Association of Hepatic Lipase Gene Polymorphisms with Hypertriglyceridemia and Low High-Density Lipoprotein-Cholesterol Levels Among South Indian Subjects Without Diabetes

ORIGINAL ARTICLE

Association of Hepatic Lipase Gene Polymorphismswith Hypertriglyceridemia and Low High-DensityLipoprotein-Cholesterol Levels Among South IndianSubjects Without Diabetes

Kuppuswamy Ashok Ayyappa, MSc,1 Saurabh Ghosh, PhD,2

Viswanathan Mohan, MD, FRCP, PhD, DSc, FNASc,1 and Venkatesan Radha, MSc, PhD1

Abstract

Aim: The aim of this study was to investigate the association of four variants of the hepatic lipase (HL [or LIPC]) gene withvarious lipid parameters among South Indian subjects with normal glucose tolerance (NGT).Subjects and Methods: In total, 747 NGT subjects were randomly selected from the Chennai Urban Rural EpidemiologicalStudy (CURES). Serum triglycerides, serum cholesterol, and high-density lipoprotein cholesterol (HDL-C) were measuredusing a Hitachi-912 autoanalyzer (Roche Diagnostics GmbH, Mannheim, Germany). Genotyping of HL gene variants wasdone by the polymerase chain reaction–restriction fragment length polymorphism method, and 20% of samples were se-quenced to validate the genotypes obtained. Haplotype analysis was also carried out.Results: The TT genotype of the rs1800588 C/T (C-480T) polymorphism was significantly associated with hypertriglycer-idemia, with an adjusted odds ratio of 2.58 (95% confidence interval 1.38–4.85, P = 0.003), whereas those with the CC genotypeof the rs6074 A/C (Thr479Thr) had significantly lower HDL-C levels (41.3 – 9.8 mg/dL) compared with the AA genotype(43.6 – 10.2 mg/dL, P = 0.02). Haplotype analysis showed the TGC haplotype was significantly associated with low HDL-Clevels.Conclusions: Among South Indian subjects without diabetes, the rs1800588 C/T (C-480T) and rs6074 C/A (Thr479Thr)variants of the HL gene are associated with hypertriglyceridemia and low HDL-C, respectively. The TGC haplotype wassignificantly associated with low HDL-C.

Introduction

Dyslipidemia is a major risk factor for coronary heartdisease (CHD) and is also seen in a high proportion of

subjects with type 2 diabetes (T2D). The World HealthOrganization estimates that dyslipidemia is associated withmore than half of global cases of ischemic heart disease andmore than 4 million deaths per year.1 Dyslipidemia is a broadterm that refers to several lipid disorders, including an ele-vated level of low-density lipoprotein (LDL) cholesterol(LDL-C), a low level of high-density lipoprotein (HDL) cho-lesterol (HDL-C), hypertriglyceridemia, atherogenic dyslipi-demia, and mixed lipid disorders.2

The prevalence of T2D and CHD has doubled in India inthe past three decades.3,4 It is well established that Asian In-dians have an increased susceptibility to T2D and premature

CHD compared with Europeans. This has been explained by ahigher frequency of hyperinsulinemia,4 insulin resistance,5

dyslipidemia with low levels of HDL-C,6 and increased vis-ceral fat despite a lower body mass index, and this uniquephenotype is referred to as the ‘‘Asian Indian phenotype.’’7,8

However, it is not clear whether the Asian Indian phenotyperepresents a unique genetic susceptibility or results fromlifestyle-related factors. Support for genetic susceptibilitycomes from the observation that hyperinsulinemia wasdemonstrated in newborn Asian Indian children but not intheir United Kingdom counterparts9 and for some differencesin genetic association with T2D in Asian Indians.10,11

One of the most striking features of the Asian Indian phe-notype is the presence of dyslipidemia, with hypertriglycer-idemia and low HDL-C being the most prominent features.6

Indeed, a low level of HDL-C is seen in 60–70% of adults in

1Madras Diabetes Research Foundation-ICMR Advanced Centre for Genomics of Type 2 Diabetes and Dr. Mohan’s Diabetes SpecialitiesCentre, WHO Collaborating Centre for Non-Communicable Diseases, IDF Centre for Education, Gopalapuram, Chennai, India.

2Human Genetics Unit, Indian Statistical Institute, Kolkata, India.

DIABETES TECHNOLOGY & THERAPEUTICSVolume 15, Number 6, 2013ª Mary Ann Liebert, Inc.DOI: 10.1089/dia.2012.0302

503

urban Indians12 and even in urban adolescent children.13,14

However, few studies have looked at the possible causes ofthe low level of HDL-C and hypertriglyceridemia. It is likelythat lifestyle factors (e.g., high carbohydrate diet15 or physicalinactivity16) contribute to the dyslipidemia in our population.However, it is also possible that genetic factors play a role inthis. Association of genetic variants with low HDL levels hasbeen studied earlier in this population, with respect to thelipoprotein lipase gene.17 Hepatic lipase (HL) is similar to li-poprotein lipase and plays a key role in the metabolism of pro-atherogenic and anti-atherogenic lipoproteins, affecting theirplasma levels as well as their physicochemical properties. HLis a glycoprotein that catalyzes the hydrolysis of lipoproteintriacylglycerols and phospholipids. The majority of HL issynthesized and secreted by the liver and is bound to heparinsulfate proteoglycans on the surface of sinusoidal endothelialcells and external surfaces of microvilli of parenchymal cells inthe space of Disse,18 promoting the uptake of HDL and apoli-poprotein-B-containing remnant particles.19 It is estimated that30–45% of variability in HL activity is genetically determined.20

Several independent studies have documented the associationof some of the prominent single nucleotide polymorphisms(SNPs) in the HL gene.21–25 Although there are some studies onthe variants in coding regions of the HL gene in Turkish26 andJapanese27 population, little is known about the association ofvariants of the HL gene with dyslipidemia in South Asians.

The aim of the present study was to investigate the asso-ciation of four variants in the HL gene—namely, rs1800588(C-480T) (C/T), rs6074 (Thr479Thr) (C/A), rs690 (Val155Val)(G/T) and rs6083 (Ser193Asn) (G/A)—with dyslipidemia inan Asian Indian (urban South Indian) population.

