25
Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=cbps20 British Poultry Science ISSN: 0007-1668 (Print) 1466-1799 (Online) Journal homepage: http://www.tandfonline.com/loi/cbps20 Associations between variants of bone morphogenetic protein 7 gene and growth traits in chickens Yan Wang, Fuyou Guo, Hao Qu, Chenglong Luo, Jie Wang & Dingming Shu To cite this article: Yan Wang, Fuyou Guo, Hao Qu, Chenglong Luo, Jie Wang & Dingming Shu (2018): Associations between variants of bone morphogenetic protein 7 gene and growth traits in chickens, British Poultry Science, DOI: 10.1080/00071668.2018.1454586 To link to this article: https://doi.org/10.1080/00071668.2018.1454586 Accepted author version posted online: 18 Apr 2018. Submit your article to this journal Article views: 3 View related articles View Crossmark data

Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

  • Upload
    others

  • View
    1

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Full Terms & Conditions of access and use can be found athttp://www.tandfonline.com/action/journalInformation?journalCode=cbps20

British Poultry Science

ISSN: 0007-1668 (Print) 1466-1799 (Online) Journal homepage: http://www.tandfonline.com/loi/cbps20

Associations between variants of bonemorphogenetic protein 7 gene and growth traits inchickens

Yan Wang, Fuyou Guo, Hao Qu, Chenglong Luo, Jie Wang & Dingming Shu

To cite this article: Yan Wang, Fuyou Guo, Hao Qu, Chenglong Luo, Jie Wang & Dingming Shu(2018): Associations between variants of bone morphogenetic protein 7 gene and growth traits inchickens, British Poultry Science, DOI: 10.1080/00071668.2018.1454586

To link to this article: https://doi.org/10.1080/00071668.2018.1454586

Accepted author version posted online: 18Apr 2018.

Submit your article to this journal

Article views: 3

View related articles

View Crossmark data

Page 2: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

1

Accepted 30th January 2018

Publisher: Taylor & Francis & British Poultry Science Ltd

Journal: British Poultry Science

DOI: 10.1080/00071668.2018.1454586

Associations between variants of bone morphogenetic protein 7 gene and growth

traits in chickens

Yan Wang, Fuyou Guo, Hao Qu, Chenglong Luo, Jie Wang, and Dingming Shu*

Institute of Animal Science, Guangdong Academy of Agricultural Sciences,

Guangzhou 510640, China; State Key Laboratory of Livestock and Poultry Breeding

& Guangdong Key Laboratory of Animal Breeding and Nutrition, Guangzhou

510640, China

* Corresponding author: Dingming Shu Email: [email protected]

Short title: BMP 7 gene variants and growth

Abstract:

1. Enhancing bone strength to solve leg disorders in poultry has become an important

goal in broiler production.

2. Bone morphogenetic protein 7 (BMP7), a member of the BMP family, represents

an attractive therapeutic target for bone regeneration in humans and plays critical

roles in skeletal development.

3. The objective of this study was to investigate the relationship between BMP7 gene

expression, single nucleotide polymorphisms (SNPs) and growth traits in chickens.

Here, a SNP (c.1995T>C) in the chicken (Gallus gallus) BMP7 gene was identified,

Page 3: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

2

Accepted 30th January 2018

that was associated with growth and carcass traits.

4. Genotyping revealed that the T allele occurred more frequently in breeds with high

growth rates, whereas the C allele was predominant in those with low growth rates.

The expression level of BMP7 in the thigh bone of birds with the TT genotype was

significantly higher than in those with the CC genotype at 21, 42 and 91 days of age.

5. These findings suggest that selecting the birds with the TT genotype of SNP

c.1995T>C could improve bone growth, could reduce leg disorders in fast-growing

birds. The SNP c.1995T>C may serve as a selective marker for improving bone

growth and increasing the consistency of body weights in poultry breeding.

Keywords: bone formation, single nucleotide polymorphism, gene expression, shank

circumference, shank length

Introduction

In past decades, broiler chickens (Gallus gallus) have experienced significant

increases in the growth rates and meat yields. However, certain problems, such as

obesity, ascites and leg disorders have accompanied the improvement of these

production traits (Dunnington and Siegel, 1996). Birds with leg disorders show

reduced feed intake, poor growth, loss of immunity and declining carcass quality,

increasing the cost of rearing. In particularly, birds with leg problems are

characterised by decreased uniformity and poor economic performance. Enhancing

bone strength to maintain bone proportions as a method to prevent chicken leg

problems has become an important goal in current broiler production. Some studies

have already reported that leg problems have a genetic component (Rekaya et al.,

2013; Gonz´alez-Cer´on et al., 2015).

