[CANCER RESEARCH 58, 2293-2297, June I. 1998)

Advances in Brief

Ataxia-telangiectasia and T-Cell Leukemias: No Evidence for Somatic ATM

Mutation in Sporadic T-ALL or for Hypermethylation of theATM-NPAT/E14 Bidirectional Promoter in T-PLL1

Liping Luo, Feng-min Lu, Steve Hart, Letizia Foroni, Hodjattallah Rabbani, Lennart Hammarström,A. David B. Webster, and Igor Vofechovsky2

Karolinska Institute. Department of Biosciences al NOVUM. S-14157 Huddinge. Sweden [L L. F-M. L. H. R.. L.H.. 1. V.l. and Royal Free Hospital School of Medicine,

University of London, London NWj 2PF. United Kingdom ¡S.H., L F., A. D. B. W., I. V.¡

Abstract

The ATM gene deficient in ataxia-telangiectasia, a recessive multisystem

disease associated with a high risk of lymphomas and leukeniias, was foundpreviously to be inactivated in a rare sporadic malignancy, T-cell prolym-phocytic leukemia (T-PLL), which is often associated with cytogenetic aber

rations of chromosome 14. The ATM gene was shown to sustain frequentloss-of-function mutations in T-PLL tumor cells, consistent with functioning

as a tumor suppressor gene in this leukemia. To investigate the possibility ofnonmutationai or nonrecombinational mechanisms of T-PLL development,

we have used bisulfite genomic sequencing to analyze DNA methylation in theputative bidirectional promoter region of the closely linked ATM and NPAT/E14 genes within the CpG island at Hq22-q23. We show that this region is

completely demethylated in lymphocytes expressing ATM; however, no extensive hypermethylation was found in 9 T-PLL tumor DNA samples withoutevidence of ATM/p53 mutations. Because acute T-cell lymphoblastic leuke-inias (T-ALL) were also observed in ataxia-telangiectasia patients and T-ALL

tumor cells contain chromosome 14 abnormalities, 19 presentation samples ofT-ALL patients were analyzed for ATM mutations. Although T-ALL patients

exhibited rare núcleo)ide substitutions not previously found in ATM, all wereidentified in the germ-line, indicating constitutional polymorphisms, poten

tially confined to ethnic subpopulations. The absence of somatic nucleotidechanges in ATM in T-ALL as compared with T-PLL suggests a distinct

pattern of genetic events in the development of the two leukemias.

Introduction

A-T3 is a recessive pleiotropic syndrome caused by mutations in the

ATM gene (1, 2) located at 1Iq22-q23 (3). The risk of malignancies,especially lymphoid neoplasias of T-cell origin, is substantially increased in A-T (4) and was associated previously with spontaneouschromosomal instability observed in A-T cells (5).

T-PLL, an aggressive malignancy with a median age at diagnosis of 69years, exhibits immunophenotypic and cytogenetic similarities to a T-cellleukemia seen in A-T (6-8). In particular, T-PLL is often associated with

translocations and inversions of chromosome 14 (7, 8). Similar cytogenetic aberrations have been observed in excess in lymphocytes of A-Tpatients, where the T-cell clonal expansions can precede the development

of a similar mature leukemia by decades (9, 10). To test ATM as acandidate gene for sporadic T-PLL, we analyzed tumor DNA samples

Received 2/12/98; accepted 4/9/98.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

1Supported by the British Medical Research Council, the Swedish Cancer Foundation,

and the European Community BIOMED Programme PL950914.2 To whom requests for reprints should be addressed, at Karolinska Institute. CBT.

Blickagangen 6, 14157 Huddinge, Sweden. Phone: 46-8-6089269: Fax: 46-8-7745538;E-mail: igor.vorechovsky@cbt.ki.se.

' The abbreviations used are: A-T. ataxia-telangiectasia; T-PLL. T-cell prolympho-

cytic leukemia; T-ALL, T-cell acute lymphoblastic leukemia: SSCP. single strand conformation polymorphism; ATM. a gene mutated in ataxia-telangiectasia; LOH. loss of

heterozygosity; FISH, fluorescence in situ hybridization.

