Association of the IL-17, IL-21, and IL-23R GenePolymorphism with HBV Infection in Kidney

Transplant Patients

Sara Hejr,1,2 Mohammad Hossein Karimi,1 Ramin Yaghobi,1 Eskandar Kamali-Sarvestani,3,4

Bita Geramizadeh,1 and Jamshid Roozbeh 5

Abstract

Inflammatory cytokine gene polymorphisms may influence the hepatic and extrahepatic HBV-related disease intransplant patients. In this study, the association between IL-17, IL-23R, and IL-21 gene polymorphisms withhepatitis B virus (HBV) infection was evaluated in kidney transplant patients. In total, 220 kidney transplantpatients were enrolled in this cross-sectional study between years 2007 and 2011. The genomic HBV DNA wasidentified using an HBV PCR detection Kit according to the manufacturer’s instruction. The cytokine genepolymorphisms, including IL-17 197 A/G (rs2275913), IL-21 + 1472 G/T (rs2055979), IL-21 5250 C/T (rs4833837),and IL-23R C/A (rs10889677) were evaluated by PCR-RFLP and ARMS-PCR protocols. The serum levels of IL-17and IL-21 were analyzed in HBV infected and noninfected transplant patients by ELISA methods according tomanufacturer’s instructions. 70 of 220 (35%) transplant patients experienced acute rejection. HBV DNA wasdetected in 52 of 220 (23.64%) transplant patients. 16 of 52 (30.8%) HBV-infected kidney transplant patientsexperienced acute rejection. A significant higher frequency of C allele of IL-23R (rs10889677) polymorphism, ahigher frequency of AG heterozygote genotype and A allele of IL-17-G197A (rs2275913) polymorphism, a higherfrequency of TT homozygote genotype and T allele of IL-21-G1472T (rs2055979) polymorphism, and a higherfrequency of CC homozygote genotype and C allele of IL-21-C5250T (rs4833837) polymorphism were found inHBV-infected kidney transplant patients with acute rejection. Diagnosis of the higher frequency of the IL-17, IL-21, and IL-23R cytokine genotypes and allele polymorphisms in HBV-infected kidney transplant patients whoexperienced acute rejection, illustrates the importance of Th17-related cytokine genetic patterns. A better eval-uation of HBV infection in kidney transplant patients is needed.

Introduction

Several kinds of cytokines have antiviral actions, bothdirectly through inhibition of viral replication and indi-

rectly through evaluation of the multiple patterns of host re-sponse (1,14). Its importance is best demonstrated in hepatitisB virus (HBV) infection, which is one of the common causes ofclinical complications in kidney graft recipients (1). The cy-tokines released by T CD4 + and T CD8 + cells downregulateHBV replication and may control viral infection without thedeath of the infected cells. On the other hand, HBV becomeschronic when the presence of an ongoing suboptimal in-flammatory response activates the process of liver disease(19,22). Recently, emerging evidence presents a subset of Thelper cells, the T helper 17 (Th17) cells, which contribute tothe pathogenesis of HBV disease (24). The target cells and

mechanisms of the Th17 cell-secreted cytokines, includingIL-17 and IL-21 in HBV-infected livers, were subsequentlyevaluated. Th17 cell-associated inflammation is also posi-tively regulated by the IL-23 cytokine produced by antigen-presenting cells (31,34). Th17 cells are significantly increased inchronic HBV-infected patients, triggering liver damage (34).Th17 cells have a positive association with serum alanineaminotransferase in chronic HBV-infected patients (8,30,32,34).IL-21 stimulates T and B cell responses and plays a role in thecontrol of chronic HBV viral infections and in transplant pa-tients (3,9). Serum IL-21 levels might be a biomarker for HBeAgseroconversion, and may contribute to antiviral therapy inHBeAg-positive patients with chronic HBV infection (3,9,18).The frequency of IL-21 in patients with HBV infection wasfound to be higher than in healthy controls (5). Several reportshave focused on the function of IL-21 in HBV clearance and

1Shiraz Transplant Research Center, 3Autoimmune Disease Research Center, 4Immunology Department, and 5Shiraz Nephrology UrologyResearch Center, Shiraz University of Medical Sciences, Shiraz, Iran.

2Islamic Azad University, Jahrom Branch, Jahrom, Iran.