Research Design and Methods

Subjects and study design

The study subjects were selected from the urban compo-nent of the Chennai Urban Rural Epidemiology Study(CURES), an epidemiology study conducted on a represen-tative population (> 20 years) of Chennai (formerly Madras),the fourth largest city in India.28 In brief, 26,001 adult subjects(> 20 years of age) were recruited in Phase 1 of CURES using asystematic random sampling method covering the whole ofChennai City. This identified 1,529 self-reported ‘‘diabetessubjects.’’ In Phase 2, all self-reported or ‘‘known diabetessubjects’’ were invited to our center for detailed studies, ofwhich 1,382 responded (response rate, 90.4%). In Phase 3,every 10th subject from Phase 1 (n = 2,600), excluding thosewith self-reported diabetes, were invited to undergo an oralglucose tolerance test (OGTT). For the present study, 1,000unrelated subjects with normal glucose tolerance (NGT), de-fined as those who had a fasting plasma glucose level of < 5.6mmol/L (100 mg/dL) and 2-h plasma glucose value of 7.8mmol/L (140 mg/dL), were selected from Phase 3 of CURES.The ratio of males versus females in the present study was466:534. Those who were on lipid-lowering drugs such asstatins, fibrates, and niacin were excluded from the study(n = 134). On the basis of the National Cholesterol EducationProgram Adult Treatment Panel III guidelines,29 the studypopulation was divided into those with normal HDL-C(‡ 45 mg/dL among males; ‡ 50 mg/dL among females) andlow HDL-C (£ 45 mg/dL among males; £ 50 mg/dL amongfemales), normal triglycerides (£ 150 mg/dL) and high tri-

glycerides (‡ 150 mg/dL), normal LDL-C (£ 110 mg/dL) andhigh LDL-C (‡ 110 mg/dL), and normal total cholesterol(£ 200 mg/dL) and high total cholesterol (‡ 200 mg/dL).

Written informed consent was obtained from each studyparticipant, and the studies were approved by the Institu-tional Ethics Committee of the Madras Diabetes ResearchFoundation.

Phenotype measurements

Anthropometric measurements including weight, height,and waist measurements were obtained using standardizedtechniques. The body mass index (BMI) was calculated usingthe formula of weight (kg)/height squared (m2). Fasting bloodsample was taken for estimation of levels of plasma glucoseand serum lipids. Biochemical assays were carried out using aHitachi-912 autoanalyzer (Roche Diagnostics GmbH, Mann-heim, Germany) using kits supplied by Roche Diagnostics.Glycated hemoglobin was estimated by the high-performanceliquid chromatography method using the Variant� machine(Bio-Rad, Hercules, CA). Serum insulin concentration was es-timated using kits from Dako (Glostrup, Denmark).

Levels of serum cholesterol (cholesterol oxidase–peroxidase–amidopyrine method; Roche Diagnostics), serum triglycerides(glycerol phosphate oxidase–peroxidase–amidopyrine method;Roche Diagnostics), and HDL-C (direct method, polyethyl-ene glycol–pretreated enzymes; Roche Diagnostics) weremeasured using the Hitachi-912 autoanalyzer. Insulin resis-tance was calculated using the homeostasis assessmentmodel using the formula fasting insulin (IU/mL) · fastingglucose (mmol/L)/22.5.30

Genetic analysis

EDTA-anticoagulated venous blood samples were col-lected from all study subjects, and the genomic DNA wasisolated from whole blood by proteinase K digestion followed

Table 1. Clinical and Biochemical Characteristics

of the Study Subjects

Parameter

Normal glucosetolerance subjects

(n = 1,000)

Sex (male:female) 466:534Age (years) 45 – 13BMI (kg/m2) 23.4 – 4.7Waist circumference (cm) 83.5 – 12.1Blood pressure (mm Hg)

Systolic 115 – 17Diastolic 74 – 11

Fasting plasma glucose (mmol/L) 4.7 – 0.42-h post-load plasma glucose (mmol/L) 5.5 – 0.05Fasting serum insulin ((IU/mL) 8.3 – 5.6Glycated hemoglobin (%) 5.5 – 0.5Serum cholesterol (mg/dL) 173 – 35Serum triglycerides (mg/dL)

Untransformed 156 – 56Log-transformed 1.99 – 0.20

HDL-C (mg/dL) 43 – 10LDL-C (mg/dL) 107 – 30

Data are mean – SD values.BMI, body mass index; HDL-C, high-density lipoprotein-cholesterol;

LDL-C, low-density lipoprotein-cholesterol.

504 ASHOK AYYAPPA ET AL.

by phenol–chloroform extraction.31 The concentration andpurity was estimated with a NanoDrop� 1000 spectropho-tometer (Thermo Scientific, Wilmington, DE).

We amplified the regions of the HL gene using the Gen-eAmp� PCR [polymerase chain reaction] system 9700 (Ap-plied Biosystems, Foster City, CA), using the followingprimers: forward 5¢ GGC ATC TTT GCT TCT TCG TC 3¢,reverse 5¢ CTG GCT CAG GAA AGT GGT GT¢; forward 5¢TTCATCCAGGCAGCTCTTCT 3¢, reverse 5¢ CCAATCTTGTGCGTTCCAC 3¢; forward 5¢ CTTTCCCATTAGGGCTGGAT 3¢, reverse 5¢ TCCTATGGGCTGTTTGATGC 3¢; andforward 5¢ TGC TGT GTT TGC TTC CTG TT 3¢, reverse 5¢AAG GCA GCC ATT CCA GAT AA3¢ (Sigma, Bangalore,India). Restriction fragment length polymorphism was car-ried out using NlaIII (rs1800588 C/T), Xmn1 (rs690 G/T),Tsp509I (rs6083 G/A), and ScrfI (rs6074 A/C) restriction en-zymes (New England Biolabs, Inc., Ipswich, MA). Agarose gelelectrophoresis was used to check the amplification of thePCR and the restriction enzyme–digested products. The per-

centage of agarose in the gel varied, depending on the ex-pected size(s) of the fragment(s). Ethidium bromide wasincluded in the gel matrix to enable fluorescent visualizationof the DNA fragments under ultraviolet light. To ensure thatthe genotyping was of adequate quality, we performed ran-dom duplicates in 20% of the samples. The assays were per-formed by a technician who was masked to the phenotype,and there was 99% concordance in the genotyping. Further-more, a few variants were confirmed by direct sequencingwith an ABI 310 genetic analyzer (Applied Biosystems).

Statistical analysis

Statistical Package for Social Sciences (SPSS) Windows(version 15.0) (SPSS, Inc., Chicago, IL) was used for statisticalanalysis. Allele frequencies were estimated by gene counting.Agreement with Hardy–Weinberg expectations was testedusing a v2 goodness-of-fit test. The v2 test or Fisher’s exact ttest as appropriate was used to compare the proportions of

Table 2. Association of Hepatic Lipase Gene Polymorphisms with Serum Triglyceride

OR (95% CI), P

Single nucleotide polymorphism Normal TG subjects High TG subjects Unadjusted Adjusteda

rs1800588 (C-480T) (C/T) (n) 577 168CC 341 (59.1%) 89 (53.0%) Reference ReferenceCT 207 (35.9%) 60 (35.7%) 1.11 (0.76–1.60), 0.57 1.13 (0.77–1.63), 0.52TT 29 (5.0%) 19 (11.3%) 2.51 (1.34–4.68), 0.004b 2.58 (1.38–4.85), 0.003b

