(CANCER RESEARCH 58. 5406-5410, December I. 1998]

Attenuation of Telomerase Activity by a Hammerhead Ribozyme Targeting theTemplate Region of Telomerase RNA in Endometrial Carcinoma CellsYasuhiro Yokoyama,1 Yuichiro Takahashi, Ariyoshi Shinohara, Zenglin Lian, Xiaoyun Wan, Kenji Niwa, and

Teruhiko Tamaya

Department of Obstetrics timi Gvnecologv, Gifu Universit\ School of Medicine. Gifit, Gif»500. Japan

ABSTRACT

Telomerase activity is found in almost all carcinoma cells but not inmost somatic cells, suggesting that telomerase is an excellent target forcancer therapy. We designed hammerhead ribozymes against humantelomerase RNA and studied their possible use as a tool for cancertherapy. Three ribozymes targeting the 3' end of the GUC sequence at33-35 (the template region), 168-170, and 313-315 from the 5' end of

telomera.se RNA were designed. In a cell-free system, these three ham

merhead ribozymes efficiently cleaved the RNA substrate. When theseribozyme RNAs were introduced into Ishikawa cells, which are endome-

trial carcinoma cells, only a ribozyme targeting the RNA template regioncould diminish the telomerase activity. Next we subcloned the ribozymesequence into an expression vector and introduced this into AN3CA cells,which are endometrial carcinoma cells. The clones that were obtainedshowed reduced telomerase activity and telomerase RNA with expressionof the ribozyme. These data suggest that the ribozyme against the RNAtemplate region is a good tool to repress telomerase activity in cancer cells.

INTRODUCTION

Telomerase is a ribonucleoprotein believed to play a role in cellularsenescence and immortalization (1-3). It synthesizes telomeric DNAwith a template ot" its integral RNA and prevents the telomere from

shortening (4). Telomerase activity has been determined in varioustissues and cells during the past years, and it has been shown that mostcancer cells, germ cell lines, and some somatic cells express telomerase activity, and that most somatic cells do not (5). Normal somaticcells lose telomerase activity in the early stage of embryogenesis (6),and the restoration of telomerase activity is currently considered toimmortalize cells and also to be a significant step in the carcinogen-

esis of cells. The specificity of telomerase in cancer cells suggests thatit could be a good target for cancer therapy. To date, only an agent thatinduces cellular differentiation, such as retinoids, has been reported toreduce telomerase activity in some carcinoma cell lines (7-9).

Telomerase is composed of a RNA molecule and the associatedproteins (10). Telomerase RNA functions as a template for the extension of the telomeric repeat, and protein components function intelomere DNA recognition and binding and RNA binding and catalysis. Therefore, telomerase RNA is an essential molecule for telomerase to exert its action (11).

Hammerhead ribozymes are catalytic RNA molecules. They arebeing increasingly considered and used as human gene therapeuticagents for human malignancies (12, 13). The ribozymes used as genetherapeutic agents are, in most cases, /raii.v-acting hammerhead ri

bozymes based on the model of Haseloff and Gerlach (14). Thehammerhead ribozymes consist of a catalytic core and flanking anti-

sense sequences. The antisense sequence of the ribozymes functionsin the recognition of target sites of the RNA molecules. These sequences may carry out additional action by the ribozymes in targeting

Received 5/1/98: accepted 10/5/98.The cosls of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

1To whom requests for reprints should be addressed, at Department of Obstetrics and

Gynecology. Gifu University School of Medicine. 40 Tsukasa-machi. Gifu. Gifu 500-8076. Japan. Phone: 81-58-267-26.11: Fax: 81-58-265-9006.

some types of RNA sequences, such as telomerase RNA. Ribozymesmay surpass the efficiency of the antisense oligonucleotide in suchcases. In the present study, we designed hammerhead ribozymesagainst telomerase RNA and studied the possibility of using theribozymes to suppress telomerase activity in cancer cells.

MATERIALS AND METHODS

Cell Culture. Endometrial carcinoma cell lines Ishikawa and AN3CA wereused in this study. Ishikawa cells were a kind gift from Dr. Másalo Nishida(Tsukuba University School of Medicine, Tsukuba, Japan; Ret'. 15). AN3CA

cells were purchased from the American Type Culture Collection. All cell lineswere maintained in Eagle's MEM supplemented with 10% fetal bovine serum

under an atmosphere of 95% ainSVr CO, at 37°C.

In Vitro Cleavage Reaction by Ribozymes. Because hammerhead ribozymes recognize a GUC sequence and cleave it most efficiently, attemptswere made to determine whether the GUC sequence is located within telomerase RNA and which GUC sequence could be eligible. There are 14 GUCsequences within the approximately 450-base length of the RNA. Considering

the complementarity between the upstream and downstream sequences fromeach GUC, we chose three sites (34-36. 168-170, and 313-315 from the 5'

end of telomerase RNA) as target sites. The target site of the ribozymes isshown in Fig. 1. The ribozymes were named 36-, 170-, and 315-ribozyme afterthe cleavage sites from the 5' end of the RNA.