VIRAL IMMUNOLOGYVolume 26, Number 3, 2013ª Mary Ann Liebert, Inc.Pp. 1–6DOI: 10.1089/vim.2013.0007

1

its relationship to the severity of chronic HBV infection (23).These observations suggest that IL-21 plays a key role inage-dependent response to HBV clearance (7,23). IL-23 regu-lates the function of IL-17-producing cells against intracellularpathogens (25). Also, the IL-21 secreting TCD4 + cells werehigher in HBV-infected patients with acute and chronic liverfailure (10). IL-23 plays an important role in autoimmunetissue inflammation and induces the generation of not fullycharacterized effector cells that mediate protection againstmicroorganisms (2,25). In chronic HBV-infected patients orHBV-associated acute and chronic liver failure, the serumlevels of both IL-23 and IL-17 were significantly elevated (28).It has been proposed that HBV antigens are the initiativefactor for enhancement of IL-23 expression in HBV-infectedliver, as HBcAg can stimulate dendritic cells to secrete highlevels of IL-23 (31,34). However, the precise mechanismsunderlying the effects of the IL-23/IL-22 and IL-23/IL-21 axeson hepatitis B pathogenesis have not yet been elucidated (11).Genetic polymorphisms in IL-23R have been linked to geneticsusceptibility to a number of human autoimmune diseases(12,14,22). Literature reports cite the presence of IL-23R genepolymorphism that is located on chromosome 1p31.3 (8,12).The relationship between IL-23R genetic polymorphism andkidney transplant outcomes was examined, showing that IL-23R polymorphism may have a potential role in long-termallograft outcome (12). Therefore, in this study the associationbetween IL-17, IL-23R, and IL-21 genetic polymorphisms withHBV infection was evaluated in kidney transplant recipients.

Patients and Methods

Patients and samples

In this study, a total of 220 patients who underwent kidneytransplantation in transplant ward at Namazi Hospital affil-iated to Shiraz University of Medical Sciences, Shiraz, Iranwere evaluated between the years 2007 and 2011. All of thestudied patients were Iranian; non-rejected transplant pa-tients were considered as controls. One EDTA-treated bloodsample was collected from each studied transplant patient.The kidney graft outcome and acute rejection episode wereevaluated for early 2 month period post-transplantation.Donors were selected on the basis of ABO blood groupcompatibility; all were negative for cross matches. In this

study, transplant patients were divided into two studiedgroups according to the presence or absence of acute rejectionepisodes. Rejection episodes were identified by an expert ne-phrology team based on the approved clinical diagnostic cri-teria and invariably confirmed by needle biopsy, as well aselevated serum creatinine and blood urea nitrogen levels. Thestandard immunosuppressive regimen for all 220 recipientsincluded cyclosporine (5 mg/kg initially, a maintenance dose of2–2.5 mg/kg; cyclosporine level was 50–150 ng/mL), prednis-olone (120 mg/day initially, tapering to 10 mg/day), and my-cophenolate mofetil (1000 mg twice daily). Acute rejection wasinitially treated with intravenous steroids and steroid-resistantrejection was treated with OKT3 monoclonal antibody (4).

DNA extraction for HBV DNA and cytokine genotyping

The buffy coats and plasma of EDTA-treated whole bloodsamples from kidney transplanted patients were availablefrom the sample bank affiliated with the Shiraz TransplantResearch Center. Genomic DNA was extracted from buffycoats (cytokine genotyping) and plasma (HBV DNA) using aDNPTM Kit (CinnaGen, Iran) as follows: Pre-warm kit toroom temperature before use and pre-warm lysis solution byplacing in 370C for 20 min and softly shake. Mix 100 lL ofeach buffy coats (for cytokine genotyping) and plasma (forHBV DNA) samples with 400 lL of lysis solution and vortexfor 15–20 sec. Add 300 lL of precipitation solution, mix byvortex for 3–5 sec and place in - 20�C for 20 min. Then cen-trifuge at 12,000 g for 10 min. Decant by gently inverting oftube and placing the tube on tissue paper for 2–3 sec. Add1 mL wash buffer to pellet, mix for 3–5 sec and centrifuge at12,000 g for 5 min, then decant. Pour off the wash buffercompletely and dry pellet at 650C for 5 min.

