Upload
others
View
2
Download
0
Embed Size (px)
Citation preview
Artists and Scientists
Curated by Kim Grant and Carolyn Eyler
September 22 - November 10, 2011
University of Southern Maine Art Gallery
Gorham, Maine
Cole Caswell
Dave Champlin
Sara Crisp
Nina Katchadourian
Barrett Klein
Steven Kutcher
Mike Libby
Jim Nutting
Ken Weber
2 3
September 22-November 10, 2011 USM Art Gallery, Gorham
Opening Reception: ThUrSdAy, SEpT. 22, 6-8 pm
Engaging Insects Roundtable: ThUrSdAy, SEpT. 22, 4:15-5:45 pm in the Art Gallery
Arttalk: Visiting Artist Nina KatchadourianFridAy, SEpT. 23, 1 pm, Burnham Lounge, robie Andrews hall, Gorham
Free Film Screening: Beetle Queen Conquers TokyoMoNdAy, oCT. 17, 5:15-6:45 pm, Lee Auditorium, Wishcamper, portland ThUrSdAy, oCT. 20, 4-5:30 pm, Bailey hall room 10, Gorhamwww.beetlequeen.com
Sponsored by the department of Environmental Science, Communications and Media Studies department, Biology department and the Biology Student Club, Gorham Student Life,
USM Art Gallery, and Women & Gender Studies program.
ArT GALLEry hoUrS: Tuesday-Friday: 11 am-4 pm;
Saturday and Sunday: 1-5 pm. Closed oct. 11.
ALL EvENTS ArE FrEE and open to the public. Call 207.780.5008 www.usm.maine.edu/gallery 37 College Avenue, Gorham, Maine 04038
Foreword
The Engaged contributors intervene with insects in ways
that help us see, understand, and recognize the world.
To some extent, this exhibit was designed as a laboratory
to compare the direct intervention of artists and scientists
with spiders and six types of insects: moth/butterfly, grasshopper,
fly, beetle, bee, and ant. We found a fluidity of interrelationships
among this group of artists, scientists, and hybrids who escape easy
classification in their pursuit of new forms of aesthetic knowledge.
Nina Katchadourian’s unorthodox art emerges from direct observation
of her immediate world and a curiousity to see how her responses might
manifest. The resulting smörgåsbord of different subjects and media
typically have a bright humor packed with suggestive meanings, such
as her use of caterpillars to spell the words “Quit Using Us.”
USM biologist Dave Champlin spends considerable time growing
and dissecting caterpillars, then staining their cells in order to trace
stages of metamorphosis. These intensive lab experiments nourish
Champlin’s expansive thinking. For example, he thinks about genetic
code as origami folding instructions: “it is much easier (and accurate)
to imagine evolution tweaking an origami folding plan than a blueprint.”
Speaking of evolutionary tweaking, Steven Kutcher uses his
considerable insect expertise to carefully nurture their development
as painters. one big problem to overcome has been small feet
brushes. Kutcher first experimented with making “painting shoes,”
then discovered that if he moistened the paper first, the expanding
watercolors marked the insects’ walking patterns in sometimes quite
pleasing ways. Kutcher’s drawings appear in both our art gallery and
in a book documenting insect tracings on the shelf of an entomology
professor’s office in the next campus building. This is just one example
of how keeping multiple reference points in play is best when engaging
with this exhibit – and for that matter, the world.
Carolyn Eyler director of Exhibitions and programs,
University of Southern Maine Art Gallery
Artists and Scientists
4 5
We Are Surrounded.
Insects outnumber, outweigh, out smart us. They preceded us on
the earth by over 300 million years. They will surely survive long
after we are gone. yet, despite their overwhelming numbers and
unquestionable powers of survival and adaptation we usually try to
ignore their presence. For most people an encounter with an insect is
experienced as unpleasant, something more like a minor accident or
illness rather than a pleasure associated with the wonders of nature
such as the sight of an osprey or the Grand Canyon. how many people
welcome the sight of the first flies and anthills of spring with feelings
comparable to those provoked by the first crocuses and daffodils?
insects are more often considered invaders than welcome visitors.