from patients with T-PLL using exon scanning SSCP (11, 12) and found

mutations in about half of them (13). In contrast to ATM mutationsidentified in the germ-line of hundreds of A-T patients (ATM mutation

database is at http://www.vmrc.org/vmrc/atm.htm), the most frequentnucleotide changes in T-PLL were missense mutations resulting in amino

acid substitutions in highly conserved residues of the ATM protein, inparticular in the kinase homology domain (13). A high proportion ofloss-of-function and missense mutations was reported independently(14-16), pointing to a tumor suppressor function of ATM in the develo-ment of T-PLL. In addition, ATM rearrangements were identified in this

leukemia using FISH or FISH on DNA fibres (Fibre FISH; 14, 15) andSouthern blotting (15), although the latter analysis was negative in anindependent study including a higher number of cases (16). Reversetranscription-PCR or Western blot analyses (14-16)4 showed a reduced

or absent expression of ATM in this leukemia. Most mutated T-PLL

samples in which no expression data were available had no normal copyoíATM (13), also supporting a tumor suppressor mechanism of ATM-

related tumorigenesis.Abnormal patterns of DNA methylation have been described in a

number of tumors, including both widespread genomic hypomethylationand regions with abnormally increased methylation (17). These changeshave been proposed to contribute to oncogenesis by affecting the expression levels of proto-oncogenes and tumor suppressor genes (17). Hyper

methylation of DNA in tumor cells, especially if it occurs in normallyunmethylated CpG islands associated with gene promoter regions, has thecapacity to decrease gene expression and alter chromatin structure. Evidence to support hypermethylation of CpG islands in tumor cell exists fora growing number of tumor suppressor genes, including the Rb gene,VHL, E-cadherin, APC, pió, and pl5 genes (18, 19; for review see 17).To test the possibility of epigenetic inactivation of ATM in T-PLL, weanalyzed presentation T-PLL samples without the evidence for an ATMmutation for DNA methylation in the putative ATM-NPAT/E14 promoterregion (20, 21). We also examined tumor cells of T-ALL cases in anexon-by-exon mutation analysis of ATM, because A-T patients can alsodevelop T-ALL (4) and T-ALL tumor cells may exhibit chromosome 14abnormalities, including inv(14) as in T-PLL.

Materials and Methods

Patients. Patients with T-PLL and their samples were characterized previously(7, 8, 13). DNA samples from nine presentation T-PLL cases were included in theDNA methylation study. Western blot analysis or reverse transcription-PCR carried out in three of the cases indicated the absence of ATM expression ( 15),4 but

the expression data were not available for the remaining samples. Because theprevious independent investigations (13-16) suggested a high proportion of T-PLLcases with reduced or absent ATM expression, six additional T-PLL cases inwhich no mutation was found by exon-by-exon SSCP analysis were included toincrease the probability of detecting putative DNA methylation errors. Presenta-

4 M. R. Yuille et ai. submitted for publication.

2293

on March 7, 2021. © 1998 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

THE ATM GENE AND T-CELL LEUKEMIAS

Table 1 Oligonucleotide primers for amplification of hisulßle-irealed A-T segments

Coordinate"(I)

top strand, region AFirstPCRtop-A-Fl

top-A-Rl

SecondPCRtop-A-F2

top-A-R2

(II) top strand, region BFirstPCRtop-B-FI

top-B-Rl

SecondPCRtop-B-F2

top-B-R2(III)bottoni strand, region A

FirstPCRhottom-A-FIbottom-

A-R1Second

PCRboltom-A-F3holtom-A-R2(IV)

bottom strand, regionBFirstPCRbottom-B-Flbottom-B-RlSecond

PCRbottom-B-F2botlom-B-R25

' -GAAAGATGGAGTGAGGAGAGGGAGGAGTTA- 3 '

5 ' -CCTCAAACTTAAAAAAACGAAAATAAAAAA- 3'5

' -GGGTTATTTTGGAGGGGTGTATGAGATTGG- 3 '

5 ' -CGAACCGAAAAACGAACCACAAACACTAA- 3'5

' -TTAAAATATTCGGTTCGTCGGAGTAAAA- 3 '

5 ' - ACCTCAAAAATCCTTCTATCCAACATAACC- 3'5

' -GGTTAGCGTTTAGCGTTTGCGGTTCGTTTT- 3 '