PCR-based molecular protocols

HBV PCR. The genomic HBV DNA was identified inpatient samples using specific primers to amplify a fragmentof the surface gene by a qualitative hepatitis B virus PCRdetection Kit (CinnaGen, Iran) according to the manufac-turer’s instruction.

Cytokine genotyping. IL-17, IL-23R, and IL-21 cytokinegenetic polymorphisms were evaluated by PCR-based

Table 1. Primers and Types of PCR Protocols for the IL-17, IL-23R, IL-21, and Internal Control

SNP Primers Method

IL-17(-197 A/G) Forward primer: 5¢GCAGCTCTGCTCAGCTTCTAA3¢ PCR-RFLPrs2275913 Reverse primer: 5¢TTCAGGGGTGACACCATTTT3¢

IL-21(G1472T) Forward primer: 5¢GCTCTGAACCCAAACACTCTC3¢ PCR-RFLPrs2055979 Reverse primer: 5¢ACAGCCAGGAAACTCTGGAA3¢

Forward primer: 5¢TTAGTTGGGCCTTCTGAAAG3¢ ARMS-PCRIL-21(C5250T) Reverse primer: 5¢TTAGTTGGGCCTTCTGAAAA3¢

rs4833837 Common: 5¢TGTAATGCACGACATTGCAG3¢IL-23R (C/A) Forward primer: 5¢TTTTAGCCATTCTTCTGCCTC3¢ ARMS-PCR

rs10889677 Reverse primer: 5¢TTTTAGCCATTCTTCTGCCTA3¢Common: 5¢CGCCTGGCCTAATGATTCTA3¢

Beta globins Forward : 5¢ACACAACTGTGTTCACTAGC3¢ ARMS-PCR (Internal Control)Reverse: 5¢CAACTTCATCCACGTTCACC3¢

SNP, single nucleotide polymorphism.

2 HEJR ET AL.

protocols. IL-17 (A197G) and IL-21(G1472T) genetic poly-morphisms were analyzed by in-house PCR-RFLP protocols(Tables 1 and 2). The PCR products were digested by Xag1and NlaIII restriction enzymes (Fermentas, Lithuania). TheIL-23R and IL-21C5250T genetic polymorphisms wereevaluated using in-house ARMS-PCR protocols (Tables 1and 2). A beta globin gene primer was used as an internalcontrol. The PCR primers and PCR mix and thermocyclingconditions are presented with detail in Tables 1 and 2, re-spectively. The amplified products were monitored by aga-rose gel electrophoresis and ethidium bromide staining.

Cytokine level measurement. The case group consistedof 22 patients with acute rejection and the control groupincluded 22 patients without rejection. Plasma samples wereisolated immediately and stored at - 80�C until required foran analysis by an ELISA Kit (eBioscience, USA).

The levels of IL-17 and IL-21 were evaluated by ELISAmethods in all 44 persons with or without HBV infection,respectively. Each patient and control groups contained11 females and 11 males with ages ranged from 20–58 and20–53 years, respectively. The plasma samples were collectedfrom each kidney transplant groups immediately and storedat - 80�C until using ELISA Kits (eBioscience, USA), ac-cording to the manufacturer’s instructions.

Statistical analysis

Allele and genotype frequencies were calculated in kidneytransplant patients and controls by direct gene counting.Statistical evaluation was carried out using SPSS software,version 16. The frequency of the alleles/genotypes wascompared in patients and controls by Chi-square test andFisher’s exact test. Odds ratios (OR) and 95% confidenceintervals (CIs) for relative risks were calculated. P < 0.05 wasconsidered as statistically significant. Haplotypes wereevaluated using Arlequin version 3.11.

Results

The age range of kidney transplant patients was between 1and 79 years old. The 130 of 220 (59.1%) kidney transplantrecipients were male and 90 of 220 (40.90%) were female with

a mean – SD age of 31.79 – 35.37 years. The 60 of 220 (27.28%)transplant patients showed acute rejection and 160 of 220(72.73%) patients did not. Acute rejection was confirmed in 35of 130 (27%) male and 25 of 90 (27.8%) female patients.

