Journal Pre-proof

ARMS-qPCR Improves Detection Sensitivity of Earlier Diagnosis of Papillary ThyroidCancers with Worse Prognosis Determined by BRAF V600E and TERT Promoter Co-existing Mutations.

Peng-Cheng Yu, Li-Cheng Tan, Xiao-Li Zhu, Xiao Shi, Roman Chernikov, ArsenySemenov, Ling Zhang, Ben Ma, Yu Wang, Xiao-Yan Zhou, Qing-Hai Ji, Wen-Jun Wei,Yu- Long Wang

PII: S1530-891X(21)00021-5

DOI: https://doi.org/10.1016/j.eprac.2021.01.015

Reference: EPRAC 132

To appear in: Endocrine Practice

Received Date: 29 December 2020

Accepted Date: 8 January 2021

Please cite this article as: Yu PC, Tan LC, Zhu XL, Shi X, Chernikov R, Semenov A, Zhang L, MaB, Wang Y, Zhou XY, Ji QH, Wei WJ, Wang Y-L, ARMS-qPCR Improves Detection Sensitivity ofEarlier Diagnosis of Papillary Thyroid Cancers with Worse Prognosis Determined by BRAF V600Eand TERT Promoter Co-existing Mutations., Endocrine Practice (2021), doi: https://doi.org/10.1016/j.eprac.2021.01.015.

This is a PDF file of an article that has undergone enhancements after acceptance, such as the additionof a cover page and metadata, and formatting for readability, but it is not yet the definitive version ofrecord. This version will undergo additional copyediting, typesetting and review before it is publishedin its final form, but we are providing this version to give early visibility of the article. Please note that,during the production process, errors may be discovered which could affect the content, and all legaldisclaimers that apply to the journal pertain.

© 2021 Published by Elsevier Inc. on behalf of the AACE.

1

ARMS-qPCR Improves Detection Sensitivity of Earlier Diagnosis of Papillary Thyroid Cancers with Worse Prognosis 1

Determined by BRAF V600E and TERT Promoter Co-existing Mutations. 2

3

Peng-Cheng Yu1, 2,*, Li-Cheng Tan1, 2,*, Xiao-Li Zhu3, *,Xiao Shi 1, 2, Roman Chernikov4, Arseny Semenov4,Ling Zhang3, Ben 4

Ma1, 2, Yu Wang1, 2, Xiao-Yan Zhou3, Qing-Hai Ji1, 2, Wen-Jun Wei1, 2,Yu- Long Wang1, 2 5

6

1. Department of Head and Neck Surgery, Fudan University Shanghai Cancer Center, Shanghai, People's Republic of China. 7

2. Department of Oncology, Shanghai Medical College, Fudan University, Shanghai, People's Republic of China. 8

3. Department of Pathology, Fudan University Shanghai Cancer Center, Shanghai, People's Republic of China. 9

4. Endocrine Surgery Department, N.I.Pirogov Clinic of High Medical Technologies, Saint-Petersburg State University, 10

Russia. 11

12

* These authors contributed equally to this work. 13

14

Correspondence to: kakarwen@163.com(Wen-Jun Wei), yulongwang@fudan.edu.cn (Yu-Long Wang) 15

No.270 Dongan Rd, Shanghai, China, 200032 16

Telephone and Fax Number: +86-021-64175590 17

18

Funding Statement: 19

This study was mainly supported by the National Science Foundation of China (81772851 and 81972501 to Yu-Long Wang, 20

82002830 to Xiao Shi), and partially supported by the Shanghai Sailing Program (No. 20YF1408200 to Xiao Shi). 21

22 Journ

al Pre-

proof

2

Disclosure: The authors have no conflicts of interest to declare. 23

24

Acknowledgments: 25

We feel grateful to Wei-Wei Wei and Cun-Xin Jia of AmoyDx for the free ARMS-qPCR testing kits for BRAF V600E and 26

TERT promoter mutation detection and the technical support provided. 27

28

Journ

al Pre-

proof

1

ARMS-qPCR Improves Detection Sensitivity of Earlier Diagnosis of Papillary Thyroid Cancers with Worse Prognosis 1

Determined by BRAF V600E and TERT Promoter Co-existing Mutations. 2

3

Peng-Cheng Yu1, 2,*, Li-Cheng Tan1, 2,*, Xiao-Li Zhu3, *,Xiao Shi 1, 2, Roman Chernikov4, Arseny Semenov4,Ling Zhang3, Ben 4

Ma1, 2, Yu Wang1, 2, Xiao-Yan Zhou3, Qing-Hai Ji1, 2, Wen-Jun Wei1, 2,Yu- Long Wang1, 2 5

6

1. Department of Head and Neck Surgery, Fudan University Shanghai Cancer Center, Shanghai, People's Republic of China. 7

2. Department of Oncology, Shanghai Medical College, Fudan University, Shanghai, People's Republic of China. 8

3. Department of Pathology, Fudan University Shanghai Cancer Center, Shanghai, People's Republic of China. 9

4. Endocrine Surgery Department, N.I.Pirogov Clinic of High Medical Technologies, Saint-Petersburg State University, 10

Russia. 11

12

* These authors contributed equally to this work. 13

14

Correspondence to: kakarwen@163.com (Wen-Jun Wei), yulongwang@fudan.edu.cn (Yu-Long Wang) 15

No.270 Dongan Rd, Shanghai, China, 200032 16

Telephone and Fax Number: +86-021-64175590 17

18

Funding Statement: 19

This study was mainly supported by the National Science Foundation of China (81772851 and 81972501 to Yu-Long Wang, 20

82002830 to Xiao Shi), and partially supported by the Shanghai Sailing Program (No. 20YF1408200 to Xiao Shi). 21

22 Journ

al Pre-

proof

2

Disclosure: The authors have no conflicts of interest to declare. 23

24

Acknowledgments: 25

We feel grateful to Wei-Wei Wei and Cun-Xin Jia of AmoyDx for the free ARMS-qPCR testing kits for BRAF V600E and 26

