(ATF3) expression in the neural retina and optic nerve of zebrafish

Comparative Biochemistry and Physiology, Part A xxx (2009) xxx–xxx

CBA-08850; No of Pages 11

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part A

j ourna l homepage: www.e lsev ie r.com/ locate /cbpa

ARTICLE IN PRESS

Activating transcription factor 3 (ATF3) expression in the neural retina and opticnerve of zebrafish during optic nerve regeneration

Katherine E. Saul, Joseph R. Koke, Dana M. García ⁎Department of Biology, Texas State University-San Marcos, San Marcos, Texas 78666, USA

⁎ Corresponding author. Tel.: +1 512 245 3368; fax:E-mail addresses: [email protected] (K.E. Saul),

[email protected] (D.M. García).

1095-6433/$ – see front matter © 2009 Elsevier Inc. Aldoi:10.1016/j.cbpa.2009.10.042

Please cite this article as: Saul, K.E., et al., Acduring optic nerve regeneration, Comp. Bio

a b s t r a c t
a r t i c l e i n f o
Article history:Received 10 April 2009Received in revised form 17 October 2009Accepted 26 October 2009Available online xxxx

Keywords:Optic nerve regenerationZebrafishATF3Differential gene expressioncAMPOligodendrocytesAstrocytesRetinal ganglion cells

Fish, unlike mammals, can regenerate axons in the optic nerve following optic nerve injury. We hypothesizedthat usingmicroarray analysis to compare gene expression in fish which had experienced optic nerve lesion tofish which had undergone a similar operation but without optic nerve injury would reveal genes specificallyinvolved in responding to optic nerve injury (including repair), reducing detection of genes involved in thegeneral stress and inflammatory responses. We discovered 120 genes were significantly (minimally two-foldwith a P-value≤0.05) differentially expressed (up or down) at one or more time point. Among these wasATF3, a member of the cAMP-response element binding protein family. Work by others has indicatedthat elevated cAMP could be important in axon regeneration. We investigated ATF3 expression further byqRT-PCR, in situ hybridization and immunohistochemistry and found ATF3 expression is significantlyupregulated in the ganglion cell layer of the retina, the nerve fiber layer and the optic nerve of the injured eye.The upregulation in retina is detectable by qRT-PCR by 24 h after injury, at which time ATF-3 mRNA levels are8-fold higher than in retinas from sham-operated fish. We conclude ATF3 may be an important mediator ofoptic nerve regeneration-promoting gene expression in fish, a role which merits further investigation.

+1 512 245 [email protected] (J.R. Koke),

l rights reserved.

tivating transcription factor 3 (ATF3) expresschem. Physiol., A (2009), doi:10.1016/j.cbpa

© 2009 Elsevier Inc. All rights reserved.

1. Introduction

Evolution of vertebrate animals has resulted in two distinctiveforms of embryonic development — amniotic and anamniotic.Anamniotes (fish, amphibians), as compared to amniotes, in a sensenever fullymature, andmany genes that are developmentally silencedin amniotes as adults remain transcriptionally active throughoutanamniotes' lifetimes. Anamniotes retain impressive regenerativecapacities, even to the extent of entire limb replacement, whileamniotes, mammals in particular, for the most part do not. Thislimited regenerative capacity of mammals is especially noteworthy instudy of spinal cord injuries and neurodegenerative diseases thatresult in a loss of function due to the failure of neurons in the centralnervous system (CNS) to survive and regenerate axons. Because theretina of the eye and optic nerve are part of the CNS and are accessibleto experimental manipulation, optic nerve injury (ONI) and subse-quent regeneration (ONR) – when it happens – have been usedextensively as a model system for study of regenerative capacities ofthe central nervous system in vertebrates (for a recent review, seeGarcia and Koke, 2009). Comparative studies in model organisms(zebrafish as anamniotes, mice as amniotes) may yield powerfulinsights, not just into clinically important information, but intoevolutionary trade-offs regarding complexity and control of develop-

ment. For example, several genes whose inactivity (e.g., BCL2) oractivity (e.g. PTEN) seems to prevent ONR in mammals are also foundto be over-expressed (BCL2) (Chen et al., 1997) or mutated (PTEN)(Groszer et al., 2006; Hu et al., 2005) in many metastatic cancers,implying their normal condition is necessary for maintenance of thedifferentiated state.

Damage to the optic nerve of mammals and fish results indegeneration of axons distal to the injury site (towards the brain). Inmammals, apoptosis of retinal ganglion cells (RGCs) in the retinaresults within 10–14 days (Cho et al., 2005). Growth of any newneurites that may sprout from the nerve stump is hampered by bothphysical and molecular barriers: specifically the formation of theglial scar (Goldberg and Barres, 2000; Ries et al., 2007) andmolecular barriers that may include myelin inhibitory protein,semaphorin 3A, and chondroitin sulfate proteoglycans (Cao et al.,2008). In the mouse, it has been shown that optic nerve astrocytesare an obstacle to ONR; selectively poisoning them in the presence ofreactivated Bcl2 is permissive to the tracking of newly formedneurites through the nerve casing en route to targets in the brain(Cho and Chen, 2008).

In addition to extrinsic factors, factors intrinsic to RGCs themselvesmay block regeneration of crushed axons in mammals, even in theabsence of astrocytes (Goldberg et al., 2002a,b). These factors includePTEN (phosphatase and tensin homolog), which blocks the down-stream effects of PIP3 signaling by dephosphorylating PIP3, convertingit to PIP2. PTEN seems to be constitutively active in adult mammalianRGCs. PIP3 activates, among many other things, Akt (a.k.a. protein

ion in the neural retina and optic nerve of zebrafish.2009.10.042

mailto:[email protected]



http://dx.doi.org/10.1016/j.cbpa.2009.10.042

http://www.sciencedirect.com/science/journal/10956433


2 K.E. Saul et al. / Comparative Biochemistry and Physiology, Part A xxx (2009) xxx–xxx

ARTICLE IN PRESS

kinase B) which in turn inhibits TSC1, TSC2 (tuberous sclerosiscomplex 1, 2), relieving the inhibition of mTOR (mammalian target ofrapamycin). Active mTOR integrates cellular signals in response tovarious stimuli, including hypoxia and nutrient availability, promotesprotein synthesis and prevents apoptosis. Therefore, inactivation ofPTEN would be expected to relieve inhibition of PIP3 and permitactivation of mTOR and its downstream effectors. This expectationhas been verified in an elegant study using adult, “floxxed” mice toremove the gene for PTEN from RGCs; RGCs of such mice withdisregulated mTOR resist apoptosis after ONI and show robustneurite extension through the lesion into the distal stump within14 days (Park et al., 2008). In lower vertebrates there is littleevidence that astrocytes or intrinsic factors present an obstacle tonerve regeneration. Following optic nerve injury by crush or axotomyin fish, rapidly growing neurites sprout from the nerve stump andfunctionally re-enervate the brain (Attardi and Sperry, 1963;Bernhardt, 1989, 1999; Veldman et al., 2007).

Presumably fish are able to regenerate the axons of the optic nervebecause they are able to express or suppress genes in response to ONIappropriately to create a permissive environment (as compared tomammals) for RGC survival and neurite extension. In this study, weused cDNA microarray analysis to compare gene expression inzebrafish retina which had experienced ONI to that in fish whichhad undergone a similar operation, but without the optic nerve injury(sham-operated, or SO), and we made these comparisons at threedifferent time points (3, 24, and 168 h). In so doing, we discovered120 genes that were differentially expressed. Among these wasactivating transcription factor 3 (ATF3), a member of the ATF/CREBfamily (Hai and Hartman, 2001). Work by others has indicated thatelevated cAMP could be important in axon regeneration (Hannila andFilbin, 2008; Muller et al., 2007); therefore, we investigated ATF3further by quantitative RT-PCR (qRT-PCR), in situ hybridization (ISH)and immunohistochemistry.

2. Materials and methods

2.1. Animals

All animal use protocols were approved by the Texas StateUniversity-San Marcos IACUC (approval # 0703_0122_07). Wild-type ZDR zebrafish (Danio rerio, Aquatica Tropicals, Plant City, FL,USA) were acclimated to a 12/12 h light/dark cycle for a minimum of14 days before use. These fish represent a wild-type, lab-bred (but notinbred) lineage which originated from Scientific Hatcheries (Hun-tington, CA, USA) and have been maintained for 30 or moregenerations. We compared four interventions, designated opticnerve injured (ONI), sham-operated (SO), contralateral (CL) andcontrol (CT). The surgical procedures for each are described below.