HBV infection and kidney transplantation

The genomic HBV DNA was detected in 52 of 220(23.64%) kidney transplant patients and the rest of patients(168 of 220; 76.34%) did not show the history of HBV mo-lecular infection. Sixteen of 52 (30.8 %) HBV infected and 44of 168 (26.2%) HBV uninfected transplant patients experi-enced acute graft rejection. HBV infection was found in 9 of35 (25.7%) and in 7 of 25 (28%) male and female patients withacute allograft rejection, respectively. Twenty seven of 111(24.3%) patients who received transplants from cadavers and25 of 109 (23%) who received transplants from living donorsshowed HBV infection. HBV infection was found in 10 of 27(37%) acute rejected transplant patients received kidney fromcadaver and the rest of them (17 of 27; 53%) did not expe-rience acute rejection. HBV infection was also found in 6 of25 (20%) acute rejected transplant patients received kidneyfrom living donors and the rest of them (19 of 25;80%) re-ceived the graft from living donors.

HBV infection and cytokine polymorphisms

The frequency of alleles and genotypes of cytokine genesincluding: IL-17-A197G (rs2275913), IL-21-G1472T (rs2055979),IL-21-C5250T (rs4833837), and IL-23R (rs10889677) were de-termined in 52 HBV-infected and 168 HBV-noninfected kidneytransplant recipients.

The significantly higher frequency of C allele of IL-23R(rs10889677) polymorphism was found in HBV infectedkidney transplant patients experiencing acute rejection( p = 0.03, OR = 0.41, 95% CI = 0.17–1.01, study power = 58%).The frequency of AG heterozygote genotype and A allele ofIL-17-G197A (rs2275913) polymorphism was also higher inHBV-infected kidney transplant patients experienced acuterejection. The higher frequency of TT homozygote genotypeand T allele of IL-21-G1472T (rs2055979) polymorphism andhigher frequency of CC homozygote genotype and C allele ofIL-21-C5250T (rs4833837) polymorphism were found in HBV

Table 2. The PCR Mix and Thermocycling Conditions for the IL-17, IL-23R, and IL-21 Gene Polymorphisms

SNP PCR thermocycling condition PCR mix condition

IL-17PCR-RFLP

94�C, 5 min; 57�C, 30 sec;72�C, 30 sec; 30 cycle

Total volume of 8 lL, with 2 lL genomic DNA,1 lL of primers, 1 lL buffer(baq), 0.15 lLof dNTP, and 0.05 lL Taq DNA polymerase

IL-21(G1472T)PCR-RFLP

94�C, 5 min; 64�C, 30 sec;72�C, 30 sec; 30 cycle

Total volume of 8 lL, with 2 lL genomic DNA,1 lL of primers, 1 lL buffer(baq), 0.15 lLof dNTP, and 0.05 lL Taq DNA polymerase

IL-21(C5250T)ARMS-PCR

94�C, 5 min; 64�C, 30 sec;72�C, 30 sec; 30 cycle

Total volume of 6 lL containing 0.15 lL dNTPs,1 lL of Forward primers, 1 lL of commonprimer, 0.9 lL of inner primers, 1 lLof buffer (baq), 0.05 lL Taq DNA polymerase,and 4 lL genomic DNA.

IL-23RARMS-PCR

94�C, 5 min; 63�C, 30 sec;72�C, 30 sec; 30 cycle

Total volume of 6 lL containing 0.15 lL dNTPs, 1 lLof external primers 1 lL of common primer,0.7 lLof inner primers, 1 lL of buffer (baq), 0.05 lLTaq DNA polymerase, and 4 lL genomic DNA

CYTOKINE GENE POLYMORPHISM IN HBV INFECTION 3

infected kidney transplant patients with acute rejection(Table 3). The haplotype 2 was the most frequent haplotypein the acute rejected and nonacute rejected patients withHBV infection. The frequency of haplotypes 1 was signifi-cantly higher in the nonacute rejected patients comparedwith the acute rejected group ( p = 0.02). The haplotype 4 wasnot found in the acute rejected group of patients (Table 4).

HBV infection and cytokine levels

IL-17 and IL-21 were both found in 2 of 11 (18.2%) and 4 of11 (36.4%) of HBV-infected and HBV-noninfected kidneytransplant female patients, respectively. IL-17 was also foundin 1 of 11 (9.1%) and 7 of 11 (63.6%) of HBV-infected andHBV-noninfected kidney transplant male patients, respec-tively. The IL-21 was found in 1 of 11 (18.2%) and 6 of 11(54.6%) of HBV-infected and HBV-noninfected kidneytransplant male patients, respectively (Table 5).