MAF (T) 23.0% 29.2% — —

rs690 (Val155Val) (G/T) (n) 561 163GG 176 (31.4%) 53 (32.5%) Reference ReferenceGT 275 (49.0%) 72 (44.2%) 0.86 (0.58–1.30), 0.49 0.93 (0.61–1.40), 0.73TT 110 (19.6%) 38 (23.3%) 1.14 (0.71–1.85), 0.57 1.22 (0.75–1.99), 0.40

MAF (T) 44.1% 45.4% — —

rs6083 (Ser193Asn) (G/A) (n) 519 150GG 212 (40.8%) 68 (45.3%) Reference ReferenceGA 233 (44.9%) 64 (42.7%) 0.85 (0.58–1.26), 0.43 0.86 (0.58–1.28), 0.47AA 74 (14.3%) 18 (12.0%) 0.75 (0.42–1.35), 0.35 0.79 (0.44–1.43), 0.45

MAF (A) 36.7% 33.3% — —

rs6074 (Thr479Thr) (A/C) (n) 564 161AA 131 (23.2%) 43 (26.7%) Reference ReferenceAC 281 (49.8%) 68 (42.2%) 0.73 (0.47–1.13), 0.16 0.71 (0.45–1.11), 0.15CC 152 (27.0%) 50 (31.1%) 1.00 (0.62–1.60), 0.99 0.96 (0.59–1.55), 0.87

MAF (C) 51.9% 52.1% — —

aAdjusted for age, gender, and body mass index.bP value indicates a significant difference.CI, confidence interval; MAF, minor allele frequency; OR, odds ratio.

Table 3. Association of the Hepatic Lipase Variant rs1800588 (C-480T) with Serum Triglycerides

Under Various Genetic Models

Genotype distribution Adjusted OR (95% CI)a

Genotype for TGs Normal TG subjects High TG subjects Additive model Dominant model Recessive model

CC 341 (59.1%) 89 (53.0%) 2.73 (1.44–5.18) 1.23 (0.865–1.754) 2.69 (1.446–5.02)CT 20 (35.9%) 60 (35.7%) Padditive = 0.002b Pdominant = 0.24 Precessive = 0.002b

TT 29 (5%) 19 (11.3%) — — —

aAdjusted for age, gender, and body mass index.bP value indicates a significant difference.CI, confidence interval; OR, odds ratio; TG, triglyceride.

HEPATIC LIPASE/DYSLIPIDEMIA IN SOUTH INDIANS 505

genotypes or alleles. One-way analysis of variance was usedto compare groups for continuous variables. Logistic regres-sion analysis was done using HDL and triglycerides (dichot-omized) as the dependent variable and the genotypes (riskfactor) and age, gender, and BMI (covariates adjusted in theanalysis) as independent variables. Significant P values ob-tained were then corrected for multiple testing.

Haplotype analysis was performed using Haploview soft-ware (available at www.broad.mit.edu/mpg/haploview/).32

Haplotype frequencies were estimated using an expectation-maximization algorithm. Linkage disequilibrium (LD) andhaplotype frequencies were estimated using Haploviewsoftware. A P value of < 0.05 was considered as statisticallysignificant. Significant P values obtained were then correctedfor multiple testing (Bonferroni’s correction), and permuta-tion P values were calculated by comparing haplotype fre-quencies between cases and controls based on 10,000replications using the functions from the Haploview program.Power was estimated using an online post hoc power com-putation tool PS power and sample size calculator.

Results

The clinical and biochemical characteristics of the studysubjects are shown in Table 1. Among the 1,000 NGT studysubjects the ratio of male:female NGT subjects in the presentstudy was 466:534. Table 2 shows the distribution of geno-type frequencies among the study subjects stratified basedon serum triglyceride levels. We found the rs1800588 C-480Tvariant of the HL gene to be significantly associated withhypertriglyceridemia. All the genotype frequencies of thefour variants in the study subjects were in Hardy–Weinbergequilibrium. The frequency of the TT genotype was 11.3%

among the hypertriglyceridemic group, compared with 5%among the normotriglyceridemic group (P = 0.005). The mi-nor allele frequency of the T allele was also significantlyhigher among the hypertriglyceridemic group (29.2%)compared with the normotriglyceridemic group (23.0%)(P = 0.02). Logistic regression analysis showed that the un-adjusted odds ratio (OR) for the TT genotype was 2.51 (95%confidence interval [CI] 1.34–4.68, P = 0.004). This associationpersisted even after adjusting for age, gender, and BMI, withan OR of 2.58 (95% CI 1.38–4.85, P = 0.003). None of the othervariants showed any significant difference in the distributionof genotype frequency between the two groups. We alsoperformed the power calculation to evaluate whether oursample size had sufficient power to detect the observeddifference in the proportion of the CC and CT genotypes inthe two groups (controls and cases) and found that thepower was 0.75.

Testing the association of the HL variants undervarious genetic models

Various genetic models were tested for the variant that wassignificantly associated with serum triglycerides (Table 3).

The association of the rs1800588 (C-480T) variant of theHL gene with triglycerides was assessed based on the ad-ditive genetic model. We obtained an OR of 2.73 (95% CI1.44–5.18, P = 0.002) for the TT genotype, after adjusting forage, sex, and BMI. Under the dominant model, the OR was1.23 (95% CI 0.86–1.75, P = 0.24) for the CT + TT genotype.Under the recessive model, we observed an adjusted OR of2.69 (95% CI 1.44–5.02, P = 0.002) for the TT genotype. Allthese observations were done after adjusting for age, sex,and BMI.

Table 4. Association of Hepatic Lipase Gene Polymorphisms with High-Density Lipoprotein

OR (95% CI), P

Single nucleotide polymorphism Normal HDL subjects Low HDL subjects Unadjusted Adjusteda

rs1800588 (C-480T) (C/T) (n) 413 332CC 235 (56.9%) 196 (59.0%) Reference ReferenceCT 150 (36.3%) 116 (34.9%) 0.92 (0.68–1.26), 0.63 0.94 (0.68–1.30), 0.73TT 28 (6.8%) 20 (6.0%) 0.85 (0.46–1.56), 0.61 0.83 (0.43–1.57), 0.56

MAF (T) 24.9% 23.5% — —

rs690 (Val155Val) (G/T) (n) 398 326GG 134 (33.7%) 95 (29.1%) Reference ReferenceGT 181 (45.5%) 166 (50.9%) 1.29 (0.92–1.81), 0.13 1.31 (0.91–1.87), 0.13TT 83 (20.9%) 65 (19.9%) 1.10 (0.72–1.67), 0.64 1.02 (0.66–1.59), 0.90

MAF (T) 43.6% 45.4% — —

rs6083 (Ser193Asn) (G/A) (n) 356 312GG 136 (38.2%) 144 (46.2%) Reference ReferenceGA 169 (47.5%) 127 (40.7%) 0.71 (0.51–0.98), 0.04b 0.72 (0.51–1.02), 0.06AA 51 (14.3%) 41 (13.1%) 0.75 (0.47–1.21), 0.25 0.67 (0.40–1.10), 0.11

MAF (A) 38.1% 33.5% — —

rs6074 (Thr479Thr) (A/C) (n) 407 317AA 102 (25.1%) 72 (22.7%) Reference ReferenceAC 206 (50.6%) 142 (44.8%) 0.97 (0.67–1.41), 0.90 0.80 (0.54–1.20), 0.29CC 99 (24.3%) 103 (32.5%) 1.47 (0.97–2.21), 0.06 1.25 (0.81–1.95), 0.30

MAF (C) 49.6% 55.0% — —

aAdjusted for age, gender, and body mass index.bP value indicates a significant difference.CI, confidence interval; MAF, minor allele frequency; OR, odds ratio.