5 ' -TTCCCGCGTCCGCGCTTAAACCC AATACAAACC - 3'5

' -AAACAAACTAAATCGCACACGACTAAATT- 3'5

' - GACGACGAGGGCGAAGAGGGTGGGTGAGAG - 3'5

' -CCGACTCCTCTCGCCTCCTCCCGTAACCAC-3'5' - CGTTGGTTATTGGTGGATATGGCGTAGG - 3'5

' -CCATATCCACCAATAACCAACAACTTAAC-3'5

' -AAAGGTTTTTTTGTTTAGTATAGTCGGGTTTAATTT- 3'5

' -CCATATCCACCAATAACCAACAACTTAAC - 3'5

' -CGTTCGAGGGTAATAATATGATTAAAATTA- 3 '259-288

801-830290-319720-749659-685

1126-115711-740

1079-110333-361758-777460-489690-717697-711117-11697-711042-10

'The coordinates of the primers indicate their placement in the nucleotid sequence (the GenBank accession number D83244).

lion Mood samples from 19 unselected patients with T-ALL were obtained fromthe Royal Free Hospital. London. The diagnosis of T-PLL (6-8) and T-ALL (22)

was established according to criteria recommended previously. The average age atonset ( ±SD) of patients with T-ALL was 21.9 years (±12.1: range between 2 and

44).DNA Extraction and PCR-SSCP Analysis. Tumor and blood DNA was

extracted using conventional methods (12). The PCR-SSCP method was de

scribed previously (11). Briefly, each coding exon of ATM was amplified usinga pair(s) of oligonucleotide primers giving the PCR fragments of the sizebetween 152 and 340 bp, suitable for SSCP. T-ALL samples were run togetherwith patients with A-T as positive controls. ATM segments exhibiting band-

shifts were reamplified using the same conditions except for omission of alabel. DNA was purified and sequenced in both directions using an automatedApplied Biosystem model 377 sequencing station.

LOH Analysis. Four microsatellite markers closely flanking (DIISÌ294,D11S1818, D11S2000) or within (D11S2179) the ATM gene were used toanalyze pairs of normal and tumor DNA samples containing SSCP changes.The analysis of LOH was described previously (23).

Southern Blot Analysis. T-ALL DNA samples were digested with severalrestriction enzymes and transferred to nylon membranes. Three cDNA-ampli-fied segments of ATM were labeled with [a-12P]dCTP (3.000 Ci/mM) and used

in successive hybridizations to detect putative genomic rearrangements indigested T-ALL DNA. The following oligonucleotide primers were used:segment VII. 5'-CTTCATGAGGACAGTGATGTG T-3' and 5'-AGTTGA-

CAGCCAAAGTCTTGA G-3' (fragment size 779 bp); segment I. 5'-GTG-GTGGAGTTATTGATGAC-3' and 5'-GGGTCCTCTACTGTATTTGAT-3'(fragment size 732 bp): segment IV. 5'-TAGTTTTCAGGAGCCTATCAT-3'and S'-CTTCATCATGCCATTGACTTC (fragment size 865 bp). The segments VII, 1 and IV covered the 5'. middle part, and 3' end oíATM cDNA.

respectively.Sodium Bisuinte Treatment. The bisulfite conversion reaction (24) was

carried out according to the combined protocols of Clark et al. (25) andZeschnigk et al. (26). Briefly, genomic (2 ;u.g) and control plasmid (pATM.100 ng) DNAs were digested with EcoRl, the endonuclease with no restrictionsites within the region examined, in a 100-/xL reaction overnight. The sampleswere denatured at 37°Cfor 15 min by adding II p.1 of freshly prepared 3 MNaOH, then treated at 98°Cfor 5 min and immediately mixed with 1 ml of

fresh, ice-cold bisulfite solution. The mixture was incubated in the dark, firstat 4°Cfor 4 h and then at 55°Cfor an additional 16 h. DNA was recovered

using Wizard DNA Clean-up system (Promega) or GeneCleanll Kit (Bio 101,

Inc.) and eluted in 100 /¿Iof water. For desulfonation. 10 ¿j.1of 3 M NaOH was

added and incubated at 37°Cfor 15 min. The solution was then neutralized by

adding ammonium acetate (pH 7.0) to a final concentration of 3 M. DNA wasethanol-precipitated, dried, and resuspended in 20 fj.\ of water.