The bacteriophage T7 RNA polymerase system was used to produce theribozymes. A set of oligomers was designed to make the DNA template. Oneprimer contained a T7 RNA polymerase promoter sequence followed by the 5'

half of the ribozyme sequence; the other primer contained the antisensesequence of the ribozyme. Seventeen nucleotides from the 3' end of both

primers were complementary to each other.The primers used for each ribozyme were as follows: (a) 36-ribozyme,

5'-GGATCCTAATACGACTCACTATAGGTTAGGGTTACTGATGA and5'-ATlTTlTGTTTCGTCCTCACGGACTCATCAGTAACCCTAAC; (b)170-ribozyme, S'-GGATCCTAATACGACTCACTATAGGCCAGCAGCTC-TGATGA and S'-AAAAAATGTTTCGTCCTCACGGACTCATCAGAG-CTGCTGGC; and (c) 315-ribozyme, 5'-GGATCCTAATACGACTCACTAT-AGGCCCCCGAGACTGATGA and 5'-GCCGCGGGTTTCGTCCTCACG-

GACTCATCAGTCTCGGGGGC.The primers were mixed to form a hemiduplex, and a PCR amplification of

25 cycles was performed at 94°Cfor 1 min, 40°Cfor 1 min, and 72°Cfor 1

min. Unincorporated deoxynucleotide triphosphate was eliminated with aSephadex G25 Quick Spin Column (Boehringer Mannheim, Tokyo. Japan).The transcription ot" RNA from the synthetic DNA template was carried out

using a T7-MEGAshortscript kit (Ambion, Inc.. Austin, TX). The transcriptionreaction mixture contained 500 ng of template DNA. 40 mM Tris-HCl (pH 7.5),

6 HIMMgCI2, 10 mM NaCl, 2 mM spermidine, 10 mM DTT, 30 /UMnucleotidetriphosphate, 1 unit//xl recombinant RNase inhibitor, and 1.0 unit//j.l T7 RNApolymerase in a 20-/J.I volume. The reaction was carried out at 37°Cfor 2 h.

The reaction mixture was treated with RNase-free DNase. followed by phenol-

chloroform extraction and ammonium acetate ethanol precipitation.Plasmid pGEM83 was prepared to produce the RNA substrate mimic of

telomerase RNA. pGEM83, in which almost the full length of the cDNA oftelomerase RNA was inserted, was kindly provided by Dr. Bryant Villeponteau(Geron Corp., Menlo Park, CA). pGEM83 was digested with Sail (BoehringerMannheim). The transcription of RNA from plasmid templates was carried outusing MAXscript in viiru transcription kits (Ambion. Inc.). The transcriptionreaction mixture contained 1 /j.g of linearized plasmid DNA: 0.5 unit/ml SP6RNA polymerase; 40 mM Tris-HCl (pH 7.5): 6 mM MgCI2; 10 mM NaCl: 2 mM

spermidine: 10 mM DTT: 0.5 mM ATP, GTP, and UTP: O.I mM CTP; 50 ßCi

5406

on March 1, 2021. © 1998 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

RIBOZYME AGAINST TELOMERASE RNA

Telomerase RNA component ~450

base

ribozymeribozyme

315-

ribozyme

Fig. I. Target sites of three ribozymes. Three ribozymes were designed to largeldifferent sites in 450-base-long telomerase RNA. The ribozymes were named after thecleavage site from Ine 5' end of the RNA.

of [a-'2P]CTP (specific activity, 800 Ci/mmol: DuPom. Inc., Wilmington.

DE); and I unit/ml recombinant RNase inhibitor in a 100-jul volume. Thereaction was carried out at 37°Cfor 1 h. The reaction mixture was treated with

RNase-free DNase, followed by phenol-chloroform extraction and ammonium

acetate ethanol precipitation. The transcript was 601 bases long.The ribozyme and substrate RNA (molar ratio. 5:1) were mixed in a 10-^d

reaction volume containing 50 mM Tris-HCl (pH 7.5) and 1 niM EDTA. Themixture was heated at 95°Cfor 2 min and cooled quickly on ice, and MgCKwas added at a final concentration of 10 mM and then incubated at 37°Cfor 3 h.

The reactions were stopped by the addition of an equal volume of stop solution(95% formamide. 25 mM EDTA, 0.05% bromphenol blue, and 0.05% xylenecyanol) and heated at 65°C for 5 min. The reaction mixture was electro-

phoresed in a 6% polyacrylamide-7 M urea gel in Tris-borate EDTA buffer.