TERT promoter mutation detection and the technical support provided. 27

28

29

30

31

32

33

34

35

36

37

38

39

40

41

42

43

44 Journ

al Pre-

proof

3

45

Abstract: 46

Objective: 47

The co-existence of BRAF V600E and TERT promoter mutation C228T/C250T has been extensively associated with thyroid 48

cancer prognosis. Our study aimed to establish a sensitive method for mutation detection and to explore the correlation in 49

detail. 50

Methods: 51

BRAF and TERT promoter mutation status of 250 papillary thyroid cancer was determined using both Amplification 52

Refractory Mutation System quantitative PCR (ARMS-qPCR) and Sanger sequencing to compare the sensitivity of these two 53

methods. The associations between the mutation status and the clinicopathological features were then analyzed. 54

Results: 55

Results showed that ARMS-qPCR was more sensitive than Sanger (BRAF V600E: 75.2% (188/250) vs. 52.4% (131/250), 56

p<0.001; TERT promoter C228T/C250T mutation: 12.0% (30/250) vs. 3.6% (9/250), p=0.001; Co-mutation (9.6% (24/250) vs. 57

3.2% (8/250), p=0.005). Both ARMS-qPCR and Sanger indicated that BRAF V600E and TERT promoter co-mutation patients 58

had a higher diagnosis age, recurrence rate, and were related to a more advanced TNM stage and higher MACIS score. 59

Moreover, ARMS-qPCR identified an earlier group stage which was younger, with a smaller tumor, and a lower recurrence 60

rate compared with the BRAF V600E and TERT promoter co-existing mutation Sanger results. Besides, the newly identified 61

group had a lower MACIS score and a lower TNM stage. 62

Conclusion: 63

In conclusion, patients with co-existing BRAF V600E and TERT promoter mutation have a worse prognosis. ARMS-qPCR, 64

the more sensitive method, can be used to identify the early stages of patients with a potentially worse prognosis. 65

Key Words: Thyroid cancer, ARMS-qPCR, BRAF, TERT 66 Journ

al Pre-

proof

4

67

68

Introduction 69

Thyroid cancer is the most common endocrine malignant tumor[1]. Papillary thyroid cancer (PTC) frequently occurs, about 70

80-85%, with a relatively better prognosis, whose 10-year Overall Survival (OS) rate could be more than 95%[2]. However, 71

poorly differentiated thyroid cancer (PDTC) and anaplastic thyroid cancer (ATC) have more aggressive behavior and a much 72

poorer prognosis. Evidence has shown that ATC and PDTC can arise de novo and be dedifferentiated from PTC[3]. 73

Identifying the potentially aggressive PTC can prevent dedifferentiation occurrence. However, predictors and mechanisms 74

remain unclear. 75

Currently, the high-resolution ultrasound, fine-needle aspiration (FNA), combined with the molecular diagnosis, are the 76

standard measures for thyroid nodules' management used to make a confidence-based choice to perform surgery or active 77

surveillance. Although the BRAF V600E's diagnostic specificity for malignant thyroid cancer may be more than 99%, it is 78

difficult to further distinguish PTC and PDTC/ATC since they have similar BRAF V600E mutation frequency [4]. There is a 79

need for new molecules or factors for auxiliary discrimination. Importantly, both sensitive and specific molecules and 80

detection methods should be used to estimate the clinicopathological feature's contribution and identify aggressive tumors. 81

Recent studies have shown that BRAF V600E and Telomerase reverse transcriptase (TERT) promoter mutation frequently 82

occurs in PDTC, ATC, or PTC, and the co-existence of BRAF V600E and TERT promoter mutation is associated with a poor 83

prognosis[5–7]. The BRAF V600E mutation frequency is about 40%, consistent with the previously reported in PTC. 84

However, TERT promoter mutation frequency may rise to 70% in ATC, 40% in PDTC and from 4-10% in PTC. The 85

co-existence rate of BRAF V600E and TERT promoter mutation may be about 10%[8]. Evidence has shown that BRAF 86

V600E can consistently activate the MAPK signaling pathway, indicating that BRAF V600E can be the cause of thyroid 87

cancer[9]. TERT promoter mutation can reactivate TERT transcription, making it not only to sustain telomere length through 88 Journ

al Pre-

proof

5

its canonical function but also to promote malignant transformation via multiple signaling pathway crosstalk[10]. TERT 89

promoter mutation is associated with a more severe histopathological subtype, and the co-existence of BRAF V600E and 90

TERT promoter mutation may be an apparent signature for patients with poor prognosis. 91

However, there is still no agreed best method for BRAF and TERT promoter mutation detection in thyroid cancer. In the past 92

decades, Sanger sequencing has been considered to be the best standard, and it is still recognized as the most specific method 93

to date. However, it has limitations, including the low detection sensitivity (the threshold about 10%) and low-throughput 94

(each reaction for a target sequence less than 1000bp) that gradually cannot satisfy the detection needs. Besides Sanger, there 95

are still many mutation detection methods, such as Amplification Refractory Mutation System quantitative PCR 96

(ARMS-qPCR), digital droplet PCR (ddPCR), and Next-Generation Sequencing (NGS), with much higher sensitivity or 97

higher throughput[11,12]. Previous studies have shown that the HRM (High-Resolution-Melting), IdyllaTM, RT-ASA, and 98

NGS have different sensitivity in BRAF mutation detection of melanoma FFPE (formalin-fixed paraffin-embedded) 99

section[13]. In the past decades, ARMS/ddPCR/NGS based methods were much more expensive than Sanger and more 100

difficult in technique development. QPCR or NGS based methods have been gradually used in clinical practice, not only in 101

thyroid cancer but also in NSCLC, colon cancer, melanoma because of their decreasing cost [14–17]. In PTC, BRAF V600E 102

mutation varies from 30-80%, and TERT promoter mutation 4-12%[2,8,18]. While the geographical region of patients, tissue 103

resources, tumor cell contamination have influence, the different mutation detection methods play an essential role in the 104

mutation frequency variation. Unified high-sensitivity mutation detection standards can minimize research bias and prevent 105

missed diagnosis. While there is no FDA/CFDA approved ARMS Kit for TERT promoter mutation, ARMS-qPCR has already 106

been used in clinical practice for BRAF mutation detection. C/G ratio of TERT promoter higher than 80% causing difficulties 107

in primer design and reaction stock optimization, resulting in the ARMS-TERT blank region. 108