PCR Amplifications and Primers in the Bisulfite Method. The strand-specific nested primers used to amplify bisulfite-treated DNA are shown inTable 1. PCR reactions were carried out in a 50-100-^1 reaction mixturecontaining 3-5 fil of bisulfite-treated DNA, 200 /u,MdNTP. 1 /¿Mof eachprimer, 1.5-2 mM MgCl,. 50 mM KC1. 10 mM Tris-HCl (pH 8.3) and 2.5 unitsof AmpliTaq DNA polymerase (Perkin-Elmer) in a 9600 DNA Thermal Cycler(Perkin-Elmer). As a positive control of the reliability of conversion, 100 ng ofthe PCR-amplified sequence (the forward primer was 5'-TGGCCACGGCT-TCTTTTCTCC-3' and the reverse primer was 5'-TCCCGCCTCTTTCGCT-TCAC-3') of a portion of ATM promoter was subcloned (pATM) into the

pGEM-T Easy vector (Promega) and was methylated using S.v.vland Hhal

DNA methylatransferases (New England Biolabs) according to the manufacturer's recommendations. The efficiency of in vitro methylation was deter

mined by digestions with methylation sensitive restriction endonucleases.Cloning and Sequencing. The amplified fragments were sequenced di

rectly or cloned into the T-easy vector. Individual clones were sequenced either

manually using Sequenase v. 2.0 DNA sequencing kit or automated DNAsequencer. At least five clones were sequenced from each DNA strand andamplified region.

Results and Discussion

The Absence of Somatic Nucleotide Changes in 19 Tumor DNAfrom T-ALL. The SSCP analysis carried out on 19 unrelated T-ALL

samples showed unique patterns in 6 of them (Table 2, Fig. 1). Withthe exception of the 31 ISA—>Gmutation (Fig. 1/4, Table 2), detected

previously in a tumor sample from one patient with a high-gradediffuse B-cell non-Hodgkin's lymphoma (13), none of these nucleo-

tide changes were earlier observed in hundreds of Caucasians analyzed to date. As most of the SSCP shifts were found in patients ofnon-European ancestry (Table 2), 190 DNA samples from unrelated

individuals from the African and Iranian populations were screenedusing the same primer pairs to distinguish rare polymorphisms frommutations. In addition, normal tissue or remission samples wereanalyzed in all but one T-ALL case with an SSCP change (Table 2).

These analyses showed that M1040V mutation was detected as a rarepolymorphism in unaffected individuals of both Cambian ( 1 homozy-

2294

on March 7, 2021. © 1998 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

THE ATM GENE AND T-CELL LEUKEMIAS

<••

•¿�ÃŒ

GCCA11à:

TCa.11TTAüG11G

GÃŒSLCCAAC TCftT TAUft.CA0i./4GftG

G CCA TTC1 R.A/1T

TAC/

l;A

|\

Fig. 1. Example of ATM polymorphisms foundin T-ALL cases. A. 3118A—G (M1040V); B,5882A-»G (Y1961C). The SSCP patterns (left

¡itine!)and the corresponding nucleotide change isshown in the rare alíele(left muidle ¡yuncí),tumorDNA (righi muidle panel) and control DNA (rightpanel) as the sense (B) and antisense (A) strand.The altered nucleotides or samples are designatedwith an arrow.

IlKA uVKA/

A A ATCTG TG CAC150

AAATCTGTGCAGA

150

AAATCTATG CAG160

gote and 4 hétérozygotesof 95 tested) and Iranian ( 1 hétérozygoteof95 tested) populations. Moreover, this substitution was found in thegerm-line of the patient T-ALL 15 (Table 2). In view of these results,the 3118A—»Gtransition reported in the B-cell non-Hodgkin's lym-

phoma patient (13) was likely to be a germ-line change representing

a rare polymorphism. In addition, all tested nucleotide substitutionsidentified in tumor DNA (Table 2) were found to be present in thegerm-line of T-ALL carriers, also suggesting rare polymorphisms.

The analysis of 95 unaffected Iranians for exon 13 mutation did notreveal this change, indicating that this germ-line transition must be

very rare. The results of the LOH analysis were consistent with thepresence of SSCP alternations in the germ-line: in each normal-tumor

DNA pair analyzed, no LOH or allelic imbalance was detected (Table2). Southern blot analyses did not reveal any structural abnormalitiesin the ATM gene using three cDNA probes in any T-ALL samples.

Our data show that, unlike in T-PLL, nucleotide changes indicatingloss of function of ATM were not found in this series of T-ALL cases,

suggesting a distinct ATM function in the development of the twoleukemias. Because amino acid substitutions detected in T-ALL (Table 2) were found in the germ-line and in unaffected individuals,

potentially limited to a particular ethnic group, we conclude that theyrepresent rare constitutional polymorphisms and at present there doesnot seem to be any indication of their causal link to T-ALL.

