BIOLOGY AND BIOTECHNOLOGY OF THE PLANT HORMONE ETHYLENE II

Biology and Biotechnology of the Plant Hormone Ethylene II

Edited by

A.K. Kanellis Department of Pharmaceutical Sciences, Aristotle Vniversity of Thessaloniki, Thessaloniki, Greece

C. Chang Department of Cel! Biology and Molecular Genetics, Vniversity of Maryland, Col!ege Park, MD, U.S.A.

H. Klee Department of Horticultural Sciences, Vniversity of Florida, Gainesville, FL, V.S.A.

A.B. Bleecker Department of Botany, Vniversity of Wisconsin-Madison, Madison, WI, V.S.A.

J.C. Pech ENSAT Auzevil/e Tolosan, Castane! Tolosan cedex, France

D. Grierson BBSRC Research Group in Plant Gene Regulation, Departmen! of Physiology and Environmental Science, Vniversity of Nottingham, Sutton Bonington Campus. Loughborough, Vnited Kingdom

SPRINGER-SCIENCE+BUSINESS MEDIA, B.V.

Library of Congress Cataloging-in-Publication Data Proceedings of the EU-TMR-Euroconference Symposium on Biology and Biotechnology of the Plant Hormone Ethylene II, Thira (Santorini), Greece 5-8 September, 1999

ISBN 978-94-010-5910-7 ISBN 978-94-011-4453-7 (eBook) DOI 10.1007/978-94-011-4453-7

Printed an acid-free paper

AH Rights Reserved © 1999 Springer Science+Business Media Dordrecht Originally published by Kluwer Academic Publishers in 1999 Softcover reprint of the hardcover Ist edition 1999 No part of the material protected by this copyright notice may be reproduced or utilized in any form or by any means, electronic or mechanical, including photocopying, recording or by any information storage and retrieval system, without written permission from the copyright owner.

TABLE OF CONTENTS

~~~ ~ Kanellis. A.K.. C. Chang. H Klee. A.B. Bleecker. J.c. Pech and D. Grierson

1. Biochemical and Molecular Mechanisms of Ethylene Synthesis

ACC oxidase in the biosynthesis of ethylene John, P., E.A. Reynolds, A.G. Prescottand and A.D. Bauchot

Analysis of ACC oxidase activity by site-directed mutagenesis of conserved amino acid residues 7 D. Kadyrzhanova, TJ. McCully, T. Warner, K. Vlachonasios, Z. Wang and D.R. Dilley

Evaluation of novel inhibitors of ACC oxidase possessing cyclopropyl moiety 13 Dourtoglou, V., E. Koussissi and K. Petritis

Characterization of the promoter of mungbean auxin-inducible ACC synthase gene, Vr-ACS6 21 Yoon, I. S., D.H. Park, H. Mori, B.G. Kang and H. Imaseki

Searching for the role of ethylene in non-climacteric fruits: Cloning and characterization of ripening-induced ethylene biosynthetic genes from non-climactericpPineapple (Ananas Comosus) fruits 29 Cazzonelli, C.J., A.S. Cavallaro and J.R. Botella

Organization and structure of l-aminocyclopropane-l-carboxylate oxidase gene family from peach 31 Bonghi, C., B. Ruperti, A. Rasori, P. Tonutti and A. Ramina

Metabolism of l-aminocyclopropane-l-carboxylic acid by Penicillium citrinum 33 Honma, M., YJ. Jia, Y Kakuta and H. Matsui

Structural modifications of ACC oxidase during catalytic inactivation 35 Ramassamy, S., S. Bidonde, L. Stella, J.C. PechandA. Latche

2. Perception and Signal Transduction Pathways

Characterization of Arabidopsis ethylene-overproducing mutants Woeste, K.E. and J. J. Kieber

37

vi

Control of ethylene responses at the receptor level 45 Sisler, E.C. and M. Serek

The Ethylene Signal Transduction Pathway 51 Bleecker, A. B., A. E. Hall, F. I. Rodriguez, J. J. Esch and B. Binder

The role of two-component systems in ethylene perception 59 Gamble, R.L., M.L. Coonfield, M.D. Randlett, and G.E. Schaller

Protein-protein interactions in ethylene signal transduction in Arabidopsis 65

Chang, e., P.B. Larsen, C-K. Wen, W. Ding, J.A. Shockey and Z. Pan

Ethylene signaling: more players in the game 71 Van Der Straeten, D., J. Smalle, A. Bertran, A. De Paepe, I. De Pauw, F. Vandenbussche, M. Haegman, W. Van Caeneghem, and M. Van Montagu

The effect of ethylene and cytokinin on GTP binding and MAP kinase activity in Arabidopsis thaliana 77 Smith, A.R., I.E. Moshkov, G.V. Novikova and M.A. Hall

Ethylene and methyl jasmonate interaction and binding models for elicited biosynthetic steps of paclitaxel in suspension cultures of Taxus canadensis 85 Phisalaphong, M. and J.e. Linden

Barren mutants in maize - a case study in plant signaling 95 Peterson, P. A.

Ethylene signal transduction pathway in cell death during aerenchyma formation in maize root cells: role of phospholipases 103 He, C.J., P.W. Morgan, B.G. Cobb, W.R. Jordan and M.e. Drew

3. Growth and Development and Fruit Ripening

Ethylene-dependent and ethylene-independent pathways in a climacteric fruit, the melon Pech, J.e., M. Guis, R. Botondi, R. Ayub, M. Bouzayen, J.M. Lelievre, F. EI Yahyaoui and A. Latche

Isolation and characterization of novel tomato ethylene-responsive cDNA clones involved in signal transduction, transcription and mRNA translation Zegzouti, H., B. Jones, B. Toumier, J. Leclercq, A. Bemadac and M. Bouzayen

105

I 11

vii

Analysis of gene expression and mutants influencing ethylene responses and fruit development in tomato 119 Giovannoni, J., E. Fox, P. Kannan, S. Lee, V. Padmanabhan and 1. Vrebalov

Ethylene as the initiator of the inter-tissue signalling and gene expression cascades in ripening and abscission of oil palm fruit 129 Henderson, J. and D. 1. Osborne

Ethylene perception and response in Citrus fruit 137 Cubells-Martinez, X., J.M. Alonso, M.T. Sanchez-Ballesta and A. Granell

Phytochrome B and ethylene rhythms in sorghum: biosynthetic mechanism and developmental effects 145 Finlayson, S.A., C-J. He, I-J. Lee, M.C. Drew, J.E. Mullet and P.W. Morgan

Involvement of ethylene biosynthesis and action in regulation of the gravitropic response of cut flowers 151 Philosoph-Hadas, S., H. Friedman, R. Berkovitz-Simantov, I. Rosenberger, E.J. Woltering, A.H. Halevy and S. Meir

Ethylene and flower development in tobacco plants 157 De Martinis, D., I. Haenen, M. Pezzotti, E. Benvenuto and C. Mariani

ACC oxidase expression and leaf ontogeny in white Glover 165 McManus, M.T., D.A. Hunter, S.D. Yoo and D. Gong

Interaction of ethylene with jasmonates in regulation of some physiological processes in plants 173 Saniewski, M., J. Ueda and K. Miyamoto

Isolation of developmentally-regulated genes in immature tomato fruit: towards an understanding of pre-ripening development 181 Jones, B., H. Zegzouti, P. Frasse and M. Bouzayen

Interaction between ethylene and abscisic acid in the regulation of Citrus fruit maturation 183 Alferez, F. and L. Zacarias

Interactions between abscisic acid and ethylene in ethylene-forming capacity of preclimacteric apple fruits 185 Lara, L and M. Vendrell

Soil compaction: Is there an ABA-ethylene relationship regulating leaf expansion in tomato? 187 Hussain, A., J.A Roberts, C.R. Black and LB. Taylor

viii

Use of I-methylcyclopropene to modulate banana ripening Joyce, D.C., AJ. Macnish, P.J. Hofman, D.H. Simons and M.S. Reid

Endo-J3-mannanase activity during lettuce seed germination at high temperature in response to ethylene Nascimento, W.M., D.J. Cantliffe and D.J. Huber

Ethylene and gibberelin in secondary dormancy releasing of Amaranthus caudatus seeds K~pczyIiski, J. and M. Bihun

4. Ethylene and Senescence of Plant Organs

Regulation and function of pollination-induced ethylene in carnation and petunia flowers Jones, M.L., W.R. Woodson and J.T. Lindstrom

The role of short-chain saturated fatty acids in inducing sensitivity to ethylene Halevy, A. H. and C. S. Whitehead

Apoptotic cell death in plants: The role of ethylene Woltering, E. J., A. J. de Jong and E. T. Yakimova

Cloning of tomato DADI and study of its expression during programmed cell death and fruit ripening Hoeberichts, F.A., L.H.W. Van der Plas, and EJ. Woltering

RNAase activities is post-translationallly controlled during the dark-induced senescence program Gallie, D.R. and S.-C. Chang

Ethylene regulation of abscission competence Lashbrook, C.C. and H.J. Klee

Role of ethylene sensitivity in mediating the chilling-induced leaf abscission of Ixora plants Michaeli, R., S. Philosoph-Hadas, J. Riov and S. Meir

Expression of abscission-related endo-p-l,4-glucanase Casadoro, G., L. Trainotti and C.A. Tomasin

Differential display and isolation of cDNAs corresponding to mRNAs whose abundance is influenced by ethylene during peach fruitlet abscission

189

191

193

195

203

209

217

221

227

235

243

249

ix

Ramina, A., C. Bonghi, J.J. Giovannoni, B. Ruperti and P. Tonutti

The effect of auxins and ethylene on leaf abscission of Ficus benjamina 255 AI-Khalifah, N.S. and P.G. Alderson

Effect of ethylene on the oxidative decarboxylation pathway of indole-3-acetic acid 261 Goren, R., L. Winer and J. Riov

An Arabidopsis ETRI homologue is constituvely expressed in peach fruit abscission zone and mesocarp 267 Tonutti, P., C. Bonghi, B. Ruperti, A. Scapin and A. Ramina

Characterization of caEG2, a pepper endo-8-1,4-glucanase gene involved in the abscission of leaves and flowers 269 Trainotti, L., C.A. Tomasin and G. Casadoro

Cellulase gene expression in ethylene treated geranium flowers 271 Rilioti, Z., S. Lind-Iversen, C. Richards and K.M. Brown

Use of I-methylcyclopropene to prevent floral organ abscission from ethylene-sensitive Proteaceae 273 Macnish, AJ., D.C. Joyce, J.D. Faragher and M.S. Reid

Effects of selenium uptake by tomato plants on senescence, fruit ripening and ethylene evolution 275 Pezzarossa, B., F. Malorgio and P. Tonutti

5. Stress Ethylene: Biochemical and Molecular Approaches

Ethylene enhances the antifungal diene content in idioblasts from avocado mesocarp Prusky, D., A. Leikin-Frenkel and L. Madi

Stimulated ethylene production in tobacco (Nicotiana tabacum L., CV. KY 57) leaves infected systemically with cucumber mosaic virus yellow strain Chaudhry, Z., S. Fujimoto, S. Satoh, T. Yoshioka, S. Rase and Y. Ehara

ACC deaminase is central to the functioning of plant growth promoting Rhizobacteria Glick, B. R., J. Li, S. Shah, D. M. Penrose and B. A. Moffatt

The role of ethylene in the formation of cell damage during ozone Stress: Does ozone induced cell death require concomitant ADS

277

285

293

299

x

and ethylene production? Kettunen, R., K. Overmyer and J. Kangasjarvi

Flooding-induced sensitisation to ethylene in Rumex palustris and the possible involvement of a putative ethylene receptor Vriezen, W.H., C. Mariani and L.A.C.J. Voesenek

Interactions between oxygen concentration and climacteric onset of ethylene evolution Solomos, T.

Manipulation of the expression of heme activated protein hap5c gene in transgenic plants Gherraby, W., A. Makris, I. Pateraki, M. Sanmartin, P. Chatzopoulos and A. K. Kanellis

Ethylene and polyamines synthesis in cherimoya fruit under high CO2 levels: Adaptative mechanism to chilling damage Mufioz, M.T., M.I. Escribano and C. Merodio

Effects of copper and zinc on the ethylene production of Arabidopsis thaliana Mertens, J., J. Vangronsveld, D. Van Der Straeten and M. Van Poucke

Ethylene dependent aerenchyma formation is correlated with diverse gene expression patterns Finkelstein, D. B, S. A. Finlayson, M. C. Drew, W. R. Jordan, R. A. Wing and P. W. Morgan

Ethylene biosynthesis in Rumex palustris upon flooding Vriezen, W.H., L.A.C.J. Voesenek and C. Mariani

Apoplastic ACC in ozone- and elicitor- treated plants MOder, W., J. Kangasjarvi, E.F. Elstner, C. Langebartels and H. Sandermann Jr.

ACC synthase isozymes of tomato (LE-ACSIB & LE-ACS6) that are inducible only by touch Tatsuki, M. and H. Mori

6. Biotechnological Control of Ethylene

Ethylene perception in tomato: lots of genes, lots of functions Klee, H., D. Tieman and C. Lashbrook

307

313

321

327

333

339

343

345

347

351

xi

Horticultural performance of ethylene insensitive petunias 357 Clark, D.G., H.J. Klee, J.E. Barrett, and T.A. Nell

Role of ethylene in aroma formation in cantaloupe charentais melon 365 Bauchot, A.D., D.S. Mottram, A.T. Dodson and P. John

Genetic engineering of cantaloupe to reduce ethylene biosynthesis and control ripening 371 Clendennen, S., K. J. A. Kellogg, K. A. Wolff, W. Matsumura, S. Peters, J. E. Vanwinkle, B. Copes, M. Pieper, and M.G. Kramer

Physiological analysis of flower and leaf abscission in antisense-ACC oxidase tomato plants 381 Zacarias, L., C. Whitelaw, D. Grierson, and J.A. Roberts

Ethylene in higher plants: biosynthetic interactions with polyamines and high-temperature-mediated differential induction of NR versus TAEI ethylene receptor 387 Mehta, R. A., D. Zhou, M. Tucker, A. Handa, T. Solomos and A. K. Mattoo

Understanding the role of ethylene in fruit softening using antisense ACC oxidase melons 395 Guis, M., A. Latche, M. Bouzayen and J.C. Pech Rose, J.K.C., K.A. Hadfield and A.B. Bennett

Ethylene biosynthesis in transgenic auxin-overproducing tomato plants 397 Castellano, J.M., J. Chamarro and B. Vioque

Unpredictable phenotype change connected with Agrobacterium tumefaciens mediated transformation of non-ripening tomato mutant 399 Bartoszewski, G., O. Fedorowicz, S. Malepszy, A. Smigocki, and K. Niemirowicz-Szczytt

7. Applied Aspects

On chloroplast involvement and ethylene/nitric oxide (NO·) stoichiometry in fruit maturation Leshem, Y.Y., R.B.H. Wills and V.V. Ku

Ethylene delays onset of woolly breakdown in cold-stored peaches Sonego, L., A. Lers, A. Khalchitski, Y. Zutkhi, H. Zhou, S. Lurie and R. Ben-Arie

Ethylene removal by peat-soil and bacteria: aspects for application

401

405

xii

in horticulture 411 EIsgaard, L.

Ethylene development in different clones of" Annurca" apple and its influence on the biosynthesis of aroma esters and alcohols 419 Lo Scalzo, R. and A Testoni

Does inhibition of ACO activity in Japanese-type plums account for the suppression of ethylene production in attached fruit by the tree factor and the suppressed climacteric? 427 The role oj ethylene in the tree Jactor and suppressed climacteric in Japanese-type plums McGlasson, W.B., N. Abdi and P. Holford

Softening in apples and pears: a comparative study of the role of ethylene and several cell wall degrading enzymes 431 Moya, M.A., C. Moggia, J. Eyzaguirre and P. John

Differential effects of low temperature inhibition on kiwifruit ripening and ethylene production 433 Antunes, M.D.C., I. Pateraki, P. Ververidis, AK. Kanellis and E. Sfakiotakis

Differences in colour development and earliness among pepino clones sprayed with ethephon 437 Leiva-Brondo, M., J. Prohens and F. Nuez

S-methyl-cysteine sulfoxide increases during postharvest storage of broccoli 439 Accumulation of alkyl-cysteine derivatives in Crucifers Masuda, R., K. Kaneko and M. Saito

Action of 1,1-dimethyl-4-(phenylsulfonyl) semicarbazide (DPSS), a new antisenescence preservative for cut carnation flowers Satoh, S., M. Mikami, S. Kiryu, T. Yoshioka and N. Midoh

Differences in postharvest characteristics of miniature potted roses (Rosa hybrida) Muller, R., AS. Andersen, B.M. Stummann and M. Serek

Dry weight variations as influenced by thylene inside tissue cultures vessels Jona, R. and D.Travaglio

Index of authors

Index of Keywords

441

443

445

447

451

Prologue

Ethylene is a simple gaseous plant hormone (C2H4, the simplest olefin) produced by higher plants and also by bacteria and fungi. Because of its commercial importance and its profound effects on food quality, plant growth and development, its biosynthesis, action, and control of its action by chemical, physical and biotechnological means have been intensively investigated. Thanks to new tools available in biochemistry and molecular genetics, major parts of the ethylene biosynthesis, perception and signal transduction pathways have been elucidated. This knowledge has been applied to enhance the quality of a number of agronomically important crops.

