Autoinduction of Bacillus subtilis phoPR Operon Transcription

JOURNAL OF BACTERIOLOGY, July 2004, p. 4262–4275 Vol. 186, No. 130021-9193/04/$08.00�0 DOI: 10.1128/JB.186.13.4262–4275.2004Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Autoinduction of Bacillus subtilis phoPR Operon Transcription Resultsfrom Enhanced Transcription from E�A- and E�E-Responsive

Promoters by Phosphorylated PhoPSalbi Paul, Stephanie Birkey,† Wei Liu,‡ and F. Marion Hulett*

Laboratory for Molecular Biology, Department of Biological Sciences, University of Illinois at Chicago, Chicago, Illinois 60607

Received 3 February 2004/Accepted 1 April 2004

The phoPR operon encodes a response regulator, PhoP, and a histidine kinase, PhoR, which activate orrepress genes of the Bacillus subtilis Pho regulon in response to an extracellular phosphate deficiency. Inductionof phoPR upon phosphate starvation required activity of both PhoP and PhoR, suggesting autoregulation of theoperon, a suggestion that is supported here by PhoP footprinting on the phoPR promoter. Primer extensionanalyses, using RNA from JH642 or isogenic sigE or sigB mutants isolated at different stages of growth and/orunder different growth conditions, suggested that expression of the phoPR operon represents the sum of fivepromoters, each responding to a specific growth phase and environmental controls. The temporal expressionof the phoPR promoters was investigated using in vitro transcription assays with RNA polymerase holoenzymeisolated at different stages of Pho induction, from JH642 or isogenic sigE or sigB mutants. In vitro transcriptionstudies using reconstituted E�A, E�B, and E�E holoenzymes identified PA4 and PA3 as E�A promoters and PE2as an E�E promoter. Phosphorylated PhoP (PhoP�P) enhanced transcription from each of these promoters.E�B was sufficient for in vitro transcription of the PB1 promoter. P5 was active only in a sigB mutant strain.These studies are the first to report a role for PhoP�P in activation of promoters that also have activity in theabsence of Pho regulon induction and an activation role for PhoP�P at an E�E promoter. Informationconcerning PB1 and P5 creates a basis for further exploration of the regulatory coordination or overlap of thePhoPR and SigB regulons during phosphate starvation.

Inorganic phosphate (Pi) is the limiting nutrient for biolog-ical growth in the soil, the natural habitat of Bacillus subtilis. Tothrive in this environment where Pi levels are often 2 to 3orders of magnitude lower than levels of other required ions(29), B. subtilis has evolved complex regulatory systems forutilization of this limiting nutrient. At least three global regu-latory systems are responsible for changes in gene expressionupon phosphate deprivation. One set of genes is controlledeither positively or negatively by the PhoP-PhoR two-compo-nent regulators, genes referred to as the Pho regulon genes(for review, see reference 12). Other genes that are inducedupon phosphate limitation are dependent on SigB (1), an al-ternative stress sigma factor. A third class of genes is expressedunder phosphate-limiting growth conditions that are indepen-dent of either SigB or PhoP-PhoR (1). The regulatory coordi-nation between these three sets of genes is unclear, althoughup-regulation of certain Pho regulon genes has been reportedin a sigB mutant strain (12, 33).

Pho regulon genes are the most extensively studied set ofphosphate-regulated genes in B. subtilis. Identification of genesof known function that are directly regulated by PhoP-PhoRprovides insight into one strategy B. subtilis may use to deal

with conditions of limiting phosphate. A high-affinity Pi trans-port system (25, 34, 36) (PstS system) is induced for the uptakeof inorganic phosphate, while a family of alkaline phospha-tases, PhoA, PhoB, and PhoD (5, 6, 14, 15), are secreted whoseactivity may function to supply the decreasing Pi pool. Anioniccell wall polymer turnover (2) is controlled by PhoP-PhoR, asphosphorylated PhoP (PhoP�P) directly represses tag genes(23, 35) that are required for synthesis of the high-phosphateanionic polymer, teichoic acid (27), and activates the tua genes(24, 35) responsible for synthesis of a non-phosphate-contain-ing polymer (39), teichuronic acid, under phosphate-limitingconditions. One might say that B. subtilis carries its phosphatereserve on its back, as teichoic acid is turned over as theteichuronic acid replaces it. The secreted phosphodiesterasesand phosphomonoesterases, PhoD, PhoB, and PhoA, are be-lieved to have a role in the teichoic acid degradation, providingan additional phosphate supply for uptake via the PstS high-affinity transport system. Other genes that require PhoP-PhoRfor activation that may be directly regulated by PhoP�P in-clude glpQ (1), encoding a glycerophosphodiesterase; glnQ(28), encoding a glutamine ABC transporter; ykoL (37), apeptide of unknown function; and additional genes of un-known function, yhaX, yhbH, yttP (33) and yycp, ydbH, and yjdB(28).

The Pho regulon response is controlled at two levels: at thelevel of phoPR operon transcriptional regulation and by thesignal that results in autophosphorylation of PhoR and thesubsequent activation of PhoP by phosphorylation via PhoR.Studies reported here focused on transcriptional regulation ofthe phoPR operon. Previous reports showed that the phoPRoperon was expressed at low levels during phosphate-replete

* Corresponding author. Mailing address: Laboratory for MolecularBiology, Department of Biological Sciences, University of Illinois atChicago, 900 S. Ashland Ave. (M/C 567), Chicago, IL 60607. Phone:(312) 996-5460. Fax: (312) 413-2691. E-mail: [email protected].

† Present address: NFRP/TSCRP Program, Congressionally Di-rected Medical Research Programs, Science Applications Interna-tional Corp., Ft. Detrick, MD 21702.

‡ Present address: Genencor International, Inc., Palo Alto, CA94304.

4262

on March 11, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

growth but was induced two- to threefold upon Pi limitation(16). That the induced transcription level of phoPR in thewild-type (WT) strain was dependent on the phosphate star-vation signal and PhoPR suggested that the operon was auto-regulated, perhaps directly. These data raised a question aboutthe preinduction transcription of phoPR, as previously charac-terized Pho regulon promoters which are directly activated byPhoP (phoA, phoB, phoD, tuaA, and pstS) are silent in vivounder Pi-replete conditions. Further, neither artificially elevat-ing phoPR transcription under phosphate-replete conditionsvia an inducible promoter (4) nor chromosomal mutation (A.Puri and F. M. Hulett, unpublished data) initiates the Phoresponse, presumably because the signal is missing. Studiesreported here were initiated to determine if phoPR transcrip-tion were directly regulated by PhoPR and, if so, what mech-anism accounts for expression of phoPR during Pi-repletegrowth when other Pho regulon promoters are silent.

Our data suggest that the phoPR operon is directly auto-regulated by PhoP-PhoR. This regulation is accomplished byup-regulation of E�A and E�E promoters responsible for tran-scription of the phoPR operon. Two additional phoPR promot-ers are not PhoP regulated. This is the first report of PhoPactivation of an E�E promoter or of a role for PhoP in up-regulation of promoters that have some activity in the absenceof Pho regulon induction.

MATERIALS AND METHODS

Bacterial strains and plasmids. All strains and plasmids used in this work arelisted in Table 1. Plasmids pSB5 and pSB38 were constructed by amplifyingphoPR promoter regions from JH642 (pheA1 trpC2) chromosomal DNA using a5� primer containing an EcoRI site and one of two 3� primers each containing aBamHI site. Primers FMH202 (5�-GTGAATTC�300TCATTGAACTTGAACTG�282-3�) and FMH079 (5�-GTGGATCC�92GTAATGACATCATAGCCT�75-3�) or FMH312 (5�-TTGGATC�24CACAACTAAAATTTTCTTGTTC�3-3�)were used to amplify two phoPR promoter fragments that were each cloned intopCR2.1, creating pSB5 and pSB38, respectively. (Superscript numbers identifybase pair positions 5� [�] or 3� [�] of the PhoP translational start site.) ThephoPR promoter fragments in pSB5 (392 bp) or pSB38 (324 bp) were sequenced,released from the vector by BamHI and EcoRI digestion, and cloned into the

EcoRI/BamHI sites upstream of the promoterless lacZ in pDH32 to createpSB40, which contains the full-length phoPR promoter fusion, and pSB39, whichcontains the same 5� promoter sequence with a 3� coding region deletion. pSB40and pSB39 were linearized by Pst1 digestion, transformed into JH642 orMH5600 (phoP �EcoRI), selecting for Cmr and screened for an amyE� pheno-type. Representative pSB40 transformants containing a single copy of the full-length phoP-lacZ promoter fusion at the amyE locus in JH642 or MH5600 (phoP�EcoRI) were called MH5562 and MH5565, respectively. Representative pSB39transformants containing the 3�-truncated phoPR-lacZ promoter fusion in JH642or MH5600 (phoP �EcoRI), were called MH5559 and MH5567, respectively.MH5580 was constructed by transforming chromosomal DNA containing thesigE::Ermr from strain EU8701 into MH5562 and selecting for Erm-resistanttransformants. MH6200 was constructed by transforming chromosomal DNAfrom PB344 (sigB::Spcr) into MH5562 and selecting for Spcr transformants.