Discussion

HBV clinical manifestation in kidney transplant patients isprimarily affected by immunosuppression, which may leadto end-stage liver disease. Kidney transplant patients who

received long-term immunosuppression experience severeHBV infections. Extrahepatic clinical manifestation of HBVmay lead to membranous nephropathy and lower frequencyof membranoproliferative glomerulonephritis. Severity ofHBV-related glomerulonephritis is more relentless, and slowlyprogresses to kidney failure, need for dialysis, and receivingkidney transplantation (1). Th17 and its compartments mayhave a role in inflammatory and pro-inflammatory responsesagainst viral infections (1, 14). Genotypic and phenotypiccharacteristics of Th17 relate cytokines including: IL-17 andIL-21 were recently studied in immunovirology-based re-searches (11,29,33). Its importance is best demonstrated inHBV infection (6,8,29,34). Therefore, a possible associationbetween IL-17, IL-23R, and IL-21 genetic polymorphisms withHBV infection and outcomes was studied in kidney transplantpatients.

IL-17 as a pro-inflammatory cytokine has two peripheraland intrahepatic forms increased in patients with HBV in-fection, correlated with the severity of liver injuries in in-fected patients (11,13,23,33,34). IL-17 is able to activate andstimulate monocytes and myeloid dendritic cells to producea variety of proinflammatory cytokines, leading to immune-related liver damage (30,34). IL-17 can mobilize, recruit, and

Table 3. The Frequency of Cytokine Gene Polymorphism and HBV Infection

in Acute Rejected Kidney Transplant Patients

SNP Genotype HBV + Acute Rejected % (N) HBV-Acute Rejected % (N) P value OR 95%CI

IL-17(-197 A/G)rs2275913

AA 12.5 % (2) 6.82 % (3) 0.68 1.48 .15–12.86AG 43.75 % (7) 27.28 % (12) 0.22 2.07 0.54–8.01GG 43.75 % (7) 65.91 % (29) 0.12 0.40 0.11–1.49A allele 34.38 % (11) 20.46 % (18) 0.11 2.04 0.76–5.45G allele 65.63 % (21) 79.55 % (70)

IL-23R (C/A)rs10889677

AA 18.75 % (3) 40.91 % (18) 0.11 0.33 0.06–1.53AC 43.75 % (7) 43.19 % (19) 0.96 1.02 0.28–3.75CC 37.5 % (6) 15.91 % (7) 0.07 3.17 0.37–14.04A allele 40.63 % (13) 62.5 % (55) 0.03* 0.41 0.17–1.01C allele 59.38 % (19) 37.5 % (33)

IL-21(G1472T)rs2055979

TT 18.75 % (3) 9.1% (4) 0.30 2.31 0.35–14.77TG 56.25 % (9) 45.46 % (20) 0.45 1.54 0.42–5.70GG 25 % (4) 45.46 % (20) 0.15 0.40 0.09–1.65T allele 46.88 % (15) 31.82 % (28) 0.12 1.89 0.76–4.68G allele 53.13 % (17) 68.19 % (60)

IL-21(C5250T)rs4833837

CC (68.75%) 11 (50%) 22 0.19 2.20 0.57–8.82CT (31.25%) 5 (36.37%) 16 0.71 0.80 0.20–3.12TT 0 (0%) (13.64%) 6 0.11 0.00 0.00–20.65C allele (84.38%) 27 (68.19%) 60 0.07 2.52 0.81–8.37T allele (15.63%) 5 (13.82%) 28

HBV + , HBV Infected; HBV-, HBV Noninfected; N, number; P value < 0.05 = significant; OR, Odds Ratio; 95%CI = 95% ConfidentialInterval.

Table 4. The Frequencies of IL-21 Haplotypes in HBV-infected and Noninfected Kidney Transplant Patients

Haplotype ID number Haplotype distribution HBV + (acute rejected) HBV + (nonacute rejected) P Value

1 GC 5 (15%) 17 (23.5%) 0.02*2 TT 15 (47%) 32 (44.5%) 0.933 GT 12 (38%) 18 (25%) 0.194 TC 0 (0%) 5 (7%) 0.12

*referes to statistically significant associations.