The rapid advances in elucidating the mechanisms of ethylene perception and synthesis by plants, the signal transduction pathway, and ethylene control in transgenic plants have made the organization of a series of conferences dedicated to the plant hormone ethylene imperative. It is noted here that studies on ethylene have led the way in enhancing our understanding of the biosynthesis of a plant hormone at the biochemical and molecular levels, and future studies should further help in the understanding of the biochemical machinery responsible for the perception and signal transduction of this plant hormone.

The Ethylene Symposia were established two decades ago as important international scientific events. The purpose of the present Symposium was the critical assessment of the existing knowledge and the exchange of new ideas on the mechanisms of ethylene synthesis, perception and signal transduction, its role in pathogenesis and stress, its involvement in plant growth and development and, lastly, the biotechnological control of its formation and function. This book will be of major interest to all academic, industrial and agricultural researchers as well as advanced undergraduate and graduate students in plant biology, biotechnology, biochemistry, genetics, molecular biology and food science.

This volume contains the main lectures and selected contributed papers that were presented at the EU-TMR-Euroconference Symposium entitled "Biology and Biotechnology of the Plant Hormone II" held in Thira (Santorini), Greece, September 5-8, 1998. This international scientific event was organized by the Postharvest Physiology and Biotechnology Group of the Institute of Viticulture, Vegetable Crops and FloricuIture-N.AG.RE.F., Heraklion, Crete, Greece, the Institute of Molecular Biology and Biotechnology-FO.R.T.H., Heraklion, Crete, Greece and the Laboratory of Farmacognosy, Dept. of Pharmaceutical Sciences, Aristotle University of Thessaloniki, Thessaloniki, Greece.

We would like to thank the European Commission of the European Union and especially the TMR-Euroconference Programme, Cost Action 915, DGXII-INCO DC Programme and DGXII-FAIR Programme. Special thanks go to the Ministry of Education of Greece, Ministry of Culture of Greece, Hellenic Tourism Organization, General Secretariat of Research & Technology of Greece and National Agricultural Research Foundation of Greece for their financial support. Appreciation is also

xiii

xiv

extended to a number of private firms which contributed to the success of this important event.

We are particularly indebted to the members of the scientific and local organizing committees as well as to the staff of the P.M. NOMIKOS Conference site in Thira for their efforts for the success of this Symposium. Lastly, we acknowledge the help of Mrs. A. Giannakopoulou for handling secretarial aspects.

A.K. Kanellis, Thessaloniki (Greece) C. Chang, College Park (MD, USA) H. Klee, Gainesville (FL, USA) A. B. Bleecker, Madison (WI, USA) J.C. Pech, Toulouse (France) D. Grierson, Sutton Bonington (UK)

ACC OXIDASE IN THE BIOSYNTHESIS OF ETHYLENE

1. Abstract

P. JOHN I, E.A. REYNOLDS 1, A.G. PRESCOTT2 AND A.-D. BAUCHOT1

Department of. Agricultural Botany, School of Plant Sciences, The University of Reading, Reading, RG6 6AS, UK. Department of Applied Genetics, John Innes Centre, Norwich Research Park, Cotney Lane, Norwich, NR44UH, UK

The paper concerns two aspects of the role of l-aminocyclopropane-l-carboxylate oxidase (A CO) in the biosynthesis of ethylene. First, a mechanism is proposed to account for the provision of ascorbate to the enzyme functioning in the plant cell. Evidence indicates that the enzyme is located in the apoplasm, at least in ripening fruit. It is suggested that ascorbate in the apoplast remains in a reduced state by the outward flow of reducing potential across the plasma membrane. Second, ACO is proposed to have evolved from an ancestral Fe (H)-dependent dioxygenase so as to enhance ethylene production as a regulated signal of plant stress. Among extant non-flowering plants, ACO activity has been found only in seedlings of representatives of the Coniferales and Gnetales. These results suggest that ACO arose relatively late in the evolution of the land plants; an evolutionary event reversed by suppressing expression in genetically engineered fruits.

2. Introduction

I-aminocyclopropane-l-carboxylate oxidase (ACO) is the enzyme responsible for the final stage in the biosynthesis of ethylene in higher plants (Fig. 1). From considerations of protein sequence and function ACO belongs to the family of Fe(II)-dependent dioxygenases [I, 2]. When compared with other members of this enzyme family [3], ACO shows two unique features: it uses ascorbate instead of 2-oxoglutarate as a co­substrate, and it has an absolute requirement for CO2 as a cofactor. The present paper is concerned with two aspects of the role of ACO in the biosynthesis of ethylene. First, we shall consider how the requirement for ascorbate is met in vivo; then we shall examine the origin of the ascorbate-requiring ACO in the evolution ofland plants.

1

2

o OH O~OH HO OH

+ NH3+

[><COO-

Fe(II) CO2

+ H2C=CH2

+ HCN + CO2 +

Figure 1. Reaction catalysed by ACC oxidase.

3. Interaction of ACO with Ascorbate in vivo

OH

ACO appears able to function in both the cytosol of plant cells and in the cytosol of transgenic yeast cells [4-8]. In ripening climacteric fruit, where the highest ACO activity is observed, there is evidence that the enzyme is localised predominantly in the apoplast [7, 9]. Ascorbate occurs in the apoplast but it is unlikely that the concentrations of apoplastic ascorbate reach those of the symplast [\ 0, \\]. Moreover the apoplast does not appear to posses enzyme systems for the regeneration of ascorbate from dehydroascorbate [II]. It was previously suggested [3, \2] that Cyt-b in the plasma membrane [\3] could conduct electrons from cytosolic ascorbate for the regeneration ofapoplastic ascorbate from its oxidised form (Fig. 2.).

The outward flow of negative charge across the plasma membrane would depend upon the external positive charge of the plasma membrane generated by the electrogenic proton pumping of the plasma membrane ATPase. The proposal finds a parallel in chromaffin granules of the adrenal medulla where the internal ascorbate pool is maintained in a reduced state by Cyt-b mediated electron transport across the granule membrane [14]. The proposal is consistent with the results of Malerba and colleagues [15-19] who showed that ACO activity in vivo is stimulated by enhanced proton extrusion at the plasma membrane. It is also consistent with the observation that protonophoric uncouplers, such as 2,4-dinitrophenol (DNP), which discharge the ATPase-generated potential across the plasma membrane, inhibit ACC conversion to ethylene in plant tissues [20, 21]. Under the same treatment cytosolic activities such as that of ACC synthase remain relatively unaffected. These last observations were made before ACO had been characterised [22]. When the ascorbate requirement for ACO was recognised, Ververidis [23] showed that the ACO activity measured in melon fruit discs was protected against DNP-inhibition by the addition of ascorbate and Fe(II). Thus, as predicted by the model (Fig. 2) the DNP-sensitivity may depend upon ascorbate coming, in effect, from the tissue.

3

In some tissues ascorbate and monodehydroascorbate may be transported directly across the plasma membrane [24]. Significantly this transport is sensitive to inhibition by ionophores in a manner consistent with the transport being driven by an electrochemical proton gradient [24]. A clear picture of the in vivo action of ACO can come only when we know more about the localisation of ACO in different tissues, and how ascorbate (and ACC) cross the plasma membrane.

Cyt-b Ethylene )C DHA

Ascorbate

_( Ascorbate)C GSSG \( NADPH

DHA GSH) NADP ACC

Apoplast Cytoplasm

Figure 2. Proposed model of how ascorbate is supplied to an apoplastic ACC oxidase.

4. Evolutionary Origin of ACO

Ethylene is released on the breakdown of a very wide range of organic compounds [25], thus it is likely that small amounts of ethylene would be released whenever plant tissues break down or decay, consequently it would have been available to the earliest land plants as an indication of stress (a Fig. 3). It was previously suggested [13] that ACC accumulated in early land plants as a side reaction from S-adenosyl methionine, an

- intermediary metabolite common to many plant stress response pathways (b Fig. 3). Conversion of ACC to ethylene in a regulated manner by ACO could have served as a means of generating a signal that reported the plant response to the stress, rather than being simply a consequence of the stress applied (c Fig. 3).

A prerequisite of this proposed evolutionary transition is the ability of all land plants to detect and respond to ethylene. Esch et al. (this volume) have provided evidence for the presence of slow-release-ethylene-binding activity in representatives of all major groups of land plants. It was also found in the cyanobacterium, Synechocystis where it may have arisen from an original function as a copper scavenging protein.

4

Methionine ~ STRESS SAM synthase 1 ~ I

===~> Cell damage a

S-Adenosyl methionine "-... f b

ACC synthase

~ ACC ~ ACC oxidase

Lignification Betaine

Polyamines ~ Ethylene

Figure 3. In the evolution of land plants it is proposed that ACC oxidase arose as a means of generating ethylene from ACC which had accumulated in a side-reaction of metabolic pathways up­regulated by stress.

An initial screening of land plants for their ability to convert ACC to ethylene [26, 27] led us to locate the origin of ACO with the origin of the spermatophytes [28]. In this survey ACC was supplied to excised leaf material; we have repeated the screen using an in vitro assay for ACO [22]. When extracts were prepared from leaf material, an ACO activity was recovered only from angiosperms. The leaves of many gymnosperm species are rich in tannins and other compounds that can inhibit enzyme activity. Thus we checked in each case that ACO activity from an angiosperm source was not inhibited by co-extraction with leaf material from the gymnosperms. However, when we turned from leaves to seedlings as a source of enzyme, in vitro ACO activity was detected in representatives of the Coniferales and the Gnetales. In contrast ACO was absent, when assayed either in vivo or in vitro, from representatives of the Cycadaceae and Gingkoaceae. The activity which was recovered from seedlings of representatives of Coniferales and Gnetales showed all the characteristics of angiosperm ACO: it required CO2, Fe(JI) and ascorbate and it was inhibited by the addition of oxaloacetate.

We are now extending this work to identifY (i) the distribution of putative ACO sequences in lower plants, and (ii) the patterns of transcription of ACO among different tissues in different phylogenetic groups.

5. Concluding Remarks

Transgenic plants in which ACO activity is suppressed through the expression of an antisense gene have been produced, first with tomato [29] and subsequently in other fruit and flower crops. In Cantaloupe melon hybrids we have been comparing the development of aroma volatiles in wild-type fruit and in fruit containing an ACO

5

antisense gene (Bauchot et al. this volume). This work exemplifies how ACO­generated ethylene regulates specific components of a complex biochemical system. We have proposed here (Fig. 3) that ACO arose relatively late in the evolution of land plants. If future findings support this proposal, then the genetically engineered suppression of ACO activity in tomato and melon can be viewed as a reversal of a relatively recent evolutionary event; a reversal that occurred without human intervention in Potamogeton pectinatus, where ACO activity has been lost naturally [30].

6. Acknowledgements

Weare grateful for financial support from the Research Endowment Trust Fund of the University of Reading (E.R.) and the EU FAIR Programme (A-D. B.).

7. References

1. Prescott, AG. (1993) A dilemma of dioxygenases (or where biochemistry and molecular biology fail to meet), J. Expt. Bot. 44, 849-861.

2. Roach, P.L., Clifton, 1.1., Fulop, Y., Harlos, K., Barton, G.J., Hajdu, J., Andersson, I., Schofield, C.J. and Baldwin, J.E. (1995) Crystal structure of isopenicillin N synthase is the first from a new structural family of enzymes, Nature 375, 700-704.

3. Prescott, AG. and John, P. (1996) Dioxygenases molecular structure and role in plant metabolism, Annu. Rev. Plant Phys. Planl Mol. Bioi. 47,245-271.

4. Bouzayen, M., Latche, A. and Pech, 1.e. (1990) Subcellular localization of the sites of conversion of l-aminocyc1opropane-l-carboxylic acid into ethylene in plant cells, Planla 180, 175-180.

5. Peck, S.e., Reinhardt, D., Olson, D.C., Boller, T. and Kende, H. (1992) I.ocalization of the ethylene­forming enzyme from tomatoes, l-aminocyc1opropane-l-carboxylate oxidase in transgenic yeast J. Plant Physiol. 140, 681-686.

6. Ayub, R.A., Rombaldi, C., Petitprez, M., Latche, A, Peeh, J.e. and Lelievre, J.M. (1993) Biochemical and immunocytological characterization of ACC oxidase in transgenic grape cells, in J.e. Pech, A Latche and C. Balague (eds.), Cellular and Molecular Aspects of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 98-99.

7. Rombaldi, C. Lelievre, 1.M., Latche, A., Petitprez, M .. , Bouzayen, M .. and Pech, J.e. (1994) Immunocytolocalization of I-aminocyclopropane-I-carboxylic acid oxidase in tomato and apple fruit, Planta 192, 453-460.

8. Reinhardt, D., Kende, H. and Boller, T. (1994) Subcellular localization of l-aminocyc1opropane-l­carboxylate oxidase in tomato cells, Planla 195, 142-146.

9. LaIche, A, Dupille, E., Rombaldi, C., Cleyet-Marc1, J.e., Lelievre, J.M. and Pech, J.e. (1993) Purification, characterization and subcellular localization of ACC oxidase from fruits, in J.e. Pech, A Latche and e. Balague (eds.), Cellular and Molecular Aspects of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrechl, pp. 39-45.

10. Foyer, e.H. (1993) Ascorbic acid., in R.G. Alscher and J.L. Hess (cds.), Antioxidants in Higher PlanlS, CRC Press Boca Racon, ppJ I-58.

II. Smirnoff, N. (1996) The function and metabolism of ascorbic acid in plants, Ann. Bot, 78, 661-669. 12. John, P. (1997) Ethylene biosynthesis: the role of l-aminocyc1opropane-l-carboxylate (ACC)

oxidase, and its possible evolutionary origin, Physiol. Plant. 100, 583-592. 13. Horemans, N., Asard, 1-1., and Caubergs, R.J. (1994) The role of ascorbate free radical as an electron

acceptor to cytochrome b-mediated trans-plasma membrane electron transport in higher plants, Planl Physiol. 104, 1455-58.

14. lalukar, Y., Kelley, P.M. and Njus, D. (1991) Reaction of ascorbic acid with cytochrome b561 -concerted electron and proton transfer, J. BioI. Chern. 266,6878-6882.

15. Malerba, M.. Crosti, P, Armocida, D. and Bianchctti, R. (1995) Activation of ethylene production in Aeer pseudoplalanus L.cultured cells by fusicoccin, J. Plant Physiol. 145: 93-100.

6

16. Malerba, M., Crosti, P. and Bianchetti, R. (1995) Trans-plasma membrane reduction offerricyanide induces an activation of l-aminocyclopropane-l-carboxylic acid oxidase in Acer pseudoplatanus L cultured cells, J. Plant Physiol. 145, 580-582.

17. Malerba, M., Crosti, P. and Bianchetti, R. (1995) Regulation of I-aminocyclopropane-I-carboxylic acid oxidase by the plasmalemma proton pump in Acer pseudo platanus L cultured cells, J. Plant Physiol. 145,711-716.

18. Malerba, M., Crosti, P. and Bianchetti, R. (1995) Ferricyanide induced ethylene production is a plasma membrane proton pump dependent I-aminocyclopropane-I-carboxylic acid (ACC) oxidase activation, J. Plant Physiol. 147, 182-190.

19. Malerba, M. and Bianchetti, R. (1996) A mutant of Arabidopsis thaliana with decreased activity of the plasma-membrane proton pump lacks the fusicoccin-dependent stimulation of ethylene synthesis, J. Plant Physiol. 147,614-616.

20. Yu, Y., Adams, D.O. and Yang, S.F. (1980) Inhibition of ethylene production by 2,4-dintrophenol and high temperature, Plant Physiol. 66, 286-290.

21. John, P., Porter, AJ.R. and Miller, AJ. (1985) Activity of the ethylene-forming enzyme measured in vivo at different cell potentials, J. Plant Physiol. 121,397-406.

22. Ververidis, P., and John, P. (1991) Complete recovery in vitro of ethylene-forming enzyme activity, Phytochemistry30, 725-727.

23. Ververidis, P. (1991) Characterisation and partial purification of the enzyme responsible for ethylene synthesis from l-aminocyclopropane-l-carboxylic acid in plant tissues, PhD thesis, The University of Reading.