2.2. Optic nerve injury

Optic nerve injury was performed as described below using amethod modified from Liu and Londraville (2003). Zebrafish wereanesthetized in 0.2% MS-222 (Finquel® tricaine methanesulfonate,Argent Chemical Laboratories, Redmond, WA, USA) dissolved in tankwater. Each zebrafish was wrapped in a wet paper towel, exposingonly the head, and placed on the stage of a stereomicroscope fordissection. By separating the dorsal connective tissue, cutting thelateral rectus muscle, and then angling the eye rostrally, the opticnerve was exposed. Taking care not to damage the ophthalmic artery,the optic nerve was partially severed (~90%) using 3 mm micro-scissors (EM Sciences, Hatfield, PA, USA). The eyewas placed back intothe socket and the fish revived by placing it in aerated aquariumwater. Sham operations were identical except the optic nerve was notsevered. Only one eye was operated on in each fish, yielding an

Please cite this article as: Saul, K.E., et al., Activating transcription factorduring optic nerve regeneration, Comp. Biochem. Physiol., A (2009), do

unoperated contralateral eye. Control fish were not handled,anesthetized or subjected to surgical manipulations until sacrificed.

2.3. RNA extraction

All fish were sacrificed at midday to eliminate differences in geneexpression associated with diurnal rhythm. Following euthanasia byoverdose in MS-222, whole eyes were removed 3 h, 24 h, and 7 daysfollowing ONI or SO and immediately placed in RNA later (Ambion;Austin, TX, USA). For microarray analysis, the optic nerve injured eyesfrom 12–15 identically treated fish were pooled for each of threetriplicate samples. The sclera and lens were removed, and theremaining eye tissues (retina, retinal pigment epithelium, andchoroid) were placed in 1 ml of TRI-Reagent (Ambion) for RNAextraction. RNA clean-upwas performed using RNAeasy spin columns(QIAGEN, Valencia, CA, USA). RNA quality and integrity was assessedusing a Nanodrop spectrophotometer (Thermofisher Scientific,Waltham, MA, USA) and glyoxal gel electrophoresis with ethidiumbromide (Applied Biosystems, Foster City, CA, USA) staining to detectthe 18 S and 28 S rRNA bands. RNA samples were sent to MichiganState University's Research Technology Support Facility for anadditional quality check using the Agilent BioAnalyzer and subse-quent microarray analysis.

2.4. Microarray analysis

The Zebrafish 14 K OciChipTM Oligo-nucleotide Array (OcimumBiosolutions, Indianapolis, IN) was used for dual-color analysiscomparing ONI and SO fish. A total of 9 OciChips were used toanalyze the triplicate RNA samples at 3 h, 24 h and 168 h. TheOcimum 14 K OciChipTM Oligo-nucleotide Array comprises 14,067unique, ~50-mer probes representing 8839 genes. Labeling andhybridization was carried out using standard procedures at theMichigan State University Research Technology Support Facility(http://www.genomics.msu.edu/) and following the microarraymanufacturer's instructions. Slides were scanned using an Affymetrix428 Array Scanner and analyzed with the GenePix Pro 3.0 software(Axon Instruments, Sunnydale, CA, USA). Array normalization andstatistical analysis were performed using the “limma: Linear Modelsfor Microarray Data” library module (version 2.2.0) of the R statisticalpackage. Intensity data were normalized using the global LOWESS(locally weighted scatter plot smoothing) method with the leastsquares method used for the linear model fit. A one-way analysis ofvariance was performed on the ratios of the triplicate time points todetermine whether statistically significant differences existed in geneexpression between SO and ONI samples at the three time points (3,24, and 168 h). To be included in the analysis, hybridized spots met aminimum criterion of exceeding a threshold intensity of 1000fluorescence units in at least one channel for at least one sample ateach time point. All of the microarray signal data have been depositedin the Gene Expression Omnibus (GEO) repository under the seriesaccession number GSE17854. All genes that displayed greater than2.0-fold change (up or down) at one or more time points wereconsidered differentially expressed and were individually analyzedfor gene ontology using the web-based search engine GeneTools(Beisvag et al., 2006). Ontology analysis was accomplished based onGenBank accession number.

2.5. Quantitative RT-PCR

Reverse transcription was completed on 350 ng of RNA isolatedfrom the pooled retinas of 2–3 fish using MMLV Reverse Transcriptase(Promega, Milwaukee, WI, USA) using random and oligo dT primers(Promega) for 60 min at 37 °C. Quantitative reverse transcriptasePCR (qRT-PCR) was carried out on an Eppendorf Realplex2 Master-cycler (Hamburg, Germany) using Invitrogen's Universal SYBR®

3 (ATF3) expression in the neural retina and optic nerve of zebrafishi:10.1016/j.cbpa.2009.10.042

http://www.genomics.msu.edu/


Table 1Microarray results summarizing changes in gene expression as a result of ONI.

Time after ONI Number of genes showing≥2.0-foldexpression changes in ONI

Up Down

3 h 12 424 h 10 9168 h 43 47

3K.E. Saul et al. / Comparative Biochemistry and Physiology, Part A xxx (2009) xxx–xxx

ARTICLE IN PRESS

GreenER™ Two-Step qRT-PCR Universal Kit (Invitrogen, Carlsbad, CA)following the cycling program: 5 min at 50 °C for cDNA synthesis,95 °C for 10 min, 45cycles [95 °C for 15 s, 60 °C for 15 s, 68 °C for 15 s],followed by melt curve analysis. The following primers were used:ATF3 (NM_200964), F-TCACGCTGGACGACTTCACAAACT and R-TCTCAGTGTTCATGCAGGCTCTGT; ß-actin (NM_131031), F-ATCAG-CATGGCTTCTGCTCT and R-GTGAGGAGGGCAAAGTGGTA; ribosomalgene L24 (NM_173235), F-ATGTGAGTCTGCGTTTCTGTCCAAG and R-GCTTCTTCGACACCTCCTCAGACTG. ß-actin primers were purchasedfrom Bio-Synthesis (Lewisville, TX, USA); other primers werepurchased from Integrated DNA Technologies (http://www.idtdna.com/). Fold-changes were estimated using 2-ΔΔCT method describedby Livak and Schmittgen (2001) using ß-actin and L24 as referencegenes. The results presented here for whole eye extracts are based onthe L24 gene, while results for retinal extracts are based on ß-actin

Table 2Genes showing 2.0-fold or greater increased expression 3 h after injury.

Accession number Name/description

NM_200931.1 KDEL containing 1NM_200570.1 Selenium-binding protein 1NM_200333.1 CXXC finger 1 (PHD domain)NM_001034972.1 Phosphatidylinositol 4-kinase III alphaNM_001012262.1 Crystallin, gamma S2XM_001332616.1 Similar to peroxisomal biogenesis factor 6BC076530.1 Tumor protein p63NM_214773.1 Acid phosphatase 5a, tartrate resistantNM_001007383.1 zgc: 101832 (aka small ribonucleoprotein A′)NM_200319.1 Transmembrane protein 57NM_214716.1 Heat shock protein 4, likeAF028724.1 Connexin 30.9

Table 3Genes showing 2.0-fold or greater decreased expression 3 h after injury.


NM_200751.1⁎ Retinal pigment epithelium-specific protein 65aBX323035.8 DNA sequence from clone DKEYP-94H10NM_131568.1 Transient receptor potential cation channel (trpc4apb)NM_213506.1 zgc:63491

⁎ This gene was represented in two different spots. Here the average fold-change is given.

Table 4Genes showing 2-fold or greater increased expression 24 h after injury.


