegradation (Bourbonnais andPaice, 1990; Hatakka, 1994), also has important applications in the bleachingof wood pulp (Bourbonnais and Paice, 1992) and the degradation of phenoliccompounds (Bollag et al., 1988; Roy-Arcand and Archibald, 1991). Thestructure and function of fungal laccases were reviewed by Thurston (1994).A number of researchers have used PCR as a tool in their studies on thelaccase genes of wood-rotting basidiomycetes (Giardina et al., 1995, 1996;Yaver et al., 1996; Wahleithner et al., 1996; D’Souza et al., 1996) and thesestudies are reviewed in this section.
Giardina et al. (1995) used RT–PCR and the rapid amplification ofcDNA ends (RACE) technique (Frohman et al., 1988) to amplify partialcDNA fragments encoding the laccase pox1 gene from the white-rotbasidiomycete Pleurotus ostreatus. After first-strand cDNA synthesis using
Study of Lignocellulose Degradation 215
Table 10.2. Primers used for PCR amplification of manganese peroxidase-encoding genomic DNA and cDNA sequences.
Genea OrganismPCRprocedure 5′ Primer 3′ Primer
Amplifiedproduct(bp) Reference
mnp-1
(MNP H4)
Pleurotus ostreatus IFO 30160 DNA-PCR Not given Not given Not given Asada et al.
(1995)
mnp-1
(MNP H4)
P. chrysosporium
BKM-F 1767 (ATCC 24725)
DNA-PCR GCAATGGCCTTCGGTTCTCT TTAGGCAGGGCCATCGAACT Not given Bogan et al.
(1996a)
mnp-2
(MNP ?)
P. chrysosporium
BKM-F 1767 (ATCC 24725)
DNA-PCR CAGATGGCCTTCAAGTCCCT TTATGCGGGACCGTTGAACT Not given Bogan et al.
(1996a)
mnp-3
(MNP H3)
P. chrysosporium
BKM-F 1767 (ATCC 24725)
DNA-PCR GCACTCAAGCCAGCGCAATG TGTCCGGCGCGTCAGACTTA Not given Bogan et al.
(1996a)
MNP Fungus IZU-154,
P. chrysosporium ME446
RT–PCR ATCCGCCTCACCTTCCACGA GCGACGGAGTGGGAGGCGAG ~400 Matsubara et al.
(1996)
mnp1
(=mnp-2)
(MNP ?)
P. chrysosporium
ME446 (ATCC 34541)
RT–PCR TCCGGTCAACGGCTTGGTATTCCAG GCGATCGTCTTGTTCGGGCGGCCAG 517, 676 Broda et al.
(1996)
mnp-1
(MNP H4)
P. chrysosporium
BKM-F 1767 (ATCC 24725)
RT–PCR CAGACGGTACCCGCGTCACC AGTGGGAGCGGCGACATCAC Not given Bogan et al.
(1996a)
mnp-2
(MNP ?)
P. chrysosporium
BKM-F 1767 (ATCC 24725)
RT–PCR CCGACGGCACCCGCGTCAGC CGAGCGGGAGCGGCGACGCC Not given Bogan et al.
(1996a)
mnp-3
(MNP H3)
P. chrysosporium
BKM-F 1767 (ATCC 24725)
RT–PCR CCGACGGTACCAAGGTCAAC AGCGGCAGCGGCGACGCGAC Not given Bogan et al.
(1996a)
aManganese peroxidase isozymes encoded by the given mnp genes (Kirk and Farrell, 1987; Boominathan and Reddy, 1992; Cullen and Kersten, 1992; Goldand Alic, 1993) are shown in parentheses.
reverse transcriptase (RT) and the RT primer, another primer was used toamplify a 750 bp cDNA fragment corresponding to the 3′-end of the pox1gene (Table 10.3). A second PCR was carried out using two new primers andthe first-strand cDNA as template to amplify a 900 bp cDNA fragmentcorresponding to the 5′-end of the pox1 gene. Except the RT primer, theprimers were derived from the genomic DNA sequence determined earlierfor the pox1 gene (Table 10.3). Together the two PCR fragments obtainedaccounted for the entire pox1 cDNA. The deduced amino acid sequence ofpox1 showed 45–63% similarity with the laccase genes of Coriolus hirsutus,basidiomycete PM1 (CECT 2971), Phlebia radiata and Agaricus bisporus,but only 20–27% similarity with the laccase genes of Neurospora crassa,Aspergillus nidulans and Cryphonectria parasitica (Giardina et al., 1995). Inorder to determine whether pox1 and pox2 (another P. ostreatus laccase gene)were allelic or not, two separate PCR amplification experiments wereperformed using the genomic DNA from six monokaryotic isolates as thetemplates. The two primer sets were located at identical positions on bothpox1 and pox2 sequences, thus resulting in the amplification of 570 bpfragments (Table 10.3). However, the two products were distinguishablebecause of the presence of a unique HindIII site in pox1, and a uniqueBamHI in pox2. The results showed that the two genes segregated togetherinto monokaryons and hence were non-alleles (Giardina et al., 1995).
In a subsequent study, Giardina et al. (1996) used RT–PCR to synthesizethe entire laccase pox2 cDNA sequence, as well as the genomic equivalent ofthe pox2 gene. RT–PCR was done using mRNA and the oligonucleotideprimer dT-NotI (Table 10.3). This was followed by PCR with the highfidelity Pfu polymerase, using the primer pairs O1/O2, LAC1/LAC2, andLAC3/dTNotI (Table 10.3), at annealing temperatures of 50°C, 60°C and53°C, respectively. To amplify the 3′-end of the pox2 gene, primer pairsLAC3/LAC4 (Table 10.3) were used with Pfu polymerase, genomic DNA astemplate, and an annealing temperature of 60°C. The pox2 cDNA had 84%nucleotide and 90% amino acid similarity with the pox1 cDNA (Giardina etal., 1996).
Yaver et al. (1996) used RT–PCR and two degenerate oligonucleotideprimers (Table 10.3), one based on the N-terminal sequence of laccase and theother based on the C-terminal sequence of the C. hirsutus gene, to amplify alaccase gene-specific PCR product from Trametes villosa using first-strandcDNA synthesized from poly(A)-RNA of xylidine-induced cells. The first-strand cDNA was synthesized using reverse transcriptase and a commercialcDNA synthesis kit (Gibco BRL). The PCR product was then used as a probeto screen a cDNA library of T. villosa and obtain more than 100 positive clones.Out of these, the longest clone (LCC cDNA) was sequenced and found to havean identity of 90% with the sequence of the C. hirsutus laccase.
A 220 bp PCR-amplified fragment, isolated from genomic DNA of thephytopathogenic fungus Rhizoctonia solani with oligonucleotide degenerateprimers, was used to isolate laccase gene sequences from a R. solani genomic
Study of Lignocellulose Degradation 217
Table 10.3. Primers used for PCR amplification of laccase-encoding genomic DNA and cDNA sequences.
Genea OrganismPCRprocedure 5′ Primer 3′ Primer
Amplifiedproduct(bp) Referencea
Laccase
(3′-pox1)
Pleurotus ostreatus
(str. Florida)
RT–PCR CGCAGATCCCAACTTGGGATCGACTGGCTT
[03]
AATTCGCGGCCGCTTTTTTTTTTTTTTT
[04]
750 Giardina et al.
(1995)
Laccase
(5′-pox11,
5′-pox22)
Pleurotus ostreatus
(str. Florida)
RT–PCR ATGTTTCCAGGCGCACGG
[01]
CCAGTCGATCCCAAGTTGGG
[02]
900 Giardina et al.
(19951, 19962)
Laccase
(pox1)
Pleurotus ostreatus
(str. Florida)
DNA-PCR GCTGGCACGTTCTGTAAG
[05]
TCTGCCTCGATGACCTGC
[06]
570 Giardina et al.
(1995)
Laccase
(pox2)
Pleurotus ostreatus
(str. Florida)
DNA-PCR GCTGGAACGTTTTGTAAG
[07]
TCTGCTTCAATGACGAGC
[09]
570 Giardina et al.
(1995)
Laccase
(3′-pox2)
Pleurotus ostreatus
(str. Florida)
RT–PCR CGCTCTAGACTCGTCATTGAAGCAGATG
[LAC1]
GCGCTGCAGCTAAGCTATGCCACCTTTGTC
[LAC2]
842 Giardina et al.
(1996)
Laccase
(3′-pox2)
Pleurotus ostreatus
(str. Florida)
RT–PCR CATCCATTCCATCTTCACGGC
[LAC3]
AATTCGCGGCCGCTTTTTTTTTTTTTTT
[dt-Not I] [=04, see above]
434 Giardina et al.
(1996)
Laccase
(3′-pox2)
Pleurotus ostreatus
(str. Florida)
DNA-PCR CATCCATTCCATCTTCACGGC
[LAC3]
CGTCGGAGATGAGGTTC
[LAC4]
Not given Giardina et al.
(1996)
Laccase Trametes villosa RT–PCR ACCAGNCTAGACACGGGNTGAGATACT-
GACGNGAAGCGGACTTGCTGGTCACT-
ATCTTCGAAGATCTCG
CGCGGCCGCTAGGATCCTCACAATGGCCAA-
GTCTCTGCCTCGACCTTC
Not given Yaver et al.
(1996)
Laccase Rhizoctonia solani DNA-PCR T
ATCCATTGGCATGGNTTTTTTCAA
A C C C C G
GTGNCAATGATACCAGAANGT
A GTG G A
220 Wahleithner et
al. (1996)
Laccase Fomes fomentarius
TVJ-93-7-T, Ganoderma
lucidum (strains 58537
and 103561), Gloeophyl-
lum trabeum Madison-
617-R, Grifola frondosa,
Lentinula edodes RA-
3-2-E, Lentinus tigrinus,
Phlebia brevispora HHB-
7099-Sp, Phlebia tremel-
losa FP-101416, Pleuro-
tus ostreatus NRRL 2366,
Trametes (Coriolus) versi-
color ATCC 12679
DNA-PCR CATTGGCATGGNTTTTTTCA
C C C C
GTGGCTATGATACCAGAANGT
A A G G A
144–217 D’Souza et al.
(1996)
aSuperscripts in the ‘Gene’ column refer to the corresponding superscripts in the ‘Reference’ column.
DNA library (Wahleithner et al., 1996). The primers corresponded to twoamino acid sequences conserved among laccases (IHWHGFFQ andTFWYHSH; Table 10.3). The sequence of the cloned PCR fragment had60% similarity to the corresponding region of a C. hirsutus laccase gene(Kojima et al., 1990). Sequencing of 15 other PCR clones established thepresence of three distinct laccase genes, designated lcc1, lcc2, and lcc3. Usingthe cloned PCR fragment as the probe, nine genomic clones were isolatedfrom the R. solani genomic library.
D’Souza et al. (1996) used primers (Table 10.3), based on the conservedsequences around the two pairs of histidines in the N-terminal copper-binding regions of known basidiomycete laccases, to rapidly isolate laccasegene-specific sequences from different wood-rot basidiomycetes. GenomicDNA was isolated from each of the wood-rot fungi and used as the templatein PCR. Of the 11 white-rot and brown-rot fungi (belonging to nine genera)used for the amplification of the laccase gene-specific PCR products, eightgave amplification products of approximately 200 bp. One strain, Gloeo-phyllum trabeum Mad-617-R, a brown-rot fungus, gave a 144 bp PCRproduct. No PCR products were obtained for Fomes fomentarius andPleurotus ostreatus, two white-rot fungi which are known to producelaccases (Hatakka, 1994). However, Southern hybridization of restrictionenzyme-digested genomic DNA of F. fomentarius and P. ostreatus, using theG. trabeum 144 bp PCR product as the probe, showed hybridization bandsindicating that laccase genes are present in these two strains. Several of thewhite-rot fungi tested gave two PCR products, one of 144 bp, and the otherof the expected 200 bp. Sequencing of the larger PCR product revealed a sizerange of 197–217 bp; the smaller PCR products all were 144 bp in size(D’Souza et al., 1996). All the PCR products sequenced had a high degree ofsimilarity to corresponding regions of previously published laccase genesequences. Alignment of the predicted amino acid sequences of the PCR-amplified products showed high similarities between the laccase genesegments of the wood-rotting fungi and lower similarities to those ofAspergillus nidulans and Neurospora crassa, two laccase producing non-wood rotters (Fig. 10.1). Following up on the demonstration of a laccasegene-specific PCR product from the genomic DNA of the brown-rot fungusG. trabeum, D’Souza et al. (1996) demonstrated for the first time thepresence of laccase activity in cultures of this and other brown-rot fungi.Using the approach described above, a laccase gene-specific 199 bp PCRproduct was recently isolated and sequenced from a soil basidiomycete,AX-1 (Srinivasan et al., 1996). The laccase gene fragment of AX-1 showed ahigh degree of nucleotide similarity (62–94%) to the corresponding portionsof laccase genes from wood-rotting basidiomycetes.
Cellulase genesA large number of microorganisms degrade cellulose in nature; of these,fungi are perhaps the most studied. Cellulolytic enzymes include the
220 C.A. Reddy and T.M. D’Souza
hydrolytic cellulases and oxidative cellulases. Hydrolytic cellulases consistof three classes: endoglucanases (EG), cellobiohydrolases (CBH) andβ-glucosidases. Oxidative cellulases consist of two classes: cellobiose qui-none oxidoreductase (cellobiose dehydrogenase) and cellobiose oxidase(Eriksson et al., 1990; Beguin and Aubert, 1995). Fungal and bacterialcellulases share similar functional characteristics, including a catalytic core, aconserved cellulose-binding terminal region, and an intervening, highlyglycosylated hinge region (Knowles et al., 1987; Gilkes et al., 1991; Bayer etal., 1996). A brief review of the use of PCR methodology for studying thecellulases of ligninolytic fungi is presented here.
Covert et al. (1992) characterized three structurally related CBH genes(cbh1-1, cbh1-2 and cbh1-3) from P. chrysosporium which were closelyrelated to the Trichoderma reesei cbh-1 gene (Shoemaker et al., 1983). Full-length cDNA species encoding P. chrysosporium cbh1-1, cbh1-2 and cbh1-3were amplified by PCR, cloned, and sequenced. RT–PCR was carried outusing total RNA isolated from P. chrysosporium BKM-F 1767 cellulolytic
Fig. 10.1. Alignment of the predicted amino acid sequences of the PCR-amplifiedlaccase gene products (D’Souza et al., 1996). The abbreviations for the fungal strains are:Tv, Trametes versicolor; Pb, Phlebia brevispora; Gl103561 and Gl58537, Ganodermalucidum strains 103561 and 58537; Le1 and Le2, Lentinula edodes PCR products 1 and2; Lt, Lentinus tigrinus; Gt, Gloeophyllum trabeum; Tvi, Trametes villosa; Po, Pleurotusostreatus; PM1, unidentified basidiomycete; Ch, Coriolus hirsutus; Cv, Coriolus versicolor;Pr, Phlebia radiata; Ab, Agaricus bisporus; An, Aspergillus nidulans; Nc, Neurosporacrassa. Sequences from the latter nine organisms were taken from published literature (seeD’Souza et al., 1996). Alignment was done using the GENEPRO program (RiversideScientific Enterprises). The program introduces gaps where necessary to optimize thealignments. Amino acid positions with a ≥ 50% match are highlighted. Invariant amino acidpositions are shown in bold.
Study of Lignocellulose Degradation 221
cultures using downstream primers (Table 10.4) to synthesize first-strandcDNA of cbh1-1 and cbh1-3. Then, upstream primers were used to amplifythe cDNA for these two genes. The cDNA cbh1-2 was amplified by DNA-PCR employing double-stranded cDNA (synthesized using an oligo-dTprimer) as the template and two specific primers (Table 10.4) (Covert et al.,1992). A highly conserved region, assumed to be the catalytic site, within theP. chrysosporium cDNAs cbh1-1, cbh1-2 and cbh1-3 was 80%, 69% and 80%similar, respectively, to the corresponding region within the T. reesei cbh-1gene. However, analysis of the P. chrysosporium cbh1-1 gene revealed that itwas different from other fungal cellulase genes because it did not contain thehinge or tail regions. Transcription studies on these three genes were alsocarried out using competitive RT–PCR (described in Section 10.4.3).
Two allelic variants of the P. chrysosporium ME-446 cbhII gene wereisolated from a cDNA library after screening with a T. reesei cbhII geneprobe (Tempelaars et al., 1994). Characterization of these cDNAs byrestriction enzyme analysis, Southern hybridization analysis, and partialsequencing using the dideoxy chain-termination method, revealed that theywere very similar, and in the cellulose-binding domain had a 65% amino acidsimilarity to the corresponding region of the T. reesei cbhII gene. The resultsalso revealed that the entire cbhII gene is present on a PstI genomic fragment.Therefore, inverse PCR (Ochman et al., 1990) was used to amplify a 1.1 kbpfragment from PstI-digested and religated genomic DNA, using two primers(Table 10.4) deduced from the cbhII cDNA sequence, and the high fidelityPfu polymerase. The inverse PCR was followed by conventional DNA-PCRusing the 1.1 kbp PCR-amplified DNA fragment as the template and twoprimers, based on the DNA sequence adjacent to the PstI restriction site. Theresulting 2.3 kbp PCR-amplified genomic cbhII fragment was cloned,sequenced, and analysed. Sequence comparison showed that both thegenomic and cDNA clones represent two distinct classes (type 1 and type 2),which were later shown to be allelic variants (Tempelaars et al., 1994).
Chow et al. (1994) isolated two allelic forms of a cellulase (endogluca-nase) CEL3-encoding cDNA from a cDNA library of A. bisporus, animportant commercial mushroom. The cDNA library was constructed inlambda ZAP-PII (Raguz et al., 1992) from cDNA synthesized from acellulose-grown mycelial culture. A sample of this cDNA library was excisedin vivo as pBluescript plasmids with R408 helper phage (Short et al., 1988),and total plasmid DNA was isolated from the bacterial culture harbouringthese plasmids. PCR amplification was performed on the total plasmid DNAusing a 20-mer degenerate oligonucleotide (OL60B1, Table 10.4), which iscomplementary to a region from a 19 kDa CNBr CEL3-cleaved peptide, asthe reverse primer, and the T7 primer (Table 10.4) which corresponds to aregion 5′ of the insertion site in the pBluescript plasmid, as the forwardprimer. Three PCR amplified products, 400 bp, 600 bp and 1.1 kbp in size,were obtained. Northern hybridization studies showed that the 400 bp PCR
222 C.A. Reddy and T.M. D’Souza
Table 10.4. Primers used for PCR amplification of cellulase-encoding genomic DNA and cDNA sequences.
Gene OrganismPCRprocedure 5′ Primer 3′ Primer
Amplifiedproduct(bp)a Referencea
cbh1-1 P. chrysosporium
BKM-F 1767 (ATCC 24725)
RT–PCR GAGAATTCTGAAACCGCTACACATT TGAATTCCACCAATATTCACGCAGG Not given Covert et al.
(1992)
cbh1-2 P. chrysosporium
BKM-F 1767 (ATCC 24725)
DNA-PCR GAGAATTCGAGGTTGAGACGCGATA TTGTGACCCCAGCATTAGATACA Not given Covert et al.
(1992)
cbh1-3 P. chrysosporium
BKM-F 1767 (ATCC 24725)
RT–PCR GAGAATTCTACCGTCTGCTCACACT GAGAATTCCTTAGTAGCACTGGGA Not given Covert et al.
(1992)
cbh1-1 P. chrysosporium
BKM-F 1767 (ATCC 24725)
Competitive
RT–PCR
CACAGTGTGTCCAAGGGATGTC
[pr6]
CAAAAGCCCGTGTTGGAGGT
[pr7]
221, 274 Covert et al.
(1992)
cbh1-2 P. chrysosporium
BKM-F 1767 (ATCC 24725)
Competitive
RT–PCR
GCCGATGGTGGACTTGC
[Ps1]
CGTGGTACCAAGCCAGCCTT
[pr5]
132, 197 Covert et al.
(1992)
cbh1-3 P. chrysosporium
BKM-F 1767 (ATCC 24725)
Competitive
RT–PCR
GCTAAGTACGGTACCGGCTA
[pr3]
GCAGTCGCTTCCGGAGCAGC
[pr2]
226, 286 Covert et al.
(1992)
cbhII P. chrysosporium
ME446 (ATCC 34541)
Inverse
PCR
GACGTCTAGAGGCTGGTGATAACGG ATCAAGCTTGCCGGCTTCGGTACCC 1100 Tempelaars et
al. (1994)
cbhII P. chrysosporium
ME446 (ATCC 34541)
DNA-PCR GCGAATTCCACATTCCAGCATTTCAT-
CCGTTG
CGCTGCAGAGATGCTAACCGAATTT-
CAACCGG
2300 Tempelaars et
al. (1994)
cbh1.1 P. chrysosporium
ME446 (ATCC 34541)
DNA-PCR ACAATGTTCCGCACTGCTACTT
[G36]
AGGGTGCCCGCGGAGGTGCC
[G32]
Not given1,
8402, 9502
Tempelaars et
al. (1994)1,
Broda et al.
(1995)2
Table 10.4 continued
Gene OrganismPCRprocedure 5′ Primer 3′ Primer
Amplifiedproduct(bp)a Referencea
cbh1.2 P. chrysosporium
ME446 (ATCC 34541)
DNA-PCR CACTCCTCGCATTCACTTGTCT
[G34]
CTGCCGGTCTCGGTCCAGTTGC
[G35]
Not given1,
5602, 8402
Tempelaars et
al. (1994)1,
Broda et al.
(1995)2
cbhII P. chrysosporium
ME446 (ATCC 34541)
DNA-PCR CCTCAGCCCTTACTACGC
[#29]
CCAATCTACCTCTACAGC
[#32]
Not given1,
9502, 13302
Tempelaars et
al. (1994)1,
Broda et al.
(1995)2
cel3 Agaricus bisporus
D649
DNA-PCR T
CCTTGATCNACGATAAAATG
C G A G G
[OL60B1]
GTAATACGACTCACTATAGGGC
[T7]
400, 500,
1100
Chow et al.
(1994)
cbh1-4 P. chrysosporium
BKM-F 1767 (ATCC 24725)
RT–PCR GATCGAATTCATGTTCCGCGCCGCCGCACT
[CBH-5′]GATCGAATTCTTAGTAGCACTGCGAGTAGT
[CBH-3′]1537 van Rensburg et
al. (1996)
cbh1-1 P. chrysosporium
BKM-F 1767
RT–PCR TCCTTTTGTTGGGCGTCGTC ACCTCCAACACGGGCTTTG 766, 8176 Lamar et al.
(1995)
cbh1-4 P. chrysosporium
BKM-F 1767
RT–PCR AAGGTCGTCCTCGACTCGAA CTCCAAGCCCTTCACCGTCG 741, 7795 Lamar et al.
(1995)
aSuperscripts in the ‘Amplified product’ column refer to the corresponding superscripts in the ‘Reference’ column.
product hybridized to a 1.4 kbp cel mRNA; the 600 bp product to a 1.4 kbpmRNA as well as to a small mRNA thought to be non-cel mRNA. The1.1 kbp PCR-amplified product was assumed to be an almost full-lengthcopy of the cel3 cDNA. The 400 bp PCR product was digested with EcoRIto remove a small terminal vector sequence, labelled with 32P-dCTP, andused as a probe to screen the cDNA library (Chow et al., 1994) to obtain 14cDNA clones which were then analysed. The nucleotide sequence of theclones showed that two types of cDNAs were isolated. Using genomic DNAfrom four monokaryotic mycelia, the segregation pattern of the cel3 gene wasstudied. Since two differing patterns of hybridization were obtained inSouthern hybridization analysis, it was concluded that the two genes wereallelic (Chow et al., 1994). These alleles had 98.8% sequence identity to eachother.
A cDNA fragment encoding the P. chrysosporium cellobiohydrolase(cbh1-4) was amplified using RT–PCR and cloned (van Rensburg et al.,1996). First-strand cDNA was synthesized from P. chrysosporium BKM-F1767 poly(A)-RNA using a commercial kit and commercial primers(Boehringer Mannheim). The DNA was then amplified using two primers(Table 10.4), CBH-5′ (forward primer), and CBH-3′ (reverse primer) basedon a previously published cbh1-4 gene sequence (Vanden Wymelenberg etal., 1993). The 1537 bp PCR-amplified product was determined to beidentical to the published nucleotide sequence of cbh1-4, minus the twointrons (Vanden Wymelenberg et al., 1993). It was subcloned into the yeastmulticopy episomal plasmid pJC1 by inserting it between the yeastphosphoglycerate kinase-I gene promoter (PGK1P) and terminator(PGK1T) sequences. The recombinant plasmid (pCBH) contained thePGK1P-cbh1-4-PGK1T construct, designated CBH1. A 3477 bp PvuIIDNA fragment containing this CBH1 construct was excised from pCBHand subcloned into a unique SmaI site of another plasmid, pEND. Thisplasmid consisted of the yeast multicopy episomal, expression/secretionvector (pDLG4) and the gene end1, which encodes the endo-β-1,4-glucanaseof Butyrivibrio fibrisolvens, a cellulolytic rumen bacterium. The resulting12 kbp plasmid, designated pENCB, was transformed into the yeastSaccharomyces cerevisiae, and the coexpression of cbh1-4 and end1 wasanalysed. The maximum cellulolytic activity of the transformed S. cerevisiaeY294 [pENCB], containing both the genes, was 1380 U as compared to S.cerevisiae with cbh1-4 (which had a maximum cellobiohydrolase activity of12.03 U) and end1 (which had a maximum endo-β-1,4-glucanase activity of1100 U). These studies indicated that coexpression of both the genes resultsin enhanced cellulose degradation (van Rensburg et al., 1996).
Cellobiose dehydrogenase (CDH) is a haemoflavoenzyme, secretedunder cellulolytic conditions, that oxidizes cellodextrins, lactose and man-nodextrins (Eriksson et al., 1990). The role of CDH in wood degradation,and catabolism of cellobiose has been suggested (Bao et al., 1993; Erikssonet al., 1993; Ander, 1994). In a recent study, Raices et al. (1995) isolated more
Study of Lignocellulose Degradation 225
than 50 putative positive clones, using either immuno- or gene-probescreening for the CDH gene. Out of these clones, five were sequenced andfound to overlap with identical sequences, but lacking the 5′-end of themRNA. This 5′-end was obtained by RACE (Frohman et al., 1988), usingpoly(A)-RNA as the template and two nested primers (sequences not shown)based on the 5′-end of the longest cDNA isolated. A single PCR product,Ra-12, corresponding to the missing 5′-end, was obtained. By determiningthe sequences of the 5′ (Ra-12) and 3′ (CP3) sections of the CDH gene, thecomplete cDNA sequence was determined (Raices et al., 1995). The full-length cDNA was assembled by combining Ra-12 and CP3 in a recombina-tion PCR using the Ra-12 forward and the CP3 reverse primers (sequencesnot shown). The complete cDNA contains 2310 translated bases excludingthe 3′ poly(A)-tail. Analysis of the CDH amino acid sequence showed thepresence of haem and flavin adenine dinucleotide (FAD) domains, as well asthe nucleotide-binding motif. The FAD domain appears to be distantlyrelated to the glucose/methanol/choline (GMC) oxidoreductase family(Raices et al., 1995).
Xylanase genesGraham et al. (1993) used a novel PCR-based procedure to synthesize anartificial xylanase gene from the white-rot fungus Schizophyllum commune.The sequence of the synthetic gene was designed so that restriction enzymerecognition sequences could be introduced into the gene without alterationof the amino acid sequence of the final translation product. Additionally, thedesign also incorporated a selection of codon bias suited for expression in E.coli. Overlapping PCR primers Xyl1 (189-mer) and Xyl2 (208-mer) weremixed with different dilutions of two other primers, Xyl3 (42-mer) and Xyl4(36-mer), in a PCR-amplification procedure to yield a 426 bp double-stranded product XylA, representing two-thirds of the 5′-end of the xylanasegene. An aliquot of XylA was mixed with a 217-mer oligonucleotide primerand flanking primers Xyl3 (5′-end) and Xyl6″ (3′-end) and subjected to asecond PCR to yield a 629 bp double-stranded XylB DNA representing thefull-length xylanase-encoding xynA gene (Graham et al., 1993). The XylBfragment was subcloned into a plasmid vector; after sequencing threesubclones, it was found that errors were introduced in the sequences of eachof the subclones because of the low fidelity of Taq polymerase. The error wascorrected by selecting one of the subclones and excising the segmentcontaining the error using flanking restriction sites and replacing it with acorrect segment from another subclone; the result was an authentic xynAgene. The synthesized xynA gene was subcloned into the NheI–HindIII siteof the protein expression vector, pTUG. To accomplish this, the 5′ PstI siteof xynA was changed to a NheI site by PCR amplification using a new 5′primer Xyl3″ (with a NheI recognition site) and the original 3′ primer Xyl6″.The PCR product was then subcloned into pTUG and, after verification thatthe sequence was correct, was transformed into E. coli JM101. Xylanase-
226 C.A. Reddy and T.M. D’Souza
secreting clones produced clearing zones when grown on Luria broth agarplates containing remazol brilliant blue xylan substrate.
Using the data obtained from the N-terminal sequence of purifiedxylanase APX-II from the xylanolytic fungus Aureobasidium pullulansY-2311-1, Li and Ljungdahl (1996) designed two degenerate biotinylatedoligonucleotide primers, P0813 and P3035 (Table 10.5) to amplify a xylanasegene from genomic DNA. The resulting 83 bp biotinylated PCR fragmentswere used as probes to screen a cDNA library, as well as in the character-ization of genomic DNA (Southern blot), and in the study of regulation ofthe xylanase gene (Northern blot). Five positive clones were obtained afterscreening the cDNA library of which two were sequenced. The sequencedata revealed that none of these clones contained the 5′-end of the gene.Using PCR, the 5′-end of the cDNA was amplified from the cDNA library,using two oligonucleotide primers. The forward primer (T3 promotersequence; P200) was located at the 5′ of the insert while the reverse primer(P3338) was 152 bp from the 5′-end of the positive cDNA clones (Table 10.5).The PCR product was cloned and sequenced and using the sequence data,two oligonucleotide primers PFW and PRW (Table 10.5) were synthesized.PFW and PRW corresponded to the 5′- and 3′-ends of the full-length cDNAfor the A. pullulans xylanase, and were used to amplify the whole gene.Comparison between the genomic and cDNA sequences revealed that oneintron of 59 bp was present in the coding region. The result of the Southernblot showing the presence of only a single copy in the genome, and that ofthe Northern blot showing that only a single transcript was present,indicated that the two xylanases present in the culture were encoded by thesame gene (Li and Ljungdahl, 1996).
10.4.2 Allele-specific oligonucleotides
The PCR approach was also used to differentiate lip alleles of P. chrysospo-rium (Gaskell et al., 1992, 1994, 1995). Two primers, A and B (Table 10.1),were used to amplify lip H8 sequences from the genomic DNA ofbasidiospores (homokaryotic) and dikaryote isolates of P. chrysosporium.Amplified products of 251 bp and 260 bp were obtained. These PCRproducts were Southern blotted and probed with gene-specific oligonucleo-tide probes to identify rapidly the H8 gene and its alleles (Gaskell et al.,1992).
In another study, Gaskell et al. (1994) developed a strategy for geneticmapping by segregation analysis. They monitored allelic segregation by PCRof genomic DNA from single basidiospore-derived cultures followed byprobing with allele-specific oligonucleotides. Gene-specific PCR primerswere used for 12 P. chrysosporium genes coding for LIP (Table 10.1), glyoxaloxidase (GLOX) and CBH (Table 10.4). Based on the sequences of theamplified products, allele-differentiating probes were prepared. Geneticlinkage was determined by monitoring the segregation of specific alleles
Study of Lignocellulose Degradation 227
Table 10.5. Primers used for PCR amplification of xylanese-encoding genomic and cDNA sequences.
Gene OrganismPCRprocedure 5′ Primer 3′ Primer
Amplifiedproduct
(bp) Reference
Xylanese
[xylA =
5′-end of
xynA]
Schizophyllum
commune
DNA-PCR ACCCCGTCTTCTACCGGTACCGACGGTGGTTA-
CTACTACAGCTGGTGGACCGACGGTGCTGGTG-
ACGCTACCTACCAGAACAACGGTGGTGGTTCT-
TACACGTTAACCTGGTCTGGTAACAACGGTAA-
CTTAGTTGGTGGTAAAGGTTGGAACCCGGGTG-
CTGCTTCTAGATCTATCTCTTACTCTGGT
[Xyl1] (189-mer)
ACCGCCTCTGCAGCTTCTGGTACCCCGTCTTC-
TACCGGTAC
[Xyl3] (42-mer)
GACGGAGCGTTGTAACGCCAGGTAGACAGGA-
TGTCGTAGGTGGCGCCGTTGCAGGTAACGGA-
TCCTTTGTGAGAAGCAGCAGAAGACGGGTCG-
TAAGAACCGTAAGATTCAACGATGTAGTATT-
CGATCAGACTCGAGCGGGTCCAACCGTAAAC-
AGACAGGTAAGAGTTACCGTTCGGCTGGTAG-
GTACCAGAGTAAGAGATAGATC
[Xyl2] (208-mer)
CTGGGTACCATCGATAGACGGAGCGTTGTAA-
CGCCA
[Xyl4] (36-mer)
426 Graham et al.
(1993)
Xylanase
[xylB =
xynA]
Schizophyllum
commune
DNA-PCR ACCGCCTCTGCAGCTTCTGGTACCCCGTCTTC-
TACCGGTAC
[Xyl3] (42-mer)
CTAGACGGTGATGGTAGCGGTACCAGAAGAC-
TGGTAACCTTCGGTCGCGACGATCTGGTAGT-
TGTGTTCAGAACCCAGGTTCATACCCAGGCC-
TTTCCAAGCGTCGAAGTGGCACTGAACGTCG-
ACGGTACCAGAGATAGAACCACCCGGAGCTT-
TTTTCGGGTTACGTACAGACCAGAACTGTTC-
GAAGGTCTGGGTACCATCGATAGACGGAGCG-
TTGTA
[Xyl5] (222-mer)
CGTATAAGCTTCTATTAGCTAGCGGTGACGG-
TGATGGTAGCCG
[Xyl6″] (43-mer)
629 Graham et al.
(1993)
Xylanese
[xynA]
Schizophyllum
commune
DNA-PCR GCCTCTGCTAGCGGTACCCCGTCTTCTACCGG-
TAC
[Xyl3″] (35-mer)
CGTATAAGCTTCTATTAGCTAGCGGTGACGG-
TGATGGTAGCCG
[Xyl6″] (43-mer)
Not
given
Graham et al.
(1993)
Xylanese
[3′-end of
xynA]
Aureobasidium
pullulans
Y-2311-1
DNA-PCR TATGTNCAAAATTATAA
C G C C
[P0813]
CCATTATTCCAATACAT
G G G
[P3035]
83 Li and Ljungdahl
(1994)
Xylanese
[5′-end of
xynA]
Aureobasidium
pullulans
Y-2311-1
DNA-PCR GTCGCCATTGACACCGT
[P200]
GAAGTCGCCATTGACACCGTTGTT
[P3338]
Not
given
Li and Ljungdahl
(1994)
Xylanese
[xynA]
Aureobasidium
pullulans
Y-2311-1
DNA-PCR CGGCACGAGCTCGTGCCGG
[PFW]
GTAGCAAGGTGTCTGACAT
[PRW]
895 Li and Ljungdahl
(1994)
among homokaryotic segregants. Homokaryotic single-basidiosporecultures were first isolated and identified, followed by the extraction ofgenomic DNA, amplification of genes, and differentiation of alleles usingradiolabelled oligonucleotides as probes. The linkage was computed fromallelic co-segregation frequencies. Five linkage groups were identified, oneof which contained eight closely linked lip genes. One unlinked lip gene,was determined to co-segregate with a cbh1 gene cluster (Gaskell et al.,1994).
Recently, Gaskell et al. (1995) investigated the copy number, inheritance,genomic location, and distribution of Pce1, an insertional element within P.chrysosporium gene lipI, discovered after analysis of the sequences of the tenknown lip genes. PCR was used to amplify a 1767 bp Pce1 insertionalelement from genomic DNA of P. chrysosporium BKM-F 1767, usingprimers at the junction of the insertion point of Pce1 in lipI2. The Pce1element was localized to the 3.7 Mb chromosomal band by experimentsusing the amplified product to probe Southern blots of clamped homoge-neous field electrophoresis gels of size-fractionated chromosomes of adikaryotic strain of P. chrysosporium BKM-F 1767. The copy number anddistribution of Pce1 were assessed by Southern blot analysis of restrictionenzyme-digested genomic DNA. An additional Pce1-like sequence wasfound on a 4.6 kbp BamHI–XbaI genomic DNA fragment. Southern blotanalysis of genomic DNA from 17 strains of P. chrysosporium using Pce1 asa probe showed that only three isolates hybridized under moderate strin-gencies. One widely used laboratory strain, ME-446, did not show hybrid-ization with Pce1. Allelic segregation patterns were determined for lipA andlipI using PCR with gene-specific primers and 69 single-basidiosporeisolates. PCR products of 2236 bp and 479 bp allowed easy differentiation oflipI alleles. For lipA, allele-specific probes were used to differentiate PCRproducts, since all the lipA gene-specific PCR products were identical inlength. The results showed that lipA and lipI alleles co-segregate. RT–PCRfollowed by probing with allele-specific oligonucleotides, was also done inorder to detect lipI1 and lipI2 transcripts in N-limited and C-limited cultures(discussed in section 10.4.3).
10.4.3 Gene expression under varying environmental conditions
Stewart et al. (1992) used competitive RT–PCR and gene-specific oligonu-cleotide probes to study the pattern of LIP gene expression in P. chrysospo-rium BKM-F 1767. First-strand cDNA of four closely related LIP genes(lipA, lipB, GLG5 and 0282) was prepared by reverse transcription using aconserved downstream primer (Table 10.1). Gene-specific upstream primerswere used to amplify the double-stranded cDNA. Each PCR containedgenomic DNA as a competitive template. The cDNA levels of the four geneswere quantified in N-limiting and C-limiting culture conditions. Thetranscript levels for the LIP H8-encoding lipA and lipB genes, and for the
230 C.A. Reddy and T.M. D’Souza
LIP H2-encoding 0282 gene, were similar in C- and N-limited cultures.However, for the LIP H10-encoding GLG5 the N-limited cDNA levels werebetween 25 and 100 pg, but no cDNA product was amplified in the C-limitedcultures. Competitive PCR was also used to quantify the LIP H2-encodingGLG4 and V4 transcript levels, using gene-specific primers (Table 10.1). TheGLG4 transcript was more abundant (1000-fold) in C-limited than inN-limited cultures. The V4 gene transcript could only be detected using asecond set of primers (Table 10.1) and when reverse transcription reactionsincluded 0.5 µg of RNA and were extended to 45 min. Under theseconditions, the V4 gene transcripts were found to be more abundant inN-limited than in C-limited cultures.
Brooks et al. (1993) determined the expression profiles of LIPH8-encoding LIG1 and LIP H2-encoding LIG5 in P. chrysosporiumME-446 cultures under conditions of nitrogen limitation (LN) or non-limitation (HN) using gene-specific primer pairs (Table 10.1). No LIG1expression was seen in either LN or HN cultures, but LIG5 expression wasseen in both LN and HN cultures. In carbon non-limiting cultures, however,no LIG5 transcripts were seen, leading to the conclusion that LIG5expression in strain ME-446 is dependent on low C concentration.
The expression of LIP genes from C-limited cultures of P. chrysosporiumBKM-F 1767 was analysed by PCR. For this, cDNA prepared from 6-day-oldC-limited cultures was used as the template with degenerate oligonucleotideprimers corresponding to the regions surrounding the proximal and distal Hisresidues in LIP from BKM-F 1767 (Reiser et al., 1993). Twenty-four PCRclones were analysed and found to be ordered into two sets, based on digestionwith the restriction enzymes SalI and RsaI. One set showed a high degree ofsimilarity to the LIP H2-encoding CLG4 cDNA sequence of de Boer et al.(1987), while the other was similar to the LIP H8-encoding L18 cDNAsequence (Ritch et al., 1991). These represented the major transcripts inC-limited cultures.
Broda et al. (1995) applied the RT–PCR technique to monitor theexpression of 11 genes from low-N cultures of P. chrysosporium ME-446during growth with one of four different carbon sources: low glucose (0.2%),high glucose (2.0%), Avicel (0.2%) and ball-milled straw (BMS; 0.2%).Different primers were used for amplification of LIP H8-encoding genesLIG1, LIG2, LIG3, and LIG4, the LIP H2-encoding gene LIG5, theunknown LIP-encoding gene LIG6 (Table 10.1), the MNP-encoding genemnp1 (Table 10.2), and the CBH-encoding genes cbh1.1, cbh1.2, and cbhII(Table 10.4). Amplification of the constitutively expressed trpC gene wasused as a positive control for gene expression in all cultures (primers for trpCare shown in Table 10.6). Cultures grown in low glucose expressed onlyLIG5 (on days 3–8), and cbh1.1 (on days 7 and 8). High glucose culturesexpressed none of the genes studied, except low levels of mnp1 on day 3.Avicel cultures expressed cbh1.1 and cbh1.2 on days 3–6; LIG1 and LIG2 onday 6, LIG3 on days 4–8, LIG6 on day 3, and cbhII, LIG5 and mnp1 on days
Study of Lignocellulose Degradation 231
Table 10.6. Primers used for PCR amplification of genomic DNA and cDNA of house-keeping and other genes isolated from ligninolytic fungi.