24. Rautenkranz, AAF., Li, L., MOchler , MOrtinoia, E., and Oertli, lJ. (1994) Transport of ascorbic and dehydroascorbic acids across protoplast and vacuole membranes isolated from barley (Hordeum vulgare L. cv Gerbel) leaves, Plant Physiol. 106, 187-193.

25. Abeles, F.B. (1973) Ethylene in Plant Biology, Academic Press, New York. 26. Osborne, 0.1 (1989) The control role of ethylene in plant growth and development, in H. Clijsters et

al. (eds.), Biochemical and Physiological Aspects of Ethylene Production in Lower and Higher Plants, Kluwer Academic Publishers, Dordrecht, pp. I-II.

27. Osborne, OJ., Walters, J., Milborrow, B.V., Norville, A and Stange, L.M.C. (1996) Evidence for a non-ACC ethylene biosynthesis pathway in lower plants, Phytochemistry 42,51-60.

28. John, P., Iturriagagoitia-Bueno, T., Lay, V., Thomas, P.G., Hedderson, TAl, Prescott, AG., Gibson, E.l & Schofield, CJ. (1997) l-aminocyclopropane-I-carboxylate oxidase: molecular structure and catalytic function, in AK. Kanellis et al. (eds.) Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 15-21.

29. Hamilton, AJ., Lycett, G.W. and Grierson, D. (1990) Antisense gene that inhibits synthesis of the hormone ethylene in transgenic plants, Nature 346, 284-287.

30. Summers, lE., Voesenek, LACJ., Blom, C.W.P.M., Lewis, MJ. and Jackson, M.B. (1996) Potamogeton pectinatus is constitutively incapable of synthesizing ethylene and lacks 1-aminocyclopropane-l-carboxylic acid oxidase, Plant Physiol. 111,901-908.

ANALYSIS OF ACC OXIDASE ACTIVITY BY SITE-DIRECTED MUTAGENESIS OF CONSERVED AMINO ACID RESIDUES

l. Abstract

O. KAOYRZHANOV A, T.J. MCCULLY, T. WARNER, K. VLACHONASIOS, Z. WANG AND O.R. DILLEY Postharvest Physiology Laboratory, Horticulture Dept., Plant and Soil Sciences, Michigan State University, East Lansing, Michigan, 48824 USA

Site-directed mutagenesis of ACC oxidase (ACO) was used to determine the nature and role of conserved amino acid residues in the mechanism by which CO2 activates the enzyme. Mutants of ACO were expressed in E. coli as His-Tag fusion proteins. A consensus sequence search of 38 known or putative ACO revealed 8 completely conserved lysine residues; K72 , K144, K158, KI72, K199, K230 K292 and KZ96 • All of the lysine mutant forms were typically activated by COz indicating that none of them is essential for CO2 activation by a carbamylation mechanism. H177, H234 and 0 179 are essential ligands for Fe. The H177, H234 and 0 179 ligands for Fe in ACO have equivalent residues in isopenicillin N synthase (IPNS) as H214 , 0 216 and H270. ACO, a non-heme Fe2+/ascorbate requiring enzyme, belongs to the IPNS protein structure family. The C­terminal sequence from K292 through E301 is important for enzyme activity and CO2

activation; Arg299 may be involved in the mechanism of CO2 activation. We prepared R244K and S246A mutants to determine if these Arg and Ser residues may serve as ligands for the carboxyl group of ACe. The R244K and S246A mutants were 5.4% and 35% as active, respectively, as the native enzyme but were typically activated by CO2 ;

the Km values for ACC for the R244K and S246A mutants were increased 2- to 3-fold compared to the native enxyme. This supports a putative role of Arg244 and Ser246 as ligands for the ACC carboxyl group.

2. Itroduction

The plant hormone ethylene is of great significance to agriculture; it affects plant development at all stages from seed germination to plant organ senescence. Its' effects include: abscission of leaves, flowers and fruits, floral initiation, sex expression, and fruit ripening among many others. Understanding how ethylene production is regulated is of great practical and fundamental importance. We are studying the structure and function of ACC oxidase to determine how it catalyzes the final step in ethylene biosynthesis. We are employing site-directed mutagenesis of the protein to determine the nature and role of key conserved amino acid residues important for oxidizing \-

7

8

aminocyclopropane-l-carboxylic acid (ACC) to ethylene, and to determine the mechanism by which CO2 activates the enzyme to be lO-fold more active than it is at limiting ambient CO2 levels in the atmosphere [2, 6].

3. Site-directed Mutagenesis

We prepared mutants by site-directed mutagenesis employing an E. coli vector expressing apple ripening-related ACC oxidase [10] as His-Tag fusion proteins. Enzyme activity of the mutant enzymes was examined in cell lysates [4]. A native enzyme was prepared in parallel for each mutation for which the sequence was confirmed [4].

Table I. None of the completely conserved lysine residues among 38 known or putative ACC oxidascs arc essential for CO2 activation of ACC oxidase.

Amino acid7. Cell Lysate mutated

Activit~) C02 activation' % of native native mutant

KI58E 32.0 11.6 12.0 KI58R 23.0 4.4 5.7 KI58Q 4.7 8.8 10.2 K158L 1.4 12.5 37.8 K230R 25.1 12.0 10.2 K230Q 22.0 7.7 8.5 K230E 7.4 8.4 5.1 K144E 65.6 5.6 5.4 KinE 53.9 5.4 7.7 KI99E 10.0 6.5 5.4 K292E 7.3 7.2 7.7 K296E 135.0 7.8 7.8

K72G73-EnT73w 39.9 11.5 14.9

'Single letter abbreviations for amino acids: Arg, R; Glu, E; Gin. Q; Gly, G; Leu, L; Lys, K; Thr, T 'A native enzyme was prepared in parallel as the control for each mutation produced in the E. coli vector. Activity is % of native enzyme activity. 'C02 activation expressed as ratio of enzyme activity at CO, saturation vs. air level CO,. wThe double mutant was required to express the full length protein.

4. Carbamylation of Conserved Lysine Residues is not the Mechanism of CO2

Activation

A consensus sequence search of 38 known or putative ACC oxidases revealed 8 completely conserved lysine (K) residues; K72, K144, KISS, KI72, K199, K230 K292 and K296 (see footnotes to the tables for the single letter abbreviations for the amino acids employed). Whereas some mutants, notably K 158L, K 199E, K230E and K292E mutants, were only slightly active all mutant forms were typically activated (5 to 10-

9

fold) by CO2 (Table I). This indicates that none of them is essential for CO2 activation by a carbamylation mechanism when examined as single point mutations. This confirms the results of Chamg et al. [I] who mutated seven of these lysine residues to arginine and found that all the mutants were CO2 activated.

Table 2. Hisl77, His2J4 and ASp179 are ligands for iron in ACC oxidase. Gln '•s, Glnm , and HisJ' are not essential for activity nor CO2 activation. Asp substitutes for Glu"'for activity and CO, activation while the E30lL mutant has very low activity but is activated by CO,. ArgW and Ser46 are ACe carboxyl group ligands.

Amino acid' Cell Lysate mutated

Activitt CO2 activation' % of native native mutant

HI77F 0 9.7 0 HI77E 0.3 12.9 15.7 HI77D 0 5.6 0 HI77Q 0.93 8.1 7.1 HI77N 0 12.7 0 H234F 0 9.8 0 Dl79L 0 11.1 0 H39F 86.0 10.4 12.4

Q294F 25.6 6.8 6.7 QI88A 19.2 7.8 8.6 QI88N 4.9 5.7 14.0 Ql88K 3.9 7.1 16.9 E30lD 43.3 6.3 7.8 E301L 2.64 17.0 15.1 R244K 5.4 8.9 12.6 S246A 35.0 8.6 10.4

7.Single letter abbeviations for amino acids: Ala, A,: Asn, N; Asp, D; Arg, R; Gill, E; Gin, Q; His, H; Leu, L; Lys, K; Phe, F; Ser, S. Y A native enzyme was prepared in parallel as the control for each mutation produced in the E. coli vector. Activity is % of native enzyme activity. 'C02 activation expressed as ratio of enzyme activity at e02 saturation vs. air level CO2•

5. Fe Binding Site

ACC oxidase is a Fe2+/ascorbate requiring enzyme. We previously demonstrated [4] that Hl77, H234 and 0 179 are essential ligands for Fe confirming the results of John el al. [5] and Shaw et al. [9]. H39 and glutamine Q294, although completely conserved, are not essential for enzyme activity. Low residual activity of the HI77F mutant found to be independent of CO2 [4] when examined as the purified fusion protein suggested that HI77 might be directly involved in the CO2 activation mechanism. Further studies with the H 177F fusion protein assayed in cell lysates have not confirmed this (Table 2). However, the HI77E mutant fusion protein shows low residual activity that is only weakly activated by CO2 while the H 1770 mutant has no activity. The low residual activity of the H 177E mutant shows Fe concentration-dependent CO2 activation; as the Fe concentration is increased from 2.5 to 80 11M, CO2 activation increases from nil to

10

about 5-fold. The Hl77Q mutant has low residual activity, which is dependent on CO2,

while the H177N mutant is not active. These data suggest that CO2 activation may involve direct participation of Hl77. The Hl77, H234 and D179 ligands for Fe in ACC oxidase have the same residues in common in isopenicillin N synthase (IPNS) as H214, D216 and H270 according to crystal structure analysis of IPNS [7, 8]. ACC oxidase, among several other non-heme Fe2+/ascorbate requiring enzymes, has been shown to belong to the same protein structure family as IPNS.

Table 3. Lys292, Glu297 and Glu301 flanking the important Arg299 strongly affect ACC oxidase activity but their residual activities are activated by CO2•

Amino Acid Cell Lysate MutatedZ

Activi!t CO, activation' % of native native mutant

K292E 7.3 7.2 7.7 Q294F 25.6 6.8 5.5 K296E 135.0 7.8 7.8 E297L 2.2 5.2 10.8

R299K 99.2 7.0 8.1 R299L 0.43 9.5 23.0 R299H 0.21 16.6 4.0 R299E 0 7.6 0

E301D 43.3 6.3 7.8 E30lL 2.6 17.0 15.1

ZSingle letter abbreviations for amino acids: Arg, R; Asp, D; Gin, Q; Glu, E; His, H; Leu, L; Lys, K; Phe, F. Y A native enzyme was prepared in parallel as the control for each mutation produced in the E. coli vector. Activity is % of native enzyme activity. 'CO, activation expressed as ratio of enzyme activity at CO2 saturation vs. air level CO2•

6. C-terminal Region of ACC Oxidase Is Important for Enzyme Activity and CO2

Activation

Some of the residues in the C-terminal region are critically important for enzyme activity. This portion of the protein is predicted to be in close proximity to the catalytic site [8]. Of the conserved residues, K292, E297, R299 and E301 are important while Q294 and K296 are not (Table 3). When R299 was mutated to lysine, the R299K mutant was equivalent in activity and CO2 activation to that of the native protein while the R299E mutant was not active. This suggests that a strong positive charge as provided by Arg or Lys at position 299 is important for activity. Histidine also has a positive charge at neutral pH 7 but the R299H mutant had low residual activity poorly activated by CO2. Since the R299K mutant is equivalent in activity and CO2 activation to that of the native enzyme while the R299H mutant is not, this suggests the possibility that Arg299 may be subject to carbamylation or otherwise affected by CO2 and thus explain CO2 activation. The guanido-N of Arg is not known to be carbamylated [1] so the effect of CO2 may be through another mechanism. Moreover, the R299L mutant had low residual activity

11

and this was well activated by CO2, The E301 D mutant was about 50% as active as the native enzyme and was typically activated by CO2 whereas the E301L mutant had low activity and was activated by CO2 • These data indicate that the C-terminal sequence from K292 through EJ01 is important for enzyme activity and CO2 activation. The sequence from L 291 through E297 is predicted to be a-helical in nature followed by the helix-breaking p298. This would place R299 at a bend or loop and perhaps explain the requirement for the positive charge at this position for COz-dependent activation. We are currently preparing mutants for p298 and FJOO (which are completely conserved residues among the ACC oxidases) to determine their role(s).

7. ACC Binding Site

l-aminocyclopropane-I-carboxylic acid (ACC) is recognized as a D-amino acid by ACC oxidase [1]. The binding site for the D-valinyl residue in the IPNS tri-peptide substrate (L-adipoyl-L-cysteinyl-D-valine) includes residues providing Van der Waals forces for interacting with the D-valine isopropyl group [8] and ACC oxidase is predicted to have similarly placed residues. Arg244 and Ser246 in ACC oxidases are conserved and the equivalent residues in IPNS (Arg279 and Ser28 I) are H-bonded to the D-valinyl carboxyl group of the IPNS substrate [8]. ACC oxidase also catalyzes oxidation of alpha-aminoisobutyrate, D-alpha-aminobutyrate and D-alanine and these are all competitive inhibitors of ACC oxidase with respect to ACC because they are alternative substrates. Cyclopropane-I-carboxylic acid is also a competitive inhibitor of ACC oxidase. The inhibitory substrates all probably have a common binding site for the carboxyl group. The oxidation of D-alpha-aminobutyrate and alanine yields the corresponding aldehydes, CO2 and ammonia [1]. Alpha-aminoisobutyrate oxidation yields CO2, ammonia and acetone. ACC oxidase converts D-valine to iso-butanal [3]. Based on these observations we prepared R244K and S246A mutants to determine if these Arg and Ser residues may serve as ligands for the carboxyl group of ACe. The R244K and S246A mutants were 5.4% and 35% as active, respectively, as the native enzyme but were typically activated by CO2 (Table 2). The Km values for ACC for the R244K and S246A mutants were increased by about 2- to 3-fold. The efficiency of the R244K mutant for ACC as substrate (Vmax IKm) was only about 2% of that of the native enzyme and that of the S246A mutant was 6%. This supports a putative role of Arg244 and Ser246 as ligands for the ACC carboxyl group perhaps by H-bonding as was shown for the D-valinyl carboxyl group of the IPNS substrate [3]. Moreover, Arg244 is more important than Ser246 in H-bonding to the ACC carboxyl group. We are currently preparing the R244K-S246A double mutant which should be largely inactive. The Km for ascorbate for the R244K mutant was 1.9 times greater than that of the native enzyme while the Km for the S246A mutant was 1.6 times less than that of the native enzyme. The Km for CO2 for the R244K mutant was 1.8 times greater than that of the native enzyme whereas that for the S246A mutant was about 1.5 times greater. The efficiencies of the R244K and S246A mutants for ascorbate as substrate were 21 and 44%, respectively, while for CO2 the efficiencies were 9 and 25%, respectively. These data suggest that proper binding of ACC to R244 and S246 is important for the enzyme to use ascorbate as a co-substrate in the reaction and for CO2

12

activation. Since the Km for ascorbate was lowered for the S246A mutant and raised for the R244K mutant by similar magnitudes, this suggests that ACC binding directly affects ascorbate binding.

8. Other Mutants

We have also prepared mutants Q188A, Q188N, Ql88K that differ greatly in activity but are all CO2 activated (Table 2]. For the 3 conserved cysteine residues (C2S, Cl33 and Cl65] only C28 is very important for activity but all the cysteine mutants C28A, C133A, C133P (proline] and C165A are about equally active and typically activated about 10-fold by CO2 [4].

9. Acknowledgements

This work was funded by USDA-NRI Grant # 9602627 and the Michigan Agricultural Experiment Station.

10. References

1. Charng, Y.Y., Lin, Y., Dong, J.G. and Yang, S.F. (1997) On I-aminocyclopropane-I-carboxylate (ACC) oxidase, in AK. Kanellis et al. (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 23-29.

2. Fernandez-Maculet, J.C., Dong, J.G. and Yang, S.F. (1993) Activation of l-aminocyclopropane-I­carboxylate oxidase by carbon dioxide, Biochem. Biophys. Res. Comm. 193,1168-1173.

3. Gibson, E.l, Zhang, Z., Baldwin, lE. and Scholdield, CJ. (1998) Substrate analogues and inhibition of ACC oxidase: conversion ofD-valine to iso-butanal, Phytochemistry 48,619-624.

4. Kadyrzhanova, Dina, McCully,IJ., Jarwarski, SA, Ververidis, P., Vlachonasios, K., Murakami, K.G. and Dilley, D.R. (1997) Structure-function analysis of ACC oxidase by site-directed mutagenesis, in A.K. Kanellis et al. (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 5-13.

5. John, P., lturriagagoitia-Bueno, Lay, V., Thomas, P.G., Hedderson, I.AJ., Prescott, AG., Gibson, EJ. and Schofield, CJ. (1997) I-aminocyclopropane-I-carboxylate oxidase: molecular structure and catalytic function, in AK. Kanellis, et al. (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 15-21.

6. Poneleit, L. and Dilley, D.R. (1993) Carbon dioxide activation of l-aminocycJopropane-l­carboxylate (ACC) oxidase in ethylene biosynthesis, Postharvest BioI. and Technol. 3,191-1993.