NM_200964 Activating transcription factor 3NM_001024811 GTP-binding protein 1-likeNM_130992.1 Noggin 2NM_001001399 Signal sequence receptor, ßAY178796.1 Annexin 2aBX000434.11 DNA sequence from clone CH211-2E18NM_201293 S-adenosyl homocysteine hydrolase-like 1U93471.1 Nuclear receptor subfamily 4, group A, member 2aNM_001098251.1 Similar to Bardet-Biedl syndrome 1NM_207060.1 Transmembrane protein 49


gene expression. Analysis was performed on triplicate biologicalreplicates for each condition (ONI, SO, CL and CT) except for the 3 and24 h time points for whole eye, in which duplicate samples wereanalyzed (not shown). In addition to the ONI, SO and unoperatedcontrol fish, we also included the contralateral eye of the ONI fish inthe qRT-PCR analysis, in order to determine if the stress of handlingthe fish had an impact on gene expression (Chiang and Thomas,1972). Comparison of results among ONI, SO, control, and contralat-eral eye was performed by two factor analysis of variance (ANOVA)using the R statistical package, followed by single factor ANOVA foreach time point and post-hoc Tukey–Kramer test to determinesignificance of differences among treatment categories using StatPlus(Analyst Soft - http://www.analystsoft.com/en/).

2.6. In situ hybridization and immunofluorescence microscopy

For in situ hybridization (ISH) and immunofluorescent localizationof ATF3 mRNA and protein, respectively, both eyes, optic nerves andbrain were dissected out intact in 4% PFA in PBS then fixed overnight.Following washing in PBS, the tissue was cryoprotected by incubationin 30% sucrose-PBS until the tissue sank. The intact visual tract wasmounted to permit transverse sectioning to allow sections to includethe CL and ONI retina, optic nerves, chiasma, and optic tectum of thebrain. For ISH, ONI fish were sacrificed at 24 h after injury by overdosein MS-222. Sections were cut at 14 µm using a Zeiss Microm cryostat,collected on poly-L-lysine-coated coverslips and stored at −80 °C

Ratio (ONI:SO) Previous reports in a nerve injury model

6.65 None3.35 (Purdey, 2001)3.09 None3.02 None2.51 None2.27 None2.19 None2.06 None2.05 (McWhorter et al., 2008)1.99 None1.97 None1.96 None

Ratio (SO:ONI) Previous reported in a nerve injury model

2.22 (Schonthaler et al., 2007)2.17 None2.13 (Wu et al., 2008)2.04 None

Ratio (ONI:SO) Previous reports in a nerve injury model

3.60 (Seijffers et al., 2007; Saito and Dahlin, 2008)3.09 None2.57 (Matsuura et al., 2008)2.23 None2.19 None2.12 None2.11 None2.04 (Ettl et al., 2006)2.00 None1.98 None


http://www.idtdna.com/

http://www.idtdna.com/

http://www.analystsoft.com/en/


Table 5Genes showing 2-fold or greater decreased expression 24 h after injury.

Accession number Name/description Ratio (SO:ONI) Previous reports in nerve injury model

NM_200410.1 Solute carrier family 16 (monocarboxylic acid transporters) 2.43 NoneXM_679775.1 Cerebellin 2a precursor 2.12 NoneNM_131594.1 ß-catenin-interacting protein 2.12 NoneNM_199946.1 Male germ cell-associated kinase 2.10 NoneNM_200711.1 Calbindin 2 2.09 NoneNM_213364.2 Proline 4 hydroxylase, ß 2.08 NoneNM_212866.1 zgc:77051 2.04 NoneXM_693793.2 Similar to ClpB caseinolytic peptidase B homolog 2.01 NoneNM_213000.1 Chimerin 1 2.00 None


ARTICLE IN PRESS

until use. In situ hybridization was performed using methodsmodified from Braissant and Wahli (1998). Sections were post-fixedin 4% PFA (10 min at room temperature) and incubated in PBScontaining 0.1% activated diethylpyrocarbonate (DEPC) 2 times for15 min at room temperature. Sections were equilibrated for 15 min in5X SSC (NaCl, 0.75 M; Na citrate, 0.075 M) and prehybridized for 2 hat 55 °C in hybridization buffer: 50% formamide (Sigma Aldrich), 5XSSC, 40 µg/mL salmon sperm DNA (Invitrogen). Hybridizationreaction of ATF3 probes at a concentration of 200 ng/mL was carriedout at 55 °C for 15 h. Probes (Eurofins MWG Operon, http://www.eurofinsdna.com/) were conjugated to DIG at the 5′ end with the

Table 6Genes showing 2-fold or greater increased expression 168 h after injury.

Accession number Name/description R

NM_200937 Inhibitor of growth family, member 3 3XM_694495.2 Serum/glucocorticoid regulated kinase 2 3NM_198818.1 Tubulin beta 5 3NM_213062.1 Ubiquitin-like modifier activating enzyme 1 3NM_001110403.1 Heat shock protein 8 2NM_001002378.1 zgc:92066 2NM_212617.1 YY1 transcription factor 2NM_200093.1 ORM1-like 1 2NM_131098.1 Apolipoprotein Eb 2NM_200751.1 RPE-specific protein 65a 2CR848747.8 Tubulin beta 5 2NM_212758.1 Peptidylprolyl isomerase A 2AY391434.1 Ribosomal protein SA 2NM_001004679.1 zgc:103619 2NM_001007105.1 Apoptotic chromatin condensation inducer 1a 2NM_212756.1 Granulin 2 2XM_001334747.1 Similar to tubulin alpha 6 2XM_678183.2 Similar to zinc finger protein 91 2AY178796.1 Annexin 2a 2NM_001045851.1 zgc:154081 2NM_200577.1 zgc:66026 2NM_001002695.1 zgc:92631 2NM_214716.1 Heat shock protein 4, like 2NM_199949.2 Eukaryotic translation elongation factor 1 beta 2 2NM_139180.1 Lysozyme 2NM_200845.1 zgc:77702 2NM_200964.1 Activating transcription factor 3 2NM_001003558.1 Tubulin, alpha 8 like 3 2NM_001002378.1 zgc:92066 2AY057057.1 Baculoviral IAP repeat-containing 5a 2NM_131708.1 Trypsin 2NM_130926.1 Non-metastatic cells 2 2CU302326.8 DNA sequence from clone CH211-143F7 2NM_152961.2 Fatty acid binding protein 3, muscle, heart 2BC042319.1 Tubulin, alpha 1 2NM_200185.1 Tubulin, alpha 8 like 4 2BC064291.1 Elongation factor 1-alpha 2NM_201055.1 zgc:55862 2XM_679690.2 si:ch211-214 k9.2 1XM_688637.2 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated 1NM_001003447.1 Ribosomal protein L15 1NM_001105116.1 Novel protein similar to vertebrate praja family protein 1


following sequences (5′→3′): GCAGGACACCTTGTCATC (antisense);GAGATGACAAGGTGTCCTGC (sense). Following hybridization, sec-tions were washed 30 min in 2X SSC, 1 h in 2X SSC, 1 h in 0.1X SSC,and then equilibrated in Tris-buffer (100 mM Tris–HCl/150 mMNaCl)for 5 min; all these steps were performed at room temperature.Incubation with anti-DIG antibody conjugated to alkaline phospha-tase (Roche, Indianapolis, IN, USA) diluted 1:1000 in Tris-buffercontaining 0.5% nonfat dry milk was carried out for 2 h at roomtemperature. Sections were washed 3 times for 15 min in Tris-bufferprior to color development for 30 min in NBT/BCIP solution (Roche)diluted 1:500 in Tris-buffer.

atio (ONI:SO) Previous reports in nerve injury model

.96 None

.52 None

.50 (Veldman et al., 2007)

.12 None

.78 None

.72 None

.62 None

.59 None

.54 None

.54 (Schonthaler et al., 2007)

.51 (Veldman et al., 2007)

.49 None

.49 None

.45 None

.42 None

.38 (Cameron et al., 2005)

.34 None

.28 None

.26 None

.24 None

.21 None

.16 None

.16 None

.16 None

.15 None

.15 None

.13 (Seijffers et al., 2007; Saito and Dahlin, 2008; Veldman et al., 2007)

.12 None

.12 None

.12 None

.09 None

.09 None

.09 None

.06 None

.06 (Gulati-Leekha and Goldman, 2006; Senut et al., 2004)

.05 None

.04 None

.02 None

.99 None

.97 None

.97 None

.96 None


http://www.eurofinsdna.com/

http://www.eurofinsdna.com/


Table 7Genes showing 2-fold or greater decreased expression 168 h after injury.