We hypothesized that Sanger sequencing could not recognize only a few tumor cells with a somatic mutation in the whole 109

tumor. However, more sensitive methods can identify them during their early malignant transformation stage. Therefore, the 110 Journ

al Pre-

proof

6

BRAF and TERT promoter mutation status of 250 papillary thyroid cancer was detected using both ARMS-qPCR and Sanger 111

sequencing to compare their sensitivity[12,19]. The associations between the mutation status and the clinicopathological 112

features were also analyzed. 113

In conclusion, we found that both methods showed that tumors with co-existing BRAF V600E and TERT promoter mutation 114

are more aggressive. ARMS-qPCR was much more sensitive than Sanger sequencing for BRAF V600E and TERT promoter 115

mutation detection. ARMS-qPCR can be used to identify earlier patient stages with a potentially worse prognosis. 116

117

118

119

Methods: 120

1.Tissue collection and DNA extraction 121

All the 250 papillary thyroid carcinoma samples were collected from patients who received surgery in Fudan University 122

Shanghai Cancer Center between 2014 to 2016. The specimens were collected within 30 minutes after dissection, and 123

immediately transferred to a liquid nitrogen container, and stored at -80℃ to ensure the quality of tissue preservation. The 124

Institutional Review Board of FUSCC approved this study, and each patient provided informed consent. Total DNA was 125

extracted using the DNA extraction kit (Tiangen Biotech, #DP304, China), DNA concentration and purification were 126

measured using Nanodrop 2000 (Thermo Fisher, USA) and the clinical and pathologic data prospectively collected for 127

analysis. 128

129

2. Sanger sequencing 130

We used nest-PCR for TERT promoter amplification and regular PCR procedure for BRAF V600 amplification. The 131

TaKaRa TaqTM (TaKaRa, R001B, Japan) and Premix Taq™ (TaKaRa, RR003A, Japan) were separately used for the TERT 132 Journ

al Pre-

proof

7

promoter and BRAF amplification. The lateral primer Sanger-TERTp-1F: TAGGCCGATTCGACCTCTCT and 1R: 133

ACCTCGCGGTAGTGGCTGC first amplified the 488bp products, and we then used the internal primer Sanger-TERTp-2F: 134

AGCGCTGCCTGAAACTCGC and 2R: CACAGACGCCCAGGACCG for internal amplification to get 220bp products. 135

Both procedures had the following amplification conditions: 1 cycle at 94 °C for 3 min, 35 cycles at 94 °C for 30 s, 59 °C for 136

30 s and 72 °C for 30 s, 1 cycle at 72 °C for 10 min. For BRAF V600 sequencing, we just used the Sanger-BRAF-F: 137

GCTTGCTCTGATAGGAAAATGAG and R: GTAACTCAGCAGCATCTCAGG to obtain a 237bp product, with the 138

annealing temperature of 55°C. The sequencing was performed on ABI 3730XL, using the primer TERT-RS: 139

ACGTGGCGGAGGGACTGG and Sanger-BRAF-F for sequencing. Samples with mutation rates above 15% were deemed to 140

have undergone mutation. 141

142

3. ARMS-qPCR based BRAF and TERT promoter mutation detection 143

BRAF and TERT promoter mutation detection assays were performed using BRAF V600E Diagnostic Kit (AmoyDx, China) 144

and TERT promoter mutation detection Kit (AmoyDx, China) on an ABI 7500 Real-time PCR system (Life Technologist, 145

USA) according to the manufacturer's instructions. 5-10 ng genomic DNA was added in a 50 μl system in each assay. The 146

amplification conditions included: 1 cycle at95 °C for 5 min, 15 cycles at 95 °C for 25 s, 64 °C for 20 s, and 72 °C for 20 s, 147

31 cycles at 93 °C for 25 s, 60 °C for 35 s, and 72 °C for 20 s, and the fluorescent signals were recorded at 60 °C. The 148

mutation status classification was identified following the manuscripts of kits. 149

150

4. Statistical analysis 151

Continuous variables such as age and size were compared using Student's t-test, and the categorical variables were 152

compared using the chi-square test or Fisher's exact test, appropriately. Kaplan–Meier analysis and log-rank tests were used to 153

generate and compare the recurrence-free survival curves. The Kaplan-Meier survival plots were generated using Graphpad 154 Journ

al Pre-

proof

8

Prism 7.0 (GraphPad Software, San Diego, CA). The statistical analyses were carried out using SPSS (IBM SPSS Statistics 25, 155

USA). A two-sided p-value <0.05 was considered statistically significant. 156

157

158

Results 159

1. Characteristics of the patients included in this study. 160

We retrospectively collected the clinicopathological data of the 250 patients (Table 1), including the age at the time of 161

surgery, gender, maximum tumor diameter, multifocality, Hashimoto's thyroiditis, vascular, capsular, muscle invasion status, 162

and TNM stage. We then calculated the MACIS score (Metastasis, Age, Completeness of resection, Invasion, and Size) with 163

prognostic survival[20]. We followed the patient for 1200 ± 261.4 days after surgery and recorded the recurrence time. 164

2. ARMS-qPCR has higher BRAF and TERT promoter mutation detection sensitivity. 165

The DNA extracted from frozen papillary thyroid carcinoma tissues stored in liquid nitrogen was analyzed for BRAF 166

V600E and TERT promoter mutation using Sanger sequencing and ARMS-qPCR separately. The BRAF mutation frequency 167

using the Sanger sequencing method was 52.4%（131/250）, vs. 75.2% (188/250) using ARMS-qPCR (Supplementary Figure 168

s1A&s1B). TERT promoter mutation frequency increased from 3.6% (9/250) using Sanger and to 12.0% (30/250) using 169