7. Roach, P.L., Clifton, I.J., FUlOp, V., Harlos, K., Barton, G.F., Hajdu, J., Anderson, 1., Schofield, CJ. and Baldwin, lE. (1995) Crystal structure of isopencillin N synthase is the first from a new structural family of enzymes, Nature 375,700-704.

8. Roach, P.L., Clifton, I.J., Hensgens, C.M.H., Shibata, N., Schofield, C.J., Hajdu, J.and Baldwin, J.E. (1997) Structure of isopenicillin N synthase complexed with substrate and the mechanism of penicillin formation, Nature 387,827-830.

9. Shaw, J.F., Chou, Y.S., Chang, R.C. and Yang, S.F. (1996) Characterization of the ferrous ion binding sites of apple I-aminocyclopropane-I-carboxylate oxidase by site-directed mutagenesis, Biochem, Bio. Res. Commun. 225:697-700.

10. Wilson, LD., Zhu, Y., Burmeister, D.M. and Dilley D.R. (1993) Apple ripening-related cDNA clone pAP4 confers ethylene-forming ability in transformed Saccharomyces cerevisiae, Plant Physiol. 102,783-788.

EVALUATION OF NOVEL INHIBITORS OF ACC OXIDASE POSSESSING CYCLOPROPYL MOIETY

1. Abstract

V. DOURTOGLOU, E. KOUSSISSI, AND K. PETRITIS Viory/ SA, Vitanioti St. 36, GR-145 64 Kifissia, Athens, Greece

Ethylene production is inhibited by several new structural analogues of amino cyclopropane carboxylic acid (ACC), without an amine function in the Cl position. The Substituted Cyclopropane Carboxylic Acids (SCCA) require a minimal cyclopropane ring but no amine function to exhibit inhibition. Ethylene inhibition was essayed on tomato discs, and on partially purified ACC oxidase from apple fruits. These new inhibitors possess a cyclopropane ring and a substituant (R2) in the C2 position. First results showed that the amount of ethylene inhibition is strongly correlated to the chemical structure of (R2, R5) and to the presence or not of a carboxylic function in the CI position of the cyclopropane ring. To evaluate the nature of inhibition, kinetic studies were made using partially purified ACC oxidase from apple fruits. From all the inhibitors tested the best results were obtained using trans -phenyl cyclopropane carboxylic acid and cyclopropane I, I dicarboxylic acid.

2. Introduction

Ethylene is a plant hormone that profoundly influences many diverse aspects of plant growth development and responses to environmental stresses. I-aminocyclopropane-I­carboxylate (ACC) synthase and ACC oxidase (ACO) are the two key enzymes of the biosynthetic pathway [1,2,3,4,9]. ACO has been extracted and purified from various fruit species, [2, 3, 4, 5, 6]. I-Amino cyclopropane-I-carboxylate (ACC) oxidase catalyses the final step in the biosynthesis of ethylene in plants. The above enzyme belongs to a family of felTous iron (Fell) oxidases and requires carbon dioxide (C02) as activator [7,8, 10].

The global reaction is described by the following equation:

ACC+02 +ascorbate -----. C2H4+HCN+C02 +H20+dehydroxyascorbate This enzyme has a structural similarity with the non-heme oxygenases [10] and like

the other enzymes of the same family requires dioxygen as co-substrate. Previous work has been done in order to clarify the exact mechanism of catalysis, which is still unknown.

13

14

It has been proved using site directed mutagenesis that H177 and Dl79 of ACC oxidase participate in the catalysis mechanism and CO2 activation does not necessariily involve LYS participation for carbamate formation [12, 15, 16, 17]. It has also been demonstrated that some oxo-acids act as inhibitors. [16]. In addition, ACC oxidase catalyses oxidation of ACC in a stereospecific way as already shown [3, 7] with the recombinant apple ACC oxidase [6, 17] and the avocado fruit enzyme.

The synthesis of novel inhibitors requires knowledge of the mechanism of the active centre catalysis. New inhibitors should have specificity for ACC oxidase and should not interfere with other enzymes ofthe plant.

3. Materials and Methods

3.1. PLANT MATERIAL

Cherry tomatoes were grown in the greenhouse of Vioryl S.A. under hydroponic conditions using perlite as substrate and liquid fertiliser (Auxenol, Stabolin 1, Stabolin 2) which are commercial products of VIORYL S.A. Apples "Golden Delicious" were purchased from the local market.

3.2. CHEMICALS

All chemicals were purchased from commercial sources. Potential inhibitors were purchased from ACROS and FLUKA except: trans-2-phenylcyclopropane carboxylic acid (PCCA), which was synthesised in VIORYL S.A.

3.3. IN VITRO EVALUATION OF THE INHIBITORS USING TOMATO FRUIT DISCS

Cherry tomatoes were cut in two pieces, and put in Erlenmeyer flasks with an open top screw cap, equipped with silicon rubber septum. Half of each tomato was covered with 3ml of inhibitor and half with 3ml of water. The experiment was done for three different inhibitor concentrations: 0,25-0,5-0,7 mM. After 19h at 300C the produced ethylene in each flask was calculated by gas chromatography (1 ml gas samples were withdrawn from the headspace and the amount of ethylene produced was analyzed by GC).

3.4. EXTRACTION AND PARTIAL PURIFICATION OF THE ACC OXIDASE (ACO) FROM APPLES

Unless otherwise stated all operations were carried out at 4°C. 100g of apple (cut in 4-5 pieces) were turned into powder inside a thermomixer that contained liquid nitrogen, and a spoon of sea sand. The powder was mixed with buffer A (0,1 M Tris-HCI (pH=7.4), 10% (v/v) glycerol, 30mM sodium ascorbate, 5mM DDT, 1 % PVP 40000). The proportion of buffer to apple (v/w) was 2: 1.

The mixture was then centrifuged at 13000 rpm for 40 min, the supernatant was 30% saturated in ammonium sulphate, and centrifuged again under the same conditions.

15

The supernatant was then 90% saturated in ammonium sulphate, and centrifuged for the third time under the same conditions. Protein was precipitated from the supernatant by ammonium sulphate added at 90% saturation and collected by centrifugation as above. Thereafter the pellet was thawed and resuspended in 5mL of buffer B (Tris-HCI 20mM (pH=7.4), Glycerol 10% (v/v), sodium ascorbate 3mM, DDT ImM), saturated 1M in ammonium sulphate. Then 2mL of the dissolved pellet were desalted by passage through a column of Sephadex-G25, 33,5cm long (radius: 0,75cm) that had been equilibrated with Buffer B. 30 fractions of3,5mL were collected.

3.5. ASSAY FOR ENZYMATIC ACTIVITY

Enzymatic activity was measured according to two slightly different methods. A) Inside a 5 ml vial, equipped with a cap with silicon septum, was put the reaction mixture, consisting of: IOmM NaHC03, 20llM FeS04, 0,25mM ACC, 100llL of enzymatic extract, made up to ImL with buffer B. Enzyme extract was always added last, and the vial was immediately closed with its cap. ACO activity was assayed by measuring the ethylene produced by GC (Varian 3700), after incubation for Ih at 35°C. In this case to take samples from the vial headspace, a gas tight syringe of ImL was used. B) In some cases 2 ml vials were used where the total volume of the reaction mixture remained 1 mL so the headspace left was I mL. Also, in this case the final concentration of FeS04 in the reaction mixture was changed to 200IlM. Ethylene was measured using the Varian 3800 Gas chromatograph, equipped with a capillary RT-Q-PLOT column (RESTEC) (0,53mm i.d., 15m, 0,5Ilm) with a Helium flow rate of 8mLlmin at 50°C. Column temperature was stable at 50°C (isotherm), and the detector was maintained at 150°C. The GC was also equipped with an autosampler (Varian 8200) which would take 10 0 ilL samples from the headspace of the vials and inject them. Using this facility ethylene was measured after incubation for 10m in at 30DC.

In order to estimate the initial velocity of the reaction, in some experiments, we measured the ethylene produced both after 10 and 20 min of incubation. The value of Uo in each case was calculated using an Excel curve-fitting program and the data of each experiment.

4. Results

The elution profile of ACO after desalting by Sephadex-G25 column is shown in Figure 1. The fractions used for the determination of the inhibitory effect were those of the highest activity. In general maximal activity was found between fractions 6 and 10.

4.1. EV ALUA TION OF THE INHIBITORS

The apparent value ofKm for ACO was determined and found to be 25-30IlM, In order to evaluate the inhibitors further purification was not required; the inhibitory effect of the new compounds was determined, using the same enzyme extract both for the inhibitor and the blank assays.

16

l\ \ :

T~ i

~ ~ "-

"\. ~ ~ , /

o 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32

Fraction num ber

Figure 1. Elution profile of apple ACO from Sephadex G-25 column (33.5 cm long, radius 0.75). The fractions used for the all the assays are 7, 8, 9.

As shown in Table 1, the highest inhibitory effect has been observed for the compounds: CDA, CPA, CMK, and PCCA (see the legend to Table I for abbreviations). Compounds like CCA exhibit activation effect like CO2• Further studies are required to determine if ACO I oxidizes the above inhibitors to others compounds and what is the chemical structure of the reaction products.

2-MCM, CMC, MCC tested as potential inhibitors of ACC oxidation, using ACOI, did not reveal any inhibition effect and this is probably due to the lack of a strong nucleophilic group attached to the active site. As shown in Table I, the above three compounds have as the Rl group a primary or secondary alcohol, or an ester. Comparing the effect of a bulky chain at C2 carbon (R2 group) we found that by increasing the size of the R2 group increased the rate of inhibition if the position C I is occupied by a strong nucleophilic group like a carboxylic or amino group.

CMK possessing a methyl ketone in the C I position revealed an inhibition also, possibly due to a ligation to iron in the active site.

4.2. EVALUATION OF THE INHIBITORS IN TOMATO DISC EXPERIMENTS

The inhibitory effect ofPCCA and CHRA (see the legend to Figure 3 for abbreviations) has been evaluated in tomato disc experiments. Inhibition of ethylene production 24 hours was observed in tomato discs treated with 5mM and 10 mM of the inhibitors and production of ethylene plotted against tomato discs treated only with water. In Figure 3 the inhibitory effect of the two compounds on tomato discs is more clearly shown over a short time scale.

The results observed from the inhibition of ethylene production from tomato discs are in agreement with these obtained from the inhibition of ACC oxidation using partially purified apple ACOl. The cyclopropane -I,l-dicarboxylic acid has not been tested in tomato disc experiments.

~3 H~5

R2 R1

17

TABLE 1. Evaluation of the inhibitory effect of cyclopropane compounds on ethylene production from ACC using apple ACOI extract.

Inhibitor Chemical Structure ofRl, R2, R3, R4, R5 I n(%)

Ki Km KmI [ImM]

Rl R2 R3 R4 R5

PCCA COOH C5H6 H H H 50[10] 8,6 16 18 MCA COOH CH3 H H H See Figure 2 CCA COOH H H H H Activator

CDA COOH H H H COOH 88 [1] 0,1

30 30 8

CRHY COOH (CH3)2C=CH C C

H 23 [5] No kinetic models H3 H3

CRHA CH20H (CH3)2C=CH C C

H 11 [10] No kinetic models H3 H3

2-MCM CH20H CH3 H H H No inhibition

CMC CHOHC

H H H H No inhibition H3

CMK -COCH3 H H H H 35 [1] No kinetic models

MCC COOCH

H H H H No inhibition 3

CPA NH2 H H H H 51 [1] No kinetic models

PCCA: Trans-2-Phenylcyclopropane-l-carboxylic acid, MCA: 2-Methylcyclopropanecarboxylic acid CCA: Cyclopropanecarboxylic acid, CDA: Cyclopropane-I, I-dicarboxylic acid CRHY: Trans-2-Chrysanthemic acid, CHRA: Chrysanthemyl alcohol, 2-MCM: 2-Methyl-Cyclopropane-Methanol CMC: Cyclopropyl methyl Carbinol, CMK: Cyclopropyl methyl Ketone, MCC: Methyl Cyclopropane carboxylate, CPA Cyclopropylamine, In%, [I] = % of inhibition of ethylene production, using apple ACO 1 at [ACe] = 250!JM. [I] indicates the concentration in mM of the inhibitor, KmI is the Km in the presence ofthe Inhibitor

5. Discussion

Ki values were obtained for PCCA and CDA, which exhibited a non-competitive inhibition. The apparent Ki was found to be 8.6 mM for PCCA and 0.18 mM for CDA. From the kinetic data it was not possible to predict the type of inhibition for all the inhibitors due to non-linearity in Lineweaver -Burk plots. Taken into consideration that previous authors reported [12] that iron is li~ated to HI77, Dl79 and H234, we propose a schematic active site with ferrous iron (Fe I) in an octahedral configuration with three

18

bonds occupied by the side chains of the above amino acids, and two others with the amino carboxylic group of ACC in a bidentate five atom ring. The last one should be occupied from the hydroxyl group of ascorbic acid.

,~ 5 t------~==::_::=__---------____1 e ~ 4+----~------~~~------~ 0>

~ 3+--~~----------------~ 'E

~ 2r~;r~======;:=:~~::;;~:;~==~::~~ i1hf---.~:F===4.-L---"-----------i ~ o~=---~x--.--x~x~x:-------xj

0,2 0,4 o,e 0,8 1 1.2 1,4 11e

-1L--------------------~ mMofACC

-+-0 ___ 10mM -+-15mM -X-20mM

Figure 2. Effect of different concentrations of 2-methylcyclopropanecarboxylic acid on Ethylene production using an ACOI apple extract.

I 2 3 4 5 6 7 8 9 10 II 12 13

Hours (h)

-+-Tomato disks + water

_ 10 mM trans-2-Phenylcyclopropane-I-carboxylic acid

-.- 10 mM Chrysanthemyl alcohol

Figure 3. Inhibition of ethylene production from tomato discs using 10 mM of trans-2-phenylcyclopropane -I-carboxylic acid (PCCA) and Chrysanthemyl alcohol (CHRA)

19

If ACC binds to the ferrous iron (Fell) with both the amino and carboxyl groups, the obtained stable spatial conformation partially explains the sterospecificity of ACC oxidation, clearly demonstrated in the case of (I R, 2S)-1-amino-2-ethy lcyclopropane-1-carboxylic acid (AEC) by previous authors [6, 7]. The ethyl group attached to C2 position of AEC in the diasteroisomer (1 R, 2S) has not steric hindrance to an intramolecular oxidation. This fact leads us to suggest that the oxidation occurs by a iron (H)-linked peroxide in a unique spatial orientation. While this is not the aim of this study it must be taken into consideration in order to propose a model of inhibition.

ASCORBATE

Figure 4. The schematic intermediate (B) resulting from the action of hydrogen peroxide at the active site of ACOI.

ASCORBATE

PCCA .. 0C;N o/O-r~:::"" I __ 0, I N -... ./,

N ° Fe H /:"--./ '"'e .... ~ci o L-(_N I

N:::d ASCORBATE

Figure 5. Schematic reaction with the PCCA in the intermediate (8)

20

with ferrous iron (Fell). The bulky side chain attached to C2 of the inhibitor influences the replacement of the inhibitor from the ACC, when the first is attached prior to ACC to the ferrous iron (Fell) active site. The bulky side chain also leads to a less active ACOI conformation by disturbing the internal geometry of the enzyme active site.

6. References

I. Yang, S.F. and Hoffman, N.E. (\984) Ethylene biosynthesis and its regulation in higher plants, IInnu. Rev. Plant Physiol. 35, 155-189

2. Dong, J.G., Olson, D., Silverstone, A and Yang, S.F. (1992) Sequence of a eDNA coding for a 1-aminocyclopropane-I-earboxylate oxidase homolog from apple fruit, Plant Physiol. 98,1530-1531

3. Fernandez-Maculet, le. and Yang, S.F. (1992) Extraction and partial characterization of the ethylene-forming enzyme from apple fruit, Plant Physiol. 99, 751-754

4. Yerveridis, P. and John, P. (1991) Complete recovery in vitro of ethylene-forming enzyme activity, Phytochemistry 30, 725-727

5. Dupille, E., Latche, A, Roques, e. and Pech, le. (1992) Stabilization in vitro et purification de I'enzyme formant I 'ethylene chez la pommc, C.R. Acad. Sci. PariS, Serie 1II, t 315, 77-84

6. McGarvey, I. and Christoffersen, R.E. (1992) Characterization and kinetic parameters of cthylene­forming enzyme from avocado fruit, 1. BioI. Chern. 267,5962-5967

7. Charng, Y.-Y., Dong, J.-G. and Yang, S.F. (1996) Structure-function studies on the 1-aminocyclopropane-I-carboxylic acid (ACC) oxidase carbon dioxide binding site. in NATO Advanced Research Workshop, Biology and Biotechnology of the Plant Hormone Ethylene, June 9-13, Chania, Crete, Greece

8. Dilley, D.R., Wilson, I.D., Burmeister, D.M., Kuai, J. Poneleit L., Zhu, Y., Pekker, Y. Gran, e. and Bower, A (1993) Purification and characterization of ACC oxidase and its expression during ripening in apple fruit, in J. C. Pech et al. (eds.), Cellular and Molecular Aspects of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 46-52.