Gene OrganismPCRprocedure 5′ Primer 3′ Primer
Amplifiedproduct(bp) Reference
ITSa P. chrysosporium BKM-F 1767,
P. chrysosporium HHB-6251-sp,
P. chrysosporium FP-104297-sp,
P. sordida HHB-7423-sp,
P. sordida HHB-8922-sp,
F. fomentarius, Penicillium sp., Pythium
sp., P. radiata, R. solani
DNA-PCR GGAAGTAAAAGTCGTAACAAGG
[ITS 5]
TCCTCCGCTTATTGATATGC
[ITS 4]
700 Johnston and
Aust (1994b)
β-tubulin P. chrysosporium
BKM-F 1767 (ATCC 24725)
RT–PCR AGGTCGTCTCAGACGAACAC GGCATGGGTACTCTCCTGATC 495, 640 Lamar et al.
(1995)
trpC P. chrysosporium
ME446 (ATCC 34541)
RT–PCR CACGGGCATCGTGACGGATAC TGGGTCTTGAGTGTGTAGTGG 126, 179 Broda et al.
(1995)
Pcel P. chrysosporium
BKM-F 1767 (ATCC 24725)
DNA-PCR GGGACCGTAGCTACATCAGCAAT CTGGCTGGGTACATCAG 1747 Gaskell et al.
(1995)
aPresented here as an example of similar papers published using the internal transcribed spacer (ITS) region or other regions of fungal ribosomal DNA forphylogenetic studies of lignocellulosic fungi.
3–8. BMS cultures expressed cbh1.1 and cbh1.2 on days 3–6, LIG1 on day 8and cbhII, LIG5 and mnp1 on days 3–8.
RT–PCR and allele-specific oligonucleotide probes were used to detectthe LIP H2-encoding lipI transcripts in N-limited and C-limited cultures ofP. chrysosporium BKM-F 1767 (Gaskell et al., 1995) using gene-specificprimers (Table 10.1). The fungus expressed lipI1 transcripts in both culturemedia, but lipI2 transcripts were not detected; the lipI2 contains a 1747 bpinsertional element Pce1 (described in Section 10.4.2). The results indicatedthat Pce1 inactivated the lipI2 gene.
Rajakumar et al. (1996) used RT–PCR to determine whether LIP-likegenes were transcribed in P. sordida and C. subvermispora cultures grownunder ligninolytic (N-limited medium) conditions. The primers used areshown in Table 10.1. The results showed that one LIP-like sequence, with a88.4% nucleotide similarity to the corresponding region of a T. versicolor lipgene, was transcribed in P. sordida cultures. However, no LIP-like tran-scripts were detected in C. subvermispora cultures.
Quantitative RT–PCR analysis was done on mRNA isolated fromanthracene-transforming soil cultures of P. chrysosporium BKM-F 1767 toassess the temporal regulation of the H2O2-producing glyoxal oxidase(GLOX) gene expression (Bogan et al., 1996b). Anthracene, a known LIPsubstrate, needs the presence of H2O2 for its transformation by LIP. Theprimers used for PCR amplification of the lip gene sequences are shown inTable 10. 1; no primer sequences for glx were given. The results showed thatduring the initial period of incubation (<10 days), the LIP H8-encoding lipAand the LIP H2-encoding lipD transcripts were at the highest levels. Thehighest transcript level for any of the genes studied was that of the LIPH2-encoding lipJ (days 15–20). The lipA transcript level, however, main-tained high levels for a majority of the 25 days. No lipF (unknown LIP-encoding) transcripts were seen on any of the days studied. The transcriptlevels of lipA and glx genes correlated with the levels of the enzymes theycoded for (H8 and GLOX, respectively). The oxidation of anthracene wasalso seen to take place throughout the course of the study (Bogan et al.,1996b).
In a separate study, Bogan et al. (1996a) used competitive RT–PCR toexamine the temporal expression of three MNP genes (mnp-1, mnp-2 andmnp-3) of P. chrysosporium BKM-F 1767 during the bioremediation ofPAH-contaminated soil. All three transcripts were seen on day 1 or 2, withpeak levels on day 6. The β-tubulin gene (tub) and glyceraldehyde-3-phosphate dehydrogenase gene (gpd) transcripts were also determined bycompetitive RT–PCR as controls for mRNA loading. The results showedthat mnp mRNA levels correlated with MNP enzyme levels and with thedisappearance of PAHs from the soil, supporting the hypothesis that MNPare involved in the oxidation of PAHs in soil (Bogan et al., 1996a).
Competitive RT–PCR was used to determine the relative transcriptlevels of P. chrysosporium BKM-F 1767 cbh1-1, cbh1-2 and cbh1-3 genes in
Study of Lignocellulose Degradation 233
glucose-grown, sucrose-grown and cellulose–cellobiose-grown cultures(Covert et al., 1992). First-strand cDNAs were prepared by reverse tran-scription with downstream primers (see Table 10.4). This was followed byPCR-amplification using upstream primers (Table 10.4) in the presence ofserial dilutions of genomic DNA as competitive templates. The primersflanked an intron common to all three genes, so that the PCR-amplifiedproducts obtained from cDNA and genomic DNA could be identified onagarose gels. Gene-specific oligonucleotide probes were used to furtherestablish the identity between the three genes. The results showed thatcbh1-3 transcripts were about 1000-fold more abundant than those of cbh1-1and cbh1-2 in cellulose–cellobiose-grown cultures. The cbh1-1 andcbh1-2 transcript levels were low in all four cultures, but were higher thancbh1-3 transcript levels in 3-day-old glucose-grown cultures. Thus, unlikecbh1-3, cbh1-1 and cbh1-2 appear not to be subjected to glucose repression.
10.5 Future Perspectives
An increasing number of researchers have been using PCR methodology inrecent years for studies on fungal lignocellulose degradation. The techniquesapplied to date have been limited to DNA-PCR, RT–PCR, competitiveRT–PCR and inverse PCR. These techniques have been used for thedetection, isolation and characterization of genes involved in lignocellulosedegradation. The latter included genes encoding LIP, MNP, laccase, cellulaseand xylanase. PCR approaches have also played a major role in the study ofregulation of expression of genes encoding lignocellulose-degradingenzymes under a variety of environmental conditions. Furthermore, PCRtechniques were also useful for mapping and segregation analysis of genesinvolved in lignin and cellulose breakdown as well as for studying themolecular genetics of an insertional element Pce1 in P. chrysosporium.
The PCR approaches described above have been useful in enhancing ourunderstanding of fungal lignocellulose degradation but these studies repre-sent only the beginning of what we believe will be an expanding field infuture research. Several new and improved PCR-based techniques showpromise for future applications in this research area. For example, DDRT–PCR (Liang and Pardee, 1992; see Chapter 3) is a sensitive technique thatcould be used for detailed studies on environmental control of geneexpression. Another area where PCR could be used effectively would be inphylogenetic studies of lignocellulose-degrading wood-rot basidiomycetes(Hibbett and Vilgalys, 1991; Kwan et al., 1992; Boysen et al., 1996; Bunyardet al., 1996; Chiu et al., 1996). More recently, in the Center for MicrobialEcology at Michigan State University, we have initiated studies usingdenaturing gradient gel electrophoresis PCR (DDGE–PCR) to characterizethe phylogenetic affiliation of the various lignin-degrading soil basidiomy-cetes. Thus it appears quite likely that a greater variety of PCR approaches
234 C.A. Reddy and T.M. D’Souza
will be used by researchers in the future for increasing the knowledge offungal lignocellulose degradation systems.
Acknowledgements
The research in the authors’ laboratory reported in this review was supportedin part by DOE grant DE-FG02-85ER-13369 to C.A. Reddy, and NSF grantBIR-9120006 to the Center for Microbial Ecology at Michigan StateUniversity.
References
Ander, P. (1994) The cellobiose-oxidizing enzymes CBQ and CbO as related tolignin and cellulose degradation – a review. FEMS Microbiology Reviews 13,297–312.
Asada, Y., Watanabe, A., Irie, T., Nakayama, T. and Kuwahara, M. (1995) Structuresof genomic and complementary DNAs coding for Pleurotus ostreatus manganese(II) peroxidase. Biochimica et Biophysica Acta 1251, 205–209.
Ashktorab, H. and Cohen, R.J. (1992) Facile isolation of genomic DNA fromfilamentous fungi. BioTechniques 13, 198–200.
Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. andStruhl, K. (1995) Current Protocols in Molecular Biology. John Wiley & Sons,New York.
Bao, W., Usha, S.N. and Renganathan, V. (1993) Purification and characterization ofcellobiose dehydrogenase, a novel extracellular hemoflavoenzyme from thewhite-rot fungus Phanerochaete chrysosporium. Archives of Biochemistry andBiophysics 300, 705–713.
Bayer, E.A., Morag, E., Shoham, Y., Tormo, J. and Lamed, R. (1996) The cellulosome:A cell surface organelle for the adhesion to and degradation of cellulose. In:Fletcher, M. (ed.) Bacterial Adhesion: Molecular and Ecological Diversity. Wiley-Liss, New York, pp. 155–182.
Beguin, P. and Aubert, J.-P. (1995) The biological degradation of cellulose. FEMSMicrobiology Letters 13, 25–58.
Bej, A.K. and Mahbubani, M.H. (1992) Applications of the polymerase chain reactionin environmental microbiology. PCR Methods and Applications 1, 151–159.
Black, M.T., Gunn, F.J., Chapman, S.K. and Reid, G.A. (1989) Structural basis for thekinetic differences between flavocytochromes b2 from the yeasts Hansenulaanomula and Saccharomyces cerevisiae. Biochemical Journal 263, 973–976.
Bogan, B.W., Schoenike, B., Lamar, R.T. and Cullen, D. (1996a) Manganeseperoxidase mRNA and enzyme activity levels during bioremediation of poly-aromatic hydrocarbon-contaminated soil with Phanerochaete chrysosporium.Applied and Environmental Microbiology 62, 2381–2386.
Bogan, B.W., Schoenike, B., Lamar, R.T. and Cullen, D. (1996b) Expression of lipgenes during growth in soil and oxidation of anthracene by Phanerochaetechrysosporium. Applied and Environmental Microbiology 62, 2381–2386.
Study of Lignocellulose Degradation 235
Bollag, J.-M., Shuttleworth, K.L. and Anderson, D.H. (1988) Laccase-mediateddetoxification of phenolic compounds. Applied and Environmental Micro-biology 54, 3086–3091.
Boominathan, K. and Reddy, C.A. (1992) Fungal degradation of lignin: biotechno-logical applications. In: Arora, D.K., Elander, R.P. and Mukerji, K.G. (eds)Handbook of Applied Mycology, Volume 4: Fungal Biotechnology. MarcelDekker, New York, pp. 763–822.
Bourbonnais, R. and Paice, M.G. (1990) Oxidation of non-phenolic substrates. Anexpanded role for laccase in lignin biodegradation. FEBS Letters 267, 99–102.
Bourbonnais, R. and Paice, M.G. (1992) Demethylation and delignification of kraftpulp by Trametes versicolor laccase in the presence of 2,2′-azinobis(3-ethylbenzthiazoline-6-sulphonate). Applied Microbiology and Biotechnology 36,823–827.
Boysen, M., Borja, M., Del Moral, C., Salazar, O. and Rubio, V. (1996) Identificationat strain level of Rhizoctonia solani AG4 isolates by direct sequence ofasymmetric PCR products of the ITS regions. Current Genetics 29, 174–181.
Broda, P., Birch, P.R.J., Brooks, P.R. and Sims, P.F.G. (1995) PCR-mediated analysisof lignocellulolytic gene transcription by Phanerochaete chrysosporium:substrate-dependent differential expression within gene families. Applied andEnvironmental Microbiology 61, 2358–2364.
Brooks, P.R., Sims, P.F.G. and Broda, P. (1993) Isozyme specific polymerase chainreaction analysis of differential gene expression: a general method applied tolignin peroxidase genes of Phanerochaete chrysosporium. Bio/Technology 11,830–834.
Bunyard, B.A., Chaichuchote, S., Nicholson, M.S. and Royse, D.J. (1996) RibosomalDNA analysis for resolution of genotypic classes of Pleurotus. MycologicalResearch 100, 143–150.
Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J. and Rutter, W.J. (1979) Isolation ofbiologically active ribonucleic acid from sources enriched in ribonuclease.Biochemistry 18, 5294–5299.
Chiu, S.W., Ma, A.M., Lin, F.C. and Moore, D. (1996) Genetic homogeneity ofcultivated strains of shiitake (Lentinula edodes) used in China as revealed by thepolymerase chain reaction. Mycological Research 100, 1393–1399.
Chow, C.-K., Yague, E., Raguz, S., Wood, D.A. and Thurston, C.F. (1994) The cel3gene of Agaricus bisporus codes for a modular cellulase and is transcriptionallyregulated by the carbon source. Applied and Environmental Microbiology 60,2779–2785.
Collins, P.J. and Dobson, A.D.W. (1995) PCR amplification of lignin peroxidasegenes in white rot fungi. Biotechnology Techniques 9, 917–920.
Covert, S., Vanden Wymelenberg, A. and Cullen, D. (1992) Structure, organizationand transcription of a cellobiohydrolase gene cluster from Phanerochaetechrysosporium. Applied and Environmental Microbiology 58, 2168–2175.
Cullen, D. and Kersten, P. (1992) Fungal enzymes for lignocellulose degradation. In:Kinghorn, J.R. and Turner, G. (eds) Applied Molecular Genetics of FilamentousFungi. Chapman and Hall, London, pp. 100–131.
de Boer, H.A., Zhang, Y.Z., Collins, C. and Reddy, C.A. (1987) Analysis of nucleotidesequences of two ligninase cDNAs from a white-rot filamentous fungus,Phanerochaete chrysosporium. Gene 60, 93–102; Corrigendum (1988) Gene 69,369.
236 C.A. Reddy and T.M. D’Souza
de Jong, E., Field, J.A. and de Bont, J.A.M. (1994) Aryl alcohols in the physiologyof ligninolytic fungi. FEMS Microbiology Reviews 13, 153–188.
Dieffenbach, C.W. and Dveksler, G.S. (1995) PCR Primer: a Laboratory Manual.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, pp. 714.
D’Souza, T.M., Boominathan, K. and Reddy, C.A. (1996) Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR. Applied andEnvironmental Microbiology 62, 3739–3744.
Eriksson, K.-E.L., Blanchette, R.A. and Ander, P. (1990) Microbial and EnzymaticDegradation of Wood and Wood Components. Springer Verlag, Berlin.
Eriksson, K.-E.L., Habu, N. and Samejima, N. (1993) Recent advances in fungalcellobiose oxidoreductases. Enzyme and Microbial Technology 15, 1002–1008.
Frohman, M.A., Dush, M.K. and Martin, G.R. (1988) Rapid production of full-lengthcDNAs from rare transcripts: amplification using a single gene-specific oligonu-cleotide primer. Proceedings of the National Academy of Sciences USA 87,2725–2730.
Garber, R.C. and Yoder, O.C. (1983) Isolation of DNA from filamentous fungi andseparation into nuclear, mitochondrial, ribosomal, and plasmid components.Analytical Biochemistry 135, 416–422.
Gaskell, J., Dieperink, E. and Cullen, D. (1991) Genomic organization of ligninperoxidase genes of Phanerochaete chrysosporium. Nucleic Acids Research. 19,599–603.
Gaskell, J., Vanden Wymelenberg, A., Stewart, P. and Cullen, D. (1992) Method toidentify specific alleles of a Phanerochaete chrysosporium gene encoding ligninperoxidase. Applied and Environmental Microbiology 58, 1379–1381.
Gaskell, J., Stewart, P., Kersten, P.J., Covert, S.F., Reiser, J. and Cullen, D. (1994)Establishment of genetic linkage by allele-specific polymerase chain reaction:application to the lignin peroxidase gene family of Phanerochaete chrysosporium.Bio/Technology 12, 1372–1375.
Gaskell, J., Vanden Wymelenberg, A. and Cullen, D. (1995) Structure, inheritance,and transcriptional effects of Pce1, an insertional element within Phanerochaetechrysosporium lignin peroxidase gene lipI. Proceedings of the National Academyof Sciences USA 92, 7465–7469.
Giardina, P., Cannio, R., Martirani, L., Marzullo, L., Palmieri, G. and Sannia, G.(1995) Cloning and sequencing of a laccase gene from the lignin-degradingbasidiomycete Pleurotus ostreatus. Applied and Environmental Microbiology 61,2408–2413.
Giardina, P., Aurilia, V., Cannio, R., Marzullo, L., Amoresano, A., Siciliano, R., Pucci,P. and Sannia, G. (1996) The gene, protein and glycan structures of laccase fromPleurotus ostreatus. European Journal of Biochemistry 235, 508–515.
Gilkes, H.R., Henrissat, B., Kilburn, D.G., Miller, R.C., Jr and Warren, R.A.J. (1991)Domains in microbial β-1,4-glycanases: sequence conservation, function, andenzyme families. Microbiological Reviews 55, 303–315.
Gilliland, G., Perrin, S. and Bunn, H.F. (1990) Competitive PCR for quantitation ofmRNA. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCRProtocols: a Guide to Methods and Applications. Academic Press, New York,pp. 282–287.
Gold, M.H. and Alic, M. (1993) Molecular biology of the lignin-degradingbasidiomycete Phanerochaete chrysosporium. Microbiological Reviews 57,605–622.
Study of Lignocellulose Degradation 237
Graham, R.W., Atkinson, T., Kilburn, D.G., Miller, R.C. Jr and Warren, R.A.J. (1993)Rational design and PCR-based synthesis of an artificial Schizophyllum com-mune xylanase gene. Nucleic Acids Research 21, 4923–4928.
Graham, G.C., Mayers, P., and Henry, R.T. (1994) A simplified method for thepreparation of fungal genomic DNA for PCR and RAPD analysis. Bio-Techniques 16, 48–50.
Hatakka, A. (1994) Lignin-modifying enzymes from selected white-rot fungi:production and role in lignin degradation. FEMS Microbiology Reviews 13,125–135.
Hibbett, D.S. and Vilgalys, R. (1991) Evolutionary relationships of Lentinus to thePolyporaceae: evidence from restriction analysis of enzymatically amplifiedribosomal DNA. Mycologia 83, 425–439.
Higuchi, T. (1993) Biodegradation mechanism of lignin by white-rot basidiomycetes.Journal of Biotechnology 30, 1–8.
Hilger, A.B. and Myrold, D.D. (1991) Method for extraction of Frankia DNA fromsoil. Agriculture, Ecosystems and Environment 34, 107–113.
Holzbaur, E.L.F. and Tien, M. (1988) Structure and regulation of a lignin peroxidasegene from Phanerochaete chrysosporium. Biochemical and Biophysical ResearchCommunications 155, 626–633.
Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (1990) PCR Protocols: aGuide to Methods and Applications. Academic Press, New York.
James, C.M., Felipe, M.S.S., Sims, P.F.G. and Broda, P. (1992) Expression of a singlelignin peroxidase-encoding gene in Phanerochaete chrysosporium strain ME446.Gene 114, 217–222.
Johnston, C.G. and Aust, S.D. (1994a) Transcription of ligninase H8 by Phanero-chaete chrysosporium under nutrient nitrogen sufficient conditions. Biochemicaland Biophysical Research Communications 200, 108–112.
Johnston, C.G. and Aust, S.D. (1994b) Detection of Phanerochaete chrysosporium insoil by PCR and restriction enzyme analysis. Applied and EnvironmentalMicrobiology 60, 2350–2354.
Kawasaki, E.S. (1990) Sample preparation from blood, cells, and other fluids. In:Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR Protocols: aGuide to Methods and Applications. Academic Press, New York, pp. 146–152.
Kim, W.K., Mauthe, W., Hausner, G., and Klassen, G.R. (1990) Isolation of highmolecular weight DNA and double-stranded RNAs from fungi. CanadianJournal of Botany 68, 1898–1902.
Kirk, T.K. and Farrell, R.L. (1987) Enzymatic ‘combustion’: the microbial degrada-tion of lignin. Annual Reviews of Microbiology 41, 465–505.
Knowles, J., Lehtovaara, P. and Teeri, T. (1987) Cellulase families and their genes.Trends in Biotechnology 5, 255–261.
Kojima, Y., Tsukuda, Y., Kawai, Y., Tsukamoto, A., Sugiura, J., Sakaino, M. and Kita,Y. (1990) Cloning, sequences analysis, and expression of ligninolytic phenolox-idase genes of the white-rot basidiomycete Coriolus hirsutus. Journal ofBiological Chemistry 265, 15224–15230.
Kwan, H.S., Chiu, S.W., Pang, K.M. and Cheng, S.C. (1992) Strain typing inLentinula edodes by polymerase chain reaction. Experimental Mycology 16,163–166.
Lamar, R.T., Schoenike, B., Vanden Wymelenberg, A., Stewart, P., Dietrich, D.M. andCullen, D. (1995) Quantitation of fungal mRNAs in complex substrates by
238 C.A. Reddy and T.M. D’Souza
reverse transcription PCR and its application to Phanerochaete chrysosporium-colonized soil. Applied and Environmental Microbiology 61, 2122–2126.
Lee, S.B. and Taylor, J.W. (1990) Isolation of DNA from fungal mycelia and singlespores. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCRProtocols: a Guide to Methods and Applications. Academic Press, New York,pp. 282–287.
Li, X.L. and Ljungdahl, L.G. (1994) Cloning, sequencing, and regulation of a xylanasegene from the fungus Aureobasidium pullulans Y-2311-1. Applied and Environ-mental Microbiology 60, 3160–3166; Erratum (1994) Applied and EnvironmentalMicrobiology 60, 4647.
Liang, P. and Pardee, A.B. (1992) Differential display of eukaryotic messenger RNAby means of the polymerase chain reaction. Science 257, 967–971.
Lucas, M.C., Jacobson, J.W. and Giles, N.H. (1977) Characterization and in vitrotranslation of polyadenylated messenger ribonucleic acid from Neurosporacrassa. Journal of Bacteriology 130, 1192–1198.
Matsubara, M., Suzuki, J., Deguchi, T., Miura, M. and Kitaoka, Y. (1996) Character-ization of manganese peroxidases from the hyperlignolytic fungus IZU-154.Applied and Environmental Microbiology 62, 4066–4072.
More, M.I., Herrick, J.B., Silva, M.C., Ghiorse, W.C. and Madsen, E.L. (1994)Quantitative cell lysis of indigenous microorganisms and rapid extraction ofmicrobial DNA from sediment. Applied and Environmental Microbiology 60,1572–1580.
Mullis, K.B. and Faloona, F.A. (1987) Specific synthesis of DNA in vitro via apolymerase-catalyzed chain reaction. Methods in Enzymology 155, 335–350.
Naidu, P.S. and Reddy, C.A. (1990) Nucleotide sequence of a new lignin peroxidasegene GLG3 from the white-rot fungus Phanerochaete chrysosporium. NucleicAcids Research 18, 7173; Corrigendum (1992) Nucleic Acids Research 20, 4124.
Ochman, H., Gerber, A.S. and Hartl, D.L. (1988) Genetic applications of an inversepolymerase chain reaction. Genetics 120, 621–623.
Ochman, H., Ajioka, J.W., Garza, D. and Hartl, D.L. (1990) Inverse polymerase chainreaction. Bio/Technology 8, 759–764.
Ogram, A.V., Sayler, G.S., Gustin, D. and Lewis, R.J. (1987) DNA adsorption to soilsand sediments. Environmental Science and Technology 22, 982–984.
Picard, C., Ponsonnet, C., Paget, E., Nesme, X. and Simonet, P. (1992) Detection andenumeration of bacteria in soil by direct DNA extraction and polymerase chainreaction. Applied and Environmental Microbiology 58, 2717–2722.
Pribnow, D., Mayfield, M.B., Nipper, V.J., Brown, J.A. and Gold, M.H. (1989)Characterization of a cDNA encoding a manganese peroxidase from the lignin-degrading basidiomycete Phanerochaete chrysosporium. Journal of BiologicalChemistry 264, 5036–5040.
Raeder, U. and Broda, P. (1988) Preparation and characterization of DNA fromlignin-degrading fungi. Methods in Enzymology 161B, 211–220.
Raguz, S., Yague, E., Wood, D.A. and Thurston, C.F. (1992) Isolation and character-ization of a cellulose-growth-specific gene from Agaricus bisporus. Gene 19,183–190.
Raices, M., Paifer, E., Cremata, J., Montesino, R., Stahhlberg, J., Divne, C., Szabo, I.J.,Henriksson, G., Johansson, G. and Pettersson, G. (1995) Cloning and character-ization of a cDNA encoding a cellobiose dehydrogenase from the white rotfungus Phanerochaete chrysosporium. FEBS Letters 369, 233–238.
Study of Lignocellulose Degradation 239
Rajakumar, S., Gaskell, J., Cullen, D., Lobos, S., Karahanian, E. and Vicuna, R. (1996)lip-Like genes in Phanerochaete sordida and Ceriporiopsis subvermispora, whiterot fungi with no detectable lignin peroxidase activity. Applied and Environmen-tal Microbiology 62, 2660–2663.
Rao, T.R. and Reddy, C.A. (1984) DNA sequences from a ligninolytic filamentousfungus Phanerochaete chrysosporium capable of autonomous replication in yeast.Biochemical and Biophysical Research Communications 118, 821–827.
Reddy, C.A. (1993) An overview of the recent advances on the physiology andmolecular biology of lignin peroxidases of Phanerochaete chrysosporium. Journalof Biotechnology 30, 91–107.
Reddy, C.A. and D’Souza, T.M. (1994) Physiology and molecular biology of thelignin peroxidases of Phanerochaete chrysosporium. FEMS MicrobiologyReviews 13, 137–152.
Reiser, J., Walther, I., Fraefel, C. and Fiechter, A. (1993) Methods to investigate theexpression of lignin peroxidase genes by the white-rot fungus Phanerochaetechrysosporium. Applied and Environmental Microbiology 59, 2897–2903.
Ritch, T.G., Nipper, N.V., Akileswaran, L., Smith, A.J., Pribnow, D.G. and Gold,M.H. (1991) Lignin peroxidase from the basidiomycete Phanerochaete chryso-sporium is synthesized as a preproenzyme. Gene 107, 119–126.
Roy-Arcand, L. and Archibald, F.S. (1991) Direct dechlorination of chlorophenoliccompounds by laccases from Trametes versicolor. Enzyme and MicrobialTechnology 13, 194–203.
Saiki, R., Sharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and Arnheim,N. (1985) Enzymatic amplification of β-globin genomic sequences and restric-tion site analysis for diagnosis of sickle cell anemia. Science 230, 1350–1354.
Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis,K.B. and Erlich, H.A. (1988) Primer-directed enzymatic amplification of DNAwith thermostable DNA polymerase. Science 239, 487–491.
Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: a LaboratoryManual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,New York.
Schneider, H., Barth, W. and Bohme, H.-J. (1996) Cloning and characterization ofanother lignin peroxidase gene from the white-rot fungus Phanerochaetechrysosporium. Biological Chemistry Hoppe-Seyler 377, 399–402.
Selenska-Pobell, S. (1995) Direct and simultaneous extraction of DNA and RNAfrom soil. In: Akkermans, A.D.L., van Elsas, J.D. and De Bruijn, F.J. (eds)Molecular Microbial Ecology Manual. Kluwer Academic Publishers, Dor-drecht.
Shoemaker, S., Schweickart, V., Ladner, M., Gelfand, D., Kwok, S., Myambo, K. andInnis, M. (1983) Molecular cloning of exocellobiohydrolase I derived fromTrichoderma reesei strain L27. Bio/Technology 1, 691–696.
Short, J.M., Fernandez, J.M., Sorge, J.A. and Huse, W.D. (1988) Lambda ZAP: abacteriophage lambda expression vector with in vivo excision properties. NucleicAcids Research 16, 7583–7600.
Silver, J. and Keerikatte, V. (1989) Novel use of polymerase chain reaction to amplifycellular DNA adjacent to an integrated provirus. Journal of Virology 63,1924–1928.
Sims, P., James, C. and Broda, P. (1988) The identification, molecular cloning andcharacterization of a gene from Phanerochaete chrysosporium that shows strong
240 C.A. Reddy and T.M. D’Souza
homology to the exo-cellobiohydrolase I gene from Trichoderma reesei. Gene74, 411–422.
Smith, T.L., Schalch, H., Gaskell, J., Covert, S. and Cullen, D. (1988) Nucleotidesequence of a ligninase gene from Phanerochaete chrysosporium. Nucleic AcidsResearch 16, 1219.
Sogin, M.L. (1990) Amplification of ribosomal RNA genes for molecular evolutionstudies. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCRProtocols: a Guide to Methods and Applications. Academic Press, New York,pp. 307–314.
Srinivasan, C., D’Souza, T.M. and Reddy, C.A. (1996) American Society forMicrobiology 96th General Meeting. New Orleans. Abstract May 19–23. Q266.
Steffan, R.J. and Atlas, R.M. (1991) DNA amplification to enhance detection ofgenetically engineered bacteria in environmental samples. Applied and Environ-mental Microbiology 54, 2185–2191.
Stewart, P., Kersten, P., Vanden Wymelenberg, A., Gaskell, J. and Cullen, D. (1992)Lignin peroxidase gene family of Phanerochaete chrysosporium: complex regula-tion by carbon and nitrogen limitation, and the identification of a seconddimorphic chromosome. Journal of Bacteriology 174, 5036–5042.
Tebbe, C.C. and Vahjen, W. (1993) Interference of humic acid and DNA extracteddirectly from soil in detection and transformation of recombinant DNA frombacteria and a yeast. Applied and Environmental Microbiology 59, 2657–2665.
Tempelaars, C.A.M., Birch, P.R.J., Sims, P.F.G., and Broda, P. (1994) Isolation,characterization, and analysis of the expression of the cbhII gene ofPhanerochaete chrysosporium. Applied and Environmental Microbiology 60,4387–4393.
Thorn, R.G., Reddy, C.A., Harris, D. and Paul, E.A. (1996) Isolation of saprophyticbasidiomycetes from soil. Applied and Environmental Microbiology 62,4288–4292.
Thurston, C.F. (1994) The structure and function of fungal laccases. Microbiology140, 19–26.
Timberlake, W.E. and Barnard, E.C. (1981) Organization of the gene clusterexpressed specifically in the asexual spores of Aspergillus nidulans. Cell 26,29–37.
Todd, J.A., Bell, J.I. and McDevitt, H.O. (1987) HLA-DQβ gene contributes tosusceptibility and resistance to insulin-dependent diabetes mellitus. Nature 329,599–604.
Triglia, T., Peterson, M.G. and Kemp, D.J. (1988) A procedure for in vitroamplification of DNA segments that lie outside the boundaries of knownsequences. Nucleic Acids Research 16, 8186.
Tsai, Y.-L. and Olson, B.H. (1993) Rapid method for separation of bacterial DNAfrom humic substances in sediments for polymerase chain reaction. Applied andEnvironmental Microbiology 58, 2292–2295.
Tuor, U., Winterhalter, K. and Fiechter, A. (1995) Enzymes of white-rot fungiinvolved in lignin degradation and ecological determinants for wood decay.Journal of Biotechnology 41, 1–17.
Vahey, M.T., Wong, M.T. and Michael, N.L. (1995) A standard PCR protocol: Rapidisolation of DNA and PCR assay for β-globin. In: Dieffenbach, C.W. andDveksler, G.S. (eds) PCR Primer: a Laboratory Manual. Cold Spring HarborLaboratory Press, Cold Spring Harbour, New York, pp. 17–21.
Study of Lignocellulose Degradation 241
van Elsas, J.D. and Smalla, K. (1995) Extraction of microbial community DNA fromsoils. In: Akkermans, A.D.L., van Elsas, J.D. and De Bruijn, F.J. (eds) MolecularMicrobial Ecology Manual, Kluwer Academic Publishers, Dordrechtpp. 1.3.3/1–1.3.3.11.
van Rensburg, P., van Zyl, W.H. and Pretorius, I.S. (1996) Co-expression of aPhanerochaete chrysosporium cellobiohydrolase gene and a Butyrivibrio fibri-solvens endo-β-1,4-glucanase gene in Saccharomyces cerevisiae. Current Genetics30, 246–250.
van Vaerenbergh, B., Grootaert, B. and Moens, W. (1995) Validation of a method forthe preparation of fungal genomic DNA for polymerase chain reaction (PCR)and random amplification of polymorphic DNA (RAPD). Journal of Mycologyand Medicine 5, 133–139.
Vanden Wymelenberg, A., Covert, S. and Cullen, D. (1993) Identification of the geneencoding the major cellobiohydrolase of the white rot fungus Phanerochaetechrysosporium. Journal of Bacteriology 174, 2131–2137.
Veres, G., Gibbs, R.A., Scherer, S.E. and Caskey, C.T. (1987) The molecular basis ofthe sparse fur mouse mutation. Science 237, 415–417.
Wahleithner, J.A., Xu, F., Brown, K.M., Brown, S.H., Golightly, E.J., Halkier, T.,Kauppinen, S., Pederson, A. and Schneider, P. (1996) The identification andcharacterization of four laccases from the plant pathogenic fungus Rhizoctoniasolani. Current Genetics 29, 395–403.
Yaver, D.S., Xu, F., Golightly, E.J., Brown, K.M., Brown, S.H., Rey, M.W., Schneider,P., Halkier, T., Mondorf, K. and Dalbøge, H. (1996) Purification, character-ization, molecular cloning, and expression of two laccase genes from the whiterot basidiomycete Trametes villosa. Applied and Environmental Microbiology62, 834–841.
242 C.A. Reddy and T.M. D’Souza
PCR Methods for theDetection of Mycotoxin-producing Fungi
R. Geisen
Bandesforschungsanstalt fur Ernahrung, Institut fur Hygiene undToxikologie, Engesserstr. 20, 76131 Karlsruhe, Germany
11.1 Introduction
Nearly every food or feed commodity can be contaminated by fungalorganisms. It is estimated that approximately 25% of the yearly productionof plant-derived foods are spoiled by fungi. Many of the food-bornefilamentous fungi are capable of producing mycotoxins, which are toxicmetabolites of concern to both the health of humans and the health ofanimals. Mycotoxins, like antibiotics, are secondary metabolites, which areprimarily produced in the idiostage of fungal growth. Some mycotoxins,such as patulin, were originally isolated as antibiotics due to their inhibitoryactivity towards bacteria, but were later shown to be toxic in animalexperiments (Wilson, 1974). Mycotoxins belong to different chemical classes,and mainly polyketide, isoprene and amino acid-containing substances arefound (Martin, 1992). Approximately 300 different mycotoxins have beenidentified, but only about 20 mycotoxins produced by different species arerelevant to human health (Table 11.1). Due to the different molecularstructures of these mycotoxins, their influences on human and animal healthrange from teratogenic, immunosuppressive, tremorgenic, nephrotoxic, hep-atotoxic to carcinogenic effects (Bullerman, 1979). Some mycotoxicoses aredocumented by epidemiological studies. Examples are the ergotism due tothe ingestion of ergot alkaloides produced by Claviceps purpurea (Barger,1931), the alimentary toxic aleukia which occurred in the Urals and was dueto the infection of cereals with T2 toxin-producing fungi (Bamburg et al.,1968), the endemic nephropathia in the Balkan region which correlated withthe high occurrence of ochratoxin A-producing filamentous fungi (Krogh,1987), the high incidence of oesophageal cancer in relation to the high intake
11
© CAB INTERNATIONAL 1998. Applications of PCR in Mycology(eds P.D. Bridge, D.K. Arora, C.A. Reddy and R.P. Elander) 243
of fumonisin-containing maize products (Nelson et al., 1993), and some casesof epidemiological correlations between the higher incidence of liver cancerand higher ingestion of aflatoxins (Chu, 1991). Even if these drastic, well-documented cases are rare, the constant uptake of small amounts ofmycotoxins, especially those with carcinogenic activity, can have profoundeffects on human health.
This situation demonstrates the importance of using appropriatemethods to control the mycological status of food and feed commodities.Conventional methods for the detection of mycotoxinogenic fungi areculture methods, which are time-consuming and require expertise in fungaltaxonomy. Taxonomic classification can be simplified by the use of selectivemedia, but the time required is not reduced (Davies et al., 1987). Theseproblems can be overcome by the use of the PCR which can reduce thedetection time from several days to several hours. The diagnostic PCRapproach for the detection of mycotoxinogenic fungi is an indirect method.DNA or DNA fragments of the target organism can be amplified anddetected by gel electrophoresis. However, the method does not distinguishbetween dead and living cells. This fact, which is a disadvantage for thedetection of pathogenic bacteria in foods, is advantageous in the case of
Table 11.1. Mycotoxins of relevance to human health.
Genus Toxins
Aspergillus AflatoxinSterigmatocystinCyclopiazonic acid
Penicillium PatulinOchratoxin ACitrininPenitrem ACyclopiazonic acidPR toxin
Fusarium T2 ToxinDeoxynivalenolNivalenolZearalenonDiacetoxyscirpenolFumonisin
Alternaria Tenuazonic acidAlternariolAlternariol monomethylether
Claviceps Ergot alkaloids
244 R. Geisen
mycotoxinogenic fungi, as mycotoxins are usually very stable. A positivePCR can, therefore, be taken as an indication that the sample potentiallycontains mycotoxins and should be analysed further. The PCR approach,however, has the disadvantage that the quantification of fungal biomass is noteasy and although some PCR-based quantification methods have beendescribed (Hu et al., 1993), they are too laborious for routine analysis.
A prerequisite for the development of a diagnostic PCR is the availabilityof unique target sequences, which are specific for the mycotoxin-producingfungus. Ideally, these target sequences should not be present in strains of thesame species that are not able to produce mycotoxins. Possible targetsequences for PCR or gene probe approaches are given in Table 11.2. Fordetection of pathogenic or toxinogenic bacteria in foods, respective toxin orvirulence genes are often used as target sequences for amplification (Olsen etal., 1996). The counterparts for mycotoxinogenic fungi are the genes whichcode for the enzymes of the mycotoxin biosynthetic pathway (referred to asmycotoxin biosynthetic genes). However, to date, only some of the genes ofmycotoxin biosynthetic pathways have been cloned and sequenced. The bestanalysed biosynthetic pathways at the genetic level are those from theaflatoxins (Trail et al., 1995a; Yu et al., 1995), the trichothecens (McCormicket al., 1996), patulin (Beck et al., 1990; Wang et al., 1991), PR-toxin (Procterand Hohn, 1993) and for sterigmatocystin (Kelkar et al., 1996). Sterig-matocystin is a precursor of aflatoxin and the sterigmatocystin biosyntheticgenes are rather homologous to the aflatoxin biosynthetic genes (Brown etal., 1996). Genes for biosynthetic enzymes of secondary metabolites areusually clustered (Hohn et al., 1993) and this is true for the aflatoxin (Trailet al., 1995a; Yu et al., 1995), sterigmatocystin (Brown et al., 1996),trichothecene (Hohn et al., 1993) and fumonisin biosynthetic genes (Desjar-dins et al., 1996).
The polyketide synthase gene from Penicillium patulum, which is thekey enzyme in the biosynthetic pathway of the mycotoxin patulin, has beencloned (Beck et al., 1990). Polyketide synthases are often involved in fungalsecondary metabolism and can be found in various species (Hopwood andSherman, 1990). The polyketide synthases are composed of different catalyticdomains, each specific to a certain reaction. These domains, however, often
Table 11.2. Target sequences for PCR/gene probes.
Specificity Target sequences Microorganisms
Gene specific Toxin genes, virulence genes BacteriaToxin biosynthetic genes Fungi
Empirical Ribosomal genes, random clonedfragments, RAPD products
Bacteria and fungi
Detection of Mycotoxin-producing Fungi 245
share high sequence homology, even between species, which makes this geneunsuitable as a specific target gene for diagnostic PCR (Mayorga andTimberlake, 1992).
11.2 Mycotoxin Biosynthetic Genes as Target Sequences
11.2.1 Aflatoxinogenic fungi
The aflatoxins are the most carcinogenic natural substances known and canbe found in various food commodities (Diener et al., 1987). They areproduced predominately by Aspergillus flavus, A. parasiticus and A. nomius(Bennett, 1988). Whereas nearly all A. parasiticus isolates are able to produceaflatoxins B1 , B2 , G1 and G2 , A. flavus is only able to produce aflatoxins B1
and B2 . Only about 40–50% of A. flavus strains isolated are able to producethese mycotoxins. A. flavus is highly related taxonomically to A. oryzae asis A. parasiticus to A. sojae (Kurtzman et al., 1986) and they share 90%nucleotide sequence homology. A. oryzae and A. sojae are used in the foodindustry as fermentation organisms and both are generally recognized as safe(GRAS) organisms. Both species have never been reported to produceaflatoxin, but they show high morphological similarity to their aflatoxin-producing relatives (Klich et al., 1995). A method specific to aflatoxin-producing fungi should be capable of differentiating between these closelyrelated species and also between aflatoxin-producing and non-producing A.flavus strains.
The aflatoxin biosynthetic gene cluster is partially elucidated. Thesequences of some of the genes are already known and published (Trail et al.,1995b). Interestingly, the genes are organized in such a way that the geneencoding the first enzyme in the pathway is located at one end of the clusterand the other genes follow in the same order as the enzymatic reactions inthe biosynthetic pathway (Fig. 11.1). Due to this arrangement, the gene fornorsolorinic acid reductase (nor-1) is located at one end of the cluster, thegene for versicolorin A dehydrogenase (ver-1) lies in the middle, and thegene for sterigmatocystin-O-methyltransferase is located at the other end ofthe cluster. By selecting these genes as target sequences in a multiplex PCR,the whole aflatoxin biosynthetic gene cluster can be covered, and partialdeletions of the cluster can be detected (Geisen, 1996). Conventionalmorphological methods for the detection of aflatoxinogenic fungi cannotdistinguish between aflatoxin producing and non-producing strains. If thenon-producing phenotype is due to a deletion of the biosynthetic genecluster or a part thereof, or to nucleotide changes at the primer binding sites,the PCR approach is able to distinguish between both genetic alterations.