Media and enzyme assays. For phosphate starvation induction of Pho reporterenzymes, alkaline phosphatases (APases), or the phoPR promoter fusions, cellswere cultured in low-phosphate defined medium (LPDM) as described previ-ously (13). For sporulation induction conditions, the cells were grown in modifiedSchaeffer’s sporulation medium with glucose (SSG) (21). �-Galactosidase spe-cific activity was determined by the method of Ferrari et al. (9). �-Galactosidasespecific activity was expressed in units per milligram of protein. The unit usedwas equivalent to 0.33 nmol of ortho-nitrophenol produced per min. APasespecific activity was determined as previously described (13); the units weremicromoles of p-nitrophenol produced per minute at 37°C.

RNA preparation and primer extension analysis. Total RNA was isolatedfrom B. subtilis cells grown in either LPDM or SSG medium. Two volumes ofRNAprotect bacterial reagent (QIAGEN) was mixed with 1 volume of bacterialculture and incubated for 5 min at room temperature. The mixture was centri-fuged at 5,000 � g for 10 min. The total RNA was extracted from the above pelletusing the RNeasy Midi kit (QIAGEN). A total of 50 g of RNA was used in eachprimer extension reaction mixture. The primer extension reactions were per-formed as described previously (5) using primer FMH079 (see Fig. 2). A se-quencing ladder was produced by end labeling the primer FMH079 with[-32P]ATP and with pSB5 as template using Sequenase (U.S. BiochemicalCorp.) according to the instructions of the manufacturer.

DNase I footprint assays. The phoPR promoter fragment from pSB5 (Table 1)was digested with either BamHI, for the coding strand, or EcoRI for the non-coding strand and was end labeled with Klenow fragment in the presence of[�-32P]dATP. The insert was then released by digestion with either EcoRI orBamHI. Purification of the probes and the DNase I footprinting experimentswere performed according to the methods of Liu and Hulett (24). In eachreaction mixture, 1.4 g of a truncated form of PhoR (*PhoR) and variousamounts of PhoP were used. A final concentration of 4 mM ATP was added forreactions requiring PhoP�P. The concentration of PhoP in the reaction mixtureswas 55 nM, 275 nM, 1.38 M, and 6.7 M.

TABLE 1. Bacterial strains and plasmids

Strain or plasmid Genotype Source or reference

B. subtilis strainsJH642 pheA1 trpC2 J. A. HochEU8701 pheA1 trpC2 �sigE::Ermr C. P. MoranPB344 trpC2 sigB�3::Spcr C. PriceMH5636 pheA1 trpC2 rpoC� pYQ52 Cmr Ying QiMH5654 pheA1 trpC2 rpoC� pYQ52 Cmr �sigE::Ermr Ying QiMH5559 trpC2 pheA1 amyE::phoP39-lacZ Cmr This studyMH5562 trpC2 pheA1 amyE::phoP40-lacZ Cmr This studyMH5565 trpC2 pheA82::Tn917 LEr phoP �EcoRI amyE::phoP40-lacZ Cmr This studyMH5567 trpC2 pheA82::Tn917 LEr phoP �EcoRI amyE::phoP39-lacZ Cmr This studyMH5580 trpC2 pheA1sigE::Ermr amyE::phoP40-lacZ Cmr This studyMH6200 pheA1 trpC2 rpoC� pYQ52 Cmr �sigB3::Spcr This study

PlasmidspCR2.1 Ampr Kanr InvitrogenpSB5 Ampr Kanr full-length phoPR promoter in pCR2.1 This studypSB38 Ampr Kanr full-length phoPR promoter without the coding region in pCR2.1 This studypSB39 Ampr Cmr 326-bp BamHI/EcoRI fragment from pSB38 subcloned into pDH32 This studypSB40 Ampr Cmr 396-bp BamHI/EcoRI fragment from pSB5 subcloned into pDH32 This studypSP200 pET 16b::sigB Ampr This studypSP201 pET 16b::sigE Ampr This study

VOL. 186, 2004 COMPLEX phoPR OPERON PROMOTER 4263


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Overexpression and purification of proteins. (i) �B. A DNA fragment con-taining the entire coding region of �B was amplified by PCR using chromosomalDNA of JH642 as template. Oligonucleotide primers were FMH492 (5�-TGCATATG TTGATCATGACACAACCATCAAAAACT-3�) and FMH493(5�-ATGGATCCTTACATTAACTCCATCGAGGGATCTT-3�). These primers con-tained NdeI and BamHI sites, respectively. The PCR product was cloned intopET16b (Novagen) at the same sites, to generate pSP200. Escherichia coliBL21(DE3)pLysS cells containing pSP200 were grown in Luria-Bertani medium(1,000 ml) containing ampicillin (100 g/ml) at 30°C. When the optical density at540 nm was 0.6, isopropyl-�-D-thiogalactopyranoside (1 mM) was added to theculture and the cells were collected by centrifugation at 8,000 � g for 15 min aftera 3-h incubation period. The pellet fraction was suspended in 30 ml of sonicationbuffer (50 mM Tris [pH 8], 500 mM NaCl, 5 mM MgCl2, and 20% glycerol), towhich 1 mM phenylmethylsulfonyl fluoride was added directly before the cellswere disrupted by sonication and separated by centrifugation at 120,000 � g for1 h at 4°C. The supernatant fraction was applied to a 2.5-ml nickel-nitrilotriaceticacid–agarose (QIAGEN) affinity column (the Ni-nitrilotriacetic acid resin waspreviously equilibrated with sonication buffer in a 1.0- by 10-cm Econo column[Bio-Rad]). The column was sequentially washed with the sonication buffer (20times with 2.5 ml) followed by 30 mM imidazole in sonication buffer (twice with2.5 ml) at 4°C. The bound protein was eluted using a stepwise imidazole con-centration gradient from 100 to 500 mM in the sonication buffer at 4°C. Theeluted proteins were dialyzed overnight against 2� storage buffer (10 mM Tris[pH 8.0], 10 mM MgCl2, 100 mM KCl, 0.1 mM EDTA, and 50% glycerol) at 4°C.The protein concentration was determined with the Bio-Rad protein assay (Bio-Rad Laboratories) using bovine serum albumin as the standard.

(ii) �E. A DNA fragment that contains the mature �E protein-coding region(sigE) without the N-terminal 27-amino-acid-coding region of pro-�E (20a) wasgenerated by PCR using JH642 chromosomal DNA as template. The followingprimers were made with the restriction sites for NdeI and BamHI: FMH490 (5�-TGCATATGGGCGGGAGTGAAGCCCTGCCGCCTCCAT-3�) and FMH491(5�-CTGGATCCTTACACCATTTTGTTGAACTC-3�). The PCR product was clonedinto pET16b at the same site (Novagen), generating pSP201. pSP201 was trans-formed into E. coli BL21(DE3) pLysS, and a representative transformant was usedas a �E-overexpressing strain. The �A-overexpressing strain was provided by M.Fujita and Y. Sadaie. �E and �A were overexpressed and purified as describedabove.

(iii) PhoP and *PhoR. PhoP and *PhoR were purified as previously described(22). *PhoR is a soluble, truncated form of PhoR (38).

(iv) RNAP and core polymerase. B. subtilis MH5636 (34) or B. subtilis MH5654was grown in either LPDM or SSG medium, and the RNA polymerase (RNAP)and the core polymerase were purified as described previously (34).