Page 4: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

3

Accepted 30th January 2018

Bone morphogenetic proteins (BMPs) are growth factors and secreted signalling

molecules that can induce ectopic bone growth. BMPs belong to the transforming

growth factor β (TGFβ) superfamily. BMPs play critical roles in embryonic

development and cellular functions, both in postnatal and adult animals, especially in

postnatal bone formation (Chen et al., 2004). Bone morphogenetic protein 7 (BMP7)

is an attractive therapeutic agent for bone regeneration in humans, because it can

induce new bone formation when implanted within a suitable matrix (Sampath et al.,

1990; Sengle et al., 2008). In fact, BMP7 plays important roles in multiple processes,

such as murine hind brain development, tooth and eye development, nephrogenesis

and skeletal patterning (Luo et al., 1995; Arkell and Beddington, 1997; Helder et al.,

1998). In 1994, Houston et al (1994) cloned and expressed chicken BMP7 in the

epiphyseal growth plate. BMP7 has been previously identified as a likely candidate

gene affecting hyperpigmentation of the visceral peritoneum (HVP) in chickens by

using a genome wide association study (Luo et al., 2013). Body weights (BW) of

Huiyang Beard chickens (HB; a Chinese chicken breed native to the Guangdong

province with a low growth rate and high meat quality, tailored to Chinese tastes)

with HVP was significantly lower than that of normal Huiyang Beard chickens (P <

0.05, unpublished data). Such results revealed that BMP7 plays a specific role in the

growth plate, possibly in osteoblast activation or as a chemotactic agent for the

metaphyseal vessels.

This study investigated the functional importance of BMP7 by analysing its

sequence and identifying polymorphisms associated with growth and body

composition in an F2 intercross between Huiyang Bearded (HB) breed and the

fast-growing Lingnanhuang Line A (HQLA, which has undergone over 10

generations of selection for a high growth rate). Differences in gene expression were

Page 5: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

4

Accepted 30th January 2018

validated among birds with different genotypes. The information concerning the

polymorphisms could be integrated into breeding programs to address leg problems

and increase body weights in broiler breeders.

Materials and methods

Sample collection and phenotypic measurements

Screening for polymorphisms in the chicken BMP7 gene was performed on 10

birds each from the HB and HQLA breeds. In the association analysis, the birds were

from the HB × HQLA F2 resource population, which included 824 birds (436 males,

388 females) from six hatches. The F2 individuals were generated and fed as

described in previous studies (Sheng et al., 2013; Luo et al., 2014). All birds had free

access to feed and water, and were sacrificed at 91 days of age, at which point their

vein blood was collected into centrifuge tubes with anticoagulant containing

ethylenediaminetetraacetic acid disodium salt solution and stored at -80°C.

Body weight was measured at hatching and every other week from hatch until the

birds reached 84 days of age. Shank length (SL) and circumference (SC) were

measured every 14 days during 28–84 days of age. Feed intake (FI) was measured

every seven days from 77–84 days of age, and feed conversion ratio (FCR) was

calculated during 77–84 days of age. At 91 days of age, the BW, SL and SC were

measured and the birds were slaughtered. Anatomical and carcass traits, such as

carcass weight (CW), thigh and shankbone weight (LBW), metatarsal and phalanx

weight (MPW; these two bones being tested together), leg muscle weight (LMW)

and breast muscle weight (BMW) were recorded.

A total of 1029 DNA samples from eight breeds were genotyped to determine the

allele frequencies. These included the Red Jungle Fowl, Recessive Rock White,

Page 6: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

5

Accepted 30th January 2018

HQLA, HB, Silkies, Beijing-You, Xiayan and Xinghua Chicken, were tested. All

experimental birds were from the Guangdong Wiz Agricultural Science &

Technology Co. (Guangzhou, China). Genomic DNA was isolated from the blood

samples of 1853 birds using a standard phenol and phenol/chloroform

purification-based protocol.

Polymorphism identification

Seven primer pairs were used to amplify a fragment of the BMP7 gene to identify

polymorphic sites in the exons of BMP7 from the HB breed and HQLA chickens

(Table 1). PCR amplification was performed in a 25-μl reaction volume on a

GeneAmp PCR system 9600 PCR Cycler (Perkin Elmer, Foster City, CA, USA). The

PCR reaction mixture contained 100 ng of chicken genomic DNA as a template,

primers at 10 μM each, 1×PCR reaction mix and 1 U of Taq DNA polymerase

(Dongsheng, Guangzhou, China). The PCR amplification was performed with the

following cycling parameters; initial denaturation at 94°C for 4 min, followed by 35

cycles of denaturation for 45 s at 94°C, then annealing for 45 s at the optimal

temperature and elongation for 90 s at 72°C (Table 1). A final extension was

performed at 72°C for 10 min. All amplified products were separated on agarose gels,

purified and then sequenced in both directions. The DNAstar software (DNAstar Inc.,

Madison, WI, USA) was used to analyse and align the potential polymorphic sites.