Accession number Name/description Ratio (SO:ONI) Previous reports in nerve injury model

NM_212799.1 Phosphodiesterase 6G, cGMP-specific, rod, gamma 3.31 NoneNM_131868.2 G protein, alpha transducing activity polypeptide 1 2.79 (Cameron et al., 2005)NM_001007160.1 Phosphodiesterase 6A, cGMP-specific, rod, alpha 2.78 NoneNM_212755.1 Opioid receptor, delta 1b 2.75 NoneNM_131838.2 ATPase, Na+/K+ transporting, beta 2b polypeptide 2.74 NoneNM_213202.1 G protein, beta polypeptide 3 2.69 NoneXM_001338177.1 Similar to KIAA1447 2.59 NoneNM_212609.1a G protein, beta polypeptide 1 2.59 NoneXM_686878.2 Tubulin, gamma complex associated protein 3 2.58 NoneNM_213149.1 FK506 binding protein 5 2.58 NoneNM_131175.1 Opsin 1, long-wave-sensitive, 1 2.56 (Raymond et al., 2006)NM_194384.1 Aldolase c, fructose-bisphosphate 2.54 NoneNM_200784.1 Coiled-coil-helix-coiled-coil-helix domain containing 10 2.52 NoneNM_200719.1 ADP-ribosylation factor-like 3, like 2 2.48 NoneNM_152955.1 Dachsund a 2.42 NoneXM_001337793.1 Similar to Abelson murine leukemia viral oncogene homolog 1 2.41 NoneXM_681309.1 Slit and trk like 4 protein 2.40 NoneNM_199968.1 ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit 2.39 NoneNM_001030077.1 Solute carrier family 9 (sodium/hydrogen exchanger), member 7 2.36 NoneNM_131039.1 es1 protein 2.33 NoneNM_001017711.1 G protein-coupled receptor kinase 1 b 2.30 NoneNM_001020620.1 zgc:110664 2.25 NoneNM_200837.1b zgc:73359 2.25 NoneNM_212881.1 zgc:73371 2.24 NoneNM_199517.1 N-myc downstream regulated family member 3a 2.23 NoneBX649356.19 DNA sequence from clone CH211-209H5 2.23 NoneNM_200785.1 zgc:73310 2.22 NoneNM_131319.1 Opsin 1 (cone pigments), short-wave-sensitive 1 2.21 NoneNM_194393.1 Guanylate cyclase activator 1C 2.20 NoneNM_131567.1 Retinal degradation slow 4 2.16 NoneNM_001003431.1 zgc:92880 2.12 NoneBC063938.1 Rhodopsin 2.09 NoneCT027840.6 Zebrafish DNA sequence from clone CH211-271F14 2.09 NoneNM_213216.2 Arginine and glutamate rich 1a 2.08 NoneNM_199972.1 Elongation of very long chain fatty acids-like 4 2.07 NoneNM_212702.1 Bromodomain containing 3b 2.06 NoneNM_001099994.1 Clusterin-like 2.05 NoneXM_677731.1 Phosducin 1 2.05 NoneNM_131693.1 Muscle-specific beta 1 integrin binding protein 2.04 NoneAC024175.3 Mitochondrial genome 2.01 NoneNM_131192.1 Opsin 1, short-wave-sensitive 2 2.01 NoneXM_690644.2 Similar to radial spokehead-like protein 3 1.99 NoneNM_001077302.1 si:ch211-195b13.1 1.97 NoneNM_178132.2 NK3 homeobox 2 1.96 NoneNM_001007765.1 NADH dehydrogenase Fe-S protein 1 1.96 NoneNM_200009.1 zgc:73138 1.95 None

a This gene was represented in two different spots. Here the average fold-change is given.b This gene was represented in three different spots. Here the average fold-change is given.


ARTICLE IN PRESS

For immunofluorescence, uninjured fish and ONI fish (24 and 72 hafter injury) were sacrificed by overdose in MS-222. Sections were cutat 20 µm and collected on poly-L-lysine coated coverslips and storedat −80 °C until use. ATF3 immunostaining was performed asdescribed by Seijffers et al. (2007). Images were captured using anOlympus FV1000 laser scanning confocal microscope and prepared forpublication using Adobe PhotoShop 10.0.1.

2.7. Intensity analysis of immunofluorescent staining for the ATF3protein

Staining intensity was determined using the pixel intensity tool ofthe Fluoview Software for the Olympus FV1000 laser scanningconfocal system. RGCs were selected from two different retinalsections for each treatment category and time point and weremeasured for whole cell labeling using z projections of stackscontaining ten 1.0 µm thick sections. RGC nuclei were measuredusing single, 1.0 µm optical sections to avoid inclusion of fluorescencefrom above or below the nuclei. Differences in pixel intensity wereevaluated using two factor ANOVA and a post-hoc Tukey–Kramer testto determine where the differences lay.


3. Results

3.1. Microarray analysis

Using the Zebrafish 14 K OciChipTM Oligonucleotide Array, wefound 120 genes with at least a 2.0-fold difference (P≤0.05) betweenONI and SO eyes at one or more time points following surgery. Thenumber of differentially expressed genes at 168 h was much greaterthan the number at 3 and 24 h (Tables 1–7). All genes that displayedgreater than 2.0-fold differences at one or more time point wereindividually analyzed for known functional characteristics and geneontology. The majority of the genes were not classified ontologicallybeyond the major categories of biological process, metabolic functionand cellular component. However, in some cases this seemed to be aproblem of notation rather than a lack of understanding of the genesin question. That said, of the genes that were classified, the greatestnumber fell into the molecular function category of nucleotidebinding (15 genes), the biological process category of signaltransduction (8 genes) and the cellular component category ofintegral to membrane (10 genes). Additional major categories undermolecular function were metal ion binding (7 genes), including



Fig. 2. qRT-PCR for retinas. At 3 h post-ONI, no significant differences were apparentamong the experimental groups (ONI, SO, CL, and CT). Twenty-four h after ONI, ATF3


ARTICLE IN PRESS

calcium, zinc, manganese, magnesium and iron binding, and receptoractivity and signal transducer activity (7 genes each). Interestingly,among the genes in the signal transducer activity were numerousgenes associated with visual perception, almost all of which weresubstantially down-regulated at 168 h post-injury.

One gene expressed at higher levels in ONI fish in the cellproliferation and differentiation categories was ATF3, a member of thecAMP-response element binding protein family of transcriptionfactors. Because work by others has indicated that elevated cAMPcould be important in axon regeneration (Hannila and Filbin, 2008;Muller et al., 2007), the increased expression of ATF3 in the injuredeye was of particular interest. ATF3 showed no change in expressionlevels at 3 h, but increased expression levels at 24 and 168 h– 3.60-and 2.13-fold, respectively (Pb0.005 in both cases). Therefore, ATF3expression was examined further by qRT-PCR, in situ hybridizationand immunolocalization.

expression in ONI retinas appeared sharply and significantly 18-fold upregulated incomparison to SO, CL, and CT retinas, in which ATF3 levels were not significantlydifferent from one another. After 168 h, ATF3 expression in ONI eyes had notsignificantly decreased compared to the 24h level of expression, remaining signif-icantly higher than the levels seen in the SO, CL, and CT retinas. For each bar in thegraph, N=3, and the variation is shown as SEM.

3.2. ATF3 expression analysis by quantitative RT-PCR

Two different qRT-PCR analyses were performed: one using RNAextracted from whole eyes (Fig. 1) and the other using RNA extractedfrom retina (Fig. 2). Quantitative RT-PCR performed using RNAextracted fromwhole eyes 3 h post-surgery revealed ATF3 expressionlevels to be significantly (P≤0.05) increased in eyes that hadundergone surgery (ONI and SO) relative to those that had not(control and contralateral). In contrast, there were no significantdifferences among any of the treatment groups (ONI, SO, control orcontralateral) at the same time point based on qRT-PCR performedusing retinal RNA.