4 HEJR ET AL.

activate neutrophils and cause massive tissue inflammationand extensively involves in the pathogenesis of chronic HBVliver disease and antiviral immunity (13,15,16,28,31). Xu et al.showed the higher level of serum IL-17 and the higher ex-pression level of IL-17 mRNA in patients with HBV infec-tions in comparing with healthy control (30). Niu et al. alsodemonstrated that intrahepatic IL-17 + T cells play importantroles in development of chronic HBV (20). In another re-port, Ge et al. suggested the potential role of peripheralTh17 cells in the immune activation of chronic HBV infec-tion (8). Zhang et al. showed that both peripheral blood andliver of patients with chronic HBV infection are highly en-riched with Th17 cells (34). The various important roles ofIL-17 and IL-17-producing cells in the progression of HBV-related chronic liver damages were described by Wang et al.(27).Ye et al. showed IL-17-mediating liver neutrophilrecruitment as a potential mechanism of liver injury inpatients with HBV infection (31). Similar to other reports, inthis study diagnosis of the higher frequency of AG geno-type and A allele of IL-17-G197A genotype was found inHBV-infected acute rejected kidney transplant patients,especially females.

IL-21 is another cytokine related functionally to Th17.Several earlier studies focused on the key role of IL-21 in HBVclearance and especially to the severity of chronic infection.IL-21 may be a part of an effective primary hepatic immuneresponse to HBV (7,23). The higher level of IL-21 transcriptwas expressed particularly in the blood samples of infectedadults who were previously cleared of HBV. Totally, whenthe host–virus balance is broken, a remarkable increase in IL-21 and its producing Th17 cells would be expected. Recently,another research group found a higher frequency of IL-21-secreting CD4 + T cells in patients with acute and chronic liverfailure and with severe chronic HBV infection than in patientswith moderate chronic HBV infection and normal controls(10).This group also suggests the possible role of IL-21 in thesevere liver inflammation (10). Baan et al. showed thatblockade of the IL-21 pathway may provide a new perspectivefor the treatment of allogeneic responses in patient’s post-transplantation (3). On the other hand, Hecker et al. demon-strated the induction of IL-21 expression in intravascularmonocytes of patients receiving allogeneic transplantation (9).Finally, in another report, Ding et al. analyzed the level of IL-21 in TCD4 + cells of peripheral blood from different types ofHBV-infected patients and declared the role of IL-21 in theHBV pathogenesis. The higher frequency of IL-21( + ) TCD4 +cells in the patients with acute and chronic asymptomaticHBV infection was shown as compared to healthy controlsand patients with severe chronic HBV infection. The level ofIL-21 that is correlated to Th17 cells varied in different types ofHBV infected patients (5). In this study, the higher frequencyof TT genotype and T allele of IL-21-G1472T polymorphism

and higher frequency of CC genotype and C allele of IL-21-C5250T polymorphism were found in HBV infected kidneytransplant patients experiencing acute rejection.

IL-23 is a heterodimeric cytokine that plays a critical rolein the development of autoimmune diseases and modulatingsubpopulations of T helper cells (2,17). Earlier reports en-forced on the linkage between IL-23R gene polymorphismslocated on chromosome 1p31.3 and genetic susceptibility toa number of human autoimmune diseases (2,26). These re-sults suggest the role of IL-23: IL- 23R pathway in devel-opment of many immune related diseases (2,28). HBV liverdisease is an inflammation-related disorder characterizedby significant dysfunctions in the IL-23/IL-17 signalingpathway. Obvious elevation of serum IL-17 and IL-23 wasfound in HBV infected patients (28,31,34). HBV antigens(HBcAg) are the initiative factor for enhancement of IL-23expression in HBV-infected liver (31,34). IL-17 significantlyupregulates the expression of IL-23 in monocytes and my-eloid dendritic cells of patients with chronic HBV infection(5). Therefore, research emphasized the relationship be-tween increases of the IL-23 after expression of IL-17 andsuggested a functional IL- 23/IL-17 axis in HBV-infectedliver. The inducing role of IL-6 and IL-21in expression of IL-23R was also presented (11,33).