In a multiplex PCR system, several genes can be detected in one reactionat a time. Several primer sets are added to the reaction mixture and thereaction is carried out at an optimized temperature. After electrophoresis of
246 R. Geisen
the products, several amplicons become visible. Multiplex PCR with up to 18primers has been described (Chamberlain et al., 1989). The advantage of thissystem is improved specificity. It was observed that some secondarymetabolite biosynthetic genes are more widely distributed in different fungalspecies than expected (see later for details). Thus, it might happen that a PCRproduct of the same length as the diagnostic PCR product may occur in amycotoxin non-producing species. This situation reduces specificity dras-tically if only a monomeric PCR is used. The occurrence of two or more
Fig. 11.1. Schematic illustration of the aflatoxin biosynthetic pathway. The order of thegenes reflects their relative location in the aflatoxin biosynthetic gene cluster, according toYu et al. (1995). The target genes of the multiplex PCR analysis are indicated in boxes.
Detection of Mycotoxin-producing Fungi 247
PCR products of identical length as the diagnostic PCR products withtemplate DNA of non-producing species, however, is unlikely. In addition,a multiplex reaction has the advantage that an internal control reaction canbe included which signals the activity of the polymerase.
Due to the complexity of a multiplex PCR system, several requirementsmust be met. The reaction kinetics of the different primer sets should besimilar to ensure that comparable amounts of PCR products are producedduring a reaction. The reaction kinetics are strongly dependent on the primerdesign: G/C content, melting temperature, secondary structures, 5′3′ overlap.A G/C content of 40–60% and a length of 23–28 nucleotides are suggestedas general guidelines for specific annealing. The primary structure ofpublished aflatoxin biosynthetic gene-specific primers are given in Table11.3.
Another important aspect for the development of a multiplex reaction isthe primer location. They should be chosen in such a way that the resultingPCR products are easily separated by agarose gel electrophoresis. The primerbinding sites for the detection of aflatoxinogenic fungi with the multiplexPCR system are shown in Fig. 11.2. The presence of introns in two of theamplicons does not influence the result. This indicates that the intronposition and length are very conserved in aflatoxin biosynthetic genes. The
Table 11.3. Sequences of published primers specific for aflatoxin biosynthetic genes.
Gene Sequencea Positionb Reference
aflR >aflR <
TATCTCCCCCCGGGCATCTCCCGGCCGTCAGACAGCCACTGGACACGG
4501482
Shapiro et al.(1996)
nor1 >nor1 <
ACCGCTACGCCGGCACTCTCGGCACGTTGGCCGCCAGCTTCGACACTCCG
501900
Geisen (1996)
ver1 >ver1 <
ATGTCGGATAATCACCGTTTAGATGGCCGAAAAGCGCCACCATTCACCCCAATG
4961391
Shapiro et al.(1996)
ver1 >ver1 <
GCCGCAGGCCGCGGAGAAAGTGGTGGGGATATACTCCCGCGACACAGCC
6231160
Geisen (1996)
omtA >omtA <
GGCCCGGTTCCTTGGCTCCTAAGCCGCCCCAGTGAGACCCTTCCTCG
2081232
Shapiro et al.(1996)
omtA >omtA <
GTGGACGGACCTAGRCCGACATCACGTCGGCGCCACGCACTGGGTTGGGG
3011098
Geisen (1996)
aThe sequences are given 5′ to 3′.bThe positions of the first and last nucleotide of the amplified product are given relativeto the first codon of the gene.
248 R. Geisen
results of typical multiplex PCR analyses with DNA from aflatoxinogenicfungi are shown in Fig. 11.3. All aflatoxin-producing strains show the sametriplet pattern after electrophoretic separation of the PCR products. Thepattern of the aflatoxinogenic A. flavus strains was identical to that of the A.parasiticus strains, indicating the homology of the aflatoxin biosyntheticgenes in both species, which is also described in the literature (Yu et al., 1995).Non-aflatoxinogenic A. flavus strains gave variable results. One strainshowed no signal at all, indicating a complete or nearly complete deletion ofthe aflatoxin biosynthetic gene cluster. Another strain exhibited a doubletpattern, the band for the omt-A gene was missing, suggesting a deletion of thepart of the gene cluster containing the genes for the last reactions in thebiosynthetic pathway. A third strain possessed all three PCR DNA productbands, demonstrating another type of mutation, perhaps in one of theregulatory genes. Most of the non-aflatoxinogenic strains which wereanalysed showed changes in the triplet pattern, suggesting that theirphenotype was due to deletions of the aflatoxin biosynthetic genes.
A. versicolor, which is not an aflatoxin-producing species, showed thesame triplet pattern. This was not unexpected as A. versicolor is a sterig-matocystin producer, and sterigmatocystin is the precursor of aflatoxin(Dutton, 1988). It is synthesized as an end-product of a secondary metabolitepathway in some fungi like A. versicolor, A. nidulans, and in species ofChaetomium, Monocillium, Farrowia and Bipolaris. Sterigmatocystin byitself is an important mycotoxin, although with a reduced toxicity comparedwith aflatoxin (Feuell, 1969). The sterigmatocystin biosynthetic pathway isvery similar to the one for the aflatoxin biosynthesis. For example, the genesfor the conversion of versicolorin A to sterigmatocystin are very conservedin both pathways. In addition, aflR, a regulatory gene of the aflatoxinbiosynthetic pathway, is able to induce the genes of the sterigmatocystin
Fig. 11.2. Illustration of the primer binding sites of the three aflatoxin biosynthetic gene-specific primer pairs used for multiplex PCR. Thick lines represent the aflatoxinbiosynthetic gene coding sequences, cross-hatched boxes indicate intron sequences.
Detection of Mycotoxin-producing Fungi 249
biosynthetic pathway when introduced into a mutant of A. nidulans. A genefor a polyketide synthase which is required for aflatoxin biosynthesis wasalso identified in A. nidulans (Brown et al., 1996).
As mentioned above, the method should differentiate between A. flavus,A. parasiticus and the related species, A. oryzae and A. sojae. Figure 11.3shows that this is, indeed, the case. Both fermentation organisms obviouslycarry only a part of the aflatoxin biosynthetic gene cluster, as two bandsspecific for the ver-1 and omt-A genes appear. But the band for the nor-1gene is missing, indicating a deletion of the beginning of the gene cluster. Themethod clearly differentiates between these two GRAS organisms and theaflatoxinogenic fungi. These organisms do not have the same habitat and A.oryzae and A. sojae are only scarcely found in nature. Both strains areadapted to a fermentative food environment, which is not the typical habitat
Fig. 11.3. Agarose gel of the multiplex PCR products of different A. flavus, A. parasiticus,A. versicolor, A. sojae and A. oryzea strains. Chromosomal DNA of these strains wasisolated and subjected to PCR analysis using the aflatoxin biosynthetic gene-specificprimer. Lane 1, A. sojae DSM1147; lane 2, A. oryzea DSM1861; lane 3, A. versicolorBFE294; lanes 4–6, A. flavus BFE301, BFE310, BFE311; lanes 7–9, A. flavus BFE84,BFE292, BFE302; lanes 10 and 11, A. parasiticus BFE291, BFE293; lane 12, size standard,fragment sizes are indicated in bp.
250 R. Geisen
for aflatoxinogenic species. They are, however, morphologically very similarto the aflatoxinogenic species and the ability of the PCR method todifferentiate between these species can be used for the confirmation andsafety control of the GRAS species used for production of human food.
This diagnostic PCR method gave negative results with many of thefood-borne fungal species tested (Table 11.4). These included differentspecies of the genera Penicillium, Fusarium, Aspergillus, Byssochlamys andGeotrichum. Two interesting exceptions were several strains of Penicilliumroqueforti and P. italicum. Both species gave a positive signal in the case ofthe nor-1 specific band. The PCR product which appeared had the samemigration behaviour as the nor-1-specific amplicon from an aflatoxinogenicstrain. To analyse potential sequence homology, a digoxigenin-labelled nor-1PCR product was used as a probe for hybridization to the PCR product fromP. roqueforti. A weak signal indicated some homology, suggesting that P.roqueforti contains sequences with homology to the nor-1 gene of aflatox-inogenic fungi. The results demonstrate the advantage of multiplex PCRanalyses over monomeric reactions with regard to their specificity.
Shapiro et al. (1996) described a similar diagnostic PCR method for thedetection of aflatoxinogenic fungi. Three target genes, the omt-1 gene, thever-1 gene, and the apa-2 gene, from the aflatoxin biosynthetic gene clusterwere used in three separate monomeric PCRs. The apa-2 (now named asaflR) gene is a regulatory gene, influencing the expression of the other
Table 11.4. Results of PCR analyses specific for aflatoxin biosynthetic genes with food-borne fungi.
Species BFE straina nor-1 ver-1 omt-A
Penicillium italicum BFE45 + – –P. digitatum BFE46 – – –P. nalgiovense BFE66 – – –P. camemberti BFE135 – – –P. chrysogenum BFE236 – – –P. roqueforti BFE278 + +c –Byssochlamys nivea BFE218 – – –Geotrichum candidum BFE222 – – –Fusarium moniliforme BFE322 – – –F. graminearum DSM1095b – – –F. poae DSM62376 – – –F. solani DSM62416 – – –F. sporotrichoides DSM62423 – – –
aStrain number according the culture collection of the Bundesforschungsanstalt furErnahrung.bStrain number of the German Culture Collection (DSM).cThe PCR fragment was slightly larger than that of A. parasiticus.
Detection of Mycotoxin-producing Fungi 251
aflatoxin biosynthetic genes (Chang et al., 1993). In contrast to the resultsdescribed by Geisen (1996), no strong positive PCR signals were found withDNA from aflatoxinogenic A. flavus strains. After 30 cycles a weak signal forthe omt-1 gene appeared, and after 40 cycles, a weak band for the ver-1 genebecame visible with DNA from A. flavus as the template, but a reaction withthe aflR-specific primer pair failed. The sequences for the aflR genes of A.flavus and A. parasiticus are highly homologous, but show distinct differ-ences according to Chang et al. (1995). These sequence dissimilarities mightbe responsible for the failure to detect the aflR gene in A. flavus by PCR.Shapiro et al. (1996) could not identify the omt-1 gene in A. nidulans, apotential sterigmatocystin-producing species, and they argued that no omt-1gene was present. The PCR approach described by Geisen (1996) however,demonstrates that at least in A. versicolor, an omt-1-homologous sequencewas present.
Detection of aflatoxinogenic A. flavus strains in a food systemAflatoxinogenic fungi are found predominantly in certain foods such aspeanuts, almonds, figs and spices (Bullermann, 1979). Figs are often infectedby members of the group of black aspergilli, including A. flavus and A.parasiticus (Doster et al., 1996). Figs that were infected with an aflatoxino-genic strain of A. flavus could be identified with the PCR approach. Theexpected amplicons were generated with DNA isolated from infected figs,whereas uninfected figs gave no signal at all (Farber et al., 1997).
The most crucial prerequisite for diagnostic PCR with food samples isthe isolation of sample DNA in a PCR-usable form. It is known that certainfood components like fats and proteins can interfere with the activity of Taqpolymerase (Rossen et al., 1992). An inhibition of the PCR was also observedfor the infected figs, indicating that a high concentration of carbohydrates isalso inhibitory to the PCR system. The sample DNA was prepared by aphenol extraction method. An estimation of the sensitivity of the reactionrevealed that it was reduced by a factor of ten compared with pure fungalDNA.
Kreutzinger et al. (1996) described a method for reducing inhibitoryactivity in PCR from environmental samples. In an attempt to detectectomycorrhizal fungi in their natural habitat by PCR, they observed that theTaq polymerase was inhibited strongly by compounds in the sample. Thisproblem was overcome by the use of very dilute template DNA in a firstround of PCR, followed by a second reaction with nested PCR primers.Lantz et al. (1994) have described another approach for the preparation ofsample DNA. They attempted to detect pathogenic Listeria monocytogenescells in soft cheese by PCR. However, with conventional sample DNApreparation protocols, the reaction failed; foods with a high fat content areparticularly inhibitory to the polymerase reaction. Functional templateDNA can be prepared if an aqueous, two phase sample preparation systemis used. With this system, the sample is homogenized in a mixture of two
252 R. Geisen
non-soluble aqueous solutions, which separate in two phases after homoge-nization. One phase consists of a polyethylene glycol (PEG) solution and theother of a dextran solution. This extraction system separates PCR inhibitorycompounds, which partition to the PEG phase. If samples from the dextranphase are used for PCR, L. monocytogenes cells can be detected.
Shapiro et al. (1996) used their PCR method for the detection ofaflatoxinogenic fungi in corn. They described an enrichment procedure toamplify the template DNA prior to PCR by suspending the corn sample ina rich medium; the sensitivity of the method increased with the incubationtime but the detection time increased simultaneously. Only corn inoculatedwith aflatoxinogenic A. parasiticus gave positive signals with the PCR andafter 24 h incubation, 1 × 102 spores of A. parasiticus could be detected.
Even with sophisticated DNA preparation protocols, the occurrence offalse negative reactions with food samples remains a problem. The use of aninternal standard can give information about the quality of the reaction. If auniversal primer set is used which gives a PCR product with all food-relevantfungal species, then a DNA band of a particular length should occur in nearlyall food samples where there is contaminating fungal biomass. Alternatively,the sample can be spiked with purified fungal DNA of a certain species. Theoccurrence of the standard amplicon is then an indication of the efficiency ofthe reaction. It is advantageous to use a universal primer set instead of aspecific one, as every available fungal DNA can then be used as an internalstandard. A universal fungus-specific primer system has been described byKappe et al. (1996); the target sequences of this system are the 17S ribosomalRNA genes. Similarly, the conserved nucleotide sequences of the rRNAgenes, which can serve as primer sequences for the amplification of the ITS1and ITS2 regions, have been described (White et al. 1990).
The primers ITS1 and ITS2 can be added as a fourth primer pair to themultiplex PCR. They amplify the ITS1 region from different fungal speciesand the PCR product is approximately 250 bp long, although the length mayvary depending on the template DNA used. Figure 11.4 shows some typicalresults. The aflatoxinogenic strain now shows a quadruplet pattern asexpected. All other strains, including different Penicillium or Aspergillusspecies, show only the standard band of the ITS1 region. As a result of thisreaction design, a sample with a quadruplet pattern indicates the presence ofan aflatoxinogenic species, whereas a monomeric band of about 250 bpindicates that the reaction was not inhibited by food components and that thesample did not contain potential aflatoxinogenic fungi.
11.2.2 PR toxin producing fungi
Penicillum roqueforti occurs in various natural habitats. It is used as a fungalstarter culture for the production of blue-veined cheese (Marth, 1987), butcan also be found as a spoilage organism in different food and feedcommodities (Frisvad, 1988). P. roqueforti is a heterogeneous species that
Detection of Mycotoxin-producing Fungi 253
was recently divided, according to secondary metabolite patterns anddifferences in its ITS regions, into three distinct species: P. roqueforti, P.paneum and P. carneum (Boysen et al., 1996). All three species are able toproduce various secondary metabolites: P. carneum is capable of producingpatulin, penitrem A and mycophenolic acid; P. roqueforti produces PR toxin,marcfortines and fumigaclavine A; and P. paneum produces patulin, botryo-diploidin and other secondary metabolites. All three species are morpho-logically very similar. P. roqueforti is the species which is used exclusively forthe production of blue cheese. All strains isolated from blue cheese are ableto produce PR toxin (Geisen and Holzapfel, 1995). PR toxin is a relativelytoxic substance, which is able to inhibit protein translation in eukaryotic cells(Moule et al., 1978). However, PR toxin is not stable in the cheese matrixwhere it is converted to the much less toxic PR imine (Scott, 1981).Nevertheless, strains which do not produce PR toxin are preferable over
Fig. 11.4. Agarose gel of the multiplex PCR products of different food-borne fungi.Chromosomal DNA of these strains was isolated and subjected to PCR analysis using theaflatoxin biosynthetic gene-specific primers in addition to a primer pair specific for theITS1 region of the rRNA genes. Lane 1, F. moniliforme BFE312; lane 2, F. solani BFE325;lane 3, P. digitatum BFE350; lane 4, A. flavus BFE312 (aflatoxin negative); lane 5, A. flavusBFE84 (aflatoxin positive); lane 6, size standard, fragment sizes are indicated in bp.
254 R. Geisen
conventional strains with respect to safety considerations. PR toxin is asesquiterpenoid secondary metabolite, with acetyl-CoA as the first pre-cursor. One of the key enzymes in its biosynthetic pathway is thearistolochen synthase, a sesquiterpene cyclase. The nucleotide sequence ofthis gene is known (Procter and Hohn, 1993) and, by using gene-specificPCR with the aristolochen synthase gene (ari1) as a target, it is possible toscreen P. roqueforti strains for the presence of aristolochen synthase. Strainswith a deletion in that gene are expected to be unable to produce PR toxin.This method of screening for PR toxin-free strains is more direct, reliable andless time-consuming than looking for the ability to produce PR toxinespecially as PR toxin production is dependent on various environmentalconditions (Scott et al., 1977), which makes the identification of PR toxin-negative strains by conventional methods difficult.
Strains isolated from cheese and infected feeds were subjected to PCRanalysis with ari1-specific primers. A product of the expected lengthoccurred in nearly all strains, indicating the presence of the ari1 gene. Figure11.5 shows a typical result obtained with several strains. Subsequent analysisby thin layer chromatography (TLC) showed that all strains except oneproduced PR toxin. The strains which were negative in the PCR, but whichwere able to produce PR toxin, were verified by dot-blot hybridization usingan ari1-specific probe. After the analysis all PR toxin-producing strains werepositive either in the dot-blot hybridization or the PCR analysis (Table 11.5).An exception was one strain which did not produce PR toxin, indicating thatit did not carry the ari1 gene. The other strains which were negative in thePCR analysis, but positive in the dot-blot hybridization and TLC obviouslycarried active genes which may have alterations in their primer binding sites.These results show that it is not always appropriate to rely solely on onePCR target site, as small changes in the sequence can have dramatic effectson the PCR results. The single strain which was negative in the PCR analysisand did not produce PR toxin, was originally isolated from cheese and istherefore probably a safe candidate for the production of blue-veined cheese.
As mentioned above, homologues of aflatoxin biosynthetic genes can beidentified unexpectedly in P. roqueforti (Table 11.5). The same phenomenonis apparent with the ari1 gene and a sequence homologous to that gene canbe found unexpectedly in various species (Table 11.6). The gene-specific PCRgave positive results with P. camemberti and Byssochlamys nivea, bothspecies which are not known to produce PR toxin. With the dot-blot analysiseven more species gave positive results, indicating the occurrence of ari1-likesequences in a variety of species, which are not able to produce PR toxin. Therelevance of the frequent occurrence of a nucleotide sequence homologous tosecondary metabolite biosynthetic genes in various fungi is not known.Enzymes of secondary metabolite pathways have less specificity than theircounterparts from primary metabolism (Dutton, 1988) and this results in asomewhat different behaviour from that of biosynthetic enzymes of primarymetabolism. In certain cases, one enzyme can catalyse analogous reactions
Detection of Mycotoxin-producing Fungi 255
with related but different substrates. This can result in a metabolic grid, anetwork of enzymatic reactions from different substrates that give rise todifferent reaction products (Yabe et al., 1991). This is one of the reasons whyin secondary metabolism a large number of end-products can be produced,such as the aflatoxins, the fumonisins, the trichothecens or the ochratoxins.This behaviour may also be an explanation for the positive PCR results forspecific secondary metabolite biosynthetic genes in various species. If thesespecies possess active genes with homology to mycotoxin biosynthetic genes,
Fig. 11.5. Agarose gel of PCR products of P. roqueforti strains and a P. nalgiovense strain(as a control) with aristolochen synthase-specific primers. Lane 1, P. roqueforti BFE42;lane 2, P. roqueforti BFE50; lane 3, P. nalgiovense BFE66; lane 4, P. roqueforti BFE53; lane5, P. roqueforti BFE54; lane 6, size standard, fragment sizes are indicated in kb.
256 R. Geisen
their gene products may participate in secondary metabolite pathwaysleading to different, perhaps as yet unidentified, end-products.
These results taken together suggest that a monomeric PCR reaction,which targets only one gene, possesses insufficient specificity for thedetection of mycotoxin-producing fungi. Multiplex reactions, as was descri-bed for aflatoxinogenic fungi, are recommended. If only one gene of themycotoxin biosynthetic pathway is known, as in the case of PR toxin,another known specific sequence can be used as an additional targetsequence, for example the sequences of the rRNA genes of P. roqueforti(Boysen et al., 1996).
Table 11.5. Presence of the ari1 gene sequences and ability to produce PR toxin invarious Penicillium roqueforti strains.
BFE straina ari1b Dot-blotc PR toxind nor1e Sourcef
BFE42 + + + – CBFE53 + + + + CBFE168 + + + ND CBFE169 + + + – CBFE170 + + + ND CBFE171 + + + ND CBFE172 + + + ND CBFE50 – + + – CBFE54 – – – – CBFE62 – + + + CBFE63 + + + + CBFE208 + + + ND SBFE209 + + + ND SBFE210 + + + ND SBFE211 + + + ND SBFE215 + + + ND SBFE216 + + + – SBFE212 – + + – SBFE213 + + + – SBFE284 + + + + SBFE285 + + + + S
aStrain number according the culture collection of the Bundesforschungsanstalt furErnahrung.bThe presence of the ari1 gene sequences was checked with gene-specific PCR.cFor dot-blot analysis the labelled ari1-specific PCR product was used.dDetected by thin layer chromatography.eThe presence of the nor1 gene was checked by gene-specific PCR.fC, isolated from cheese; S, isolated from silage.ND, not determined.
Detection of Mycotoxin-producing Fungi 257
11.2.3 rDNA and miscellaneous sequences as target sequences
The organization of ribosomal RNA genes is highly conserved within thefungal kingdom. The small subunit, 5.8S, and large subunit rRNA genes areorganized in a single transcription unit and are separated by two spacerregions ITS1 and ITS2. The RNA transcript is post-transcriptionallyprocessed into small subunit, 5.8S, and large subunit rRNA species. TherRNA sequences have conserved and variable regions and are useful forstudying distantly related organisms at the taxonomic level. The ITSsequences, however, are more variable in their nucleotide composition andcan be used for differentiation of species or populations. It may be possibleto identify unique sequences within the ITS regions which may serve astarget sequences for diagnostic PCR. Universal primers which can be usedfor amplification or cycle sequencing of ITS1 and ITS2 have been described(White et al., 1990; Fig. 11.6). It is relatively straightforward to sequencethese regions by using primers such as ITS1 and ITS4, and to determineunique sequences for primer development. A prerequisite for usage of thesesequences for detection of mycotoxinogenic fungi is the requirement thattheir presence be linked to the ability of a strain to produce a mycotoxin. Thisis one of the drawbacks of this approach as in most cases not all strains of aspecies are able to produce the respective mycotoxin. A species-specificprimer pair identified by this approach does not ultimately mean that it is
Table 11.6. Presence of aristolochen synthase gene likenucleotide sequences in various species.
BFE straina
Detection of ari1-likesequences by
PCR Dot-blot
P. roqueforti BFE278 + +P. camemberti BFE135 + +B. nivea BFE218 + +P. italicum BFE45 – +P. nalgiovense BFE66 – +A. nidulans BFE125 – +P. digitatum BFE46 – –P. chrysogenum BFE236 – –G. candidum BFE222 – –A. flavus BFE388 – –A. parasiticus BFE293 – –A. versicolor BFE294 – –
aStrain number according the culture collection of theBundesforschungsanstalt fur Ernahrung.
258 R. Geisen
specific only for the mycotoxinogenic strains of that species. A positive resultfrom PCR of the rRNA genes is, therefore, not as valid as the results froma PCR targeted to the mycotoxin biosynthetic genes.
Considerable literature data on ITS sequences of different fungi areavailable. Most of the sequences were obtained for taxonomic purposes andtheir specificity in PCR analyses has not been determined (Morales et al.,1993; Bunting, et al., 1996; Waalwijk et al., 1996). F. sambucinum (teleo-morph, Gibberella pulicaris) is able to produce fusarin C and trichothecenes(Smith and Solomons, 1994). O’Donnel (1997) has described three differentgroups of ITS sequences within the species F. sambucinum. However, thepossible relationship between these ITS groups and the ability to produce amycotoxin was not considered. Grimm and Geisen (1996) sequenced theITS1 region of fumonisin-producing Fusarium species. They were able toidentify regions which were common to all fumonisin-producing fungi, butwhich showed minor polymorphisms in sequence compared with non-fumonisin-producing species. On the basis of these differences, primer pairswere derived which gave only the expected products from F. moniliforme, F.nygamai, F. napiforme and F. proliferatum, i.e. potential fumonisin-producing fungi.
Schilling et al. (1996) analysed the ITS region of Fusarium culmorum(teleomorph, unknown), F. graminearum (teleomorph, Gibberella zeae) andF. avenaceum (teleomorph, G. avenacea) with the aim of developing ITS-specific PCR primers. All three species are plant pathogens of cereals andgrasses. The three species are able to produce different mycotoxins: F.avenaceum produces moniliformin and trichothecene A; F. graminearumproduces zearalenone, trichothecene A + B and fusarin C; and F. culmorumproduces zearalenone, trichothecene A + B and culmorin. Schilling et al.(1996) were not able to identify sufficient sequence polymorphisms withinthe ITS region of these three species to identify specific primer target sites.For this reason, they applied another approach in which preselected randomsequences were chosen as target sequences for the PCR primers. Thispreselection was achieved by identifying RAPD–PCR patterns which werespecific for each species. RAPD–PCR is a variation of conventional PCR(Williams, 1990) in which one primer of arbitrary sequence is used. Thehybridization temperature during RAPD–PCR is considerably reducedcompared with conventional PCR. This enables semi-specific binding of the
Fig. 11.6. Illustration of a typical fungal rRNA gene and the position of the universalprimers ITS1 and ITS4.
Detection of Mycotoxin-producing Fungi 259
primer and results in a specific RAPD pattern. If identical conditions areused, the same pattern should be generated with each reaction. Depending onthe type of random primer used, the resulting RAPD pattern can be species-specific (Guthrie et al., 1992), and can differentiate between variousgenotypes within a species (Hamelin et al., 1993) or even between strains ofthe same species (Bidochka et al., 1994). The probability that certain bandsof the RAPD pattern which occur only in mycotoxin-producing fungiconsists of unique sequences is very high. Schilling et al. (1996) isolatedunique bands of the RAPD pattern of Fusarium species. They derivedspecific PCR primer target sites from their sequences which could be used fordifferentiation and detection of these species.
The approach described above may be a general method for thedevelopment of a diagnostic PCR method for a particular group ofmicroorganisms if no genetic data are available. The same approach was usedfor the development of gene probes for potential fumonisin-producing fungi(Geisen, 1997). Two RAPD bands were identified which only occurred withpotential fumonisin-producing fungi, such as F. moniliforme, F. nygamai, F.napiforme and F. proliferatum. These two DNA fragments were labelledeither with digoxigenin or with biotin and used as probes for various fungalDNA sequences. Specific hybridization of the probes was visualized byalkaline phosphatase reactions with either fast blue B (resulting in a bluecolour) or fast red TR (resulting in a red colour). When both colours werepresent on the membrane the result was interpreted as the presence of apotential fumonisin-producing fungus. A survey of the results with theDNA from various food-borne fungi is given in Table 11.7. From theseresults it can be concluded that primer sequences for diagnostic PCR can bederived from RAPD fragments as also shown by Schilling et al. (1996).
In addition to rRNA genes or random sequences, sequences from clonedgenes of mycotoxin-producing fungi may serve as targets for diagnosticPCR. Niessen and Vogel (1997) developed a PCR analysis which was specificfor F. graminearum. All other Fusarium species or species of other generagave negative results, indicating high specificity for the method. The reactionwas directed against the endogenous galactose oxidase gene (gaoA); however,the authors did not attempt to correlate mycotoxin production and PCRresults.
11.3 Conclusions
PCR is a valuable tool for the rapid screening of foods and feeds for thepresence of mycotoxin-producing fungi. Results can be obtained from aninfected sample within 24 h as compared with up to several days byconventional methods. If an appropriate target sequence is chosen, themethod can also differentiate between mycotoxin-producing and non-producing strains of a species in most cases.
260 R. Geisen
Problems with inhibitory substances within food samples can beovercome by an adapted DNA purification protocol (Lantz et al., 1994), theuse of highly diluted DNA and a subsequent nested second amplification(Kreutzinger et al., 1996), or controlled by the use of internal standard DNAgiving information about the quality of the reaction.
The most direct procedure for the development of a diagnostic PCRmethod for mycotoxin-producing fungi is the targeting of the mycotoxinbiosynthetic genes. If their sequences are not available, other opportunitiesfor the identification of target sequences exist, such as the determination ofspecificities in ITS sequences, or random sequences preselected by RAPDs;sequences from structural genes may also serve as target sites. Thesesecondary target sequences are less specific because mycotoxin-producingand non-producing strains are indistinguishable. Diagnostic PCR methods
Table 11.7. Dot-blot analysis with the RAPD geneprobes for fumonisin-producing fungi.
BFE straina Probe 1 Probe 2
Penicillium italicum BFE45 – –P. digitatum BFE46 – –P. nalgiovense BFE66 – –Aspergillus flavus BFE84 – +A. nidulans BFE125 – –P. camemberti BFE125 – –Byssochlamys nivea BFE218 – –Fusarium moniliforme BFE314 + +F. moniliforme BFE315 + +F. moniliforme BFE316 + +F. moniliforme BFE317 + +F. moniliforme BFE318 + +F. moniliforme BFE319 ND +F. moniliforme BFE320 + +F. proliferatum BFE343 + +F. proliferatum BFE344 + +F. nygamai BFE353 + +F. nygamai BFE355 + +F. napiforme BFE354 + +F. graminearum BFE323 – –F. poae BFE324 – –F. solani BFE325 – –F. sporotrichoides BFE326 – –
aStrain number according the culture collection of theBundesforschungsanstalt fur Ernahrung.ND, not determined.
Detection of Mycotoxin-producing Fungi 261
are rapid tools for safety control of foods and feeds. They can, however,only give information about the presence of a potential mycotoxin-producing fungus in a sample but cannot detect the mycotoxin itself. Apositive result indicates a potential health hazard and the product shouldbe further checked for the presence of the particular mycotoxin byanalytical methods.
Acknowledgements
P. Thiel and J. P. Rheeder are thanked for providing fumonisin-producingFusarium species, and H. Auerbach for the P. roqueforti strains from silage.
References
Bamburg, J.R., Riggs, N.V. and Strong, F.M. (1968) The structures of toxins from twostrains of Fusarium trincinctum. Tetrahedron 24, 3329–3336.
Barger, G. (1931) Ergot and Ergotism. Gurney and Jackson, London.Beck, J., Ripka, S., Siegner, A., Schiltz, E. and Schweizer, E. (1990) The multi-
functional 6-methylsalicylic acid synthase gene of Penicillium patulum. Euro-pean Journal of Biochemistry 192, 487–498.
Bennett, J.W. and Papa, K.E. (1988) The aflatoxigenic Aspergillus spp. Advances inPlant Pathology 6, 263–280.
Bidochka, M.J., McDonald, M.A., St Leger, R.J. and Roberts, D.W. (1994) Differ-ention of species and strains of entomopathogenic fungi by random amplifica-tion of polymorphic DNA (RAPD). Current Genetics 25, 107–113.
Boysen, M., Skouboe, P., Frisvad, J. and Rossen, L. (1996) Reclassification of thePenicillium roqueforti group into three species on the basis of molecular geneticand biochemical profiles. Microbiology 142, 541–549.
Brown, D.W., Yu, J., Kelkar, H.S., Fernandes, M., Nesbit, T.C., Keller, N.P., Adams,T.H. and Leonhard, T.J. (1996) Twenty five coregulated transcripts define asterigmatocystin gene cluster in Aspergillus nidulans. Proceedings of the NationalAcademy of Sciences USA 93, 1418–1422.
Bullerman, L.B. (1979) Significance of mycotoxins to food safety and human health.Journal of Food Protection 42, 65–86.
Bunting, T.E., Plunbley, K.A., Clarke, B.B. and Hillman, B.I. (1996) Identification ofMagnaporthe poae by PCR and examination of its relationship to other fungi byanalysis of their nuclear rDNA ITS1 region. Phytopathology 86, 398–404.
Chamberlain, J.S., Gibbs, R.A., Ranier, J.E., Nguyen, P.N. and Caskey, C.T. (1990)Multiplex PCR for the diagnosis of Duchenne muscular dystrophy. In: Gelfland,D.H., Innis, M.A., Sninsky, J.J. and White, T.J. (eds) PCR protocols: a Guide toMethods and Applications. Academic Press, San Diego, pp. 272–281.
Chang, P.K., Cary, J.W., Bhatnagar, D., Cleveland, T., Bennett, J.W., Linz, J.,Woloshuk, C.P. and Payne, G.A. (1993) Cloning of the Aspergillus parasiticusapa-2 gene associated with the regulation of aflatoxin biosynthesis. Applied andEnvironmental Microbiology 59, 3273–3279.
262 R. Geisen
Chang, P.K., Bhatnagar, D., Cleveland, T. and Bennett, J.W. (1995) Sequencevariability in homologs of the aflatoxin pathway gene aflR distinguishes speciesin Aspergillus section Flavi. Applied and Environmental Microbiology 61, 40–43.
Chu, F.S. (1991) Mycotoxins: food contamination, mechanism, carcinogenic potentialand preventive measures. Mutation Research 259, 291–306.
Davies, N.D., Iyer, S.K. and Diener, U.L. (1987) Improved method of screening foraflatoxin with a coconut agar medium. Applied and Environmental Microbiology53,1593–1595.
Desjardins, A.E., Hohn, T.M. and McCormick, S.P. (1993) Trichothecene biosyn-thesis in Fusarium species: chemistry, genetics and significance. MicrobiologicalReviews 57, 595–604.
Diener, U.L., Cole, R.J., Sanders, T.H., Payne, G.A., Lee, L.S. and Klich, M. (1987)Epidemiology of aflatoxin formation by Aspergillus flavus. Annual Review ofPhytopathology 25, 249–270.
Doster, M.A., Michailides, T.J. and Morgan, D.P. (1996) Aspergillus species andmycotoxins in figs from California orchards. Plant Disease 80, 484–489.
Dutton, M.F. (1988) Enzymes and aflatoxin biosynthesis. Microbiological Reviews 52,274–295.
Farber, P., Geisen, R. and Holzapfel, W.H. (1997) Detection of aflatoxinogenic fungiin figs by a PCR reaction. International Journal of Food Microbiology 36,215–220.
Feuell, A.J. (1969) Types of mycotoxins in food and feeds. In: Goldblatt, L.A. (ed.)Aflatoxin. Academic Press, New York, pp. 187–221.
Frisvad, J.C. (1988) Fungal species and their specific production of mycotoxins. In:Samson, R.A. and van Reenen-Hoekstra, E.S. (eds) Introduction to Food BorneFungi. Centraalbureau voor Schimmelcultures, Baarn, pp. 239–249.
Geisen, R. (1996) A multiplex PCR reaction for the detection of potential aflatoxinand sterigmatocystin producing fungi. Systematic and Applied Microbiology 19,388–392.
Geisen, R. (1997) Nachweis von potentiell fumonisinbildenden Fusarien mit Hilfe einer‘Multicolour Dot Blot Reaktion’. In: Gareis, M. and Scheuer, R. (eds) Proceedingsof the 18th Mykotoxin Workshop, Bundesanstalt fur Fleischforschung, Kulmbach,10–12 June 1996. Bundesanstalt fur Fleischforschung, pp. 15–20.
Geisen, R. and Holzapfel, W.H. (1995) Molecular charcterization of PR toxinproducing Penicillium roqueforti strains. BIOspectrum 3, 101.
Grimm, C. and Geisen, R. (1996) A PCR reaction specific for potential fumonisinproducing Fusaria based on ITS sequences. VAAM Workshop, Regulation inFungi. Julich. November 21–22.
Guthrie, P.A.I., Magill, C.W., Frederiksen, R.A. and Odvody, G.N. (1992) Randomamplified polymorphic DNA markers: a system for identifying and differ-entiating isolates of Colletotrichum graminicola. Phytopathology 82, 832–835.
Hamelin, R.C., Ouellete, G.B. and Bernier, L. (1993) Identification of Gremmeniellaabietina races with random amplified polymorphic DNA markers. Applied andEnvironmental Microbiology 59, 1752–1755.
Hohn, T.M., McCormick, S.P. and Desjardins, A.E. (1993) Evidence for a gene clusterinvolving trichothecene-pathway biosynthetic genes in Fusarium sporotri-choides. Current Genetics 24, 291–295.
Hopwood, D.A. and Sherman, D.H. (1990) Molecular genetics of polyketides and itscomparison to fatty acid biosynthesis. Annual Review of Genetics 24, 37–66.
Detection of Mycotoxin-producing Fungi 263
Hu, X., Nazar, R.N. and Robb, J. (1993) Quantification of Verticillium biomass inwilt disease development. Molecular Plant Pathology 42, 23–36.
Kappe, R., Fauser, C., Okeke, C.N. and Maiwald, M. (1996) Universal fungus-specificprimer systems and group specific hybridization oligonucleotides for 18S rRNA.Mycoses 39, 25–30.
Kelkar, H.S., Keller, N.P. and Adams, T.H. (1996) Aspergillus nidulans stc P encodesan O-methyltransferase that is required for sterigmatocystin biosynthesis.Applied and Environmental Microbiology 62, 4296–4298.
Klich, M., Yu, J., Chang, P.K., Mullaney, E.J., Bhatnagar, D. and Cleveland, T. (1995)Hybridization of genes involved in aflatoxin biosynthesis to DNA of aflatoxino-genic and non-aflatoxinogenic aspergilli. Applied Microbiology and Biotechnol-ogy 44, 439–443.
Kreutzinger, N., Podeu, R., Gruber, F., Gobl, F. and Kubiceck, C.P. (1996)Identification of some ectomycorrhizal basidiomycetes by PCR amplification oftheir gpd (glyceraldehyde-3-phosphate dehydrogenase) genes. Applied andEnvironmental Microbiology 62, 3432–3438.
Krogh, P. (1987) Ochratoxins in food. In: Krogh, P. (ed.) Mycotoxins in Food.Academic Press, London, pp. 97–121.
Kurtzman, C.P., Smiley, M.J., Robnett, C.J. and Wicklow, D.T. (1986) DNArelatedness among wild and domesticated species in the Aspergillus flavus group.Mycologia 78, 955–959.
Lantz, P.G., Tjernfeld, F., Borch, E., Hahn-Hagerdahl, B. and Rådstrom, P. (1994)Enhanced sensitivity in PCR detection of Listeria monocytogenes in soft cheesethrough use of an aqueous two-phase system as a sample preparation method.Applied and Environmental Microbiology, 60, 3416–3418.
Marth, E. (1987) Dairy products. In: Beuchat, L. (ed.) Food and Beverage Mycology.Van Nostrand Reinhold, New York, pp. 175–209.
Martin, J.F. (1992) Secondary metabolites. In: Kinghorn, J.R. and Turner, G. (eds)Applied Molecular Genetics of Filamentous Fungi. Blackie Academic andProfessional, London, pp. 214–252.
Mayorga, M.E. and Timberlake, W.E. (1992) The developmentally regulated Aspergil-lus nidulans wA gene encodes a polypeptide homologous to polyketide and fattyacid synthases. Molecular and General Genetics 235, 205–212.
McCormick, S.P., Hohn, T.M. and Desjardins, A.E. (1996) Isolation andcharacterization of Tri3, a gene encoding 15-O-acetyltransferase fromFusarium sporotrichoides. Applied and Environmental Microbiology 62,353–359.
Morales, V.M., Pelcher, L.E. and Taylor, J.L. (1993) Comparison of the 5.8S rDNAand internal transcribed spacer sequences of isolates of Leptosphaeria maculansfrom different pathogenicity groups. Current Genetics 23, 490–495.
Moule, Y., Jemmali, M. and Darracq, N. (1978) Inhibition of protein synthesis by PRtoxin, a mycotoxin from Penicillium roqueforti. FEBS Letters 8, 341–344.
Nelson, P.E., Desjardins, A.E. and Plattner, R.D. (1993) Fumonisins, mycotoxinsproduced by Fusarium species: biology, chemistry and significance. AnnualReviews of Phytopathology 31, 233–252.
Niessen, L. and Vogel, R.F. (1997) Specific identification of Fusarium graminearumby PCR with gaoA targeted primers. Systematic and Applied Microbiology 20,111–113.
O’Donnel, K.L. (1992) Ribosomal DNA internal transcribed spacers are highly
264 R. Geisen
divergent in the phytopathogenic ascomycete Fusarium sambucinum (Gibberellapulicaris). Current Genetics 22, 213–220.
Olsen, J.E., Aabo, S., Hill, W., Notermans, S., Wernars, K., Granum, P.E., Popovic,T., Rasmussen, H.N. and Olsvik, Ø. (1995) Probes and polymerase chainreaction for detection of food-borne bacterial pathogens. International Journalof Food Microbiology 28, 1–78.
Proctor, R.H. and Hohn, T.M. (1993) Aristolochen synthase: isolation, character-ization, and bacterial expression of a sesquiterpenoid biosynthetic gene (ARi1)from Penicillium roqueforti. Journal of Biological Chemistry 268, 4543–4548.
Rossen, L., Nørskov, P., Holmstrøm, K. and Rasmussen, O.F. (1992) Inhibitionof PCR by components of food samples, microbial diagnostic assays andDNA-extraction solutions. International Journal of Food Microbiology 17,37–45.
Schilling, A.G., Moller, E.M. and Geiger, H.H. (1996) Polymerase chain reaction-based assays for species-specific detection of Fusarium culmorum, F. grami-nearum and F. avenaceum. Phytopathology 86, 515–522.
Scott, P.M. (1981) Toxins of Penicillium species used in cheese manufacture. Journalof Food Protection 44, 702–710.
Scott, P.M., Kennedy, B.P.C., Harwig, J. and Blanchfield, B.J. (1977) Study ofconditions for production of roquefortin and other metabolites of Penicilliumroqueforti. Applied and Environmental Microbiology 33, 249–253.