They bite and sting; they destroy plants from pampered garden roses
to entire tracts of forest; they ruin picnics. insects spread disease;
they instigate disasters; they rank with flood and fire as agents of
destruction. Their depredations are recounted in one of the earliest
surviving texts from ancient Sumer, which describes a priest driving
away a plague of locusts by means of a charm. We defend ourselves as
we can, now most often with poisonous chemicals and insurance, but
insects are an unrelenting force of nature. They remind us that our
tenure on the earth is a shaky truce, a balancing act amid the claims
and requirements of others. They may be small, but they out number us
200 million to one. We are at their mercy.
Measured in human scale insects are tiny; their lives are short,
ranging from a few hours to a few months; their reproductive capacities
are stunning, in five months a pair of houseflies could produce
190,000,000,000,000,000,000 descendants. Such considerations, in
addition to their incredible ubiquity, help to explain the widespread
indifference to the fate of individual insects. has anyone ever
attempted to liberate fruit flies from a scientific laboratory on the
basis of their rights? is the fly in the lab any less happy than the one
buzzing around your kitchen? Although the ethical issues involved
may be troubling in the abstract, (are the lives of small, short-lived,
multi-legged creatures less intrinsically valuable than larger, longer-
lived creatures?) it is difficult to feel moved by the plight of creatures
we annihilate both inadvertently and intentionally on a daily basis.
Even if we tread carefully we cannot stop to mourn the death of each
bug that splashes across our windshield. perhaps there is some small
compensatory virtue in simply giving insects our attention.
The common fly occupies a privileged place in Western art history.
in his Lives of the great renaissance artists Giorgio vasari recounts
how the young Giotto tricked his teacher Cimabue by painting a very
life-like fly on the nose of a painted Madonna. Completely fooled by
the illusion Cimabue tried to brush the fly away and was astonished to
discover it had been painted by his precocious student. here one might
say that the history of modern Western naturalistic representation has
its beginnings in the depiction of a fly that could not be brushed away.
The close links between art and science in
the modern world have been increasingly
acknowledged and studied in recent years.
Giotto’s probably mythical trompe l’oeil fly was far
more than a joke; it was part of a new attitude
in which the natural world, from the stars in the
sky to the insects on the ground, was considered
worthy of serious attention and study. Close observation of nature was
accompanied by the development of scientific illustration. Beginning with
Albrecht durer’s 1505 watercolor of a stag beetle a new form of visualizing
knowledge evolved in the wake of the renaissance. What had previously
been difficult or impossible to see with the naked eye was magnified and
drawn to show all of its complex and minute details, revealing not only
previously obscured visual information but beauty as well.
6 7
Before the 20th century scientific study often went hand in
hand with religious conviction. in the 19th century the wondrous
complexity of insects and their activities were often cited as proof
of God’s existence as the grand designer of the universe. The social,
architectural and nutritive systems of bees were considered both
symptoms and symbols of a cosmic order, as were spiders’ webs. Earlier
dutch Baroque still-life paintings combine botanically accurate studies
of plants with entomologically correct representations of caterpillars,
moths and butterflies as symbols of death and Christian resurrection.
other insects are also common in dutch still-life paintings, often
depicted on rotting leaves or fruit they are vanitas symbols that
reminded the viewer of the transience of all earthly beauty. The
Surrealist painter Salvador dali transformed this symbolism into 20th
century psychoanalytic terms when he repeatedly figured his obsession
with sex and death in the form of grasshoppers and putrefying objects
covered in meticulously rendered swarms of ants.
More recently insects have become important figures for
conceptualizing the complex interrelationships between living
beings and their environments. The sensitivity of insects to their
local ecosystem and their elaborate systems of communication and
organization have become common metaphors for decentralized forms
of connectivity like the internet. The swarming of social insects like
ants and bees provide examples of rhizomatic forms of communication
and concerted action that seem particularly relevant to our human
world in which social media and electronic information motivate
widespread human actions from flash mobs to political protest and
revolution. The phenomenon of bee colony collapse has also brought
sharply into view the continued dependence of our technologically
oriented society on an increasingly degraded and destroyed natural
world. it may be that however often they seem to threaten human
interests, to ignore or attempt to eliminate insects is to hasten our
own demise.