In vitro transcription. Linear template DNA used in the in vitro transcriptionassays was released from pSB5 by EcoRI digestion, releasing a 409-bp DNAfragment containing the full-length phoPR promoter region. These DNA frag-ments were purified from a 1% agarose gel with a QIAquick gel extraction kit(QIAGEN) according to the manufacturer’s directions. The transcription reac-tion mixture (20-l final volume) consisted of a 2 nM concentration of template,various concentrations of PhoP or PhoP and *PhoR, 1 mM ATP, and 0.4 pmolof purified B. subtilis RNAP (34). The transcription buffer contained 100 mMpotassium glutamate, 10 mM Tris (pH 8.0), 0.1 mM EDTA, 50 mM KCl, 1 mMCaCl2, 5 mM MgCl2, 10 g of bovine serum albumin per ml, 1 mM dithiothreitol,and 5% glycerol. Either PhoP alone or a mixture of PhoP-*PhoR (equal molar)and ATP (1.0 mM) was incubated with the template at 37°C for 10 min. RNAPor the core polymerase containing required sigma factors was then added to thereaction mixture, and incubation continued at 37°C for 15 min. A single round oftranscription was initiated by the addition of a transcription buffer containingATP, GTP, and CTP at 100 M each, 10 M UTP, 5 Ci of [�-32P]UTP(Amersham), and heparin at 50 g/ml. After incubation at 37°C for 15 min,reactions were stopped by the addition of 10 l of loading dye (7 M urea, 100mM EDTA, 5% glycerol, 0.05% xylene cyanol, and 0.05% [wt/vol] bromophenolblue). Samples were analyzed on 8 M urea–6% polyacrylamide gels. Dried gelswere analyzed by using a PhosphorImager (Molecular Dynamics).

RESULTS

PhoP or PhoP�P binds to three sites in the phoPR promoterregion and one site in the coding sequence for PhoP. Previousdata showed that induction of the phoPR operon upon phos-phate-limited growth was dependent on PhoP and PhoR.DNase I footprinting experiments were performed to deter-

mine whether regulation of the phoPR operon by the PhoP-PhoR two-component system might be direct. Either PhoP (inthe presence of *PhoR but the absence of ATP) or PhoP�P(in the presence of *PhoR and ATP) protected multiple re-gions positioned similarly on the coding and noncoding strands(Fig. 1 and 2). Phosphorylated PhoP extended the PhoP-pro-tected region primarily on the noncoding strand between twoPhoP binding regions from �150 to �213 and directly 5� of thePhoP-protected region on the coding strand within the PhoP-coding sequence (�39 to �25). Only PhoP�P protected aregion on the coding strand between �9 and �22 or a regionbetween �245 and �280 on the noncoding strand. All regionsprotected by both phosphorylated and unphosphorylated PhoPcontained appropriately spaced (4 to 6 bp apart) repeatedconsensus sequences for PhoP dimer binding (6), TT(A/C/

FIG. 1. DNase I footprint analysis of the phoPR promoter boundby PhoP and PhoP�P. Various amounts of PhoP, incubated with*PhoR (1.4 g) in the presence or absence of 4 mM ATP, were mixedwith the 407-bp phoPR promoter labeled on either the coding ornoncoding strand and treated with DNase I. The concentration ofPhoP used in each reaction mixture was, from left to right, 0 nM, 55nM, 275 nM, 1.38 M, and 6.7 M. Lanes with PhoP�P are labeled�ATP, and those with unphosphorylated PhoP are labeled �ATP.Lanes F, PhoP-free lanes; lane G, the G-sequencing reaction lane usedas a reference. The thick black vertical lines represent the PhoP andPhoP�P binding regions, while the thin lines represent sites boundonly by PhoP�P. The hypersensitive sites are marked with a darkarrowhead. Base pairs are numbered relative to the translation startsite (as �1).

4264 PAUL ET AL. J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

T)A(C/T)A (Fig. 2). The consensus repeats positioned 5� ofthe coding region were on the noncoding strand, while therepeat within the coding region was on the coding strand. Anumber of DNase-hypersensitive sites were evident on thecoding and the noncoding strands upon PhoP binding (Fig. 1).

The PhoP binding site in the PhoP-coding region is requiredfor full induction of the phoPR promoter during phosphatedeprivation. Three PhoP-activated Pho regulon promotershave secondary binding sites in addition to a core bindingregion between approximately �20 and �60, relative to thetranscription start site, that binds two PhoP dimers. The sec-ondary binding sites are located either 177 bp 5� of thetranscription start site (6) or 3� within the coding region (25).In the phoD promoter, a 5� secondary binding site was essentialfor 95% of the promoter function. Two other PhoP-activatedpromoters, phoA and pstS, had PhoP and/or PhoP�P bindingregions within the coding region of the activated gene thatwere required for full expression of either promoter. To assessthe importance of the 3� PhoP binding site for phoPR promoterexpression, phoPR promoter activity in JH642 (parental strain,MH5562) or a phoP mutant strain (MH5565) containing afull-length phoP-lacZ promoter fusion was compared to that ofa JH642 strain (MH5559) or a phoP mutant strain (MH5567)with a phoP-lacZ promoter fusion containing a deletion of the3� binding site, as shown in Fig. 2 (deletion of bp �25 to �92).Figure 3A shows low expression from the full-length phoPRpromoter in JH642 (MH5562) during exponential growth un-der phosphate-replete conditions (1 to 4 h) followed by induc-tion (5 to 8 h), initiated as the culture entered stationary phasedue to Pi limitation. The same promoter fusion in the phoP

mutant strain (MH5565) showed little induction upon phos-phate limitation, but lacZ expression increased slightly duringlate stationary phase (10 to 12 h). Expression of the phoPpromoter fusion with the 3� truncation in JH642 (strainMH5559) or in the phoP mutant background (MH5567) wasreduced 5-fold compared to the full-length promoter inJH642, indicating the importance of this PhoP binding sitewithin the PhoP coding sequence to phoPR operon promoterfunction during phosphate starvation.

The same four strains plus a sigE mutant strain (MH5580)containing the full-length phoPR-lacZ promoter fusion werecultured in a high-phosphate medium (SSG; 43 mM Pi), whichwas designed to induce sporulation and development, to assesspost-exponential phoP promoter expression independent of Pi

limitation, a condition where PhoP would be predicted to beunphosphorylated. The phoP-lacZ expression pattern (Fig. 3B)from the full-length promoter fusion, either in the parent strain(MH5562) or in the phoP mutant strain (MH5565) was similar.Expression in either strain was low during the first 7 h ofgrowth, followed by a threefold induction that peaked between9 and 10 h. Because there was no difference in the �-galacto-sidase accumulation in the phoP� versus the phoP strain, itwould appear that there is no significant role for PhoP inphoPR transcription under these conditions. The full-lengthpromoter fusion in the sigE mutant background (MH5580)failed to induce during late stationary growth. Induction of the3�-truncated phoP promoter-lacZ fusion in the phoP mutantstrain (MH5567) was similar to that of the complete promoter,but expression was reduced in JH642 (MH5559), suggesting apossible repressor role for the unphosphorylated PhoP. Ex-

FIG. 2. Transcription start sites and PhoP binding sites on the phoPR promoter sequence and 5� PhoP coding sequence. Gray shading identifiessequence protected by both PhoP and PhoP�P. Stippled shading identifies sequence protected only by PhoP�P. Transcriptional start sites for PB1,PE2, PA3, PA4, or P5 are indicated by bold sequence base pairs that are identified by a bent arrow followed by the promoter number. The �10consensus sequence for each promoter is underlined by a slender rectangle marked �10 followed by the promoter number. The �35 consensussequence for each promoter is overlined by a slender rectangle marked �35 followed by the promoter number. The consensus repeats for PhoPdimer binding [TT(A/C/T)A(C/T)A] are underlined with the sequence in bold print. The translational start codon, ATG, is boxed and identifiedby a bent arrow marked �1. Sequence numbering is relative to the A of ATG as �1. Arrows with half arrowheads identify primers used to amplifysequences in the two promoter fusion constructs analyzed below in Fig. 3. The asterisk identifies the transcription site of PBX1.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

pression of the 3�-deleted promoter in either the WT or �phoP background was reduced during the first 7 h compared tothe full-length promoter.