9. Dong, J.G., Femandez-Maculet, J.e. and Yang, S.F. (1992) Purification and characterization of 1-aminocyc\opropane-I-carboxylate oxidase from ripe apple fruit, Proc. Natl. Acad. Sci. USA 89, 9789-9793.

10. Femandez-Maculet, J.e. and Yang, S.F. (1993) Activation of I-aminocyclopropane-I-carboxylate oxidase by carbon dioxide, Biochem. Biophys. Res. Comm.193, 1168-1173.

11. Dupille, E., Rombaldi, e., Lelievre, J.M., Cleyet-Marel, le., Pech, le. and Laiche, A (1993) Purification, properties and partial amino-acid sequence of l-aminoeyclopropane-I-carboxylic acid oxidise from apple fruits, Planta 190:65-70.

12. Barlow, J., Zhang, Z., 10hn, P., Baldwin, lE. and Schofield, C.1. (1997) Inactivation of 1-Aminocyclopropane-I-carboxylate oxidase involves oxidative modifications, Biochemistry, 36. 3563-3569.

13. Zhang Z. H., Barlow J.N., Baldwin J.E. and Schofield e. (1998) Metal-catalysed oxidation and mutagenesis studies on the iron (II) binding site of I-aminocyclopropane-I-carboxylate oxidase, Biochemistry, 36, 15999-16007.

14. Pirrung, M.e., Kaiser, L.M. and Chen, J. (1993) Purification and properties of the apple fruit ethylene-forming enzyme, Biochemistry, 32, 7445-7450.

15. Kadyrzhanova, D.K, McCully, T.1., Jaworski,S.A, Yerderidis P, Ylachonasios K.E., Murakami, K.J. and Dilley, D.R. (1997) Structure-function analysis of ACC oxidase by site-directed mutagenesis, in A.K. Kanellis et at. (cds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 5-13.

16. John, P., Iturriagagoitia-bueno, T., Lay, Y., Thomas, P.G., Hedderson, T.A.J., Prescott, A.G., Gibson, E.G. and Schofield, C.1. (1997) l-Aminocyclopropane-I-carboxylate oxidase: Molecular structure and catalytic function, in A.K. Kanellis et at. (cds), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 15-21.

17. Charng, Y., Lui, Y., Dong, J.G. and Yang, S.F. (\997) On I-aminocyclopropane-I-carboxylic acid (ACC) Oxidase, in A.K. Kanellis et al. (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 23-29

CHARACTERIZATION OF THE PROMOTER OF THE MUNG BEAN AUXIN­INDUCIBLE ACC SYNTHASE GENE, Vr-ACS6

1. Abstract

I.S. YOON 1, D.H. PARKI, H. MORI2, B.G. KANG 1 AND H. lMASEKe J Department of Biological Sciences, Yonsei University, Seoul, Korea, 2Graduate Division of Biochemical Regulation, Nagoya University, Nagoya, Japan

Auxin-induced ethylene production in mung bean hypocotyls is further modified by other plant hormones. Cytokinin synergistically stimulates, and abscisic acid and ethylene suppress auxin-induced ethylene production. We have isolated an ACC synthase gene, Vr-ACS6, the expression of which is specific to auxin. Transgenic tobacco plants were prepared with a fusion gene in which the GUS gene was placed under the Vr-ACS6 promoter (1.5 kb), and seedlings obtained from T1 seeds were treated with combinations of auxin and cytokinin, abscisic acid or ethylene, then GUS activity was assayed. The expression of GUS activity was specific to auxin (lAA, 2,4-0 or NAA) and the degree of expression was dependent on concentrations of lAA, with a detectable GUS activity as low as 0.1 11M lAA. lAA-induced GUS expression was stimulated by simultaneous presence of cytokinin, and suppressed by ABA and ethylene. These interactions were also confirmed by GUS staining of treated seedlings of both green and etiolated transgenic plants. In etiolated seedlings, GUS stain was observed in the elongation zone ofhypocotyls, whereas in green seedlings, the stain was observed in shoot tips and cotyledons. These interactions were found to affect the rate of ethylene production in mung bean hypocotyls. The results indicate that the 1.5 kb 5'­untranscribed region of Vr-ACS6 gene contains all these elements necessary for the hormone interactions.

2. Introduction

The rate of ethylene production in higher plant is changed by a number of internal as well as external stimuli. Auxin is a notable internal stimulus that increases dramatically the ethylene production rate in a concentration dependent manner. This increase results from an increased endogenous activity of ACC synthase that is caused by activated transcription of a specific isogene of ACe synthase [I, 2). Genes of Aee synthase are comprised of a small gene family, and some of the isogenes are expressed in response to a specific stimulus. Using winter squash, tomato, and mung bean Ace synthase isogenes, we have functionally classified the isogenes into 3 groups; auxin-, wound- and ripening-inducible isogenes [3].

21

22

Mung bean, which we have used for physiological as well as biochemical studies of ethylene production, was reported to contain at least 5 isogenes (Vr-ACSI - 5) [4, 5], and a sequence fragment of an ACC synthase isogene which was different from any of the 5 genes was also isolated (Vr-ACS6) and its expression was induced by auxin [6]. Botella et al. [7] reported that the Vr-ACSI isogene was induced by auxin, and recently, Kim et al. [8] also reported that Vr-ACSI was expressed in response to auxin. We have cloned full length cDNAs of four isogenes from mung bean (Vr-ACSJ, 2, 3, and 6), and found that Vr-ACS6 was an auxin-specific isogene but not Vr-ACSJ [2]. The expression of Vr-ACS6 was under the control of auxin, cytokinin, abscisic acid and ethylene, as was observed in ethylene production.

In order to analyze the interaction of plant hormones at the molecular level, we introduced a Vr-ACS6 5'-untranscribed region/GUS chimeric gene into tobacco, and examined if the region is sufficient for interaction of plant hormones. In this report, we describe that a 1.5 kb untranscribed region of Vr-ACS6 contains all the elements sufficient to confer the hormonal interaction affecting Vr-ACS6 gene expression.

3. Materials and Methods

3.1. ISOLA nON OF Vr-ACS6ISOGENE

Using Vr-ACS6 eDNA, we screened a genomic library of mung bean, and nine positive clones were isolated after 3 rounds of screening. One of them which contained the longest insertion (7.6kb) was selected and used for further analysis. The nucleotide sequence of the gene contained a sequence identical to that of the cDNA, that were separated into three exons. The transcription initiation site determined by primer extension was the cytosine base 280 base-upstream of the translation initiation codon, ATG. and the clone contained 1612 bases of 5'-untranscribed region.

3.2. TRANSGENIC TOBACCO CONTAINING THE Vr-ACS6 PROMOTER-GUS CHIMERIC GENE

The 1.5 kb untranscribed region from -1531 to + 158 was prepared by PCR and inserted into the HindIII/XbaI site of pBIlOl, and tobacco SRI was transformed with the chimeric gene via Agrobacterium tumefaciens. Transformed tobacco lines were selected by kanamycin resistance, and Tl or T2 seedlings were used in this work.

3.3. GUS ACTIVITY ASSAY AND STAINING

For GUS activity assay, Tl or T2 seeds were germinated and grown in soil mix, and leaf discs excised from second leaves of 4 to 6-leaf stage plants were incubated in 10 mM phosphate buffer, pH 6.8, that contained indole-3-acetic acid (IAA), and benzylaminopurine (BA) or abscisic acid (ABA), for 6 hours. For ethylene treatment, incubation was carried out in an air-tight chamber which contained IOLethylene/L. The leaf discs were then extracted with a buffer and GUS activity was fluorometrically determined with 4-methylumbelliferone glucuronide (MUG) as substrate.

23

For histochemical GUS staining, Tl or T2 seeds were germinated and grown on agar that contained 114 strength of Hoagland solution and 100g./mLkanamycin in the dark or continuous light at 26°C for 6 days (in dark) or 10 days (in light). Seedlings were incubated with plant hormones as described above for 5 hours in the dark, then transferred to X-Glu in TrisHCI buffer followed by incubation at 37°C for 6 hours.

4. Results

4.1. Vr-ACS6 IS THE AUXIN-INDUCIBLE ISOGENE, BUT Vr-ACSI IS NOT

Northern blot analysis was carried out with hypocotyl sections of etiolated mung bean (Vigna radiata) seedlings. The results indicated that mRNAs for Vr-ACSI and 6 were not detected in control hypocotyls, but incubation of hypocotyl sections with IAA induced great accumulation of Vr-ACS6 mRNA, but not of Vr-ACSI mRNA. 2,4-dichlorophenoxyacetic acid, I-naphthaleneacetic acid and indole-3-butyric acid similarly induced expression of Vr-ACS6, but none of BA, ABA, methyljasmonate, salicylic acid, and sucrose induced expression of Vr-ACS6. Thus, the response of Vr­ACS6 is highly specific to auxin. The auxin-induced expression of Vr-ACS6 was dependent on IAA concentration from 1 f.lM to 500 f.lM, and was further increased by simultaneous addition of BA or kinetin to IAA solution, but suppressed by ABA or ethylene. The expression of Vr-ACS6 in etiolated hypocotyls by auxin was not inhibited by cycloheximide. By contrast, expression of Vr-ACSI was induced by cyclohexmide but not by auxin, and mRNA accumulation increased with increased concentration of cycloheximide.

4.2. FUNCTION OF THE 1.5 KB 5'-UNTRANSCRIBED REGION IN A HETEROLOGOUS SYSTEM

Since tobacco leaf discs behaved similarly to mung bean hypocotyls in terms of ethylene production as affected by plant hormones, we used tobacco (Nicotiana tabacum SRI) for transformation with the Vr-ACS6 promoter/GUS chimeric gene for convenience.

In transgenic tobacco, both green leaf discs and etiolated seedlings produced no GUS activity without treatment, but when the tissues were treated with varying concentration of IAA, GUS activity appeared at 1M and further increased as IAA concentration was elevated (Fig. 1).

The auxin-induced GUS activity was modified by the simultaneous presence of other plant hormones. When kinetin was added to 100M lAA, GUS activity increased several fold compared to IAA alone, and the effect of kinetin was concentration dependent, whereas ABA and ethylene significantly suppressed the IAA-induced GUS activity (Fig. 2).

24

Green Leaf Discs

M 8 765 -Log[IAA]

4

8

6

4

2

Etiolated Seedlings

654 -Log[IAA]

Figure I. Dose dependency of Vr-ACS6 promoter activity on IAA concentration in transgenic tobacco. Tissues were treated with lAA as indicated, and GUS activity was assayed.

3

Histochemical staining of GUS activity revealed that GUS was expressed primarily in elongating hypocotyls in etiolated seedlings, and in apical buds and petiole to lamina of cotyledons in green seedlings. Root tips did not produce GUS stain. The presence of cytokinin expanded the area of staining as well as intensified the stain, and the opposite effect was observed in the presence of ABA and of ethylene. Microscopic observation of sections of the stained green cotyledons revealed that all of mesophyll cells and vascular cells were stained.

Those results indicate that the promoter region of Vr-ACS6 functioned in tobacco plant in the same manner as in mung bean plants.

~ U til

(/) :::l C) Q)

> ~ Q) a:::

Cytokinin Effect ABA Effect Ethylene Effect 30· 25 20 .

15

~ ~

10 100 uM

cP Kinetin 10 100 uM ABA

+ + 1M 100uM 1M 500 uM

Figure 2. Effects of cytokinin (kinetin), ABA and ethylene on auxin-induced activity of the Vr-ACS6 promoter in transgenic tobacco. Hypocotyl sections of etiolated mung bean seedlings were treated with plant hormones as indicated, and GUS activity was assayed.

25

4.3. STRUCTURE OF THE PROMOTER REGION OF Vr-ACS6

The promoter region of Vr-ACS6 contained multiple nucleotide sequences highly homologous to the functionally identified auxin-responsive elements (Fig. 3).

ABRECore

CACGTGGC CTATGTGGC

•• ~lIdGH3D1

Figure 3. Structure of the 1.5 kb promoter region of Vr-ACS6. Ml to M3 boxes indicate sequences conserved only in auxin-specific ACC synthase isogenes (Vr-ACS6, Cm-ACS2, Cm-ACS3 and A t-ACS4).

The 41bp sequence between -187 to -147 consisted oftwo domains homologous to the D4 and Dl domains of the soybean GH3 promoter. Soybean GH3 is an auxin-inducible gene and its promoter contains three independently functional auxin-responsive elements, Dl, D4 and El [9]. Another class of auxin-responsive element (ARE-I) is present in the parB promoter [10], and the Vr-ACS6 promoter also contained a sequence homologous to ARE-I. Tobacco protoplasts proliferate in response to auxin, and parB is a gene specifically expressed concomitant with cell growth. ARE-I has been shown to drive expression of a reporter gene in response to auxin in transgenic tobacco.

A G-box sequence, CACGTGGC, located at -110 to -104 of the Vr-ACS6 promoter is identical to the functionally identified ABA responsive element of rice rab-16A [11] and wheat Em [12]. However, application of ABA alone neither stimulated expression of Vr-ACS6 in mung bean, nor induced GUS activity in the transgenic tobacco.

We noticed 3 or 4 short sequences conserved only in auxin-specific ACS isogenes, and 3 of them, Ml to M3 were found in Vr-ACS6 promoter region.

5. Discussion

Auxin-induced ethylene production is a unique system in which interaction of plant hormones can be studied at the molecular level. The gene affected by auxin has been identified as a specific isogene of ACC synthase, and auxin inducibility of its expression was shown to be enhanced by cytokinin and suppressed by ABA or ethylene [2]. As the first step to delineate the molecular mechanism of hormonal interaction, we

26

have chosen Vr-ACS6 of mung bean, isolated its gene, and examined if its promoter region confers interactive responsiveness to auxin, cytokinin, ABA and ethylene.

A 1.5 kb promoter region of Vr-ACS6 functions in heterologous tobacco plant as we expected. GUS gene placed under control of the Vr-ACS6 promoter was efficiently expressed in a dose-dependent manner when transgenic tobacco plants were treated with auxin, and its expression was specific to auxin. Moreover, the auxin-induced expression of the chimeric GUS gene is enhanced by cytokinin, but suppressed by ABA or ethylene. These characteristics of the transgene in tobacco plant are identical to those of the native Vr-ACS6 gene in mung bean. These results indicate that the transgenic tobacco plants can be used to dissect domains in the promoter that are functional for hormonal interaction.

The 1.5 kb promoter region of Vr-ACS6 contains multiple auxin-responsive elements. Auxin-responsive elements have been functionally identified in the promoter of several auxin-responsive genes, PS-IAA4/5 [13], GH3 [9] and SAUR [14]. These genes were isolated from elongating tissues in response to auxin, and contained a conserved TGTCTC motif, which had been shown as a core element that confers auxin­responsiveness. Another class of auxin-responsive elements has been identified in dividing cells in response to auxin, and are contained in parA, parR and areA genes of tobacco. The promoter of Vr-ACS6 contains domains which are highly homologous to parR and GH3 auxin-responsive elements (Fig. 5). GH3 contains two independent auxin-responsive elements [D1 and D4). Vr-ACS6 contains two segments in tandem, each of which are homologous to D4 and Dl, respectively. Although these elements in Vr-ACS6 are yet to be functionally confirmed, high specificity of Vr-ACS6 expression to auxin may result from interaction of these multiple auxin-responsive elements.

The response of Vr-ACS6 to ABA is suppression of auxin-inducibility, but, interestingly, the gene contains a typical ABA-responsive element, CACGTGGC, that confers induced expression of particular genes. Moreover, there are two more sequences homologous to the ABA-responsive elements, albeit one is in reverse direction. However, a known ethylene-responsive element of class I chitinase gene [GCC box, TAAGAGCCGCC) is not present in Vr-ACS6.

These observations indicate that further detailed analysis of the promoter region will reveal the structural bases of the molecular mechanism ofhoromonal interaction.

6. Acknowledgement

This work was supported in part by a Grant-in-Aid for Scientific Research on Priority Area [No. 05276101 and 05276102) from the Ministry of Education, Science and Culture, Japan.

7. References

I. Nakagawa, N., Mori, H, Yamazaki, K. and Imaseki, H. (1991) Cloning ofa complementary DNA for auxin-Induced l-aminocyc1opropane-I-carboxylate synthase and differential expression of the gene by auxin and wounding, Plant Cell Physiol. 32, 1153-1163.