The works in this exhibition are products of the attentive
investigation of insects by artists and scientists. Many of them
are visual presentations intended to reveal the insects themselves
from their dNA, through their cellular forms and isolated body parts
to the entire physically present creature in a created environment.
These presentations are part of the long-standing tradition of insect
imaging that brings to light the hidden beauty and designs that
permeate the natural world. A number of works also directly address
the problems and possibilities of human insect interaction. Turned to
human purposes insects become artists and artistic media, unwitting
collaborators in the creation of products for human entertainment
and aesthetic appreciation. Whether their actions are simply traced or
their created forms are celebrated and honored, it seems likely that the
insects are in pursuit of their own, and to us unknown, ends. if they
could speak they might well say, “quit using us.”
Kim Grant Associate professor of Art historyUniversity of Southern Maine
8 9
Using technology and mobile data i engage, record, and
question our contemporary landscape. This practice re-
appropriates and invents tools, technologies, and systems
[GpS tracking systems, multi-perspective sampling proce-
dures, augmented clothing design, and photographic data collection] to
help explore the space between our human perception of the land and
the land’s actual state(s). A constant curiosity in regards to this space
pushes my work into an intricate play between social and geological
landscape; this exploration is framed within the arc of a historic
photographic perception and its contemporary transversal shiftings.
The three projects included in the exhibition invertebrates
consider interior spaces as environments rich with non-human
inhabitants - dwellings as ecologies, ripe for inhabitation. The first
investigatory project Invertebrates samples and catalogues the insects
that co-inhabit my home on peaks island off the coast of Maine.
The second project Colonization focuses on the shape of
growth. Using my darkroom/studio as a testing site the project samples
deceased spiders that have been re-colonized by mold. particular
interest is given to growth patterns and the apparent stages of
colonization found in each specimen.
The third project The Interior Arachnid Territory Tracking Kit 2 is
a fully inclusive kit that investigates interior ecologies and the spiders
that dwell within them. The IATTK 2 houses various experiments
that track both the spiders and the qualities of their chosen interior
dwelling spaces. This kit was developed for the Invertebrates exhibition
and has been deployed in the USM Art Gallery building.
i received an interdisciplinary M.F.A. from the Maine College
of Art. over the last few years i have been an active collaborator with
the Geographic observatory and WEArEX [wax]. in addition to these
collaborations i have worked with the arts collective Spurse and the art
non-profit organization the Creative Material Group [CMG].
www.colecaswell.com
Cole Caswell
UnICorn moThiNKjET priNT 2009, 24” X 30”
10 11
rESEArChErS iN My LAB at University of Southern Maine
use insect metamorphosis as a model to help understand
hormonal control of animal development. Experiments in
the lab focus on metamorphosis of the moth, Manduca
sexta, especially the development of the compound adult eye and the
associated optic lobe of the moth’s brain. We were surprised to find
the precursors to the moth’s eyes actually function as skin cells in the
caterpillar until the start of metamorphosis. At that time, nutritional
status signals hormones that will coordinate responses in virtually
every cell of the caterpillar body. Although the caterpillar’s cells
contain the genetic code to form the adult moth, the developmental
programs to form the adult are not activated until hormones switch
them on at the start of metamorphosis. My images in the exhibit are
mostly of the developing eye and brain of the moth.
Dave Champlin is an associate professor of biology at University of Southern Maine.Champlin completed his doctoral work at Cornell University with John Lis
on the structure of transcriptionally active chromatin. he went on to an
American Cancer Society postdoctoral fellowship with James Truman at
the University of Washington, Seattle, examining the hormonal control of
insect metamorphosis. Champlin has continued those studies in his own
research lab at USm with additional support provided by the national
Science Foundation, the United States Department of Agriculture, and the
national Institutes of health. An important element of the USm research
program has been the mentoring of over thirty graduate, undergraduate,
and high school students as they pursued independent research projects.
Dave Champlin
RIghT: ADULT eye DeveLopmenT, mAnDUCA SexTA
LefT, DeTaIL: brAIn opTIC Lobe (neUrobLAST) STem CeLLS, mAnDUCA SexTA
12 13
Maine artist Sara Crisp utilizes wood panels and employs
the ancient technique of encaustic, in which powdered
pigments are suspended in a wax medium and fused with
heat. She builds up the surface of each painting, layer
by layer, which results in a translucent surface with a worn, pitted and
porous texture. There is a central opening in each piece that acts as a
box trapping an array of found natural objects beneath cloudy layers of
wax and a thin sheet of mica.