Table 1. Primers used to study BMP7 gene and bone traits in broiler chickens

Gene names

Primer names

Primer sequences (5’-3’) Binding regions

Product sizes (bp)

Annealing

temperature (°C)

Sequence amplification and SNP detection

BMP7 BMP7-exon1-F

GCGTCCTCGCCGACTTCAC

Exon 1 Intron 1

411 58

Page 7: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

6

Accepted 30th January 2018

BMP7-exon1-R

CTCGCCACCCATCCCACCT

BMP7-exon2-F BMP7-exon2-R

ACAGACAACAGGACCAGGA AGATTTCACCATACCACCC

Intron 1 Intron 2

1193 58

BMP7-exon3-F BMP7-exon3-R

GTTTTGAGTCGGTTGTGTG TTCTGTTGTGCTCTGTTGC

Intron 2 Intron 3

1629 58

BMP7-exon4-F BMP7-exon4-R

GGACTGATGCGTATGGATGT TCGCTTGTTTGTTTGTTTTG

Intron 3 Intron 4

524 58

BMP7-exon5-F BMP7-exon5-R

TGACTACAGCACAAGAGACT GTGAAATACAAAGCAGAATA

Intron 4 Intron 5

772 54

BMP7-exon6-F BMP7-exon6-R

TCCACAATCTAATGTCTTCA ATCCTGCTCTTCCCTCCCTG

Intron 5 Intron 6

433 58

BMP7-exon7-F BMP7-exon7-R

CTGTGTGTGCTTATGGGGGA TGTTGGTTTGTTGTGGGGTT

Intron 6 Exon 7

1352 58

Quantitative real-time PCR analyses

BMP7 BMP7-Rt-F BMP7-Rt-R

GAGAACAGCAGCAGCGACC CAAAATAGAGCACTGAGATGGC

Exon 4-5 Exon 7

271 58

ACTB β-actin-F β-actin-R

CCCCAAAGCCAACAGAGAGA GGTGGTGAAGCTGTAGCCTCTC

Exon 2 Exon 3

274 58

GAPDH

GAPDH-F GAPDH-R

GGTGAAAGTCGGAGTCAACGG TCGATGAAGGGATCATTGATGGC

Exon 2 Exon 3 108 58

SNP analyses

SNP analysis was performed for a polymorphic site located in exon 7 using the

PCR-restriction fragment length polymorphism method. A 1352 bp fragment was

Page 8: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

7

Accepted 30th January 2018

amplified using specific primer pairs (BMP7-exon7-F/R; Table 1) and digested with

EcoRI (Thermo scientific, Shanghai, China) for 6 h at 37°C. Then, the digested

products were analysed by agarose gel electrophoresis on 2% agarose gels.

Association of polymorphisms with growth and carcass traits

All 824 birds from the F2 resource population were used for the association analysis.

The GLM program from JMP software (SAS Institute Inc., Cary, NC USA)

evaluated the associations between genotypes and phenotypes. The model used to

analyse the data was assumed to be:

Yijklm = μ + Si + Hj + Sk + Dkl + Gm + eijklm

where Yijklm was the phenotypic value of the trait, μ was the overall mean, Si was the

effect of the ith sex, Hj was the effect of the jth hatch, Sk was the effect of the kth sire,

Dkl was the effect of the lth dam within the kth sire, Gm was the effect of the mth

genotype and eijklm was the residual effect. The adjusted phenotypic value was

calculated as μ + eijklm.

Quantitative real-time PCR (qPCR)

The TRIzol reagent (Life Technologies, Rockville, MD USA) was used to isolate

total RNA from the thigh bones of the F8 birds that were obtained from six

generations in the HB × HQLA F2 resource population at 21, 42 and 91 days of age.

Bone tissue samples were weighed (approximately 0.2 g), ground into a powder in

liquid nitrogen, and then homogenised in 2 ml of TRIzol using a handheld electric

homogenate instrument (Germany, Staufen, IKA). The homogenised samples were

left for 5 min at room temperature and then centrifuged at 12,000 rpm at 4°C for 10

min. Subsequent operations were performed according the manufacturer’s

instructions. There were eight individuals with the TT, TC and CC genotypes of SNP

c.1995T>C, respectively; 50% of the birds in each group were male and female.

Page 9: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

8

Accepted 30th January 2018

First-strand cDNA synthesis and reverse transcriptase PCR were performed as

described in the instructions for the PrimeScriptTM II reagent Kit with gDNA Eraser

(TaKara, Dalian, China). Primer pairs BMP7-Rt-F/BMP7-Rt-R (Table 1) were used

to determine the relative expression values of the BMP7 gene by qPCR. The PCR

amplifications were performed in 20 μl reaction volumes comprising 0.5 μl of

chicken cDNA, 0.5 μl of each primer and 10 μl of SYBR Green Real-time PCR

Master Mix (TOYOBO, Tokyo, Japan) in a LightCycler 480 Real-Time PCR System

(Roche Applied Science, Indianapolis, IN, USA). The PCR conditions were: 95°C

for 1 min, followed by 40 cycles of 95°C for 15 s, 58°C for 15 s, and 72°C for 20 s.

The level of fluorescence was used to calculate the threshold cycle (Ct) value for

each sample. The relative expression levels of gene were analysed using the

comparative Ct method, in which housekeeping genes β-actin and GAPDH (Table 1)

were used as internal controls and the geometric averaging of those two internal

control genes was calculated according a previously published method

(Vandesompele et al., 2002). The quantitation procedures recommended by Roche

Applied Science were used to correct for differences in mRNA quantities. All 72

birds (24 from each age) from the F8 population were used for gene expression

analysis. Each time point was analysed separately.