Shapiro, R., Paster, N., Eyal, O., Menasherov, M., Mett, A. and Salomon, R. (1996)Detection of aflatoxinogenic molds in grains by PCR. Applied and Environmen-tal Microbiology 62, 3270–3273.
Smith, J.E and Solomons, G.L. (1994) Mycotoxins in Human Nutrition and Health.Directorate General XII, EUR 16048 EN, European Commission, Brussels.
Trail, F., Mahanti, N., Mehigh, R., Liang, S.H., Zhou, R. and Linz, J. (1995a) Physicaland transcriptional map of an aflatoxin gene cluster in Aspergillus parasiticus andfunctional disruption of a gene involved early in the aflatoxin pathway. Appliedand Environmental Microbiology 61, 2665–2673.
Trail, F., Mahanti, N. and Linz, J. (1995b) Molecular biology of aflatoxin biosynthesis.Microbiology 141, 755–765.
Waalwijk, C., de Koning, J.R.A., Baayen, R.P. and Gams, W. (1996) Discordantgroupings of Fusarium spp. from sections Elegans, Liseola and Dlaminia basedon ribosomal ITS1 and ITS2 sequences. Mycologia 88, 361–368.
Wang, I.K., Reeves, C. and Gaucher, G.M. (1991) Isolation and sequencing of agenomic DNA clone containing the 3 terminus of the 6-methysalicylic acidpolyketide synthetase gene of Penicillium urticae. Canadian Journal of Micro-biology 37, 86–95.
White, T.J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification and directsequencing of fungal ribosomal RNA genes for phylogenetics. In: Gelfland,D.H., Innis, M.A., Sninsky, J.J. and White, T.J. (eds) PCR protocols: a Guide toMethods and Applications. Academic Press, San Diego, pp. 315–322.
Williams, J.K.G., Kubelik, A.R. Livak, K.J., Rafalski, J.A. and Tingey, S.V. (1990)DNA polymorphisms amplified by arbitrary primers are useful as geneticmarkers. Nucleic Acids Research 18, 6531–6535.
Wilson, D.M. (1974) Patulin and penicillic acid. In: Rodricks, J.V. (ed.) Mycotoxinsand Other Fungal Related Food Problems. American Chemical Society, Wash-ington DC, pp. 90–109.
Detection of Mycotoxin-producing Fungi 265
Yabe, K., Ando, Y., and Hamasaki, T. (1991) A metabolic grid among versiconalhemiacetal acetate, versiconol acetate, versiconol and versiconal during aflatoxinbiosynthesis. Journal of General Microbiology 137, 2469–2475.
Yu, J., Chang, P.K., Cary, J.W., Wright, M., Bhatnagar, D., Cleveland, T., Payne, G.A.and Linz, J. (1995) Comparative mapping of aflatoxin pathway gene clusters inAspergillus parasiticus and Aspergillus flavus. Applied and EnvironmentalMicrobiology 61, 2365–2371.
266 R. Geisen
PCR Diagnostics in MedicalMycology
T. Hughes, T.R. Rogers and K. Haynes
Department of Infectious Diseases, Imperial College of Science,Technology and Medicine, Hammersmith Campus, Du Cane Road,London W12 0NN, UK
12.1 Introduction
Recent advances in the use of immunosuppressive therapies to treat cancerand enable solid organ or bone marrow transplants, together with advancesin the development of broad spectrum antibiotics, have created an increasingpopulation of immunocompromised patients. In addition, the HIV pandemichas created a large increase in the number of immunosuppressed individuals.These patients are at significant risk from systemic fungal infections. Theincidence of invasive fungal infection in bone marrow transplant patients hasbeen reported to be as high as 50%, and the subsequent mortality rates aregenerally around 80% (Tang and Cohen, 1992). The three major opportu-nistic fungal pathogens in the UK are Candida albicans, Aspergillus fumiga-tus and Cryptococcus neoformans but many other fungi have also beenreported as pathogens in these clinical settings. These include non-albicansCandida spp., especially Candida krusei and Candida glabrata, Aspergillusflavus, Pneumocystis carinii, Fusarium spp., Trichosporon beigelii, Rhizopusarrhizus, Histoplasma capsulatum, Paracoccidioides brasiliensis and Cocci-dioides immitis (Bodey, 1988; Anaissie et al., 1989). With the exception of thecryptococcal antigen latex agglutination test, established methods for diag-nosing systemic fungal infections are often time-consuming and insensitive;e.g. blood cultures are nearly always negative in cases of invasive aspergillosis(Richardson and Warnock, 1993). If appropriate therapy is to improve theprognosis of the immunocompromised patient with systemic fungal infec-tion, early diagnosis is required (Burch et al., 1987).
Antibody responses in immunocompromised hosts are generally tooweak to form the basis of a diagnostic test. However, a large research
12
© CAB INTERNATIONAL 1998. Applications of PCR in Mycology(eds P.D. Bridge, D.K. Arora, C.A. Reddy and R.P. Elander) 267
investment has been made in the development of antigen detection-basedimmunoassays for the diagnosis of various systemic mycoses including bothinvasive candidosis and aspergillosis, disseminated histoplasmosis, coccidioi-domycosis and paracoccidioidomycosis. While these tests have theadvantages of being both quick and relatively straightforward to perform,they have not gained general acceptance due to low sensitivity and/or lackof commercial availability (De Repentigny et al., 1994). Extracellulargalactomannan (GM) circulating in patients with invasive aspergillosis canbe detected in serum samples with a commercially available latexagglutination test (Pastorex Aspergillus, Sanofi Diagnostics Pasteur, Marnes-La Coquette, France) which uses a monoclonal antibody (raised against A.fumigatus GM) to detect antigen. However, reports on the utility of thisdiagnostic test vary (Van Cutsem et al., 1990; Kappe and Schulze-Berge,1993; Haynes and Rogers, 1994; Manso et al., 1994; Verweij et al., 1995).In contrast with other fungal infections, diagnosis of cryptococcosis by thecryptococcal antigen latex agglutination test is accepted as the standardmethod of diagnosis, with a high sensitivity and specificity. Most equivalenttests are not sensitive enough to exclude diagnosis on the basis of a negativeresult.
Commercial biochemical tests are available for identifying clinical yeastisolates, e.g. Vitek Yeast Biochemical Card (bioMerieux Vitek Inc., Hazel-wood, Missouri) and the API 20C identification system (bioMerieux VitekInc.); both are reliable for the identification of common yeasts but problemsof non-specificity have been encountered with more unusual species (Fennet al., 1994).
Inability or delay in diagnosing fungal infection defers the administra-tion of appropriate therapy. This has grave implications for the prognosis ofthe patient: reliable and rapid diagnostic tests for systemic mycoses areimperative to improve rates of patient survival (Haynes and Rogers, 1996).
In attempting to overcome low sensitivity, poor specificity and delay,molecular approaches to the diagnosis of fungal infection have been adopted,particularly the polymerase chain reaction (PCR). PCR can be very sensitiveand, depending on primer design, very specific. Several species-specificPCR-based diagnostic methods for detection of various common fungalpathogens have been described. This discussion will concentrate solely onthe diagnosis of systemic fungal infection; however, many of the principlesdescribed could easily be adapted to the diagnosis of superficial orsubcutaneous mycoses.
12.2 Strategies for Designing PCR-based Diagnostics
When developing a PCR-based diagnostic method various factors can beadapted to optimize both sensitivity and specificity.
268 T. Hughes et al.
12.2.1 Target
The specificity of a diagnostic PCR can be engineered to suit the purpose forwhich it is being used by selecting an appropriate target sequence foramplification. The specificity is determined by the degree of homologyshared between the target sequence and DNA sequences of different generaor species. For example, a highly conserved region from a gene universallyshared by all fungi is a suitable target sequence for a PCR protocol designedto indicate whether an infection is bacterial or fungal in origin. This strategyhas been adopted by several groups who have selected highly conserved, or‘universal’, regions within fungal ribosomal RNA (rRNA) genes as targetsequences for amplification. Various amplicon detection methods can be usedto identify the fungal source of DNA to genus or species level. The rRNAgenes are a popular choice for this strategy as they contain highly conservedregions which can be used to amplify all DNAs, adjacent to highly variableregions which can be used for subsequent species identification. Anotheradvantage is that rRNA genes are generally present at a high copy numberwhich increases the sensitivity of the PCR. Makimura’s group (1994)developed a PCR based on conserved regions within the fungal 18S rRNAgenes which successfully amplified DNA from 78 strains of 25 medicallyimportant fungi. Haynes et al. (1995) described a PCR in which one pair ofprimers corresponded to the V3 region of the S. cerevisiae large subunitrRNA gene sequences universally conserved within the fungal kingdom.Species-specific forward primers were then designed which could be used intandem with the universal reverse primer to specifically amplify DNA fromA. fumigatus, Cr. neoformans and C. albicans.
Hopfer et al. (1993) used a previously described set of primers based onan rRNA gene sequence present thoughout the fungal kingdom (White et al.,1990) to amplify a 306–311 bp target in 42 different fungi. The ampliconswere subjected to restriction enzyme analysis; PCR products were digestedwith HaeIII and separated by electrophoresis through agarose gels. Theresulting patterns were used to place the sources of fungal DNA into fivebroad groups including Candida spp. and related yeasts, and Aspergillus spp.plus related septate moulds.
Alternatively, a highly variable region would give greater specificity,enabling the detection of a particular genus or species. Generally, the morevariable the target region the more discriminatory the PCR (Mitchell et al.,1994b). Tang et al. (1993) described a PCR to detect the alkaline proteasegenes of A. fumigatus and A. flavus ; the species were distinguished by thesize of the amplified fragment. This PCR was shown to detect both A.fumigatus and A. flavus in four bronchoalveolar lavage (BAL) samples offour patients with either proven or possible invasive pulmonary aspergillosis;only one of 18 BAL samples from immunosuppressed patients with noclinical indication of fungal infection was positive by PCR.
Medical Mycology Diagnostics 269
12.2.2 Sample choice and preparation
As part of the developmental process for a diagnostic PCR protocol, thechoice of clinical material and the method of DNA extraction from thatmaterial is critical. Ideally, the presence of target DNA in the chosenspecimen will be clinically significant; the detection of Candida mustdistinguish pathogen from commensal, the detection of Aspergillus mustdistinguish pathogen from colonization or environmental contamination.Most PCR protocols for the diagnosis of Candida infections involve theexamination of blood samples as detection of the fungus in blood is regardedas clinically significant. The diagnosis of invasive aspergillosis is morecomplicated as the fungus is rarely isolated from blood cultures and areproducible PCR method for detecting Aspergillus DNA in blood remainselusive. This problem is complicated further as the significance of detectionof this ubiquitous organism in respiratory specimens is questionable (seeSection 12.3.2). Often a positive PCR result will need to be interpretedwithin the clinical setting to determine its relevance. As so many patientswith systemic or pulmonary fungal infections are immunocompromised, theinvasiveness of the procedure required to obtain the specimen must also beconsidered, particularly where sequential samples may be required.
Potentially suitable specimens for the diagnosis of systemic fungalinfection are blood and/or serum, particularly as these may be obtained byrelatively non-invasive procedures. The organism load may be very low ortransient and a 5 ml blood sample is unlikely to be fully representative of thebody’s 4–5 l. Therefore in order to decrease sampling error as much aspossible, consecutive samples may need to be taken over a short period oftime.
The DNA extraction method used must achieve two particular aims: toefficiently purify fungal DNA with minimal loss, and to remove inhibitorsof PCR from the sample, e.g. haem. Breaking open the fungal cell wall isdifficult but can be achieved either enzymatically or mechanically. Digestionwith lytic enzymes such as Zymolyase (ICN Biomedicals Ltd, Thame) orNovoZym 234 (Calbiochem-Novabiochem Ltd, Nottingham) can aid DNAextraction, although mechanical means such as breaking open cells with glassbeads have been successful, particularly for penetrating the thick poly-saccharide capsule of Cr. neoformans (Tanaka et al., 1996). Yields of extractedDNA may also be improved by using commercially available kits to purifyDNA from proteins released by cell lysis (e.g. QIAamp Tissue Kit, Qiagen,Crawley). They are usually quicker to perform than established methods andavoid the use of phenol and chloroform, but they do add significantly to thecost of protocols.
12.2.3 Amplicon detection and analysis
The method used to detect or display amplicons resulting from PCR canincrease both sensitivity and specificity. The simplest method is ethidium
270 T. Hughes et al.
bromide staining of PCR products separated by electrophoresis throughagarose gels. This has a detection limit of approximately 20 ng per amplifiedband, and in addition yields information on the size of the PCR product. Anincrease in sensitivity can be achieved if a nested PCR is performed.Yamakami et al. (1996) designed a nested PCR to detect Aspergillus speciesin serum of patients with invasive aspergillosis; the second (nested) round ofPCR increased the sensitivity of detection by gel staining from 50 pg to 50 fgtarget DNA. Southern analysis increased the sensitivity another ten-fold to5 fg.
Specific oligonucleotide probes have been developed for identification ofPCR products from individual fungal species by Southern hybridization.Sandhu et al. (1995) used PCR to amplify a conserved region within the 28SrRNA genes from 50 fungal isolates (including common pathogens andsaprophytes). Variable regions within 21 of these 50 isolates were used todesign species-specific probes. When labelled with 32P each probe hybridizedonly to homologous DNA. In order to avoid the use of radioisotopes,fluorescein can be used to label probes; fluorescein labelling of an internalprobe followed by chemiluminescence (ECL detection system) of Southernblots allowed the confirmation of products from a PCR that amplified aregion within the 18S rRNA gene universally conserved in all fungi (Polancoet al., 1995).
Alternatively, probes can be used as part of an enzyme immunoassaydetection system. Species-specific probes are bound to the wells of amicrotitre plate and denatured PCR products labelled with digoxigenin arehybridized to the probes; the products are visualized using anti-digoxigeninantibody conjugated to horseradish peroxidase with an appropriate chromo-gen substrate system, e.g. 3,3′,5,5′-tetramethylbenzidine (Sigma, Poole) andhydrogen peroxide. A colour reaction indicates the presence of target DNAidentified by the specific probe. Probes are often captured on to the wellsurface by biotin-labelling the probe and precoating the wells with streptavi-din, but dry-adsorption (evaporating a probe solution in the wells overnightat 37°C and heating for 2 h at 60°C) has been reported to be more efficientand negates the need for biotinylating probes (Hirayama et al., 1996). Fujitaet al. (1995) described a PCR-immunoassay that generated amplicons withuniversal primers based on the internal transcribed spacer (ITS) region offungal DNA; species-specific probes derived from this region were used toidentify amplicons from C. albicans, C. tropicalis, C. parapsilosis and C.krusei. Using the biotin–avidin capture system and the C. albicans-specificprobe, a detection sensitivity of two yeast cells per 0.2 ml blood wasachieved.
Another approach to amplicon analysis is to look at single-strandconformational polymorphism (SSCP). Minor sequence changes in highlyconserved regions of DNA will cause subtle morphological changes in DNAtertiary structure resulting in changes in a fragment’s mobility. Differencesof only one base pair can be resolved by separating the DNA products
Medical Mycology Diagnostics 271
electrophoretically under non-denaturing conditions on a high-resolutionacrylamide gel, allowing discrimination between species or even strains (Yapand McGee, 1994). Walsh et al. (1995) developed a universal PCR basedon the 18S rRNA gene combined with SSCP detection to identify a varietyof opportunistic fungal pathogens. The SSCP gel patterns enableddiscrimination between Candida spp., Aspergillus spp., Cr. neoformans,Pseudallescheria boydii and R. arrhizus.
12.3 Diagnosis of Systemic Fungal Infections by PCR
Much research investment has been made into the development of PCR as adiagnostic tool in the field of medical mycology. The major developments inPCR-based diagnosis of invasive candidosis, invasive aspergillosis, P. cariniipneumonia, cryptococcosis and infections due to dimorphic fungi arediscussed below.
12.3.1 Invasive candidosis
Candida spp., C. albicans in particular, are the most common fungalpathogens of immunocompromised hosts, causing a variety of infectionsfrom cutaneous disease of skin and nails to deep-seated systemic infectionand candidaemia. Diagnosis is relatively straightforward for superficialinfections but remains a problem for the more invasive forms of disease(Dupont, 1990). While most attention was initially paid to developingdetection methods for C. albicans, as the primary pathogen of the genus, ithas become apparent that other species of the genus may also cause disease.In a retrospective study of blood culture isolates from cancer patientsapproximately half (28 of 55) of the Candida isolates were C. albicans whilethe rest comprised of C. tropicalis (seven), C. glabrata (seven), C. krusei(five), C. parapsilosis (three), C. guilliermondii (three) and two mixedinfections of C. albicans and C. glabrata (Meunier et al., 1992). Many of thePCR protocols published therefore describe strategies to detect both C.albicans and other species.
One of the first PCR methods for diagnosing fungal infection to bepublished was that by Buchman et al. (1990); the gene coding for Candidaspp. cytochrome P450 lanosterol-14α-demethylase (L1A1) was chosen as thetarget for amplification due to its involvement in the process of ergosterolbiosynthesis. The sensitivity of the PCR was not fully assessed but wasestimated in spiking experiments to be approximately 102–103 c.f.u. ml–1.Clinical samples including urine, sputum, wound fluid and blood from sixpatients that had all undergone surgical trauma were tested by PCR; 15 ofthese gave positive results. However, the specificity of this PCR was notevaluated and the implications of the PCR-positive clinical samples was notdiscussed.
272 T. Hughes et al.
A sequence within a duplicated region of C. albicans mitochondrialDNA (mt DNA), EO3, was chosen by Miyakawa et al. (1992) as the targetfor a C. albicans-specific PCR. Primers, designed from partial sequencing ofthe region, generated a 1.8 kb fragment from 40 strains of C. albicans (typeA and B) but not from any other of 38 isolates including seven non-albicansCandida spp., Cr. neoformans, Saccharomyces cerevisiae, three bacterialisolates and a human cell line. The sensitivity of the PCR was determined byspiking serial dilutions of yeast cells into both saline and human urine; thedetection limits were two to ten cells and 100 cells in saline and urinerespectively on ethidium bromide-stained gels. This was improved to two toten cells for both saline and urine by Southern hybridization analysis. Theauthors conceded that such a large amplicon may be impractical when tryingto detect small amounts of DNA present in clinical specimens such as blood,but suggested that smaller C. albicans-specific fragments (400–500 bp)within EO3 may amplify more efficiently.
Niesters et al. (1993) used a nested PCR in conjunction with a numberof detection methods to identify various species of Candida. Sequences fromthe small subunit (SSU) rRNA genes of C albicans, C. glabrata and S.cerevisiae were used to design primers which amplified the entire gene.Products were also obtained from C. guilliermondii, C. krusei, C. para-psilosis, C. pseudotropicalis, C. stellatoidea and C. tropicalis. Species-specificfingerprints generated by direct sequencing, Southern hybridization withspecies-specific probes, restriction enzyme mapping and interrepeat PCR(with repeat-oriented primers) were all able to identify these eight Candidaisolates to species level. Restriction mapping provided the most rapid meansof identification (1 day), but none of the methods were used to test clinicalmaterial.
In contrast to the high copy number gene targets described above, a PCRfor diagnosing candidaemia was reported based on amplification of a 158 bpsegment from the C. albicans actin gene (Kan, 1993). Amplicons werehybridized in the PCR reaction tube with a radiolabelled 30 bp internalprobe before electrophoresis on acrylamide gels which were then exposed toautoradiography film. The sensitivity was reported as 25 fg of DNA or tenyeast cells in spiked samples. The specificity testing showed the PCR to begenus-specific, with the exception of S. cerevisiae. Preliminary evaluation ofthe PCR was carried out using immunocompetent mouse models and patientsamples. Blood samples from a murine candidaemia model were cultured andplasma samples were pooled and tested by PCR. All samples were con-sistently positive by culture and PCR over a period of 4 days after initiationof infection. In the second model, localized infection in the thigh wasinduced and blood and plasma samples were taken every 3 days up to 15 daysafter inoculation; no samples tested positive either by culture or PCR. Asimilar pattern was seen in blood cultures from patients. Serum samples werecollected from 14 patients who had previously had Candida isolated from atleast one blood culture; 11 of these were PCR positive while sera from 12
Medical Mycology Diagnostics 273
patients with active oral thrush and 17 healthy volunteers were all PCRnegative. This protocol was the first described that could detect and identifynumerous species of Candida and was shown to work with samples fromboth mice and patients. More importantly the PCR could detect candidaemiawithout false positives generated by the presence of Candida either as acommensal or in a non-disseminated infection.
Crampin and Matthews (1993) also used a low copy number gene forPCR amplification, heat shock protein 90 (HSP90). Primers designed fromthe C. albicans gene generated amplicons with C. albicans DNA. In addition,non-specific products were seen in samples ‘spiked’ with C. glabrata, C.parapsilosis, C. guilliermondii, C. krusei and human DNA, although theauthors stated that these were not seen in PCR performed on any clinicalsamples. Southern analysis allowed detection of 100 c.f.u. C. albicans ml–1
broth or 5 pg genomic DNA. An investigation of 100 clinical specimens(including swabs, urines, peritoneal fluids, pus and blood/serum) tested byroutine culture, extended culture and PCR, gave positive results with 23%,31% and 37% of samples respectively. The clinical relevance of detecting C.albicans in these samples was not discussed.
One of the C. albicans chitin synthase genes (CHS1) has also beenexploited as a target for PCR based on the rationale that CHS1 is not presentin any mammalian genome and could therefore help to prevent false-positiveresults (Jordan, 1994). The single pair of primers described produceddifferent sized amplicons from C. albicans (122 bp), C. parapsilosis (311 bp),C. tropicalis (519 bp) and C. glabrata (535 bp); these four species areresponsible for 90% of cases of neonatal candidaemia. This was the firstpublished method that was capable of detecting different medically impor-tant species of Candida in just one step. Species-specific probes weredesigned for use in Southern hybridization which gave a detection limit of10 c.f.u. ml–1 blood. Comparing PCR and blood culture in 27 pairs of bloodsamples showed concordance in 26 pairs; blood samples from 29 high-riskneonates with no signs of Candida infection and five bone marow transplantrecipients with mucosal colonization with Candida were all negative byPCR. While this protocol was not shown to be more sensitive than bloodculture in this case, it had the advantages of speed and easy speciesdifferentiation.
Meanwhile, the rRNA genes remain a popular target for PCR. Holmeset al. (1994) described two sets of primers based on the 5S rRNA gene andthe adjacent non-transcribed intergenic spacer (IGS); one pair amplified aproduct of 105 bp from C. albicans and five non-albicans species, while thesecond set amplified a 684 bp product from C. albicans only, witha sensitivity comparable to the PCRs already described of approximately 15c.f.u. ml–1 blood.
Similarly, the V4 region within the SSU rRNA gene was the basis for aPCR which, in conjunction with Southern blotting and a species-specificprobe, could specifically detect C. albicans candidaemia in neutropenic mice
274 T. Hughes et al.
with a sensitivity of 10–15 c.f.u. ml–1 blood (van Deventer et al., 1995).Gastrointestinal colonization was established in immunocompetent mice andblood samples were tested by the same method to demonstrate that the PCRwould only detect invasive fungal cells and not commensals. A comparisonof PCR with blood culture demonstrated a large increase in the number ofpositives when PCR was used (89–100% compared with 44–100% forculture). Only C. albicans was investigated in this report but the authorsindicated the possibilities for adapting this method to other species usingdifferent probes.
Fujita et al. (1995) reported a universal PCR that was capable ofdetecting any fungal species with primers based on sequences from the 5SrRNA gene and adjacent ITS region; specific probes designed from the ITS2region (found between 5S and 26S) were used in an enzyme immunoassay tospecifically detect PCR products from C. albicans, C. tropicalis, C. para-psilosis, C. krusei and C. glabrata. Using colorimetric detection instead ofethidium bromide staining increased the sensitivity ten-fold from 102 to 10cells ml–1.
Haynes et al. (1995) and Haynes and Westerneng (1996) used a reverseprimer based on a sequence from the large subunit (LSU) rRNA gene,universally conserved within the fungal kingdom, in tandem with fourdifferent forward primers, each specific for a medically important species ofCandida. The four PCRs used the same temperature cycles and so could runconcurrently, and were shown to correctly identify nine isolates of C.albicans, 18 of C. glabrata, 13 of C. parapsilosis and 18 of C. krusei in a blindstudy. The testing process, including DNA extraction from single colonies,was estimated to take approximately 3 h, although no testing was performedon clinical samples.
Recently a PCR based on the C. albicans L1A1 gene was described whichwas capable of amplifying DNA from a variety of yeasts including C.albicans, ten non-albicans Candida species, S. cerevisiae and Blastoschizo-myces capitatus (Morace et al., 1997). The PCR had a sensitivity of 200 fgCandida DNA and seven different species were identified by restrictionenzyme mapping. This method was applied to a small number of blood andBAL samples from patients considered likely to have fungal infection; 15 of21 bloods and six of 20 BAL samples gave PCR-positive results and this wasconsidered to correlate well with culture results. The authors emphasizedthat this protocol must be used to analyse a much larger number of patientspecimens before any conclusion can be made. These results were encourag-ing but a much simpler extraction method would be neccessary for thisprotocol to be used on a routine basis.
12.3.2 Invasive aspergillosis
Members of the genus Aspergillus are ubiquitous saprophytes commonlyfound in soil and decaying vegetation. Aspergillus conidia account for
Medical Mycology Diagnostics 275
0.1–22% of total airborne spores and are found in air and dust within thehospital environment (Anassie, 1992). There are at least 200 species ofAspergillus but few are associated with disease in humans; the majority ofinvasive disease is due to A. fumigatus and can arise from colonization or denovo infection (Rinaldi, 1983). The common route of entry into the body isvia the respiratory tract. Conidia are smooth and, in the case of A. fumigatus,only 2–3 µm in size and can therefore easily reach the alveolar airspace; thismay be directly linked to A. fumigatus being the primary pathogen of thegenus (Kwon-Chung and Bennett, 1992). In predisposed (e.g. neutropenic)patients the infection rapidly becomes invasive; pulmonary disease dissem-inates haematogeneously through the body to other major organs and theassociated morbidity and mortality are very high (Cohen, 1990). Earlyadministration of antifungal therapy is essential for improvement of prog-nosis in cases of invasive disease (Burch et al., 1987), however, early diagnosisremains notoriously difficult. Routine microbiological investigation involvesculture and cytological examination of respiratory specimens such as BALfluid and induced sputum, procedures that have been evaluated and reviewedby several groups in a number of retrospective studies. Nalesnik et al. (1980)suggested that even a single Aspergillus-positive sputum culture must betreated as potentially significant in patients with haematological malignancy.Yu et al. (1986) confirmed this, adding that in neutropenic cases positiverespiratory specimens were virtually diagnostic. Cytological examination ofBAL specimens has been considered to be of a higher predictive value thanculture (Levy et al., 1992), although in patients with acute leukaemia, BALshave been reported to be of more use for diagnosing P. carinii pneumoniathan invasive aspergillosis (Saito et al., 1988). The majority of respiratoryspecimens are negative for Aspergillus by cytology and culture, and thepredictive value of immunological diagnosis has yet to be proven. The goldstandard remains cytology and culture of biopsy specimens, but opensurgery is contra-indicated in critically ill patients.
In order to avoid the invasive procedures of obtaining specimens such asBAL fluid or bronchial washings, Reddy et al. (1993) investigated thepossibility of using PCR to detect A. fumigatus in urine samples. The primerswere based on an A. fumigatus partial protein sequence that shared a highdegree of homology with ribotoxins of A. restrictus and with alpha sarcin ofA. giganteus. The PCR amplified A. fumigatus and A. restrictus DNA only,with a detection limit of 0.6 pg by Southern analysis. Prospective screeningof 13 urine samples from patients undergoing bone-marrow transplantationrevealed two positives; however only one was from a proven case of IA.
Spreadbury et al. (1993) were able to specifically detect A. fumigatusDNA in three of three culture-positive respiratory specimens from patientswith clinically diagnosed IA by using a PCR that amplified part of the 26Sintergenic spacer region from the A. fumigatus rRNA gene complex.However, as Aspergillus conidia are inhaled by the general population on aday-to-day basis, the significance of finding Aspergillus in the respiratory
276 T. Hughes et al.
tract of an individual is still controversial. To assess the significance of apositive PCR result, culture-negative samples from immunosuppressedpatients at high risk and from immunocompetent patients with known lungdisease (other than IA) were analysed by PCR: two of ten of the formerpatient group and two of seven of the latter patient group gave positiveresults. It was suggested that results based on Southern hybridization may betoo sensitive – the two positives from the former patient group were notdetected by electrophoresis alone – but that the high level of correlationbetween culture, clinical data and PCR results supported PCR as a validmethod of diagnosis of IA.
These findings were corroborated by further work from the same group;Tang et al. (1993) used primers based on sequences obtained from the alkalineprotease (Alp) genes of A. fumigatus and A. flavus to detect Aspergillus DNAin four BAL samples from four patients with proven or probable aspergillo-sis. One patient with possible aspergillosis was PCR positive, as were one of18 (6%) immunosuppressed patients with no evidence of fungal infection andfive of 28 (18%) immunocompetent patients, the latter most likely resultingfrom colonization.
Verweij et al. (1994) investigated a larger group of low-risk patients andfound a similar level of prevalence of detectable Aspergillus colonization. 72BAL specimens from 70 non-neutropenic patients were tested by culture andgenus-specific PCR: 11 of the 72 samples (15%) were PCR positive. In aseparate study the validity of the PCR was assessed in a mouse model of IAand in patient BAL samples. The primers were derived from sequencesobtained from the 18S rRNA genes of A. fumigatus, A. flavus, A. terreus, A.nidulans and A. niger so that other species that have been reported asopportunistic pathogens could also be detected (Cohen, 1990). Strong cross-reactions were observed with Paecilomyces variotii, Penicillium marneffeiand Penicillium chrysogenum but these were differentiated from Aspergillusby Southern analysis and restriction enzyme digestion. Sensitivity wasincreased from 1 pg to 10 fg when rRNA was transcribed into cDNA priorto amplification, although this was deemed unnecessary as no furthersamples were identified as positive using this extra step. Five of six mice withexperimental IA were PCR positive, as were nine of 18 BAL samples fromimmunosuppressed patients; none of the control mice or 14 BAL samplesfrom low-risk patients were positive. In comparison only one BAL samplefrom four patients with documented IA grew Aspergillus.
A competitive PCR was described by Bretagne et al. (1995) which usedan internal control to indicate false-negative results due to inhibition of thePCR. This was achieved by spiking each sample with a fragment ofM13mp18 phage DNA flanked at each end by the A. fumigatus-specificprimers; successful amplification would generate a 135 bp product from A.fumigatus DNA and a separate smaller amplicon from the control sequence.False-positive results due to carry-over contamination from previous ampli-fications was avoided by the substitution of dUTP for dTTP and digestion
Medical Mycology Diagnostics 277
with uracil-N-glycosylase. However, it should be noted that this is notnecessarily sufficient to prevent false positives due to contamination. In astudy of PCR protocols used in seven centres for Mycobacterium tuberculosisdetection, this substitution method was employed by the centre that had thehighest rates of false-positive results (Vaneechoutte and van Eldere, 1997). Of55 BAL samples tested with this PCR, 15 were positive, 37 were negative andthree were negative due to inhibition and discounted. Three patients hadproven IA and another three were high risk, but the remaining nine positivesamples were from two groups of patients, none of whom developed IA. Asthe three patients with aspergillosis had already been clinically diagnosed andgiven empirical antifungal therapy, the authors concluded that PCR was oflittle value in diagnosing cases of IA where clinical symptoms were overt;routine methods were sufficient and the question of the predictive value ofPCR diagnosis in high-risk patients remained unanswered. Verweij suggestedthat optimized techniques and sampling schedules are required if PCR is toprove useful in the early diagnosis of IA (Verweij et al., 1996).
Recently, Yamakami et al. (1996) reported a genus-specific nested PCRbased on 18S rRNA genes of Aspergillus which was evaluated using serumfrom experimentally infected mice and from patients with IA. Southernanalysis increased the sensitivity of the PCR to 5 fg Aspergillus DNA. Serumsamples from animals sacrificed over a period of 4 days post-infection weretested by PCR and Pastorex Aspergillus latex agglutination; these tests gavefive of eight and three of eight positives respectively and all the controls werenegative. However, mice were inoculated with viable conidia through asurgical incision over the trachea, possibly allowing direct inoculation of thebloodstream, in which case this would not be an appropriate model of IA.Serum samples (100 µl) from 20 patients with documented IA were alsotested, giving 14 positive samples by PCR and 12 positive samples byPastorex. Sera from 20 healthy volunteers were all negative. These results arepromising but care would need to be taken when designing samplingschedules, especially when sample volumes are so small.
A test proven to be sensitive and specific that can be performed onclinical material obtained without invasive procedures is still needed toimprove the ante-mortem diagnosis of IA.
12.3.3 Pneumocystis carinii pneumonia
Interest in the ubiquitous and, until recently, taxonomically ambiguous P.carinii (Pixley et al., 1991; Stringer et al., 1992) was re-awakened in the early1980s when the advent of AIDS caused a significant increase in the incidenceof P. carinii pneumonia (PCP) to such an extent that PCP became adiagnostic feature of AIDS and was a major cause of morbidity and mortalityin AIDS patients (Cushion et al., 1994). The major obstacle yet to beovercome in the development of simple, rapid diagnostics for this infectionis the lack of an in vitro culture system, primarily due to the organism’s
278 T. Hughes et al.
fastidious nature (Wakefield et al., 1990). Conventional diagnostic proce-dures remain: cytochemical staining of BAL or, less frequently, inducedsputum samples, either non-specifically (Giemsa, methenamine silver) orwith a specific immunofluorescent monoclonal antibody stain (Cartwright etal., 1994). However, small numbers of organisms are difficult to visualize anda more sensitive method is needed to attempt diagnosis at an earlier stage ofinfection. Many research groups have therefore explored the possibilities ofusing PCR as a diagnostic method for PCP.
The first PCR reported for detection of P. carinii in clinical samplesamplified a sequence from the large subunit mitochondrial rRNA gene (mtrDNA) and although sequences were derived from a rat isolate, the PCR alsoamplified P. carinii DNA from human isolates (Wakefield et al., 1990). Theproducts were verified using Southern analysis with a probe specific forhuman P. carinii. The PCR appeared to be at least as sensitive as stainingwhen detecting P. carinii in BAL, but apparently false-positive signals wereobserved on blots from three immunosuppressed patients with no evidenceof PCP and from bronchoscope washings from an unspecified source.
While some groups have designed novel PCRs to detect P. carinii, the mtrDNA primers have since been used by many other investigators. Eisen et al.(1994) found this PCR to be more sensitive than Toluidine Blue-O stainingand immunofluorescence in sputum samples from 20 HIV-positive patients.In another study an enzyme immunoassay was developed as a potentialreplacement for Southern analysis (Cartwright et al., 1994). This assaydetected P. carinii in all induced sputa from documented PCP cases,compared with 78% by immunofluorescence, and the entire procedure couldbe performed in a single day. This PCR assay was considered sensitiveenough to detect P. carinii in induced sputa from patients with a loworganism burden, possibly saving them from the invasive procedure ofbronchoscopy. However, no advantage over conventional methods forroutine detection of P. carinii in BAL was evident. These findings are similarto those reported by other groups (Lipschik et al., 1992; Tamburrini et al.,1993; Roux et al., 1994).
Honda et al. (1994) described a comparison of conventional and capillaryPCR in which both protocols used the mt rDNA primers to detect P. cariniiin sputum and BAL samples from immunosuppressed patients. The volumeof the reaction mix in capillary PCR is only 10 µl (compared with 25–100 µlin conventional PCR) and thermocycling is performed in sealed glasscapillary tubes; this allows much faster and more efficient temperaturetransfer. However, savings made in reaction constituents have to be balancedagainst the purchase of a specialized thermocycling machine. The capillaryPCR was 1000-fold more sensitive than conventional PCR (detecting 3 ×10–2 fg DNA compared with 30 fg) and took only 20 min to complete. Theauthors suggested that the high sensitivity of the capillary protocol enableddetection of P. carinii carriage and subclinical infection and allowed forearlier initiation of antimicrobial therapy.
Medical Mycology Diagnostics 279
In an attempt to monitor organism loading during treatment of P. cariniiinfection in immunosuppressed rats, O’Leary et al. (1995) incorporated themt rDNA primers into a semi-quantitative PCR (SQPCR). Rat β-globin wasused as the internal standard and assay results were expressed as Pneumocys-tis mt rDNA/globin signal ratios. The SQPCR results correlated stronglywith cyst counts in BAL and lung homogenates. Furthermore the PCR wascapable of detecting P. carinii DNA during the early phase of infection whenfew cysts could be visualized by staining of pulmonary tissue and none wereseen in BAL fluid.
Alternative gene targets for P. carinii PCR include those encoding the 5SrRNA (Kitada et al., 1991), 18S rRNA (Lipschik et al., 1992), dihydrofolatereductase (DHFR) (Schluger et al., 1992) and thymidylate synthase (TS)(Olsson et al., 1993) genes. These were all included in a comparison of theefficacy of different PCR methods, along with the mt rDNA PCR and anested PCR which amplified the ITS of the rRNA genes (Lu et al., 1995).When used to analyse 50 BAL specimens, the two nested PCRs (ITS and 18S)achieved 100% sensitivity after the second round (53% and 50% respectivelyafter the first), the mt rDNA PCR 87%, the 5S rDNA PCR 33%, the TSPCR 60% and the DHFR PCR 23%. The 18S and TS PCRs demonstratedfalse-positive results with S. cerevisiae and C. albicans, plus Cr. neoformansand C. albicans respectively, leading to the conclusion that the nested ITSPCR was the most sensitive and specific of the methods tested.
In order to avoid the invasive nature of sampling methods such asbronchoscopy or open lung biopsy, non-invasive samples such as serum andblood have been investigated as attractive alternatives for potential routinespecimens when diagnosing P. carinii infection. Preliminary experiments byKitada et al. (1991) detected P. carinii DNA in three of five mice withexperimentally induced P. carinii infection; reduced sensitivity comparedwith performance of PCR with lung biopsy specimens was attributed to loworganism load in the blood. Schluger et al. (1991) used the DHFR PCR onserum samples from AIDS patients with PCP; P. carinii DNA was detectedin five of 14 experimental rats and seven of 18 AIDS patients. However, fourpatients had documented extrapulmonary PCP, two of which were notdetected by PCR. Tamburrini et al. (1993) successfully detected P. carinii inspiked samples down to two organisms µl–1 serum or whole blood, but thiscould not be reproduced in serum and blood specimens from HIV-positivepatients with documented PCP. The conclusion was that, even allowing forhaematogeneous dissemination, the presence of P. carinii in the bloodstreamis transient and PCR detection is not applicable to serum samples.
12.3.4 Cryptococcosis
Cryptococcal meningitis, caused by Cr. neoformans var. neoformans or Cr.neoformans var. gattii, is a major cause of morbidity in individuals infectedwith HIV (Kwon-Chung et al., 1994). Before the cryptococcal antigen latex
280 T. Hughes et al.
agglutination (LA) test became widely available, cryptococcal meningitiswas diagnosed by India ink preparations of cerebrospinal fluid; this gavea positive result in approximately 50% of cases. Detection of capsularpolysaccharide by LA has a reported sensitivity and specificity of 99% andimmunological diagnosis appears to be reliable (De Repentigny et al., 1994).
The reliability of the LA test as a method of diagnosing cryptococcosishas obviated the need for diagnostic PCR. However, a number of protocolshave been described. Mitchell et al. (1994a) designed primers from the 5.8SrDNA and adjacent ITS region of Filobasidiella neoformans, the teleomorphof Cr. neoformans. These primers were able specifically to amplify DNAfrom 37 strains of Cr. neoformans; amplification from clinical material wassuggested but not attempted. A nested PCR based on the Cr. neoformansURA5 gene was developed to diagnose non-HIV related pulmonarycryptococcosis (Tanaka et al., 1996). Sixteen respiratory specimens wereanalysed in order to evaluate both the PCR and the glass bead-basedextraction method. Of the five which were positive by culture, four werePCR positive and no culture-negatives were PCR positive. While thisprotocol performed well on this small number of samples, the advantagesover culture were unspecified.
12.3.5 Dimorphic fungal infections
The dimorphic fungi H. capsulatum, B. dermatitidis, Co. immitis and Pa.brasiliensis are primary human pathogens. However, the incidence of eachhas increased as the number of immunosuppressed patients has risen. Theroute of infection for these is generally via the respiratory tract; they causeprimary pulmonary disease in competent hosts. H. capsulatum causeschronic pulmonary disease in those with structural lung defects anddisseminated disease in immunocompromised hosts. Co. immitis is asympto-matic in 60% of cases and rarely disseminates. Pa. brasiliensis manifests moreas a disseminated infection than a pulmonary one while B. dermatitidisinfection is initially pulmonary but can disseminate and mimic other diseasessuch as tuberculosis (TB) (Bradsher, 1996).
While the incidence of these fungi is increasing, particularly in theAmericas where they are endemic, diagnosis using molecular methods is notwell documented and little diagnostic PCR research has been published.Diagnosis relies mostly on cytological staining of BAL fluids and sputa withPapanicolaou stain and methenamine silver; TB is excluded by the acid Schifftest (Lemos et al., 1995). Visualization of the fungus gives a firm diagnosis forhistoplasmosis and blastomycosis as colonization with these organisms doesnot occur (Bradsher, 1996).
Molecular methods other than PCR have been successfully used; achemiluminescent DNA probe kit (GenProbe, San Diego, California) hasbeen shown to have sensitivities of 87.8–100% and specificities of 100%when identifying different isolates of B. dermatitidis, H. capsulatum, Co.