The difference in PhoP requirement under different phoPRinduction conditions might be explained by multiple promot-ers, as was determined for phoB (encoding APase B), whichwas shown to have a vegetative promoter that required PhoPunder Pi-limiting growth conditions and a second promoter forinduction during sporulation (5).

The phoPR operon is transcribed from multiple promoters.Primer extension was performed to identify the promoter(s)responsible for expression of the phoPR operon. Figure 4Ashows the results of the primer extension analysis on RNAisolated during Pho regulon expression under phosphate star-vation conditions. Three 5� ends (labeled P1, P3, and P4) wereidentified (Fig. 4A, lane 1) by using RNA isolated from cellsapproximately 1 h after phoPR induction, T1. An additional 5�end (P2) was observed (Fig. 4A, lane 2) by using RNA isolatedfrom cells 3 h into phosphate starvation induction, T3. Theconcentration of P2 increased relative to P3 and P4 concentra-tions in RNA from cells 4 h after phoPR induction (Fig. 4A,lane 3), while P1 continued to increase but remained the leastabundant of the 5� ends. Because we show below that the same

5� ends were found in vitro using purified RNAP, we will referto them as transcription start sites.

To explore the transcriptional regulation of the phoPRoperon under sporulation conditions, we performed primerextension analysis of the phoPR operon with total RNA iso-lated from post-exponential-stage cells grown in SSG at sporu-lation stage 4, T4. Under sporulation conditions, the major 5�end for the phoPR operon (Fig. 4B, lane 2) was identical to theabove P2 promoter identified in RNA from cells that enteredstationary phase due to Pi starvation (above and Fig. 4B, lane1). A low concentration of P1 was also observed.

The transcription start sites P1, P2, P3, and P4 are located�23, �34/�37, �48/�49, and �69 bp upstream of the trans-lational start site (ATG), respectively (Fig. 2). The �10 and�35 regions of each promoter were analyzed for sequencesimilarity to established sigma factor binding consensus se-quences (10). Sequence alignments (Fig. 4C) provided putativepromoter assignments for P1, P2, P3, and P4 as �B, �E, �A, and�A, respectively. Hereafter, we refer to the four promoters asPB1, PE2, PA3, and PA4. Putative �10 and �35 sequences foreach promoter are indicated in Fig. 2.

Temporal expression of the phoPR promoters investigatedusing in vitro transcription assays with RNAP isolated at

FIG. 3. The roles of PhoP or PhoP binding regions in phoPR transcription differ during phosphate-limited and phosphate-replete growth.(A) Growth and phoPR expression in LPDM. An arrow marks the induction of APase in phoP� strains MH5562 and MH5559. (B) Growth andphoPR expression in SSG. Filled symbols represent growth; open symbols represent expression of various phoP-lacZ promoter fusions. Circle,MH5562 (JH642 strain; phoP-lacZ); square, MH5565 (phoP strain; phoP-lacZ); triangle, MH5559 (JH642 strain; phoP-lacZ fusion containing adeletion of bp �25 to �92 that removed the 3� PhoP binding site, phoP�25-92-lacZ); inverted triangle, MH5567 (� phoP; phoP�25-92-lacZ); diamond,MH5580 (sigE phoP-lacZ).



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

different times during induction. RNAP was purified from B.subtilis (MH5636, His-tagged rpoC strain) grown in LPDM asthe cells transitioned from exponential growth to stationaryphase at T0 and 3 or 4 h later (T3 and T4), or from strainMH5654 (sigE rpoC His tagged) at stage T4. In vitro transcrip-tion reactions were carried out with each RNAP in the pres-ence of PhoP�P (Fig. 5A). The in vitro transcription pattern

differed considerably depending on the stage of growth of thecells from which the RNAP was isolated (Fig. 5A).

Primer extension (Fig. 5B) was used to identify the T4

RNAP (WT or sigE) in vitro transcript start sites (Fig. 5A,lanes 3 and 4). PA4 and PB1 transcripts were identified in the invitro-generated mRNA using T4 RNAP isolated from the sigEdeletion strain. PB1 and PE2 were identified in the T4 RNAP

FIG. 4. Primer extension identified four mRNA 5� ends in the phoPR promoter region. (A) Primer extension analysis of the phoPR promoterregion. The end-labeled primer FMH079 was annealed to RNA from transition or post-exponential-stage cultures. (A) Lane 1, RNA isolated fromLPDM-grown cells during early induction (T1); lanes 2 and 3, RNA isolated from LPDM-grown cells during later Pho induction (T3 and T4); lanesT, C, G, and A, sequencing ladders generated by annealing the same end-labeled primer to a plasmid (pSB5) containing the full-length promoterregion of the phoPR operon and extending it with Sequenase (U.S. Biochemical Corp.). Arrowheads labeled PB1, PE2, PA3, and PA4 identify themRNA 5� ends. (B) Comparison of phoP 5� ends in RNA isolated from postexponential cells grown under phosphate starvation or phosphate-replete sporulation conditions. Lane 1, RNA isolated from LPDM-grown cells during late Pho induction, T4; lane 2, DNA isolated from SSG-growncells at sporulation stage T4. (Labeling is as in panel A.) (C) Putative promoter �10 and �35 consensus regions for PB1, PE2, PA3, and PA4compared to sigma factor consensus sequences (10). Bold letters in the PB1, PE2, PA3, and PA4 sequences represent matches to the sigma bindingconsensus sequence. In the consensus sequence, capital letters indicate highly conserved positions and lowercase letters indicate less-conservedpositions. R � A or G; W � A or T.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

from the WT strain. Both in vitro-generated mRNAs identifieda transcription start site (PBxl) not observed in total RNA fromcells cultured under the conditions previously tested. The PBX1

transcription start site and putative �10 and �35 sequencesfor �B are indicated in Fig. 2.

The in vitro-generated PA4 and PA3 transcripts (Fig. 5A, lane1) decreased in reactions using later-stage T3 or T4 RNAPfrom a WT strain (lanes 2 and 3) but were most prominent(Fig. 5A, lane 4) in the reaction using stage T4 sigE RNAP.Conversely, the PE2 transcript that was absent in the reactionusing WT T0 RNAP (Fig. 5A, lane 1) was apparent in T3

RNAP reactions and increased dramatically in reactions usingstage T4 WT RNAP (Fig. 5A, lane 3). PE2 was not transcribedby the T4 RNAP missing the SigE subunit (Fig. 5A, lane 4),suggesting that PE2 is dependent on SigE (directly or indi-rectly). The quantity of both the PB1 and PBxl transcripts in-creased with later-stage RNAP but showed no difference withRNAP isolated from WT or sigE stage T4 cells (Fig. 5A, lanes3 and 4), suggesting that the sigE mutation did not affect theform of RNAP required for their transcription. Thus, the num-ber of transcripts obtained varied, as did the relative concen-tration of each transcript, depending on the growth stage andthe strain from which the RNAP was isolated.

Promoters PE2 and PA4 require phosphorylation of PhoP(PhoP�P) for maximum expression. To determine the role ofPhoP and PhoP�P in transcription from PB1, PE2, PA3, andPA4, in vitro transcription reactions were done using the full-length promoter as template and WT T4 RNAP or sigE T4

RNAP in the absence of PhoP or with varying concentrationsof PhoP or PhoP�P. Figure 6A shows the results of the in vitrotranscription using WT T4 RNAP. Lanes 1 and 5 showed thatsignificant amounts of PE2 and Pxl transcripts were generatedin the absence of PhoP. Reaction mixtures with increasingPhoP concentrations from 1 to 5 pmol (Fig. 6A, lanes 2 to 4)indicated that these concentrations of PhoP did not signifi-cantly affect transcription from PE2 and PBxl. Similar reactionsthat included *PhoR and ATP for phosphorylation of PhoP(lanes 6 to 8) indicated that PhoP�P (1 to 5 pmol) enhancedPE2 transcription but not transcription of PBXl.