In whole eye samples taken 24 h after ONI, ATF3 expression wasunchanged from the 3h samples, while ATF3 expression in the SOeyes had declined significantly (P≤0.05) compared to expression inSO eyes at 3 h (Fig. 1). However, because of variability among the24 h ONI eyes the approximately 3-fold difference between expres-sion levels in ONI relative to SO eyes was obscured. Levels of ATF3expression in CL and CT eyes were not significantly different fromeach other or their 3 h levels (Fig. 1). However, at 24 h ATF3expression appeared strongly and significantly upregulated in retinalONI samples (approximately 28-fold) in comparison to levels

Fig. 1. qRT-PCR for whole eyes. The Y-axis shows relative Ct values (CtATF3−CtL24);lower values indicate higher levels of gene expression. Three h after ONI or SO, ATF3expression in both the ONI and the SO eyes was significantly upregulated compared tothe CL and CT eyes, but was not significantly different between ONI and SO eyes. Thelargest increase in ATF3 gene expression was observed in ONI eyes at168h, where aroughly 16-fold, significant (Pb0.001) increase in expression was observed incomparison to SO, CL, and CT eyes. For each bar in the graph, N=3. For technicalreasons, N=2 at 3 and 24 h for the control; therefore, those data are not included in thegraph. However, the mean relative Ct value at 3 h was 7.6 and at 24 h was 7.3. Thevariation is shown as SEM (standard error of the mean).


observed in SO, CL, and CT retinas, which were not significantlydifferent from one another or from all groups at 3 h post-ONI (Fig. 2).

One week (168 h) after ONI, qRT-PCR showed ATF3 expressionfrom whole eyes of ONI fish to be at the highest levels of any of thethree time points, approximately 16 times higher than that found inSO, CL, CT. ATF3 levels in SO, CL and control eyes were not significantlydifferent from one another (Fig. 1). Similar results were seen inextracts from retinal samples where ATF3 expression in ONI retinaswas sharply up as compared to SO, CL, and CT retina (Fig. 2).Interestingly, at 168 h, ATF3 expression levels observed in retinalsamples were not statistically different from that seen in whole eyesamples (Figs. 1 and 2).

3.3. In situ hybridization and immunohistochemistry

ISH on sections of zebrafish retinas obtained 24 h post-ONI usingthe antisense probe revealed strong staining of RGC cytoplasm andthe nerve fiber layer, as compared to the sense probe (Fig. 3). The RGCaxons appeared myelinated (Fig. 3B and C), and most of the antisensereaction product appeared to be in the cytoplasm near the membraneof the myelinating cells (Fig. 3B). The intensity of the reaction productgenerated by the antisense probe obscured the transition between theaxon bundles and the perikaryon of the RGCs, and the reactionproduct also extended into the injured optic nerve (Fig. 3A).

Immunofluorescence staining indicated little or no presence of theATF3 protein in the cytoplasm of retinal ganglion cells from fish notsubjected to ONI (Fig. 4A). Twenty-four and 72 h after ONI, fluorescentlabeling due to anti-ATF3 was seen in the cytoplasm and nuclei ofRGCs in ONI retinas and to a slightly lesser extent in the respective CLretinas (Fig. 4C–F). Pixel intensity and statistical analysis of ATF3labelling indicated a doubling of staining intensity measured overwhole RGCs (nuclei and cytoplasm) 24 h after ONI, with no significantdifference between the ONI and CL retinas (Fig. 5A). A slight butsignificant drop in ATF3 staining intensitywas observed 72 h after ONI(as compared to 24 h), but again there was no significant differencebetween the ONI and CL retinas (Fig. 5A). However, the result wasstrikingly different when examining nuclei exclusive of cytoplasm. Incomparison to the whole cell results, nuclei observed in RGCs fromONI fish injured 24 h prior to immunolabeling showed about 40%more ATF3 labeling than any of the other categories, including the24 h CL retina. ATF3 staining in nuclei after ONI, in both the ONI and CLretinas was significantly more intense than that seen in uninjured(0h) fish. As seen in the whole cell analysis, nuclear labeling declined



Fig. 3. In situ hybridization of ATF3 probes. Micrographs showing results of in situ hybridization on cryosections of retina from ONI eyes fixed 24 h after injury. Panels A and B showlow magnification views of retina and optic nerve from antisense and sense probed tissue sections, respectively. In A, the retinal layers are keyed, where 1 is the nerve fiber layer, 2indicates the nuclei of the RGCs, 3 the inner plexiform layer, 4 the inner nuclear layer, 5 the outer nuclear layer, 6 the photoreceptors, 7 the RPE, and 8 the choroid. All images wereobtained at the same brightness and contrast settings using digital scanning microscopy. Comparison of results between the antisense and sense probes in the inner plexiform layerswas somewhat confounded ostensibly by endogenous phosphatases that may have caused false positive staining. However, in the nerve fiber layer (1) and in the optic nerve, densereaction product is apparent in panel A (antisense probe) and not apparent in panel B (sense probe) in the same locations. Panels C is an enlargement of the area indicated bythe yellow-outlined box in panel A, showing dense reaction product resulting from the antisense probe in the perikaryon areas of RGCs andwhat appear to bemyelinating cells in thebundled fiber layer. Because of the density of the reaction product, the boundary between RGC cytoplasm and the myelinating cells is obscured. Panel D is similar to C, except thesense probe was used. No reaction product resembling that seen in panel C is apparent. The calibration bars in C and D represent 40 µm.


ARTICLE IN PRESS

from 24 to 72 h after ONI, but remained significantly elevatedcompared to nuclei of RGCs from uninjured fish (Fig. 5B). In addition,ATF3 labeling was observed 24 h after injury in the injured optic

Fig. 4. Immunofluorescence localization of the ATF3 protein in RGCs. Each panel shows a porDAPI; the red indicates ATF3 antibody localization. Panel A shows a representative area fromATF3 present). Panels C and D show ATF3 localization 24 h after ONI in the RGC layer from Oand nuclei of RGCs, while the small arrows in C show labeling in the bundled axon layer.measurements and statistical analysis of these images.


nerve, but not in the CL uninjured nerve, in a similar pattern as seen byISH with the antisense probe for ATF3 (Fig. 6). Labeling wasparticularly strong in the nuclei and cytoplasm of cells resembling

tion of the RGC layer in a 1 µm thick optical section through nuclei. Blue staining is froma fish not subjected to ONI. Panel B shows the immunofluorescence control (no anti-

NI retina and CL retina, respectively. The large arrows indicate labeling in the cytoplasmPanels E and F are similar to C and D 72 h after ONI. See Fig. 5 for staining intensity



Fig. 5. Intensity analysis of immunofluorescent staining for the ATF3 protein. Stainingintensity was determined using the pixel intensity tool of the Fluoview Software for theOlympus FV1000 laser scanning confocal system. Panel A, RGCs from randomly selectedareas of two different sections for each category and time point were measured forwhole cell labeling using z projections of stacks containing ten 1.0 µm thick sections.Panel B, RGC nuclei were measured using single optical sections to avoid inclusion offluorescence from above or below the nuclei. N=15 for each category and time point.In both panels, the error bars indicate standard error of the mean. “⁎” indicates the 0 hvalue is significantly less than all the other categories. The 24 h CL and ONI values arenot different from each other, but are different from the 72h CL and ONI values (also notdifferent from one another). In panel B, the “⁎⁎” at 24 h indicates that ATF3 staining inthis group was significantly greater than in all other categories. No other significantdifferences were found.


ARTICLE IN PRESS

optic nerve astrocytes, as described by Macdonald et al. (1997),observed closest to the injury site (Fig. 6).

4. Discussion

In this studywe report 120 genes differentially regulated in responseto optic nerve injury. Our experimental design incorporated RNAextracted from the retinas of sham-operated fish to compare to RNAextracted from retinas of optic nerve injured fish.With this comparison,we attempted to eliminate “noise” from non-neuronal tissue repair andinflammatory responses, while emphasizing “signal” — gene responsesspecific to neural injury and regeneration. The time points of 3, 24, and168 h were chosen to capture early responders and then compareexpression profiles after one day and one week. Others have reportedregenerating axons first form terminal arbors in the brain at 7 days(Bernhardt et al., 1996).