Table 4 shows the distribution of genotype frequenciesamong the study subjects stratified based on HDL-C levelsaccording to the modified Adult Treatment Panel III guide-lines29 as mentioned earlier. The rs6074 (Thr479Thr) (A/C)variant of the HL gene was significantly associated with lowHDL-C levels. The logistic regression analysis showed thatthe unadjusted OR for the CC genotype was 1.47 (95% CI 0.97–2.21, P = 0.06); after adjusting for age, sex, and BMI, the ORwas 1.25 (95% CI 0.81–1.95, P = 0.30). Similarly, the rs6083(Ser193Asn) (G/A) variant of the HL gene was significantlyassociated with normal HDL-C levels among the NGT sub-jects. We observed a significantly higher GA frequency(47.5%) among the normal HDL-C group, compared with thelow HDL-C group (40.7%) (P = 0.05). However, the OR sig-nificance was lost after adjusting for age, gender, and BMI:OR = 0.72 (95% CI 0.51–1.02, P = 0.06).

Because HDL-C cut points are different in males and fe-males, separate analysis was done in males and females.Table 5 shows that among the males, the GA genotype of thers6083 (Ser193Asn) (G/A) variant was also significantlyassociated with normal HDL-C levels. The frequency of theGA genotype was significantly associated with normalHDL-C levels (54.1%) compared with low HDL-C levels(38.3%) (P = 0.05). However, the significance was lost afteradjusting for age and BMI. There was no significant asso-ciation of HL gene variants with HDL-C among females.Table 6 shows that among males, none of the four HL vari-ants showed any significant association with serum tri-glycerides; however, in the case of female NGT subjects, inthe variant C-514T, the frequency of the TT genotype wassignificantly higher among the high triglyceride group(11.9%) compared with the normal triglyceride group (4.1%)(P = 0.001). The minor allele frequency of the T allele wasalso significantly higher among the high triglyceride group

(39.7%) compared with the normal triglyceride group(23.3%) (P < 0.001).

In Table 7, a linear regression analysis was done to estimatethe effect size b (B) of the four HL gene variants with variousquantitative traits among subjects without diabetes. In thecase of the - 514 C/T variant, we observed a significant effectsize (B) of 0.06 with an SE of 0.21 (P = 0.003). Also, in the caseof the rs6074 (Thr479Thr) variant, a significant B of 0.79 wasobserved (P = 0.01). The other variants did not show any

Table 5. Association of Hepatic Lipase Gene Polymorphisms with High-Density Lipoprotein Based on Gender

Single nucleotide polymorphism Normal HDL subjects Low HDL subjects P value

Male subjectsrs6083 (Ser193Asn) (G/A) (n) 61 214

GG 21 (34.4%) 100 (46.7%) 0.05 (GG vs. GA)a

GA 33 (54.1%) 82 (38.3%) 0.26 (GA vs. AA)AA 7 (11.5%) 32 (15.0%) 0.87 (GG vs. AA)

MAF (A) 38.5% 34.1% 0.42

rs6074 (Thr479Thr) (A/C) (n) 79 226AA 16 (20.3%) 51 (22.6%) 0.58 (AA vs. AC)AC 43 (54.4%) 108 (47.8%) 0.44 (AC vs. CC)CC 20 (25.3%) 67 (29.6%) 0.95(AA vs. CC)

MAF (C) 52.5% 53.5% 0.89

Female subjectsrs6083 (Ser193Asn) (G/A) (n) 109 284

GG 40 (36.7%) 119 (41.9%) 0.53 (GG vs. GA)GA 52 (47.7%) 129 (45.4%) 0.76 (GA vs. AA)AA 17 (15.6%) 36 (12.7%) 0.42 (GG vs. AA)

MAF (A) 39.4% 35.3% 0.32

rs6074 (Thr479Thr) (A/C) (n) 118 301AA 32 (27.1%) 75 (24.9%) 0.95 (AA vs. AC)AC 61 (51.7%) 136 (45.2%) 0.10 (AC vs. CC)CC 25 (21.2%) 90 (29.9%) 0.21(AA vs. CC)

MAF (C) 47.0% 52.4% 0.17

aP value indicates a significant difference.HDL, high-density lipoprotein; MAF, minor allele frequency.

FIG. 1. Linkage disequilibrium pattern of the hepatic lipasegene (four loci). Pairwise linkage disequilibrium coefficientsD¢ · 100 are shown in each cell.


significant association with any of the quantitative traitsamong the NGT subjects.

Table 8 shows the association between clinical and bio-chemical parameters with the four variants of the HL gene.In the case of the C-480T variant, the TT genotype was sig-nificantly associated with higher triglyceride levels com-pared with the other genotypes (P = 0.002). In the case of thers6074 (Thr479Thr) (A/C) variant, the CC genotype wassignificantly associated with lower HDL-C levels(41.3 – 9.8 mg/dL), compared with the AA genotype(43.6 – 10.2 mg/dL) (P = 0.02). None of the parametersshowed any significant association with rs690 (Val155Val)(G/T) variants in the HL gene among the study subjects. The

significant associations observed were validated by per-forming multiple testing.

Association of the haplotype with HDL-C and serumtriglyceride levels

Figure 1 shows the LD pattern observed in the HL genewith respect to the four variants studied among NGT subjects.The LD value between rs690 (G/T) and rs6074 (A/C) wasweak with r2 = 0.02, the LD between rs1800588 (C-482T) andrs690 (G/T) was very weak with r2 = 0.00, and the LD valuebetween rs6083 (G/A) and rs6074 (A/C) was moderate withr2 = 0.13.