ARMS (Figure s1C&s1D). We compared the co-existing frequency of the two detection methods since several studies have 170

found that the co-existence of BRAF V600E and TERT promoter mutation defines the most aggressive subtype of thyroid 171

follicular cell-derived carcinoma. We found that the ARMS-qPCR could improve the co-existing frequency from 3.2% (8/250) 172

to 9.6% (24/250) (Figure 1A&1B). In summary, ARMS-qPCR has a higher sensitivity than Sanger in BRAF V600E and TERT 173

promoter mutation detection. 174

175

3. TERT promoter mutation is associated with a worse prognosis, while BRAF V600E shows no apparent significance. 176 Journ

al Pre-

proof

9

We analyzed the association between TERT promoter C228/C250 mutation or BRAF V600E and clinicopathological 177

features. The results of both Sanger and ARMS methods showed that patients with TERT promoter mutation were older 178

compared with wild type (Sanger: 62.2±9.0 vs 40.5±12.6, p < 0.0001; ARMS: 51.3 ± 13.1 vs 39.9±12.5, p < 0.0001), had a 179

higher recurrence frequency (Supplementary Figure 2A&2B) (Sanger: 44.4% (4/9) vs 2.9% (7/241), p < 0.0001; ARMS: 13.3% 180

(4/30) vs 3.2% (7/220), p = 0.031), higher MACIS score (Sanger: 6.3±1.3 vs 4.2±0.8, p = 0.001; ARMS: 5.1±1.3 vs 4.2±0.8, 181

p = 0.002), and higher grade of T stage (Sanger: p < 0.0001; ARMS: p = 0.001) and TNM stage (Sanger: p < 0.0001; ARMS: 182

p =0.001)(Table 2). 183

However, the results indicated that BRAF V600E mutation assessed using both Sanger and ARMS had no significant effect 184

on tumor capsular or muscle invasion frequency, and tumor multifocality or recurrence frequency or MACIS score (Table s1). 185

Besides, there was no apparent difference in the TNM stage distribution between BRAF V600E and BRAF wild-type. The 186

Sanger sequencing results showed that the tumors were bigger than in the wild type group among BRAF V600E patients 187

(2.0cm±1.2cm vs. 1.7cm±1.0cm, p = 0.024). The Sanger results indicated that the BRAF V600E group had less patients with 188

vascular invasion (0% vs. 5.0%, p =0.011), consistent with the ARMS results (2.1% vs. 3.2%, p = 0.640). 189

TERT promoter mutation appears to be associated with a much poorer prognosis while BRAF V600E has no significant 190

effect. 191

192

4. Both methods indicate that the co-existence of BRAF V600E and TERT promoter mutation is associated with a 193

worse prognosis. 194

Previous studies have shown that the presence of BRAF V600E or TERT promoter mutation is associated with a poor 195

prognosis, especially in patients with co-existing BRAF V600E and TERT promoter mutation [8,21]. We analyzed the 196

clinicopathological features and recurrence status of patients to compare the difference between BRAF V600E and wild-type, 197

TERT promoter mutation and wild-type, and whether there was co-mutation or not, to identify whether the association still 198 Journ

al Pre-

proof

10

exist when ARMS-qPCR improves the mutation detection sensitivity. In summary, patients with co-existing BRAF V600E and 199

TERT promoter mutation had more aggressive features (Table 3). 200

Both Sanger and ARMS showed that, the patients with co-existing BRAF V600E and TERT promoter were older (Sanger: 201

66.4±6.1 vs 40.4±12.5, p < 0.0001; ARMS: 51.0±14.2 vs 40.2±12.6, p < 0.0001), with higher recurrence risk(Figure 2A&2B) 202

(Sanger: 50% vs 2.9%, p < 0.0001; ARMS: 16.7% vs 3.1%，p = 0.014 ), higher MACIS score (Sanger: 6.9±0.7 vs 4.2±0.8, p < 203

0.0001; ARMS: 5.1±1.5 vs 4.2±0.7, p = 0.006), and more advanced grade of T stage (Sanger: p < 0.0001; ARMS: p < 0.0001) 204

and TNM stage (Sanger: p < 0.0001; ARMS: p < 0.0001) (Table 3). We compared the association between mutation identified 205

using Sanger or ARMS separately and clinicopathological features. We identified several different analytical results such as 206

the patient's gender, tumor size, Hashimoto's thyroiditis, and muscle invasion, as shown in Table 3. In summary, both Sanger 207

and ARMS results indicated that co-existing BRAF V600E and TERT promoter mutation is associated with a much poorer 208

prognosis. 209

210

5. ARMS-qPCR can identify co-existing BRAF V600E and TERT promoter mutation patients earlier with a potentially 211

worse prognosis. 212

ARMS-qPCR detected more BRAF V600E and TERT promoter mutation, while the features of the newly identified group 213

remain unclear. The positive co-existing BRAF V600E and TERT promoter mutation identified using ARMS were classified 214

into two groups; the Sanger mutation-positive and negative (Table 4). The results showed that the newly detected group was 215

much younger (43.3±10.1 vs. 66.4±6.1, p < 0.0001). Besides, the group had fewer malignant features, much smaller tumor 216

size (1.8cm ±1.5cm vs. 4.0cm±1.3cm, p = 0.002), much lower recurrence frequency (0.0% (0/16) vs. 50% (4/8), p = 0.007), 217

and lower MACIS score, showing that this group had a much better long-term prognosis and survival. The T stage and TNM 218

stage grades were also lower. We also analyzed the Sanger mutation-negative group and found that ARMS-co-mutation 219

positive patients were older than the ARMS-BRAF Wild type/TERT promoter wild type patients ( 51.0±14.2 vs. 37.7±13.5, p 220 Journ

al Pre-

proof

11

< 0.0001 ), with higher recurrence frequency (16.7% (4/24) vs. 3.6% (2/56), p = 0.042), higher MACIS score, and advanced 221

TNM stage (Supplementary Table s2). 222

Such a phenomenon was also seen when we did the same analysis in the ARMS-TERT promoter mutation group, but not in 223

the ARMS-BRAF group. In the ARMS-TERT promoter mutation group, the newly identified group had much younger patients 224

and had a smaller tumor, less muscle invasion occurrence, less recurrence frequency and lower MACIS score. 225