Complementary DNA microarray analysis of retinal regeneration(Cameron et al., 2005) and optic nerve regeneration in zebrafish havebeen previously reported (Veldman et al., 2007). Veldman et al.(2007) used laser capturemicrodissection to examine changes in geneexpression in RGCs 3 days after optic nerve crush injury. Among the120 genes that we report here as being differentially regulated, only asmall minority (b20%) have been previously reported as beingassociated with nerve injury or repair. Many of these genes includecytoskeletal genes, e.g. various tubulin genes, expression of whichcould be related to axonal extension. Many more genes have been


described as being involved in development or differentiation in non-injury models, for example, baculoviral IAP repeat containing 5a, alsoknown as survivin. Work done by Delvaeye et al. (2009), indicates thatthis gene is expressed in retina during development, and knocking itdown results in both microcephaly and microphthalmia in zebrafishlarvae, implying that it is important in development of the centralnervous system. In mice, survivin is expressed in proliferating, but notquiescent cells (Adida et al., 1998) and by neural progenitor cells(Pennartz et al., 2004). In the context of our model, neural progenitorsare retained in the retina of fish throughout their whole lives (Fausettand Goldman, 2006) and may increase proliferative activity inresponse to optic nerve injury.

Numerous genes associated with phototransduction declined inexpression in the optic nerve injured fish relative to the sham-operated fish. For example, there were greater than 2-fold decreasesin expression of two, short wavelength opsins as well as rhodopsin inthe optic nerve injured eye at 168 h post-injury. Green-sensitive opsinhas been reported by Cameron et al. (2005) to decrease nearly 2-foldin fish which have sustained retinal injury; however, that down-regulation appears to be transient with expression levels recoveringto normal values by three days post-lesion. We found othercomponents of the visual signaling pathway were also expressed atlower levels in the optic nerve injured eye. The general decline ingenes associated with phototransduction may result from a decreasein the number of photoreceptors as a result of apoptosis or fromdecreased activity of the photoreceptors consequent to retrogradesignals or lack thereof. This conjecture requires further investigation.

Veldman et al. (2007) found ATF3 among many members of theCREB/ATF family upregulated following optic nerve crush. The presentstudy used RNA derived from retina and choroid as we wereinterested in the responses of all the cell types present, particularlyglia, to severing the optic nerve. Despite these differences inexperimental design, like Veldman et al. (2007), who reported aN20-fold increase in ATF3 expression, we saw higher expression levelsfor ATF3 in the retinas taken from injured fish.

We found ATF3 significantly upregulated in extracts from wholeONI and SO eyes 3 h after ONI or SO based on qRT-PCR analysis. Theamount of upregulation was not significantly different between ONIand SO, and both were significant in comparison to CL and CT eyes. Nosuch differences in ATF3 expression were seen in retina-only extracts.ATF3 is known to be induced by tissue injury or stress in a number ofdifferent cell types in addition to neurons (Hai et al., 1999); therefore,the differences we observed 3 h post-ONI between whole eye andretina-only are likely due to non-neuronal tissue injured during thesurgical procedure. This inference is supported by comparing the 3hlevels of ATF3 expression between the ONI and SO whole eyes (Fig. 1)and then to the same in the retinal samples (Fig. 2). At 24 h post-surgery, ATF3 expression levels in samples derived from sham-operated whole eye returned to levels not different from CL and CT(Fig. 1). However, 24h post-surgery retinal samples showed ATF3expression reaching the highest fold-change value recorded in thisstudy (Fig. 2). The sharp difference between results from whole eyeand retinal samples apparently results from an abrupt increasebetween 3 and 24 h in ATF3 expression in RGCs and possiblyassociated axonal glia (Fig. 3), an increase obscured by decreasingATF3 expression in non-retinal tissues in the whole eye preparations.This interpretation is reinforced by comparison of extracts 168 h afterONI, where ATF3 expression levels are not significantly differentbetween whole eye and retinal extracts in the ONI group, and bothremain significantly upregulated in comparison to the SO, CL, and CTgroups (Figs. 1 and 2).

ISH using the ATF3 antisense probe after ONI did not revealheightened ATF3 expression in any cell type in the retina other thanRGC cell bodies and cellular elements in the nerve fiber layer at 24(Fig. 3) or 168 h (not shown) after injury. The pattern of labeling inthe nerve fiber layer was reminiscent of internodal regions of



Fig. 6. ATF3 immunofluorescence in optic nerve 72 after ONI. Panel A shows a portion of the optic nerve injured 72 h prior to fixation and immunostained for ATF3 (red). The cut edgeis at the left, and the back of the eye is at right. The blue stain results from DAPI, showing the location of nuclei. The image is a projection of 20 optical sections, each 1 µm thick. Notethe apparent gradient of ATF3 expression, brightest at both ends and less bright in the center. The arrow indicates cytoplasmic and nuclear localization of ATF3 in what appears to bean optic nerve astrocyte. Labeling is more obvious in panel B, which is an image obtained at higher magnification. In panel B, many cells can be seen (examples indicated by arrows)with ATF3 staining in the cytoplasm and to a lesser extent in nuclei (pink spots due to colocalization with DAPI). Panel C shows the CL optic nerve from the same section fromwhichimages A and B were obtained. All three images were recorded and processed to maintain identical sensitivity and brightness settings.


ARTICLE IN PRESS

myelinated axons. Myelination of the intraretinal RGC axons inzebrafish has been attributed to oligodendrocytes and the myelindescribed as “loose” myelin (Schweitzer et al., 2007). In contrast, inmammals the majority of intraretinal RGC axons are unmyelinated(Perry and Lund, 1990). Our own examination of the inner retinausing transmission electron microscopy revealed many, but not all,RGC axons to be myelinated (data not shown). Optic tract oligoden-drocytes of fish have been reported to have many molecular andmorphological similarities to Schwann cells (Bastmeyer et al., 1994),and although the resolution of the ISH technique used in this studywas insufficient to be conclusive, it appears that the majority of theupregulated ATF3 expression in response to ONI at 24 h may haveoccurred in intraretinal oligodendrocytes, while after 168 h ATF3expression appeared most intense in the RGC cytoplasm (data notshown). Immunofluorescence results roughly mirrored resultsobtained by ISH in that intensity of labeling in the RGCs in retinasipsilateral to the injury site was significantly higher than in eithercontralateral retinas or retinas from uninjured fish. Furthermore,while both nuclei and cytoplasm were labeled, the contrast betweeninjured and uninjured was most striking in the nuclear labeling bothin the retina as well as in the optic nerve. The difference in the labelingof the optic nerve was particularly noteworthy as the nuclear labelingin that region indicates non-neuronal cells are expressing ATF3. Thecells labeled with anti-ATF3 appear to be astrocytes.

The ATF3 protein also has been found by immunohistochemicaltechniques in small numbers of cells in the optic nerve of rats aftercrush injury (Hunt et al., 2004). Upregulation of ATF3 mRNAtranscription in response to injury or other noxious stimuli has beenreported in many studies of mammalian neurons. ATF3 is a member ofthe ATF/CREB family and is a basic region-leucine zipper (bZip) DNA


binding protein that when phosphorylated by protein kinase A (PKA)can homodimerize or heterodimerize with related bZip proteins suchas JunB, JunC (a.k.a. c-Jun), JunD, ATF2, CREB2, and CHOP. Withrespect to initiation of transcription, the homodimer seems to act as arepressor, while the heterodimers appear to be activators (Hai andHartman, 2001). In a mouse model, constitutive over-expression ofATF3 was found to cause upregulation of Hsp27, c-Jun and SPRR1A inuninjured dorsal root ganglion (DRG) neurons (Seijffers et al., 2007).Hsp27 is a known downstream target of ATF3 in injured DRG neurons(Benn et al., 2002). SPRR1A is a small proline-rich protein upregulated~60-fold in DRG after peripheral (sciatic) nerve injury, and it has beenshown to colocalize with F-actin at the membrane in regeneratinggrowth cones (Bonilla et al., 2002). SPRR1A, c-Jun, and ATF3 allcontain functional AP-1 binding regions in their promoters (Cai et al.,2000), which can be recognized by heterodimers of ATF3/c-Jun,causing Seijffers et al. (2007) to speculate that c-Jun and ATF3 regulateeach other's production and synergize to enhance neurite outgrowthin regenerating peripheral nerve. Hsp27, c-Jun and SPRR1A were notrepresented on our microarray; however, qRT-PCR analysis of c-Junindicated a pattern of expression similar to that seen for ATF3. In otherwords, c-Jun levels in injured and uninjured retinas was the same at3 h post-surgery; however, at 24 and 168 h c-Jun levels weresignificantly higher in injured versus sham-operated retinas andwere significantly higher than they were at 3 h (data not shown).Veldman et al. (2007) also reported 10- to 20-fold upregulation ofc-Jun in RGCs taken from injured fish based on qRT-PCR analysis.Quantitative RT-PCR analysis was not performed for either Hsp27or SPRR1A.