The age at diagnosis of T-ALL reported in A-T patients was

between 2 and 18 years of age (4). This age range appears lower thanthat for T-PLL in A-T; however, the mean age at diagnosis of T-ALLin the non-A-T population is also much lower than that in T-PLL, aswas the case of our series of T-ALL patients. Therefore, it does not

seem likely that ATM would specifically be involved in youngerT-ALL patients.

As with T-PLL, cytogenetic abnormalities found in T-ALL involve

chromosome 14, in particular, in a wide range of translocations. Two

patients with A-T who developed T-ALL were reported to carry an

inversion of chromosome 14 in leukemic cells, an alteration oftenfound in T-PLL (4). In our series of 19 T-ALL patients, 17 were

examined previously by a cytogeneticist. Of the analyzed samples,three clonal chromosome 14 aberrations were found and all of themwere translocations. Interestingly, all three were found in patients witha rare ATM polymorphism (Table 2). suggesting an association ofmolecular and cytogenetic changes. However, cytogenetic abnormalities of chromosome 14 are not unique to T-PLL/T-ALL and can befound in a variety of lymphomas, T-cell chronic lymphocytic leukemia, Sezary syndrome, and adult T-cell leukemia associated withT-lymphotropic virus. Furthermore, with the exception of the5882A—>G transition, all cases had a significant amount of normalATM copy in tumor DNA. Although ATM may act as a gate-keeper inthe development of T-PLL (i.e., its inactivation is an essential eventfor T-PLL to develop), the pattern of nucleotide changes associatedwith the initiation or progression of T-ALL is clearly distinct. No

amino acid substitutions in the kinase homology domain, whichpredominate in T-PLL (13), were found in T-ALL. Although thepossibility of ATM inactivation in a subset of more prevalent T-ALL

cannot be excluded, the existence of frequent point mutations or smalldeletions/insertions, alterations common in T-PLL (13), is not likely.

Putative Bidirectional ATM-NPAT/E14 Promoter is Demethy-lated in Cells Expressing ATM. Sodium bisulfite converts unmethy-

lated cytosines to uracils while leaving methylated cytosines intact.Unlike the analysis of DNA methylation using methylation-sensitive

restriction enzymes, the bisulfite technique permits the positive assessment of each cytosine in a continuous stretch of DNA (24). Theputative bidirectional promoter was divided into two regions designated A and B, amplified separately using a set of nested primers(Table 1). The amplified region contained altogether 67 CpG dinucle-

otides. The bisulfite genomic sequencing showed (Fig. 2) that the

2295

on March 7, 2021. © 1998 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

THE ATM GENE AND T-CELL LEUKEM1AS

Table 2 Summary of ATM polymorphism.* delected in T-ALL cases

Patient/ethnicoriginT-ALL1

I/HinduT-ALLlS/ArabT-ALL4/ArabT-ALL10/Eur.Cauc.T-ALL15/AfricanT-ALL

12/ArabCytogeneticsN.A.

46.XY; 45.XY,-5,-10,del( 11).+markert(ll;14)t(l;14)46.XY.

-10, +markerdel(9)/t(10;14)Primeratml-6

atml-6amil-12atml-15atml-22atl3Wild

lype alíeletumor sample

Segment(%)exon

7exon 7exon13intron16exon23exon

4150

505050500inNucleotide

sequencechange410A->T

378T->A|744T^CIVS16+22A->C3I18A-^G5882A^GPredicted

proteinchangeY137F

D126EF582L?M

1040VY1961CAllelic1bnlcalnini2ninini—loss

at3nininini4"ni——niPresenceofalteration in

germ-lineN.A.''+

++++

Note: T.r annealing temperature." Markers 1. 2. 3. and 4 correspond to DI1S2000. DIIS2179, D11S2I94, and D1IS1818. respectively.'' Sample was not informative for assessing LOH (not available or not polymorphic).' No allelic loss in tumor DNA.'' Not analyzed.

intervening region between ATM and NPAT/E14 genes was completely demethylated in lymphocyte DNA obtained from four control,nonaffected individuals. The binding sites for numerous transcriptionfactors, in particular in region B (20), were also completely unmethy-

lated (Fig. 2). The absence of methylated cytosines was observed inboth DNA strands, which were analyzed separately using bottom andtop primers as bisulfite-treated DNA is no longer complementary. The

analysis of in vitro premethylated and untreated control pATMshowed no conversion in bisulfite-treated plasmid, while all CpGs

were converted in nonmethylated pATM. We. therefore, conclude thatthe intervening area of the CpG island associated with ATM is un-methylated (positions 325-1010, the GenBank accession number

D83244), compatible with the active transcription of housekeepingATM.