Medical Mycology Diagnostics 281
immitis and Cr. neoformans (Stockman et al., 1993). The probes, based onrDNA sequences, were found to shorten the diagnostic process significantly,and the preparation required was much less than for exoantigen testing.These probes were recommended by the author to supplement diagnosis byin vitro conversion of hyaline mould to yeast forms; false-negative resultsthat occasionally occurred with the B. dermatitidis probe could thus beavoided and morphologically similar organisms could be differentiated, suchas the yeast form of H. capsulatum and C. glabrata.
12.4 Future Prospects for PCR Diagnostics in MedicalMycology
Commercially produced PCR-based protocols are now widely available forthe diagnosis of various infectious diseases, e.g. TB, viral hepatitis. Notwith-standing the huge research investment that has been made in the developmentof diagnostic PCRs in the field of medical mycology, there are no suchprotocols available for the diagnosis of fungal infections. The most likelycontender for a successful PCR-based protocol is the detection of P. cariniifor the diagnosis of PCP, but the advantages of PCR over establisheddiagnostic methods for this disease are debatable. Until simple, rapid andreproducible methods are developed for the extraction of fungal DNA fromclinical material, the routine diagnosis of systemic fungal infections by PCRremains unlikely.
References
Anaissie, E. (1992) Opportunistic mycoses in the immunocompromised host:experience at a cancer centre and review. Clinical Infectious Diseases 14 (Suppl.1), S43–S53.
Anaissie, E., Bodey, G.P., Kantarjian, H., Ro, J., Vartivarian, S.E., Hopfer, R., Hoy,J. and Rolston, K. (1989) New spectrum of fungal infections in patients withcancer. Reviews in Infectious Diseases 11, 369–378.
Bodey, G.P. (1988) The emergence of fungi as major hospital pathogens. Journal ofHospital Infection 11 (Suppl. A), 411–426.
Bradsher, R.W. (1996) Histoplasmosis and blastomycosis. Clinical Infectious Diseases22 (Suppl. 2), S102–S111.
Bretagne, S., Costa, J-M., Marmorat-Khuong, A., Poron, F., Cordonnier, C., Vivaud,M. and Fleury-Feith, J. (1995) Detection of Aspergillus species DNA inbronchoalveolar lavage samples by competitive PCR. Journal of ClinicalMicrobiology 33, 1164–1168.
Buchman, T.G., Rossier, M., Merz, W.G. and Charache, P. (1990) Detection ofsurgical pathogens by in vitro DNA amplification. Part I. Rapid identification ofCandida albicans by in vitro amplification of a fungus-specific gene. Surgery108, 338–347.
282 T. Hughes et al.
Burch, P.A., Karp, J.E., Merz W.G., Kuhlman, J.E. and Fishman, E.K. (1987)Favourable outcome of invasive aspergillosis in patients with acute leukaemia.Journal of Clinical Oncology 5, 1985–1993.
Cartwright, C.P., Nelson, N.A. and Gill, V.J. (1994) Development and evaluation ofa rapid and simple procedure for detection of Pneumocystis carinii by polymerasechain reaction. Journal of Clinical Microbiology 32, 1634–1638.
Cohen, J. (1990) Clinical manifestation and management of aspergillosis in thecompromised patient. In: Warnock, D.W. and Richardson M.D. (eds) FungalInfection in the Compromised Patient, 2nd edn. John Wiley & Sons, Chichester,pp. 117–152.
Crampin, A.C. and Matthews, R.C. (1993) Application of the polymerase chainreaction to the diagnosis of candidosis by amplification of an HSP90 genefragment. Journal of Medical Microbiology 39, 233–238.
Cushion, M.T., Harmsen, A., Matsumoto, Y., Stringer, J.R., Wakefield, A.E. andYamada, M. (1994) Recent advances in the biology of Pneumocystis carinii.Journal of Medical and Veterinary Mycology 32 (Suppl. 1), 217–228.
De Repentigny, L., Kaufman, L., Cole, G.T., Kruse, D., Latge, J.-P. and Matthews,R.C. (1994) Immunodiagnosis of invasive fungal infections. Journal of Medicaland Veterinary Mycology, 32 (Suppl. 1), 239–252.
Dupont, B. (1990) Clinical manifestations and management of candidosis in thecompromised patient. In: Warnock, D.W. and Richardson M.D. (eds) FungalInfection in the Compromised Patient, 2nd edn. John Wiley & Sons, Chichester,pp. 55–84.
Eisen, D., Ross, B.C., Fairburn, J., Warren, R.J., Bard R.W. and Dwyer, B. (1994)Comparison of Pneumocystis carinii detection by Toluidine Blue-O staining,direct immunofluorescence and DNA amplification in sputum specimens fromHIV positive patients. Pathology 26, 198–200.
Fenn, J.P., Segal, H., Barland B., Denton, D., Whisenant, J., Chun, H., Christofferson,K., Hamilton, L. and Carroll, K. (1994) Comparison of the updated Vitek YeastBiochemical Card and API 20C yeast identification systems. Journal of ClinicalMicrobiology 32, 1184–1187.
Fujita, S., Lasker, B.A., Lott, T.J., Reiss, E. and Morrison, C.J. (1995) Microtitrationplate enzyme immunoassay to detect PCR-amplified DNA from Candidaspecies in blood. Journal of Clinical Microbiology 33, 962–967.
Haynes, K.A. and Rogers, T.R. (1994) Retrospective evaluation of a latex agglutina-tion test for diagnosis of invasive aspergillosis in immunocompromised patients.European Journal of Clinical Microbiology and Infectious Diseases 13, 670–674.
Haynes, K.A. and Rogers, T.R. (1996) Clinical perspectives and diagnosis of invasiveaspergillosis. Revista Iberoamericana de Micologia 13, S25–S29.
Haynes, K.A. and Westerneng, T.J. (1996) Rapid identification of Candida albicans,Candida glabrata, Candida parapsilosis and Candida krusei by species-specificPCR of large subunit ribosomal RNA. Journal of Medical Microbiology 44,390–396.
Haynes, K.A., Westerneng, T.J., Fell J.W. and Moens, W. (1995) Rapid detection andidentification of pathogenic fungi by PCR amplification of large subunitribosomal RNA. Journal of Medical and Veterinary Mycology 33, 319–325.
Hirayama, H., Tamaoka, J. and Horikoshi, K. (1996) Improved immobilisation ofDNA to microwell plates for DNA–DNA hybridization. Nucleic Acids Research24, 4098–4099.
Medical Mycology Diagnostics 283
Holmes, A.R., Cannon, R.D., Shepherd, M.G. and Jenkinson, H.F. (1994) Detectionof Candida albicans and other yeasts in blood by PCR. Journal of ClinicalMicrobiology 32, 228–231.
Honda, J., Hoshino, T., Natori, H., Tokisawa, S., Akiyoshi, H., Nakahara, S. andOizumi, K. (1994) Rapid and sensitive diagnosis of CMV and Pneumocystiscarinii pneumonia in patients with haematological neoplasia by capillary PCR.Journal of Haematology 86, 138–142.
Hopfer, R.L., Walden, P., Setterquist, S. and Highsmith W.E. (1993) Detection anddifferentiation of fungi in clinical specimens using PCR amplification andrestriction enzyme analysis. Journal of Medical and Veterinary Mycology 31,65–75.
Jordan, J.A. (1994) PCR identification of four medically important Candida speciesusing a single primer pair. Journal of Clinical Microbiology 32, 2962–2967.
Kan, V.L. (1993) PCR for the diagnosis of candidaemia. Journal of Infectious Diseases168, 779–783.
Kappe, R. and Schulze-Berge, A. (1993) New cause for false-positive results with thePastorex Aspergillus antigen latex agglutination test. Journal of Clinical Micro-biology 31, 2489–2490.
Kitada, K., Oka, S., Kimura S., Shimada, K., Serikawa, T., Yamada, J., Tsunoo, M.,Egawa, K. and Nakamura, Y. (1991) Detection of Pneumocystis carinii sequencesby PCR: animal models and clinical application to non-invasive specimens.Journal of Clinical Microbiology 29, 1985–1990.
Kwon-Chung, K.J. and Bennett, J.E. (1992) Medical Mycology. Lea and Febiger,London.
Kwon-Chung, K.J., Pfieffer, T., Chang, Y.C., Wickes, B.L., Mitchell, D. and SternJ.J. (1994) Molecular biology of Cryptococcus neoformans and therapy ofcryptococcosis. Journal of Medical and Veterinary Mycology 32 (Suppl. 1),S407–S415.
Lemos, L.B., Baliga, M., Taylor, B.D., Cason, Z.J. and Lucia, H.L. (1995) Broncho-alveolar lavage for diagnosis of fungal disease. Acta Cytologica 39, 1101–1111.
Levy, H., Horak, D.A., Tegtmeier, B.R., Yokota, S.B. and Forman, S.J. (1992) Valueof bronchoalveolar lavage and bronchial washing in the diagnosis of invasivepulmonary aspergillosis. Respiratory Medicine 86, 243–248.
Lipschik, G.Y., Gill, V.J., Lundgren, J.D., Andrawis V.A., Nelson N.A., Nielson, J.O.,Ognibene, F.P. and Kovacs, J.A. (1992) Improved diagnosis of Pneumocystiscarinii infection by PCR on induced sputum and blood. Lancet 340, 203–206.
Lu, J-J., Chen, C-H., Bartlett, M.S., Smith, J. and Lee, C.H. (1995) Comparison ofsix different PCR methods for detection of Pneumocystis carinii. Journal ofClinical Microbiology 33, 2785–2788.
Makimura, K., Murayama, S.Y. and Yamaguchi, H. (1994) Detection of a wide rangeof medically important fungi by PCR. Journal of Medical Microbiology 40,358–364.
Manso, E., Montillo, M., De Sio, G., D’Amico, S., Discepoli, G. and Leoni, P. (1994)Value of antigen and antibody detection in the serological diagnosis of invasiveaspergillosis in patients with haematological malignancies. European Journal ofClinical Microbiology and Infectious Diseases 13, 756–760.
Meunier, F., Aoun, M. and Bitar, N. (1992) Candidaemia in immunocompromisedpatients. Clinical Infectious Diseases 14 (Suppl. 1), S120–S125.
Mitchell, T.G., Freedman, E.Z., White, T.J. and Taylor, J.W. (1994a) Unique
284 T. Hughes et al.
oligonucleotide primers in PCR for identification of Cryptococcus neoformans.Journal of Clinical Microbiology 32, 253–255.
Mitchell, T.G., Sandin, R.L., Bowman, B.H., Meyer, W. and Merz, W.G. (1994b)Molecular mycology: DNA probes and applications of PCR technology. Journalof Medical and Veterinary Mycology 32 (Suppl. 1), S351–S366.
Miyakawa, Y., Mabuchi, T., Kagaya, K. and Fukazawa, Y. (1992) Isolation andcharacterisation of a species-specific DNA fragment for detection of Candidaalbicans by PCR. Journal of Clinical Microbiology 30, 894–900.
Morace, G., Sanguinetti, M., Posteraro, B., Lo Cascio, G. and Fadda G. (1997)Identification of various medically important Candida species in clinicalspecimens by PCR and restriction enzyme analysis. Journal of Clinical Micro-biology 35, 667–672.
Nalesnik, M.A., Myerowitz, R.L., Jenkins, R., Lenley, J. and Herbert, D. (1980)Significance of Aspergillus species isolated from respiratory secretions indiagnosis of invasive pulmonary aspergillosis. Journal of Clinical Microbiology11, 370–376.
Niesters, H.G., Goessens, W.H., Meis, J.F. and Quint, W.G. (1993) Rapid, PCR-basedidentification assays for Candida species. Journal of Clinical Microbiology 31,904–910.
O’Leary, T.J., Tsai, M.M., Wright, C.F. and Cushion, M.T. (1995) Use of semi-quantitative PCR to assess onset and treatment of Pneumocystis carinii infectionin a rat model. Journal of Clinical Microbiology 33, 718–724.
Olsson, M., Elvin, K., Lofdahl, S. and Linder, E. (1993) Detection of Pneumocystiscarinii DNA in sputum and BAL samples by PCR. Journal of ClinicalMicrobiology 31, 221–226.
Pixley, F.J., Wakefield, A.E., Banerji, S. and Hopkin J.M. (1991) Mitochondrial genesequences show fungal homology for Pneumocystis carinii. Molecular Micro-biology 5, 1347–1351.
Polanco, A.M., Rodrıguez-Tudela, J.L. and Martınez-Suarez. (1995) Detection ofpathogenic fungi in human blood by the polymerase chain reaction. EuropeanJournal of Clinical Microbiology and Infectious Diseases 14, 618–621.
Reddy, L.V., Kumar, A. and Kurup, V.P. (1993) Specific amplification of Aspergillusfumigatus DNA by PCR. Molecular and Cellular Probes 7, 121–126.
Richardson, M.D. and Warnock, D.W. (1993) Fungal Infection. Blackwell ScientificPublications, Oxford.
Rinaldi, M.G. (1983) Invasive aspergillosis. Reviews in Infectious Diseases 5,1061–1077.
Roux, P., Laurard, I., Poirot, J.L., Chouaid, C., Denis, M., Olivier, J.L., Nigou, M. andMiltgen, M. (1994) Usefulness of PCR for detection of Pneumocystis cariniiDNA. Journal of Clinical Microbiology 32, 2324–2326.
Saito, H., Anassie, E.J., Morice, R.C., Dekmezian, R. and Bodey, G.P. (1988)Bronchoalveolar lavage in the diagnosis of pulmonary infiltrates in patients withacute leukaemia. Chest 94, 745–749.
Sandhu, G.S., Kline, B.C., Stockman, L. and Roberts, G.D. (1995) Molecular probes fordiagnosis of fungal infections. Journal of Clinical Microbiology 33, 2913–2919.
Schluger, N., Sepkowitz, K, Armstrong, D., Bernard, E., Rifkin, M., Cerami, A. andBucala, R. (1991) Detection of Pneumocystis carinii in serum of AIDS patientswith PCP by the polymerase chain reaction. Journal of Protozoology 38 (Suppl.),S240–S242.
Medical Mycology Diagnostics 285
Schluger, N., Godwin, T., Sepkowitz, K, Armstrong, D., Bernard, E., Rifkin, M.,Cerami, A. and Bucala, R. (1992) Application of DNA amplification toPneumocystis : presence of serum Pneumocystis carinii DNA during human andexperimentally induced PCP. Journal of Experimental Medicine 176,1327–1333.
Spreadbury, C., Holden, D., Aufauvre-Brown, A., Bainbridge, B. and Cohen, J.(1993) Detection of Aspergillus fumigatus by polymerase chain reaction. Journalof Clinical Microbiology 31, 615–621.
Stockman, L., Clark, K.A., Hunt, J.M. and Roberts, G.D. (1993) Evaluation ofcommercially available Acridnium ester-labelled chemiluminescent DNA probesfor culture identification of Blastomyces dermatitidis, Coccidioides immitis,Cryptococcus neoformans and Histoplasma capsulatum. Journal of ClinicalMicrobiology 31, 845–850.
Stringer, J.R., Edman, J.C., Cushion, M.T., Richards, F.F. and Watanabe, J. (1992) Thefungal nature of Pneumocystis. Journal of Medical and Veterinary Mycology 30(Suppl. 1), S271–S278.
Tamburrini, E., Mencarini, P., De Luca, A., Maiuro, G., Ventura, G., Antinori, A.,Ammassari, A., Visconti, E., Ortona, L., Siracuscano, A., Ortona, E. and Vicari,G. (1993) Diagnosis of Pneumocystis carinii pneumonia: specificity and sensitiv-ity of PCR in comparison with immunofluorescence in BAL specimens. Journalof Medical Microbiology 38, 449–453.
Tanaka, K.I., Miyazaki, T., Maesaki, S., Mitsutake, K., Kakeya, H., Yamamoto, Y.,Yanagihara, K., Hossain, M.A., Tashiro, T. and Kohno, S. (1996) Detection ofCryptococcus neoformans gene in patients with pulmonary cryptococcosis.Journal of Clinical Microbiology 34, 2826–2828.
Tang, C.M. and Cohen, J. (1992) Diagnosing fungal infections in immunocompro-mised hosts. Journal of Clinical Pathology 45, 1–5.
Tang, C.M., Holden, D.W., Aufauvre-Brown, A. and Cohen, J. (1993) Detection ofAspergillus species by PCR and its evaluation in BAL fluid. American Reviewsin Respiratory Diseases 148, 1313–1317.
Van Cutsem, J., Meulemans, L., van Gerven, F. and Stynen, D. (1990) Detection ofcirculating galactomannan by Pastorex Aspergillus in experimental invasiveaspergillosis. Mycoses 33, 61–69.
Van Deventer, A.J., Goessens, W.H., van Belkum, A., van Vliet, H.J., van Etten, E.W.and Verbrugh, H.A. (1995) Improved detection of Candida albicans by PCR inblood of neutropenic mice with systemic candidiasis. Journal of ClinicalMicrobiology 33, 625–628.
Vaneechoutte, M. and van Eldere, J. (1997) The possibilities and limitations of nucleicacid amplification technology in diagnostic microbiology. Journal of MedicalMicrobiology 46, 188–194.
Verweij, P.E., Meis, J.F., van den Hurk, P., de Pauw, B.E., Hoogkamp-Korstanje,J.A. and Melchers, W.J. (1994) Polymerase chain reaction as a diagnostic toolfor invasive aspergillosis: evaluation in bronchoalveolar lavage fluid from lowrisk patients. Serodiagnosis and Immunotherapy in Infectious Disease 6,203–208.
Verweij, P.E., Rijs, A.J., de Pauw, B.E., Horrevorts, A.M., Hoogkamp- Korstanje, J.A.and Meis, J.F. (1995) Clinical evaluation and reproduciblity of the PastorexAspergillus antigen latex agglutination test for diagnosing invasive aspergillosis.Journal of Clinical Pathology 48, 474–476.
286 T. Hughes et al.
Verweij, P.E., Donnelly, J.P., de Pauw, B.E. and Meis, J.F. (1996) Prospects for theearly diagnosis of invasive aspergillosis in the immunocompromised patient.Reviews in Medical Microbiology 7, 105–113.
Wakefield, A.E., Pixley, F.J., Banersi, S., Sinclair, K., Miller, R.F., Moxon, E.R. andHopkin, J.M. (1990) Detection of Pneumocystis carinii with DNA amplification.Lancet 336, 451–453.
Walsh, T.J., Francesconi, A., Kasai, M. and Chanock, S.J. (1995) PCR and single-strand conformational polymorphism for the recognition of medically importantopportunistic fungi. Journal of Clinical Microbiology 33, 3216–3220.
White, T.J., Bruns, T.D., Lee, S. and Taylor, J. (1990) Amplification and directsequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A.,Gelfand, D.M., Sninsky, J.J. and White, T.J. (eds) PCR Protocols: a Guide toMethods and Applications. Academic Press, San Diego, pp. 315–322.
Yamakami, Y., Hashimoto, A., Tokimatsu, I. and Nasu, M. (1996) PCR detection ofDNA specific for Aspergillus species in serum of patients with invasiveaspergillosis. Journal of Clinical Microbiology 34, 2464–2468.
Yap, E.P. and McGee, J.O’D. (1994) Non-isotopic single-strand conformationalpolymorphism analysis of PCR products. In: Griffin, H.G. and Griffin, A.M.(eds) PCR Technology: Current Innovations. CRC, Boca Raton, Florida,pp. 165–177.
Yu, V.L., Muder, R.R. and Poorsattar, A. (1986) Significance of isolation of Aspergillusfrom the respiratory tract in diagnosis of invasive pulmonary aspergillosis.American Journal of Medicine 81, 249–254.
Medical Mycology Diagnostics 287
Applications of PCR inFungal–Plant Interactions
E. Ward, A. Tahiri-Alaoui and J.F. Antoniw
Crop and Disease Management Department, Institute for ArableCrops Research, Rothamsted, Harpenden, Herts AL5 2JQ, UK
13.1 Introduction
This chapter describes the use of PCR-based techniques for studyingplant–fungal interactions. The first section describes the uses of PCR fordetection of fungal pathogens and symbionts within their hosts and theother three sections cover approaches used to study the genes involvedin plant–fungal interactions. Some genes involved in fungal infection andplant responses to infection are common to many host–pathogencombinations and some of these have been characterized at the nucleotideor amino acid level. Where this is the case, PCR allows similar genes fromother interactions to be isolated and characterized relatively easily. Asecond approach, which does not rely on any previous sequencecharacterization, is to search for genes whose expression is altered duringfungal interactions and PCR-based methods are available to do this. Thefinal application discussed is the use of PCR to detect genomic differencesbetween plants or fungi that differ in one characteristic only, e.g. fungalpathogenicity or plant resistance to a particular pathogen. Recent reviewson various aspects of plant–fungal interactions have described: plantresistance genes (Ellis et al., 1988; Michelmore et al., 1992; Keen, 1992);fungal pathogenicity and virulence genes (Schafer, 1994; Van Etten et al.,1994; Hensel and Holden, 1996); fungal avirulence genes (de Wit, 1992);genes involved in mycorrhizal interactions (Gianinazzi-Pearson, 1996;Gianinazzi-Pearson et al., 1996); plant defence genes (Dixon et al., 1994);and fungal colonization of plants (Takenaka, 1995).
13
© CAB INTERNATIONAL 1998. Applications of PCR in Mycology(eds P.D. Bridge, D.K. Arora, C.A. Reddy and R.P. Elander) 289
13.2 Applications
13.2.1 Detection, localization and quantification of fungi in plant tissues
PCR is now widely used to detect and identify microorganisms, and there aremany examples of its use for fungi, including both plant pathogens andsymbionts. This application has been reviewed by Foster et al. (1993), Ward(1994) and Bridge and Arora (Chapter 4) and will not be covered here. PCRassays developed for a fungus in pure culture can usually be adapted fordetection of the fungus within the plant although procedures to overcomePCR inhibitors in some plant tissues may be necessary (Robb and Nazar,1996). This then opens the way for using PCR to quantify the extent offungal colonization of plant tissue or to localize the fungus within the plant.
One area in which PCR is beginning to be used is the quantification offungal biomass in infected tissues. For reviews of quantitative PCR, see Ferre(1992), Diaco (1995) and Zimmerman and Mannhalter (1996). The use ofPCR for quantification is not straightforward. This is because the PCRincludes an exponential phase, so minute differences in efficiency of reactionbetween samples can give rise to dramatically different amounts of finalproduct. To overcome this problem, internal control DNA, which isamplified in the same PCR reaction, should be included. The quantity ofcontrol product is then used to adjust the quantity of the test amplicon forvariations in the efficiency of the PCR between tubes. The detection andquantification of the PCR products can be done by measuring the intensityof ethidium bromide-stained DNA on gels (e.g. using densitometry), byscintillation counting of labelled DNA, or by using colorimetric techniques.
Quantitative PCR has several advantages over other methods of deter-mining fungal biomass, such as tissue maceration and dilution plating whichis a lengthy and labour-intensive procedure. Also, the dilution plating assaymay only indicate the amounts of fungus that can be isolated rather than theamount actually present, and it cannot be used for obligate pathogens orsymbionts. PCR is a much more rapid technique and it does not requireisolation of pure fungus from the tissue. Another method of biomassdetermination is to measure ergosterol or chitin levels, but this method doesnot allow discrimination between different fungi infecting the same plant,which is possible with PCR. Serological methods have also been used forfungal biomass determination but it is generally difficult to obtain antibodieswith the required specificity for the fungus being studied. PCR has thepotential to measure fungal biomass simply and with great sensitivity andspecificity. Quantitative PCR has been used in the detection of mycorrhizalfungi (Simon et al., 1992), Verticillium spp. (Hu et al., 1993; Moukhamedovet al., 1994; Robb and Nazar, 1996), Leptosphaeria maculans (Mahuku et al.,1995) and Microdochium nivale (Nicholson et al., 1996). The ability tomonitor the amounts of different fungi infecting the same plant at the sametime by quantitative PCR will be of great value in studying disease complexes
290 E. Ward et al.
(Nicholson et al., 1996) and interactions between fungi, e.g. synergism andcompetition.
Localizing fungi within plant tissues can be done simply by separatingthe different parts of the plant and testing each for the presence of the fungus;PCR was used to monitor the spread of Verticillium species through theirhosts at different times after infection (Moukhamedov et al., 1994; Hu et al.,1993). A much more precise method, capable of localizing the fungus at thecellular level, is in situ PCR (Nuovo, 1995), in which thin sections of infectedplant tissue are placed on a microscope slide and the PCR is performeddirectly on this. This is technically difficult and although there are now manyapplications in studying human infections, particularly those involvingviruses, we are not aware of any applications to the study of fungi or plant–fungal interactions published yet. This could be an area for development inthe future, not just for detection of the fungi themselves but also for thedetection of mRNA from genes expressed in plant–fungal interactions.
13.2.2 Targeted approaches to cloning and analysing plant and fungalgenes
These approaches can be used when physiological, biochemical and/ormolecular data about a gene or gene product suggest that it is involved in aparticular plant–fungal interaction. They are particularly suitable for genesand gene products that are common to many plants or fungi and/or areexpressed in response to a range of pathogens, hosts or other stimuli. Manyof the plant defence genes fall into this category. Nucleotide or amino acidsequence data from previously characterized genes or proteins are used todesign primers that can amplify the same or homologous genes or identifycDNA clones for those genes. Whether designing primers from amino acidor nucleotide sequences, this approach usually involves the use of degenerateprimers that allow for uncertainties in the nucleotide sequence (see Kwok etal., 1995 for a review of their design and use). Examples of genes isolatedusing targeted approaches are given in Table 13.1.
Where a protein involved in a particular interaction has been charac-terized, amino acid sequence information can be used to design primers toamplify part of the corresponding gene from genomic DNA or cDNA.Because of the redundancy of the genetic code, a given amino acid may beencoded by different nucleotide triplets. Degenerate primers should bedesigned as a pool of all the possible combinations of nucleotides that couldcode for the amino acid sequence. Deoxyinosine can be used to reduce thecomplexity of the primer pool. In other cases, nucleotide sequence informa-tion can be used to design primers, e.g. where nucleotide sequence informa-tion is already known for related genes. This generally involves the use ofdegenerate primers because even within conserved regions of genes there isoften some variation, e.g. between different plants or fungi or betweendifferent members of a gene family in the same plant.
Study of Fungal–Plant Interactions 291
Table 13.1. Genes isolated from various plant–fungal interactions using PCR-based targeted approaches.
Gene product Organism Reference
Fungal genes for products involved in Pectin lyase Glomerella cingulata Templeton et al. (1994)fungal attachment and penetration of Exo-β1,3-glucanase Cochliobolus carbonum Schaeffer et al. (1994)the host plant Endopolygalacturonase Fusarium moniliforme Caprari et al. (1993)
Extracellular protease (ALP1) Cochliobolus carbonum Murphy and Walton (1996)
Genes for fungal toxins Phytotoxins synthesized by cyclic Cochliobolus victoriae Nikolskaya et al. (1995)peptide synthetases Diheterospora chlamydosporia Nikolskaya et al. (1995)
Cylindrocladium macrospora Nikolskaya et al. (1995)
Plant defence genes Phenylalanine ammonia lyase Rice Zhu et al. (1995)Peroxidase Wheat Båga et al. (1995)Pathogenesis-related gene RH2 Pea root epidermis Mylona et al. (1994)Chitinases Sugar beet Nielsen et al. (1994)
Pea Vad et al. (1993)Maize Wu et al. (1994)Wheat Liao et al. (1994)
Polygalacturonase inhibitor (PGIP) Soybean Favaron et al. (1994)IWF (non-specific lipid transferprotein)
Sugar beet Nielsen et al. (1996)
Fungal and plant genes involved in Plant sugar transporter Medicago truncatula Harrison (1996)mycorrhizal interactions Fungal phosphate transporter Glomus versiforme Harrison and van Buuren (1995)
Once a small region of the gene of interest has been amplified using PCR,full-length clones may be obtained by screening genomic or cDNA librarieswith labelled PCR-amplified DNA, or by using other PCR-based approa-ches. For cDNA clones the missing parts of the gene sequence can be clonedby an approach most commonly referred to as RACE (rapid amplification ofcDNA ends; Frohman, 1995). RACE is also known as anchored PCR or one-sided PCR. RACE involves amplification using one primer derived from ashort stretch of known sequence in the gene/mRNA and another primer thatanneals either to the poly(A)-tail (to obtain the 3′-end) or to an appendedhomopolymer tail (for the 5′-end). There are several examples of its use incloning genes involved in plant–fungal interactions (Vad et al., 1993; Nielsenet al., 1994, 1996; Murphy and Walton, 1996).
PCR-based approaches have allowed genes and their mRNA products tobe cloned and analysed much more quickly than was previously possible.Once sequences are published it is possible for other workers to use theinformation to analyse similar genes immediately rather than waiting for theexchange of clones. There are various uses for the genes once isolated, inaddition to characterizing the gene structure and organization. The spatialand temporal expression of the gene can be studied during infection bytechniques such as Northern blotting (Vad et al., 1993; Wu et al., 1994; Zhuet al., 1995; Nielsen et al., 1996), reverse transcriptase (RT) PCR (Baga et al.,1995; Guo et al., 1995; Meyer et al., 1996) or in situ hybridization. The genecan be cloned into an expression vector allowing purification and furthercharacterization of the protein and the production of antisera (Templeton etal., 1994; Guo et al., 1995). The promoter from the gene can be fused to areporter such as β-glucuronidase (GUS), transformed into plants and theexpression studied in various tissues at different times after infection or othertreatments (Zhu et al., 1995).
In fungi, mutants lacking particular genes have been obtained by targetedgene disruption using cloned genes and this has allowed functional studies tobe carried out. A gene encoding the exo-β-1,3-glucanase of Cochlioboluscarbonum was cloned using degenerate primers based on amino acidsequence and this was then used to generate mutants that could not producethe enzyme. The mutant was still pathogenic to maize, indicating that theexo-β-1,3-glucanase gene was not essential for pathogenicity (Schaeffer et al.,1994). A similar approach was used to study an extracellular protease ALP1from Cochliobolus carbonum (Murphy and Walton, 1996). The ALP1mutants thus generated had the same growth and disease phenotypes as thewild-type strain, indicating that this gene by itself was not required forpathogenicity. Although the above studies could have been done without thePCR, its use enabled the work to be done much more easily and quickly thanwas previously possible.
PCR can also be used for in vitro mutagenesis to study the effects ofparticular amino acid residues on the biological activity of the gene product.Altered primers can be used to replace the nucleotides coding for single or
Study of Fungal–Plant Interactions 293
multiple amino acid residues in the protein. This approach was used to studythe mode of action of the AVR9 elicitor peptide involved in the Cladospo-rium fulvum – tomato interaction (Honee et al., 1994).
13.2.3 Studying plant and fungal genes involved in interactions bycomparative genome analysis
The biochemical basis of the effects of most genes involved in plant–fungalinteractions is not known. One approach devised for studying these genes isbased on comparing the DNA of organisms with or without a trait of interestto find the regions that differ. In particular, this has been used to study plantresistance genes, but the methods described are applicable to other plant andfungal genes. The first stage in the analysis is to find a molecular marker thatis closely linked genetically to the required gene. Two types of strategies arecommonly used to ‘home in’ on the region of interest. The first is to use nearisogenic lines, that differ primarily in the gene of interest (Horvath et al.,1995). The second is a ‘pooling approach’ such as bulked segregant analysis(Michelmore et al., 1991). Using this technique, markers linked to a trait ofinterest are identified using two pooled DNA samples, one from (homo-zygous) individuals that express the trait and the other from (homozygous)individuals lacking the trait. Any polymorphism between the two poolsshould be linked with the trait. Markers thus identified are then confirmedby mapping a segregating population.
Until the advent of PCR in the late 1980s most of the markers usedwere RFLP (restriction fragment length polymorphisms). Although theseallowed much faster and easier screening than did the previously availablephenotypic markers, the procedure required relatively large quantities ofpurified DNA and usually radioactive detection. PCR offered theopportunity of being able to screen for differences much more easily; thetechniques do not involve radioactivity, are simpler and can be performedon small amounts of crudely prepared samples. Some of the previouslydeveloped RFLP methods were subsequently converted to PCR-basedprotocols by sequencing the clones and then designing primers based onthese sequences (Balint-Kurti et al., 1994; Kilian et al., 1994). These markersare frequently referred to as SCARs (sequence-characterized amplifiedregions).
Additional PCR-based methods were also developed that allow theidentification of useful markers much more quickly. The most widely usedof these involves PCR at low stringency, with arbitrarily chosen primers, andis known by the acronyms RAPDs (random amplified polymorphic DNAs;Williams et al., 1990), AP-PCR (arbitrarily primed PCR; Welsh andMcClelland, 1990) and DAF (DNA amplification fingerprinting). Theconcept is essentially the same and hereafter RAPDs will be used to refer toall three techniques. In this technique, the primers are usually much shorter(10 bases) than those generally used for PCR (~20 bases) and one primer is
294 E. Ward et al.
sufficient. Also the conditions of the PCR are made relatively non-specific,e.g. by reducing the annealing temperature and increasing the number ofamplification cycles (e.g. from 25 to 45). Since the primers are so short andmismatches are allowed by low stringency conditions it is likely that manyprimer-binding sites will be present in the target DNA. There is also a highprobability that pairs of sequences complementary to the primer will bearranged close enough together and in the correct orientation for PCR-amplification of the intervening sequences. Each RAPD is likely to result inthe amplification of several (usually 3–10) bands that can be detected byagarose gel electrophoresis and ethidium bromide staining. Alternativedetection methods, that reveal a larger number of bands, are silver stainingof polyacrylamide gels (Caetano-Anolles et al., 1991) radioactive labelling ofproducts run on acrylamide gels detected by autoradiography (Welsh andMcClelland, 1990) and denaturing gradient gel electrophoresis (DGGE)(Procunier et al., 1995). Reactions with different RAPD primers can detectvariation at different levels, including species, isolates and near-isogenic linesdiffering only in a single trait, e.g. plant resistance to disease or fungalpathogenicity.
Due to the ease of use and the speed at which markers can be developedusing it, RAPDs have been used extensively in the few years since the methodwas first reported. Several reviews have covered various aspects of thetechnique and its applications in genetics and plant breeding (Waugh andPowell, 1992; Bowditch et al., 1993; Rafalski and Tingey, 1993; Williams etal., 1993; He et al., 1994; McClelland and Welsh, 1995). Using RAPDs,markers have now been identified that are closely linked to the resistancegenes for barley stem rust (Horvath et al., 1995), barley powdery mildew (Xuand Kasha, 1992), wheat leaf rust (Schachermayr et al., 1994), lettuce downymildew (Michelmore et al., 1991; Paran and Michelmore, 1993; Maisonneuveet al., 1994), pea powdery mildew (Timmerman et al., 1994), bean rust(Miklas et al., 1993) and muskmelon Fusarium wilt (Wechter et al., 1995).RAPDs have also been used as markers in fungi, but the work here hasmainly been used for species and population analysis (McDermott et al.,1994).
The major problem with the RAPD technique is the lack of reproduci-bility, although with appropriate precautions the effects of this can beminimized. Usually RAPD bands behave as dominant markers (only one ofthe alleles can be amplified) rather than co-dominant markers (each alleleamplifies a different band) which would be generally more useful. Anotherfeature of RAPDs is that multiple loci are amplified. Whilst this is usefulinitially, in that many loci can be analysed at once, it is a disadvantage insubsequent analyses because of the complexity of the patterns. Anotherpotential source of problems is contamination and it is essential to includenegative controls. Because of these problems RAPD markers are oftenconverted to more reproducible markers (SCARs) after cloning and sequenc-ing (Markussen et al., 1995; Naqvi and Chattoo, 1996).
Study of Fungal–Plant Interactions 295
Another, more recently developed technique for isolating markers linkedto traits of interest is AFLPs (amplified fragment length polymorphisms)(Vos et al., 1995; Perkin Elmer, 1995). The technique is based on the selectiveamplification of restriction fragments generated from the genomic DNA.First the DNA is digested with restriction enzymes and oligonucleotideadaptors are ligated to it. Sets of restriction fragments are then amplifiedselectively and, finally, the amplified fragments are analysed after gelelectrophoresis. The selectivity is achieved by using primers that contain therestriction site and variable 3′ extensions. The number of bands produceddepends on the type of gel analysis used but typically 50–100 restrictionfragments are resolved on denaturing polyacrylamide gels. The AFLPmethod is more robust and reliable than RAPDs because more stringentreaction conditions are used, but is more difficult and expensive to do. Thetechnique has been used to select markers closely linked to the R1 (resistanceto Phytophthora infestans) gene of potato (Meksem et al., 1995) and thetomato Cf-9 gene (resistance to Cladosporium fulvum ; Thomas et al., 1995).Other PCR-based methods have also been developed that allow rapididentification of markers for genes of interest (for reviews, see Karp et al.,1996; Staub et al., 1996), including variable non-translated repeats (VNTRs)and microsatellite/simple sequence repeats (SSRs). Once developed, thesemarkers are useful in screening breeding lines to track which progenycontains the desirable trait (marker-assisted selection). Molecular markers,and particularly those involving PCR, allow much faster and easier screeningthan do the previously available phenotypic markers, and this is importantin these high throughput studies.
The markers can also be used to facilitate cloning of the gene of interest(for resistance, pathogenicity, etc.) by map-based cloning procedures (Young,1990, 1995; Michelmore et al., 1991). This is an approach whereby informa-tion about the gene’s chromosomal location is used as the basis for cloning.After markers that are closely linked genetically to the gene of interest havebeen identified a physical map is constructed in which the distances betweenmarkers are calculated as numbers of nucleotides rather than recombinationfrequencies (e.g. using pulsed-field gel electrophoresis). Chromosome walk-ing is then used to identify overlapping clones in the region of interest. Thelast stage is to pinpoint the target gene among the overlapping clones, usuallyby complementation of organisms with the recessive phenotype. Thisapproach is a long-term, labour-intensive undertaking, but it has been usedto isolate the genes conferring resistance to the bacterial pathogen Pseudomo-nas syringae in tomato (Martin et al., 1993) and Arabidopsis thaliana(Mindrinos et al., 1994).
It may also be possible to identify genes of interest which, for example,differ between wild-type and deletion mutants, by genomic subtractionmethods. DNA that is found in one of the pair of organisms under test, butnot the other, is selected and then amplified using PCR (Straus and Ausubel,1990; Lisitsyn et al., 1993). This approach has been used to clone the
296 E. Ward et al.
Arabidopsis gibberellin synthesis (GA1) locus (Sun et al., 1992). Subtractivehybridization is also used on mRNA, to find mRNA species which arepresent in colonized plants but absent from the uninfected plant (see section13.2.4).
13.2.4 Non-targeted approaches to characterizing altered geneexpression during plant–fungal interactions
The use of PCR in combination with standard cloning techniques is now awidely adopted strategy to identify genes whose expression is altered duringbiological interactions and it has resulted in the saving of much time, effortand cost. Several methods have been developed and optimized in differentlaboratories to suit a specific need and a particular biological system. In thissection we discuss three applications of PCR to investigate changes in geneexpression during fungal–plant interaction, without prior knowledge of thegenes or proteins that might be involved: (i) the use of PCR in combinationwith differential hybridization methods to screen for differentially expressedgenes; (ii) RNA fingerprinting methods to analyse differential gene expres-sion; (iii) the use of PCR in conjunction with subtractive hybridization togenerate probes specific to differentially expressed genes.
Differential screening of cDNA librariesVarious papers discuss the use of PCR to construct cDNA libraries (Gurrand McPherson, 1992; Clackson et al., 1993; Lambert and Williamson,1993). PCR can also be used during screening to estimate the average cDNAinsert size (Gussow and Clackson, 1989). This allows the presence, size andorientation of inserts to be determined rapidly by amplification withflanking primers, and (for orientation) by including a single internal primer.PCR can be performed directly on single phage plaques, aliquots from phagelibraries, or bacterial colonies, circumventing all DNA preparation. Whenthe PCR-based assessment is used in combination with the IPTG and X-Galcolour selection method (Sambrook et al., 1989) to determine the relativenumbers of recombinant (white) versus wild-type (blue) phage, it providesa simple and accurate assessment of the quality of cDNA library underinvestigation.
Differential screening allows the identification of cDNA clones corre-sponding to differentially expressed genes. Poly(A)+ RNAs extracted fromthe two samples under comparison are used as templates to generate labelledcDNA probes that are hybridized separately to duplicate copies of the samecDNA library. Clones that hybridize to both probes correspond to genesthat are constitutively expressed in both samples, whereas clones thathybridize to only one probe correspond to mRNAs that are expressed inonly one sample (Sambrook et al., 1989). To ensure the purification of singleclones, putative positive phage clones are screened through two or threerounds of differential hybridization. Due to the high number of phages
Study of Fungal–Plant Interactions 297
which are analysed during each round of screening, the method can be verytime-consuming and costly. PCR can be used to simplify and speed up thisprocess. An aliquot is taken from each phage clone as template for a PCRreaction using, for example, M13 forward and reverse sequencing primers toamplify the cDNA insert within the polylinker or any specific primersflanking the cloning site. There are several advantages of using this approach:(i) it shows whether the phage clone is single or contaminated by othersurrounding phages; (ii) it gives an estimate of the size of the inserted cDNA;(iii) several phage clones can be screened at once; (iv) when combined withSouthern blot analysis it allows analysis of the induction or repression of theclones under investigation. This approach has been used to clone symbiosis-related cDNAs from eucalypt ectomycorrhizae (Tagu et al., 1993) and tostudy genes whose expression is altered during the colonization of tomatoroots with the arbuscular mycorrhizal fungus Glomus mosseae (Tahiri-Alaoui and Antoniw, 1996).