The GLM program from JMP software (SAS Institute Inc., Cary, NC, USA) was

used to evaluate the associations between genotypes and expressions. The model

used to analyse the data was assumed to be:

Yim = μ + Si + Gm + eijklm

where Yim was the gene relative expression levels, μ was the overall mean, Si was the

effect of the ith sex, Gm was the effect of the mth genotype and eijklm was the residual

effect. Differences showing P<0.05 were considered significant.

Page 10: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

9

Accepted 30th January 2018

Ethics statement

The Animal Care Committee of the Institute of Animal Science, Guangdong

Academy of Agricultural Sciences (Guangzhou, People’s Republic of China)

approved the study (approval number GAAS-IAS-2009-73).

RESULTS

Identification of SNPs in the BMP7 gene

Seven primer pairs were designed to detect single nucleotide polymorphisms (SNPs)

in the 97.98% sequences of all exons of chicken BMP7. Comparative sequencing

revealed only one potential polymorphic site, which created a restriction sites for the

endonuclease EcoRI in the 3’ UTR of BMP7 (c.1995T>C, GenBank accession No.

XM_417496.3). A 1352 bp DNA fragment containing the SNP, which was amplified

using primers BMP7-exon7-F/R, was detected by digestion with EcoRI, allowing us

to distinguish between the T allele (which produced a DNA fragment of 1352 bp)

and the C allele (which produced two DNA fragments with lengths of 989 bp and

363 bp) (Figure 1).

FIG 1 HERE

Figure legends

Fig. 1. The electrophoresis patterns obtained after digestion with EcoRI

endonuclease at the c.1995T>C locus. Agarose gel electrophoresis (2.0%) image

showing the DNA restriction fragment patterns indicative of polymorphisms in

BMP7 gene after amplification with the primer pair BMP7-exon7-F/R. The

genotypes are shown at the top of the lanes, M, Marker DL2000 DNA Ladder

(TaKara).

Page 11: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

10

Accepted 30th January 2018

Allelic frequencies of the SNP c.1995T>C in different chicken breeds

The allelic frequencies of the SNP c.1995T>C in fast-growing and low-growing

chicken breeds were notably different. As shown in Table 2, the C allele was

predominant in those breeds with a low growth rate, such as Red Jungle Fowl, HB

and Xinghua chicken. However, the T allele was predominant in high-growth-rate

breeds, including Silkies, HQLA and White Recessive Rock chicken.

Table 2. Allelic frequencies for the SNP c.1995T>C in the BMP7 gene in 8 chicken

breeds

Breeds BW10 (μ±S.E.)

No. of

birds

Genotypic number

Allelic frequency

male female TT TC CC T C Silkies 1444±64.31 1340±50.31 54 54 0 0 1.000 0.000

Fast-growing Lingnanhuang

Line A 2305±26.31 2017±25.51 70 61 8 1 0.929 0.071

White Recessive

Rock 1890±171.82 1556±125.12 95 54 38 3 0.768 0.232

Xiayan 1152±81.02 875±75.02 91 28 47 16 0.566 0.434Beijing-You 1101±168.02 962.0±88.02 51 15 22 14 0.510 0.490

Xinghua 704±63.02 661±59.02 100 3 29 68 0.175 0.825Huiyang Bearded

855±69.32 620.0±56.12 549 0 39 510 0.036 0.964

Red jungle fowl

-3 -3 19 0 0 19 0.000 1.000

BW10: live body weight at 70 days of age, g.

1These data were from the Guangdong Wiz Agricultural Science & Technology Co.

(Guangzhou, China).

2These data were from the “Animal Genetic Resources in China. Poultry” (Chen et

al., 2010).

3Data not collected

Page 12: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

11

Accepted 30th January 2018

Associations between the SNP c.1995T>C and growth traits

The SNP c.1995T>C in BMP7 was significantly associated with certain growth and

carcass traits in the HB × HQLA F2 resource population. Furthermore, the growth

traits, including BW, SC and SL at 56 and 91 days of age for the birds with the TT

genotype were significantly higher than those for the birds with the CC genotype

(P<0.05; Table 3). However, the birds with the TT genotype had the lowest FCR at

77–84 days of age in all birds tested (P<0.05; Table 3). For carcass traits, individuals

with the TT genotype were heavier than those with the CC genotype in terms LBW

and MPW (P<0.05, Table 3).

Table 3. Association analyses in the “HB × HQLA” F2 resource population

Traits SNP c.1995T>C Genotype (μ±S.E.)2

P-value TT (n=100) TC (n=416) CC (n=308) BW8 0.031 1271±16.1a 1238±7.9ab 1221±9.2b BW13 0.004 2180±29.1a 2096±14.2b 2063±16.7b SC8 1.727E-4 3.81±0.020a 3.76±0.010b 3.72±0.011c

SC13 2.27E-3 4.25±0.023a 4.19±0.011b 4.15±0.013c SL8 0.020 80.94±0.381a 80.28±0.185ab 79.74±0.215b SL13 7.04E-3 93.69±0.465a 92.85±0.226a 92.98±0.263b

1FCR11-12 0.008 -0.27±0.110b 0.03±0.053a 0.13±0.063a LBW 0.011 36.32±0.542a 35.10±0.264b 34.41±0.306b MPW 0.032 34.09±0.539a 33.20±0.263ab 32.49±0.305b

n: the number of birds studied.