The reaction was analyzed by autoradiography.Introduction of Ribozymes into Ishikawa Cells. Ishikawa cells (5 x IO4)

were seeded in a 6-well plate and incubated for 2 days. The medium wasreplaced with serum-free DMEM. Ribozymes were synthesized using theT7-MEGAshortscript kit (Ambion. Inc.) as described above.

The ribozyme (15 jig) was mixed with 15 ;ul of DOTAP2 (Boehringer

Mannheim) in a total volume of 75 /J.1of HEPES buffer [20 mM (pH 7.4)] andincubated for 15 min at room temperature. The mixture was suspended in 2.0ml of DMEM. Cells were exposed to the ribozyme/DOTAP mixture every12 h.

Cells were harvested at 24 and 48 h after the first exposure to the ribozymeand submitted to the telomerase detection assay.

Construction of the Ribozyme Expression Vector and Transfection.Two single-stranded oligodeoxynucleotides were synthesized such that the45-bp ribozyme contained flanking Sail and Hindttl restriction sites on bothends (S'-TCGACGTTAGGGTTACTGATGAGTCCGTGAGGACGAAACA-AAAAATGA and S'-AGCTTCATTTTTTGTTTCGTCCTCACGGACTCA-TCAGTAACCCTAACG). The oligonucleotides were 5' phosphorylated by

T4 polynucleotide kinase (New England Biolabs, Inc., Beverly, MA), annealed, and cloned into pHßAPr-1-neo (16). The sequence and orientation of

the ribozyme in the vector were confirmed by DNA sequencing with asequence primer (5'-GACCAGTGTTrGCCTTTTA-3') designed from the sequences in the 5' untranslated region of ß-actin.The constructed vector was

designated pHßAPr-l-neo-36RZ.Lipofection of Ishikawa cells and AN3CA cells with pHßAPr-1-neo-36RZ

or pHßAPr-1-neo was performed according to the protocol recommended bythe manufacturer (Life Technologies, Inc.). In brief, approximately 5 X IO4

cells were transfected with 10 /¿gof vector DNA that had been complexed with50 /j,l of Lipofectin (Life Technologies, Inc.). Three days after transfection,G418 was added to the medium to a final concentration of 1 mg/ml. Thetransfected cells were exposed to G4I8 for 4 weeks.

RT-PCR and Southern Blot Analysis for Ribozyme Expression. Total

RNA was extracted from the transtectants and parental AN3CA cells using

2 The abbreviations used are: DOTAP, N-[l-(2,3-dioleoyloxyl)propyl]-/V,/V./V-trimeth-

ylammoniummethyl sulfate; RT-PCR. reverse transcription-PCR: TRF. telomere repeatfragment; TRAP. Telomerie repeat amplification protocol.

Isogene (Nippon Gene. Inc.. Tokyo. Japan). Total RNA (500 ng) from eachtransfectant was reverse-transcribed with a random hexamer. followed by PCRusing two primers, 5'-AGCACAGAGCCTCGCCTTT (from the ß-actin5'untranslated region) and 5'-TGGATCCCTCGAAGCTT (from a plasmid

polylinker). The cycling conditions were 94°Cfor 30 s, 47°Cfor 30 s, and72°Cfor I min for 25 cycles. PCR products were electrophoresed on a 1.5%

agarose gel and mounted on a nylon membrane by capillary transfer. Themembrane containing an amplified 119-bp DNA was hybridized using a32P-labeled probe that was complementary to the conserved catalytic sequences of the ribozyme (5'-CCTCACGGACTCATCAG). The labeling of the

oligomer was carried out by T4 polynucleotide kinase (Toyobo. Inc.. Tokyo.Japan) and [y-'2P]ATP (DuPont, Inc.).

Northern Blotting of Telomerase RNA Expression in Transfcctants.Total RNA was extracted with Isogene (Nippon Gene, Inc.). Total RNA (20/j.g) was loaded on a 1.0% agarose/formaldehyde gel. electrophoresed. andthen mounted on a nylon membrane by capillary transfer. Northern blottingwas carried out using the cDNA of telomerase RNA inserted in pGRN83 andglyceraldehyde-3-phosphate dehydrogenase cDNA (Clontech Laboratories.

Inc.. Palo Alto, CA).Telomerase Detection Assay. Cultured cells were washed once with PBS

and scraped into a buffer [10 mM HEPES-KOH (pH 7.5). 1.5 mM MgCK. 10

mM KCI, and 1 mM DTT]. The cells were washed in the buffer, homogenizedin 200 /U.1of a cell lysis buffer [10 mM Tris-HCl (pH 7.5). 1 mM MgCK. 1 HIMEGTA. 0.1 mM benzamidine, 5 m.Mß-mercaptoethanol. 0.5% 3-[(3-cholami-dopropyl)dimethylammonio]-l-propanesulfonic acid (WAKO Chemical In

dustries, Inc.. Osaka. Japan), and 10% glycerol|. and incubated on ice for 30min. Cell homogenates were then centrifuged at 12.000 X g for 20 min at 4°C.