Similar experiments were carried out with sigE T4 RNAP(Fig. 6B) to examine PB1, PA3, and PA4, as the data in Fig. 5A(lane 4) had shown the highest transcription levels of thesepromoters with that sample of RNAP. A control to mark theposition of PE2 and PBxl was included in lane 1 from a reactionmixture identical to that in Fig. 6A, lane 8. Lanes 2 and 5contained transcripts generated from the phoPR promoter bysigE T4 RNAP alone. Unphosphorylated PhoP (Fig. 6B, lanes3 and 4) did not significantly affect transcription of PB1, PA3, orPA4. PhoP�P (2.5 to 5 pmol) increased the PA4 transcriptseveralfold (Fig. 6B, lanes 6 and 7). PB1 and PA3 showed littleenhanced transcription by PhoP�P (Fig. 6B, lanes 6 and 7).PhoP�P did not affect transcription from the PBX1 promoter.

In vitro transcription using core RNAP plus purified sigmafactors identifies �A, �B, and �E phoPR operon promoters.Data from Fig. 4 and 5 suggested that the different phoPRpromoters likely required different forms of RNAP holoen-

FIG. 5. Growth stage-specific RNAP shows temporal expression of in vitro phoPR promoter transcripts and the absence of PE2 with RNAPfrom a sigE mutant strain. (A) In vitro transcription of the phoPR promoter with RNAP isolated from stage T0, T3, and T4 cells grown in LPDM.The in vitro transcription reactions were carried out as described in Materials and Methods. M, RNA marker. In vitro transcripts were generatedusing RNAP from LPDM-grown MH5636 cells harvested at T0 (lane 1), T3 (lane 2), or T4 (lane 3) or from MH5654 (sigE) cells at T4 (lane 4).All reaction mixtures contained 5 pmol each of PhoP and *PhoR plus 1 mM ATP. (B) In vitro transcription products identified by primer extension.Markings and procedures were the same as for Fig. 4A, except the mRNA was generated by in vitro transcription (panel A, lanes 3 and 4).



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

zymes for transcription. To reconstitute specific RNAP ho-loenzymes, B. subtilis sigma factors were expressed in E. coliand purified as described in Materials and Methods, and corepolymerase was prepared from RNAP holoenzyme as de-scribed previously (34).

Figure 7A shows phoPR promoter transcripts generated us-

ing the reconstituted E�A. An in vitro transcription reactionusing core RNAP, PhoP�P, and the phoPR promoter templateyielded no transcripts (lane 6). The reaction with reconstitutedE�A (lanes 1 and 7) identified PA4 and PA3 as �A promoters.The PA4 promoter showed enhanced transcription with in-creasing concentrations of PhoP�P (lanes 8 to 13) but little

FIG. 6. PhoP�P enhances transcription from PE2 and PA4. (A) PhoP phosphorylation affects RNAP T4 phoPR promoter transcript PE2.Symbols are the same as for Fig. 5. Lanes 1 and 5 contain no PhoP; lanes 2 to 4 and lanes 6 to 8 contain increasing concentrations of PhoP (1,2.5, and 5 pmol). For phosphorylation of PhoP, equal molar concentrations of PhoP and *PhoR were in reaction mixtures applied to lanes 6 to8. (B) T4 RNAP from a sigE strain yielded PB1, PA3, and PA4 transcripts but no PE2 transcript; PhoP�P enhanced PA4 transcription. Lane 1 containsan in vitro transcription reaction identical to lane 8 in panel A for a direct comparison between reactions using T4 RNAP from JH642 and froma mutant strain. Lanes 2 and 5 contain no PhoP; lanes 3 and 4 and lanes 6 and 7 contain increasing concentrations of PhoP (2.5 and 5 pmol,respectively). Lanes 6 and 7 each contain equal molar amounts of PhoP and *PhoR plus ATP for phosphorylation of PhoP.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

change with unphosphorylated PhoP (lanes 2 to 5). The PA3

promoter was very weak with PhoP (lanes 2 to 5) or without(lanes 1 and 7) but showed enhanced transcription withPhoP�P (lanes 8 to 13).

The PE2 promoter is a �E promoter that is enhanced byPhoP�P (Fig. 7B). The reaction using the same promotertemplate and same the core enzyme as above for reconstituted�E RNAP holoenzyme resulted in transcription from the PE2

promoter (lane 1) that was little affected by increasing PhoPconcentrations between 0.5 and 5 pmol (lanes 2 to 4). Reac-tions containing PhoP�P (lanes 5 to 8) yielded increasing PE2

transcripts with increasing PhoP concentrations between 0.25and 5 pmol, indicating that the E�E PE2 promoter is PhoP�Pactivated. A control experiment (Fig. 7B, lanes 9 through 12)that was carried out with a well-characterized E�E promoter(41, 42), spoIIID, indicated that the spoIIID transcripts were

FIG. 7. PhoP�P activates transcription from PA4 and PE2 by using different forms of RNAP. (A) Expression of PA3 and PA4 requires E�A. LaneM contains the 200-nucleotide marker. Lanes 1 to 5 and 7 to 13 contain reconstituted E�A. Lane 6 contains core RNAP with no sigma factor added.Lanes 1 and 7 contain no PhoP or PhoP�P. Lanes 2 to 5 contain increasing amounts of PhoP (0.1 to 5.0 pmol). Lane 6 contains 5.0 pmol ofPhoP�P. Lanes 8 to 13 contain increasing amounts of PhoP�P (0.1 to 5 pmol). Lanes 8 to 13 contain equal molar amounts of PhoP and *PhoRplus ATP for phosphorylation of PhoP. (B) PhoP�P specifically activates the PE2 E�E promoter of the phoPR operon. The 100-nucleotide markeris in the lane marked M. Lanes 1 to 8 contain reconstituted E�E plus the phoPR template. Lanes 2 to 4 contain increasing amounts (0.5, 1, and5 pmol) of PhoP. Lanes 5 to 8 contain increasing amounts (0.25, 0.5, 1, and 5 pmol) of PhoP�P. Lanes 9 to 13 contain reconstituted E�E plus thespoIIID template. Lanes 10 and 11 contain 1 and 5 pmol of PhoP, respectively. Lanes 12 and 13 contain 1 and 5 pmol of PhoP�P, respectively.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

not affected by PhoP or PhoP�P. These data suggest thatPhoP�P activation of E�E promoters is specific to the phoPRPE2 promoter.

Reconstituted E�B in reactions with the phoPR template(Fig. 8A) yielded transcripts from PB1 and PBX1 (lane 1). Nei-ther promoter appeared to require PhoP (lanes 2 to 5) orPhoP�P for transcription (lanes 6 to 9), as neither promotershowed a dose-dependent transcription increase, and any vari-

ation in transcription appeared to be within experimental er-ror.

RNAP holoenzyme isolated from a sigB mutant strain can-not catalyze PB1 transcription (Fig. 8). To further test PB1 andPBX1 promoter dependence on SigB, we isolated RNAP froma sigB mutant strain (MH6200) at stages T0 and T4 for in vitrotranscription studies (Fig. 8B). Lane 1 shows transcriptionproducts from the phoPR promoter template using RNAP

FIG. 8. Core plus SigB is sufficient to transcribe from PB1 or P(x1); RNAP from a sigB mutant strain cannot transcribe from PB1 or P(x1). (A) E�B

transcription from the PB1 or P(x1) promoter does not require PhoP or PhoP�P. Lane M contains the 100-nucleotide marker. Reaction mixturesin lanes 1 to 9 contained the phoPR promoter template and reconstituted E�B. Lanes 2 to 5 and 6 to 9 contained increasing amounts (0.1, 0.5, 1,and 5 pmol) of PhoP or PhoP�P, respectively. (B) Neither T0 RNAP nor T4 RNAP from a sigB mutant strain can transcribe from PB1. Lanes 1to 7 contain the phoPR template. The reaction mixture in lane 1 contained T0 sigE RNAP plus PhoP�P and identified the migration positions ofP(BX1), PB1, PA3, and PA4. Lane 2 contains core RNAP plus �B as in lane 1 of panel A. Reaction mixtures in lanes 3 and 4 contained T0 RNAP,and those in lanes 5 to 7 contained T4 RNAP from a sigB mutant strain. Reaction mixtures in lanes 3 and 5 contained PhoP, and lanes 4, 6, and7 contained PhoP�P.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

from a sigE mutant as position markers for PBX1, PB1, PA3, andPA4. Lane 2 shows PB1 and PBX1 transcripts from the sametemplate using reconstituted E�B. Neither PB1 nor PBX1 wastranscribed when using the SigB-deficient T0 RNAP with PhoPor PhoP�P (lanes 3 and 4, respectively), in marked contrast tothat observed in the control reactions using T0 RNAP from asigE mutant strain (lane 1) or reconstituted E�B (lane 2). TheSigB-deficient T0 RNAP yielded an increased level of PA4

transcript with PhoP�P (lane 4) compared to that with un-phosphorylated PhoP (lane 3). No PB1 transcript was detectedusing T4 RNAP holoenzyme from a sigB mutant (lanes 5 to 7),while PA4 and PE2 transcripts were enhanced with PhoP�P,consistent with previous experiments. Interestingly, a tran-script was detected at the PBX1 position using T4 RNAP ho-loenzyme from a sigB mutant.