Table 6. Association of Hepatic Lipase Gene Polymorphisms with Serum Triglycerides

Among Male and Female Normal Glucose Tolerance Subjects

Single nucleotide polymorphisms Normal TG subjects High TG subjects P value

Male subjectsrs6083 (Ser193Asn) (G/A) (n) 201 73

GG 85 (42.3%) 36 (48.6%) 0.27 (GG vs. GA)a


MAF (A) 35.6% 33.8% 0.77

rs6074 (Thr479Thr) (A/C) (n) 263 85AA 62 (23.6%) 25 (29.4%) 0.30 (AA vs. AC)AC 121 (46%) 34 (40%) 0.38 (AC vs. CC)CC 45 (17.1%) 18 (21.2%) 0.87 (AA vs. CC)

MAF (C) 46.3% 45.5% 0.93

rs1800588 (C-514T) (C/T) (n) 263 85CC 140 (53.2%) 46 (54.1%) 0.75(CC vs. CT)CT 78 (29.7%) 29 (34.1%) 0.65 (CT vs. TT)TT 13 (4.9%) 7 (8.9%) 0.46 (CC vs. TT)

MAF (T) 22.5% 26.2% 0.39

rs690 (Val155Val) (G/T) (n) 273 73GG 82 (35.7%) 19 (26%) 0.27 (GG vs. GT)GT 101 (43.9%) 35 (47.9%) 0.77 (GT vs. TT)TT 47 (20.4%) 19 (26%) 0.18 (GG vs. TT)

MAF (T) 42.4% 50.0% 0.12

Female subjectsrs6083 (Ser193Asn) (G/A) (n) 318 76

GG 127 (39.9%) 32 (42.1%) 0.97 (GG vs. GA)a


MAF (A) 37.4% 32.9% 0.34

rs6074 (Thr479Thr) (A/C) (n) 386 101AA 90 (23.3%) 25 (24.8%) 0.50 (AA vs. AC)AC 164 (42.5%) 36 (35.6%) 0.43 (AC vs. CC)CC 82 (21.2%) 23 (22.8%) 0.89 (AA vs. CC)

MAF (C) 48.8% 43.5% 0.93

rs1800588 (C-514T (C/T) (n) 386 101CC 201 (52.1%) 43 (42.6%) 0.75 (CC vs. CT)CT 129 (33.4%) 31 (30.7%) 0.001 (CT vs. TT)a

TT 16 (4.1%) 12 (11.9%) 0.001 (CC vs. TT)a

MAF (T) 23.3% 39.7% < 0.0001a

rs690 (Val155Val) (G/T) (n) 331 90GG 94 (28.4%) 34 (37.8%) 0.06 (GG vs. GT)GT 174 (52.6%) 37 (41.1%) 0.34 (GT vs. TT)TT 63 (19.0%) 19 (21.1%) 0.69 (GG vs. TT)

MAF (T) 45.3% 41.7% 0.43

aP value indicates a significant difference.MAF, minor allele frequency; TG, triglyceride.


Table 9 shows the haplotypes obtained with Haploviewversion 4.2 software. The haplotypes associated were testedfor multiple correction (a/number of possible haplotypes),where a = 0.05. Owing to lower LD values (r2 = 0.00) betweenthe rs1800588 (C/T) ( - C514T) variant and other variants, thers1800588 (C/T) ( - C514T) variant was not included inthe haplotype block. So the other three SNPs were included inthe haplotype block. Therefore, in combination with threeSNPs, rs6074 (Thr479Thr) (C/A), rs690 (Val155Val) (G/T),and rs6083 (Ser193Asn) (G/A) in the coding region of the HLgene, eight haplotype combinations were obtained, of whichthe GAA and TGC haplotypes were taken for further analysiswith various disease phenotypes. Because eight tests wereperformed corresponding to the eight haplotypes satisfyingthe selection criterion, a multiple correction was done usingBonferroni’s correction. The true association of the haplotypewas tested using permutation analysis in Haploview soft-ware, wherein 10,000 permutations were computed, to obtainthe differences in haplotype frequencies between cases andcontrols. We observed that the difference in the proportion inthe haplotypes GAA and TGC between the cases and controlswas truly significant.

For HDL-C levels, the frequency of the GAA haplotype wassignificantly higher among the normal HDL group (0.268)compared with the low HDL group (0.257) (P = 0.006). Thefrequency of the TGC haplotype was observed to be signifi-cantly higher among the low HDL group (0.150) comparedwith the normal HDL group (0.096) (P = 0.002).

In the case of serum triglycerides, the haplotype frequen-cies were not significantly different between the cases andcontrols (data not shown).

Table 7. Estimation of Effect Size for Quantitative

Traits Among the Hepatic Lipase Gene Variants

Among Normal Glucose Tolerance Subjects

Polymorphism B (b) SE P valuea

C-514TFasting plasma glucose (mg/dL) 1.92 2.49 0.43Serum cholesterol (mg/dL) 1.82 1.55 0.24HDL-C (mg/dL) 0.42 0.36 0.24Log TG (mg/dL) 0.06b 0.21b 0.003b

LDL-C (mg/dL) 1.05 1.39 0.45

rs690 (Val155Val)Fasting plasma glucose (mg/dL) - 0.86 2.18 0.69Serum cholesterol (mg/dL) - 0.81 1.38 0.55HDL-C (mg/dL) - 0.14 0.32 0.64Log TG (mg/dL) - 0.006 0.18 0.76LDL-C (mg/dL) - 0.36 1.22 0.76

rs6083 (Ser193Asn)Fasting plasma glucose (mg/dL) 1.13 2.33 0.62Serum cholesterol (mg/dL) - 0.88 1.44 0.53HDL-C (mg/dL) 0.32 0.34 0.33Log TG (mg/dL) - 0.20 0.20 0.31LDL-C (mg/dL) - 0.59 1.31 0.64

rs6074 (Thr479Thr)Fasting plasma glucose (mg/dL) 0.54 2.21 0.80Serum cholesterol (mg/dL) 1.42 1.35 0.29HDL-C (mg/dL) 0.79 0.32 0.01Log TG (mg/dL) 0.01 0.08 0.52LDL-C (mg/dL) - 0.56 1.21 0.64

aAdjusted for age, sex, and body mass index.bP value indicates a significant difference.HDL-C, high-density lipoprotein-cholesterol; LDL-C, low-density

lipoprotein-cholesterol; TG, triglyceride.

Table 8. Association Between Hepatic Lipase Single Nucleotide Polymorphisms and Biochemical

Parameters Stratified Based on the Genotypes

Clinical parameter,genotypea

rs1800588(C-480T) Pb

rs690(Val155Val) Pb

rs6083(Ser193Asn) Pb

rs6074(Thr479Thr) Pb

Fasting plasma glucose (mg/dL)0 84.0 – 7.8 84.4 – 8.0 84.2 – 8.3 85 – 8.21 85.2 – 8.5 0.09 84.4 – 8.5 0.96 84.6 – 7.8 0.64 84 – 8.3 0.292 82.9 – 8.8 84.2 – 7.5 83.7 – 7.5 84.5 – 7.8

Serum cholesterol (mg/dL)0 176.2 – 33.9 181.5 – 37.4 177.2 – 33.8 181 – 371 180.6 – 37.3 0.27 175.0 – 34.1 0.09 177.4 – 35.8 0.32 177 – 33.8 0.162 178.9 – 34.4 176.9 – 33.0 171.5 – 30.2 174 – 36

HDL-C (mg/dL)0 42.6 – 10.0 43.4 – 10.4 41.5 – 9.2 43.4 – 9.71 43.2 – 9.9 0.68 42.3 – 9.7 0.40 43.3 – 10.2 0.10 43.6 – 10.2 0.02c