BW8, 13: live body weight at 56 and 91 days of age, g.

SC8, 13: shank circumference at 56 and 91 days of age, cm.

SL8, 13: shank length at 56 and 91 days of age, cm.

FCR11–12: feed conversion ratio at 77–84 days of age.

LBW: thigh bone and shank bone weight, g.

MPW: metatarsal and phalanx weight, g.

Page 13: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

12

Accepted 30th January 2018

1 The adjusted phenotypic value was calculated twice as μ + eijklm by Johnson Su.

2 Means within a row lacking a common superscript are different (P<0.05).

Gene expression in birds with different variants of BMP7

The effects of the SNP c.1995T>C on the expressions of BMP7 gene were

investigated in the thighbones of the HB × HQLA F8 birds at 21, 42 and 91 days of

age. The expression level of the TT genotype of BMP7 was significantly higher than

the CC genotype in thighbones both at 21, 42 and 91 days of age (P<0.05; Figure 2).

FIG 2 HERE

Fig. 2. Different expressions of BMP7 in different genotypes of SNP c.1995T>C.

Relative expression analyses in chicken thigh bones of BMP7 gene were normalized

to the geometric average of ACTB (β-actin) and GAPDH genes for alleles at 21, 42

and 91 days of age that varied at SNP c.1995T>C. Error bars represent the SE, and

the P-values for the expression of BMP7 at each time point were 0.019, 0.001, 0.038,

respectively (from left to right in the order of the corresponding graph). a, b indicates

significant differences between different genotypes on the same day (P<0.05).

DISCUSSION

Recombinant BMPs have been applied successfully to induce healing of segmental

bone defects in number of species, including humans, rats, sheep and dogs (Yasko et

al., 1992; Gerhart et al., 1993; Cook et al., 1994; Kirker-Head et al., 1998; Geesink

et al., 1999). BMPs are well-established agents for inducing orthotopic and ectopic

bone formation. For gene therapy for bone formation, cells received the transfer by

adenovirus vectors containing the BMP7 cDNA, which produce biologically active

Page 14: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

13

Accepted 30th January 2018

BMP7, which may be a viable route for stimulating bone regeneration (Franceschi et

al., 2000). Similar to other BMPs, BMP7 stimulates the expression of the osteoblast

phenotype in vitro, and possibly causes osteoblast precursors to migrate into the

metaphyseal edge of the growth plate where they developed their physiological

functions (Vukicevic et al., 1989; Ahrens et al., 1993; Asahina et al., 1993; Houston

et al., 1994). BMP7-deficient mice exhibit various developmental defects, such as

holes in the basisphenoid bone and the xyphoid cartilage, polydactyly in hind limbs,

and cleft palate, indicating a requirement for BMP7 for the coordination of digit

formation and palatogenesis (Jena et al., 1997; Kouskoura et al., 2013). Studies have

suggested that the expression of BMP7 in the interdigital and peridigital tissues is

responsible for the outgrowth of the digit cartilages; BMP7 plays an important role in

the formation of the digits in chickens (Montero and Hurlé, 2007; Lorda-Diez et al.,

2009) and has an important role in the process of skeletogenesis.

The chicken BMP7 gene is located between 12 Mb to 12.1 Mb on chromosome 20,

and QTL analysis of bone traits in an F2 intercross, between domesticated white

Leghorn and wild-type red jungle fowl chickens, identified a QTL that affects bone

biomechanical strength (Rubin et al., 2000). This QTL is located on chicken

chromosome 20 from 26 cM to 67 cM, which contains the BMP7 gene. Jacobsson et

al (2005) identified a QTL that located in a similar region on chicken chromosome

20 (form 26 cM to 62 cM) that affected BW in an F2 intercross from two

growth-selected lines (http://www.animalgenome.org/cgi-bin/QTLdb/GG/). In this

study, an SNP (c.1995T>C) was identified in the BMP7 gene that was significantly

associated with partial growth and carcass traits, and genotyping results revealed that

T alleles predominated in high-growth-rate chicken breeds, and C alleles

predominated in breeds with a low growth rate (Table 3, Table 2). Significant

Page 15: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

14

Accepted 30th January 2018

associations at 70 and 84 days of age showed that birds with the TT genotype had the

highest growth rates at 28–56 and 56–84 days of age in all birds tested. However, for

LMW and BMW, there was no statistically significant difference among the

individuals with TT, TC and CC genotypes (data not shown). Therefore, the results

suggest that SNP c.1995T>C can improve bone growth while maintaining high

growth rates with no adverse effects on muscle growth and development. Phenotypic

correlations of leg problems with growth rate were unfavourable, and this agreed

with recent genetic analysis that indicated that the genetic relationship between

growth traits and leg problems was extremely weak in chickens, ranging only from

0.01 to 0.08 (Gonz´alez-Cer´on et al., 2015). Taken together, the BMP7 gene was

identified as a likely candidate gene for bone and body growth traits in chickens.