There is an obvious sculptural quality to Crisp’s work. The
physicality of the wax, its luster and depth draw you in to it’s delicate
layers, embedding bones, insects, and plants, to a state of fossilization.
She works from an innate sense of duality; man vs. nature; order vs.
chaos; creating a contrast between sharply constructed lines and
raw natural elements. She connects us to the past, not only with
her technique, but by incorporating the grid, the most primitive
manifestation of rationality and order, creating an imaginary space
within which her chosen objects relate to each other and where they
intersect with the human made world.
Crisp has had solo exhibitions throughout New England and
New york. She has also participated in numerous group exhibitions,
and received several awards and reviews. Crisp studied art at the rhode
island School of design and is represented exclusively by denise Bibro
Fine Art in New york City.
www.denisebibrofineart.com
Sara Crisp
UnTITLeD (beehIve)ENCAUSTiC/MiXEd MEdiA200715” X 15”
UnTITLeD (beeTLe WIng SpIrAL)MiXEd MEdiA oN pANEL2007, 25” X 25”
14 15
ENGAGiNG iNSECTS FEATUrES FoUr of Katchadourian’s
unorthodox encounters with insects in photography,
video, installation, and graphic art. natural Crossdressing
[right] depicts the artist wearing a mustache made of live
caterpillars. in the installation Ant Static, a monitor on the floor-with
hidden dvd player- displays a heavily layered and speeded up loop
of swarming ants to produce the look of television “snow” or static.
other works include Quit Using Us,[above] a banner made of caterpillars
spelling the title with their bodies; and gIFT/gIFT, a video showing
tweezers forming letters of thread in a web as a spider struggles to
mend the disruptions.
Nina Katchadourian was born in Stanford, California and
grew up spending every summer on a small island in the Finnish
archipelago, where she still spends part of each year. her work exists
in a wide variety of media including photography, sculpture, video and
sound. her work has been exhibited domestically and internationally
at places such as pS1/MoMA, the Serpentine Gallery, New Langton Arts,
Artists Space, SculptureCenter, and the palais de Tokyo. in january
2006 the Turku Art Museum in Turku, Finland featured a solo show of
works made in Finland, and in june 2006 the Tang Museum in Saratoga
Springs exhibited a 10-year survey of her work and published an
accompanying monograph entitled “All Forms of Attraction.”
The Museum of Contemporary Art San diego presented a solo show of
recent video installation works in july 2008. in February 2010 she was
the artist in residence at the dunedin public Art Gallery in dunedin,
New Zealand, where she had a solo show entitled “Seat Assignment.”
She is currently at work on a permanent public piece, commissioned
by the GSA, for a border crossing station between the US and Canada.
Katchadourian is represented by Catharine Clark gallery in San Francisco.
www.ninakatchadourian .com
Nina Katchadourian
nATUrAL CroSSDreSSIng C-priNT, 2002, 40” X 30”
16 17
AS ‘ENToMoArTiST,’ i fashion ways of exploring, creating,
and communicating both science and art, primarily
with insects at center stage. My science—a combination
of investigating sleep in societies of insects, and
communication in frogs fooled by robot doppelgangers—is enhanced by
visuals, and my art is driven by biological concepts. i produced natural
history exhibits for museums (at the American Museum of Natural
history, and Chase Studio, inc.) and studied entomology at Cornell, the
University of Arizona, and most recently at the University of Texas at
Austin. Today, i celebrate insects through illustration, film, sculpture,
and science. i am presently a visiting scientist living in an apiary
at Cornell University, but will soon move to Germany and panama to
spearhead projects that will weave insect research with visualizing
nature.
A bustling society is difficult to visualize in its entirety, even
when peering through the transparent window of an observation hive
full of honey bees. Some individual behaviors and collective actions are
impossible to perceive with the naked eye. To overcome this obstacle, i
recently recorded and mapped behaviors of bees using infrared imaging
technology. during the course of my scientific research in a German
apiary (BEEgroup, University of Würzburg), i filmed colonies of honey
bees and created thermal visions in which temperature translated
into color and patterns of activity emerged. My thermal portraits
feature bees performing waggle dances (communicating direction and
distance of desirable destinations to sisters), heating brood, thermally
slaughtering invaders, and sleeping. These portraits are an attempt to
capture the invisible actions of a society.