No Indication of Extensive Hypermethylation in T-PLL. Wethen analyzed nine tumor DNA samples, in which no mutation has

B

I

=

—¿�

been identified in an exon-by-exon SSCP analysis of the ATM and p53genes (13) and at least three of them had absent ATM expression ( 15)4.

Most tumors exhibited the same pattern as seen in normal cells (Fig.2), i.e., there was no methylation of any CpGs examined. No tumorDNA sample was found with an extensive hypermethylation involving all or most CpG dinucleotides as observed previously for the Rbgene (19). In two tumor samples we observed unconverted cytosines;however, because the number of unconverted cytosines in CpGdinucleotides correlated well with the numbers of unconverted cytosines outside CpG (data not shown) and the lack of conversion wasstrand-specific, these results suggested an incomplete bisulfite con

version reaction rather than a hypermethylation. Repeated conversionexperiments using prolonged incubation with sodium bisulfite lead tothe disappearance of unconverted cytosines. These results were consistent with previous analyses using a large number of clones (27),demonstrating that the rate of conversion in non-CpG cytosines was

more than 99%. A putative bias introduced by the preferential amplification of methylated versus unmethylated template (28) was excluded by designing specific methylation primers (29) for one strand.Despite these precautions, we observed single uncoverted cytosines intwo tumor samples (Fig. IB). Although it does not seem likely thatone methylated cytosine outside known binding sites would lead to asubstantial reduction in transcription (30), these observations may becompatible with the hypothesis that random methylation errors maybe found at presentation of T-PLL and may contribute to a slightly

decreased expression of ATM followed by a clonal selection of cellswith heritable epigenetic defects (17). Such methylation errors probably result from purely stochastic processes because there is noevidence for the directed de novo methylation of particular sequencesduring carcinogenesis. However, more detailed analyses with morecases will be required to establish a possible causal relationshipbetween DNA methylation errors in ATM promoter sequence andT-PLL development.

In conclusion, we have developed a technique for detecting methylated cytosines in about 0.7 kb region of the CpG island associatedwith the ATM promoter. This method can be used for the analysis ofDNA methylation from as few as a hundred cells and assist instudying the regulation of ATM expression in different cell types andATM mutation hot spots. No extensive hypermethylation was found inselected T-PLL cases without ATM mutation and no somatic ATMmutations were identified in a series of 19 cases with T-ALL, sug

gesting that this leukemia sustains a different pattern of nucleotidechanges as compared to T-PLL.

c t a g ctag gateFig. 2. Methylation pattern of the ATM promoter in normal and T-PLL cases. A,

complete cytosine demethylation in the region covering nucleotides 400-700 in twocontrol samples; B. example of an occassional methylated cytosine in a T-PLL sample.

Acknowledgments

We thank M R. Yuille, M. J. S. Dyer, and D. Catovsky from the Institutefor Cancer Research, Surrey, United Kingdom, for providing nine T-PLL DNA

samples.

2296

on March 7, 2021. © 1998 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

THE ATM GENE AND T-CELL LEUKEMIAS

References

1. Savitsky, K.. Bar-Shira, A.. Gilad. S., Rotman, G.. Ziv. Y., Vanagaile. L.. Tagle.

D. A.. Smith. S.. Uziel, T., Sfez. S., Ashkenazi, M.. Pecker, I.. Frydman, M.. Harnik.R., Patanjali. S. R.. Simmons, A., Clines, G. A., Sartiel. A.. Gatti, R. A., Chessa, L..Sana!. O., Lavin, M. F., Jaspers. N. G. J., Taylor, A. M. R., Arieti, C. F., Miki. T.,Weissman, S. M., Lovett, M.. Collins. F. S., and Shiloh. Y. A single ataxia telangi-ectasia gene with a product similar to PI-3 kinase. Science (Washington DC). 268:1749-1753, 1995.

2. Savitsky, K., Sfez, S., Tagle. D. A.. Ziv. Y.. Sartiel, A., Collins. F. S., Shiloh. Y., andRotman. G. The complete sequence of the coding region of the ATM gene revealssimilarity to cell cycle regulators in different species. Hum. Mol. Genet.. 4: 2025-2032. 1995.

3. Gatti, R. A.. Berkel. I.. Boder. E.. Braedtd. G.. Charmley. P.. Concannon. P.. Ersoy.F.. Foroud, T., Jaspers. N. G. J., Lange. K.. Lathrop. M. G.. Leppert, M.. Nakamura.Y., O'Connel. P.. Paterson. M., Salser. W., Sanai. O.. Silver. J., Sparkes, R. S., Susi.