RNA fingerprinting methodsAnother approach to detecting and isolating differentially expressed genes isby comparing cDNA fingerprints generated from mRNA expressed underdifferent conditions (see Chapter 3; McClelland and Welsh, 1995; McClel-land et al., 1995, for recent reviews and protocols). These methods are theRNA equivalents of the DNA fingerprinting methods described in Section13.2.3. Liang and Pardee (1992) were the first to describe an RNAfingerprinting protocol, which they termed differential display reversetranscriptase PCR (DDRT–PCR). They used a primer for reverse transcrip-tion based on oligo-dT but with an anchor of two bases at the 3′-end. Afterreverse transcription and denaturation, PCR was performed on the firststrand cDNA using the anchored oligo-dT primer together with anarbitrarily chosen 10-mer primer to generate a fingerprint of productsanalysed on a polyacrylamide sequencing gel. DDRT–PCT has been used inthe investigation of gene regulation in both animal and plant systems.Although the principle of the technique is simple and elegant, there areseveral problems in practice, including the redundancy and under-representation of certain mRNA species and a rather high number of falsepositives that cannot be confirmed by Northern blot analysis. We haveencountered such problems in our laboratory in investigating the interactionof barley roots with the take-all fungus, Gaeumannomyces graminis var.tritici, and potato infected with potato cyst nematode, Globodera ros-tochiensis. Despite extensive analysis, and although barley and potatoshowed dramatic physiological responses to the pathogen attack, no differ-ences in gene expression were found between uninfected plants and plantsresponding to pathogen attack. This led to the design of an experimentalsystem in which it was demonstrated that differential display showed astrong bias towards high copy number mRNA species (Bertioli et al., 1995).There are few reports of the successful use of differential display in analysing
298 E. Ward et al.
plant–microbe interactions (Martin-Laurent et al., 1995; Martin-Laurent etal., 1996). Various efforts have been made to optimize and streamline themethod (Liang, et al., 1993, 1994; Li et al., 1994; Mou et al., 1994).
In an alternative protocol, termed RNA arbitrarily primed PCR (RAP-PCR; Welsh et al., 1992) arbitrary primers are used both for cDNA synthesisand PCR amplification. A method of RNA fingerprinting based on AFLPshas also been developed and used to analyse gene expression during potatotuber development (Bachem et al., 1996).
Subtractive hybridization methodsThis approach involves the subtraction (by hybridization) of the mRNAsexpressed in uninfected cells from those expressed in infected cells to leaveonly those expressed during infection. PCR has been invaluable in amplify-ing the minute amounts of material that result from this process. The cDNAthus produced can be used to make subtractive cDNA libraries or used as aprobe to screen existing cDNA libraries. There are several variations of thetechnique depending on the method used to separate the hybridized andnon-hybridized molecules, including hydroxylapatite chromatography(Sambrook et al., 1989), biotinylation (Wieland et al., 1990) and magneticbeads (Sharma et al., 1993). Examples of the use of the technique in studyingplant–fungal interactions have been reported (Sharma et al., 1993; Lonneborget al., 1995; Roberts and Pryor, 1995; Justesen et al., 1996). Recentdevelopments in subtractive hybridization techniques include representa-tional difference analysis (RDA) and PCR-select cDNA subtraction.
RDA is a method originally developed by Lisitsyn et al., (1993) toisolate differences between two complex genomes. Genomic RDA relies onthe generation, by restriction enzyme digestion and PCR amplification, ofsimplified versions of the genomes under investigation known as‘representations’. If an amplifiable restriction fragment (the target) exists inone representation (the tester), and is absent from another (the driver), akinetic enrichment of the target can be achieved by subtractive hybridizationof the tester in the presence of excess driver. Sequences with homologuesin the driver are rendered unamplifiable, while the target hybridizes onlyto itself, and retains the ability to be amplified by PCR. Successive iterationsof the subtraction/PCR process produces bands on ethidium bromide-stained agarose gels corresponding to enriched target. The RDA methodwas adapted for cDNA and successfully used to identify a number ofcaffeine-induced cDNA fragments from pre-B cell lines (Hubank andSchatz, 1994). Although we are not aware of any published work using thecDNA-RDA method to investigate altered gene expression in plant–fungalinteractions, the approach seems to be fast, sensitive, reproducible, with fewfalse positives and capable of being applied to a wide range of biologicalproblems.
PCR-select cDNA subtraction (Clontech, 1996) uses a new methodcalled suppression PCR (Siebert et al., 1995). The PCR-select cDNA primer
Study of Fungal–Plant Interactions 299
adaptors are engineered to prevent undesirable amplification, i.e. amplifica-tion of common sequences, during PCR. Suppression occurs whencomplementary sequences are present on each end of a single-strand cDNA.During each primer annealing step, the hybridization kinetics stronglyfavour the formation of a pan-handle secondary structure that preventsprimer annealing. When occasionally a primer anneals and is extended, thenewly synthesized strand will also have the inverted terminal repeats andform another pan-handle structure. Thus, during PCR, non-specificamplification is efficiently suppressed, and specific amplification of cDNAmolecules with different adaptors at both ends can proceed normally. Wehave used this technique to generate two specific probes of mRNA thatare specifically expressed in arbuscular mycorrhizal colonized tomato roots(tester) but not in control uninoculated roots (driver). The two probes wereused to screen a cDNA library prepared from mRNA from arbuscularmycorrhizal-colonized tomato roots (Tahiri-Alaoui and Antoniw, 1996).Two different cDNA clones were isolated, which after partial sequencingshowed 94% similarity to an inorganic phosphate transporter from potatoand 86% similarity to the ATP phosphoribosyl transferase from Escherichiacoli and Salmonella typhimurium (A. Tahiri-Alaoui and J.F. Antoniw,unpublished work).
13.3 Conclusions
PCR techniques have made a large impact on research into plant–fungalinteractions, as they have done in many other areas of biological research.PCR-based methods have been developed which allow the detection of manyplant pathogens and symbionts on or in their hosts more rapidly and reliablythan before and for a few fungi these methods are quantitative. PCR has alsosimplified the isolation of genes involved in plant–fungal interactions. Oncea protein or nucleotide sequence is available for one gene, primers can bedesigned to allow related genes to be isolated very quickly. However, PCRcan also be used to isolate genes involved in plant–fungal interactionswithout prior knowledge of the proteins involved. These methods detectdifferences at the RNA level that correlate with fungal infection ordifferences at the DNA level that correlate with a trait such as plant resistanceor fungal pathogenicity.
Acknowledgements
We thank G.L. Bateman and M.J. Adams for critical reading of themanuscript. IACR receives grant-aided support from the BBSRC. A. Tahiri-Alaoui is currently supported by a European Union (EU) grant (no. AIR3-CT94-0809).
300 E. Ward et al.
References
Bachem, C.W.B., van der Hoeven, R.S., de Bruijn, S.M., Vreugdenhil, D., Zabeau,M and Visser, R.G.F. (1996) Visualization of differential gene expressionusing a novel method of RNA fingerprinting based on AFLP: analysis ofgene expression during potato tuber development. The Plant Journal 9,745–753.
Baga, M., Chibbar, R.N. and Kartha, K.K.(1995) Molecular cloning and expressionanalysis of peroxidase genes from wheat. Plant Molecular Biology 29, 647–662.
Balint-Kurti, P.J., Dixon, M.S., Jones, D.A., Norcott, K.A. and Jones, J.D.G. (1994)RFLP linkage analysis of the Cf-4 and Cf-9 genes for resistance to Cladosporiumfulvum in tomato. Theoretical and Applied Genetics 88, 691–700.
Bertioli, D.J., Schlichter, U.H.A., Adams, M. J., Burrows, P.R., Steinbiss, H.-H. andAntoniw, J.F. (1995) An analysis of differential display shows a strong biastowards high copy number mRNAs. Nucleic Acids Research 23, 4520–4523.
Bowditch, B.M., Albright, D.G., Williams, J.G.K. and Braun, M.J. (1993) Use ofrandomly amplified polymorphic DNA markers in comparative genome studies.Methods in Enzymology 224, 294–309.
Caetano-Anolles, G., Bassam, B.J. and Gresshoff, P.M. (1991) DNA amplificationfingerprints using very short arbitrary oligonucleotide primers. Bio/Technology9, 553–557.
Caprari, C., Richter, A., Bergmann, C., Lo Cicero, S., Salvi, G., Cervone, F. and DeLorenzo, G. (1993) Cloning and characterization of a gene encoding theendopolygalacturonase of Fusarium moniliforme. Mycological Research 97,497–505.
Clackson, T., Gussow, D. and Jones, P.T. (1993) General application of PCR to genecloning and manipulation. In: McPherson, M.J., Quirke, P. and Taylor, G.R. (eds)PCR: a Practical Approach. IRL Press, Oxford, pp. 187–214.
Clontech laboratories Inc. (1996) Clontech PCR-select cDNA Subtraction Kit UserManual (PT1117-1).
de Wit, P.J.G.M. (1992) Molecular characterization of gene-for-gene systems in plant–fungus interactions and the application of avirulence genes in control of plantpathogens. Annual Review of Phytopathology 30, 391–418.
Diaco, R. (1995) Practical considerations for the design of quantitative PCR assays.In: Innis, M.A., Gelfand, D.H. and Sninsky, J.J. (eds) PCR Strategies. AcademicPress, San Diego, pp. 84–108.
Dixon, R.A., Harrison, M.J. and Lamb, C.J. (1994) Early events in the activation ofplant defense responses. Annual Review of Phytopathology 32, 479–501.
Ellis, J.G., Lawrence, G.J., Peacock, W.J. and Pryor, A.J. (1988) Approaches tocloning plant genes conferring resistance to fungal pathogens. Annual Review ofPhytopathology 26, 245–263.
Favaron, F., D’Ovidio, R., Porceddu, E. and Alghisi, P. (1994) Purification andmolecular characterization of a soybean polygalacturonase-inhibiting protein.Planta 195, 80–87.
Ferre, F. (1992) Quantitative or semi-quantitative PCR: reality versus myth. PCRMethods and Applications 2, 1–9.
Foster, L.M., Kozak, K.R., Loftus, M.G., Stevens, J.J. and Ross, I.K. (1993) Thepolymerase chain reaction and its application to filamentous fungi. MycologicalResearch 97, 769–781.
Study of Fungal–Plant Interactions 301
Frohman, M.A. (1995) Rapid amplification of cDNA ends. In: Dieffenbach, C.W andDveksler, G.S. (eds) PCR primer. A Laboratory Manual. Cold Spring HarborLaboratory Press, Cold Spring Harbour, New York, pp. 381–409.
Gianinazzi-Pearson, V. (1996) Plant cell responses to arbuscular mycorrhizal fungi:getting to the roots of the symbiosis. The Plant Cell 8, 1871–1883.
Gianinazzi-Pearson, V., Dumas-Gaudot, E., Gollotte, A., Tahiri-Alaoui, A. andGianinazzi, S. (1996) Cellular and molecular defence-related root responses toinvasion by arbuscular mycorrhizal fungi. New Phytologist 133, 45–57.
Guo, W., Gonzalez-Candelas, L. and Kolattukudy, P.E. (1995) Cloning of a novelconstitutively expressed pectate lyase gene pelB from Fusarium solani f.sp. pisi(Nectria haematococca, mating type VI) and characterization of the gene productexpressed in Pichia pastoris. Journal of Bacteriology 177, 7070–7077.
Gurr, S. J. and McPherson, M. J. (1992) PCR-directed cDNA libraries. In:McPherson, M.J., Quirke, P. and Taylor, G.R. (eds) PCR: a Practical Approach.IRL Press, Oxford, pp. 147–170.
Gussow, D. and Clackson, T. (1989) Direct clone characterization from plaques andcolonies by the polymerase chain reaction. Nucleic Acids Research 17, 4000.
Harrison, M. (1996) A sugar transporter from Medicago truncatula: altered expres-sion pattern in roots during vesicular-arbuscular (VA) mycorrhizal associations.The Plant Journal 9, 491–503.
Harrison, M. and van Buuren, M. (1995) A phosphate transporter from themycorrhizal fungus Glomus versiforme. Nature 378, 626–629.
He, Q.S., Viljanen, M.K. and Mertsola, J. (1994) Effects of thermocyclers and primerson the reproducibility of banding patterns in random amplified polymorphicDNA analysis. Molecular and Cellular Probes 8, 155–160.
Hensel, M. and Holden, D.W. (1996) Molecular genetic approaches for the study ofvirulence in both pathogenic bacteria and fungi. Microbiology 142, 1049–1058.
Honee, G., van den Ackerveken, G.F.J.M., van den Broek, H.W.J., Cozijnsen, T.J.,Joosten, M.H.A.J., Lauge, R., Kooman-Gersmann, M., Vervoort, J., Vogelsang,R., Vossen, P., Wubben, J.P. and de Wit, P.J.G.M. (1994) Molecular character-ization of the interaction between the fungal pathogen Cladosporium fulvum andtomato. In: Daniels, M., Downie, J.A. and Osbourn, A.E. (eds) Advances inMolecular Genetics of Plant–Microbe Interactions, Vol. 3. Kluwer, Dordrecht,pp. 199–206.
Horvath, D.P., Dahleen, L.S., Stebbing, J.-A. and Penner, G. (1995) A co-dominantPCR-based marker for assisted selection of durable stem rust resistance in barley.Crop Science 35, 1445–1450.
Hu, X., Nazar R.N. and Robb, J. (1993) Quantification of Verticillium biomass in wiltdisease development. Physiological and Molecular Plant Pathology 42, 23–36.
Hubank, M. and Schatz, D. G. (1994) Identifying differences in mRNA expressionby representational difference analysis of cDNA. Nucleic Acids Research 22,5640–5648.
Justesen, A., Somerville, S., Christiansen and Giese, H. (1996) Isolation andcharacterization of two novel genes expressed in germinating conidia of theobligate biotroph Erysiphe graminis f.sp. hordei. Gene 170, 131–135.
Karp, A., Seberg, O. and Buiatti, M. (1996) Molecular techniques in the assessmentof botanical diversity. Annals of Botany 78, 143–149.
Keen, N.T. (1992) The molecular biology of disease resistance. Plant MolecularBiology 19, 109–122.
302 E. Ward et al.
Kilian, A., Steffenson, B.J., Maroof, M.A.S. and Kleinhofs, A. (1994) RFLP markerslinked to the durable stem rust resistance gene Rpg1 in barley. Molecular Plant–Microbe Interactions 7, 298–301.
Kwok, S., Chang, S.-Y., Sninsky, J.J. and Wang, A. (1995) In: Dieffenbach, C.W andDveksler, G.S. (eds) PCR Primer. A Laboratory Manual. Cold Spring HarborLaboratory Press, Cold Spring Harbor, New York, pp. 143–155.
Lambert, K.N. and Williamson, V.M. (1993) cDNA library construction from smallamounts of RNA using paramagnetic beads and PCR. Nucleic Acids Research 21,775–776.
Li, F., Barnathan, E.S. and Kariko, K. (1994) Rapid method for screening and cloningcDNAs generated in differential mRNA display: application of Northern blotfor affinity capturing of cDNAs. Nucleic Acids Research 22, 1764–1765.
Liang, P. and Pardee, A.B. (1992) Differential display of eukaryotic messenger RNAby means of Polymerase Chain Reaction. Science 257, 967–971.
Liang, P., Averboukh, L. and Pardee, A.B. (1993) Distribution and cloning ofeukaryotic mRNA by means of differential display: refinements and optimiza-tion. Nucleic Acids Research 21, 3269–3275.
Liang, P., Zhu, W., Zhang, X., Guo, Z., O’Connell, R.P. Averboukh, L., Wang, F. andPardee, A.B. (1994) Differential display using one-base anchored oligo-dTprimers. Nucleic Acids Research 22, 5763–5764.
Liao, Y.C., Kreuzaler, F., Fischer, R., Reisener, H.-J. and Tiburzy, R. (1994)Characterization of a wheat class Ib chitinase gene differentially induced inisogenic lines by infection with Puccinia graminis. Plant Science 103, 177–187.
Lisitsyn, N., Lisitsyn, N. and Wigler, M. (1993) Cloning the differences between twocomplex genomes. Science 259, 946–951.
Lonneborg, A., Sharma, P. and Stougaard, P. (1995) Construction of a subtractivecDNA library using magnetic beads and PCR. In: Dieffenbach, C.W andDveksler, G.S. (eds) PCR Primer. A Laboratory Manual. Cold Spring HarborLaboratory Press, Cold Spring Harbor, New York, pp. 439–452.
Mahuku, G.S., Goodwin, P.H. and Hall, R. (1995) A competitive polymerase chainreaction to quantify DNA of Leptosphaeria maculans during blackleg develop-ment in oilseed rape. Molecular Plant–Microbe Interactions 8, 761–767.
Maisonneuve, B., Bellec, Y., Anderson, P. and Michelmore, R.W. (1994) Rapidmapping of two genes for resistance to downy mildew from Lactuca serriola toexisting clusters of resistance genes. Theoretical and Applied Genetics 89,96–104.
Markussen, T., Krueger, J., Schmidt H. and Dunemann, F. (1995) Identification ofPCR-based markers linked to the powdery-mildew-resistance gene Pl-1 fromMalus robusta in cultivated apple. Plant Breeding 114, 530–534.
Martin, G.B., Brommonschenkel, S.H., Chunwongse, J., Frary, A., Ganal, M.W.,Spivey, R., Wu, T., Earle, E.D. and Tanksley, S.D. (1993) Map-based cloning ofa protein kinase gene conferring disease resistance in tomato. Science 262,1432–1436.
Martin-Laurent, F., Franken, P. and Gianinazzi, S. (1995) Screening of cDNAfragments generated by differential RNA display. Analytical Biochemistry 228,182–184.
Martin-Laurent, F., Franken, P., van Tuinen, D., Dumas-Gaudot, E. Schlichter, U.Antoniw, J. F. Gianinazzi-Pearson, V. and Gianinazzi, S. (1996) Differentialdisplay reverse transcription polymerase chain reaction: A new approach to
Study of Fungal–Plant Interactions 303
detect symbiosis related genes involved in arbuscular mycorrhiza In: Azcon-Aguilar, C. and Barea, J.M. (eds) Mycorrhizas in Integrated Systems: From Genesto Plant Development. European Commission, Brussels, Belgium, pp. 195–198.
McClelland, M. and Welsh, J. (1995) DNA fingerprinting using arbitrarily primedPCR. In: Dieffenbach, C.W and Dveksler, G.S. (eds) PCR Primer. A LaboratoryManual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York,pp. 203–211.
McClelland, M., Mathieu-Daude, F. and Welsh, J. (1995) RNA fingerprinting anddifferential display using arbitrarily primed PCR. Trends in Genetics 11,242–246.
McDermott, J.M., Brandle, U., Dutly, F., Haemmerli, U.A., Keller, S., Muller, K.E.and Wolfe, M.S. (1994) Genetic variation in powdery mildew of barley:development of RAPD, SCAR and VNTR markers. Phytopathology 84,1316–1321.
Meksem, K., Leister, D., Peleman, J., Zabeau, M, Salamini, F. and Gebhardt, C. (1995)A high-resolution map of the vicinity of the R1 locus on chromosome V ofpotato based on RFLP and AFLP markers. Molecular and General Genetics 249,74–81.
Meyer, R.C., Hedley, P.E., Waugh, R. and Machray, G.C. (1996) Organisation andexpression of a potato (Solanum tuberosum) protein kinase gene. Plant Science118, 71–80.
Michelmore, R.W., Paran, I. and Kesseli, R.V. (1991) Identification of markers linkedto disease resistance genes by bulked segregant analysis: a rapid method to detectmarkers in specific genome regions by using segregating populations. Proceed-ings of the National Academy of Sciences USA 88, 9828–9832.
Michelmore, R.W., Kesseli, R.V., Francis, D.M., Fortin, M.G., Paran, I. and Yang,C.-H. (1992) Strategies for cloning plant disease resistance genes. In: Gurr, S.J.,McPherson, M.J. and Bowles, D.J. (eds) Molecular Plant Pathology: a PracticalApproach. IRL Press, Oxford, pp. 233–288.
Miklas, P.N., Stavely, J.R. and Kelly J.D. (1993) Identification and potential use of amolecular marker for rust resistance in common bean. Theoretical and AppliedGenetics 85, 745–749.
Mindrinos, M., Katagiri, F., Yu, G.-L. and Ausubel, F.M. (1994) The A. thalianadisease resistance gene RPS2 encodes a protein containing a nucleotide-bindingsite and leucine-rich repeats. Cell 78, 1089–1099.
Mou, L., Miller, H., Li, J., Wang, E. and Chalifour, L. (1994) Improvements to thedifferential display method for gene analysis. Biochemical and BiophysicalResearch Communications 199, 564–569.
Moukhamedov, R., Hu, X., Nazar, R.N. and Robb, J. (1994) Use of polymerase chainreaction-amplified ribosomal intergenic sequences for the diagnosis of Verti-cillium tricorpus. Phytopathology 84, 256–259.
Murphy J.M. and Walton, J.D. (1996) Three extracellular proteases from Cochlioboluscarbonum : cloning and targeted disruption of ALP1. Molecular Plant–MicrobeInteractions 9, 290–297.
Mylona, P., Moerman, M., Yang, W.-C., Gloudemans, T., van de Kerckhove, J. vanKammen, A., Bisseling, T. and Franssen, H.J. (1994) The root epidermis-specificpea gene RH2 is homologous to a pathogenesis-related gene. Plant MolecularBiology 26, 39–50.
Naqvi, N.I and Chattoo, B.B. (1996) Development of a sequence characterized
304 E. Ward et al.
amplified region (SCAR) based indirect selection method for a dominant blast-resistance gene in rice. Genome 39, 26–30.
Nicholson, P., Lees, A.K., Maurin, N., Parry, D.W. and Rezanoor, H.N. (1996)Development of a PCR assay to identify and quantify Microdochium nivale var.nivale and Microdochium nivale var. majus in wheat. Physiological and MolecularPlant Pathology 48, 257–271.
Nielsen, K.K., Bojsen, K., Roepstorff, P. and Mikkelsen, J.D. (1994) Ahydroxyproline-containing class IV chitinase of sugar beet is glycosylated withxylose. Plant Molecular Biology 25, 241–257.
Nielsen, K.K., Nielsen, J.E., Madrid, S.M. and Mikkelsen, J.D. (1996) New antifungalproteins from sugar beet (Beta vulgaris L.) showing homology to non-specificlipid transfer proteins. Plant Molecular Biology 31, 539–552.
Nikolskaya, A.N., Panaccione, D.G. and Walton, J.D. (1995) Identification of peptidesynthetase-encoding genes from filamentous fungi producing host-selectivephytotoxins or analogs. Gene 165, 207–211.
Nuovo, G.J. (1995) In situ PCR. In: Dieffenbach, C.W and Dveksler, G.S. (eds) PCRPrimer. A Laboratory Manual. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, New York, pp. 235–248.
Paran, I and Michelmore, R.W. (1993) Development of reliable PCR-based markerslinked to downy mildew resistance genes in lettuce. Theoretical and AppliedGenetics 85, 985–993.
Perkin Elmer (1995) AFLP plant mapping kit protocol (P/N 402083).Procunier, J.D., Townley-Smith, T.F., Fox, S., Prashar, S., Gray, M., Kim, W.K.,
Czarnecki, E. and Dyck, P.L. (1995) PCR-based RAPD-DGGE markers linkedto leaf rust resistance genes Lr29 and Lr25 in wheat (Triticum aestivum L.).Journal of Genetics and Breeding 49, 87–91.
Rafalski, J.A. and Tingey, S.V. (1993) Genetic diagnostics in plant breeding: RAPDs,microsatellites and machines. Trends in Genetics 9, 275–280.
Robb, E.J. and Nazar, R.N. (1996) Factors contributing to successful PCR-baseddiagnostics for potato and other crop plants. In: Marshall, G. (ed.) British CropProtection Council Monograph, No. 65. Diagnostics in Crop Production. BritishCrop Protection Council, Farnham, pp. 75–84.
Roberts, J.K. and Pryor, A. (1995) Isolation of a flax (Linum usitatissimum) geneinduced during susceptible infection by flax rust (Melampsora lini). The PlantJournal 8, 1–8.
Sambrook, J. Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A laboratoryManual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,New York.
Schachermayr, G., Siedler, H., Gale, M.D., Winzeler, H., Winzeler, M. and Keller, B.(1994) Identification and localization of molecular markers linked to the Lr9 leafrust resistance gene of wheat. Theoretical and Applied Genetics 88, 110–115.
Schaeffer, H.J., Leykam, J. and Walton, J.D. (1994) Cloning and targeted genedisruption of EXG1, encoding exo-β-1,3-glucanase, in the phytopathogenicfungus Cochliobolus carbonum. Applied and Environmental Microbiology 60,594–598.
Schafer. W. (1994) Molecular mechanisms of fungal pathogenicity to plants. AnnualReview of Phytopathology 32, 461–477.
Sharma, P., Lonneborg, A. and Stougaard, P. (1993) PCR-based construction ofsubtractive DNA library using magnetic beads. BioTechniques 15, 610–611.
Study of Fungal–Plant Interactions 305
Siebert, P.D., Chenchik, A., Kellogg, D.E., Lukyanov, K.A. and Lukyanov, S.A.(1995) An improved PCR method for walking in uncloned genomic DNA.Nucleic Acids Research 23, 1087–1088.
Simon, L., Levesque, R.C. and Lalonde, M. (1992) Rapid quantitation by PCR ofendomycorrhizal fungi conlonizing roots. PCR Methods and Applications 2,76–80.
Staub, J.E., Serquen, F.C. and Gupta, M. (1996) Genetic markers, map constructionand their application in plant breeding. Hortscience 31, 729–740.
Straus, D. and Ausubel, F.M. (1990) Genomic subtraction for cloning cDNAcorresponding to deletion mutations. Proceedings of the National Academy ofSciences USA. 87, 1889–1893.
Sun, T.-P., Goodman, H.M. and Ausubel, F.M. (1992) Cloning the Arabidopsis GA1locus by genomic subtraction. The Plant Cell 4, 119–128.
Tagu, D., Python, M., Cretin, C. and Martin, F. (1993) Cloning symbiosis-relatedcDNAs from eucalypt ectomycorrhiza by PCR-assisted differential screening.New Phytologist 125, 339–343.
Tahiri-Alaoui, A. and Antoniw, J.F. (1996) Cloning of genes associated with thecolonization of tomato roots by the arbuscular mycorrhizal fungus Glomusmosseae. Agronomie 16, 563–571.
Takenaka, S. (1995) Dynamics of fungal pathogens in host tissues. Canadian Journalof Botany 73 (Suppl. 1), S1275–S1283.
Templeton, M.D., Sharrock, K.R., Bowen, J.K., Crowhurst, R.N. and Rikkerink,E.H.A. (1994) The pectin lyase-encoding gene (pnl) family from Glomerellacingulata: Characterization of pnlA and its expression in yeast. Gene 142,141–146.
Thomas, C.M., Vos, P., Zabeau, M., Jones, D.A., Norcott, K.A., Chadwick, B.P. andJones, J.D.G. (1995) Identification of amplifed restriction fragment polymor-phism (AFLP) markers tightly linked to the tomato Cf-9 gene for resistance toCladosporium fulvum. The Plant Journal 8, 785–794.
Timmerman, G.M., Frew, T.J., Weeden, N.F., Miller, A.L. and Goulden, D.S. (1994)Linkage analysis of er-1, a recessive Pisum sativum gene for resistance topowdery mildew fungus (Erysiphe pisi D.C.) Theoretical and Applied Genetics88, 1050–1055.
Vad K., de Neergaard, E., Madriz-Ordenana, K., Mikkelsen, J.D. and Collinge, D.B.(1993) Accumulation of defence-related transcripts and cloning of chitinasemRNA from pea leaves (Pisum sativum L.) inoculated with Ascochyta pisi Lib.Plant Science 92, 69–79.
Van Etten, H., Soby, S., Wasmann, C. and McCluskey, K. (1994) Pathogenicity genesin fungi. In: Daniels, M., Downie, J.A. and Osbourn, A.E. (eds) Advances inMolecular Genetics of Plant–Microbe Interactions, Vol. 3. Kluwer, Dordrecht,pp. 163–170.
Vos, P., Hogers, R., Bleeker, M., Reijans, van de Lee, T., Hornes, M., Frijters, A., Pot,J., Peleman, J., Kuiper, M. and Zabeau, M. (1995) AFLP: a new technique forDNA fingerprinting. Nucleic Acids Research 23, 4407–4414.
Ward, E. (1994) Use of the polymerase chain reaction for identifying plant pathogens.In: Blakeman, J.P. and Williamson, B. (eds) Ecology of Plant Pathogens. CABInternational, Wallingford, pp. 143–160.
Waugh, R. and Powell, W. (1992) Using RAPD markers for crop improvement.Trends in Biotechnology 10, 186–191.
306 E. Ward et al.
Wechter W.P., Whitehead, M.P., Thomas, C.E. and Dean, R.A. (1995) Identificationof a randomly amplified polymorphic DNA marker linked to the Fom2Fusarium wilt resistance gene in muskmelon MR-1. Phytopathology 85,1245–1249.
Welsh, J. and McClelland, M. (1990) Fingerprinting genomes using PCR witharbitrary primers. Nucleic Acids Research 18, 7213–7218.
Welsh, J., Chada, K., Dalal, S.S., Ralph, D., Cheng, R. and McClelland, M. (1992)Arbitrarily primed PCR fingerprinting of RNA. Nucleic Acids Research 20,4965–4970.
Wieland, I., Bolge, G., Asouline, G. and Wigler, M. (1990) A method for differencecloning: gene amplification following subtractive hybridization. Proceedings ofthe National Academy of Sciences, USA 87, 2720–2724.
Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A. and Tingey, S.V. (1990)DNA polymorphisms amplified by arbitrary primers are useful as geneticmarkers. Nucleic Acids Research 18, 6531–6535.
Williams, J.G.K., Hanafey, M.K., Rafalski, J.A. and Tingey, S.V. (1993) Geneticanalysis using random amplified polymorphic DNA markers. Methods inEnzymology 218, 704–740.
Wu, S., Kriz, A.L. and Widholm, J.M. (1994) Molecular analysis of two cDNA clonesencoding acidic class I chitinase in maize. Plant Physiology 105, 1097–1105.
Young, N.D. (1990) Potential applications of map-based cloning to plant pathology.Physiological and Molecular Plant Pathology 37, 81–94.
Young, N.D. (1995) Isolation and cloning of plant disease resistance genes. In: Singh,R.P. and Singh, U.S. (eds) Molecular Methods in Plant Pathology. CRC Press,Boca Raton, Florida, pp. 221–234.
Xu, J. and Kasha, K.J. (1992) Transfer of a dominant gene for powdery mildewresistance and DNA from Hordeum bulbosum into cultivated barley H. vulgare.Theoretical and Applied Genetics 84, 771–777.
Zhu, Q., Dabi, T., Beeche, A., Yamamoto, R., Lawton, R. and Lamb, C. (1995)Cloning and properties of a rice gene encoding phenylalanine amonia-lyase.Plant Molecular Biology 29, 535–550.
Zimmermann, K. and Mannhalter, J.W. (1996) Technical aspects of quantitativecompetitive PCR. BioTechniques 21, 268–279.
Study of Fungal–Plant Interactions 307
PCR as a Tool for theInvestigation of Seed-borneDisease
D.A. Pearce
Division of Terrestrial and Freshwater Life Sciences, British AntarcticSurvey, High Cross, Madingley Road, Cambridge CB3 0ET, UK
14.1 Introduction to Seed-borne Disease
Seed-borne diseases are defined as diseases which have one or more stages oftheir life cycle associated with the seed. For example, nearly all the majorfungal pathogens of rice have been reported to be seed-borne. The range oforganisms infecting seed is extensive (Tables 14.1–14.3). However, very littleis known about the role and importance of seed-borne fungal inoculum inthe dissemination and development of even the most common diseases.Ninety per cent of all food crops are propagated by seed, and the nine mostwidely grown crops in world agriculture (wheat, sugar beet, rice, maize,barley, groundnut, soybean, common (Phaseolus) bean and sorghum), are allaffected by seed-borne diseases.
The importance of seed as a vector of a range of diseases is wellestablished (Neergaard, 1977), and there is a significant economic impact ofseed-borne disease, particularly in under-developed countries where routinechemical treatment of seed is prohibitively expensive, and individual farmerscan suffer huge yield reductions. For example, an average 4% overall croploss of the wheat harvest in the US could include individual farmers’ lossesof over 80% in an infected field. Similarly, an average 2% overall crop lossof the rice harvest in the Philippines could include individual farmers lossesof over 58% in an infected field.
Seed diseases and seed-borne diseases can be caused by a number of differ-ent factors: microorganisms (including viruses, bacteria, fungi and nematodes),physiological factors (including nutrient deficiency, growth in an unsuitableenvironment, phytotoxicity, ageing and congenital disorders) and mechanicalfactors (due to processing or handling equipment and insect injury).
14
© CAB INTERNATIONAL 1998. Applications of PCR in Mycology(eds P.D. Bridge, D.K. Arora, C.A. Reddy and R.P. Elander) 309
Table 14.1. Relative frequency of different organisms asseed-borne pathogens (Richardson, 1996).
No. %
Fungi 915 72Bacteria 111 9Viruses and viroids 238 19Nematodes 13 1
Table 14.2. Major seed-borne organisms prevalent in Nepal (Rajbhandary and Shrestha,1992).
Host Causal agent DiseaseLoss(%)
Rice Alternaria padwickii Pink kernelBipolaris oryzae Brown spot 5–20Pyricularia oryzae Blast 10–30Xanthomonas campestris pv.
oryzaeBacterial blight 10–25
Wheat Alternaria alternata Black pointBipolaris sorokiniana Brown spotTilletia caries Bunt <5T. laevis Bunt <5T. indica Karnal buntUstilago tritici Loose smut 5–10
Maize Bipolaris maydis Leaf blight 10–20B. turcicum Leaf blight 10–20Fusarium moniliforme Kernel rot 10–30
Crucifers Alternaria brassicae Leaf spot 5–20A. brassicicola Leaf spot 5–20Sclerotinia sclerotiorum Stalk rot 5–15Xanthomonas campestris pv.
campestrisBlack rot 10–30
Soybean Cercospora kikuchi Purple seed stainColletotrichum dematium AnthracnoseSoybean mosaic virus Hilum bleeding
310 D.A. Pearce
With the increasing distribution of germplasm between researchers andcountries, it is important that germplasm banks and international trade donot harbour and distribute seed-borne pathogens, as fungal pathogens cantravel on, in or with seed batches. Major plant diseases that have been spreadaround the world through trade (though not necessarily in seed) includepowdery mildew (on grapes), citrus canker, potato wart, wheat flag smut andDutch elm disease. In order to reduce such transmission routes, safeguardshave been introduced to prevent the spread of pests and pathogens whileallowing safe, uninterrupted seed movement. These safeguards vary widelyfrom country to country, but include rules and regulations, import permits,phytosanitary certificates, inspections, treatments, isolation, passage throughquarantine greenhouses and seed health testing. Seed health tests seek toestablish the presence of a pathogen in the seed and to make an estimate ofthe extent of this infection within the seedlot (Reeves, 1995).
Table 14.3. Important seed-borne fungal pathogens in Nepal (Manandhar et al., 1992).
Genus of pathogenTotal
speciesTotalhosts
Pathogen species ofeconomic importance Host
Alternaria 11 35 A. brassicae and A.brassiacola
Crucifers
A. padwickii RiceA. triticina Wheat
AspergillusBipolaris
2 17 A. flavus andB. oryzae
Groundnut, maizeRice
B. sorokiniana WheatBotryodiplodia 1 1 B. theobromiae MaizeBotrytis 1 3 B. cinerea ChickpeaCercospora 2 2 C. kikuchii Soybean
C. oryzae RiceColletotrichum 3 5 C. capsici Chilli
C. Iindemuthianum BeansC. truncatum Soybean
Diplodia 1 1 D. maydis MaizeDrechslera 12 16 D. tritici-repentis WheatFusarium 9 33 F. moniliforme Rice and maize
F. oxysporum LegumesPhoma 1 9 P. glumarum RiceProtomyces 1 1 P. macrosporus CorianderPyricularia 2 2 P. oryzae RiceTilletia 3 2 T. indica, T. laevis and
T. triticiWheat
Ustilaginoidea 1 1 U. virens RiceUstilago 3 3 U. maydis Maize
Investigation of Seed-borne Disease 311
14.2 Problems Encountered in the Study of Seed-borneDisease
Imported seed and the transport of plant varieties from one geographicalregion or ecological zone to another is increasing, and this practice mayintroduce new diseases where they had not been encountered previously.Seed-borne inoculum may give rise to progressive disease development in thecrop, and symptoms of disease may not be apparent immediately in thegerminating seed. The causes of poor germination are often not identified byfarmers and this is further complicated by the fact that the incidence of fungalinfection of seed is not necessarily translated into subsequent incidence ofdisease. Seed that is infested with a fungal pathogen may be discoloured andpoorly filled and thus have a poor market value, and seed that appearshealthy may harbour low populations of the pathogen that later serve as aninoculum source. Little work has been undertaken to date to determine therelative significance of different sources of inoculum in disease developmentfor even the most widely grown crops. It is, therefore, important to: (i)understand the structure of fungal populations; (ii) determine whetherindividual strains can be identified; (iii) determine how quickly the patho-genic strains adapt to their plant hosts; (iv) determine how rapidly they mightadapt to changes in the cultivars grown; and (v) ascertain whether alternativehosts are significant to the life cycle or to disease dissemination. There arealready relatively straightforward methods to differentiate between differentspecies in a pathogen complex but it remains particularly difficult todifferentiate between virulent and non-virulent strains of the same pathogenspecies.
14.3 Methods Available in the Study of Seed-borne Disease
Traditional methods in the recognition and detection of seed-borne organ-isms include: (i) direct observation; (ii) microscopic examination of imbibedseeds; (iii) examination of cultured organisms removed by washing; (iv)examination of seed after incubation (including the blotter test and the agarplate test); and (v) examination of growing plants (‘growing-on’ test). Eachof these requires three steps: extraction, isolation and identification (Reeves,1995). Such methods can be adapted to discriminate between particularspecies through exploitation of nutritional requirements. For example,Gnanamanickam et al. (1994) used selective media to detect Xanthomonasoryzae pv. oryzae in rice seed. However, despite the semi-selectivity of themedia chosen, the sensitivity of the seed assay remained inadequate becauseeven the faster growing X. o. oryzae strains were not recovered unless presentin relatively high concentrations (2 × 105 to 1 × 106 c.f.u. ml–1) in the seedextract. Detection of seed-borne X. o. oryzae on semi-selective media hasbeen a challenge because the pathogen grows very slowly, and growth is
312 D.A. Pearce
suppressed by contaminating bacteria found on seed. The more traditionalmethods suffer the disadvantage that they are slow and the sensitivity andaccuracy of diagnosis can be a problem.
The last decade has seen great advances in diagnostic technology,especially in the development of rapid and sensitive methods (Pearce andHolderness, 1996; Richardson, 1996). Recently, there has been a change inemphasis from a more traditional morphological approach to identificationof plant pathogens (for example, spore size, shape and colony colour) to amore functional approach based on aspects of the life cycle (for example,mechanism of spore production, DNA relationships and physiologicalattributes). This has come about firstly through immunodetection techniques(including polyclonal antisera and monoclonal antibodies, enzyme-linkedimmunosorbent assay (ELISA) and immunofluorescence microscopy), andthen methods currently in use and under development for the differentiationof different strains of filamentous fungi, which include the use of secondarymetabolites, mycotoxins/antibiotics, protein electrophoresis, isoenzymeelectrophoresis, fatty acid analysis (Paterson and Bridge, 1994) and DNA-based technology. DNA-based methods have included restriction fragmentlength polymorphism (RFLP) and pulse-field gel electrophoresis (PFGE)methods (Kasuga et al., 1993), and PCR amplification of various genomeregions including rRNA genes and random amplified polymorphic DNA(RAPD) (Schots et al., 1994).
Ball and Reeves (1991, 1992) reviewed the use of ELISA, PCR, RAPDand similar methods to identify pathogens on seed, but the effort to datehas been concentrated on the detection of bacteria and viruses. There iscurrently much effort being devoted to the further development of suchtechniques; Slack et al. (1996) have prepared a comparison of PCR, ELISA,and DNA hybridization for the detection of Clavibacter michiganensissubsp. sepedonicus in field-grown potatoes. Seed-borne organisms, how-ever, can provide particular problems not necessarily encountered withorganisms in pure culture. For example, RAPD cannot be used directlyto detect seed-borne organisms because of non-specific hybridization ofthe primer which may occur with extraneous DNA from seed extracts(Reeves, 1995), and although PCR techniques have been used for thecharacterization and identification of fungi, little attention has been givento the detection of seed-borne pathogens (Reeves, 1995). Lange (1986)examined nucleic acid techniques for the detection of seed-borne viruses,and their use for the detection of plant pathogenic bacteria (Rasmussenand Reeves, 1992) and seed-borne diseases (Reeves, 1995) has beenreviewed. Blakemore et al. (1994), by testing fungi isolated from seeds,noted that such methods are not yet at a stage for incorporation into seedhealth tests, but because of their high sensitivity, these techniques willcontinue to be used to detect microorganisms which are difficult to cultureor difficult to identify.
Investigation of Seed-borne Disease 313
14.4 PCR Methods Available for the Study of Seed-borneDiseases
The ability to amplify DNA from crude mycelial preparations is animportant factor in the identification of filamentous fungi from plantmaterial, as is the ability of the PCR reaction to use small amounts ofmaterial and even partly degraded materials of poor quality. Due to thesefeatures many potential sources of fungi can be used, such as unpurifiedgenetic material or material taken directly from soil, growing mycelia,museum specimens and spores (Foster et al., 1993). The first stage in theanalysis of seed-borne organisms is the culture of the organism from theseed; this is necessary, because PCR can detect dead bacteria and fungiwhich would not be a problem in seed. Where only one organism ispresent, or where a species-specific test is to be used, this can beundertaken in small volumes (500 µl) of a rich liquid growth medium over72 h at 30°C. DNA can then be extracted using a range of differenttechniques including that of rapid extraction (Cenis, 1992; Raeder andBroda, 1985; Zolan and Pukilla, 1986). Specific DNA fragments can beamplified by PCR and products separated by gel electrophoresis. Bandingpatterns can be used to distinguish between species or varieties (Ball andReeves, 1991). PCR can be carried out with RAPD primers (Williams etal., 1990); these are very short primers, not having identified DNAsequences, and usually 8–12 bases long (Caetano Anolles et al., 1992) whichwill hybridize to a large number of arbitrary sites in the genome (Fox,1993). RAPD bands aid identification where this is primarily difficult.Examples are shown in Figs 14.1 and 14.2.