The supernatant was recovered and snap-frozen in liquid nitrogen and stored at—80°C.The concentration of protein was measured with protein assay dye

(Bio-Rad Laboratories, Hercules. CA).

The TRAP assay was performed using a TRAP£Z£telomerase detection kit(Oncor, Inc.. Gaithersburg, MD). In brief, 2 n\ of tissue extract and 48 jil ofTRAP reaction mixture consisting of 5' end-labeled TS primer (5'-AATC-CGTCGAGCAGAGTT) with [-y-'2P]ATP, 50 JIM deoxynucleotide triphos-

phate mix, a TRAP primer mix (RP primer, Kl primer, and TSK1 template),and 2 IU of Taq DNA polymerase in 20 mM Tris-HCl (pH 8.3). 1.5 mM MgCl,,

63 mM KCI. 1 mM EGTA, 0.05% Tween 20. and 0.01% BSA were mixed andincubated at 30°Cfor 30 min. PCR was then performed at 94°Cfor 30 s and60°Cfor 30 s for 25 cycles. The PCR products were electrophoresed in a 12%

acrylamide gel and autoradiographed.Telomere Length Estimation. Genomic DNA was isolated from cells with

RapidPrep genomic DNA isolation kits (Pharmacia-Biotech, Inc.. Uppsala.

Sweden) and digested with Hinfl restriction enzyme (Boehringer Mannheim).DNA (10 /¿g)was loaded on a 0.6% agarose gel and electrophoresed. It wasmounted on a nylon membrane by capillary transfer and hybridized with(TTAGGG)6 oligonucleotide that was 5' end-labeled with [7-'2P]ATP.

RESULTS

Three kinds of hammerhead ribozymes were designed to target theGUC sequences in telomerase RNA, based on the model proposed byHaselof'f and Gerlach (14). The structure of 36-ribozyme is shown in

Fig. 2. Ribozymes (44 bases long) were transcribed with T7 RNApolymerase according to previously published procedures (17). First,we studied whether the three kinds of ribozymes could cleave theRNA substrate efficiently in a cell-free system. A '~P-labeled RNA

substrate ol 601 bases in length was made with SP6 RNA polymerase.This substrate and the ribozymes were mixed at a molar ratio of 1:5,and a cleavage reaction was then observed. As shown in Fig. 3, all ofthe hammerhead ribozymes efficiently cleaved the 601-base telomerase RNA substrate (Fig. 3). The 36-ribozyme, 170-ribozyme, and315-ribozyme cleaved it into 521- and 80-base fragments, 214- and387-base fragments, and 302- and 299-base fragments, respectively.

The cleaved fragments were the correct sizes, as predicted from thelocation of the cleavage site of the ribozyme.

Next we introduced the ribozymes themselves into cndometrialcarcinoma Ishikawa cells. Because ribozymes are considered to be

5407

on March 1, 2021. © 1998 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

RIBOZYME AGAINST TELOMERASE RNA

Cleavage

GCCAUUUUUUGUCUAACCCUAACUGAG •GUAAAAAACA AUUGGGAUUG

G •C

GU

Fig. 2. Structure of the 36-ribo/yme. The 20-mer an tisense sequences against the target

region were placed upstream and downstream of the catalytic core of the riho/yme. Thecleavage site is localized in the RNA template region, which is underlined.

RNA substrate601 b

31517036RZ RZ RZ

i...f

3' erase activity in transfectants was simply due to the clonal divergence,

we included pooled clones of the vector transfectants and the ri-

bozyme transfectants. As shown in Fig. 5, most clones showed anapparently reduced telomerase activity compared with that of thevector transfectant control and parental AN3CA cells. In some clones(clones 5, 9, and 10), telomerase activity was almost undetectable.Five of 10 clones (clones 5, 7, 8, 9, and 10) in which the telomeraseactivity was diminished to a variable extent were further studied forexpression of the ribozyme and telomerase RNA. To study the expression of the ribozyme, RT-PCR and Southern blot analysis were

performed. Ribozyme expression was found in all of the transfectantswith pHßAPr-1-neo-36RZ and its pooled clone (Fig. 6), implying that

ribozyme RNA was successfully expressed in these clones, althoughthe expression level differed in the clones.