E., Weeks, D. E., Wei. S., White, R., and Yoder. F. Localization of an ataxia-telangiectasia gene to chromosome 1Iq22-q23. Nature (Lond.), 336: 577-580. 1988.

4. Taylor, A. M. R.. Metcalfe, J. A.. Thick, J.. and Mak. Y-F. Leukemia and lymphomain alaxia telangiectasia. Blood, 87: 423-438. 1996.

5. Hecht. F.. Koler. R. D., Rigas. D. A.. Dahnke. G. S.. Case. M. P., Tisdale, V., andMiller. R. W. Leukaemia and lymphocytes in ataxia-telangiectasia. Lancet, 2: 1193.

1966.6. Galton, D. A. G. Prolymphocytic leukaemia. Br. J. Haematol., 27: 7-23. 1974.7. Brito-Babapulle. V., and Catovsky. D. Inversions and tandem translocations involv

ing chromosome 14qll and 14q32 in T-cell prolymphocytic leukemia and T-cellleukemias in patients with ataxia-telangiectasia. Cancer Genet. Cytogenet., 55: 1-9.

1991.8. Matutes. E.. Brito-Babapulle. V., Swansbury, J., Ellis. J., Morilla, R.. Dearden. C.,

Sempere. A., and Catovsky. D. Clinical and laboratory features of 78 cases ofT-prolymphocytic leukemia. Blood. 78: 3269-3274, 1991.

9. Taylor. A. M. R.. and Butterworth. S. V. Clonal evolution of T-cell chronic lympho-cytic leukemia in a patient with ataxia telangiectasia. Int. J. Cancer. 37: 511-516.1986.

10. Russo. G.. Isobe. M.. Gatti. R.. Finan. J.. Batuman. O.. Huebner. K.. Nowell. P. C..and Croce, C. M. Molecular analysis of a t( 14; 14) translocation in leukemic T-cell ofan alaxia telangiectasia patient. Proc. Nati. Acad. Sci. USA. 86: 602-606. 1989.

11. Vofechovsky, !.. Rasio. D.. Luo. L., Monaco. C.. Hammarslrom. L.. Webster.A. D. B.. Zaloudik. J.. Barbanti-Brodano. G.. James. M., Russo, G., Croce, C. M., andNegrini. M. The ATM gene and susceptibility to breast cancer: analysis of 38 breasttumors reveals no evidence for mutation. Cancer Res.. 56: 2726-2732. 1996.

12. Vorechovsky. I.. Luo. L.. Prudente. S.. Chessa. L.. Russo. G.. Kanariou. M.. James.M., Negrini. M.. Webster. A. D. B.. and Hammarstrom, L. Exon-scanning mutationanalysis of the ATM gene in patients with ataxia-telangiectasia. Eur. J. Hum. Genet..4: 352-355, 1996.

13. Vorechovsky, I., Luo, L., Dyer, M. J. S., Catovsky. D., Amlot. P. L.. Yaxley. J. C..Foroni. L.. Hammarstrom. L.. Webster. A. D. B.. and Yuille. M. A. R. Clustering ofmissense mutations in the ataxia-telangiectasia gene in a sporadic T-cell leukaemia.Nat. Genet., 17: 96-99, 1997.

14. Stilgenbauer, S., Schaffner, C.. Litterst, A., Liebisch, P., Gilad. S., Bar-Shira, A.,

James, M. R.. Lichter. P.. and Döhner. H. Biallelic mutations in the ATM gene inT-prolymphocytic leukemia. Nat. Med.. 3: 1155-1159. 1997.

15. Yuille, M. R., Coignet. L. J. A.. Abraham. S. M.. Yaqub. F.. Luo, L.. Matules. E.,Brito-Babapulle. V.. Vofechovsky, I.. Dyer. M. J. S., and Catovsky. D. ATM isusually rearranged in T-cell prolymphocytic leukemia. Oncogene, In: 789-796.

1998.16. Stoppa-Lyonnel. D.. Soulier. J.. Lauge. A. . Dastot. H.. Garand, R.. Sigaux, F., and

Slern. M-H. Inactivation of the ATM gene in T-cell prolymphocytic leukemia. Blood.91: 1-8. 1998.