Together, these studies suggest that the four promotersidentified by primer extension using in vivo total RNA fromJH642 (Fig. 4) included two �A promoters (PA4 and PA3), one�E promoter (PE2), and one �B promoter (PB1). The reconsti-tuted RNAP studies suggest that PhoP�P enhances transcrip-tion from E�A promoters, PA4 and PA3, and from the E�E

promoter, PE2, but not from the E�B promoter, PB1.The PE2 promoter was not transcribed in a sigE strain; P5

was identified in RNA from a sigB mutant strain. To furtheranalyze phoPR promoter expression under phosphate starva-tion in a sigE (EU8701) or sigB (PB344) mutant strain, RNAwas isolated at various times during promoter induction.Primer extension analysis indicated that PE2 was not expressedin the sigE mutant strain (Fig. 9), consistent with the fact thatin vitro transcription studies using RNAP holoenzymes from asigE mutant strain failed to transcribe PE2 and that in experi-ments using reconstituted E�E the only transcript from thephoPR template was PE2.

The role of SigB in phoPR transcription was more complex.

Primer extension located an additional 5� end of a message inRNA from the sigB mutant that was located upstream of PA4

and was the most abundant transcript at T0 (identified as P5 inFig. 9). By T1 the relative abundances of P5, PA4, and PA3 werenearly equal, as relative concentrations of P5 decreased com-pared to products of the two SigA promoters (PA3 and PA4).By T2 the PE2 E�E transcript was most abundant and contin-ued to be through T4. The form of RNAP required for P5

transcription is not known. Although a sequence similar to aSigH consensus was seen upstream of P5 (Fig. 2), the P5 primerextension product was observed by using RNA from a sigH sigBdouble mutant, suggesting that it is not transcribed by E�H

(data not shown). Further complicating the SigB analysis, a 5�end of a message was detected by primer extension analysis atapproximately the same position as the SigB-dependent tran-script, PB1, that was identified in vitro using reconstituted E�B

and that failed to be transcribed in vitro using RNAP holoen-zymes that were isolated from a sigB mutant strain. It is notclear if this accurately represents the 5� end of PB1 transcrip-tion initiation or if it results from message processing from oneof the upstream phoPR promoters, or if it is the product ofpremature termination of the reverse transcriptase reaction.

DISCUSSION

Analysis of autoregulation of the phoPR operon identifiedtwo new roles for PhoP in promoter activation. BecausePhoP�P was required for full induction of the phoPR operonduring Pi limitation (Fig. 3A) (15, 16), it was important todetermine if the regulation were direct and, if so, which pro-moter(s) was involved. Analysis of data presented here sug-gests that the mechanism of PhoP autoregulation differs fromthat required for activation of other Pho regulon promoters intwo important ways.

FIG. 9. RNA from a sigE mutant strain contains no PE2 transcript, and RNA from a sigB mutant strain shows temporal regulation of phoPRpromoter transcripts and identifies a 5� mRNA terminus upstream of PA4. Primer extension and generation of sequencing ladders were the sameas described in the legend for Fig. 4. WT lanes used RNA for primer extension studies that was isolated from the parental strain JH642 at T0, T2,or T4. �E lanes used RNA for primer extension studies that was isolated from the sigE mutant strain EU8701 at T0, T2, or T4. �B lanes used RNAfor primer extension studies that was isolated from sigB mutant strain PB344 at T0, T1, T2, T3, and T4.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Previous data that established a direct role for PhoP�P at aparticular promoter also showed that E�A holoenzyme wasrequired for transcription from that promoter (34). Here weshow that PhoP�P can also function with E�E holoenzyme toenhance transcription at the PE2 promoter of phoPR. Twoadditional B. subtilis response regulators, ResD and Spo0A,are known to function with multiple RNAP holoenzymes.ResD, a paralogue of PhoP, activates two ctaA promoters; oneis a E�A promoter and the second promoter requires a devel-opmental sigma factor (30) that we have recently shown to be�E (S. Paul and F. M. Hulett, unpublished data). Spo0A�Pactivates the spoIIA promoter, whose transcription depends onE�H, and also activates the sigE or spoIIE promoters, whosetranscription depends on E�A (19, 43, 44).

Secondly, PhoP was essential for any detectable promoterfunction in vivo (on-off switch), and PhoP�P was required forany transcription regulation in vitro at previously studiedPhoP-activated promoters (34, 35). In contrast, the role ofPhoP�P in autoregulation is to enhance the otherwise-lowertranscription from three phoPR promoters, PE2, PA3, and PA4.Two of these promoters, PA4 and PE2, have well-conservedsequences at both the �10 and �35 sequences for SigA andSigE, respectively, which may explain the PhoP-independenttranscription. In vivo, SigE-dependent stationary-phase induc-tion of phoPR in SSG was independent of PhoP (Fig. 3),supporting the in vitro transcription data, which showed thatE�E was sufficient for PE2 transcription and that the increase inPE2 expression by PhoP was phosphorylation dependent. Thein vivo data are consistent with the absence of a phosphatedeficiency signal for Pho regulation in this high-phosphatemedium, SSG, and with the identification of phoPR amonggenes controlled by E�E in a recent genome-wide study (8).

At least part of the temporal expression pattern for eachpromoter was explained by the identification of the RNAPholoenzyme required by that promoter using previous knowl-edge concerning when these RNAP holoenzymes function andhow null mutations in one sigma factor affect the RNA ho-loenzyme pool (17; for review see reference 20). Prolonged �A

promoter (PA3 and PA4) transcription levels in the sigE mutantstrain (Fig. 5) are consistent with the observation that if �E isnot made, �A remains associated with the core, whereas in theWT strain when �E is activated in the mother cell most of the�A is no longer associated with the core RNAP. Similarly,stationary-phase transcription from PE2 (Fig. 5) is consistentwith the timing of �E activation in the mother cell duringdevelopment (11, 18, 26, 31).

The PhoP binding pattern for autoregulation shows simi-larities and differences when compared to the binding patternat other PhoP-regulated promoters. PhoP binding to thephoPR promoter shared certain characteristics observed inPhoP binding patterns at other activated Pho regulon promot-ers, such as (i) binding unphosphorylated or phosphorylatedPhoP to certain promoter regions with extension of DNA pro-tection adjacent to these regions by phosphorylated PhoP (7,25), (ii) having tandemly repeated consensus sequences forPhoP dimer binding in sequences protected by both PhoP andPhoP�P (7) or (iii) possessing PhoP binding sites within thecoding sequence of the promoter-proximal gene that affectpromoter function (25). As with the phoA or pstS promoters,the PhoP binding site within the PhoP coding region was very

important for phoPR induction during Pi limitation (Fig. 3A,LPDM), but not for postexponential induction during devel-opment (Fig. 3B, SSG) under phosphate-replete conditions.

The PhoP binding pattern upstream of PhoP-stimulated pro-moters (PE2 or PA4) is different than that observed for otherPho regulon-activated promoters (tuaA, phoA, phoB, pstS, orphoD), where PhoP or PhoP�P protected a core binding re-gion from approximately �20 to �60 that contained two dimerbinding consensus repeats on the coding strand (6, 24). PhoPor PhoP�P protected the PA4 E�A promoter upstream of �35in a region that contained a single PhoP dimer consensusrepeat on the noncoding strand.

The PE2 promoter, which has a higher enhanced transcrip-tion in vitro with PhoP�P compared to PA4, differs from PhoPregulon-activated promoters not only in PhoP binding patternbut also in the holoenzyme required for transcription, E�E. Aswith PA4, the PE2 PhoP binding consensus repeats are on thenoncoding strand, but the PhoP-protected region extends from�1 to �35 upstream of the PE2 transcription start site. Tran-scription of this promoter during development (T3 in SSG) wasthe same in a phoP mutant strain as in the parent strain,indicating that the level of transcription was not dependent onPhoP (Fig. 3) under these phosphate-replete conditions.