Tsai et al. examined an association between IL-23R poly-morphisms with kidney transplant outcomes. These resultsdemonstrated that IL-3R polymorphism may have a poten-tial immunoregulatory role in long-term allograft outcomes(26). In another report, Riol et al. established the essential roleof IL-23R in the host immune response against intracellularmicrobial pathogens and its role in regulation of the functionof IL-17(25). Similarly, in this study the significant higherfrequency of C allele of IL-23R polymorphism was found inHBV-infected kidney transplant patients experiencing acuterejection. The significant higher frequency of A allele of IL-23R polymorphism was found in kidney transplant femalepatients with acute rejection.

Conclusion

Diagnosis of the higher frequency of the IL-17, IL-21 cy-tokines and IL-23R polymorphisms in HBV infected kidneytransplant patients with and without experiencing acuterejection and also finding of a significant association be-tween IL-23R polymorphisms with HBV infection in acuterejected transplant recipients open a way to study the im-portance of Th17-related cytokine genetic pattern to defineHBV pathogenesis in transplant patients.

Author Disclosure Statement

No competing financial interests exist.

Table 5. The Level of IL-17 and IL-21 in Acute Rejected in Comparing

with Nonacute Rejected HBV Infected Kidney Transplant Patients

Acute rejected Nonacute rejected

Patients Cytokines Female Male Female Male

IL-17 2 of 11 (18.2%) 1 of 11 (9.1%) 4 of 11 (36.4%) 7 of 11 (63.6%)IL-21 2 of 11 (18.2%) 1 of 11 (9.1%) 4 of 11 (36.4%) 6 of 11 (54.6%)

CYTOKINE GENE POLYMORPHISM IN HBV INFECTION 5

References

1. Arjmandi K, Yaghobi R, Ravanshad M, et al. Laboratoryeffect of HBV infection in kidney transplant recipients anddonors. Transplant Proc 2011;43:554–556.

2. Awasthi A, Riol-Blanco L, Jager A, et al. Cutting edge: IL23receptor gfp reporter mice reveal distinct populations of IL-17-producing cells. J Immunol 2009;182:5904–5908.

3. Baan CC, Balk AH, Dijke IE, et al. Interleukin-21: An inter-leukin-2 dependent player in rejection processes. Trans-plantation 2007;83:1485–1492.

4. Solez K, Colvin RB, Racusen LC, et al. Banff 07 classificationof renal allograft pathology: updates and future directions.Am J Transplant 2008;8:753–760.

5. Ding YR, Zhang Y, Lian JQ, et al. The induced IL-21 levels inCD4( + ) T cells of peripheral blood from the different clinicaltypes of patients infected with hepatitis B virus. Xi Bao YuFen Zi Mian Yi Xue Za Zhi 2011;27:304–306.

6. Dubin PJ, Kolls JK. Th17 cytokines and mucosal immunity.Immunol Rev 2008;226:160–171.

7. Franks I. Viral hepatitis: Interleukin 21 has a key role in age-dependent response to HBV. Nat Rev Gastroenterol Hepatol2011;8:243.

8. Ge J, Wang K, Meng QH, et al. Implication of Th17 and Th1cells in patients with chronic active hepatitis B. J Clin Im-munol 2010;30:60–67.

9. Hecker A, Kaufmann A, Hecker M, et al. Expression of in-terleukin-21, interleukin-21 receptor alpha and related type Icytokines by intravascular graft leukocytes during acuterenal allograft rejection. Immunobiology 2009;214:41–49.

10. Hu X, Ma S, Huang X, et al. Interleukin-21 is upregulated inhepatitis B-related acute-on-chronic liver failure and associatedwith severity of liver disease. J Viral Hepat 2011;18:458–467.

11. Huang Z, van Velkinburgh JC, et al. Pivotal roles of the in-terleukin-23/T helper 17 cell axis in hepatitis B. Liver Int2012;32:894–901.

12. Hue S, Ahern P, Buonocore S, et al. Interleukin-23 drivesinnate and T cell-mediated intestinal inflammation. J ExpMed 2006;203:2473–2483.

13. Infante-Duarte C, Horton HF, Byrne MC, Kamradt T. Mi-crobial lipopeptides induce the production of IL-17 in Thcells. J Immunol 2000;165:6107–6115.

14. Koyama S, Ishii KJ, Coban C, et al. Innate immune responseto viral infection. Cytokine 2008;43:336–341.

15. Lafdil F, Miller AM, Ki SH, et al. Th17 cells and their asso-ciated cytokines in liver diseases. Cell Mol Immunol2010;7:250–254.