Higher specificity than that obtained with RAPD can be achieved byusing variable non-translated repeat (VNTR)-derived oligonucleotides asPCR primers. This molecular method for differentiating fungal populations,and for differentiating between isolates, has been widely established andtested in the field (for example, see Bridge et al. 1997 and Pearce et al. 1996).Representative oligonucleotide primers can be selected to give either a highor a low discrimination between strains. Amplification products obtainedfrom a range of isolates can then be used to group different strains of the samespecies. Following initial work with Sarocladium oryzae and Bipolaris oryzae(Fig. 14.3), the method has been tested against other common rice pathogensincluding Gerlachia oryzae, Fusarium moniliforme, Pyricularia oryzae andRhizoctonia solani (Bridge et al., 1997; Pearce et al., 1996).
PCR-based methods have also been used in the investigation of air-bornespread of fungal pathogens. For example, a PCR-based method has beendeveloped for the identification of Tilletia indica, the causal agent of Karnalbunt of wheat (Smith et al., 1996). Oligonucleotide primers were designedfrom a sequence derived from cloned DraI fragments of mitochondrialDNA and were used to analyse teliospores which had been germinated froma seed wash extraction method of infested grain. The results demonstrated
314 D.A. Pearce
that T. indica could be reliably detected at an infestation level of fiveteliospores per 50 g grain.
Fig. 14.1. Banding patterns obtained from Sarocladium oryzae from RAPD primers.Panel A : the first nine horizontal lanes show banding patterns for DNA from nine differentstrains amplified using primer A11. The next ten lanes show patterns from ten isolatesamplified using primer no. 71. The last lane shows the molecular size markers. Panel B : thefirst nine horizontal lanes show DNA from nine isolates amplified using primer A13, lane10 shows one isolate amplified using primer A14, and lane 11 shows one isolate usingprimer A13. The next seven were amplified using primer A14. The last lane shows themolecular size markers.
Investigation of Seed-borne Disease 315
14.5 Applications of PCR in the Analysis of Seed-borneDisease
14.5.1 Fungi
The utility of PCR as a specific and sensitive assay for plant pathogenidentification is well documented (Henson and French, 1993; Smith et al.,1996). PCR and its applications in fungal disease diagnosis have also beendescribed on many occasions (for example, Annamalai et al., 1995). PCR hasalso been shown to be a useful tool in the assessment of seed-borneinoculum, in measuring seed-borne inoculum potential, the extent oftransmission from seed to crop, the extent and intensity of disease in the cropand seed-borne inoculum in relation to yield reduction and crop losses(Pearce and Holderness, 1996). PCR methods have been used in numerousother studies for identifying fungal pathogens from seed, including the
Fig. 14.2. Panel A : isolates of Bipolaris oryzae amplified with one of three RAPD primers.Size markers are shown in lane 2. Panel B : ten isolates of Bipolaris oryzae amplified withtwo RAPD primers. Size markers are shown in lane 3.
316 D.A. Pearce
detection of Pyrenophora species, Fusarium moniliforme, Stenocarpellamaydis, and the Phomopsis/Diaporthe complex (see Blakemore et al., 1994).A PCR-based method has been developed for the identification of Tilletiaindica, causal agent of Karnal bunt of wheat, in seed wash (Smith et al., 1996)and to develop an assay to detect Fusarium poae in wheat (Parry andNicholson, 1996). The latter assay was highly sensitive; it was capable ofdetecting F. poae at less than 1% seed infestation and it overcame problemsof conventional isolation methods such as competition from other fungi. Thekey advantage here is that the method can detect specific pathogens in thepresence of more aggressive species.
Fig. 14.3. Eight isolates of Sarocladium oryzae and eight isolates of Bipolaris oryzaetested with VNTR primers. Panel A : Primer GF, S. oryzae lanes 1–3, 7–9 and 11.B. oryzae lanes 4 and 5 and 12–17. Size markers are shown in lane 6. Panel B : Primer RY,S. oryzae lanes 1, 5 and 6. B. oryzae lanes 2–4, 7–11 and 17. Size markers are shown inlane 2.
Investigation of Seed-borne Disease 317
14.5.2 Other pathogens
PCR has been used in studies identifying other pathogens from seedincluding the detection of Pseudomonas syringae pv. pisi (Rasmussen andWulff, 1990), the halo blight bacterium Pseudomonas syringae pv. phaseoli-cola in phaseolus bean seeds (Prosen et al., 1991; Tourte and Manceau, 1991),and in the recognition and detection of the Xanthomonas pathogens thatcause cereal leaf streak in seed.
Maes et al. (1996) have suggested that PCR-based techniques could beuseful for the identification of bacteria in seed, and Bariana et al. (1994) havedeveloped a method for detection of five seed-borne legume viruses in onesensitive multiplex PCR test. PCR has been used to develop a rapid andsensitive colorimetric detection of Xanthomonas axonopodis pv. citri byimmunocapture and a nested-PCR (Hartung et al., 1996).
14.6 Limitations of the PCR Method
The PCR method has a great deal of potential in seed pathology, but thereare also a number of problems and limitations associated with its use.Limitations of PCR reactions described elsewhere in this book will alsoapply to the study of seed pathology. In particular, there are a number ofvariables within the PCR itself which must be optimized for each primer–species combination. The dNTP concentration must be optimized andincreasing the MgCl2 concentration from 1 to 10 mmol l–1 can have adramatic effect on the specificity and yield of the amplification (Saiki, 1990).Studies with Bipolaris and Sarocladium oryzae isolated from rice seed Oryzasativa have shown that there can be both an increase and a decrease in thenumber of VNTR bands produced when the annealing temperature is raisedfrom 35 to 47°C (Bridge et al., 1997; D.A. Pearce unpublished work). Highprimer concentrations can promote mispriming and the accumulation ofnon-specific PCR products when different buffers are used. Other variableswhich require optimization include cycle temperatures and durations, primerconcentration and sample concentration and purity. Such problems arecompounded when the reaction mixture becomes more complicated, forexample, Bariana et al. (1994) stated that the multiplex assay was less robustand required very specific conditions. As several factors all affect thespecificity and efficiency of DNA amplification, optimization is essential.No single protocol will be suitable for all applications, and each new PCRapplication will require optimization.
The problems associated with PCR reactions in terms of consistency andaccuracy of consecutive reactions require the preparation of adequatecontrols for each PCR run. Such controls should include a strain with aknown banding pattern (from a previous run) and an internal positive controlto ensure that a negative result is not the result of failure of the PCR reaction,such as may be caused by inhibitors in the sample extract. It is also important
318 D.A. Pearce
in seed pathology to conduct some form of pathogenicity test to back up thedata. This is important, as the PCR reaction works equally well for dead andfor living material, and so may amplify plant DNA. Virulence analysis andpathogenicity testing can also determine whether the increased occurrence ofa particular strain is due to increased transmission in the seed or to a highervirulence. Care must be taken to prevent extraneous DNA from contaminat-ing the reaction. All stock solutions must be fresh and sterile, and thepossibility of carry-over contamination must be minimized.
Interference may occur at two stages of the strain analysis, either at theextraction stage when the fungus is isolated from the seed or in the PCRreaction mixture. An example of interference at the extraction stage is givenby Gnanamanickam et al. (1994) who experienced problems in the detectionof Xanthomonas oryzae pv. oryzae in rice seed. In this case direct isolationfrom seed is difficult, because X. o. oryzae grows slowly on media and doesnot compete with faster growing contaminant bacteria that may show similarcolony characteristics and pigmentation. An example of interference at theamplification stage is where the PCR method is most effective with purifiedDNA but also works with crude preparations; crude DNA samples fromseed may contain large amounts of extraneous DNA and this could result inconsiderable non-specific hybridization with primer DNA (Vivian, 1992).During multiplex PCR, it is important to select primers which do not annealto each other; where a mixture of genomic DNA from two different fungi isused as template for different primers, competition between the twoamplicons can cause inconsistent results. Chemicals from the environment,or other components of the seed/plant tissue, may interfere with the PCR.Hartung et al. (1996) found that a nested PCR improved the sensitivity fromthe single-stage PCR approximately 50- to 160-fold. However, they alsofound that the addition of citrus extracts and copper (used in leaf sprays)inhibited nested PCR amplification of Xanthomonas axonopodis pv. citri.
A number of studies have been conducted to determine the reproducibil-ity of PCR in differentiating fungal populations. For example, Slack et al.(1996) compared PCR, ELISA and DNA hybridization for the detection ofClavibacter michiganensis subsp. sepedonicus in field-grown potatoes. Theyfound that the results of each assay were significantly affected by inoculumdose, cultivar and sampling date. Of the inoculated samples 36.2, 35.8 and29.1% tested positive by PCR, ELISA and DNA respectively.
14.7 Further Method Development
A current major disadvantage in the use of nucleic acid methods in seedhealth testing is that of quantification (Reeves, 1995) because it is not yetpossible to determine the number of infected seeds in a batch, and there is aneed to link presence per se with a measurement of potential future diseaseincidence. Colhoun (1983) has considered the need to be able to measure the
Investigation of Seed-borne Disease 319
inoculum load on individual seeds in order to calculate threshold levels forseed health tests.
The choice of primers is important and can be improved, as it issuggested that primers with longer sequences of bases (up to about 20) areless likely to be present at random, even in the large genomes of plants (Fox,1993) and will, therefore, achieve specific hybridizations.
Numerous minor manipulations can be made to the reaction process, inorder to increase processing speed and to increase accuracy. For example, theuse of cell lysates instead of extracted DNA obviates the DNA extractionstep, inactive primers which are activated by the first denaturation stepprevent primer dimers from forming and computer analysis packages, forexample GELCOMPAR, can speed interpretation of results.
Vera-Cruz et al. (1996) have used repetitive extragenic palindromic(REP)-PCR and RFLP analysis to measure haplotypic variation in X. oryzaepv. oryzae within a single field. Their technique involved the analysis of thegenomic structure of the field population by repetitive sequence-based PCR,with oligonucleotide primers corresponding to interspersed repeatedsequences in prokaryotic genomes and RFLP with the insertion sequenceIS1113. REP-PCR involves the use of specific primers (BOX, ERIC, ERIC2,REP and REP2). Competitive PCR may allow some degree of quantificationof pathogens present in seed batches (Nicholson et al., 1993).
Amplified fragment length polymorphism (AFLP) may provide greaterspecificity and reliability, as would DNA probes that can be obtained byexcising species-specific bands from a gel (Blakemore et al., 1992). Specificprimers, obtained by sequencing such a band, could be used to develop aPCR-based test and provide a means of accurate identification and sensitive,rapid detection.
The internal transcribed spacer (ITS) of the ribosomal DNA (rDNA)subunit repeat was sequenced in representative isolates of Cylindrocladiumfloridanum and Cylindrocarpon destructans (Hamelin et al., 1996). Thesesequences were aligned and compared with ITS sequences of other fungi inthe GenBank database. Two internal primers were then synthesized for thespecific amplification of portions of the ITS regions of each of the species.These products were then used to develop a test in which species-specificfragments were amplified directly from infected roots from which one or twoof the fungi had been isolated. ITS regions evolve rapidly, and may varyamong species within a genus or among populations.
Nested PCR, in which a second round of PCR using primers internal tothose of the first round is performed (Schesser et al., 1991), may be used toovercome non-specific amplification products from other organisms andfrom host tissues. Multiplex PCR would allow simultaneous testing for morethan one organism by the use of mixtures of primers which are specific forindividual organisms. Ligase chain reaction (LCR), like PCR, is a DNAamplification system that is highly specific and very sensitive (Lee, 1993) andeven a single mismatch can prevent the reaction. High specificity has,
320 D.A. Pearce
however, meant that it has not yet been used in plant pathology (Reeves,1995).
14.8 Future Potential for the Study of Seed-borne Disease
There is a wide range of potential applications of PCR methodology inthe analysis of seed-borne disease transmission. The potential exists forthe use of the PCR method with washings from seed samples (Vivian,1992) and without the need for extraction and isolation of the organism(Ball and Reeves, 1991). The revision of species concepts in individualpathogen populations is also being enhanced by the use of such moleculartechniques.
Factors limiting the transmission of seed-borne disease can beenhanced in order to reduce disease transmission and enhance yield. Inorder to do this, it is important to know exactly what influence thealteration of cultural practices is having on the seed-borne element oftransmission. These factors could include the impact of climate, storage,seed crop management, location of production, adjustment of culturalpractices, chemical protection, protective inoculation, seed treatment andseed health testing (Misra et al., 1995). Disease management can involvethe adjustment of sowing dates, deep ploughing, balancing host nutrition,intercropping, management of pollen and removal of collateral hosts.Control and monitoring of seed exchange can prevent the spread ofpathogens limited to a small area. Other parts of the cropping cycle whichcan be exploited for disease management include: storage practices, thenumber of crops grown per year or the order of crops, climate, plantingmethod, seed treatment and plant density.
PCR is, therefore, a useful tool for the investigation of seed-bornedisease. PCR can be used in plant pathology to understand the structure offungal populations, of both pathogens and their non-pathogenic antagonists,determine whether individual races exist; for example, is the Sarocladiumoryzae that infects rice (Oryzae sativa) the same pathogen that attacksBamboo (Bambusa spp.) or is it a different species? (See Bridge et al., 1989.)PCR methods may allow pathologists to determine how quickly a particularpathogen is evolving, or adapting to a new host or cultivar, and whetheralternative hosts are significant to the pathogen life cycle or diseasedissemination.
References
Amatya, P., Dahal, G. and Manandhar, H.K. (1992) Plant pathology in Nepal. In:Mathur, S.B., Amatya, P., Shrestha, K. and Manandhar, H.K. (eds) Plant Diseases,Seed Production and Seed Health Testing in Nepal. Proceedings of the
Investigation of Seed-borne Disease 321
first HMG/DANIDA/FAO training course in seed health testing techniques.DGISP, Denmark.
Annamalai, P., Ishii, H., Lalithakumari, D. and Revathi, R. (1995) Polymerase chainreaction and its applications in fungal disease diagnosis. Zeitschrift fur Pflanzen-krankheiten und Pflanzenschutz 102(1), 91–104.
Ball, S.F.L. and Reeves, J.C. (1991) The application of new techniques in the rapidtesting for seed-borne pathogens. Plant Varieties and Seeds 4, 169–176.
Ball, S. and Reeves, J. (1992) Appication of rapid techniques to seed health testing –prospects and potential. In: Duncan, J.M. and Torrance, L. (eds) Techniques forthe Rapid Detection of Plant Pathogens. Blackwell Scientific Publications,Oxford. pp. 193–207.
Bariana, H.S., Shannon, A.L., Chu, P.W.G. and Waterhouse, P.M. (1994) Detection offive seedborne legume viruses in one sensitive multiplex polymerase chainreaction test. Phytopathology 84(10), 1201–1205.
Blakemore, E.J.A., Reeves, J.C. and Ball, S.F.L. (1992) Research note: polymerasechain reaction used in the development of a DNA probe to identify Erwiniastewartii, a bacterial pathogen of maize. Seed Science and Technology 20,331–335.
Blakemore, E.J.A., Jaccoud Filho, D.S. and Reeves, J.C. (1994) PCR for the detectionof Pyrenophora species, Fusarium moniliforme, Stenocarpella maydis, and thePhomopsis/Diaporthe complex. In: Schots, A., Dewey, F.M. and Oliver, R. (eds)Modern Assays for Plant Pathogenic Fungi: Identification, Detection andQuantification. CAB International, Wallingford, UK, pp. 205–213.
Bridge, P.D., Hawksworth, D.L., Kavishe, D. and Farnell, P.A. (1989) A revision ofthe species concept in Sarocladium, the causal agent of sheath-rot in rice andbamboo blight, based on biochemical and morphometric analyses. PlantPathology 38, 239–245.
Bridge, P.D., Pearce, D.A., Rivera, A. and Rutherford, M.A. (1997) VNTR derivedoligonucleotides as PCR primers for population studies in filamentous fungi.Letters in Applied Microbiology 24, 421–425.
Caetano Anolles, G., Bassam, B.J. and Gresshoff, P.M. (1992) Primer–templateinteractions during DNA amplification fingerprinting with single arbitraryoligonucleotides. Molecular and General Genetics 235, 157–165.
Cenis, J.L. (1992) Rapid extraction of fungal DNA for PCR amplification. NucleicAcids Research 20, 2380.
Colhoun, J. (1983) Measurement of inoculum per seed and its relationship to diseaseexpression. Seed Science and Technology 11, 665–671.
Foster, L.M., Kozak, K.R., Loftus, M.G., Stevens, J.J. and Ross, I. (1993) Thepolymerase chain reaction and its application to filamentous fungi. MycologicalResearch 97, 769–781.
Fox, R.T.V. (1993) Principles of Diagnostic Techniques in Plant Pathology. CABInternational, Wallingford.
Gnanamanickam, S.S., Shigaki, T., Medalla, E.S. and Mew, T.W. (1994) Problems indetection of Xanthomonas oryzae pv. oryzae in rice seed and potential forimprovement using monoclonal antibodies. Plant Disease 78, 173–178.
Hamelin, R.C., Berube, P., Gignac, M. and Bourassa, M. (1996) Identification of rootrot fungi in nursery seedlings by nested multiplex PCR. Applied and Environ-mental Microbiology 62 (11), 4026–4031.
Hartung, J.S., Pruvost, O.P., Villemot, I and Alvarez, A. (1996) Rapid and sensitive
322 D.A. Pearce
colorimetric detection of Xanthomonas axonopodis pv. citri by immunocaptureand a nested-polymerase chain reaction assay. Phytopathology 86, 95–101.
Henson, J.M. and French, R. (1993) The polymersae chain reaction and plant diseasediagnosis. Annual Review of Phytopathology 31, 81–109.
Kasuga, T., Woods, C., Woodward, S. and Mitchelson, K.R. (1993) Heterobasidionannosum 5.8S ribosomal DNA and internal transcribed spacer sequence: rapididentification of European intersterility groups by ribosomal DNA restrictionpolymorphism. Current Genetics 24, 433–436.
Lange, L. (1986) The practical application of new developments in test proceduresfor the detection of viruses in seed. Developments in Applied Biology 1,269–281.
Lee, H. (1993) Infectious disease testing by ligase chain reaction. Clinical Chemistry39, 729–730.
Maes, M., Garbeva, P. and Kamoen, O. (1996) Recognition and detection in seed ofthe Xanthomonas pathogens that cause cereal leaf streak using rDNA spacersequences and polymerase chain reaction. Phytopathology 86, 63–69.
Manandhar, H.K., Shrestha, K. and Amatya, P. (1992) Seed-borne fungal diseases. In:Mathur, S.B., Amatya, P., Shrestha, K. and Manandhar, H.K. (eds) Plant Diseases,Seed Production and Seed Health Testing in Nepal. Proceedings of the firstHMG/DANIDA/FAO training course in seed health testing techniques.DGISP, Denmark.
Misra, J.K, Gergon, E.B. and Mew, T.W. (1995) Storage fungi and seed health of rice:a study in the Philippines. Mycopathologia 131, 13–24.
Neergaard, P. (1977) Seed Pathology. Macmillan Press, London.Nicholson, P., Rezanoor, H.N. and Su, H. (1993) Use of random amplified
polymorphic DNA (RAPD) analysis and genetic fingerprinting to differentiateisolates of race O, C and T of Bipolaris maydis. Journal of Phytopathology 139,261–267.
Parry, D.W. and Nicholson, P. (1996) Development of a PCR assay to detect Fusariumpoae in wheat. Plant Pathology 45, 383–391.
Paterson, R.R.M. and Bridge, P.D. (1994) Biochemical Techniques for FilamentousFungi. CAB International, Wallingford.
Pearce, D.A. and Holderness, M. (1996) Methods of identification for fungi. PlanningWorkshop on Seed Health for Disease Management, International Rice ResearchInstitute, Los Banos, Laguna, The Philippines, January 22–25.
Prosen, D., Hatziloukas, E., Panopoulos, N.J. and Schaad, N.W. (1991) Directdetection of the halo blight pathogen Pseudomonas syringae pv. phaseolicola inbean seeds by DNA amplification. Phytopathology 81, 1159 (abstract).
Raeder, U. and Broda, P. (1985) Rapid preparation of DNA from filamentous fungi.Letters in Applied Microbiology 1, 17–20.
Rajbhandary, K.L. and Shrestha, K. (1992) Plant diseases in seed production. In:Mathur, S.B., Amatya, P., Shrestha, K. and Manandhar, H.K. (eds) Plant Diseases,Seed Production and Seed Health Testing in Nepal. Proceedings of the firstHMG/DANIDA/FAO training course in seed health testing techniques.DGISP, Denmark.
Rasmussen, O.F. and Reeves, J.C. (1992) DNA probes for the detection of plantpathogenic bacteria. Journal of Biotechnology 25, 203–220.
Rasmussen, O.F. and Wulff, B.S. (1990) Detection of Pseudomonas syringae pv. pisiusing PCR. In: Durbin, R.D., Surico, G. and Mugnai, L. (eds) Proceedings 4th
Investigation of Seed-borne Disease 323
International Working Group on Pseudomonas syringae Pathovars. StamperiaGranducale, Florence, pp. 369–376.
Reeves, J.C. (1995) Nucleic acid techniques in testing for seed-borne diseases. In:Skerritt, J.H. and Appels, R. (eds) New Diagnostics in Crop Sciences. CABInternational, Wallingford.
Richardson, M.J. (1996) Seed mycology – centenary review. Mycological Research100(4), 385–392.
Saiki, R.K. (1990) Amplification of genomic DNA. In: Innis, M.J., Gelfand, D.H.,Sninsky, J.J. and White,T.J. (eds) PCR Protocols: a Guide to Methods andApplications. Academic Press, New York, pp. 13–20.
Schesser, K., Luder, A. and Henson, J.M. (1991) Use of polymerase chain reaction todetect the take-all fungus Gaeumannomyces graminis, in infected wheat plants.Applied and Environmental Microbiology 57, 553–556.
Schots, A., Dewey, F.M. and Oliver, R. (1994) Modern Assays for Plant PathogenicFungi: Identification, Detection and Quantification. CAB International, Wall-ingford.
Slack, S.A., Drennan, J.L. and Westra, A.A.G. (1996) Comparison of PCR, ELISAand DNA hybridization for the detection of Clavibacter michiganensis subsp.sepedonicus in field-grown potatoes. Plant Disease 80, 519–524.
Smith, O.P., Peterson, G.L., Raymond, J.B., Schaad, N.W. and Bonde, M.R. (1996)Development of a PCR-based method for identification of Tilletia indica, causalagent of Karnal bunt of wheat. Phytopathology 86, 115–122.
Tourte, C. and Manceau, C. (1991) Direct detection of Pseudomonas syringaepathovar phaseolicola using the polymerase chain reaction (PCR) In: Durbin,R.D., Surico, G. and Mugnai, L. (eds) Proceedings 4th International WorkingGroup on Pseudomonas syringae Pathovars. Stamperia Granducale, Florence,pp. 377–379.
Vera-Cruz, C.M., Ardales, E.Y., Skinner, D.Z., Talag, J., Nelson, R.J., Louws, F.J.,Leung, H., Mew, T.W. and Leach, J.E. (1996) Measurement of haplotypicvariation in Xanthomonas oryzae pv. oryzae within a single field by rep-PCR andRFLP analyses. Phytopathology 86, 1352–1359.
Vivian, A. (1992) Identification of plant pathogenic bacteria using nucleic acidtechnology. In: Duncan, J.M. and Torrance, L. (eds) Techniques for the RapidDetection of Plant Pathogens. Blackwell Scientific Publications, Oxford,pp. 145–161.
Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A. and Tingey, S.V. (1990)DNA polymorphisms amplified by arbitrary primers are useful as geneticmarkers. Nucleic Acids Research 18, 6531–6535.
Zolan, M.E. and Pukilla, P.J. (1986) Inheritance of DNA methylation in Coprinuscinerus. Molecular and Cellular Biology 6, 195–200.
324 D.A. Pearce
Future Directions for PCR inMycology
S. Sreenivasaprasad and P.R. Mills
Department of Plant Pathology and Microbiology, HorticultureResearch International, Wellesbourne, Warwickshire, CV35 9EF, UK
15.1 Introduction
Polymerase chain reaction (PCR)-based amplification of target nucleic acidswas conceived by Kary Mullis in California in 1983 (Mullis, 1990). To dateit is estimated that since the first publication in 1985 there have been over40,000 references to PCR (White, 1996). Over the last decade PCR hasbecome one of the most important and powerful tools in molecular biology.Two crucial technological developments – the introduction of thermostableDNA polymerases and automated thermal cyclers – have led to the commonuse of PCR for research and diagnostic purposes. Considerable effort isunderway to make the PCR technology more robust, cost effective and userfriendly.
In this chapter, some of the recent developments in amplification anddetection technologies, the currently available diagnostic PCR kits, futureapplications of PCR in mycology and perspectives are discussed. A numberof PCR based applications (Table 15.1) are currently used routinely by manylaboratories and will not be covered in detail here. Further information onthese techniques can be obtained from other reviews (Erlich and Arnheim,1992; Foster et al., 1993).
15.2 Molecular Ecology, Epidemiology and Strain Typing
Integration of genetic markers with biological traits has helped to addressquestions on mating systems, origin of strains, gene flow, and host–parasiteand symbiotic interactions. RFLP-based markers have been used extensively
15
© CAB INTERNATIONAL 1998. Applications of PCR in Mycology(eds P.D. Bridge, D.K. Arora, C.A. Reddy and R.P. Elander) 325
for this purpose. Recently, PCR technology has enabled rapid strides to betaken in this area. PCR-based multilocus genotyping is likely to resolvequestions such as the enhanced virulence or transmissibility of strains andalso the complexity of the pathogen population of a disease outbreak. Forexample, multilocus genotyping (arbitrarily primed PCR) of the asexualhuman fungal pathogen Coccidioides immitis revealed that the haploidorganism was completely recombining, within geographically isolated pop-ulations, even though no sexual stage had been recorded (White, 1996). Suchdata can be used to trace the geographic origin of an infection/pathogen. Inagricultural ecosystems such high resolution genetic information will beimportant to determine whether sexual recombination and gene flow areoccurring regularly during a pathogen’s life history. Reassortment of thevirulence genes, leading to new combinations, could very quickly overcomegenes introduced for resistance. PCR is also likely to negate the limitationsimposed on our understanding of microbial diversity using traditionalmicrobiological methods. A number of PCR-based techniques suitable forthese applications are emerging.
15.2.1 Amplified fragment length polymorphism (AFLP) analysis
AFLP is a tool that allows differentiation between individuals, genotypes andstrains and the assessment of genetic diversity and phylogeny. Originallydeveloped for genetic mapping in plants (Vos et al., 1995), this technique hasthe characteristics of an ideal system for detecting genetic variation.
The AFLP markers generated are ‘neutral’ (i.e. not subject to naturalselection) and are generated from a large number of independent loci fromdifferent parts of the genome. The profiles generated are reported to behighly reproducible, because of the high stringency PCR due to the natureof the primers (Majer et al., 1996; Mueller et al., 1996).
AFLP analysis involves selective amplification of fragments fromrestriction enzyme digests of genomic DNA. Approximately 500 ng ofgenomic DNA is digested simultaneously with a hexanucleotide-cutterEcoRI and a tetranucleotide-cutter MseI. This results in more than 150,000fragments from a fungal genome of approximately 5 × 107 bp. The digested
Table 15.1. Present applications of PCR in mycology.
RAPD–PCRRT–PCRInverse PCRPCR mutagenesisPCR gene constructionPCR SOEing*
*Splicing by overlap extension.
326 S. Sreenivasaprasad and P.R. Mills
fragments are ligated with an MseI adaptor and a biotinylated EcoRI adaptor.Fragments with the EcoRI adaptor are captured using streptavidin beads forPCR. The numerous, small Mse–Mse fragments are discarded. Primers aredesigned to match each of the restriction enzyme adaptor sequences with theaddition of an arbitrary two base extension at the 3′ ends and PCR is thenperformed at high stringency (Fig. 15.1). This leads to the amplification of amanageable number of fragments. Usually 50–70 fragments can be resolvedfrom one PCR on denaturing polyacrylamide gels and the whole procedurecan be completed in 2 days. Ready-to-use kits (e.g. Life Technologies, PerkinElmer/Applied Biosystems) are available for AFLP analysis.
15.2.2 Long PCR
Restriction fragment length polymorphisms (RFLPs) in rDNA and mtDNAhave been used extensively in assessing genetic diversity and speciesrelationships in various fungi. Conventionally, polymorphisms are detectedby Southern hybridization of the digested genomic DNA samples with aspecific probe (e.g. Sreenivasaprasad et al., 1992). RFLPs from PCRamplified segments (up to 2.0–2.5 kb) of rDNA have also been used in similarstudies (e.g. Muthumeenakshi, 1996).
Recent development of the ‘long PCR’ technique, which employs twoDNA polymerases (non-proofreading Taq and a proofreading Pwo) has ledto the amplification of 10–40 kb fragments. This has opened up newpossibilities for the rapid generation of RFLPs and mapping.
Amplification of full-length animal mitochondrial DNA by long PCR,by using a set of forward and reverse primers from the 16S RNA gene, hasrecently been reported (Nelson et al., 1996). The size of mtDNA in animalsranges from 16 to 20 kb. However, amplification of full-length mtDNA fromfungi is likely to be more challenging because the size of mtDNA in fungivaries between 20 and 170 kb (Taylor, 1986). Nonetheless, using appropriateprimers, large fragments can be amplified by long PCR to generate RFLPs.Fragments of rDNA of up to 7 kb have been amplified from Trichodermaspp. with universal ribosomal primers (White et al., 1990) in long PCR, andused to detect RFLPs (S. Muthumeenakshi, Warwickshire, 1996, personalcommunication).
A rapid vector-independent restriction mapping technique has also beendeveloped using long PCR. PCR primers are radioactively labelled to serveas probes for DNA fragments generated by partial digestion of the PCRproduct. This method has been used to generate restriction maps of 8–18 kbfragments directly amplified from human genomic DNA (Her and Wein-shilboum, 1995).
Another application of long PCR is in repetitive-element based PCR(REP-PCR). Dispersed repeat sequences in Magnaporthe grisea are beingused extensively to genotype the isolates by Southern hybridization-basedfingerprinting (Levy et al., 1991; Xia et al., 1993). Recently, REP-PCR has
Future Directions 327
Fig. 15.1. Amplified fragment length polymorphism (AFLP) technique.
328 S. Sreenivasaprasad and P.R. Mills
been developed for genotyping M. grisea isolates (George et al., 1997). Twooutwardly directed primers, designed from a repetitive element sequence,were used in combination with long PCR to generate distinct bandingpatterns (Fig. 15.2) with M. grisea isolates from different hosts. Theamplicons ranged in size from 0.4 kb to longer than 23 kb, although mostscorable bands were less than 23 kb in size. The PCR profiles generateddifferentiated the rice-infecting and rice non-infecting M. grisea isolates.Robust groupings and close correspondence between the Pot2 REP-PCRand MGR586 RFLP lineages were observed upon cluster analysis of PCRprofiles from clonal as well as highly diverse rice-infecting M. griseapopulations.
Fig. 15.2. Flowchart showing the REP-PCR technique.
Future Directions 329
15.3 Diagnostic PCR
PCR-based detection of pathogenic fungi directly from infected tissue hasbeen reported for several important systems (Levesque et al., 1994; Sreeniva-saprasad et al., 1996). PCR has also been used to monitor mycorrhizalsymbionts (Henrion et al., 1994) and to detect pathogens directly from soil(Henson et al., 1993). Recently, a nested multiplex PCR approach has beendeveloped to simultaneously detect conifer root rot fungi Cylindrocarpondestructans and Cylindrocladium floridum (Hamelin et al., 1996).
With most of these PCR methods, which are based on rDNA sequences,infected tissue with dead mycelium might also test positive as the DNA couldstill be amplified. It would be preferable to discriminate between viable andnon-viable propagules of the pathogen, particularly in the context ofcertification programmes and quarantine tests. In order to detect the viablepropagules only, it would be necessary to develop reverse transcriptase(RT)–PCR-based tests, using RNA as the source of amplification. Species-specific primers from rDNA sequences can be used in RT–PCR, although itis not certain whether amplification of ribosomal RNA can always bedirectly correlated with viable biomass. RT–PCR amplification of sequencessuch as chitin synthase genes and ergosterol biosynthetic genes can be morereliably related to the viability of the propagules. These RT–PCR tests basedon gene sequences, however, are likely to be less sensitive as the abundanceof these messages is much lower as compared with the ribosomal RNAs.
Currently, a number of diagnostic kits (Table 15.2) are available forroutine use in forensic and clinical laboratories as a result of concertedresearch and development efforts between academia and industry, backed bystrong funding. Similar advances can be envisaged for PCR application inmycology in biomedical fields.
Table 15.2. Some of the currently available forensic and clinical diagnostic kits (Graham,1994; Whelen and Persing, 1996) as examples of the range of PCR applications.
Kit name Basis of detection Use
AmpliType PM Five independently inheritedgenetic loci
Forensic testing and humanidentity
AmpliFLP D1S80 16 bp Repeat on chromosomeone
Forensic testing and humanidentity
Enviroamp Legio. 5S Ribosomal RNA gene andmacrophage Legionellainfectivity potentiator gene
Detection of Legionella
Amplicor Myco. 16S Ribosomal RNA gene probe Detection of Mycobacteriumtuberculosis
Amplicor hep. RT–PCR of viral RNA Detection of hepatitis C virus
330 S. Sreenivasaprasad and P.R. Mills
15.3.1 Data processing
The expected improvements in diagnostic capability necessitate the avail-ability of software packages suitable for different applications. User-friendlyinteractive systems that answer questions in an efficient and simple mannerare likely to facilitate the introduction of diagnostics into the user’senvironment.
15.4 Genome Mapping and Sequencing
PCR has contributed to rapid completion of physical maps of human andother genomes (Graham, 1994; Marx, 1995; Abramowitz, 1996). PCR wasused as the basis for translating the various physical mapping markers intoa common language of short fragments of single-copy DNA sequence calledsequence-tagged sites (STSs). Generally, 200–500 bp of sequence data woulddefine an STS. An STS is unique to that particular genome and can bespecifically amplified by PCR. An STS detection PCR assay can be carriedout using two primers (~ 20 bases) designed to be complementary to the twostrands and at opposite ends of the sequence segment. Thus, a 100 kb clonecan be mapped by determining the order of a series of STSs and measuringthe distances between them. This information can be completely described ina database along with the conditions for the PCR assay (Olson et al., 1989).PCR has also had a considerable effect on genetic mapping through theamplification of the short tandem repeats (STRs) which are stretches oftandemly repeated short nucleotide motifs present in most eukaryoticgenomes (Kashi et al., 1997). These elements occur as interspersed repeatsand may be found by screening a genomic library. PCR primers can bedesigned for STR amplification by subcloning and sequencing (Litt, 1994).These STRs can be used both as polymorphic markers for measuring thefrequency of recombination within families and also to interrelate physicaland genetic maps. Further, substantial progress has been made in the analysisof complementary DNA clones to generate a segment of sequence called anexpressed sequence tag (EST) by PCR as part of the Human Genome Project(White, 1996). A large volume of EST sequences is available from variousanimal and plant systems e.g. Arabidopsis (Newman et al., 1994). ESTs aregenerated by partial sequencing on cDNA clones. Clones from randomlyprimed cDNA libraries or partial cDNA clones can be used to generate thisinformation rapidly. ESTs are useful for the identification and isolation ofnew genes, the identification of coding regions in genomic sequences and forgenome mapping. PCR methods have also been used to map ESTs to specificchromosomes (Adams et al., 1991).
The wider application and success of genome sequencing projectsdepend on the availability of rapid and cost-effective sequencing technology.As part of the Arabidopsis genome sequencing initiative, a microthermal
Future Directions 331
cycler has been developed with which 0.5 µl sample volumes and 40 s cycletimes can be achieved (Marziali et al., 1997). The two strategies presentlyemployed are shotgun sequencing and primer walking. However, both ofthese approaches have time-consuming procedures. Large scale templatepreparation, generation of redundant sequences and the assembly of contigsare some of the major disadvantages with the former. With the latter, primersynthesis can be expensive and slow and automation is more complicated.The use of presynthesized libraries of primers with different sequences hasbeen proposed to eliminate the primer synthesis step (Studier, 1989).Individual short primers from such a library are either ligated (Szybalski,1990) or assembled without ligation (Beskin et al., 1995) to make uniquesequencing primers. More recently, a conceptually new technique known asdifferential extension with nucleotide subsets (DENS) has been developed(Raja et al., 1997).
15.4.1 Differential extension with nucleotide subsets (DENS)
DNA sequencing using DENS is a two stage process (Fig. 15.3). Initially,a short primer is allowed to extend at 20–30°C with only two out ofthe four dNTPs present in the reaction mix. Primer (a partially degenerateoctamer or a hexamer) extension depends on how soon a basecorresponding to the dNTPs not used in the reaction is present in thestrand being synthesized. This leads to differential extension of the primer,at different sites, depending on the template sequence. The intendedpriming site, the primer and the two dNTP subsets are chosen to maximizethe length of the primer at that site. Elsewhere in the template, at randomlylocated priming sites, the primer extensions are likely to be substantiallyshorter. Subsequently, a termination reaction is performed at highertemperature with all four dNTPs present, similar to normal cyclesequencing. The higher annealing and extension temperature permits asequence pattern to be generated only from the maximally extended site.Differential extension products of the same primer are shorter to annealand extend and do not produce the sequence pattern. Although, at present,a <10% failure rate of DENS is expected because of the superimposednon-target sequence, further optimization of the procedures and conditionsis likely to improve the usefulness of this technique.
With the increasing interest in mapping and sequencing of fungalgenomes, particularly Aspergillus and Neurospora (Bennett, 1997; Hamer,1997), it is likely that PCR will have a major impact in this area.
15.5 Gene Expression
Various life processes, such as development, differentiation and response tostress, are controlled by regulation of gene expression. Identification and
332 S. Sreenivasaprasad and P.R. Mills
Fig. 15.3. Differential extension with nucleotide subsets technique for sequencing.
Future Directions 333
isolation of the differentially expressed genes are essential to understand andmanipulate these biological processes. Conventionally, differential hybrid-ization of cDNA libraries has been used to isolate these genes. Recently,various techniques that combine the advantages of PCR have beendeveloped.
15.5.1 Differential display reverse transcription–PCR
Differential display reverse transcription–PCR (DDRT–PCR) was devel-oped for isolating tumorigenesis-related genes from mice (Zhang andMedina, 1993) and humans (Liang et al., 1992), and has also been applied inthe analysis of tomato fruit ripening-related genes (Oh et al., 1995). Thetechnique facilitates rapid isolation of differentially expressed genes via PCRwithout the construction and screening of cDNA libraries.
The total mRNA pool from a sample is reverse-transcribed into 12subpopulations of cDNA using 12 different anchored oligo-dT primers (e.g.T11AC). The cDNA subpopulations are then PCR-amplified using the sameanchored primer and an arbitrary 10-mer. Additional cDNAs comprisingeach subpopulation are amplified by using alternative arbitrary primers (Fig.15.4). The composite PCR profile is representative of the mRNAs containedin each population.
Radiolabelled amplification products derived from the same anchor/arbitrary primer combinations with different samples are displayed inadjacent lanes on polyacrylamide gels, to locate the differentially expressedgenes. The gene fragments are excised, eluted, cloned and sequenced toidentify the gene. These fragments can also be used as probes on genomic/cDNA libraries to clone complete genes.
DDRT–PCR is potentially faster than differential hybridization ofcDNA libraries and initially gained wide attention. Despite this, some doubtshave been raised as to the wider applicability of this technique as it might bebiased for high copy number mRNA species and inappropriate where onlya few genes might vary. A number of modifications have been made to theoriginal protocol to optimize the technique, for example the use of longerprimers to reduce the level of false positives, and to improve reproducibility.Several ready-to-use kits are now commercially available (e.g. Gene Hunter,Pharmacia).
15.5.2 Suppression PCR
This is a technique used to selectively amplify differentially expressed (target)cDNA fragments whilst simultaneously suppressing non-target amplifica-tion. Suppression PCR is specifically designed to equalize the abundance ofmessages within target cDNA to enable the isolation of even rare transcripts(Diatchenko et al., 1996).
Tester and driver double-stranded cDNAs are prepared from the twomRNA samples under comparison. Two tester populations are created with
334 S. Sreenivasaprasad and P.R. Mills
Fig. 15.4. RNA differential display technique.
Future Directions 335
Fig. 15.5. Suppression PCR technique.
Continued opposite
336 S. Sreenivasaprasad and P.R. Mills
different adaptors but the driver has no adaptors. The first hybridizationbetween excess driver cDNA and each population of the tester cDNAresults in equalization of message abundance and enrichment of differ-entially expressed sequences in the tester. The second hybridizationbetween fresh driver cDNA and the two primary hybridization samplesmixed together leads to the generation of differentially expressed genetemplates for PCR.
Fig. 15.5 continued.
Future Directions 337
Using suppression PCR, only the differentially expressed sequences areamplified exponentially during a first round PCR. A second round PCR withnested primers results in reduced background and enrichment of targetsequences (Fig. 15.5).
This technique requires only 0.5–2.0 µg of poly(A)+ RNA as startingmaterial and is designed to amplify rare transcripts, typically the mostdifficult to obtain. Suppression PCR does not involve physical separation ofsingle-stranded and double-stranded cDNA. Strategic design and use ofadaptors suppress the amplification of most types of molecules including themolecules where panhandle-like structures are formed by the long invertedrepeats. Suppression PCR can thus achieve greater than 1000-fold enrich-ment for differentially expressed cDNA (Clontech, 1995). A ready-to-usecommercial kit is available from Clontech.