In DRG neurons elevated cAMP levels act through PKA to allowneurites to overcome the myelin inhibitory factors and grow in the




ARTICLE IN PRESS

spinal cord after a dorsal column injury (Neumann et al., 2002; Qiuet al., 2002). As ATF3 is a CREB protein and is activated byphosphorylation by PKA, which in turn is activated by cAMP, onemight expect constitutive overexpression of ATF3 to promote spinalnerve regeneration after injury. However, Seijffers et al. (2007) foundthat while constitutive overexpression promotes regeneration ofperipheral nerves from the dorsal root ganglion (DRG), it does notovercome the inhibitory effects of CNS myelin in vitro or in vivo. Thisfinding leads to interesting questions about how a transcriptionfactor's effects are regionalized within a single cell and suggest thatdownstream signaling elements are key determinants of success inregeneration. By the same token, the upregulation of ATF3 has beenobserved in bothmammalian retinas and optic nerves as well as thoseof fish, hinting that other differences, for example in the genes thatATF3 activates, must account for the differential ability of animals toregenerate the optic nerve.

Future studies will be directed at further elucidation of the role ofcAMP in neurons and astrocytes of regenerating nerve tissue, both infish andmammalian models. We have evidence that cAMP is involvedin initiation of the reactive state in vitro in F98 cells, a rat astrocytomacell line used extensively for studies of reactive astrocytosis (Malhotraet al., 1995; Boran and Garcia, 2007; Ramsey et al., 2005). In vivo, ithas been found that cAMP levels normally fall in neurons after axonalinjury (axotomy, contusion), and experimental elevation of cAMP byinhibition of phosphodiesterase and injection of dbcAMP can result inaxonal regrowth and functional recovery in mice (Pearse et al., 2004).Understanding differences between mammals and fish as well as invitro and in vivomodels could pave the way for enhancing recovery offunction in injured patients.

Acknowledgements

The authors wish to acknowledge the patient help with statisticalanalysis of the results provided by Dr. Jeff Landgraf at Michigan StateUniversity (microarray) and Dr. Floyd Weckerly at Texas StateUniversity-San Marcos (microarray and qRT-PCR). Technical assis-tance with qRT-PCR by Dr. Angela Archer formerly at Eppendorf isalso gratefully acknowledged. We acknowledge Dr. Nihal Dharmasirifor use of his dissecting scope and digital camera and Dr. Tim Raabefor his assistance with experimental design, and Mayuri Patel,Amanda Mosier and John Miller for assisting with the surgeries. Wethank Ayme Cardwell for her efforts in immunohistochemistry. Thisstudy was supported by NSF grants IOB-0615762 to DMG and DBI-0821252 to JRK and DMG, a Texas State Research EnhancementAward to JRK, and funds from the Department of Biology and Collegeof Science at Texas State University-San Marcos.

References

Adida, C., Crotty, P.L., McGrath, J., Berrebi, D., Diebold, J., Altieri, D.C., 1998.Developmentally regulated expression of the novel cancer anti-apoptosis genesurvivin in human and mouse differentiation. Am. J. Pathol. 152, 43–49.

Attardi, D.G., Sperry, R.W., 1963. Preferential selection of central pathways byregenerating optic fibers. Exp. Neurol. 7, 46–64.

Bastmeyer, M., Jeserich, G., Stuermer, C.A., 1994. Similarities and differences betweenfish oligodendrocytes and Schwann cells in vitro. Glia 11, 300–314.

Beisvag, V., Junge, F.K., Bergum, H., Jolsum, L., Lydersen, S., Gunther, C.C., Ramampiaro,H., Langaas, M., Sandvik, A.K., Laegreid, A., 2006. GeneTools–application forfunctional annotation and statistical hypothesis testing. BMC Bioinformatics 7, 470.

Benn, S.C., Perrelet, D., Kato, A.C., Scholz, J., Decosterd, I., Mannion, R.J., Bakowska, J.C.,Woolf, C.J., 2002. Hsp27 upregulation and phosphorylation is required for injuredsensory and motor neuron survival. Neuron 36, 45–56.

Bernhardt, R., 1989. Axonal pathfinding during the regeneration of the goldfish opticpathway. J. Comp. Neurol. 284, 119–134.

Bernhardt, R.R., Tongiorgi, E., Anzini, P., Schachner, M., 1996. Increased expression ofspecific recognition molecules by retinal ganglion cells and by optic pathway gliaaccompanies the successful regeneration of retinal axons in adult zebrafish.J. Comp. Neurol. 376, 253–264.

Bernhardt, R.R., 1999. Cellular and molecular bases of axonal regeneration in the fishcentral nervous system. Exp. Neurol. 157, 223–240.


Bonilla, I.E., Tanabe, K., Strittmatter, S.M., 2002. Small proline-rich repeat protein 1A isexpressed by axotomized neurons and promotes axonal outgrowth. J. Neurosci. 22,1303–1315.

Boran, M.S., Garcia, A., 2007. The cyclic GMP-protein kinase G pathway regulatescytoskeleton dynamics and motility in astrocytes. J. Neurochem. 102, 216–230.

Braissant, O., Wahli, W., 1998. Differential expression of peroxisome proliferator-activated receptor-alpha, -beta, and -gamma during rat embryonic development.Endocrinology 139, 2748–2754.

Cai, Y., Zhang, C., Nawa, T., Aso, T., Tanaka, M., Oshiro, S., Ichijo, H., Kitajima, S., 2000.Homocysteine-responsive ATF3 gene expression in human vascular endothelialcells: activation of c-Jun NH(2)-terminal kinase and promoter response element.Blood 96, 2140–2148.

Cameron, D.A., Gentile, K.L., Middleton, F.A., Yurco, P., 2005. Gene expression profiles ofintact and regenerating zebrafish retina. Mol. Vis. 11, 775–791.

Cao, Y., Shumsky, J.S., Sabol, M.A., Kushner, R.A., Strittmatter, S., Hamers, F.P., Lee, D.H.,Rabacchi, S.A., Murray, M., 2008. Nogo-66 Receptor Antagonist Peptide (NEP1–40)Administration Promotes Functional Recovery and Axonal Growth After LateralFuniculus Injury in the Adult Rat. Neurorehabil. Neural Repair 22, 262–278.

Chen, D.F., Schneider, G.E., Martinou, J.C., Tonegawa, S., 1997. Bcl-2 promotesregeneration of severed axons in mammalian CNS. Nature 385, 434–439.

Chiang, T.S., Thomas, R.P., 1972. Consensual ocular hypertensive response toprostaglandin. Invest. Ophthalmol. 11, 169–176.

Cho, K.S., Chen, D.F., 2008. Promoting optic nerve regeneration in adult mice withpharmaceutical approach. Neurochem. Res.

Cho, K.S., Yang, L., Lu, B., Feng Ma, H., Huang, X., Pekny, M., Chen, D.F., 2005. Re-establishing the regenerative potential of central nervous system axons inpostnatal mice. J. Cell Sci. 118, 863–872.

Delvaeye, M., De Vriese, A., Zwerts, F., Betz, I., Moons, M., Autiero, M., Conway, E.M.,2009. Role of the 2 zebrafish survivin genes in vasculo-angiogenesis, neurogenesis,cardiogenesis and hematopoiesis. BMC Dev. Biol. 9, 25.

Ettl, A.K., Holzschuh, J., Driever, W., 2006. The zebrafish mutation m865 affectsformation of dopaminergic neurons and neuronal survival, and maps to a geneticinterval containing the sepiapterin reductase locus. Anat. Embryol. (Berl.) 211(Suppl 1), 73–86.

Fausett, B.V., Goldman, D., 2006. A role for alpha1 tubulin-expressing Muller glia inregeneration of the injured zebrafish retina. J. Neurosci. 26, 6303–6313.

Garcia, D.M., Koke, J.R., 2009. Astrocytes as gate-keepers in optic nerve regeneration— amini-review. Comp. Biochem. Physiol. A 152, 135–13810.1016/j.cbpa.2008.09.026.

Goldberg, J.L., Barres, B.A., 2000. The relationship between neuronal survival andregeneration. Annu. Rev. Neurosci. 23, 579–612.