The PA3 promoter is protected by PhoP and PhoP�P from�23 to �10, with PhoP consensus binding sites on the non-coding strand opposite the �1 site for transcription and the�10 promoter sequence. The PA3 promoter has a very poor �A

�35 consensus and appears to be a relatively stronger pro-moter in vivo than in vitro, suggesting that an additional un-known protein may function in vivo that is absent from our invitro experiments. This could be a transcription activator or aDNA binding protein that changes the DNA conformation toenhance PA3 transcription. It occurred to us that ResD mightbe that activator, but in vitro transcription with ResD orResD�P did not increase the PA3 transcript (Paul and Hulett,unpublished).

Thus, none of the three phoPR promoters that are activatedby PhoP�P have the usual core binding region for PhoP be-tween �20 and �60 relative to their transcription start site.These differences in PhoP binding pattern during autoregula-tion suggest that the mechanism for PhoP activation of thesepromoters may be different from that for other Pho regulonpromoters and may involve differences in the PhoP-RNAPinteraction.

Regulatory coordination between phosphate deficiency re-sponse global regulators, PhoP-PhoR and SigB. Results re-ported here provide insight into the interdependent regulationbetween these two global regulators, but more investigation isrequired to fully characterize the promoters involved. SigB isactivated via the energy stress pathway during phosphate-lim-ited growth; thus, both the PhoPR operon and SigB contributeto the B. subtilis phosphate deficiency response. It is likely thatthe stress from Pi limitation is increased in the sigB mutantstrain due to the absence of SigB-regulated genes. Our datasuggest that this additional stress is responsible for induction ofP5. The dramatic appearance of an upstream 5� mRNA end(referred to as P5) in RNA isolated from a sigB mutant strainduring phosphate starvation may account for the increasedtranscription of phoPR observed in a sigB mutant during Pi

limitation (33). Assuming that this 5� end identifies a fifth



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

phoPR operon promoter, the sigma factor for the putative P5

promoter is in question. If P5 expression required only a sigmafactor that is present in a sigB mutant strain during phosphatedeficiency stress, then one might expect in vitro transcriptionfrom P5 using RNAP holoenzyme isolated from a sigB mutantstrain. That P5 was not expressed in vitro using sigB RNAP,with or without PhoP or PhoP�P, may suggest that P5 requiresan activator protein that is not PhoP.

In vitro data for transcription with E�B RNAP holoenzymeor RNAP holoenzyme from a sigB mutant strain indicate thatPB1 is a sigB promoter. That mRNA 5�ends were mapped tothe PB1 position in RNA from a sigB mutant strain places thein vitro data in question and requires further experimentationfor clarification.

A recent report concerning phoPR transcription (32) con-tains elements that both agree and differ with the work pre-sented here. The two �A promoters Pragai et al. identifiedcorrespond to PA3 and PA4. Why only two promoters wereobserved is not clear. Strain differences cannot be the reason,as we have observed all four promoters, including PB1 and PE2,in primer extension studies using RNA from B. subtilis 168(data not shown) in addition to JH642. Differences observed inPhoP footprints and PhoP DNA binding affinity to the phoPRpromoter in this and the previous study (32) have logical ex-planations. The phoPR promoter fragment used in the previ-ous study (32) does not include either the 3� or 5� PhoP/PhoP�P binding sites shown in Fig. 1 and 2. The very highconcentrations of PhoP/PhoP�P required for phoPR promoterprotection and differences in the PhoP protection pattern areconsistent with the absence of the 3� and 5� PhoP binding sites,which were found here and in earlier studies (6, 25, 34) to beimportant for in vivo promoter activity, PhoP binding affinity,and cooperative binding between PhoP dimers at other Phoregulon promoters.

In conclusion, the data presented in this study reveal a com-plex phoPR promoter, the complexity of which likely evolved asa consequence of the limited phosphate availability in the soil.The multifaceted transcriptional control suggests the impor-tance of this two-component signaling system to cellular phys-iology under a wide range of conditions that include phosphatestarvation during growth (PA4 and PA3) and development(PE2) as part of development under phosphate-replete condi-tions (PE2) and as part of the energy stress response (PB1 andP5). The data presented here provide a basic understanding ofphoPR transcriptional control onto which additional levels ofregulation are likely layered. As such, it should prove an in-valuable basis for exploring the proposed roles of ResD (40),AbrB (40), CcpA (3, 12), and SigB (12, 33) in Pho regulation,should they act directly at the transcriptional level of phoPR oraffect the Pho regulon signal that in turn affects the transcrip-tional level of phoPR via autoregulation.

ACKNOWLEDGMENTS

We thank C. Price and C. P. Moran for strains and W. Abdel-Fattahfor providing purified RNAP core enzyme. We thank Y. Chen forPhoP protein and for the helpful discussions.

This work was supported by Public Health Service grant GM 33471from the National Institutes of Health.

REFERENCES

1. Antelmann, H., C. Scharf, and M. Hecker. 2000. Phosphate starvation-inducible proteins of Bacillus subtilis: proteomics approach and transcrip-tional analysis. J. Bacteriol. 182:4478–4490.

2. Archibald, A. R., I. C. Hancock, and C. R. Harwood. 1993. Cell wall struc-ture, synthesis and turnover, p. 381–410. In J. A. Hoch, R. Losick, and A. L.Sonenshein (ed.), Bacillus subtilis and other gram-positive bacteria: biochem-istry, physiology, and molecular biology. American Society for Microbiology,Washington, D.C.

3. Blencke, H. M., G. Homuth, H. Ludwig, U. Mader, M. Hecker, and J. Stulke.2003. Transcriptional profiling of gene expression in response to glucose inBacillus subtilis: regulation of the central metabolic pathways. Metab. Eng.5:133–149.

4. Chen, Y., C. Birck, J. P. Samama, and F. M. Hulett. 2003. Residue R113 isessential for PhoP dimerization and function: a residue buried in the asym-metric PhoP dimer interface determined in the PhoPN three-dimensionalcrystal structure. J. Bacteriol. 185:262–273.

5. Chesnut, R. S., C. Bookstein, and F. M. Hulett. 1991. Separate promotersdirect expression of phoAIII, a member of the Bacillus subtilis alkaline phos-phatase multigene family, during phosphate starvation and sporulation. Mol.Microbiol. 5:2181–2190.

6. Eder, S., W. Liu, and F. M. Hulett. 1999. Mutational analysis of the phoDpromoter in Bacillus subtilis: implications for PhoP binding and promoteractivation of Pho regulon promoters. J. Bacteriol. 181:2017–2025.

7. Eder, S. C. 1998. The mechanism of PhoP transcriptional activation ofBacillus subtilis phoD and other PHO regulon genes. Master’s thesis. Uni-versity of Illinois at Chicago, Chicago.

8. Eichenberger, P., S. T. Jensen, E. M. Conlon, C. van Ooij, J. Silvaggi, J. E.Gonzalez-Pastor, M. Fujita, S. Ben-Yehuda, P. Stragier, J. S. Liu, and R.Losick. 2003. The sigmaE regulon and the identification of additional sporu-lation genes in Bacillus subtilis. J. Mol. Biol. 327:945–972.

9. Ferrari, E., S. Howard, and J. A. Hoch. 1986. Effect of stage 0 sporulationmutants on subtilisin expression. J. Bacteriol. 170:173–179.

10. Helmann, J. D., and C. P. Moran, Jr. 2002. RNA polymerase and sigmafactors, p. 289–312. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.),Bacillus subtilis and its closest relatives: from genes to cells. ASM Press,Washington, D.C.

11. Hofmeister, A. E., A. Londono-Vallejo, E. Harry, P. Stragier, and R. Losick.1995. Extracellular signal protein triggering the proteolytic activation of adevelopmental transcription factor in B. subtilis. Cell 83:219–226.

12. Hulett, F. M. 2002. The Pho regulon, p. 193–203. In A. L. Sonenshein, J. A.Hoch, and R. Losick (ed.), Bacillus subtilis and its closest relatives: fromgenes to cells. ASM Press, Washington, D.C.