2 43.0 – 10.2 42.4 – 9.4 42.9 – 10.2 41.3 – 9.8

Serum triglycerides (mg/dL)0 112.1 – 64 119 – 74 121 – 65.4 122 – 80.11 121.0 – 65 0.002c 114 – 58.7 0.73 116 – 65 0.56 112.6 – 58.5 0.582 145.2 – 91.1 120.6 – 7 113 – 98 121 – 80.2

LDL-C (mg/dL)0 111.3 – 29.7 114.2 – 32.7 111.5 – 28.6 113 – 311 113.0 – 31.6 0.40 109.9 – 29.0 0.22 110.9 – 30.9 0.29 110 – 29.2 0.332 106.9 – 26.5 110.4 – 28.6 106.0 – 28.9 108.6 – 31

Data are mean – SD values.a0 is the homozygous normal genotype, 1 is heterozygous, and 2 is the homozygous variant genotype.bP adjusted for age and sex.cP value indicates a significant difference.HDL-C, high-density lipoprotein-cholesterol; LDL-C, low-density lipoprotein-cholesterol.


Association of TGC haplotype with quantitative traitsamong the subjects without diabetes

Table 10 shows the association of the TGC haplotype withvarious biochemical parameters. The TGC haplotype wassignificantly associated with hypertriglyceridemia: the sub-jects with the TGC haplotype showed significantly higherserum triglyceride levels (2.03 – 0.22 mg/dL) compared withthe other haplotypes (1.99 – 0.2 mg/dL) (P = 0.05). We alsoobserved significantly lower HDL-C levels among the TGCcarriers (41.4 – 9.8 mg/dL) compared with the other haplo-types (43.7 – 10.0 mg/dL) (P = 0.003).

Discussion

In this case-control study, we aimed to investigate the as-sociation of the HL gene with dyslipidemia. We genotypedfour common variants: rs1800588 (C/T) (also denominated as- 480 C/T or - 514 C/T) located in the promoter region;rs6083 (Ser193Asn) (G/A) variant located in exon 4; rs690(Val155Val), located in exon 3; and rs6074 (Thr479Thr) (A/C)variant, located in exon 9 of the HL gene.

We found that the T allele of the variant - 480 C/T locatedin the promoter region of the HL gene was associated withhigher triglyceride levels. Also, the TGC haplotype was sig-nificantly associated with low HDL-C levels among the studysubjects. Studies among a Finnish population33 also found the- 480 C/T polymorphism to be associated with insulin resis-tance and high triglyceride levels. In our study the TT geno-type was found to confer a 2.5 times higher risk ofhypertriglyceridemia.

The proximal promoter region of the HL gene is an im-portant binding site for upstream stimulatory factor-1, andthe - 480 C/T substitution might induce changes in the E-boxmotif from CACGTG to CATGTG. This disruption in thebinding site is probably responsible for lowering the HL geneactivity.34 Because HL catalyzes the hydrolysis of TG fromintermediate-density lipoprotein and LDL,35 such defects inthe HL gene due to the promoter variant - 480 C/T may leadto hypertriglyceridemia. Studies on an interactive effect be-tween HL (also known as LIPC [lipase, hepatic]) gene variantsand apolipoprotein E2 and that included C-514T,G-250A

variants showed strong association of the TT genotype of the- 514 C/T variant with hypertriglyceridemia among healthyCanadian adults36 and similar association with serum tri-glycerides among an Iranian population,37 strengthening thefinding among NGT subjects in the present study. Although afew studies have shown quite a significant association withHDL-C in other ethnic populations,38–40 the present study didnot find any association with HDL-C.

The rs6074 (Thr479Thr) (A/C) variant located in exon 9 ofthe HL gene was significantly associated with low HDL-Clevels among the study subjects; however, correction for age,gender, and BMI abolished the association. Moreover, the CCgenotype was observed to be significantly associated withlow HDL-C levels (41.3 – 9.8 mg/dL) even after correcting forage and sex. An earlier study on two white populations failedto show an association with HDL-C.41 HL probably has anti-atherogenic functions involving the uptake of HDL-C by theliver as part of the reverse cholesterol transport pathway.42

Although a synonymous variation, this might facilitate bio-physical change in the conformation and energetic aspects ofthe gene, resulting in enhancement of the gene function. HighHL activity is associated with an increase in small dense LDLparticles and increased risk of vascular events.43

With reference to the rs6083 (Ser193Asn) (G/A) variant,located in exon 4 of the HL gene, we observed significantlylower serum triglycerides levels among the subjects with theAA genotype compared with the GG genotype. Exon 4 of theHL gene is the region that binds to the lipoprotein substrate.44

This points to the potential role played by this variant in en-hancing the activity of the HL enzyme in the hydrolysis of thetriglycerides of intermediate-density lipoproteins. Studiesconducted among white populations41,45 showed no signifi-cant association of this variant with HDL-C levels.

The haplotype analysis representing three variants in theHL gene showed the GAA haplotype as a protective haplo-type, conferring lower risk toward low HDL-C levels amongthe study subjects, and the TGC haplotype proved to be ahigh-risk haplotype, conferring high risk toward low HDL-Clevel. The benefit of a haplotype-based analysis is that itcaptures all of the variation across a region, which aids inimproving the ability to detect an association. Hence we candelineate the association of the HL gene variants with major

Table 9. Haplotype Frequencies of the Three Single

Nucleotide Polymorphisms of the Hepatic Lipase

Gene Phenotype: High-Density Lipoprotein Levels

HaplotypeBlock 1

Haplotypefrequency

Case, controlfrequencies

Pvaluea

PermutationP valueb

GGA 0.263c 0.257, 0.268c 0.006c 0.005c

TAC 0.161 0.150, 0.170 0.3142 NSGGC 0.138 0.149, 0.130 0.2985 NSTGA 0.136 0.125, 0.145 0.2862 NSTGC 0.12c 0.150, 0.096c 0.0021c 0.002c

GAC 0.108 0.105, 0.110 0.7416 NSGAA 0.038 0.033, 0.041 0.4115 NSTAA 0.036 0.031, 0.039 0.4017 NS

aP value after multiple corrections (P value · number of tests/number of haplotypes).

bPermutation P values were calculated based on 10,000 permuta-tion replications.

cP value indicates a significant difference.Case, low high-density lipoprotein level; control, normal high-

density lipoprotein level; NS, not significant.