Goldberg, J.L., Espinosa, J.S., Xu, Y., Davidson, N., Kovacs, G.T., Barres, B.A., 2002a. Retinalganglion cells do not extend axons by default: promotion by neurotrophic signalingand electrical activity. Neuron 33, 689–702.

Goldberg, J.L., Klassen, M.P., Hua, Y., Barres, B.A., 2002b. Amacrine-signaled loss ofintrinsic axon growth ability by retinal ganglion cells. Science 296, 1860–1864.

Groszer, M., Erickson, R., Scripture-Adams, D.D., Dougherty, J.D., Le Belle, J., Zack, J.A.,Geschwind, D.H., Liu, X., Kornblum, H.I., Wu, H., 2006. PTEN negatively regulatesneural stem cell self-renewal by modulating G0–G1 cell cycle entry. Proc. Natl.Acad. Sci. U. S. A. 103, 111–116.

Gulati-Leekha, A., Goldman, D., 2006. A reporter-assisted mutagenesis screen usingalpha 1-tubulin-GFP transgenic zebrafish uncovers missteps during neuronaldevelopment and axonogenesis. Dev. Biol. 296, 29–47.

Hai, T., Hartman, M.G., 2001. The molecular biology and nomenclature of the activatingtranscription factor/cAMP responsive element binding family of transcriptionfactors: activating transcription factor proteins and homeostasis. Gene 273, 1–11.

Hai, T., Wolfgang, C.D., Marsee, D.K., Allen, A.E., Sivaprasad, U., 1999. ATF3 and stressresponses. Gene Expr. 7, 321–335.

Hannila, S.S., Filbin, M.T., 2008. The role of cyclic AMP signaling in promoting axonalregeneration after spinal cord injury. Exp. Neurol. 209, 321–332.

Hu, X., Pandolfi, P.P., Li, Y., Koutcher, J.A., Rosenblum, M., Holland, E.C., 2005. mTORpromotes survival and astrocytic characteristics induced by Pten/AKT signaling inglioblastoma. Neoplasia 7, 356–368.

Hunt, D., Hossain-Ibrahim, K., Mason, M.R., Coffin, R.S., Lieberman, A.R., Winterbottom, J.,Anderson, P.N., 2004. ATF3 upregulation in glia during Wallerian degeneration:differential expression in peripheral nerves and CNSwhitematter. BMCNeurosci. 5, 9.

Liu, Q., Londraville, R.L., 2003. Using the adult zebrafish visual system to study cadherin-2 expression during central nervous system regeneration. Methods Cell Sci. 25,71–78.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408.

Macdonald, R., Scholes, J., Strahle, U., Brennan, C., Holder, N., Brand, M., Wilson, S.W.,1997. The Pax protein Noi is required for commissural axon pathway formation inthe rostral forebrain. Development 124, 2397–2408.

Malhotra, S.K., Bhatnagar, R., Shnitka, T.K., Herrera, J.J., Koke, J.R., Singh, M.V., 1995. Ratglioma cell line as a model for astrogliosis. Cytobios 82, 39–51.

Matsuura, I., Taniguchi, J., Hata, K., Saeki, N., Yamashita, T., 2008. BMP inhibitionenhances axonal growth and functional recovery after spinal cord injury.J. Neurochem. 105, 1471–1479.

McWhorter, M.L., Boon, K.L., Horan, E.S., Burghes, A.H., Beattie, C.E., 2008. The SMNbinding protein Gemin2 is not involved in motor axon outgrowth. Dev. Neurobiol.68, 182–194.

Muller, A., Hauk, T.G., Fischer, D., 2007. Astrocyte-derived CNTF switches mature RGCsto a regenerative state following inflammatory stimulation. Brain 130, 3308–3320.

Neumann, S., Bradke, F., Tessier-Lavigne, M., Basbaum, A.I., 2002. Regeneration ofsensory axons within the injured spinal cord induced by intraganglionic cAMPelevation. Neuron 34, 885–893.




ARTICLE IN PRESS

Park, K.K., Liu, K., Hu, Y., Smith, P.D., Wang, C., Cai, B., Xu, B., Connolly, L., Kramvis, L.,Sahin, M., He, Z., 2008. Promoting axon regeneration in the adult CNS bymodulation of the PTEN/mTOR pathway. Science 322, 963–966.

Pearse, D.D., Pereira, F.C., Marcillo, A.E., Bates, M.L., Berrocal, Y.A., Filbin, M.T., Bunge, M.B.,2004. cAMP and Schwann cells promote axonal growth and functional recovery afterspinal cord injury. Nat. Med. 10, 610–616.

Pennartz, S., Belvindrah, R., Tomiuk, S., Zimmer, C., Hofmann, K., Conradt, M., Bosio, A.,Cremer, H., 2004. Purification of neuronal precursors from the adult mouse brain:comprehensive gene expression analysis provides new insights into the control ofcell migration, differentiation, and homeostasis. Mol. Cell. Neurosci. 25, 692–706.

Perry, V.H., Lund, R.D., 1990. Evidence that the lamina cribrosa prevents intraretinalmyelination of retinal ganglion cell axons. J. Neurocytol. 19, 265–272.

Purdey, M., 2001. Does an ultra violet photooxidation of the manganese-loaded/copper-depleted prion protein in the retina initiate the pathogenesis of TSE? Med.Hypotheses 57, 29–45.

Qiu, J., Cai, D., Dai, H., McAtee, M., Hoffman, P.N., Bregman, B.S., Filbin, M.T., 2002. Spinalaxon regeneration induced by elevation of cyclic AMP. Neuron 34, 895–903.

Ramsey, G., García, D.M., Koke, J.R., 2005. Is reactive astrogliosis regulated by a cAMP-dependent CaMK pathway? FASEB J. 19 Abstract 680.13.

Raymond, P.A., Barthel, L.K., Bernardos, R.L., Perkowski, J.J., 2006. Molecular character-ization of retinal stem cells and their niches in adult zebrafish. BMC Dev. Biol. 6, 36.

Ries, A., Goldberg, J.L., Grimpe, B., 2007. A novel biological function for CD44 in axongrowth of retinal ganglion cells identified by a bioinformatics approach.J. Neurochem. 103, 1491–1505.


Saito, H., Dahlin, L.B., 2008. Expression of ATF3 and axonal outgrowth are impaired afterdelayed nerve repair. BMC Neurosci. 9, 88.

Schonthaler, H.B., Lampert, J.M., Isken, A., Rinner, O., Mader, A., Gesemann, M.,Oberhauser, V., Golczak, M., Biehlmaier, O., Palczewski, K., Neuhauss, S.C., vonLintig, J., 2007. Evidence for RPE65-independent vision in the cone-dominatedzebrafish retina. Eur. J. NeuroSci. 26, 1940–1949.

Schweitzer, J., Gimnopoulos, D., Lieberoth, B.C., Pogoda, H.M., Feldner, J., Ebert, A.,Schachner, M., Becker, T., Becker, C.G., 2007. Contactin1a expression is associatedwith oligodendrocyte differentiation and axonal regeneration in the centralnervous system of zebrafish. Mol. Cell. Neurosci. 35, 194–207.

Seijffers, R., Mills, C.D., Woolf, C.J., 2007. ATF3 increases the intrinsic growth state ofDRG neurons to enhance peripheral nerve regeneration. J. Neurosci. 27, 7911–7920.

Senut, M.C., Gulati-Leekha, A., Goldman, D., 2004. An element in the alpha1-tubulinpromoter is necessary for retinal expression during optic nerve regeneration butnot after eye injury in the adult zebrafish. J. Neurosci. 24, 7663–7673.

Veldman, M.B., Bemben, M.A., Thompson, R.C., Goldman, D., 2007. Gene expressionanalysis of zebrafish retinal ganglion cells during optic nerve regenerationidentifies KLF6a and KLF7a as important regulators of axon regeneration. Dev.Biol. 312, 596–612.

Wu, D., Huang,W., Richardson, P.M., Priestley, J.V., Liu, M., 2008. TRPC4 in rat dorsal rootganglion neurons is increased after nerve injury and is necessary for neuriteoutgrowth. J. Biol. Chem. 283, 416–426.



Documents

(ATF3) expression in the neural retina and optic nerve of zebrafish