However, there was a difference only in tumor size, Hashimoto's thyroiditis, vascular invasion in the ARMS-BRAF V600E 226

group. The newly detected group had smaller tumor (1.6cm±1.0cm vs 2.0cm±1.2cm, p = 0.006), more Hashimoto’s 227

thyroiditis (31.1% vs 12.6%, p = 0.002), and more vascular invasion (6.6% vs 0.0%, p = 0.010), while there was no 228

significant change in the age, recurrence frequency, TNM stage or MACIS score. 229

230

231

Discussion 232

To date, there is no widely accepted mutation detection method for BRAF V600E and TERT promoter mutation for a 233

thyroid nodule, and the difference in various mutation detection methods remains unclear. We compared two different 234

mutation detection methods, Sanger and ARMS, for BRAF and TERT promoter mutation, using DNA extracted from the same 235

thyroid cancer tissues. We found that ARMS has a higher sensitivity, determined by its fundamental principle that selectively 236

amplifies the target allele, consistent with previous studies involved in non-small-cell lung cancer, melanoma FFPE 237

samples[16]. The threshold of Sanger sequencing methods is usually 10% mutant allele, while ARMS-based methods can 238

detect as low as 1-5% mutant allele[22]. Besides, ARMS-qPCR is much more time-saving since it only requires the qPCR 239

procedure, while Sanger sequencing requires the PCR amplification and sequencing. The newly detected co-existing ARMS 240

with BRAF V600E and TERT promoter mutation patients were younger and had less malignant clinicopathological features. 241

The BRAF V600E mutation effect on prognosis has been controversial in thyroid cancer for many years, while the TERT 242 Journ

al Pre-

proof

12

promoter has been widely accepted as a poor prognosis marker[8]. Most studies have indicated that BRAF V600E is not only 243

an excellent PTC diagnosis marker but is also associated with a poor prognosis[23,24]. However, some studies have not 244

determined any association between BRAF V600E mutation and thyroid cancer prognosis[25]. BRAF V600E mutation 245

appears to be the only driver gene that causes multiple cancer, indicating that it occurs at the early cancer initiation stage. In 246

contrast, the progression to the more aggressive behavior of most cancer needs the "second hit", such as function loss of TP53 247

or PTEN, or recently found TERT promoter mutation[26–30]. It has been shown that all the BRAFCA/+；TPO-CreERT2 mice 248

harbor PTC in transgene mice after several months. However, only a relatively few PTC transformed into a more aggressive 249

form. 250

On the contrary, the additional function loss of P53 transformed the PTC into ATC[26]. This phenomenon is similar to that 251

in humans. Most PTC patients, even with BRAF V600E, have a relatively small tumor and excellent prognosis. In contrast, a 252

few patients can develop into locally advanced grade thyroid cancer or, unfortunately, into PDTC or ATC. P53 or PTEN 253

function loss or TERT promoter mutation can play a critical role in the malignant transformation. In summary, more attention 254

should be paid to the TERT promoter mutation status detection. 255

In our study, ARMS detected 9.5% co-existing BRAF V600E and TERT promoter patients. Sanger had 3.2%, indicating that 256

6.3% of patients who had earlier been detected using ARMS could be treated earlier via thyroid surgery instead of active 257

surveillance. We assumed that during the early period of "second hit", there was a period when the tumor cells with multiple 258

mutations and immune systems come to a balance because of the OIS (oncogene-induced senescence) [29,31]. During this 259

period, the number of tumor cells could be so small that only the relatively sensitive method can detect them; otherwise, they 260

can be missed. However, the good news is that the surgeon can remove the thyroid lobe just when found, with a few tumor 261

cells with the potential dedifferentiation ability, to prevent the balance from breaking. Previous EGFR mutation detection 262

studies have stated that successful first-generation sequencing EGFR analysis needs at least one of the three standards: DNA 263

concentration >25 ng/μl, the presence of tumor cells >30, or a tumor percentage >30 %, which is a relatively strict standard 264 Journ

al Pre-

proof

13

for FNA samples[32]. TERT promoter mutation usually occurs in human life from the middle to old age. There should be a 265

prolonged period during which TERT promoter mutation tumor cells can proliferate and become immortalized. 266

Although there was no large sample size with TERT promoter mutation in our study, the existing research data has already 267

verified the results of previous reports that co-existing BRAF V600E and TERT promoter mutation defines the most 268

aggressive group. Besides comparing the different mutation methods sensitivity, our research also clarified the progression of 269

the non-overlapping group. Currently, ARMS is the sensitive and cost-effective method for a few genes with known mutation 270

detection but it is not applicable in multiple genes. Most studies have stated that ddPCR has higher sensitivity than 271

ARMS-qPCR and a high cost. However, it is still a PCR-based technique, relying on the primer and amplification procedure. 272

Meta-analysis comparison of EGFR mutation detection methods showed that there is no significant difference in specificity 273

and sensitivity between ddPCR and ARMS-qPCR[33]. Thyroseq and other Next-Generation Sequencing-based methods, such 274

as FoundationOne CDx, have high-throughput but costs a lot. Considering that most PTC only carry BRAF or RAS mutation, 275

while other mutations even less than 2%, widely used NGS costs a lot[34]. However, PDTC and ATC usually carry several 276

mutations, such as TERT, BRAF, TP53, RAS, EIF1AX, all of these with a mutation frequency higher than 10%. And there're 277

many genes with mutation frequency higher than 5%, including PI3KCA, ATM, PTEN, CREBBP, which have already been 278

proved to associate with cancer-initiating and progress[6]. Considering these, NGS is much more suitable for PDTC or ATC 279

patients. Besides, NGS still cannot specifically amplify the target allele, making it have lower sensitivity than ARMS and 280

ddPCR, and it is not suitable for the low abundance mutation detection for specific genes [34–36]. 281