17. Jones, P. A. DNA melhvlation errors and cancer. Cancer Res.. 56: 2463-2467. 1996.18. Greger. V.. Passarge. E.. Hopping. W.. Messmer. E., and Horsthemke. B. Epigenclic

changes may contribute to the formation and spontaneous regression of retinoblas-toma. Hum. Genet.. 83: 155-158, 1989.

19. Stirzaker. C.. Millar. D. S., Paul. C. L.. Wamecke, P. M.. Harrison. J.. Vincent. P. C..Frommer. M., and Clark. S. J. Extensive DNA methylalion spanning Ihe Kb promoterin retinoblastoma tumors. Cancer Res.. 57: 2229-2237, 1997.

20. Byrd. P. J., Cooper. P. R., Stankovic, T.. Kullar, H. S., Watts, G. D. J., Robinson, P. J.,and Taylor, A. M. R. A gene transcribed from the bidirectional ATM promoter codingfor a serine rich protein: amino acid sequence, structure and expression studies. Hum.Mol. Genet.. 5. 1785-1791. 1996.

21. Imai. T., Yamauchi. M.. Seki. N.. Sugawara. T.. Saito, T.. Malsuda. Y.. Ito. H..Nagase. T.. Nomura. N., and Hon. T. Identification and characterization of a newgene physically linked to the ATM gene. Genome Res.. 6: 439-447. 1996.

22. Janossy. G.. and Campana. D. Monoclonal antibodies in the diagnosis of acuteleukemia. The Leukemic Cell, in: D. Calovsky (ed.). Methods in Haematology. pp.168-195. Churchill Livingstone. 1991.

23. Negrini. M.. Rasio. D.. Hampton. G. M.. Sabbioni. S., Rattan. S.. Carter. S. L..Rosenberg, A. L., Schwartz. G. F., Shiloh. Y.. Cavenee. W. K., and Croce. C. M.Definition and refinement of chromosome 11 regions of LOH of breast cancer:identification of a new region at 1Iq23-q24. Cancer Res., 55: 3003-3007. 1995.

24. Frommer. M.. McDonald, L. E.. Millar, D. S.. Collis, C. M.. Watt. F.. Grigg. G. W..Molloy. P. L.. and Paul. C. L. A genomic sequencing protocol that yields a positivedisplay of 5-methylcytosine residues in individual DNA strands. Proc. Nail. Acad.Sci. USA. 89: 1827-1831. 1992.

25. Clark. S. J.. Harrison. J.. Paul. C. L.. and Frommer. M. High-sensitivity mapping ofmethylated cylosines. Nucleic Acids Res.. 22: 2990-2997. 1994.

26. Zeschnigk. M., Schmilz. B.. Dittrich. B.. Suiting. K.. Horsthemke. B . and Doerfler.W. Imprinted segments in the human genome: different DNA methylation patterns inthe Prader-Willi/Angelman syndrome region as determined by the genomic sequencing method. Hum. Mol. Genet.. 6: 387-395. 1997.

27. Stoger. R.. Kajimura. T. M.. Brown. W. T.. and Laird. C. D. Epigenetic variationillustrated by DNA methylation patterns of the fragile-X gene FMRI. Hum. Mol.Genet., 6: 1791-1801. 1997.

28. Warnecke. P. M., Stirzaker, C.. Melki. J. R.. Millar. D. S., Paul. C. L.. and Clark, S. J.Detection and measurement of PCR bias in quantitative methylation analysis ofbisulfite-treated DNA. Nucleic Acids Res.. 25: 4422-4426. 1997.

29. Herman, J. G., Graff, J. R.. Myöhänen.S.. Nelkin, B. D., and Baylin. S. B. Melhy-lation-specific PCR. A novel PCR assay for methylation status of CpG islands. Proc.Nati. Acad. Sci. USA, 93: 9821-9826. 1996.

30. Hsieh. C-L. Stability of patch methylation and its impact in regions of transcriptionalinitiation and elongation. Mol. Cell. Biol.. 17: 5897-5904. 1997.

2297

on March 7, 2021. © 1998 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

1998;58:2293-2297. Cancer Res   Liping Luo, Feng-min Lu, Steve Hart, et al.   in T-PLL

Bidirectional PromoterATM-NPAT/E14Hypermethylation of the Mutation in Sporadic T-ALL or forATMSomatic

Ataxia-telangiectasia and T-Cell Leukemias: No Evidence for

  Updated version

  http://cancerres.aacrjournals.org/content/58/11/2293

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/58/11/2293To request permission to re-use all or part of this article, use this link

on March 7, 2021. © 1998 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from