15.5.3 In situ PCR
This technique is used to amplify target DNA or RNA within intact cells,permitting the correlation of PCR results with cellular localization andmorphology. Fixed cells or tissue are permeabilized and contained and PCRreagents are added to this. Thermal cycling through suitable parameters isfollowed by detection of PCR products using appropriate methods e.g.fluorescence microscopy. Lack of uniform equipment is perceived as themajor problem in performing and reproducing in situ PCR. Techniquesadapted for in situ thermal cycling, in particular, vary widely. With theavailability of new in situ PCR systems (e.g. Perkin Elmer/Applied Bio-systems) it is expected that this technique can be performed consistently,reproducibly and reliably (Perkin Elmer, 1994).
In situ PCR is an emerging tool in virology, cancer research anddevelopmental biology. This technique is likely to be employed with variousfungal systems. For example it has been applied in the study of arbuscularmycorrhizal (AM) fungi to confirm the presence of different alleles in AMfungal genes and to identify different nuclear populations within a single AMspore (Berta et al., 1996).
In the last few years, there has been an upsurge in understanding themolecular basis of differentiation and development in both pathogenic andbeneficial fungi. Various PCR-based techniques are likely to be appliedwidely on a routine basis.
15.6 Amplification Technology
Rapid advances are being made in the miniaturization of the PCR instru-ments and also in reducing the time required for amplification. For example,by adapting PCR on to a microinstrumentation platform and using suitabledetection chemistries in minute disposable chambers (0.5–50 µl), 30 cycles
338 S. Sreenivasaprasad and P.R. Mills
can be completed in 10–20 min on a very small instrument (White, 1996).Similarly, the use of silicon chambers which require only 10 µl reactions andare heated resistively can reduce amplification time by an order of magnitude.Under these conditions 30 cycles may be completed in 7 min on amicrofabricated prototype. Results for a variety of loci using these systemswere comparable with the results from conventional PCR. This apparatuswas about the size of a scientific calculator including power supply andcontrol electronics and four 9 V batteries allowed 2.5 h of operation(Abramowitz, 1996). Such portable and convenient devices are likely to beused for on-field/on-site diagnosis.
Progress in the automation of nucleic acid extraction in combinationwith the advances in PCR technology are likely to lead to the availability ofcompletely automated instrument systems for diagnostic clinics in theforeseeable future.
15.7 Detection Technology
A number of techniques (Graham, 1994) can be used to analyse PCRproducts (Table 15.3). Among these methods, scintillation proximity assay(Amersham), electrochemiluminescence (Perkin Elmer) and microwellassays (e.g. Roche) are suitable for analysing a large number of samplesroutinely.
Further progress is being made in developing novel amplicon analysisand detection methods. DNA can be bound to a 96-well polystyrenemicrotitre plate by non-covalent interactions e.g. by 500 mM NaCl orstreptavidin coating, or immobilized probes can be used to capture bio-tinylated PCR products. The plate-bound amplicons can then be analysed byenzyme-assisted colorimetric detection which enables the simultaneoushandling of numerous samples. A variation of this method is the use of abiotinylated primer and a modified triphosphate (digoxigenin-11-dUTP) inPCR (Fig. 15.6). Detection is achieved by capturing the biotinylated
Table 15.3. Amplicon analysis methods.
ElectrophoresisHybridizationDirect sequencingLaser/ALF detectionHPLCElectrochemiluminescenceScintillation proximity assayMicrowell assay
Future Directions 339
amplicons and using anti-digoxigenin antibody conjugated to alkalinephosphatase and suitable substrates (O’Donnell-Maloney et al., 1996).Furthermore, by marking a specific primer with a unique hapten, e.g.digoxigenin or fluorescein, each reaction can be detected using hapten-specific antibodies labelled with different enzyme reporters, such as alkalinephosphatase or horseradish peroxidase. This system permits the detection oftwo different targets from a single reaction by different colour reactions(Tobe et al., 1996).
Another method of amplicon detection is the use of a biotinylatedprimer and a fluorescently labelled primer in PCR. Streptavidin capturedamplicons are denatured, the fluorescently labelled strand is hybridizedto an array of immobilized probes on a glass slide and the hybridizationpattern and polymorphisms are detected by fluorescence scanning (Fig.15.7). An example of the use of this method is the identification ofpolymorphisms from exon 4 of the human tyrosinase gene (O’Donnell-Maloney et al., 1996).
Detection methods that utilize reporter dyes are being integrated intonew ‘kinetic’ thermal cyclers which can monitor the products duringamplification. It is expected that these combined instrument–reagent systems
Fig. 15.6. Detection method using a colorimetric assay.
340 S. Sreenivasaprasad and P.R. Mills
will enable rapid generation of both qualitative and quantitative data withhigh throughput (White, 1996). Recently, a microvolume multisamplefluorimeter with rapid thermal cycling has been developed by Idaho
Fig. 15.7. Detection method based on amplicon hybridization to probe assays.
Future Directions 341
Technology, Idaho, USA. This instrument combines rapid thermal cyclingcapability, and fluorescent monitoring by three different techniques (Wittweret al., 1997a, b).
Recently, scientists at USDA (Madison, Wisconsin) and Perkin Elmer(California) have applied an automated TaqMan assay system to detectTilletia indica (Berthier-Schaad et al., 1997). The TaqMan system relies on theability of the 5′ nuclease activity of Taq polymerase. During amplification,the reporter dye from the 5′ end of the probe is released and the resultantincrease in fluorescence is monitored in real time. Under optimal PCRconditions, increase in fluorescent signal above the threshold level, by theend of the amplification cycles, detects a sample as positive for T. indica.Preliminary results on the comparison of classical PCR and TaqMan with T.indica from ryegrass and other hosts yielded approximately 60% agreement.With improvements in reliability, routine use of similar assay systems can beenvisaged.
15.8 Conclusion
Rapid advances are being made in both amplification and detection technolo-gies to enable rapid and high throughput PCR analyses, and the number oftechniques available is continually increasing. In view of these developments,PCR is likely to be one of the most widely used tools in mycology in thebroad context of genes and genomics as well as diagnostics.
References
Abramowitz, S. (1996) Towards inexpensive DNA diagnostics. Trends in Bio-technology 14, 397–401.
Adams, M.D., Kelley, J.M., Gocayne, J.D., Dubnick, M., Polymeropoulos, M.H.,Xiao, H., Merril, C.R., Wu, A., Olde, B., Moreno, R.F., Kerlavage, A.R.,McCombie, W.R. and Venter, J.C. (1991) Complementary DNA sequencing:expressed sequence tags and Human Genome Project. Science 252, 1651–1656.
Bennett, J.W. (1997) White Paper: Genomics for filamentous fungi. Fungal Geneticsand Biology 21, 3–7.
Berta, B., Simon, L. and Piche, Y. (1996) In situ PCR: applications and prospects inthe study of arbuscular mycorrhizal fungi. In: International Conference onMycorrhizae, Berkeley, 4–9 August 1996 (abstract).
Berthier-Schaad, Y., Bonde, M.R., Tooley, P.W., Peterson, G.L., Knorr, D. and Schaad,N.W. (1997) A rapid, automated PCR-based technique for identification ofTilletia indica. Phytopathology 87, S8 (abstract).
Beskin, A., Zevin-Sonkin, D., Sobolev, I. and Ulanovsky, L. (1995) On the mechanismof the modular primer effect. Nucleic Acids Research 23, 2881–2885.
Clontech (1995) An innovative PCR-based method to selectively amplify differ-entially expressed genes. Clontechniques 10, 2–5.
342 S. Sreenivasaprasad and P.R. Mills
Diatchenko, L., Lau, Y.-F.C., Campbell, A.P., Chenchik, A., Moqadam, F., Huang, B.,Lukyanov, S., Lukyanov, K., Gurskaya, N. and Sverdlov, E.D. (1996) Suppres-sion subtractive hybridization: A method for generating differentially regulatedor tissue-specific cDNA probes and libraries. Proceedings of the NationalAcademy of Sciences USA 93, 6025–6030.
Erlich, H.A. and Arnheim, N. (1992) Genetic analysis using the polymerase chainreaction. Annual Review of Genetics 26, 479–506.
Foster, L.M., Kozak, K.R., Loftus, M., Stevens, J.J. and Ross, I.K. (1993) Thepolymerase chain reaction and its application to filamentous fungi. MycologicalResearch 97, 769–781.
George, M.L.C., Nelson, R.J., Zeigler, R.S. and Leung, H. (1997) Pot2 repetitiveelement-based PCR (repPCR) allows rapid genetic analysis of Pyricularia grisea.Phytopathology 87, S33 (abstract).
Graham, A. (1994) A haystack of needles: applying the polymerase chain reaction. Chemistry and Industry 18, 718–721.
Hamelin, R.C., Berube, P., Gignac, M. and Bourassa, M. (1996) Identification of rootrot of fungi in nursery seedlings by nested multiplex PCR. Applied andEnvironmental Microbiology 62, 4026–4031.
Hamer, L. (1997) From genes to genomes: Sequencing of filamentous fungal genomes.Fungal Genetics and Biology 21, 8–10.
Henrion, B., Di Battista, C., Bouchard, D., Vairelles, D. Thompson, B.D., Le Tacon,F. and Martin, F. (1994) Monitoring the persistence of Laccaria bicolor as an ecto-mycorrhizal symbiont of nursery-grown Douglas fir by PCR of the rDNAintergenic spacer. Molecular Ecology 3, 571–580.
Henson, J.M., Goins, T., Grey, W., Mathre, D.E. and Elliot, M.L. (1993) Use ofpolymerase chain reaction to detect Gaeumannomyces graminis DNA in plantsgrown in artificially and naturally infested soil. Phytopathology 83, 283–287.
Her, C. and Weinshilboum, R.M. (1995) Rapid restriction mapping by use of longPCR. BioTechniques 19, 530–532.
Kashi, Y., King, D. and Soller, M. (1997) Simple sequence repeats as a source ofquantitative genetic variation. Trends in Genetics 13, 74–78.
Levesque, C.A., Vrain, T.C. and De Boer, S.H. (1994) Development of a species-specific probe for Pythium using amplified ribosomal DNA. Phytopathology 84,474–478.
Levy, M., Romao, J., Marchetti, M.A. and Hamer, J.E. (1991) DNA fingerprintingwith a dispersed repeated sequence resolves pathotype diversity in the rice blastfungus. Plant Cell 3, 95–102.
Liang, P., Averboukh, L., Keyomarsi, K., Sager, R. and Pardee, A.B. (1992)Differential display and cloning of messenger RNAs from human breast cancerversus mammary epithelial cells. Cancer Research 52, 6966–6968.
Litt, M. (1994) PCR of TG microsatellites. In: McPherson, M.J., Quirke, P. andTaylor, G.R. (eds) PCR: a Practical Approach. IRL Press, Oxford, pp. 85–99.
Marx, J. (1995) A new guide to the human genome. Science 270, 1919–1920.Majer, D., Mithen, R., Lewis, B.G., Vos, P. and Oliver, R.P. (1996) The use of AFLP
fingerprinting for the detection of genetic variation in fungi. MycologicalResearch 100, 1107–1111.
Marziali, A., Federspiel, N. and Davis, R. (1997) Automation for the Arabidopsisgenome sequencing project. Trends in Plant Science 2, 71–74.
Mueller, U.G., Lipari, S.E. and Milgroom, M.G. (1996) Amplified fragment length
Future Directions 343
polymorphism (AFLP) fingerprinting of symbiotic fungi cultured by thefungus-growing ant Cyphomyrmex minutus. Molecular Ecology 5, 119–122.
Mullis, K.B. (1990) The unusual origin of the polymerase chain reaction. ScientificAmerican 262, 56–65.
Muthumeenakshi, S. (1996) Molecular taxonomy of the genus Trichoderma. Unpub-lished PhD thesis, The Queen’s University of Belfast, Belfast, UK.
Nelson, W.S., Prodohl, P.A. and Avise, J.C. (1996) Development and application oflong-PCR for the assay of full-length animal mitochondrial DNA. MolecularEcology 5, 807–810.
Newman, T., de Bruijn, F.J., Green, P., Keegstra, K., Kende, H., McIntosh, L.,Ohlrogge, J., Raikhel, N., Somerville, S., Thomashow, M., Retzel, E. andSomerville, C. (1994) Genes galore: a summary of methods for accessing resultsfrom large-scale partial sequencing of anonymous Arabidopsis cDNA clones.Plant Physiology 106, 1241–255.
O’Donnell-Maloney, M.J., Smith, C.L. and Cantor, C.R. (1996) The development ofmicrofabricated arrays for DNA sequencing and analysis. Trends in Bio-technology 14, 401–407.
Oh, B.-J., Balint, D.E. and Giovannoni, J.J. (1995) A modified procedure for PCR-based differential display and demonstration of use in plants for isolation ofgenes related to fruit ripening. Plant Molecular Biology Reporter 13, 70–81.
Olson, M., Hood, L., Cantor, C. and Botstein, D. (1989) A common language forphysical mapping of the human genome. Science 245, 1434–1435.
Perkin Elmer (1994) In situ PCR impacts virus, cancer and developmental biologystudies. Biosystems Reporter 23, 6–7.
Raja, M.C., Zevin-Sonkin, D., Shwartzburd, J., Rozovskaya, T.A., Sobolev, I.A.,Chertkov, O., Ramanathan, Y., Lvovsky, L. and Ulanovsky, L.E. (1997) DNAsequencing using differential extension with nucleotide subsets (DENS). NucleicAcids Research 25, 800–805.
Sreenivasaprasad, S., Brown, A.E. and Mills, P.R. (1992) DNA sequence variation andinterrelationships among Colletotrichum species causing strawberry anthrac-nose. Physiological and Molecular Plant Pathology 41, 265–281.
Sreenivasaprasad, S., Sharada, K., Brown, A.E. and Mills, P.R. (1996) PCR-based detec-tion of Colletotrichum acutatum on strawberry. Plant Pathology 45, 650–655.
Studier, F. W. (1989) A strategy for high-volume sequencing of cosmid DNAs – random and directed priming with a library of oligonucleotides. Proceedings ofthe National Academy of Sciences USA 86, 6917–6921.
Szybalski, W. (1990) Proposal for sequencing DNA using ligation of hexamers togenerate sequential elongation primers (SPEL-6). Gene 90, 177–178.
Taylor, J. W. (1986) Fungal evolutionary biology and mitochondrial DNA. Experi-mental Mycology 10, 259–269.
Tobe, V.O., Taylor, S.L. and Nickerson, D.A. (1996) Single-well genotyping ofdiallelic sequence variations by a two-color ELISA-based oligonucleotideligation assay. Nucleic Acids Research 24, 3728–3732.
Vos, P., Hogers, R., Bleeker, M., Reijans, M., van de Lee, T., Homes, M., Frijters, A.,Pot, J., Peleman, J., Kuiper, M. and Zabeau, M. (1995) AFLP: a new concept forDNA fingerprinting. Nucleic Acids Research 23, 4407–4414.
Whelen, A.C. and Persing, D.H. (1996) The role of nucleic acid amplification anddetection in the clinical microbiology laboratory. Annual Review of Micro-biology 50, 349–373.
344 S. Sreenivasaprasad and P.R. Mills
White, T.J. (1996) The future of PCR technology: diversification of technologies andapplications. Trends in Biotechnology 14, 478–483.
White, T.J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification and directsequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A.,Gelfand, D.H., Sninsky, J.J. and White, T.J. (eds) PCR Protocols: a Guide toMethods and Applications. Academic Press, San Diego, pp. 315–322.
Wittwer, C.T., Herrmann, M.G., Moss, A.A. and Rasmussen, R.P. (1997a) Con-tinuous fluoresence monitoring of rapid cycle DNA amplification. BioTech-niques 22, 130–138.
Wittwer, C.T., Ririe, K.M., Andrew, R.V., David, D.A., Gundry, R.A. and Balis, U.J.(1997b) The LightCycler™: a microvolume multisample fluorimeter with rapidtemperature control. BioTechniques 22, 176–181.
Xia, J. Q., Correll, J.C., Lee, F.N., Marchetti, M.A. and Rhoads, D.D. (1993). DNAfingerprinting to examine microgeographic variation in the Magnaporthe grisea(Pyricularia oryzae) population in two rice fields in Arkansas. Phytopathology83, 1029–1035.
Zhang, L. and Medina, D. (1993) Gene expression screening for specific genesassociated with mouse mammary tumor development. Molecular Carcinogenesis8, 123–126.
Future Directions 345
Acaulospora 113Acaulosporaceae 118Acremonium 133
A. chrysogenum 195, 197, 199A. alabamense 133
Actin genes 129–130Aflatoxin 244–253, 256AFLP, see Amplified fragment length
polymorphismAgaricales 139Agaricus bisporus 138, 139, 217, 221Agaricus caroli 139Agaricus chionodermus 139Agaricus excellens 139Akanthomyces 160–161Alga 85, 86, 87, 89, 95, 141Alternaria 137, 244
A. alternata 137A. brassicae 311A. brassicicola 311A. padwickii 311A. triticina 311
Amanita 111AM fungi, see Arbuscular mycorrhizaeAmplified fragment length polymorphism
8, 178, 296, 320, 326–327AmpliTaq 52
see also DNA polymerases
Anastomosis group (AG) 66, 140see also Rhizoctonia solani
Antibodies 28, 267, 268, 279, 290, 313AP-PCR
see Arbitrarily primed PCRArabidopsis 331
A. thaliana 296Arbitrarily primed PCR 8, 130, 138,
294Arbuscular mycorrhizae 111–115, 118,
119, 120Aristolochen synthase 255–258Armillaria 138–139
A. borealis 139A. calvescens 139A. cepistipes 139A. gemina 139A. lutea 139A. mellea 138A. ostoyae 139A. sinapina 139A. tabescens 138
Artenpaare 91Arthoniales 90, 92Ascomycota 108, 131, 132, 156Ascosphaera 156–157, 176
A. aggregata 156–157A. apis 157
Index
347
Ascosphaera continuedA. larvis 156A. subcuticulata 157
Aspergillus 131, 132, 187, 244, 251, 269,270, 272, 275–278, 332
A. awamori 197–198, 199, 200A. flavus 70, 246, 249–250,
252–253, 254, 267, 277, 311A. fumigatus 267, 268, 269,
276–277A. giganteus 276A. nidulans 159, 188, 197–198, 199,
217, 220, 221, 249–250, 252,277
A. niger 187, 188–189, 277A. nominus 246A. oryzae 199, 246, 250A. parasiticus 246, 249–250, 252–253A. restrictus 277A. sojae 246, 250A. terreus 277A. versicolor 249, 252
Attine ants 139Aureobasidium pullulans 227
Barley 295, 298, 309Basidiobolus 154
B. ranarum 141Basidiomycete/Basidiomycota 108, 131,
205–234Bean 295, 309Beauveria 159–163, 177
B. amorpha 159–161B. bassiana 71, 159–162, 178B. brongniartii 159–162B. caledonica 159–161B. velata 159–160B. vermiconia 159–161
Beet 309Bipolaris 249
B. oryzae 311, 314–316, 317, 318B. sorokiniana 311
Bjerkandera adusta 211Blastocladiella emersonii 131Blastomyces dermatitidis 281–282Blastoschizomyces capitatus 275Blotting, see HybridizationBlunt end cloning 36
see also Cloning and T/A cloningBolbitius 139Boletinus 139Boletus 109, 111Botryodiplodia theobromae 311Botryodiploidin 254Botrytis 311
B. cinerea 48, 53–59, 162, 311Brassica 136Bryophytes 87Burkholderia 118Butyrivibrio fibrisolvens 225Byssochlamys 251
B. nivea 255
Caliciales 90, 135Calluna vulgaris 116Caloplaca 91Candida 70, 267, 269, 270, 272–274
C. albicans 267, 269, 271, 272–275,280
C. glabrata 267, 272–275, 282C. guilliermondii 272–274C. krusei 267, 271, 272–275C. parapsilosis 271, 272–275C. pseudotropicalis 273C. stellatoidea 273C. tropicalis 271, 272–275
Capillary electrophoresis 6Capillary PCR 279Cassette-primer PCR 215cDNA, see Complementary DNACellulase genes 210, 220–226, 234Cercospora kikuchii 311Cercospora oryzae 311Ceriporiopsis subvermispora 211, 233Chaetomium 249Chaetothyriales 136Chelating agents 27Chitin synthase genes 69, 130, 274, 330Chromosome walking 296Chrysosporium lignosum 211Chymosin 197–198, 200Chytridiomycota 131Chytridium 141Cladiaceae 90Cladonia chlorophaea 92–95, 97Cladoniaceae 90
348 Index
Cladosporium fulvum 294, 296Clavibacter michiganensis subsp.
sepedonicus 313, 319Clavicipitales 132–133Claviceps purpurea 243Cloning 13, 21–37, 52, 59, 187–192,
195–196, 198, 220, 226, 291–293,297, 334
see also Blunt end cloning, T/Acloning and Vectors
Cluster analysis 75, 158Coccidioides immitis 267, 281–282, 326Cochliobolus carbonum 293Codon usage 25–26Coenococcum geophilum 137Colletotrichum 11, 68, 71, 73, 134, 176
C. capsici 311C. gloeosporioides 134C. graminicola 134C. lindemuthianum 134, 311C. malvarum 134C. orbiculare 134C. sublineolum 134C. trifolii 134C. truncatum 311
Competitive RT–PCR, see Reversetranscriptase PCR
Complementary DNA 29–31, 48–52,56–59, 181–189, 195–196, 197,199, 208, 209, 211–217, 222–226,227, 230–234, 277, 291, 293,297–300, 331, 334–338
see also LibraryConidiobolus 154
C. coronatus 141Coprinus 139Cordyceps 156
C. taii 163Coriolus hirsutus 217–221
C. versicolor 211, 221Cryphonectria parasitica 60, 217Cryptococcus 68
C. neoformans 267, 269, 272, 273,280–281
see also Filobasidiella neoformansCulmorin 259Cyanobacteria 86–87, 89Cylindrocarpon destructans 330Cylindrocarpon heteronema 68
Cylindrocladium floridum 330Cytochrome P-450 reductase 188
DAF, see DNA amplificationfingerprinting
Dam methylation 191see also Escherichia coli
DDRT, see Differential display reversetranscriptase PCR
Denaturing gradient gelelectrophoresis 6–7, 13, 234, 295
Dendrographa 91DENS, see Differential extension with
nucleotide subsetsDetection 12, 243–262, 268–282,
290–291, 330–331, 339–342DGGE, see Denaturing gradient gel
electrophoresisDievernia 91Differential display reverse transcriptase
PCR 14, 47–60, 195–196, 200,234, 298, 334–335
Differential expression with nucleotidesubsets 332
Diplodia maydis 311DNA amplification fingerprinting
see also Random amplificationpolymorphic DNA, Simplesequence repeats,Arbitrarily primed PCR,Enterobacterial repetitiveintergenic consensus,Repetitive extragenicpalindromic elements,Satellites, Short tandemrepeat and Variablenon-translated repeat
DNA extraction, general 10, 23, 126,206–207
from clinical samples 270from food 252–253from lichens 87–88from soil 207
DNA polymerases, features 22see also AmpliTaq, Taq, Tth, Pfu,
Pwo and VentDot blots, see HybridizationDothideales 136
Index 349
Downy mildew 295Drechslera tritici-repentis 311
ECM fungi, see EctomycorrhizaeEctomycorrhizae 109–111, 118EI-PCR, see Enzymatic inverse PCRElaphomyces 137Electrophoretic karyotyping 125, 136
see also Pulse field gelelectrophoresis
Enterobacterial repetitive intergenicconsensus 9, 70, 320
Entomophaga 154–155E. aulicae 155E. grylli 154, 178E. maimaiga 154–155
Entomophthora 154E. muscae 141
Entomophthorales 140–141, 154–156Enzymatic inverse PCR 192–193, 200Epichloë 133
E. typhina 133Eremascus 157ERIC, see Enterobacterial repetitive
intergenic consensusEricales 119Erynia 154
E. kondoiensis 156E. neoaphidis 154–156
Eryniopsis 154Erysiphales 137
see also Powdery mildewsEscherichia coli 187–188, 191, 193, 194,
226, 300EST, see Expressed sequence tagEurotiales 90Eurotium rubrum 132Expressed sequence tag 331
Farrowia 249Filobasidiella neoformans, see
Cryptococcus neoformansFingerprinting, see DNA amplification
fingerprinting and RNAfingerprinting
Fomes fomentarius 220Fumigaclavin 254
Fumonisins 244, 245, 259–260, 261Fungus–plant interactions 53–57,
107–120, 289–300Fusarin 259Fusarium 12, 65, 67, 69, 134, 159, 187,
244, 251, 259, 261, 267F. avenaceum 67, 259F. beomiforme 134F. culmorum 67, 259F. graminearum 67, 199, 259–260F. moniliforme 254, 259–260, 311,
314, 317F. napiforme 259–260F. nyagamai 259–260F. oxysporum 67, 71, 72, 135, 190,
200, 311F. oxysporum f.sp. dianthi 70F. oxysporum f.sp. lycopersici 190F. oxysporum f.sp. melonis 135F. poae 318F. polyphialadicum 134F. proliferatum 259–260F. sambucinum 259F. solani 254
Fuscoboletinus 139Fumonisin 244, 256
Gaeumannomyces–Phialophoracomplex 68, 133–134
G. graminis var. avenae 133G. graminis var. graminis 133G. graminis var. tritici 133, 298
Ganoderma 139–140G. lucidum 139–140, 221
Gaultheria shallon 116Generally recognized as safe 198,
199–200, 246, 250Geosiphon pyriforme 141Geotrichum 251Gerlachia oryzae 314Gibberella 134
G. fujikuroi 60, 135Gigaspora margarita 112, 114, 115, 118Gliocladium 133
G. penicillioides 133G. roseum 133G. virens 133see also Trichoderma
350 Index
Gliomastix 133Gloeophyllum trabeum 220–221Glomales 111–112, 141Glomus 154
G. coronatum 113, 114–115G. dimorphicum 115G. etunicatum 141G. flavisporum 114G. intraradices 112G. mosseae 70, 113–115, 298G. versiforme 114G. vesiculiferum 112
Gomphidius 109GRAS, see Generally recognized as safeGremmeniella 68Groundnut 309
Herbarium specimens 23, 89, 126Hot start-PCR 5, 27Histoplasma capsulatum 267, 281–282HIV 267, 280–281Hybridization, DNA/DNA 85, 125
dot blot 161, 197, 255, 260, 261in situ 208Northern 47, 52, 57–59, 195, 208,
222, 227, 293, 298Southern 47, 52, 57, 97, 111, 115,
222, 225, 227, 230, 271,273–274, 277, 279, 327
subtractive 299–300Hymenoscyphus ericae 116–117Hyphochytridium catenoides 131Hypocreaceae 133Hypocreales 132–133
IGS, see Intergenic spacerImmunosuppression 267, 269, 277,
279–280Insertion elements 90, 92–95, 97, 100,
136Intergenic spacer 11, 65–69, 108, 129,
130, 135, 138, 276see also Internal transcribed spacer
and Ribosomal RNA genecluster
Internal transcribed spacer 11, 12,65–69, 71, 72, 89, 91, 97–98, 101,
108, 109–111, 113–115, 116, 126,129, 130, 132–141, 156, 157, 158,160–162, 165–178, 211, 258–259,262271, 280, 281, 320
heterogeneity in ITS 73, 95–96, 115see also Intergenic spacer and
Ribosomal RNA genecluster
Intron 73, 92–96, 97–98, 100, 116–117,135–136, 137–138, 159, 163, 187,195, 234
Inverse PCR 32–33, 189, 192–193, 197,200, 207, 210, 326
IPCR, see Inverse PCRIn situ PCR 9, 291, 338Inter-repeat PCR 9, 273ITS, see Internal transcribed spacerITS heterogeneity, see Internal
transcribed spacer
Laccaria bicolor 110–111Laccase genes 215–220, 234Lactarius 111LA–PCR, see Long accurate PCRLarge subunit, see Ribosomal RNA gene
clusterLarix 139Lasallia 85, 91Lauderlindsaya borreri 91Lecanorales 90, 95–96, 135Lecanora dispersa 92Lecanora muralis 94Lentinula 176
L. edlodes (syn. Lentinusedlodes) 138, 221
Lentinus lateritia 138Lentinus novaezelandiae 138Lentinus tigrinus 221Leotiaceae 136Leotiales 135Leptosphaeria maculans 68, 136–137,
290Lettuce 295Library 21, 210, 215, 222–225, 227, 293,
299, 334see also Complementary DNA
Lichenicolous fungi 87–88, 91Ligase chain reaction 9–10, 321
Index 351
Ligation-mediated PCR 33Lignin 205–234Lignin peroxidase gene 208–214,
227–234Listeria monocytogenes 252–253Loculoascomycetes 137Long accurate PCR 31Long PCR 327–329
M13 phage 70, 277, 298Magnaporthe grisea 133, 327–329Magnaporthe poae 68Maize 309Marcfortines 254Massospora 154Messenger RNA 14, 29–30, 34, 48–52,
55–60, 126, 188, 189, 199,208–209, 222–226, 233, 297, 298,300, 334
Metarhizium 70, 133, 154, 157, 159,163–178
M. album 163, 168–178M. anisopliae 161, 163–178M. anisopliae var. frigidum 164–178M. anisopliae var. majus 163–178M. cylindrosporae 163M. flavoviride 160, 163–178M. flavoviride var. minus 160,
163–178M. guizhouense 163M. pingshaeme 163M. taii 163
Microdochium nivale 290Microhilum oncoperae 162Mitochondrial DNA 11, 73, 109, 129,
135, 136–137, 140, 159, 195–196,273, 279–280, 314, 327
Moniliformin 259Monocillium 249mRNA, see Messenger RNAmtDNA, see Mitochondrial DNAMonascus purpureus 132Mucor 141, 154Multiclavula mucida 89Multilocus genotyping, see Arbitrarily
primed PCRMultiplex PCR 246–251, 257, 318–319,
321
Muskmelon 295Mutagenesis 192–195Mycobacterium tuberculosis 278Mycocaliciaceae 90Mycoinsecticide 154, 165Mycophenolic acid 254Mycotoxin 199, 200, 243–262
NASBA, see Nucleic acid sequence-based amplification
Nectria 134, 156Nectrioidea 133Neocallimastix 141Neolentinus 138Neosartorya fischeri 132Neozygites 154Nephroma 91Nested PCR 7, 32, 271, 80, 281, 318, 320Neurospora 187, 332
N. crassa 159, 217, 220, 221Niebla 91Normandina pulchella 91Northern blot, see HybridizationNucleic acid sequence-based
amplification 9–10
Ochratoxin A 243, 244, 256Oidiodendron maius 116–117Omphalina 91, 176Onygenales 90, 132Oomycetes 67–68, 141–142Ophiostoma 71, 134Ophiosphaerella herpotricha 68
O. korrae 68Ordination 75Orygia vetusta 155Overlap PCR 194, 200
Paecilomyces 132, 158P. amoenoroseus 158P. farinosus 158P. fumosoroseus 158–159P. lilacinus 158–159P. varioti 277
Panus 138Paracoccidioides brasiliensis 267, 281
352 Index
Parmelia 95P. saxatilis 97–98, 99P. sulcata 97, 100
Parsimony 95–97, 128, 136, 154,169–171
see also Cluster analysis andPhylogenetic trees
Patulin 244, 245, 254Pea 295Peltigera 91Penicillin V amidase gene 190–191,
200Penicillium 11, 68, 131, 132, 244, 251
P. camemberti 255P. carneum 254P. chrysogenum 195, 199, 277P. digitatum 254P. italicum 251P. marneffei 277P. nalgiovense 256P. paneum 254P. patulum 245P. roqueforti 251, 253–258
Penitrem A 244, 254Peziza 136Pezizales 135–136PFGE, see Pulse field gel
electrophoresisPfu 23, 24, 28, 31, 36, 217
see also DNA polymerasesPhaeosphaeria 137Phialophora 133Phanerochaete chrysosporium 205,
210–215, 221–225, 227–230,231–233, 234
P. sordida 211Phlebia brevispora 221
P. radiata 221Phoma glumarum 311Phomopsis 317Phylogenetic trees 90–95, 127–128,
168–172see also Cluster analysis and
ParsimonyPhysconia 95, 97Phytophthora 11, 68, 141–142
P. cactorum 142P. capsici 141P. cinnamomi 70, 141–142
P. citropathora 141P. clandestina 142P. idaei 142P. infestans 56–57, 296P. iranica 142P. macrochlamydospora 142P. medicaginis 142P. megakarya 141P. megasperma 131, 142P. palmivora 141P. pseudotsugae 142P. sojae 142P. trifolii 142
Plectomycetes 137Pleospora herbarum 137Pleosporales 136Pleurotus ostreatus 211–215, 220, 221Plicaria 136Pneumocystis carinii 72, 138, 267, 272,
278–280, 282Podospora anserina 159Poly(A) tails 29–20, 48–52, 189, 195,
215, 217, 226, 293, 297, 338see also Messenger RNA
Polyacrylamide gels 6, 51–52, 272, 273,296, 298, 327, 335
Polyporaceae 138Polysaccharides 87, 89, 206Pooideae 133Potato 296, 298, 300, 311Powdery mildew 126, 137, 295, 311Pr1 gene 164, 178PR toxin 244, 245, 253–258Primer-dimer 4, 24Primers 2, 4, 5, 9, 10, 23, 24, 28, 87, 165,
168, 193–194, 209, 210, 217, 259,295, 297, 298, 300, 331, 332
anchored 48–52, 56, 58, 298degenerate 13, 24, 31, 32, 188–189,
332extended 51labelled 6, 339–341melting point 28nested 32specific 2, 4, 12, 29, 51, 65–70, 88,
89–90, 100, 109, 111, 113,119, 126, 189, 192, 222, 225,226, 227–230, 231–233, 234,253, 255, 256, 268, 269,
Index 353
Primers, specific continued273–275, 277, 280, 281, 296,314, 320
Probes 65, 67, 70, 110, 188, 210, 230,233, 245, 248, 259–260, 271,273–275, 281, 297, 300
Protomyces 132P. inouyei 137P. lactucae–debilis 131P. macrosporus 311
Proofreading 23, 327see also DNA polymerases
Proteins 24, 125, 128, 129–130, 178,187, 188, 189, 190, 197–201,294
Protein disulphide isomerase 189Pseudallescheria boydii 272Pseudocercosporella herpotrichoides
68Pseudocyphellaria 99Pseudomonas syringae 296, 318Pseudotsuga 139Puccinia 140
P. coronata 140P. graminis 67, 140P. recondita 140
Pulse field gel electrophoresis 296, 313see also Electrophoretic
karyotypingPwo 327
see also DNA polymerasesPyrenomycetes 137Pyrenophora 317Pyricularia oryzae 311, 314Pythium 68, 141
P. heterothallicum 141P. splendens 141P. sylvaticum 141P. ultimum 67–68
Q-beta replicase (Qβ) 9Quantitative PCR 7, 290
RACE, see Random amplification ofcDNA ends
Ramalina americana 98Ramalinaceae 91
Ramalinopsis 91Ramp-PCR 31Random amplification of cDNA
ends 29–31, 189, 215, 226, 293Random amplification of polymorphic
DNA 8, 11–12, 13, 63, 69–70,72, 74, 75, 98, 107, 113, 117, 119,130, 136, 138, 139–140, 155–156,157–158, 159–162, 164, 165–178,245, 259–261, 294–295, 313,314–316, 326
see also DNA amplificationfingerprinting
RAPD, see Random amplification ofpolymorphic DNA
RAP-PCR, see RNA arbitrarily primedPCR
rDNA, see Ribosomal RNA genecluster
Recombination PCR 194, 200REP 9, 70, 165–178, 320, 327–329Repetitive extragenic palindromic
elements, see REPRepresentational difference analysis
299Restriction fragment length
polymorphisms 7, 13, 65, 66–67,72, 75, 108, 110, 111, 113, 117,119, 125, 130, 134, 136, 138–141,155, 157, 160–162, 164, 294, 313,320, 325, 327–329
Reverse transcriptase PCRcompetitive 207, 209, 230–231,
234general 7, 9, 29, 95, 195–196, 200,
207, 208–209, 215–217,222–225, 231–234, 293, 326,330
see also Differential display reversetranscriptase PCR
RFLP, see Restriction fragment lengthpolymorphisms
Rhizoctonia 65–66R. oryzae 66R. solani 66 , 70, 140, 217, 220,
314Rhizomucor miehei 199Rhizopogon 109Rhizopus arrhizus 267, 272
354 Index
Ribosomal DNA, see Ribosomal RNAgene cluster
Ribosomal RNA gene cluster 10–11, 12,63, 64–69, 71, 72–73, 74, 87, 89,90–91, 92–96, 97, 99–100, 101,108, 109–111, 112–113, 118,119, 126, 129, 130–142, 154–155,157, 159–161, 164, 245, 253,258–260, 269, 271, 273–275,276–277, 279–280, 313, 320, 327,330
see also Intergenic spacer andInternal transcribed spacer
Rice (Oryza sativa) 309, 318RNA arbitrarily primed PCR 299RNA extraction 206–207RNA fingerprinting 298–299
see also Differential display reversetranscriptase PCR
Root 107, 109, 111, 116, 118–120, 298,300
Rottboellia 134RT–PCR, see Reverse transcriptase PCRRussula amoenolens 110
R. xerampelina 110Rusts 140, 295
Saccharomyces cerevisiae 187, 199, 225,273, 275, 280
Saitoella complicata 131Salmonella typhimurium 300Sarocladium oryzae 314–315, 317, 318,
321Sarcoscypha 136Satellites
micro- 9, 70, 108, 114, 119, 178, 296mini- 9, 108see also DNA amplification
fingerprintingSCAR, see Sequence characterized
amplified regionsSchizophyllum commune 226Schizosaccharomyces pombe 188Sclerotinia 68, 71Sclerotiniaceae 136Sclerotium 71Scutellospora 113
S. castanea 115
Scytalidium vaccinii 116SDA, see Strand displacement
amplificationSeedborne diseases 309–321Sequence characterized amplified
regions 12–13, 294–295Shiitake 138
see also LentinulaSequence tagged site (STS) 331Short tandem repeat (STR) 331Similarity coefficients 74Single-strand conformation
polymorphism 6–7, 13, 112,271–272
Siphulaceae 90Small subunit, see Ribosomal RNA gene
clusterSmittium 154
S. culisetae 140–141Solorina 90–91Sordariales 133Sorghum 309Southern blot, see HybridizationSoybean 309Species concepts 64Sphaerophoraceae 90Sphinctrinaceae 90Spicellum roseum 133Spizellomyces 141Splicing by overlap extension (PCR-
SOE) 326Sporothrix schenckii 71SSCP, see Single-strand conformation
polymorphismSimple sequence repeats (SSR) 296
see also DNA amplificationfingerprinting
Stabilization, PCR reaction 27Stenocarpella maydis 317Stereocaulaceae 90Sterigmatocystin 245, 246–247, 252Sticta 99Strand displacement amplification 9Strongwellsea 154Subtractive hybridization, see
HybridizationSugar 309Suillus 109–110, 139
S. granulatus 139
Index 355
Suillus continuedS. grevillei 139S. pungens 110
Suppression PCR 334–338
β-Tubulin gene 53–54, 69, 129–130, 135,197, 233
T2 toxin 243T/A cloning 35–36
see also CloningTalaromyces bacillisporus 132
T. flavus var. macrosporus 132Taphrina 132
T. populina 131T. wiesneri 131
Taq 2, 5, 7, 8, 28, 31, 36, 127, 194, 206,226, 252, 327, 342
see also DNA polymerasesTelomere fingerprinting 162Teloschistaceae 91Template 1, 2, 5, 7, 10, 48–49, 196,
197, 208, 209, 210, 211, 222, 234,341
Tetrahymena thermophila 96Thermus aquaticus 2Thlaspi 136Tilletia indica 314, 319, 342
T. laevis 311T. tritici 311
Tobacco necrosis virus 56Tolypocladium 159Tomato (Lycopersicon) 48, 53–59, 294,
296, 298, 300, 334Torrubiella 156Touchdown-PCR 5Trametes versicolor 221
T. villosa 217, 221Transfer RNA (tRNA) 158–159Trichocomaceae 132Trichoderma 70, 327
T. reesei 221–222T. virens 133see also Gliocladium
Trichosporon beigelii 267Trichothecens 245, 256, 259Trichothecium roseum 133Truffles 111, 136
see also Tuber
Tth 7, 29see also DNA polymerases
Tuber 68T. aestivum 112T. borchii 112T. brumale 112T. excavatum 112T. ferrugineum 112T. maculatum 112T. magnatum 70, 112T. melanosporum 112T. rufum 112
Tylospora fibrillosa 110Tyrosinase gene 340
Umbilicaria 85, 91U. cylindrica 99
Ustilaginales 138Ustilaginoidea virens 311Ustilago maydis 138, 311Usnea 89
Variable non-translated repeats 296,314, 317
see also DNA amplificationfingerprinting
Vector 189–195, 196, 198, 200, 226,293
see also CloningVent 24, 28
see also DNA polymerasesVerticillium 65–67, 290–291
V. albo-atrum 65, 67, 158V. chlamydosporium 67V. dahliae 65, 67, 158V. lecanii 158V. tricorpus 66
VNTR, see Variable non-translatedrepeats
Volvariella volvacea 138
Wheat 295, 309, 311, 318
Xanthomonas axonopodis pv. citri318–819
356 Index
Xanthomonas axonopodis continuedX. oryzae pv. oryzae 312, 319, 320
Xanthoria 91Xylanase genes 210, 226–230, 234Xylariales 132
Zearalenone 259Zoophthora 154
Z. phytonomi 156Z. radicans 141, 154–156
Zygomycota 107, 131
Index 357