27

2. Yoon, LS., Mori, H., Kim, JH., Kang, E.G. and Imaseki, H. (1997) VR-ACS6 is an auxin­inducible I-aminocyclopropane-I-carboxylate synthase gene in mungbean (Vigna radiata), Plant Cell Physio/' 38, 217-224.

3. Imaseki, H. Ethylene, in PJ.J. Hookyaas (ed.) The Biochemistry and Molecular Biology of Plant Hormones, Elsevier Science, Amsterdam, (in press).

4. Botella, l.R., Schlagnhaufer, C.D., Arteca, R.N. and Phillips, AT. (1992) Identification and characterization of three putative for I-aminocyclopropane-I-carboxylate synthase from etiolated mung bean hypocotyl segments, Plant Mol. Bioi. 18,793-797.

5. Botella, JR., Schalgnhaufer, CD., Arteca, lM., Arteca, R.N. and Phillips, AT. (I 993} Identification of two new members of I-aminocyclopropane-I-carboxylate synthase-encoding multigene family in mung bean, Gene 123,249-253.

6. Kim, W.T., Silverstone, A, Yip, W.K., Dong, J.G. and Yang, S.F. (1992) Induction of 1-aminocyclopropane-I-carboxylate synthase mRNA by auxin in mungbean hypocotyls and apple cultures shoots, Plant Physio/' 98, 465-471.

7. Botella, J.R., Arteca, 1.M., Schlagnhaufer, CD., Arteca, R.N. and Phillips, AT (1995) Identification and characterization of a full-length cDNA encoding for an auxin-induced 1-aminocyclopropane-I-carboxylate synthase from etiolated mung bean hypocotyl segments and expression of its mRNA in response to indole-3-acetic acid, Proc. Nail. Acad. Sci. USA 92, 1595-1598.

8. Kim, J.H., Kim, W.T., Kang, E.G. and Yang, S.F. (1997) Induction of I-aminocyclopropane-I­carboxylate oxidase mRNA by ethylene in mung bean hypocotyls: involvement of both protein phosphorylation and dephosphorylatio in ethylene signaling, Plan I J. 11,399-405.

9. Liu, Z.E., Ulmasov. AD., Shi, T., Hagen, G. and Guilfoyle, T.1. (1994) Soybean GH3 promoter contains multiple auxin-inducible elements, Planl Ce/l6, 645-657.

10. Takahashi, Y., Sasaki, T., Ishida, S. and Nagata, T. (1995) Identification of auxin-responsive elements of parB and their expression in apices of shoot and root, Proc. Nail. Acad. Sci. USA 92, 6359-6363.

II. Mundy, J., Yamaguchi-Shinozaki, K. and Chua, N.H. (1990) Nuclear proteins bind conserved elements in the abscisic acid-responsive promoter of a rice rab gene, Proc. Nail. Acad. Sci. USA 87,1406-1410.

12. Marcotte, W.R., Russell, S.H. and Quatrano, R.S. (1989) Abscisic acid-responsieve sequence from the Em gene of wheat, Plant CellI, 969-978.

13. Ballas, N., Wong, L-M. and Theologis, A (1993) Identification of auxin-responsive element, AuxRE, in the primary indoleacetic acid inducible gene, PS-IAA4/5, of pea (Pisum sativum), 1. Mol. BioI. 233, 580-596.

14. Li, Y., Liu, \Z.E., Shi, X., Hagen, G. and Guilfoyle, T. (1994) An auxin-inducible element in soybean SAUR promoter, Plant Physiol. 106,37-43.

SEARCHING FOR THE ROLE OF ETHYLENE IN NON-CLIMACTERIC FRUITS

Cloning and Characterization of Ripening-induced Ethylene Biosynthetic Genes from Non-climacteric Pineapple (Ananas Comosus) Fruits

C.1. CAZZONELLI, A.S. CAVALLARO AND J.R. BOTELLA Plant Genetic Engineering Laboratory, Department of Botany, University of Queensland, Brisbane 4072, Australia

1. Introduction

The essential role that ethylene plays during climacteric fruit ripening has made it the focus of intense research. The cloning of an ACe synthase cDNA by Sato and Theologis [3] and subsequent production of transgenic tomatoes with reduced levels of ethylene and delayed ripening [2] opened the door to the use of molecular biology approaches to control of ripening in other climacteric fruit crops. Nevertheless, non­climacteric fruit ripening is still poorly understood and the role of ethylene remains unclear. The molecular events involved in the ripening of non-climacteric fruits have not been characterized in detail; the elucidation of these events could provide valuable insights into the difference between climacteric and non-climacteric fruits.

We are interested in understanding the role of ethylene at the molecular level during non-climacteric fruit ripening. We describe here the isolation and characterization of two ripening-induced cDNAs encoding ethylene biosynthetic enzymes in non­climacteric pineapple fruits.

2. Results and Discussion

To gain a better understanding of non-climacteric fruit ripening, pineapple was used as a model system to clone and characterize two ripening-inducible cDNAs coding for two enzymes of the ethylene biosynthetic pathway, I-aminocyclopropane-l-carboxylate CACC) synthase Cacacc-I) and I-aminocyclopropane-I-carboxylate oxidase Cacaco-l) respectively. Due to the extreme acidity and high polyphenolic content of pineapple fruits, a method was optimized for the extraction of high quality RNA from fruit tissue. Full details of the RNA isolation method can be found in Cazzonelli et al. [I].

Total RNA was isolated from ripe fruits, reverse transcribed and the cDNA used to amplify an ACC synthase fragment Cacacc-I) by PCR CRT-PCR) using degenerate oligonucleotides eEZ5, EZ6, EZ7 and EZ8) designed from several conserved regions of the ACC synthase protein family [I]. acacc-l is a 1080 bp cDNA fragment encoding 360 amino acids including 10 of the 12 amino acid residues conserved in all

29

30

aminotransferases. Comparison of the deduced amino acid sequence with previously reported ACC synthases shows between 52 and 67% similarity at the protein level.

Southern analysis suggests the presence of only one copy of acacc-I in the pineapple genome. Although some acacc-I expression is detected in green fruits, there is a 16-fold increase in the level of acacc-I in ripe fruit tissue. Some minor expression of acacc-l was also found in wounded leaf tissue [1].

RT-PCR was also used to amplify an ACC oxidase cDNA fragment (acaco-l) from ripe fruit total RNA using degenerate nucleotides (ACOI and AC03) [1]. acaco-J is a partial length cDNA clone of 611 bp which codes for 203 amino acids representing approximately 66% of the ACC oxidase open reading frame. Southern analysis suggests the presence of one or two copies of the gene in the pineapple genome. Northern analysis shows the expression of acaco-J to be highly induced in wounded leaf tissue and to a lesser extent in ripening fruit tissue [1].

To our knowledge, this is the first time that either an ACC synthase or an ACC oxidase gene has been shown to be induced during ripening of non-climacteric fruits. It is difficult to explain the significance of the fact that pineapple fruits show a similar trend of ripening enhanced expression of ACC synthase and oxidase to that observed in climacteric fruits such as tomato. There are no reports of an ethylene surge during ripening of pineapple; therefore the significance of the ripening-induced ACC synthase and oxidase genes is questionable. The literature does not presently support a role for ethylene in the control of non-climacteric fruit ripening and, although it is possible that ethylene may have some other role(s), that remains to be elucidated. Nevertheless, the fact that the genes encoding not only one but the two rate limiting enzymes of the ethylene biosynthetic pathway are induced strongly suggests that ethylene is actively produced during the ripening of pineapple fruits. It is also plausible that the existence of post-transcriptional and/or post-translational regulation of either ACACC-l or ACACO-l could limit the amount of active protein present in the tissue. The cloning of ripening-induced ACC synthase and oxidase genes from a non-climacteric fruit represents the first step towards understanding the putative role of ethylene in the ripening process of this economically important group of fruits.

3. References

1. Cazzonelli, C.I., Cavallaro, AS. and Botella, 1.R. (1998) Cloning and characterisation of ripening­induced ethylene biosynthetic genes from non-climacteric pineapple (Ananas comosus) fruits, Aust. J. Plant Physiol. 25, 513-518.

2. Oeller, P. W., Min-Wong, 1., Taylor, 1. P., Pike, D. A and Theologis, A (1991) Reversible inhibition of tomato fruit senescence by antisense RNA, Science 254, 437-439.

3. Sato, T. and Theologis, A (1989) Cloning the mRNA encoding I-aminocyclopropane-I-carboxylate synthase, the key enzyme for ethylene biosynthesis in plants, Proc. Nat. Acad. Sci., USA 86,6621-6625.

ORGANIZATION AND STRUCTURE OF l-AMINOCYCLOPROPANE-l­CARBOXYLATE OXIDASE GENE FAMILY FROM PEACH

C. BONGHI, B. RUPERTI, A. RASORI, P. TONUTTI AND A. RAMINA Department of Environmental Agronomy and Crop Science, University of Padova Agripolis, 35020 Legnaro, Padova, Italy

1. Introduction

ACC oxidase (ACO) catalyzes the last step of ethylene biosynthesis, converting 1-aminocyclopropane-I-carboxylate to ethylene. Previous work described the isolation and characterization of an ACO peach cDNA clone (pch313) [1]. Southern analysis indicated that also in peach ACO is encoded by a multigene family in which at least three members are present [4]. Herein the isolation and characterization of two (PP­ACOI and PP-AC02) of these members is reported.

2. Results

2.1. ACO GENE STRUCTURE

The screening of the peach genomic library, carried out as described by Sambrook et a/. [3], using pch313 cDNA resulted in isolation of 5 clones (A2, A5, Al 0, A12, AI9). After subcloning and sequencing it has been demonstrated that the isolated clones represent two different genes homologous to pch3 13. A5, AIO, A.l2 and AI9 contain the gene indicated as PP-ACOI, while A2 contains the gene named PP-AC02.

Comparison of the nucleotide sequence of the cloned genomic regions with the pch313 cDNA indicated that the latter is identical to PP-ACOI. PP-ACOl is organized in 4 exons inters paced by 3 introns, while PP-AC02 is lacking the second intron. The comparison of the deduced amino acid sequences of PP-ACOI and PP-AC02 reveals a 78% identity which is lower than that found within the multigene family of petunia (above 90%) and tomato (between 88 and 94%) but quite similar to that found between two members of the melon ACO gene family (CM-ACOI and CM-AC03).

2.2. EXPRESSION OF ACO GENES

Gene specific probes have been isolated in the 3' untranslated regions and used for expression analyses performed as described by Tonutti et at. [4], in different peach tissues. The maximum PP-ACOl transcript accumulation occurred in flower at

31

32

anthesis. No PP-AC02 transcript accumulation was observed in flower as well as in the fruitlet abscission zones. In these regions the PP-ACOI mRNA accumulation were observed at AZ3 level after propylene treatment. PP-AC02 transcripts were detected only at S I (early stage of fruit development), while, at ripening, only the expression of PP-ACOI was observed. Propylene treatment (48 h) performed on fruit at ripening strongly stimulated PP-ACOI transcript accumulation. The same treatment performed at SI enhanced the appearance of PP-ACOI transcript and depressed the expression of PP-AC02. In leaves ACO activity increased during senescence, following propylene treatment, and wounding. Under these conditions, a marked accumulation of PP-ACOI was observed whereas no PP-AC02 transcripts were detected. In green and etiolated epicotils, root and stem of seedlings grown in a greenhouse, a greater expression of PP­AC02 was observed in comparison to PP-ACOI.

3. Conclusion

Two members (PP-ACOI and PP-AC02) of the ACO multigene family present in peach have been isolated and characterized. PP-ACOI, similar to tomato and petunia ACO genes and to a member (CM-ACOJ) of the melon ACO gene family, has three introns and four exons. PP-AC02 has only two introns inserted in position corresponding to the first and third intron of PP-ACOI. A similar situation has been reported for CM-AC02 and CM-AC03 which, compared to CM-AC01, are lacking one intron [2]. PP-ACOI appears to be constitutively expressed in almost all the peach tissues, although biosynthesis increases during fruitlet abscission, fruit ripening and leaf senescence. PP-ACOI is up regulated by propylene. PP-AC02 transcripts were found only in vegetative tissues and in fruit during early development where propylene depresses its transcription. The different effect of propylene on PP-ACOI and PP­AC02 transcription might be imputed to Ethylene-Responsive Elements (ERE) which are present in PP-ACOI but not in PP-AC02.

4. References

I. Callahan, AM., Morgens, P.H., Wright, P. and Nichols, K.E. Jr. (1992) Comparison of Pch313 (pTOMI3 homolog) RNA accumulation during fruit softening and wounding of two phcnotipically different peach cultivars, Plant Physiol. 100,482-488.

2. Lasserre, E., Bouquin, T., Hernandez. J.A. Bull, J., Pech, J.c. and Balague, C. (1996) Structure and expression of three genes encoding ACC oxidase homolgs from melon (ClIcumis melD L.), Mol. Gen. Genet. 251,81-90.

3. Sambrook, J., Fritsch, E.F. and Maniatis, 1'. (1989) Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Laboratory, New York.

4. Tonutti, P., Bonghi, c., Ruperti, 8., Tornielli, G.B and Ramina, A (1997) Ethylene evolution and 1-aminocyclopropane- I -carboxylate oxidase gene expression during early development and ripening of peach fruit, J. Amer. Soc. Hart. Sci. 122,642-647.

METABOLISM OF l-AMINOCYCLOPROPANE-I-CARBOXYLIC ACID BY PENICILLIUM CITRlNUM

M. HONMA, Y. J. JIA, Y. KAKUTA, AND H. MATSUI Faculty of Agriculture, Hokkaido University, Sapporo 0608589, Japan

The cyclopropane amino acid, l-aminocyclopropane-I-carboxylic acid (ACC) was found in fruit juices [I] and to be a precursor of ethylene in higher plants [2]. Microorganisms are known to liberate ethylene, which is derived from 2-oxoglutarate or 2-oxo-4-methylthiobutyrate [3]. ACC has never been found in microorganisms, although 2-alkyl derivatives of ACC have been isolated from bacterial metabolites [4, 5]. A fungus Penicillium citrinum synthesized ACC and liberated a little amount of ethylene. As shown by the figure, ACC was released into the medium in the logarithmic phase of growth. The extracellular concentration of ACC reached the maximal level faster than did intracellular ACC and subsequently disappeared from the medium. The intracellular ACC reached the maximal level after the maximal mycelia growth and decreased gradually. The addition of 0.05% L-methionine in the medium raised the accumulation of intracellular and extracellular ACe.

400 r------------, r------------, 3.0

B ~

~ ';:j 300

2.0 ~

U 200 U -<:

100

.<: ~

<!:: '­o

1.0 ~ ~ o o

iIW'-=:;::'.L..-"-O<:j..o..L..-J.o-.L..-.Lo-~ 0.0 50 100 150 200 250 0 50 100 150 200 250

Time (h) Time (h)

Figure J. Formation of ACC by Penicillium cilrinum P cilrinum was cultured at 28°C under shaking in the absence (A) or in the presence (8) of 0.05% L-mcthionine in 100mi of a medium containing 0.5% glucose. 0.4% polypepton, 0.1 % yeast extract, 0.125% MgS04-7H20, 0.002% FeS04-7H20, and 1.36% KH2P04. : t:.. growth,. intracellular ACC, :0 extracellular ACe.

The results indicate the existence of enzymes related to synthesis and degradation of ACe. As ethylene liberation by P. citrinum was not affected by the addition of ACC in the medium, ACC oxidase was not thought to be involved in the ACC metabolism by P. citrinum, whereas ACC deaminase was induced by the incubation with 1% 2-aminoisobutyrate instead. ACC synthase was purified from P. citrinum grown in a medium containing 0.05% L-methionine. ACC deaminase was purified from the mycelia incubated for 72 h in a medium containing 1% 2-aminoisobutyrate. Using protein sequence data, cDNAs encoding these two enzymes were isolated and sequenced. The purified ACC synthase was a dimer of a single subunit, Mr 48,000, and

33

34

had lower catalytic constant &at (0.56 S-l) and higher Km (1.74 mM) relative to those of plant enzymes (apple: Km=12 IlM, &at=9 S-l; winter squash: Km=21 IlM, &at=21 S-l) [6, 7]. The ACC synthase was inert to S-adenosyl-L-homocysteine, S-methyl-L­methionine, L-methionine sulfoxide, and L-methionine. Several papers [8, 9] show that ACC synthase was closely related to a group of aspartate aminotransferase from the sequence profiles. The aspartate aminotransferase is a homodimer, in which the active site is shared between the subunits. Apple and winter squash ACC synthases expressed in E. coli were shown to be dirners. The result on quaternary structure of P. citrinum ACC synthase is consistent with these previous findings. About 24 to 30% of its amino acid residues were identical to those in the sequences of the plant enzymes. Most of the residues conserved in the plant ACC synthase and aspartate aminotransferase were also conserved in the P. citrinum ACC synthase. ACC deaminase purified from P. citrinum had a higher Km for ACC (4.8 mM) and higher specificity that was indicated by relative activities of3.6% of ACC activity to dl-coronamic acid and 0.7% to D-serine, compared with enzymes from other origins (Pseudomonas: 1.6 mM, 23 and 3.3% ; Hansenula saturnus : 2.6 rnM, 15.4 and 2.9%) [10, 11]. The P. citrinum ACC deaminase did not show an N-terrninal residue in protein sequencing, and the cDNA coded 360 amino acid residues. This sequence was 51% similar of to that of Pseudomonas enzyme (338 residues) and 45% to the enzyme from Hansenula saturnus (341 residues) [11, 12].