To explore whether the SNP c.1995T>C could affect the expression of BMP7 in the

bones of chicken, the expression of this gene in chicken thighbones with different

alleles was examined. The expression level of the TT genotype was significantly

higher than the CC genotype in the thighbone both at 21, 42 and 91 days of age

(Figure 2). SNP c.1995T>C is in 3′ UTR of the chicken BMP7 gene, did not change

the amino acid sequence of the protein, but it may be in linkage disequilibrium with a

cis-regulatory mutation that affects the expression of BMP7 (Wang et al., 2014).

Additionally, studies have indicated that the 3′ UTR plays an important role in the

spatial and temporal regulation of mRNA translation (Dalby and Glover, 1993;

Samson, 1998). In recent experiments, Kuree et al (2014) found a

miRNA—miR-542-3p, which targets in the 3’UTR of BMP7, and over-expression of

miR-542-3p which led to repression of BMP7 and inhibition of BMP7/PI3K-survivin

signalling, which suppressed osteoblast cell proliferation and differentiation and

inhibited bone formation. Unfortunately, the SNP c.1995T>C did not change the

Page 16: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

15

Accepted 30th January 2018

miR-542-3p target sequences in the 3’UTR of BMP7, but this SNP may influence the

structure of the 3'UTR of the BMP7 gene, resulting in abatement of the binding

efficiency of miR-542-3p, or change the target sequences, binding some miRNA that

have not been found so far. However, this hypothesis requires further experimental

validation. BMP can induce the phosphorylation of Smad1/5/8, which is essential for

the activation of bone-specific genes (Chen et al., 2012). In BMPR1b and BMP7

double mutant mice, the ulna and radius are severely affected, being either absent or

shortened (Yi et al., 2000). In the chicken, BMP7 is expressed throughout limb

development, and has been implicated in early limb patterning, as well as in

skeletogenesis (Francis et al., 1994). The BMP7 as a member of the BMP family has

an important role osteogenesis. The results suggested that SNP c.1995T>C in BMP7

may play an important regulatory role in the process of skeletogenesis and improve

growth in birds.

In this study, a SNP, c.1995T>C, was identified in the BMP7 gene of chicken

(Gallus gallus) genome and showed that selecting birds with the TT genotype of

SNP c.1995T>C could improve their bone growth to reduce leg disorders during

breeding for fast-growing broilers. Further confirmation in different populations is

needed.

Acknowledgments

The curatorial works about the phenotypic measurements in this study were

supported by the Operating Funds for Guangdong Provincial Key Laboratory of

Animal Breeding and Nutrition.

Disclosure statement

Page 17: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

16

Accepted 30th January 2018

No potential conflict of interest was reported by the authors.

Funding

This study was supported by the Scientific Research Project of Guangzhou

(201610010178, 201504010017, Guangzhou, P. R. China), ‘Youth Top-notch Talent

on Science & Technology’ of Guangdong Province Special Support Program

(2016TQ03N898, Guangzhou, P. R. China) and the Earmarked Fund for Modern

Agro-Industry Technology Research System (nycytx-41, Beijing, P. R. China).

References

Ahrens, M., Ankenbauer, T., Schröder, D., Hollnagel, A., Mayer, H. & Gross, G.

(1993) Expression of human bone morphogenetic proteins-2 or -4 in murine

mesenchymal progenitor C3H10T1/2 cells induces differentiation into distinct

mesenchymal cell lineages. DNA and Cell Biology, 12: 871–880. doi:

10.1089/dna.1993.12.871

Arkell, R. & Beddington, R.S.P. (1997) BMP-7 influences pattern and growth of the

developing hindbrain of mouse embryos. Development, 124: 1–12. pmid:

9006062

Asahina, I., Sampath, T.K., Nishimura, I. & Hauschka, P.V. (1993) Human

osteogenic protein-1 induces both chondroblastic and osteoblastic differentiation

of osteoprogenitor cells derived from newborn rat calvaria. The Journal ofCcell

Biology, 123: 921–933. PMID: 8227149

Chen, G., Deng, C. & Li, Y.P. (2012) TGF-beta and BMP signaling in osteoblast

differentiation and bone formation. International Journal of Biological Sciences,

8: 272–288. doi: 10.7150/ijbs.2929

Chen, D., Zhao, M. & Mundy, G.R. (2004) Bone Morphogenetic proteins. Growth

Page 18: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

17

Accepted 30th January 2018

Factors, 22: 233–241. doi: 10.1080/08977190412331279890

Chen, K.W., Yang, N. & Wang, G.Y. (2010) Animal Genetic Pesources in China:

Poultry. China National Commission of Animal Genetic Resources. China

agriculture press. Beijing, China.