[email protected] www.pupating.org
Barrett Anthony Klein
hIveThErMAL priNT2008, 10” X 7-1/2”
Curators’ notE: CheCK oUT bArreTT KLeIn’S WonDerFUL eSSAy pAr For ThE pALETTE: iNSECTS ANd ArAChNidS AS ArT MEdiA. IT CAn be DoWnLoADeD AT WWW.pUpATiNG.orG
18 19
My pAiNTiNGS highlight the connection between science
and art; between the natural environment and the
human experience; between classic art techniques and
abstract expressionism; and between an emotive natural,
organic style and creative, constructive ideas.
i have made visible the hidden world of the insect footprint.
When an insect walks on your hand, you may feel the legs move but
nothing visible remains, only a sensation. These works of art render
these insect tracks and routes visible, producing a visually pleasing
piece while conveying pertinent, scientific information.
Kutcher’s lifelong passion for insects and exceptional
understanding of insect behavior combined with formulated ideas enables
him to manipulate an insect’s movement on the canvas. These processes
result in the creation of an unique approach to painting. his artistic
appreciation for color, line, and form helps him translate these small
creatures into living brushes.
Kutcher lives in Arcadia, CA and has obtained a b.S. in
entomology at UC Davis and an m.A. in biology at CSULb with an emphasis
on insect behavior. he is an artist, entomologist, environmentalist, and
educator who has worked in over 90 feature films with arthropods (e.g. the
spider sequences in Spider Man 1). Kutcher has been drawing and painting
since early childhood. In the 1980’s he worked on a commercial project
where he had to figure out how to make a fly walk through ink and leave
fly footprints. In 2003 he used this all of this knowledge to create the first
bug art. Kutcher’s bug art has appeared in galleries, museums, universities,
magazines, newspapers, in europe, and in his movie Bug Art, 2006.
www.BugArtBySteven .com
Steven R . Kutcher
Top RIghT: eye on yoU (USiNG TiGEr MoTh) GoUAChE oN pApEr 2004, 15” X 24”
aBove: SUnrISe #1 (USiNG dArKLiNG BEETLE) GoUAChE oN pApEr2004, 18” X 24”
20 21
roBoT-LiKE iNSECTS ANd iNSECT-LiKE roBoTS are the stuff
of science fiction and science fact. in science fiction,
insects are frequently featured as robotic critters. Either
scurrying across the galaxy as invading aliens or as robo-
bug counterparts to a futuristic human race. From Cronos to The golden
Compass, the insect/robot archetype has been used, re-used and re-
imagined countless times.
in reality, engineers look to insect movement, wing design
and other characteristics for inspiration of new technology. Some of
the most advanced “aircraft” is no bigger, or heavier, than a dragonfly,
and NASA scientists are making big steps in walking rovers and “swarm
theory” probes for planetary exploration.
This hybridization of insects and technology from both
fields, is where insect Lab borrows from. insect Lab celebrates these
correspondences and contradictions. The work does not intend to
function, but playfully and slyly insists that it possibly could.
Mike Libby is a multi-disciplinary artist who makes highly
detailed sculptures, models, collages and drawings. Through diverse
materials and methodologies, Libby explores themes of science, nature,
fantasy, history and autobiography; highlighting illogical and acute
correspondences between a constellation of topics. For the past
12 years, alongside this main body of work, Libby has enjoyed
developing the work presented here as insect Lab.
Libby Graduated with a degree in Sculpture from riSd in 1999
and has since attended the vermont Studio Center, and been artist-in-
residence at the University of Maine at orono. he has been in many solo
and group exhibits, throughout the U.S. and internationally and
is in collections worldwide. he has future shows in Boston, Washington,
New york, and LA. And he will be exhibiting alongside many respected
colleagues at “Extreme Materials 2” on view at rochester University
in New york.
www.insectlabstudio.com www.mikeplibby.com
Mike Libby
hoUSeFLy hoUSEFLy CUSToMiZEd WiTh ANTiQUE WATChpArTS ANd GEArS.GLASS doME ANd WALNUT BASE, 5” X 4” X 4”, 2001
22 23
OriGiNALLy from Millinocket, Nutting moved to Auburn
in the 8th grade. he graduated from Edward Little high
School in 1972 and from Bates College with a Biology
degree in 1976. in March of 2010, jim bought out his
partners Nel and denise and is now the sole owner of Maine Art Glass.