The expression of telomerase RNA in the transfectants was analyzed by Northern blotting. The telomerase RNA expression of thevector transfectants was unchanged when compared with that of theparental AN3CA cells. Transfectants with pHßAPr-l-neo-36RZ and

its pooled clone clearly reduced the level of telomerase RNA (Fig. 6).The reduction level roughly inversely paralleled the expression levelof the ribozyme. This suggested that the reduced telomerase activitywas associated with the reduction of the telomerase RNA expression

521 C DOTAR 36RZ 170RZ 315RZ

2448 2448 2448 2448 2448 hrs.

302.299-

387

214

•*- 80

Fig. 3. In vitro cleavage reaction. The riho/.ymes and substrale RNA were mixed andincubated for 3 h. All three ribozymes cleaved the RNA substrate, which was 601 baseslong. RZ, ribozyme.

is

í-if.4. Ribo/vme RNA was introduced into Ishikawa cells. Note that the 36-rihozyme

diminished telomerase activity most efficiently in 48 h. C control: ÃœOTAP.DOTAP(liposome) only; RZ. ribozyme; AV.internal standard.

unstable in medium supplemented with fetal bovine serum, a serum-

free medium was used. The ribozymes were mixed with cationicliposome and then introduced into the endometrial carcinoma cells. At48 h after the first administration of ribozymes, telomerase activitywas diminished most significantly in the cells in which 36-ribozymewas introduced (Fig. 4). It was thus concluded that 36-ribozyme was

the most promising in the transfection study.We subcloned the 36-ribozyme sequence into pHßAPr-1-neo and

introduced it into Ishikawa cells. However, no clones resistant toG418 (1 mg/ml) were obtained. Then we used AN3CA, anotherendometrial carcinoma cell line. By introducing pHßAPr-1-neo orpHßAPr-l-neo-36RZ into AN3CA cells and a subsequent selection

with l mg/ml G418, we obtained approximately 50 or 70 clones oftransfectant with pHßAPr-1-neo or pHßAPr-l-neo-36RZ, respectively. Ten clones were arbitrarily chosen from among the pHßAPr-l-neo-36RZ transfectant clones, and their telomerase activity wasstudied as a first step in the screening. Other pHßAPr-1-neo orpHßAPr-l-neo-36RZ transfectant clones were collected and used as apooled clone. To rule out the possibility that the alteration of telom-

0.'

^pe>e>e>eie>e>e>e> e>

f

Fig. 5. Telomerase activity in transfectants and parental AN3CA cells. Vector P., apooled clone of vector transfectant; Ribozyme P., a pooled clone of 36-ribozyme trans-fectanl; Lanes CI-C10. clones 1-10; IS. internal standard. Note that the telomerase

activity was reduced in all of the ribozyme transfectants including the pooled clone.

5408

on March 1, 2021. © 1998 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

RIBOZYME AGAINST TELOMERASE RNA

O«bA

Ri bozyme

Tel omerase RNA

G3PDH

Fig. 6. Ribozyme and telomerase RNA expression. Rihozyme expression was studiedby RT-PCR and Southern blotting. Telomerase RNA and glyceraldehyde-3-phosphate

dehydrogenase were analyzed by Northern blotting. Ribozyme was expressed in all of thetransfectants. Telomerase RNA expression was diminished in all of the transfectants.Telomerase RNA was expressed in C5, C9. and CIO, whose telomerase activity wasalmost undetectable. as shown in Fig. 5. Vector P.. a pooled clone of vector transfectant:Ribozvme P., a pooled clone of 36-ribozyme transfectant: C5, C9, and CIO, clones with

greatly reduced telomerase activity: C8. a clone with moderately reduced telomeraseactivity: C7, a clone with slightly reduced telomerase activity; C3PDH. glyceraldehyde-3-phosphate dehydrogenase.

level. However, in the clones in which telomerase activity was almostundetectable, telomerase RNA was steadily expressed.

The TRF length of clones 5, 9, and 10, in which telomerase activitywas reduced significantly, was analyzed by Southern blot hybridization. As shown in Fig. 7, the TRF of these clones was apparentlyshortened.

DISCUSSION

For the ribozymes to recognize and catalyze the target sites, thetarget region must be sufficiently exposed on the outer surface of thethree-dimensional structure of the molecules. In the present study, the36-ribozyme that targeted the RNA template region reduced the

telomerase activity most efficiently, implying that this region is located at the outer surface of the telomerase molecule. This finding isconsistent with the experiment using antisense oligonucleotide inwhich the targeting of this template region caused the most significantreduction in the telomerase activity of mouse cells (18).

The template region of telomerase RNA is crucial for enzymeactivity, but a recent investigation has demonstrated that another partof telomerase RNA is also regulatory for enzyme activity (19). Wechose the GUC sequence as a cleavage site and studied the efficiencyof the ribozymes targeting three different GUC sites. However, hammerhead ribozymes can cleave the 3' end of some other triplet

sequences such as CUC, GUA, or GUU as efficiently as they do GUC(20). This implies that there may be many other sites where ribozymescan cleave telomerase RNA more efficiently.