Cook, S.D., Baffes, G.C., Wolfe, M.W., Sampath, T.K. & Rueger, D.C. (1994)

Recombinant human bone morphogenetic protein-7 induces healing in a canine

long-bone segmental defect model. Clinical Orthopaedics and Related Research,

301: 302–312. PMID: 8156691

Dalby, B. & Glover, D.M. (1993) Discrete sequence elements control posterior pole

accumulation and translational repression of maternal cyclin B RNA in

Drosophila. The EMBO Journal, 12: 1219–1227. pmid: 8458334

Dunnington, E.A. & Siegel, P.B. (1996) Long-term divergent selection for

eight-week body weight in White Plymouth rock chickens. Poultry Sscience, 75:

1168–1179. pmid: 8893291

Franceschi, R.T., Wang, D., Krebsbach, P.H. & Rutherford, R.B. (2000) Gene

therapy for bone formation: in vitro and in vivo osteogenic activity of an

adenovirus expressing BMP7. Journal of Cellular Biochemistry. Supplement, 78:

476–486. pmid: 10861845

Francis, P.H., Richardson, M.K., Brickell, P.M. & Tickle, C. (1994) Bone

morphogenetic proteins and a signalling pathway that controls patterning in the

developing chick limb. Development, 120: 209–218. pmid: 8119128

Geesink, R.G., Hoefnagels, N.H. & Bulstra, S.K. (1999) Osteogenic activity of OP-1

bone morphogenetic protein (BMP-7) in a human fibular defect. The Journal of

Bone and Joint Surgery. British volume, 81: 710–718. pmid: 10463751

Gerhart, T.N., Kirker-Head, C.A., Kriz, M.J., Holtrop, M.E., Hennig, G.E., Hipp, J.,

Page 19: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

18

Accepted 30th January 2018

Schelling, S.H. & Wang, E. (1993) Healing segmental femoral defects in sheep

using recombinant human bone morphogenetic protein. Clinical Orthopaedics

and Related Research, 293: 317–326. pmid: 8339499

Gonz´alez-Cer´on, F., Rekaya, R., Anthony, N.B. & Aggrey, S.E. (2015) Genetic

analysis of leg problems and growth in a random mating broiler population.

Poultry Science, 94: 162–168. doi: 10.3382/ps/peu052

Helder, M.N., Karg, A., Bervoets, T.J.M., Vukicevic, S., Burger, E.H., Souza, R.N.D.,

Woltgens, J.H.M., Karsenty, G. & Bronckers. A.L.J.J. (1998) Bone

morphogenetic protein-7 (osteogenic protein-1, OP-1) and tooth development.

Journal of dental research, 77: 545–554. doi: 10.1177/00220345980770040701

Houston, B., Thorp, B.H. & Burt, D.W. (1994) Molecular cloning and expression of

bone morphogenetic protein-7 in the chick epiphyseal growth plate. Journal of

Molecular Endocrinology, 13: 289–301. pmid: 7893347

Jacobsson, L., Park, H.B., Wahlberg, P., Fredriksson, R., Perez-Enciso, M., Siegel,

P.B. & Andersson, L. (2005) Many QTLs with minor additive effects are

associated with a large difference in growth between two selection lines in

chickens. Genetical Research, 86: 115–125. doi: 10.1017/S0016672305007767

Jena, N., Martin-Seisdedos, C., McCue, P. & Croce, C.M. (1997) BMP7 null

mutation in mice: developmental defects in skeleton, kidney, and eye.

Experimental Cell Research, 230: 28–37. pmid: 9013703

Kirker-Head, C.A., Gerhart, T.N., Armstrong, R., Schelling, S.H. & Carmel, L.A.

(1998) Healing bone using recombinant human bone morphogenetic protein 2

and copolymer. Clinical Orthopaedics and Related Research, 349: 205–217.

pmid: 9584385

Kouskoura, T., Kozlova, A., Alexiou, M., Blumer, S., Zouvelou, V., Katsaros, C.,

Page 20: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

19

Accepted 30th January 2018

Chiquet, M., Mitsiadis, T.A. & Graf, D. (2013) The etiology of cleft palate

formation in BMP7-deficient mice. PloS One, 8: e59463. doi:

10.1371/journal.pone.0059463

Kureel, J., Dixit, M., Tyagi, A.M., Mansoori, M.N., Srivastava, K., Raghuvanshi, A.,

Maurya, R., Trivedi, R., Goel, A. & Singh, D. (2014) miR-542-3p suppresses

osteoblast cell proliferation and differentiation, targets BMP-7 signaling and

inhibits bone formation. Cell Death and Disease. 5: e1050. doi:

10.1038/cddis.2014.4

Lorda-Diez, C.I., Torre-Pérez, N., García-Porrero, J.A., Hurle, J.M. & Montero, J.A.

(2009) Expression of Id2 in the developing limb is associated with zones of

active BMP signaling and marks the regions of growth and differentiation of the

developing digits. The International Journal of Developmental Biology, 53:

1495–1502. doi: 10.1387/ijdb.072415cl

Luo, C., Qu, H., Wang, J., Wang, Y., Ma, J., Li, C., Yang, C., Hu, X., Li, N. & Shu, D.