Nutting’s biology background is very evident in his art. Many
of his original works depict wildlife and nature. As a biologist his art
tends to be realistic and accurate.
Nutting is the consummate collector. he has spent a lifetime
collecting natural artifacts, sea shells, fossils, rocks and minerals,
skulls, feathers, and taxidermy. jim has also provided Maine Art Glass
with his extensive library of books on natural history and reference
materials which provides an unlimited supply of design inspiration
and ideas.
When you visit Maine Art Glass, you will encounter the most
extensive and unusual of Nutting’s collections. Up in the mezzanine
(in the former choir loft of the church) and scattered throughout the
galleries of Maine Art Glass, jim has put together a world class display
of tropical and local butterflies and insects, all stunningly displayed in
stained glass display cases and hand made shadow boxes.
This collection, known as The butterfly and Insect museum
at maine Art glass is becoming well known throughout Maine and
across the country. The Butterfly and insect Museum is becoming a
destination for many school groups, summer camps, scout groups, youth
and adult service organizations and families. jim can be scheduled to
provide group tours, talks on insects and also live demonstrations of
insects and arachnids. Nutting is one of the few individuals in Maine
licensed by the Maine inland Fish and Wildlife department to keep
and exhibit live tarantulas, scorpions and other exotic invertebrates.
www.MaineArtGlass .com
Jim Nutting
beeTLe KALeIDoSCopehorN ATLAS(LArGE) hArLEQUiN (CorNEr) ANd jEWEL BEETLES2006
AGGGCTCGATGTGTTTATTCGGGACCGTTTTTCTAAATACTTTCT-
TACTTTTTACTTTTTTAAATTAAAACATCTATTAGCTACGGGTAT-
GCTATTTCTTCAATTGAAATTGCGCACTTGTAAAAAACTAAAGTTA-
AGTTGCATTCATTTAAAATATAATAACAGCATCATGTACATAATAAAA-
CATTGCCTTAATTCATTTTTAACATAATTTCTTCCTTCGTATGTTTTT-
GACTTTCTGTCGTTTTTTAAAACCAAAACACAGTACAGTGCACTA-
AAAATATTTTAAGTTACGATCTTTCTCTTTTTACTTTAAACATACT-
TAACTCCTCTCTACTCATCATATATTTTTTGTTTTGTTTTTTTTATG-
CAATGCAGGTTTCTTACGAACTATAGGTTTAAAGTTAAGCTTAAGT-
TACGATGTTGCTGATTGTTAGTTTGTGGGTTGTTTGTTTGTTTTGTT-
GTCTGCGCGTGCCATAACTTAAAATGCTATTTTCGTGGTAATTTTCAT-
GTATATTTATTTGTAGTTTTTTCTTTATCAATTCAGTAAGATTCCT-
TAATTGTTTGTGTCTTTCCCACTAAGGGGTAGTGTATGAACAGAAAA-
CAGTTCTTAGAGTGAGTTGAATTGTTTAAAATTGGTATAGCTCTTGCATC-
GATTGTTTCTGCTGATTATTATGTTGGATTGGGTGGGTAGTGCTTCTG-
GAGTCTGCCATTTCAGTAGAAGTTTGCGTGCATTTTTCTTGTACTACG-
GATTATAGTTTGTATTTGTTGCTGCCAATGGATCTGAAGGTGTTGCT-
GCTGATGCATCTGTATGTAGCTGTACCCGCCGGAGGTACCTAGTCAG-
GTTCAGTAAACCTGACTTCGCATCGGATTCTAGATGTTCGACTTCGAGA-
AGCTTACACGCAGGTGATTCGACTCGGACAGCTGGTGGTTGTGCATCT-
TAATCAGTGCTAGGACAGCCTCCTCCACGGACAACAGTTGAAGCAGTGC-