In conclusion, it is necessary to develop a highly sensitive method for early identification in the somatic mutation detection, 282

especially for those low-frequency but essential mutations such as TERT promoter. Furthermore, prospective FNA sample 283

studies using more sensitive mutation detection methods can help in decision making in surgery and active surveillance. 284

285

286 Journ

al Pre-

proof

14

References: 287

1 Powers AE, Marcadis AR, Lee M, et al. Changes in Trends in Thyroid Cancer Incidence in the United States, 1992 to 288 2016. JAMA 2019; 322: 2440-2441 289

2 Dralle H, Machens A, Basa J, et al. Follicular cell-derived thyroid cancer. Nat Rev Dis Primers 2015; 1: 15077 290

3 Ma B, Xu W, Wei W, et al. Clinicopathological and Survival Outcomes of Well-Differentiated Thyroid Carcinoma 291 Undergoing Dedifferentiation: A Retrospective Study from FUSCC. Int J Endocrinol 2018; 2018: 2383715 292

4 Nikiforov YE, Nikiforova MN. Molecular genetics and diagnosis of thyroid cancer. Nat Rev Endocrinol 2011; 7: 569-580 293

5 Lee SE, Hwang TS, Choi Y-L, et al. Prognostic Significance of TERT Promoter Mutations in Papillary Thyroid 294 Carcinomas in a BRAF(V600E) Mutation-Prevalent Population. Thyroid 2016; 26: 901-910 295

6 Landa I, Ibrahimpasic T, Boucai L, et al. Genomic and transcriptomic hallmarks of poorly differentiated and anaplastic 296 thyroid cancers. J Clin Invest 2016; 126: 1052-1066 297

7 Ngeow J, Eng C. TERT and BRAF in thyroid cancer: teaming up for trouble. J Clin Oncol 2014; 32: 2683-2684 298

8 Xing M, Liu R, Liu X, et al. BRAF V600E and TERT promoter mutations cooperatively identify the most aggressive 299 papillary thyroid cancer with highest recurrence. J Clin Oncol 2014; 32: 2718-2726 300

9 Caronia LM, Phay JE, Shah MH. Role of BRAF in Thyroid Oncogenesis. Clin Cancer Res 2011; 17: 7511-7517 301

10 Pestana A, Vinagre J, Sobrinho-Simões M, et al. TERT biology and function in cancer: beyond immortalisation. Journal 302 of Molecular Endocrinology 2017; 58: R129-R146 303

11 Li X, Li E, Du J, et al. BRAF mutation analysis by ARMS-PCR refines thyroid nodule management. Clin Endocrinol 304 (Oxf) 2019; 91: 834-841 305

12 Liu J, Zhao Z, Sun M, et al. The Sensitive Detection of Telomerase Reverse Transcriptase Promoter Mutation by 306 Amplification Refractory Mutation System-PCR. Genet Test Mol Biomarkers 2016; 20: 90-93 307

13 Harlé A, Salleron J, Franczak C, et al. Detection of BRAF Mutations Using a Fully Automated Platform and Comparison 308 with High Resolution Melting, Real-Time Allele Specific Amplification, Immunohistochemistry and Next Generation 309 Sequencing Assays, for Patients with Metastatic Melanoma. PLOS ONE 2016; 11: e0153576 310

14 Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A 1977; 74: 311 5463-5467 312

15 Martinez DA, Nelson MA. The next generation becomes the now generation. PLoS Genet 2010; 6: e1000906 313

16 Ellison G, Donald E, McWalter G, et al. A comparison of ARMS and DNA sequencing for mutation analysis in clinical 314 biopsy samples. Journal of Experimental & Clinical Cancer Research 2010; 29: 132 315

17 Bando H, Tsuchihara K, Yoshino T, et al. Biased Discordance of KRAS Mutation Detection in Archived Colorectal 316 Journ

al Pre-

proof

15

Cancer Specimens Between the ARMS–Scorpion Method and Direct Sequencing. Jpn J Clin Oncol 2011; 41: 239-244 317

18 Melo M, Gaspar DRA, Batista R, et al. TERT, BRAF, and NRAS in Primary Thyroid Cancer and Metastatic Disease. J 318 Clin Endocrinol Metab 2017; 102: 1898-1907 319

19 Zhao J, Zhao J, Huang J, et al. A novel method for detection of mutation in epidermal growth factor receptor. Lung 320 Cancer 2011; 74: 226-232 321

20 Hay ID, Bergstralh EJ, Goellner JR, et al. Predicting outcome in papillary thyroid carcinoma: development of a reliable 322 prognostic scoring system in a cohort of 1779 patients surgically treated at one institution during 1940 through 1989. 323 Surgery 1993; 114: 1050-1057; discussion 1057-1058 324

21 Landa I, Ganly I, Chan TA, et al. Frequent somatic TERT promoter mutations in thyroid cancer: higher prevalence in 325 advanced forms of the disease. J Clin Endocrinol Metab 2013; 98: E1562-6 326

22 Newton CR, Graham A, Heptinstall LE, et al. Analysis of any point mutation in DNA. The amplification refractory 327 mutation system (ARMS). Nucleic Acids Res 1989; 17: 2503-2516 328

23 Li F, Chen G, Sheng C, et al. BRAFV600E mutation in papillary thyroid microcarcinoma: a meta-analysis. Endocr Relat 329 Cancer 2015; 22: 159-168 330

24 Kim S, Lee KE, Myong JP, et al. BRAF V600E mutation is associated with tumor aggressiveness in papillary thyroid 331 cancer. World J Surg 2012; 36: 310-317 332

25 Niederer-Wüst SM, Jochum W, Förbs D, et al. Impact of clinical risk scores and BRAF V600E mutation status on 333 outcome in papillary thyroid cancer. Surgery 2015; 157: 119-125 334

26 McFadden DG, Vernon A, Santiago PM, et al. p53 constrains progression to anaplastic thyroid carcinoma in a 335 Braf-mutant mouse model of papillary thyroid cancer. Proc Natl Acad Sci USA 2014; 111: E1600-1609 336