(2013) Genetic parameters and genome-wide association study of

hyperpigmentation of the visceral peritoneum in chickens. BMC Genomics, 14:

334. doi: 10.1186/1471-2164-14-334

Luo, C.L., Qu, H., Ma, J., Wang, J., Hu, X.X., Li, N. & Shu, D.M. (2014) A

genome-wide association study identifies major loci affecting the immune

response against infectious bronchitis virus in chicken. Infection, Genetics and

Evolution, 21: 351–358. doi: 10.1016/j.meegid.2013.12.004

Luo, G., Hofmann, C., Bronckers, A.L.J.J., Sohocki, M., Bradley, A. & Karsenty, G.

(1995) BMP-7 in an inducer of nephrogenesis, and is also required for eye

development and skeletal patterning. Genes & Development, 9: 2808–2820. pmid:

7590255

Page 21: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

20

Accepted 30th January 2018

Montero, J.A. & Hurlé. J.M. (2007) Deconstructing digit chondrogenesis. BioEssays,

29: 725–737. doi: 10.1002/bies.20607

Rekaya, R., Sapp, R.L., Wing, T. & Aggrey. S.E. (2013) Genetic evaluation for

growth, body composition, feed efficiency, and leg soundness. Poultry Science,

92: 923–929. doi: 10.3382/ps.2012-02649

Rubin, C.J., Brändström, H., Wright, D., Kerje, S., Gunnarsson, U., Schutz, K.,

Fredriksson, R., Jensen, P., Andersson, L., Ohlsson, C., Mallmin, H., Larsson, S.

& Kindmark, A. (2000) Quantitative trait loci for BMD and bone strength in an

intercross between domestic and wildtype chickens. Journal of Bone and Mineral

Research, 22: 375–384. DOI: 10.1359/jbmr.061203

Sampath, T.K., Coughlin, J.E., Whetstone, R.M., Banach, D., Corbett, C., Ridge, R.J.,

Ozkaynak, E., Oppermann, H. & Rueger, D.C. (1990) Bovine osteogenicprotein

is composed of dimers of OP-1 and BMP-2A, two members of the transforming

gfd-beta superfamily. The Journal of Biological Chemistry, 265: 13198–13205.

pmid: 2376592

Samson, M.L. (1998) Evidence for 3’ untranslated region-dependent autoregulation

of the Drosophila gene encoding the neuronal nucle2 arRNA-binding protein

ELAV. Genetics, 150: 723–733. pmid: 9755203

Sengle, G., Ono, R.N., Lyons, K.M., Bächinger, H.P. etstone, R.M., Banach, D.,

Corbett, C., Ridge, R.J., Ozkaynak, E., Oppermann, H. & Sakai, L.Y. (2008) A

new model for growth factor activation: type II receptors compete with the

prodomain for BMP-7. Journal of Molecular Biology, 381: 1025–1039. DOI:

10.1016/j.jmb.2008.06.074

Sheng, Z.Y., Pettersson, M.E., Hu, X.X., Luo, C.L., Qu, H., Shu, D.M., Shen, X.,

Carlborg, Örjan & Li, N. (2013) Genetic dissection of growth traits in a Chinese

Page 22: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

21

Accepted 30th January 2018

indigenous x commercial broiler chicken cross. BMC Genomics, 14: 151–174.

doi: 10.1186/1471-2164-14-151

Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A. &

Speleman, F. (2002) Accurate normalisation of real-time quantitative RT-PCR

data by geometric averaging of multiple internal control genes. Genome Biology,

3: research0034. pmid: 12184808

Vukicevic, S., Luyten, F.P. & Reddi, A.H. (1989) Stimulation of the expression of

osteogenic and chondrogenic phenotypes in vitro by osteogenin. Proceedings of

the National Academy of Sciences of the United States of America, 86: 8793–

8797. pmid: 2554330

Wang, Y., Wang, J., Li, B.H., Qu, H., Luo, C.L. & Shu, D.M. (2014) An association

between genetic variation in the roundabout, axon guidance receptor, homolog 2

gene and immunity traits in chickens. Poultry Science, 93: 31–38. doi:

10.3382/ps.2013-03512

Yasko, A.W., Lane, J.M., Fellinger, E.J., Rosen, V., Wozney, J.M. & Wang, E.A.

(1992) The healing of segmental bone defects, induced by recombinant human

bone morphogenetic protein (rhBMP-2). A radiographic, histological, and

biomechanical study in rats. The Journal of Bone and Joint Surgery. American

volume, 74: 659–670. pmid: 1378056

Yi, S.E., Daluiski, A., Pederson, R., Rosen, V. & Lyons, K.M. (2000) The type I BMP

receptor BMPRIB is required for chondrogenesis in the mouse limb.

Development, 127: 621–630. pmid: 10631182

Page 23: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

22

Accepted 30th January 2018

Figure 1

Page 24: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

Accep

ted M

anus

cript

23

Accepted 30th January 2018

Figure 2

Page 25: Associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptIl4BRw.pdf · significantly higher than in those with the CC genotype at 21, 42 and 91 days of age

本文献由“学霸图书馆-文献云下载”收集自网络,仅供学习交流使用。

学霸图书馆(www.xuebalib.com)是一个“整合众多图书馆数据库资源,

提供一站式文献检索和下载服务”的24 小时在线不限IP

图书馆。

图书馆致力于便利、促进学习与科研,提供最强文献下载服务。

图书馆导航:

图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具