References 1. Burroughs, L. E (1957) I-Aminocyclopropane-I-carboxylic acid: a new amino-acid in perry pears

and cider apples, Nature 179,360-361. 2. Adams, D. O. and Yang, S. E (1979) Ethylene biosynthesis: identification of I-aminocyclopropane­

I-carboxylic acid as an intermediate in the conversion of methionine to ethylene, Proc. Natl. Acad. Sci. USA, 76, 170-174.

3. Lieberman, M. (1979) Biosynthesis and action of ethylene, Ann. Rev. Plant Physiol., 30, 533-591. 4. Ichihara, A., Shiraishi, K., Sato, H., Sakamura, S., Nishiyama, K., Sakai, R., Furusaki, A. and

Matsumoto, T. (1977) Structure of coronatine, J. Amer. Chem. Soc. 99,636-637. 5. Mitchell, R. E., Pirrung, C. M. and McGeeham, G. M. (1987) Absolute configuration of

norcoronatine, Phytochemistry 26, 2695-2697. 6. White, M. E, Vasquez, 1., Yang, S. E and Kirsch, 1. E (1994) Expression of apple 1-

aminocyclopropane-I-carboxylate synthase in Escherichia coli: kinetic characterization of wild-type and active-site mutant forms, Proc. Nat!. Acad. Sci. USA. 91, 12428-12432.

7. Satoh, S., Mori, M. and Imaseki, H. (1993) Monomeric and dimeric forms and the mechanism-based inactivation of I-aminocyclopropane-I-carboxylate synthase, Plant Cell Physiol. 34, 753-760,

8. Mehta, P. K. and Christen, P. (1994) Homology of I-aminocyclopropane-I-carboxylate synthase, 8-amino-7-oxononanoate synthase, 2-amino-6-caprolactam racemase, 2,2'-dialkylglycine decarboxylase, glutamate-I-semialdehyde 2,I-aminomutase and isopenicillin-N-epimerase with aminotransferase, Biochern. Biophys. Res. Commun. 198,138-143.

9. Rottmann, W. H., Peter, G. E, Oeller, P. w., Keller, 1.A., Shen, N. E, Nagy, B. P., Taylo,r L. P., Campbell, A. D. and Theologis, A. (1991) I-aminocyclopropane-I-carboxylate synthase in tomato is encoded by a multigene family whose transcription is induced during fruit and floral senescence, J. Mol. BioI. 222,937-961.

10. Honma, M., Shimomura, T., Shiraishi, K, Ichihara, A. and Sakamura, S. (1979) Enzymatic deamination of d-coronamic acid: stereoselectivity of I-aminocyclopropane-l-carboxylate deaminase,Agric. Bioi. Chern. 43,1677-1679.

II. Minami, R., Uchiyama, K., Murakami, T., Kawai, 1., Mikami, K., Yamada, T., Yokoi, D., Ito, H., Matsui, H. and Honma, M., (1998) Properties, sequence, and synthesis in Escherichia coli of 1-aminocyclopropane-I-carboxylate deaminase from Hansenula saturnus, J. Biochem. 123, 1112-1118.

12. Sheehy, R. E., Honma, M., Yamada, M., Sasaki, T., Martineau, B. and Hiatt W. R. (1991) Isolation, sequence, and expression in Escherichia coli of the Pseudomonas sp. strain ACP gene encoding 1-aminocyclopropane-I-carboxylate deaminase, J. Bacteriol. 173, 5260-5265.

STRUCTURAL MODIFICATIONS OF ACC OXIDASE DURING CATALYTIC INACTIVATION

S. RAMASSAMY', S. BIDONDE', L. STELLA2, J.e. PECH' AND A. LATCHE' 1 ENSAT, Avenue de l'Agrobiop6le BP 107, Auzeville, 31326 Castanet Tolosan Cedex, France. 2 UMR CNRS 6517, Avenue Normandie-Niemen BP 562, 13397 Marseille Cedex 20, France

1. Introduction

During the catalytic reaction, ACC oxidase (ACO) self inactivates and displays a very short half-life [I]. Functional alterations occurring through metal-catalysed oxidations are considered to be responsible for this inactivation [2). Hypothesising that chemical modifications could yield changes on the protein surface charge, we have used isoelectric focusing to study the inactivation process. This work has been performed with the apple fruit native protein and with recombinant ACO produced in S. cerevisiae. A more precise investigation has been undertaken using a pure recombinant ACO overproduced in E. coli. Peptides generated from Lys C endoprotease digestion of the active and inactive protein have been separated by HPLC and their molecular mass determined by MALDI-TOF analysis.

2. Results

After 3 and 6 h of incubation in the presence of alI co-factors and substrates, the apple and yeast proteins showed modifications of the IEF profile, whereas the SDS-PAGE profile remained unchanged (Fig. I A, B). The appearance of more acidic forms of the protein was correlated with an important decrease of ACO activity. However, the native ACO of climacteric apple already showed three forms before any incubation in the presence of exogenous substrates, indicating that the enzyme had already been modified in situ. The comparison of HPLC elution profiles obtained from endoprotease digestion of active and inactive recombinant ACO showed important modifications in the retention time of few of the 37 peaks. We were able to show that, during the inactivation process, the peptide of peak 23 was generating two new peptides with lower retention times but with an amino acid sequence exactly equivalent to the original peptide. They differed only by an increase in molecular mass of 15 and 30, respectively. The modified peptide 23 is located between amino acids 173 and 191. Interestingly it comprised histidine 177 reported to be a metalIocenter ligand.

35

36

A 301J 25

ACO activity 20

(nl.mg·1 prot .h·i ) 15 10 5 o

0.25 3 B

S06-PAGE • 38 kDa

IEF +

0.25 3

Tlmelh)

_1.8 -'.6 - ts.4

B 200 2501:] ACO activity 150

(nl.g·1MF.h-1) ~o

0.25 3 6

SOS·PAGE t~·~:+I- 36 kDa

.u IEF - 11.8

- '.7 -11.8 +

0.25

Time I")

Figure 1. Time course of structural and functional changes taking place in ACO protein during catalytic reaction. Immunoblot analysis were performed after SDS­PAGE and denaturing-IEF of protein extracts from yeast (A) and apple (B) incubated 05, 3 and 6 hours in the presence of I mM ACC, 100 /lM FeS04, 3 mM ascorbate and 10 mM NaHC03. Ethylene production was measured for 15 min. before the end of each incubation period.

3. Conclusion

We demonstrate that the catalytic inactivation of ACO is associated with a decrease in the pI of the protein, which is related to an increase of the molecular mass of some amino acids, possibly by oxidation. This subtil change in some amino acids, as well as the severe fragmentation of ACO recently reported [2] corresponds to alterations occuring during metal-catalysed oxidation. They may arise from the combination of ascorbate and transition metal ions that generate active oxygen species capable of interacting with the protein and causing covalent and functional alterations.

4. Acknowledgements

This work was supported by the Department TPV of INRA (Bursary to S. R.) and by NATO (Grant N° 930996).

5. References

L Smith, ll, Zhang, ZR, Schofield, CJ., John, P. and Baldwin, JE (1994) Inactivation of 1-aminocyclopropane-I-carboxylate (ACC) oxidase, J. Exp. Bot. 45, 1521-527.

2. Barlow, J.N., Zhang, Z., John, P., Baldwin, lEo and Schofield, CJ. (1997) Inactivation of 1-aminocyclopropane-I-carboxylate (ACC) oxidase involves oxidative modifications, Biochemistry 36,3563-3569.

3. Lay, v.J., Prescott, AG., Thomas, P.G. and John, P. (1996) Heterologous expression and site­directed mutagenesis of I-aminocyclopropane-I-carboxylate oxidase from kiwi fruit, Eur. J Biochem. 242, 228-234.

CHARACTERIZATION OF ARABIDOPSIS ETHYLENE-OVERPRODUCING MUTANTS

1. Abstract

K. E. WOESTE AND 1. 1. KlEBER Department of Biological Sciences, Laboratory for Molecular Biology, University of Illinois at Chicago, Chicago, IL 60607

We have taken a molecular genetic approach to identify elements involved in ethylene signal transduction and in the regulation of ethylene biosynthesis. Ctr mutations result in the constitutive activation of ethylene responses by disrupting ethylene signaling components. Two loci have been identified: CTR I, which encodes a protein that is similar to the Raf family of protein kinases, and clr2, mutants in which display a rosette-lethal phenotype. We have characterized CTR I protein purified from a baculovirus expression system and have found that its enzymatic properties are similar to those of Raf, including its ability to phosphorylate the MEK protein kinase. The clr2 mutation disrupts both ethylene signaling and a second, non-ethylene related pathway that is involved in cell expansion. The characterization of this mutation and progress in the cloning of CTR2, as well as the further analysis of the CTRI protein will be presented. A number of mutants affecting the regulation of ethylene biosynthesis have also been identified. One class disrupts the induction of ethylene by cytokinin. The cloning of one such On (cytokinin-insensitive) mutant revealed that the ACS5 isoform of ACC synthase is responsible for the induction of ethylene by low doses of cytokinin, and that this regulation is primarily post-transcriptional. A second class of mutants result in an elevation of the basal level of ethylene biosynthesis in etiolated seedlings. The gene corresponding to the el02 (ethylene overproducer) mutation has been cloned. This mutation disrupts the carboxy-terminal II amino acids of ACS5, suggesting that the carboxy-terminus of this protein negatively regulates its function.

2. Introduction

Ethylene biosynthesis is modulated by a diverse group of factors, including wounding, water stress, mechanostimulation, and application of other plant hormones, including auxin, cytokinin and ethylene itself and also increases dramatically during a number of developmental events such as germination, leaf and flower senescence and abscission, fruit ripening [I, 13,26]. A major mechanism in the regulation of ethylene biosynthesis is to increase the steady-state level of mRNA encoding ACC synthase [for example, see: 2, 3, 16, 17, 18, 19], the first committed and generally rate-limiting step in ethylene

37

38

biosynthesis. However, there is accumulating evidence to suggest that ACC synthase is also post-translationally regulated [IS, 16, 22, 25].

ACC synthase is encoded by a small gene family comprised of at least three to six members in the species that have been closely examined. Distinct subsets of ACS genes are expressed in response to various developmental, environmental and hormonal factors. In Arabidopsis, six ACS genes have been identified (ACSl-6), two of which are non-functional [9, 23; Woeste, Vogel and Kieber, submitted]. Inhibition of protein synthesis by cycloheximide treatment induces expression of all four functional genes, suggesting that they are under the control of a short-lived repressor [9]. Wounding, auxin, LiCI and anaerobiosis differentially induce these genes [9, II, 23]. The ACS3 gene is most likely a pseudogene and ACS] encodes a non-functional ACC synthase [10].

One approach to understanding complex circuitry regulating the numerous regulatory inputs into ethylene biosynthesis has been to isolate mutants altered in the level of ethylene production. The triple response, which is observed in etiolated seedlings treated with ethylene, has been utilized to identifY Arabidopsis mutants affected in the regulation of ethylene biosynthesis, as well as mutants disrupted in ethylene signaling [7]. The former class fall into two categories: mutants that fail to induce ethylene in response to a particular inducer [£Ytokinin-insensitive mutants, Cin; 24, 25], and mutants that overproduce ethylene [~hylene-Qverproducers, Eto; 5, 8]. These mutations identifY elements important in regulating ethylene biosynthesis in etiolated Arabidopsis seedlings. This analysis has demonstrated that cytokinin elevates ethylene biosynthesis in Arabidopsis by a post-translational modulation of ACS5 [25]. Furthermore, cloning of the gene corresponding to the et02 mutation has revealed that the carboxy-terminus of ACS5 is a negative regulator of ACS5 function [25]. Two additional Eto mutants, etol and et03, have been identified and characterized [5, 8 and K. Woeste, C. Ye and J. Kieber, submitted Here we describe a further analysis of these two mutants.

3. Isolation of Eto Mutants

We screened independent lots of ethyl methanesulfonate (EMS), diepoxybutane (DEB) and X-ray mutagenized seeds for mutants that displayed the triple response in the dark in the absence of exogenous ethylene (Fig. I). Seeds derived from more than 60,000 M, plants were screened in this manner, yielding four hundred putative mutants, of which eighteen survived, produced seeds and re-tested for this phenotype. These mutants fell into two classes: those that were revertible by inhibitors of ethylene biosynthesis and binding (Eta mutants) and those that were not [5, 8]. The latter class are affected in ethylene signaling, and are not considered here. The Eta (~hylene Qverproducing) mutants fell into three genetic loci. Nine new alleles of the recessive eta] locus and one allele each of the dominant et02 and et03 loci were identified. The reversion by inhibitors of ethylene action suggests that the seedling phenotype of the Eto mutants is due to overproduction of ethylene, a prediction that is confirmed by measurements of ethylene biosynthesis [5, 8; Table 1]. The novel eta]-3 allele produces about the same amount of ethylene as the previously-identified eta]-] allele (Table I). These Eta

39

mutations result in seedlings with elevated levels of ACC synthase activity, although the level of ACS mRNA is unaffected (K. Woeste, C. Ye and J. Kieber, submitted). This data, along with an evaluation of the interaction between various inducers of ethylene biosynthesis that act through distinct ACS isoforms, suggests that these Eta mutants are most likely affected in the post-transcriptional regulation of ACC synthase.

wt etol eto3

Figure 1. Phenotypes of three-day-old etiolated wild-type and Eta mutant Arabidapsis seedlings. Seedlings were grown for three days on MS agar in the dark at 23°C. Representative seedlings were picked and photographed.

4. Spatial Analysis of EthyleneBiosynthesis in Etiolated Seedlings

We examined the spatial pattern of ethylene biosynthesis in etiolated wild-type and etal-3 seedlings by measuring ethylene production from isolated roots, hypocotyls and combined apical hooks and cotyledons. There is only a very minor effect (~ two-fold) of wounding on ethylene biosynthesis in etiolated Arabidapsis seedlings (Woeste, Vogel and Kieber, submitted), and so wound-induced ethylene was not a major factor in this analysis. Furthermore, sections were cut under a green safe light to eliminate the effect of light on ethylene biosynthesis. In general, all tissues from etiolated wild-type seedlings make approximately the same, very low level of ethylene (Table 2). The amount of ethylene produced in this experiment by wild-type seedlings was just above the level of detection, which may obscure differences between organs. However, in etal mutant seedlings, it is clear that the majority of ethylene is produced by the apical hook/cotyledons, with the root and shoot producing much lower levels. This is similar

40

to etiolated pea and mung bean seedlings, in which the majority of ethylene is made by the apical hook [4, 20, 21]. Interestingly, etal roots and hypocotyls produced only slightly more ethylene than their wild-type counterparts, even though elongation is severely reduced in these organs in etiolated etal seedlings (Fig. I). However, even a small « two-fold) increase in ethylene biosynthesis in etiolated Arabidapsis seedlings is sufficient to reduce hypocotyl and root elongation [25], and thus the small increase observed in etal seedlings in roots and hypocotyls may be enough to inhibit elongation.

TABLE I. Ethylene biosynthesis in wild-type and Elo mutant seedlings

Genotype Mutagen Ethylene Production (pLoseedling-'oh-')"

wild-type 0.6 ± 0.5 elol-I EMS 10.4 ± 0.5 elol-3 X-ray 9.3 ± 1.6 ela3 DEB 18.5±3.2

'The ethylene that accumulated from etiolated seedlings 48-72 hours after gennination was measured as described (25). Values are the mean ± SD based on at least three replicates.

5. Gene Dosage Analysis of the eto3 Mutation

There are several possible mechanisms for the genetic dominance of the eta3 mutation [14]: the mutation could hypomorphic (Ioss-of-function) if one gene copy is not sufficient to produce a wild-type phenotype; the mutation could be hypermorphic, that is, it results in increased gene function; the mutation could be neomorphic, that is the protein is altered in such a way that it acquires a novel function; or the mutation could be antimorphic, that is acting against the function of the wild-type gene product (e. g. a dominant negative). Neither neomorphic nor hypermorphic mutations are sensitive to gene dosage: increasing the ratio of wild-type to mutant genes has no effect on the phenotype. Conversely, antimorphic mutations are sensitive to gene dosage, and so if the ratio of wild-type to mutant genes is increased, a lessening of the phenotype is observed. Additionally, if eta3 is hypermorphic, a +/+/eta3 plant should have a wild­type phenotype.