Table 10. Association of the TGC Haplotype

with the Quantitative Traits

Haplotype combination

Quantitative trait TGCOther

haplotypesP

valuea

HDL-C (mg/dL) 41.4 – 9.8 43.7 – 10.0 0.003b

Log-transformed serumtriglycerides (mg/dL)

2.03 – 0.22 1.99 – 0.2 0.05b

Fasting plasmaglucose (mg/dL)

85 – 7.8 84.0 – 8.2 0.30

Serum cholesterol (mg/dL) 214 – 50.1 200 – 38.9 0.26LDL-C (mg/dL) 112.4 – 29.7 108 – 34.0 0.08Glycated hemoglobin (%) 5.9 – 0.47 5.6 – 0.48 0.47

Data are mean – SD values.aP value after multiple corrections (P value · number of tests/

number of haplotypes).bP value indicates a significant difference.HDL-C, high-density lipoprotein; LDL, low-density lipoprotein.


dyslipidemic phenotypes among our study subjects withoutdiabetes. Apart from the - 480 C/T variant, there are notmany studies that support the association of rs690 (Val155Val)(G/T), rs6083 (Ser193Asn) (G/A), and rs6074 (Thr479Thr) (C/A) variants with HDL-C and triglycerides. By identifyingwhole chromosomal regions, haplotypes have improvedpower and reproducibility in elucidation of disease–gene as-sociations.

To circumvent the problem of population stratification, weperformed a case-control study at six unlinked marker locibelieved to be unrelated to the disease under study, butknown to have allelic diversity among different popula-tions.46 The allele frequency difference was not statisticallysignificant at any of the loci, indicating that the findings in thisstudy were unlikely to be an artifact of population sub-structuring.

To our knowledge this is the first study of the associationof four variants of the HL gene with HDL-C and serumtriglycerides in Asian Indians. We conclude that in thisethnic group, the rs1800588 (C/T) (C-480T) variant is as-sociated with hypertriglyceridemia, that the rs6074(Thr479Thr) (A/C) variant is associated with low HDL-Clevels, and that the haplotype TGC confers susceptibility tolow HDL-C levels.

Acknowledgments

K.A.A. was supported by the Council of Scientific and In-dustrial Research. The Chennai Wellingdon CorporateFoundation supported the CURES field studies. This is the109th publication from the CURES (CURES-109).

Author Disclosure Statement

No competing financial interests exist.

References

1. World Health Organization: Quantifying selected majorrisks to health. In: The World Health Report 2002—Reducing Risks, Promoting Healthy Life. Geneva: WorldHealth Organization, 2002:47–97.

2. Eaton CB: Hyperlipidemia. Prim Care Clin Office Pract2005;32:1027–1055.

3. Mather HM, Keen H: The Southall Diabetes Survey: preva-lence of known diabetes in Asians and Europeans. BMJ1985;291:1081–1084.

4. McKeigue PM: Coronary heart disease in Indians, Pakistanisand Bangladeshis: etiology and possibilities for prevention.Br Heart J 1992;67:341–342.

5. Mohan V, Sharp PS, Cloke JM, Burrin HR, Schumer B,Kohner EM: Serum immunoreactive insulin responses to aglucose load in Asian Indian and European type 2 (non-insulin dependent) diabetic patients and control subjects.Diabetologia 1986;29:235–237.

6. Mohan V, Deepa R: Risk factors for coronary artery diseasein Indians. J Assoc Physicians India 2004;52:95–97.

7. Joshi SR: Metabolic syndrome—emerging clusters of theIndian phenotype. J Assoc Physicians India 2003;51:445–446.

8. Mohan V, Sandeep S, Deepa R, Shah B, Varghese C: Epi-demiology of type 2 diabetes: Indian scenario. Indian J MedRes 2007;125:217–230.

9. Yajnik CS, Fall CH, Vaidya U, Pandit AN, Bavdekar A, BhatDS, Osmond C, Hales CN, Barker DJ: Fetal growth and

glucose and insulin metabolism in four-year old Indianchildren. Diabet Med 1995;12:330–336.

10. Vimaleswaran KS, Radha V, Ghosh S, Majumder PP,Deepa R, Babu HN, Rao MR, Mohan V: Peroxisome pro-liferator-activated receptor-gamma co-activator-1alpha(PGC-1alpha) gene polymorphisms and their relationshipto Type 2 diabetes in Asian Indians. Diabet Med 2005;22:1516–1521.

11. Vimaleswaran KS, Radha V, Ramya K, Babu HN, Savitha N,Roopa V, Monalisa D, Deepa R, Ghosh S, Majumder PP, RaoMR, Mohan V: A novel association of a polymorphism in thefirst intron of adiponectin gene with type 2 diabetes, obesityand hypoadiponectinemia in Asian Indians. Hum Genet2008;123:599–605.

12. Mohan V, Venkatraman JV, Pradeepa R: Epidemiology ofcardiovascular disease in type 2 diabetes: the Indian sce-nario. J Diabetes Sci Technol 2010;4:158–170.

13. Gupta R, Guptha S, Agrawal A, Kaul V, Gaur K, Gupta VP:Secular trends in cholesterol lipoproteins and triglyceridesand prevalence of dyslipidemias in an urban Indian popu-lation. Lipids Health Dis 2008;7:40.

14. Ramachandran A, Snehalatha C, Yamuna A, Murugesan N,Narayan KM: Insulin resistance and clustering of cardio-metabolic risk factors in urban teenagers in southern India.Diabetes Care 2007;30:1828–1833.

15. Radhika G, Ganesan A, Sathya RM, Sudha V, Mohan V:Dietary carbohydrates, glycemic load and serum high-density lipoprotein cholesterol concentrations among SouthIndian adults. Eur J Clin Nutr 2009;63:413–420.

16. Pradeepa R, Deepa R, Rani SS, Premalatha G, Saroja R,Mohan V: Socioeconomic status and dyslipidaemia in aSouth Indian population: the Chennai Urban PopulationStudy (CUPS 11). Natl Med J India 2003;16:73–78.

17. Radha V, Mohan V, Vidya R, Ashok AK, Deepa R, MathiasRA: Association of lipoprotein lipase Hind III and Ser 447Ter polymorphisms with dyslipidemia in Asian Indians. AmJ Cardiol 2006;97:1337–1342.

18. Perret B, Mabile L, Martinez L, Terce F, Barbaras R, Collet X:Hepatic lipase: structure/function relationship, synthesis,and regulation. J Lipid Res 2002;43:1163–1169.

19. Deeb SS, Zambon A, Carr MC, Ayyobi AF, Brunzell JD:Hepatic lipase and dyslipidemia: interactions among ge-netic variants, obesity, gender, and diet. J Lipid Res 2003;44:1279–1286.

20. Brunzell J, Deeb S: Familial lipoprotein lipase deficiency, apoCII deficiency, and hepatic lipase deficiency. In: Scriver C,Beaudet A, Sly W, Vale D, eds. The Metabolic and MolecularBasis of Inherited Disease. New York: McGraw-Hill,2001:2789–2816.

21. Jansen H, Verhoeven AJ, Weeks L, Kastelein JJ, Halley DJ,van den Ouweland A, Jukema JW, Seidell JC, BirkenhagerJC: Common C-to-T substitution at position 7480 of the he-patic lipase promoter associated with a lowered lipase ac-tivity in coronary artery disease patients. ArteriosclerThromb Vasc Biol 1997;17:2837–2842.