It has been shown that the enzyme activity of telomerase is notassociated with the expression level of telomerase RNA in sometumors and cells (21, 22). However, a rough correlation was foundbetween a cultured cell line and T lymphocytes (23, 24). Recently, thecrucial role of the RNA component in telomere shortening has beendemonstrated in the cells of a telomerase RNA knockout mouse (25).Despite the complex between them, we reasoned in this experimentthat the breakdown of telomerase RNA molecules by the ribozymesmust lead to the attenuation of telomerase activity, because telomerase

RNA is a direct participant in the telomerase molecule as an essentialelement. We demonstrated that the reduction of telomerase RNAexpression was associated with the attenuation of telomerase activity.This did not appear to come from clonal divergence, because thetelomerase activity and telomerase RNA in the pooled clone ofribozyme transfectant were clearly diminished compared with that ofthe parental cells and the vector transfectant. However, in some clonesin which telomerase activity was almost undetectable, telomeraseRNA was still expressed at a steady level. This may suggest thatbesides catalysis by the ribozyme, the antisense sequence of theribozyme against the RNA may interfere with enzyme activity in situ.

To date, two protein components of human telomerase have beenidentified. TP1 is a protein binding to telomerase RNA (26, 27). ItsmRNA can be a target of ribozymes, but it has been reported that itsexpression level does not parallel telomerase activity. In addition, itsexpression is not limited in the tissues with positive telomeraseactivity. hTERT is a catalytic subunit of telomerase (28, 29). It hasbeen demonstrated that the expression level of this mRNA parallelstelomerase activity. This seems to be a major regulator of telomeraseactivity. It means that the mRNA of this protein can be another targetof the hammerhead ribozyme, although the effect of the ribozyme ontelomerase activity would be indirect.

We have chosen endometrial carcinoma cells as a target cancer forthe ribozyme, but many studies have demonstrated that normal endo-

metrium possesses telomerase activity (30, 31). In this context, whenconsidering the introduction of ribozymes in vivo, endometrial carcinoma may not be a good target cancer for the ribozyme. We havepreviously reported that the telomerase activity of the endometrium isregulated by progestins (30). The secretory endometrium and decidualendometrium induced by progestins do not express telomerase activityat a detectable level. This implies that pretreatment with progestinscan totally abolish telomerase activity in the normal endometrium. Incombination with progestin, the ribozyme can selectively target cancer cells.

In immortal cells, it has been demonstrated that telomerase activityis associated with the cell cycle (32). The highest telomerase activity

kb23.1-

9.4—6.6-

4.4—

2.3—2.0—

0.6—

Fig. 7. Southern blot analysis of the TRF. Three clones with greatly attenuatedtelomerase activity were analyzed. All clones showed shorter TRFs. Vector P., a pooledclone of vector Iransfectant.

5409

on March 1, 2021. © 1998 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

RIBOZYME AGAINST TELOMERASE RNA

is (bund in the S phase of the cell cycle (33, 34), whereas quiescentcells do not possess telomerase activity at a detectable level. In thisstudy. AN3CA transfectants with the 36-ribozyme clearly grew more

slowly than did the parental cell line (data not shown). The doublingtime of the transfectant became doubled at the maximum. The trans-

fectant of AN3CA with attenuated telomerase activity passed almost30 passages and still steadily proliferated. On the other hand, we couldnot obtain the 36-ribozyme transfectant with Ishikawa cells. We tried

another expression vector (pcDNA3) in Ishikawa cells but could notobtain the ribo/.yme transfectant. This may be explained by thetoxicity of the 36-ribozyme for some cell lines.

The 36-ribozyme used in this experiment is a promising agent for

repressing telomerase activity. In this ribozyme, the antisense sequences flanking the catalytic core spanned 20 nucleotides. It has beenshown that the length of the flanking antisense sequence affectsribo/.yme kinetics (35). This may suggest that there is room for furtherimprovement in the efficiency of 36-ribozyme.

ACKNOWLEDGMENTS

We thank Dr. Musato Nishida for the Ishikawa cells. Dr. Larry Kedes.Stanford University School of Medicine, Palo Alto, CA, for pHßAPr-1-neo.

and Dr. Bryant Villeponteau for pGRN83.

REFERENCES

1. de Lange. T. Aclivalion of lelomerase in a human lumor. Proc. Nail. Acad. Sci. USA.91: 2882-2885, 1994.