27 Pearson HB, Li J, Meniel VS, et al. Identification of Pik3ca Mutation as a Genetic Driver of Prostate Cancer That 337 Cooperates with Pten Loss to Accelerate Progression and Castration-Resistant Growth. Cancer Discov 2018; 8: 764-779 338

28 Bian Y, Hall B, Sun Z-J, et al. Loss of TGF-β signaling and PTEN promotes head and neck squamous cell carcinoma 339 through cellular senescence evasion and cancer-related inflammation. Oncogene 2012; 31: 3322-3332 340

29 Chandeck C, Mooi WJ. Oncogene-induced cellular senescence. Adv Anat Pathol 2010; 17: 42-48 341

30 Huang FW, Hodis E, Xu MJ, et al. Highly Recurrent TERT Promoter Mutations in Human Melanoma. Science 2013; 339: 342 957-959 343

31 Hanahan D, Weinberg RA. Hallmarks of Cancer: The Next Generation. Cell 2011; 144: 646-674 344

32 Sun P-L, Jin Y, Kim H, et al. High concordance of EGFR mutation status between histologic and corresponding cytologic 345 specimens of lung adenocarcinomas. Cancer Cytopathol 2013; 121: 311-319 346

33 Li CC, He Q, Liang H, et al. Diagnostic accuracy of droplet digital PCR (ddPCR) and amplification refractory mutation 347 Journ

al Pre-

proof

16

system PCR (ARMS-PCR) for detecting EGFR mutation in cell-free DNA of advanced lung cancer: A meta-analysis. 348 Annals of Oncology 2019; 30: ii13 349

34 Agrawal N, Akbani R, Aksoy BA, et al. Integrated Genomic Characterization of Papillary Thyroid Carcinoma. Cell 2014; 350 159: 676-690 351

35 Nikiforova MN, Mercurio S, Wald AI, et al. Analytical performance of the ThyroSeq v3 genomic classifier for cancer 352 diagnosis in thyroid nodules. Cancer 2018; 124: 1682-1690 353

36 Pozdeyev N, Gay LM, Sokol ES, et al. Genetic Analysis of 779 Advanced Differentiated and Anaplastic Thyroid Cancers. 354 Clin Cancer Res 2018; 24: 3059-3068 355

356

357

358

Table 1. Characteristics of patients included in this study 359

Sanger BRAF V600E

TERT promoter mutation Co-existing ARMS-qPCR BRAF V600E TERT promoter mutation Co-existing Age at diagnosis, years

131(52.4%) 9(3.6%) 8(3.2%) 188(75.2%) 30(12.0%) 24(9.6%) 41.3±13.1

Sex, male 79(31.6%) Size, cm 1.9±1.1 Multifocality 85(34.0%) Hashimoto's thyroiditis 54(21.6%) Vascular invasion 6(2.4%) Capsular invasion 100(40.0%) Muscle invasion 16(6.4%) Recurrence 11(4.4%) MACIS±SD * 4.3±0.9 T 1 178(71.2%) 2 53(21.2%) 3 18(7.2%) 4 1(0.4%) N 0 68(27.2%)

Journ

al Pre-

proof

17

1A 98(39.2%) 1B 84(33.6%) M 0 250(100%)

1 0(0%) TNM

I 223(89.2%) II 25(10.0%) III 2(0.8%) IV 0(0%) I+II 248(99.2%) III+IV 2(0.8%)

Note: *: MACIS score(Metastasis, Age, Completeness of resection, Invasion, and Size) 360

361

362

Table 2. The correlation between TERT promoter mutation and clinicopathological features of PTC 363

ARMS-qPCR-TERTp * mutation p

Sanger-TERTp * mutation p

+† (n=30) -‡ (n=220) +† (n=9) -‡ (n=241) Age at diagnosis, years 51.3±13.1 39.9±12.5 0.000 62.2±9.0 40.5±12.6 0.000 Sex, male(%) 16(53.3) 63(28.6) 0.006 2(22.2) 77(32.0) 0.723 Size, cm 2.4±1.8 1.8±1.0 0.081 3.3±1.8 1.8±1.0 0.039 Multifocality(%) 10(33.3) 75(34.1) 0.935 2(22.2) 83(34.4) 0.722 Hashimotos thyroiditis (%) 2(6.7) 52(23.6) 0.034 0(0.0) 54(22.4) 0.212 Vascular invasion(%) 0(0.0) 6(2.7) 1.000 0(0.0) 6(2.5) 1.000 Capsular invasion(%) 11(36.7) 89(40.5) 0.691 5(55.6) 95(39.4) 0.490 Muscle invasion(%) 4(13.3) 12(5.5) 0.109 3(33.3) 13(5.4) 0.014 Recurrence (%) 4(13.3) 7(3.2) 0.031 4(44.4) 7(2.9) 0.000 MACIS±SD 5.1±1.3 4.2±0.8 0.002 6.3±1.3 4.2±0.8 0.001 T 0.001 0.000 1 16(53.3) 162(73.6) 2(22.2) 176(73.0) 2 7(23.3) 46(20.9) 3(33.3) 50(20.7) 3 6(20.0) 12(5.5) 3(33.3) 15(6.2) 4 1(3.3) 0(0.0) 1(11.1) 0(0.0) N 0.889 0.466 0 9(30.0) 59(26.8) 1(11.1) 67(27.8) 1A 12(40.0) 86(39.1) 5(55.5) 93(38.6) 1B 9(30.0) 75(34.1) 3(33.3) 81(33.6) M / / 0 30 221 9 242

1 0 0 0 0 Jo

urnal

Pre-pro

of

18

TNM 0.001 0.000 I 21(70.0) 202(91.8) 3(33.3) 220(91.3) II 8(26.7) 17(7.7) 5(55.5) 20(8.3) III 1(3.3) 1(0.5) 1(11.1) 1(0.4) IV 0(0.0) 0(0.0) 0(0.0) 0(0.0) I+II 29(96.7) 219(99.5) 8(88.8) 240(99.6)

III+IV 1(3.3) 1(0.5) 1(11.1) 1(0.4)