22. Hegele RA, Tu L, Connelly PW: Human hepatic lipasemutations and polymorphisms. Hum Mutat 1992;1:320–324.

23. Zambon A, Deeb SS, Hokanson JE, Brown BG, Brunzell JD:Common variants in the promoter of the hepatic lipase geneare associated with lower levels of hepatic lipase activity,buoyant LDL and higher HDL2 cholesterol. ArteriosclerThromb Vasc Biol 1998;18:1723–1729.

24. Juo SH, Han Z, Smith JD, Colangelo L, Liu K: Promoterpolymorphisms of hepatic lipase gene influence HDL2 but


not HDL3 in African American men: CARDIA study. J LipidRes 2011;42:258–264.

25. Deeb SS, Peng R: The C-514T polymorphism in the humanhepatic lipase gene promoter diminishes its activity. J LipidRes 2000;41:155–158.

26. Hodoglugil U, Williamson DW, Mahley RW: Polymorph-isms in the hepatic lipase gene affect plasma HDL-cholesterol levels in a Turkish population. J Lipid Res2010;51:422–430.

27. Arai H, Yamamoto A, Matsuzawa Y, Saito Y, Yamada N,Oikawa S, Mabuchi H, Teramoto T, Sasaki J: Polymorphismsin four genes related to triglyceride and HDL-cholesterollevels in the general Japanese population in 2000. J Ather-oscler Thromb 2005;12:240–250.

28. Deepa M, Pradeepa R, Rema M, Anjana M, Deepa R,Shanthirani S, Mohan V: The Chennai Urban Rural Epide-miology Study (CURES)—study design and methodology(Urban Component) (CURES–1). J Assoc Physicians India2003;51:863–870.

29. Grundy SM, Cleeman JI, Merz CNB Jr, Brewer HB, Clark LT,Hunninghake DB, Pasternak RC, Smith SC Jr, Stone NJ;National Heart, Lung, and Blood Institute, American Col-lege of Cardiology Foundation, American Heart Association:Implications of recent clinical trials for the National Cho-lesterol Education Program Adult Treatment Panel IIIguidelines. Circulation 2004;110:227–239.

30. Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Trea-cher DF, Turner RC: Homeostasis model assessment: insulinresistance and cell function from fasting plasma glucose andinsulin concentrations in man. Diabetologia 1985;28:412–419.

31. Maniatis T, Fritsch EF, Sambrook J: Molecular Cloning. ALaboratory Manual. Cold Spring Harbor, NY: Cold SpringHarbor Laboratory, 1982:149–151.

32. Barrett JC, Fry B, Maller J, Daly MJ: Haploview: analysis andvisualization of LD and haplotype maps. Bioinformatics2005;21:263–265.

33. Fan Y-M, Raitakari OT, Kahonen M, Hutri-Kahonen N,Juonala M, Marniemi J, Viikari J, Lehtimaki T: Hepatic lipasepromoter C-480T polymorphism is associated with serumlipids levels, but not subclinical atherosclerosis: the Cardio-vascular Risk in Young Finns Study. Clin Genet 2009;76:46–53.

34. Botma GJ, Verhoeven AJ, Jansen H: Hepatic lipase promoteractivity is reduced by the C-480T and G-216A substitutionspresent in the common HL gene variant, and is increasedby upstream stimulatory factor. Atherosclerosis 2001;154:625–632.

35. Pihlajamaki J, Karjalainen L, Karhapaa P: G-250A substitu-tion in promoter of hepatic lipase gene is associated withdyslipidemia and insulin resistance in healthy control sub-jects and in members of families with familial combinedhyperlipidemia. Arterioscler Thromb Vasc Biol 2000;20:1789–1795.

36. Wood KC, Fullerton MD, El-Sohemy A, Bakovic M: Inter-actions between hepatic lipase and apolipoprotein E gene

polymorphisms affect serum lipid profiles of healthy Cana-dian adults. Appl Physiol Nutr Metab 2008;33:761–768.

37. Kashani Farid MA, Azizi F, Hedayati M, Daneshpour MS,Shamshiri AR, Siassi F: Association between CETP Taq1Band LIPC –514C/T polymorphisms with the serum lipidlevels in a group of Tehran’s population: a cross sectionalstudy. Lipids Health Dis 2010;9:96.

38. Pollex RL, Hegele RA: Genetic determinants of plasma li-poproteins. Nat Clin Pract Cardiovasc Med 2007;4:600–609.

39. Park KW, Choi JH, Chae IH, Cho HJ, Oh S, Kim HS, LeeMM, Park YB, Choi YS: Hepatic lipase C514T polymorphismand its relationship with plasma HDL-C levels and coronaryartery disease in Koreans. J Biochem Mol Biol 2003;36:237–242.

40. Shohet RV, Vega GL, Anwar A, Cigarroa JE, Grundy SM,Cohen JC: Hepatic lipase (LIPC) promoter polymorphism inmen with coronary artery disease. Allele frequency and ef-fects on hepatic lipase activity and plasma HDL-C concen-trations. Arterioscler Thromb Vasc Biol 1999;19:1975–1978.

41. Bauerfeind A, Knoblauch H, Costanza MC, Luganskaja T,Toliat MR, Nurnberg P, Luft FC, Reich JG, Morabia A:Concordant association of lipid gene variation with a com-bined HDL/LDL-cholesterol phenotype in two Europeanpopulations. Hum Hered 2006;61:123–131.

42. Jansen H, Verhoeven AJM, Sijbrands JG: Hepatic lipase: apro- or antiatherogenic protein? J Lipid Res 2002;43:1352–1362.

43. Rader DJ: Lipid disorders. In: Topol EJ, ed. Textbook ofCardiovascular Medicine. Philadelphia: Lippincott-Raven,1998:59–90.

44. Cai SJ, Wong DM, Chen SH, Chan L: Structure of the humanhepatic triglyceride lipase gene. Biochemistry 1989;28:8966–8971.

45. van Hoek M, Dallinga-Thie GM, Steyerberg EW, SijbrandsEJ: Diagnostic value of post-heparin lipase testing in de-tecting common genetic variants in the LPL and HL genes.Eur J Hum Genet 2009;17:1386–1393.

46. Devlin B, Roeder K, Wasserman L: Genomic control, a newapproach to genetic based association studies. Theor PopulBiol 2001;60:155–166.

Address correspondence to:Venkatesan Radha, MSc, PhD

Department of Molecular GeneticsMadras Diabetes Research Foundation

and Dr. Mohan’s Diabetes Specialities CentreICMR Advanced Centre for Genomics of Type 2 Diabetes

Kallam Anji Reddy CentrePlot No. 20

Golden Jubilee Bio Tech Park for Women Society, SIPCOT-IT ParkSiruseri, Chennai–603 103, India

E-mail: [email protected]@vsnl.com

[email protected]


Documents

Association of Hepatic Lipase Gene Polymorphisms with Hypertriglyceridemia and Low High-Density Lipoprotein-Cholesterol Levels Among South Indian Subjects Without Diabetes