CATTTTACGGTCCTTCctgtaaaataaaaaggacgaggttattagtg-
gttgctccgatagttttaatagcacacatagaagggaaaaaaaattt-
taaaaatagttgtctgtgcggccattacttacGGGAAAAATTT-
GAATGCCTTAACTTCAAAGCTGTTTGAGGTGAAAGCTTCTTTGATGT-
CATCCTCAGAGCAGGATGAGctgcagggtaagagagaagatgttgt-
tagttacctttaaagagtgtcagatttaagggtacgtgggtatgtg-
gcagcgcctgctgtgaggctggttcattgattccgctcggtaggc-
gcttcgaagagcctgtggtgcgattggctcgattcataaattcacg-
cagcggagggtagtcaccccgtcttctagttggcatgcgaatcccagc-
cagcggggtgctttgtcaaattttggtagaatagggtgctacgc-
ggggtttccactgctcatagctataattgtaattgccttgtcgtgcc-
gaaatcaagccgtctcacagcatccataccgaagcagtacccgaccac-
gcctactgcccaatctgattccctcaggcacagacagcgcattgtcat-
gccctgtagaatacttacGGAATGTTGCTTAAATGTAGTGTCGCCGAC-
GGCGGATAGATGTTCTGGTAGTTCTTGCTTCCCGGTTTCTTGAAGCG-
GTGCAACGGATTTTGCGAGTAGTCACGTGTGAGTCCTGCGTCCGGCT-
GTCCCTCCTTGGGCAGCTGGACGGCCTGGTGTTTGCTTGCCATCACACG-
AGGGCTCGATGTGTTTATTCGGGACCGTTTTTCTAAATACTTTCTTACTTTTTACTTTTTTAAAT-
TAAAACATCTATTAGCTACGGGTATGCTATTTCTTCAATTGAAATTGCGCACTTGTAAAAAACTA-
AAGTTAAGTTGCATTCATTTAAAATATAATAACAGCATCATGTACATAATAAAACATTGCCTTA-
ATTCATTTTTAACATAATTTCTTCCTTCGTATGTTTTTGACTTTCTGTCGTTTTTTAAAACCAAAA-
CACAGTACAGTGCACTAAAAATATTTTAAGTTACGATCTTTCTCTTTTTACTTTAAACATACTTA-
ACTCCTCTCTACTCATCATATATTTTTTGTTTTGTTTTTTTTATGCAATGCAGGTTTCTTACGAAC-
TATAGGTTTAAAGTTAAGCTTAAGTTACGATGTTGCTGATTGTTAGTTTGTGGGTTGTTTGTTT-
GTTTTGTTGTCTGCGCGTGCCATAACTTAAAATGCTATTTTCGTGGTAATTTTCATGTATATT-
TATTTGTAGTTTTTTCTTTATCAATTCAGTAAGATTCCTTAATTGTTTGTGTCTTTCCCAC-
TAAGGGGTAGTGTATGAACAGAAAACAGTTCTTAGAGTGAGTTGAATTGTTTAAAATTGG-
TATAGCTCTTGCATCGATTGTTTCTGCTGATTATTATGTTGGATTGGGTGGGTAGTGCTTCTG-
GAGTCTGCCATTTCAGTAGAAGTTTGCGTGCATTTTTCTTGTACTACGGATTATAGTTTGTATTT-
GTTGCTGCCAATGGATCTGAAGGTGTTGCTGCTGATGCATCTGTATGTAGCTGTACCCGCCGGAGG-
TACCTAGTCAGGTTCAGTAAACCTGACTTCGCATCGGATTCTAGATGTTCGACTTCGAGAAGCTTAC-
ACGCAGGTGATTCGACTCGGACAGCTGGTGGTTGTGCATCTTAATCAGTGCTAGGACAGCCTCCTC-
CACGGACAACAGTTGAAGCAGTGCCATTTTACGGTCCTTCctgtaaaataaaaaggacgag-
gttattagtggttgctccgatagttttaatagcacacatagaagggaaaaaaaatttta-
aaaatagttgtctgtgcggccattacttacGGGAAAAATTTGAATGCCTTAACTTCAAAGCT-
GTTTGAGGTGAAAGCTTCTTTGATGTCATCCTCAGAGCAGGATGAGctgcagggtaagaga-
gaagatgttgttagttacctttaaagagtgtcagatttaagggtacgtgggtatgtggcagc-
gcctgctgtgaggctggttcattgattccgctcggtaggcgcttcgaagagcctgtggtgc-
gattggctcgattcataaattcacgcagcggagggtagtcaccccgtcttctagttggcatgc-
gaatcccagccagcggggtgctttgtcaaattttggtagaatagggtgctacgcggggtttc-
cactgctcatagctataattgtaattgccttgtcgtgccgaaatcaagccgtctcacagcatc-
cataccgaagcagtacccgaccacgcctactgcccaatctgattccctcaggcacagacagcg-
cattgtcatgccctgtagaatacttacGGAATGTTGCTTAAATGTAGTGTCGCCGACGGCGGATA-
GATGTTCTGGTAGTTCTTGCTTCCCGGTTTCTTGAAGCGGTGCAACGGATTTTGCGAGTAGT-
CACGTGTGAGTCCTGCGTCCGGCTGTCCCTCCTTGGGCAGCTGGACGGCCTGGTGTTTGCTT-
GCCATCACACGTATCGGCTTTCCCCATAAACGTAATTTATCAAGGTGAGACATGGctgtggag-