Note: TERTp*, TERT promoter; +†, mutation-positive; -‡, mutation-negative 364

365

366

367

368

369

Table 3. The difference of the clinicopathological features between BRAF V600E and TERT promoter mutation 370

co-existing(Co-mut) and No-co-existing(Non-co-mut) group. 371

ARMS-qPCR p

Sanger p Co-mut

(n=24) Non-co-mut

(n=226) Co-mut (n=8)

Non-co-mut (n=242)

Age 51.0±14.2 40.2±12.6

0.000 66.4±6.1 40.4±12.5

0.000

Sex(male) 13(54.2) 66(29.2) 0.012 3(37.5) 76(31.4) 0.710 Size(cm)

2.5±1.8 1.8±1.0 0.057

4.0±1.8 1.8±1.0 0.000

Multifocality(%) 8(33.3) 77(34.1) 0.942 1(12.5) 84(34.7) 0.271 Hashimotos thyroiditis (%) 1(4.2) 53(23.5) 0.029 0(0.0) 54(22.3) 0.207 Vascular invasion(%) 0(0.0) 6(2.7) 1.000 0(0.0) 6(2.5) 1.000 Capsular invasion(%) 10(41.7) 90(39.8) 1.000 5(62.5) 95(39.3) 0.272 Muscle invasion(%) 4(16.7) 12(5.3) 0.054 3(37.5) 13(5.4) 0.010 Recurrence (%) 4(16.7) 7(3.1) 0.014 4(50.0) 7(2.9) 0.000 MACIS±SD

5.1±1.5 4.2±0.7 0.006

6.9±0.7 4.2±0.8 0.000

T 0.000 0.000 1 12(50.0) 166(73.5) 0(0) 178(73.6) 2 6(25.0) 47(20.8) 3(37.5) 50(20.7) 3 5(20.8) 13(5.8) 4(50.0) 14(5.8) 4 1(4.2) 0(0.0) 1(12.5) 0(0.0)

Journ

al Pre-

proof

19

N 0.707 0.516 0 5(20.8) 63(27.9) 1(12.5) 67(27.7) 1A 11(45.8) 87(38.5) 3(37.5) 95(39.3) 1B 8(33.3) 76(33.6) 4(50.0) 80(33.1) M / / 0 24 226 8 242

1 0 0 0 0 TNM 0.000 0.000

I 15(62.5) 208(92.0) 1(12.5) 221(91.7) II 8(33.3) 17(7.5) 6(75.0) 19(7.9) III 1(4.2) 1(0.4) 1(12.5) 1(0.4) IV 0(0.0) 0(0.0) 0(0.0) 0(0.0) I+II 23(95.8) 225(99.5) 7(87.5) 241(99.6) III+IV 1(4.2) 1(0.4) 1(12.5) 1(0.4)

372

373

374

Table 4. In ARMS-BRAF V600E and TERT promoter mutation co-existing group, the difference between 375

Co-mut-positive and negative group detected by Sanger. 376

BRAF V600E and TERT promoter co-mutation status ARMS-qPCR+, Sanger+(n=8) ARMS-qPCR+, Sanger- (n=16) p Age at diagnosis, years 66.4±6.1 43.3±10.1 0.000 Sex, male(%) 3(37.5) 10(62.5) 0.390 Size, cm 4.0±1.3 1.8 ±1.5 0.002 Multifocality(%) 1(12.5) 7(43.8) 0.189 Hashimotos thyroiditis (%) 0(0.0) 1(6.3) 1.000 Vascular invasion(%) 0(0.0) 0(0.0) / Capsular invasion(%) 5(62.5) 5(31.3) 0.204 Muscle invasion(%) 3(37.5) 1(6.3) 0.091 Recurrence (%) 4(50.0) 0(0.0) 0.007 MACIS±SD 6.9±0.7 4.2±0.8 0.000 T 0.003

1 0(0.0) 12(75.0) 2 3(37.5) 3(18.8) 3 4(50.0) 1(6.3) 4 1(12.5) 0(0.0)

N 0.453 0 1(12.5) 4(25.0) 1A 3(37.5) 8(50.0)

Journ

al Pre-

proof

20

1B 4(50.0) 5(25.0) M /

0 8 16 1 0 0

TNM 0.001 I 1(12.5) 14(87.5) II 6(75.0) 3(12.5) III 1(12.5) 0(0.0) IV 0(0.0) 0(0.0) I+II 6(87.5) 17(100.0) III+IV 1(12.5) 0(0.0)

377

378

379

Figure 1. ARMS-qPCR has more sensitivity in BRAF V600E and TERT promoter mutation detection than Sanger sequencing. 380

(1A) and (1B) There're 8(3.6%) patients identified as BRAF V600E and TERT promoter mutation co-existing and 226(88%) patients as 381

non-co-existing by both Sanger and ARMS-qPCR, and 16(8.4%) patients identified as co-existing by ARMS-qPCR but wild-type by Sanger. 382

(1C)The representative figure of the detection results: BRAF wild-type by Sanger but V600E by ARMS-qPCR. 383

(1D)The representative figure of the detection results: TERT promoter wild-type by Sanger but mutation by ARMS-qPCR. 384

Note: TERTp, TERT promoter; **, p = 0.005 385

386

387

388

Figure 2. Both Sanger sequencing and ARMS-qPCR show co-existing of BRAF V600E and TERT promoter mutation associated with 389

higher recurrence frequency. 390

(2A) and (2B) Recurrence-free survival curve of Sanger or ARMS-qPCR results for BRAF V600E and TERT promoter mutation co-existing. 391

Note: Non-co-mut: Non-co-existing of BRAF V600E and TERT promoter mutation; Co-mut: Co-existing of BRAF V600E and TERT promoter 392 Journ

al Pre-

proof

21

mutation. 393

394

395

Journ

al Pre-

proof

Journ

al Pre-

proof

Journ

al Pre-

proof

Highlights:

·Co-existing BRAF V600E and TERT promoter mutation associates with a worse

prognosis.

·First time verify that ARMS has higher sensitivity than Sanger in BRAF and TERT

promoter mutation detection.

·ARMS could identify the the early stages of patients with a potentially worse

prognosis

Journ

al Pre-

proof