16. Langrish CL, Chen Y, Blumenschein WM, et al. IL-23 drivesa pathogenic T cell population that induces autoimmuneinflammation. J Exp Med 2005;201:233–240.

17. Lupardus PJ, Garcia KC. The structure of interleukin-23 re-veals the molecular basis of p40 subunit sharing with in-terleukin-12. J Mol Biol 2008;382:931–941.

18. Ma SW, Huang X, Li YY, et al. High serum IL-21 levels after12 weeks of antiviral therapy predict HBeAg seroconversionin chronic hepatitis B. J Hepatol 2012;56:775–781.

19. Maini MK, Boni C, Lee CK, et al. The role of virus-specificCD8 ( + ) cells in liver damage and viral control duringpersistent hepatitis B virus infection. J Exp Med 2000;191:1269–1280.

20. Niu Y, Liu H, Yin D, et al. The balance between intrahepaticIL-17( + ) T cells and Foxp3 ( + ) regulatory T cells plays an

important role in HBV-related end-stage liver disease. BMCImmunol 2011;19:12–47.

21. Park H, Li Z, Yang XO, et al. A distinct lineage of CD4 T cellsregulates tissue inflammation by producing interleukin 17.Nat Immunol 2005;6:1133–1141.

22. Phillips S, Chokshi S, Riva A, et al. CD8 ( + ) T cell control ofhepatitis B virus replication: Direct comparison betweencytolytic andnoncytolytic functions. J Immunol 2010;184:287–295.

23. Publicover J, Goodsell A, Nishimura S, et al. IL-21 is pivotalin determining age-dependent effectiveness of immune re-sponses in a mouse model of human hepatitis B. J Clin Invest2011;121:1154–1162.

24. Rehermann B. Intrahepatic T cells in hepatitis B: Viral con-trol versus liver cell injury. J Exp Med 2000;191:1263–1268.

25. Riol-Blanco L, Lazarevic V, Awasthi A, et al. IL-23 receptorregulates unconventional IL-17-producing T cells that con-trol bacterial infections. J Immunol 2010;184:1710–1720.

26. Tsai JP, Yang SF, Wu SW, et al. Association between inter-leukin 23 receptor polymorphism and kidney transplantoutcomes: A 10-year Taiwan cohort study. Clin Chim Acta2011;412:958–962.

27. Wang L, Chen S, Xu K. IL-17 expression is correlated withhepatitis B-related liver diseases and fibrosis. Int J Mol Med2011;27:385–392.

28. Wang Q, Zheng Y, Huang Z, et al. Activated IL-23/IL-17pathway closely correlates with increased Foxp3 expressionin livers of chronic hepatitis B patients. BMC Immunol2011;14:12–25.

29. Wu W, Li J, Chen F, et al. Circulating Th17 cells frequency isassociated with the disease progression in HBV infectedpatients. J Gastroenterol Hepatol 2010;25:750–757.

30. Xu Y, DU WJ, Qin LY, et al. Expression of interleukin-17 inhepatitis B related liver fibrosis. Xi Bao Yu Fen Zi Mian YiXue Za Zhi 2009;25:133–135.

31. Ye Y, Xie X, Yu J, et al. Involvement of Th17 and Th1 effectorresponses in patients with hepatitis B. J Clin Immunol2010;30:546–555.

32. Zhang F, Yao S, Yuan J, et al. Elevated IL-6 receptor ex-pression on CD4 + T cells contributes to the increased Th17responses in patients with chronic hepatitis B. Virol J2011;3:270–280.

33. Zhang JY, Song CH, Shi F, et al. Decreased ratio of Treg cellsto Th17 cells correlates with HBV DNA suppression inchronic hepatitis B patients undergoing entecavir treatment.PLoS One 2010;5:13869.

34. Zhang JY, Zhang Z, Lin F, et al. Interleukin-17-producingCD4 ( + ) T cells increase with severity of liver damage inpatients with chronic hepatitis B. Hepatology 2010;51:81–91.

Address correspondence to:Dr. Ramin Yaghobi

Shiraz Transplant Research CenterNamazee Hospital

Shiraz University of Medical SciencesShiraz

Iran

E-mail: rayaviro@yahoo.com

6 HEJR ET AL.