cagaaagtaacacgttaaaatgtatacactagggaaaagttttttggttgttagatgagtct-
gtatatggaaaatgtggctgtgtcaatatatatgtatttgtaccaatgcaatttatttgct-
gtgacacaagctataaaaatactcctgaatctcagaaagaacattgccaaaaaatttgttttt-
gatccaaacaatatatttagaatattatttttattttatttaacaaattaaatctaaacctgat-
gaatttgatgagttctagctaactgtgccttcaactcgatttttactttgtaacttcgaga-
ataataacgaaaatagtatagtcggataaacaacaatgttacgtattgctttaaaccaatta-
caaccttttttatattaaaagtacggtcctttcctcagtgtagtgaaagatcccgaccaccagc-
cgtcgaacaaagtcaacaataagggcaggcaaatatttacatactcagatgtaactgcaactt-
tatcaatgtcgtctgcctttggtgatttatacgagctgaaatgcttgtttggccgtaaaag-
tattaccaaacaaaagtttgccatctccaggctcttttccggcgcatttccaatggactttgcct-
tatttctcatattctcagaagccataacacctgcggcttggatggaatgcatgtgcagt
actcaaatacatttcaatctgccttttcatttcgatttcagtttcgattacgttttattta-
atttaagttcctgccaagtcatccgacagcttaggtcaggccactgtccagaaaaggttctaa-
cattttttaactctcatgcattacattaataaattacatcacattttatcactgctcctct-
gttttattgtaacgcaatatgcttactcagccgtttattgtttgcctaatggattaagt-
24 25
My experimental organism is the fruit fly, drosophila
melanogaster. i study shape and performance traits. The
shape traits include wing shape, head shape, and other
aspects of fly shape. The performance traits include
ethanol vapor resistance, wind tunnel flight, and other such traits.
By mass selective breeding in large populations, nearly all traits like
these can be greatly modified, in small increments, by the cumulative
contributions of many genes with small effects. This is analogous to
darwinian natural selection, which gradually improves the adaptation
of populations to their environments.
i have built devices for the mass measurement of various traits
in flies including olfactory responses, standing height, wind tunnel
performance, mating speed, larval pupation behavior, resistance to
chemical vapors, aspects of body shape, and other traits. Several of
these systems have been adopted in other labs.
My current research rests mainly on two systems. one measures
wind tunnel performance on up to 15,000 flies at a time. The other
system measures wing shape, on one fly at a time, but rapidly. on these
two parallel tracks, i study the genetics of wing shape and of wind
tunnel performance.
Ken Weber is a member of the Biology Department at University of Southern maine, teaching courses in genetics, evolution,
and cell biology.
his research at USm has been supported mainly by two national
Science Foundation grants. his general area of research is evolutionary
quantitative genetics. In particular, he studies selective breeding in large
populations, and how it gradually changes traits.
Ken Weber
FLy WiNG ANd dNA CodE
26
We Are Surrounded.
if they could speak
they might well say,
“quit using us.”