2. Allsopp, R. C.. Chang. E.. Kashefi-Aazam. M.. Rogaev, E. I.. Pialyszek. M. A., Shay,J. W.. and Harley. C. B. Telomere shortening is associated with cell division in vitroand in vivo. Exp. Cell Res.. 220; 194-200, 1995.

3. Harley. C. B. Telomere loss: mitolic clock or genetic time bomb? Mutât.Res.. 256.271-282. 1991.

4. Greider. C. W.. and Blackburn. E. H. A lelomcric sequence in the RNA of Teirahy-tnt'iut telomerase required for telomere repeat synthesis. Nature (Lond.). 337: 331-

337, 1989.5. I mull 'l.i.l V.. and Wright. W. E. Telomeres and telomerase: a simple picture becomes

complex. Cell. X7: 369-375, 1996.6. Wright. W. E.. Piatyszek. M. A.. Rainey. W. E., Byrd. W.. and Shay. J. W.

Telomerase activity in human germline and embryonic tissues and cells. Dev. Genet.,18: 173-179. 1996.

7. Sharma. H. W.. Sokoloski. J. A.. Perez, J. A.. Maltese. J. Y., Sartorelli. A. C.. Stein.C. A.. Nichols, G., Khalcd. Z., Telang, N. T.. and Narayanan. R. Differentiation ofimmortal cells inhibits telomerase activity. Proc. Nati. Acad. Sci. USA, 92: 12343-

12346. 1995.8. Albanell, J.. Han. W.. Mellado, B.. Gunawardane. R.. Svher. H. I., Dmitrovsky. E.,

and Moore, M. A. Telomerase activity is repressed during differentiation of maturation-sensitive but not resistant human tumor cell lines. Cancer Res.. 56: 1503-1508.

19%.9. Xu. D.. Gruher, A.. Peterson. C.. and Pisa. P. Suppression of telomerase activity in

HL60 cells after treatment with differentiating agents. Leukemia (Baltimore). 10:1354-1357, 1996.

10. Shore. D. Telomerase and telomere-binding proteins: controlling the endgame.Trends Biochem. Sci.. 22: 233-235. 1997.

11. Feng. J.. Funk, W. D.. Wang. S. S.. Weinrich. S. L.. Avilion. A. A.. Chiù, C. P..Adams. R. R.. Chang, E.. Allsopp. R. C. Yu. J.. Le. S.. West. M. D.. Harley, C. B..Andrews. W. H., Greider, C. W., and Villeponteuu, B. The RNA component of humantelomerase. Science (Washington DC). 269: 1236-1241, 1995.

12. Yokoyama, Y.. Morishita, S.. Takahashi, Y.. Hashimoto. M.. and Tamaya. T. Modulation of c-frnx proto-oncogene in an ovarian carcinoma cell line by a hammerheadribozyme. Br. J. Cancer. 76: 977-982. 1997.

13. Kashani-Sabet. M., Funaio. T.. Tone. T., Jiao, L., Wang, W.. Yoshida, E., Kashfinn.

B. I.. Shitara. T., Wu, A. M.. Moreno, J. G., Traweek. S. T., Ahlering, T. E., andScanion. K. J. Reversal of the malignant phenotype by an anti-ras ribozyme. Anti-sense Res. Dev., 2: 3-15. 1992.

14. Haseloff, J.. and Gerlach, W. L. Simple RNA enzymes with new and highly specificendonuclease activities. Nature (Lond.), 344: 585-591, 1988.

15. Nishida. M., Kasahara. K.. Kaneko. M.. Iwasaki. H.. and Hayashi. K. Establishmentof a new human endometrial carcinoma cell line, Ishikawa cells, containing estrogenand progesterone receptor. Acta Obstet. Gynaecol. Jpn.. 37: 1103-1 111. 1985.

16. Gunning. P.. Leavitt, J.. Muscat, G., Ng, S.. and Kedes, L. A human ß-actinexpression vector system directs high-level accumulation of antisense transcripts.Proc. Nail. Acad. Sci. USA. 04: 4831-4835. 1987.

17. Milligan, J. F.. Groebe, D. R.. Witherell. G. W.. and Uhlenbeck, O. C. Oligoribo-

nucleotidc synthesis using T7 RNA polymerase and synthetic DNA templates. Nucleic Acids Res., 15: 8783-8798. 1987.

18. Blasco. M. A.. Funk. W.. Villeponteau. B., and Greider. C. W. Functional characterization and developmental regulation of mouse telomerase RNA. Science(Washington DC). 269: 1267-1270, 1995.

19. Bhattacharyya, A., and Blackburn. E. H. A functional telomerase RNA swap in vivoreveals the importance of nontemplate RNA domains. Proc. Nati. Acad. Sci. USA. 94:2823-2827. 1997.