13. Hulett, F. M., C. Bookstein, and K. Jensen. 1990. Evidence for two structuralgenes for alkaline phosphatase in Bacillus subtilis. J. Bacteriol. 172:735–740.

14. Hulett, F. M., E. E. Kim, C. Bookstein, N. V. Kapp, C. W. Edwards, andH. W. Wyckoff. 1991. Bacillus subtilis alkaline phosphatases III and IV.Cloning, sequencing, and comparisons of deduced amino acid sequence withEscherichia coli alkaline phosphatase three-dimensional structure. J. Biol.Chem. 266:1077–1084.

15. Hulett, F. M., J. Lee, L. Shi, G. Sun, R. Chesnut, E. Sharkova, M. F. Duggan,and N. Kapp. 1994. Sequential action of two-component genetic switchesregulates the PHO regulon in Bacillus subtilis. J. Bacteriol. 176:1348–1358.

16. Hulett, F. M., G. Sun, and W. Liu. 1994. The Pho regulon of Bacillus subtilisis regulated by sequential action of two genetic switches, p. 50–54. In A.Torriani-Gorini, E. Yagil, and S. Silver (ed.), Phosphate in microorganisms:cellular and molecular biology. American Society for Microbiology, Wash-ington, D.C.

17. Ju, J., T. Mitchell, H. Peters III, and W. G. Haldenwang. 1999. Sigma factordisplacement from RNA polymerase during Bacillus subtilis sporulation. J.Bacteriol. 181:4969–4977.

18. Karow, M. L., P. Glaser, and P. J. Piggot. 1995. Identification of a gene,spoIIR, that links the activation of sigma E to the transcriptional activity ofsigma F during sporulation in Bacillus subtilis. Proc. Natl. Acad. Sci. USA92:2012–2016.

19. Kenney, T. J., K. York, P. Youngman, and C. P. Moran, Jr. 1989. Geneticevidence that RNA polymerase associated with sigmaA uses a sporulation-specific promoter in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 94:3691–3696.

20. Kroos, L., and Y. Yu. 2000. Regulation of sigma factor activity during Ba-cillus subtilis development. Curr. Opin. Microbiol. 3:553–560.

20a.LaBell, T. L., J. E. Trempy, and W. G. Haldenwang. 1987. Sporulation-specific sigma factor sigma 29 of Bacillus subtilis is synthesized from aprecursor protein, P31. Proc. Natl. Acad. Sci. USA 84:1784–1788.

21. Leighton, T. J., and R. H. Doi. 1971. The stability of messenger ribonucleicacid during sporulation in Bacillus subtilis. J. Biol. Chem. 246:3189–3195.

22. Liu, W. 1997. Biochemical and genetic analyses establish a dual role for PhoPin Bacillus subtilis Pho regulation. Ph.D. thesis. Department of BiologicalSciences, University of Illinois at Chicago, Chicago.

23. Liu, W., S. Eder, and F. M. Hulett. 1998. Analysis of Bacillus subtilis tagAB



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

and tagDEF expression during phosphate starvation identifies a repressorrole for PhoP-P. J. Bacteriol. 180:753–758.

24. Liu, W., and F. M. Hulett. 1998. Comparison of PhoP binding to the tuaApromoter with PhoP binding to other Pho-regulon promoters establishes aBacillus subtilis Pho core binding site. Microbiology 144:1443–1450.

25. Liu, W., Y. Qi, and F. M. Hulett. 1998. Sites internal to the coding regions ofphoA and pstS bind PhoP and are required for full promoter activity. Mol.Microbiol. 28:119–130.

26. Londono-Vallejo, J. A., and P. Stragier. 1995. Cell-cell signaling pathwayactivating a developmental transcription factor in Bacillus subtilis. GenesDev. 9:503–508.

27. Mauel, C., M. Young, and D. Karamata. 1991. Genes concerned with syn-thesis of poly(glycerol phosphate), the essential teichoic acid in Bacillussubtilis strain 168, are organized in two divergent transcription units. J. Gen.Microbiol. 137:929–941.

28. Ogura, M., H. Yamaguchi, K. Yoshida, Y. Fujita, and T. Tanaka. 2001. DNAmicroarray analysis of Bacillus subtilis DegU, ComA and PhoP regulons: anapproach to comprehensive analysis of B. subtilis two-component regulatorysystems. Nucleic Acids Res. 29:3804–3813.

29. Ozanne, P. G. 1980. Phosphate nutrition of plants—a general treatise, p.559–585. In E. Khasswenh (ed.), The role of phosphorus in agriculture.American Society of Agronomy, Madison, Wis.

30. Paul, S., X. Zhang, and F. M. Hulett. 2001. Two ResD-controlled promotersregulate ctaA expression in Bacillus subtilis. J. Bacteriol. 183:3237–3246.

31. Pogliano, K., A. E. Hofmeister, and R. Losick. 1997. Disappearance of thesigma E transcription factor from the forespore and the SpoIIE phosphatasefrom the mother cell contributes to establishment of cell-specific gene ex-pression during sporulation in Bacillus subtilis. J. Bacteriol. 179:3331–3341.

32. Pragai, Z., N. E. Allenby, N. O’Connor, S. Dubrac, G. Rapoport, T. Msadek,and C. R. Harwood. 2004. Transcriptional regulation of the phoPR operon inBacillus subtilis. J. Bacteriol. 186:1182–1190.

33. Pragai, Z., and C. R. Harwood. 2002. Regulatory interactions between thePho and sigma B-dependent general stress regulons of Bacillus subtilis. Mi-crobiology 148:1593–1602.

34. Qi, Y., and F. M. Hulett. 1998. PhoP-P and RNA polymerase �A holoenzymeare sufficient for transcription of Pho regulon promoters in Bacillus subtilis:PhoP-P activator sites within the coding region stimulate transcription invitro. Mol. Microbiol. 28:1187–1197.

35. Qi, Y., and F. M. Hulett. 1998. Role of PhoP�P in transcriptional regulationof genes involved in cell wall anionic polymer biosynthesis in Bacillus subtilis.J. Bacteriol. 180:4007–4010.

36. Qi, Y., Y. Kobayashi, and F. M. Hulett. 1997. The pst operon of Bacillussubtilis has a phosphate-regulated promoter and is involved in phosphatetransport but not in regulation of the Pho regulon. J. Bacteriol. 179:2534–2539.

37. Robichon, D., M. Arnaud, R. Gardan, Z. Pragai, M. O’Reilly, G. Rapoport,and M. Debarbouille. 2000. Expression of a new operon from Bacillus sub-tilis, ykzB-ykoL, under the control of the TnrA and PhoP-PhoR global reg-ulators. J. Bacteriol. 182:1226–1231.

38. Shi, L., and F. M. Hulett. 1999. The cytoplasmic kinase domain of PhoR issufficient for the low phosphate-inducible expression of Pho regulon genes inBacillus subtilis. Mol. Microbiol. 31:211–222.

39. Soldo, B., V. Lazarevic, M. Pagni, and D. Karamata. 1999. Teichuronic acidoperon of Bacillus subtilis 168. Mol. Microbiol. 31:795–805.

40. Sun, G., S. M. Birkey, and F. M. Hulett. 1996. Three two-component signal-transduction systems interact for Pho regulation in Bacillus subtilis. Mol.Microbiol. 19:941–948.

41. Tatti, K. M., C. H. Jones, and C. P. Moran, Jr. 1991. Genetic evidence forinteraction of sigma E with the spoIIID promoter in Bacillus subtilis. J.Bacteriol. 173:7828–7833.

42. Tatti, K. M., M. F. Shuler, and C. P. Moran, Jr. 1995. Sequence-specificinteractions between promoter DNA and the RNA polymerase sigma factorE. J. Mol. Biol. 253:8–16.

43. Wu, J., P. J. Piggot, K. M. Tatti, and C. P. Moran, Jr. 1991. Transcription ofthe Bacillus subtilis spoIIA locus. J. Bacteriol. 101:113–116.

44. York, K., T. J. Kenney, S. Satola, C. P. Moran, Jr., H. Poth, and P. Young-man. 1992. Spo0A controls the �A-dependent activation of Bacillus subtilissporulation-specific transcription unit spoIIE. J. Bacteriol. 174:2648–2658.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Documents

Autoinduction of Bacillus subtilis phoPR Operon Transcription