20. Koizumi. M.. Iwai, S.. and Ohtsuka, E. Construction of a series of several self-cleaving RNA duplexes using synthetic 21-mers. FEBS Lett.. 22«:228-230, 1988.

21. Avilion. A. A.. Piatyszek. M. A.. Gupta. J.. Shay. J. W.. Bacchetti, S., and Greider,C. W. Human telomerase RNA and telomerase activity in immortal cell lines andtumor tissues. Cancer Res., 56: 645-650. 1996.

22. Blasco. M. A.. Rizen. M.. Greider. C. W.. and Hanahan. D. Differential regulation oflelomerase activity and telomerase RNA during multi-stage tumorigenesis. Nat.Genet.. 12: 200-204. 19%.

23. Bodnar. A. G.. Kim, N. W.. Effros. R. B.. and Chiù.C. P. Mechanism of lelomeraseinduction during T cell activation. Exp. Cell Res., 228: 58-64, 1996.

24. Broccoli. D.. Godley, L. A.. Donehower, L. A., Varmus, H. E.. and deLange. T.Telomerase activation in mouse mammary tumors; lack of detectable telomereshortening and evidence for regulation of telomerase RNA with cell proliferation.Mol. Cell. Biol., 16: 3765-3772, 1996.

25. Lee. H. W.. Blasco. M. A.. Gottlieb, G. J.. Homer. J. W. N.. Greider. C. W.. andDePinho, R. A. Essential role of mouse telomerase in highly proliferative organs.Nature (Lond.). 392: 569-574, 1998.

26. Harrington. L.. McPhail. T.. Mar. V.. Zhou. W.. Oulton. R.. Program. A. E.. Bass.M. B.. Amida. I., and Robinson, M. O. A mammalian telomerase-associated protein.Science (Washington DC), 275: 973-977, 1997.

27. Nakayama, J.. Saito, M., Nakaniura. H.. Matsuura. A., and Ishikawa. F. TLPI : a geneencoding a protein component of mammalian telomerase is a novel member of WDrepeats family. Cell. H/Õ:875-884. 1997.

28. Meyerson. M., Counter, C. M., Eaton. E. N.. Ellisen. L. W., Steiner. P.. Caddie. S. D.,Ziaugra. L.. Beijersbergen. R. L.. Davidoff. M. J.. Liu. Q.. Bacchetti. S., Haber, D. A.,and Weinberg. A. hEST2. the putative human telomerase catalytic subunit gene, isup-regulated in tumor cells and during immortalization. Cell. 90: 785-795. 1997.

29. Nakamura. T. M., Morin, G. B.. Chapman. K. B.. Weinrich, S. L.. Andrews, W. H.,Lingner. J.. Harley, C. B.. and Cech, T. R. Telomerase catalytic subunit homologsfrom fission yeast and human. Science (Washington DC). 277: 955-959, 1997.

30. Yokoyama. Y., Takahashi. Y.. Morishita, S., Hashimoto. M., Niwa. K., and Tamaya,T. Telomerase activity in the human endometrium throughout the menstrual cycle.Mol. Hum. Reprod., 4: 173-177, 1997.

31. Kyo, S.. Takakura. M.. Kohama. T.. and Inoue. M. Telomerase activity in humanendomelrium. Cancer Res., 57: 610-614, 1997.

32. Holt, S. E.. Wright, W. E., and Shay. J. W. Regulation of ielomerase activity inimmortal cell lines. Mol. Cell. Biol., 16: 2932-2939. 1996.

33. Kruk. P. A.. Orren, D. K.. and Bohr. V. A. Telomerase activity is elevated in early Sphase in hamster cells. Biochem. Biophys. Res. Commun., 233: 717-722. 1997.

34. Zhu, X.. Kumar. R.. Mandai. M.. Sharma, N.. Sharma. H. W.. Dhingra. U.. Sokoloski,A. A., Hsiao. R., and Narayanan, R. Cell cycle-dependent modulation of telomeraseactivity in tumor cells. Proc. Nati. Acad. Sci. USA, 93: 6091-6095. 1996.

35. Goodchild. J.. and Kohli, V. Ribozymes that cleave an RNA sequence from humanimmunodeficiency virus: the effect of flanking sequence on rate. Arch. Biochem.Biophys.. 284: 386-391, 1991.

5410

on March 1, 2021. © 1998 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

1998;58:5406-5410. Cancer Res   Yasuhiro Yokoyama, Yuichiro Takahashi, Ariyoshi Shinohara, et al.   Endometrial Carcinoma CellsTargeting the Template Region of Telomerase RNA in Attenuation of Telomerase Activity by a Hammerhead Ribozyme

  Updated version

  http://cancerres.aacrjournals.org/content/58/23/5406

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/58/23/5406To request permission to re-use all or part of this article, use this link

on March 1, 2021. © 1998 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from