To distinguish these possibilities, we constructed a series of lines that contained different doses of the mutant allele of eta3 relative to the wild-type allele. To this end, we crossed a homozygous eta3 line to a wild-type diploid (Columbia) and tetraploid line (CS3151) and then measured ethylene production from the F I progeny, as well as from the parental lines (Table 3). This analysis is complicated by the fact that triploid Arabidapsis cells are larger than their diploid counterparts, and thus the cellular concentration of any particular gene product may not be increased in the triploid plants. Thus, to determine the effect of this and other variables resulting from triploidy that are not due to gene dosage effects, we also analyzed the eta2 mutation in this way. eta2 is a hypermorphic mutation that is the result of a single base pair insertion in the 3' end of the ACS5 coding region. This insertion results in a perturbation of the carboxy-terminal

41

eleven amino acids of ACS5, resulting in an increase in function of the ACS5 isoform, and thus an elevation of ethylene biosynthesis [25]. The phenotype of eta2 should be insensitive to gene dosage, and thus any difference in ethylene production between +/+/eta2 and +/eta2 seedlings can be attributed to the effects oftriploidy.

TABLE 2. Spatial analysis of ethylene biosynthesis in etiolated seedlings

Genotype

wild-type etal-3

Ethylene Production (pLoindividuar1024-h'l)a

seedlings roots

27 ±9 23 ± 9 317±26 38±9

shoots

21 ±9 28 ±6

hooks/cots

24± 12 198 ± 80

aSeedlings were grown for three days on MS agar as described [25]. The seedlings were cut at the root hypocotyl junction and just below the apical hook (hooks/cots) under a green safe light. Whole seedlings or sections (ten each) were placed on MS agar in GC vials and the accumulated ethylene measured 24 hours later as described [25]. Values are the mean ± SD based on two replicates. cots = cotyledons.

eta2 etiolated seedlings made 28% less ethylene when heterozygous in a triploid as compared to a diploid genetic background (Table 3). This reduction represents the effect of triploidy on an Eto mutation that should be insensitive to gene dosage and if the reduction in eta3 is greater than this, it indicates that the mutation is sensitive to gene dosage. Ethylene biosynthesis was reduced by 64% in eta3 seedlings in the triploid relative to the diploid heterozygote, which is significantly more than the reduction observed in eta2 seedlings, suggestiing that eta3 is sensitive to gene dosage. Furthermore, the +/+/eta3 seedlings still displayed an ethylene overproducing phenotype, indicating that eta3 is not the result of haploinsufficiency. Thus, eta3 is most likely the result of an antimorphic mutation, which implies that the wild-type ET03 gene product could be part of a multisubunit complex, and that the mutant protein acts to disrupt this complex).

Genotype

eta2 eta3

TABLE 3. Gene dosage analysis of dominant Eta mutants

Ethylene Production (pLo 'lo3_days'l)a -/- +/- ++/-

876 ±281 731 ± 52

418 ± 77 338 ± 64

303 ± 64 120 ± 28

Decrease in triploid het vs. diploid het.

28% 64%

a The ethylene that accumulated from etiolated seedlings 72-96 hours after germination was measured as described [25]. Values are the mean ± SD based on at least eight replicates

42

6. Acknowledgments

This work was supported by USDA Grants 95-37304 and 97-01425 and NASAINSF grant #IBN-9416017. The authors thank the Arabidopsis Stock Center at The Ohio State University for the CS3151 line.

7. References

1. Abeles, F.B., Morgan, P.w. and Saltveit, M.E., Jr. (1992) Ethylene in Plant Biology, Academic Press, Inc., San Diego, CA

2. Botella, 1.R., Arteca, R.N. and Frangos, J.A (1995) A mechanical strain-induced 1-aminocyclopropane-l-carboxylate synthase gene, Proc. Natl. Acad Sci. USA 92, 1595-1598.

3. Botella, J.R., Schlagnhaufer, C.D., Arteca, J.M., Arteca, R.N. and Phillips, AT. (1993) Identification of two new members of the l-aminocyclopropane-l-carboxylate synthase-encoding multigene family in mung bean, Gene 123,249-253.

4. Goeschl, J.D., Pratt, H.K. and Bonner, BA (1967) An effect oflight on the production of ethylene and the growth of the plumular portion of etiolated pea seedlings, Plant Physiol. 42,1077-1080.

5. Guzman, P. and Ecker, J.R. (1990) Exploiting the triple response of Arabidopsis to identify ethylene-related mutants, Plant Cell 2, 513-523.

6. Kathiresan, A, Reid, D.M. and Chinnappa, c.c. (1996) Light and temperature entrained circadian regulation of activity and mRNA accumulation of I-aminocyclopropane-I-carboxylic acid oxidase in Stellaria longipes, Planta 199, 329-335.

7. Kieber, J.J. (1997) The ethylene response pathway in Arabidopsis, Annu. Rev. Plant Physiol. Plant Mol. BioI. 48,277-296.

8. Kieber, J.J., Rothenburg, M., Roman, G., Feldmann, KA and Ecker, J.R. (1993) CTRI, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of protein kinases, Celln, 427-441.

9. Liang, x., Abel, S., Keller, JA, Shen, N.F. and Theologis, A (1992) The I-aminocyclopropane-l­carboxylate synthase gene family of Arabidopsis thaliana, Proc. Natl. Acad Sci. USA 89, 11046-11050.

10. Liang, X., Oono, Y., Shen, N.F., Kohler, c., Li, K., Scolnik, PA and Theologis, A (1995) Characterization of two members (ACSI and ACS3) of the I-aminocyclopropane-l-carboxylate synthase gene family of Arabidopsis thaliana, Gene 167, 17-24.

II. Liang, x., Shen, N.F. and Theologis, A (1996) Li+-regulated I-aminocyclopropane-l-carboxylate synthase gene expression in Arabidopsis thaliana, Plant J. 10, 1027-1036.

12. Machackova, r., Chauvaux, N., Dewitte, W. and Van Onckelen, H. (1997) Diurnal fluctuations in ethylene formation in Chenopodium rubrum, Plant Physiol. 113,981-985.

13. Mattoo, AK. and Suttle, J.C. (1991) The Plant Hormone Ethylene, CRC Press, Boca Raton, FL. 14. Muller, J.F. (1932) Further studies on the nature and causes of gene mutations, in D. F. Jones (ed.),

Proceedings of the Sixth International Congress of Genetics, Brooklyn Botanic Gardens, Menasha, pp. 213-255.

15. Nakajima, N., Nakagawa, N. and Imaseki, H. (1990) Molecular size of wound-induced 1-aminocyclopropane-I-carboxylate synthase from Cucurbita maxima Ouch. and change of translatable mRNA of the enzyme after wounding, Plant Cell Physiol. 29, 989-998.

16. Oetiker, lH., Olsen, D.C., Shiu, O.Y. and Yang, S.F. (1997) Differential induction of seven 1-aminocyclopropane-I-carboxylate synthase genes by elicitor in suspension cultures of tomato (Lycopersicon esculentum), Plant Mol. BioI. 34, 275-286.

17. Olson, D.C., Oetiker, J.H. and Yang, S.F. (1995) Analysis of LE-ACS3, a I-aminocyclopropane-I­carboxylic acid synthase gene expressed during flooding in the roots of tomato plants, J. Bio/. Chern. 270, 14056-14061.

18. Olson, D.C., White, J.A, Edelman, L., Harkins, R.N. and Kende, H. (1991) Differential expression of two genes for I-aminocyclopropane-I-carboxylate synthase in tomato fruits, Proc. Natl. Acad Sci. USA 88, 5340-5344.

43

19. Rottmann, W.H., Peter, G.F., Oeller, P.W., Keller, 1.A., Shen, N.F., Nagy, B.P., Taylor, L.P., Campbell, A.D. and Theologis, A. (1991) I-aminocyclopropane-I-carboxylate synthase in tomato is encoded by a multigene family whose transcription is induced during fruit and floral sencscence, 1. Mol. BioI. 222, 937-961.

20. Samimy, C. (1978) Effect of light on ethylene production any hypocotyl growth of soybean seedlings, Plant Physiol. 61. 771-774.

21. Schierle, 1., Rohwer, F. and Bopp, M. (1989) Distribution of ethylene synthesis along the etiolated pea shoot and its regulation by ethylene, 1. Plant Physiol. 134,331-337.

22. Spanu, P., Grosskopf: D.G., Felix, G. and Boller, T. (1994) The apparent turnover of 1-aminocyclopropane-I-carboxylate synthase in tomato cells is regulated by protein phosphorylation ·nrl.pt:t)~nf)J~nmhtia{} •• f'ht:lf.Phlyill" •. 1 !!6u;'J2, ~35 J.

23. Van Der Straeten, D., Van Wiemeersch, L., Goodman, H.M. and Van Montagu, M. (1990) Cloning and sequence of two different cDNAs encoding I-aminocyclopropane-I-carboxylate synthase in tomato, Proc. Natl. Acad. Sci. USA 1987,4859-4863.

24. Vogel, I.P., Schuerman, P., Woeste, K.W., Brandstalter, I. and Kieber, 1.1. (1998) Isolation and characterization of Arabidopsis mutants defective in induction of ethylene biosynthesis by cytokinin, Genetics 149, 417-427.

25. Vogel, I.P., Woeste, K. W., Theologis, A. and Kieber, 1.1. (1998) Recessive and dominant mutations in the ethylene biosynthetic gene ACS5 of Arabidopsis confer cytokinin insensitivity and ethylene overproduction, respectively, Proc. Natl. Acad. Sci. USA 95, 4766-4771.

26. Yang, S.F. and Hoffman, N.E. (1984) Ethylene biosynthesis and its regulation in higher plants, Annu. Rev. Plant Physiol. 35,155-189.

CONTROL OF ETHYLENE RESPONSES AT THE RECEPTOR LEVEL

1. Abstract

E.C. SISLERl AND M. SEREK2

I Department of Biochemistry, North Carolina State University, Raleigh, NC 27695, USA, 2Department of Agricultural Sciences, Horticulture, The Royal Veterinary and Agricultural University, Thorvaldsensvej 57, 1871 Frederiksberg C, Denmark

A range of compounds bind to the putative ethylene receptor. Some are agonists and mimic the effects of ethylene; some are antagonists and block ethylene action. In the past few years some particularly effective blocking agents for the ethylene receptor have been discovered. They block the receptor for up to 12 days at 25 C when provided in a single exposure and for much longer periods if exposure is repeated at 8-10 days intervals. A 24-hour exposure to 0.5 nl.l· l l-methylcycIopropene (I-MCP) protects banana fruit and carnation flowers from the effects of ethylene, but about 40 nl.l- l is required to prevent ethylene-induced inhibition of pea seedling growth and abscission in mung beans. The reason for this large concentration difference is unknown. Other cyclopropene compounds block banana ripening for shorter periods of time (3, 5, 7 or 12 days) but require higher treatment concentrations than l-MCP.

2. Introduction

The growth regulating properties of ethylene have been recognized for nearly a century. Now considered a true plant hormone, ethylene is thought to act by binding to a metal in a receptor [I]. A number of other compounds such as carbon monoxide, acetylene, and isocyanides mimic ethylene in inducing a response. Many other olefins are also active, but none are as effective as ethylene.

In 1973 Sisler and Pian [6] reported that some olefins block ethylene responses. In recent years some very effective blocking agents for the ethylene receptor have been discovered by Sisler and co workers [12,13,14]. These compounds hold the promise of providing new tools for controlling ripening, senescence and other ethylene responses. Since the ethylene receptor is ubiquitous in plants, these compounds should control all plant ethylene responses. Some aspects of receptor blocking agents have recently been reviewed [14, IS]; this paper does not attempt to review the many papers reporting effects of these compounds, but rather to report the most significant findings and uses of these interesting materials.

45

46

3. 2,5-Norbornadiene and Related Compounds

2,5-Norbornadiene (2,5-NBD) was the first of the olefins that were reported to block the ethylene receptor. To be effective, it requires continuous exposure and relatively high concentration (50 fll.l- I or higher). It has a very unpleasant odor, but it has proved useful as an experimental tool in many scientific studies of the role of ethylene in plant growth and development. A number of other cyclic olefins were also found to be effective when plants were exposed to them continuously [7]. Most required higher concentrations than 2,5-NBD, but transcyclooctene was effective at 0.8 fll.rl, a considerably lower concentration than the concentration required for 2,5-NBD [7]. None of these appear to have much commercial value in counteracting ethylene.

4. Diazocyclopentadiene

While searching for a photoaffinity label for the ethylene receptor, we synthesized diazocycIopentadiene (DACP), a compound that decomposed in the presence of light into products that were shown to block the ethylene receptor for many days following a single exposure [8, 9]. DACP is a weak inhibitor of ethylene responses, but upon irradiation with visible light gives rise to one or several much more active components. The product appears to be a gas at room temperature; however, it is very unstable and has not been identified. The product of DACP photolysis has been shown to block ripening and senescence in several crops like banana (Musa sapienlum), tomato (Lycopersicon esculentum), kiwi (Aclinidia chinensis), persimmon (Diospyros virginiana), carnation (Dianthus caryophyllus), miniature rose (Rosa hybrida) and to prevent ethylene inhibition of pea (Pisum sativum) growth [4, 8, 9, II]. It also has been shown, using the 14C-ethylene binding assay, to block the receptor in mung bean (Vigna radiata) sprouts and tobacco (Nicotiana tabacum) leaves. Table I gives some Kd values for leaves and petals in roses.

TABLE 1. Binding constants (Kd values) of rose petals and leaves obtained from Scatchard plots. The values indicated for DACP in the light represent the photolysis product of DACP after 3 hours in the light. The Kd value is the concentration of compound that will occupy 112 of the binding sites in the absence of competing ethylene.

Cultivar Treatment Value (~II·I) Petal Leaf

Cara mia Ethylene 0.16 0.14 Cara mia I"C_ Ethylene+ DACP (light) 0.34 0.39 Cara mia 14C_ Ethylene + DACP (dark) 141.00 146.00

Victory Parade Ethylene 0.12 0.11 Victory Parade I"C_ Ethylene+ DACP (light) 0.80 0.89 Victory Parade I"C_ Ethylene + DACP (dark) 208.00 200.00

47

5. Cyclopropenes

Cyclopropenes compete with ethylene for the receptor if applied at the same time as ethylene, i.e. before binding occurs, but after binding the cyclopropenes prevent ethylene binding and protect against ethylene even at very high concentrations. Some cyclopropenes are very active; treated tissues are resistant to ethylene for 10-12 days at 22°C after a single 24 hour exposure to concentrations as low as 0.5 nUl [2, 5, 12, 13], then they become sensitive to ethylene again and undergo apparently normal ripening or senescence.

5.1. I-METHYLCYCLOPROPENE

I-Methylcyclopropene is the most effective of a group of active cyclopropene compounds, based on active concentration and stability considerations. This will probably be the ethylene inhibitor of choice for the immediate future and holds considerable commercial potential. This compound is presently being registered for commercial use by Biotechnologies for Horticulture Inc., (751 Thunderbolt Dr., Walterboro, SC 29488, USA). It can be synthesized easily by those familiar with air­sensitive reagents [3]. At its active concentration (0.5 nl.1-1 on carnation), it has no detectable odor and has not been reported to have toxic properties. The longer the exposure time, the lower the required concentration [12]. Table 2 shows a considerable difference in the amount of I-MCP required for protection in different plants. I-MCP completely protects carnation and banana when they are given a 24-h exposure at 0.5 n1.1- 1. However, treatment with 40 n1.1-1 of I-MCP is required for maximum retardation of pea seedling growth. It is unclear why a much higher concentration is needed to counteract ethylene in pea tissues, but even this higher level represents a far lower amount of active substance than of the ethylene required to elicit the normal response. The length of the protection period has not been determined accurately in carnation but appears to be 12-15 days. Bananas are protected for 12 days at 22°C, but become sensitive again in 5 days at 35°C.

TABLE 2. Concentration of I-MCP necessary for maximum inhibition of the ethylene response

Species Response Exposure time (h) Concentration (nl. r')

Musa sapienturn ripening 24 0.7 Lycopersicon ripening 24 7.0 esculenturn Dianthus caryophyllus senescence 24 0.5 Pisurn sativurn growth 24 40.0 Vigna radiata abscission 24 40.0

5.2. OTHER CYCLOPROPENES

48

Cyclopropene (CP), I-MCP and 3,3-dimethyIcycIopropene (3,3-DMCP) are all active, but CP and I-MCP are about 1000 times more active than 3,3-DMCP (Table 3). All of these compounds are gases at room temperature and have no obvious odor at the concentrations needed to protect plants. Most of the studies to date have been done with I-MCP, since it is more stable than CP and more active than 3,3-DMCP.

TABLE 3. Concentration required for maximum inhibition, and time of ethylene insensitivity in Musa sapien/urn fruits

Compound

I-MCP (I-methyleyelopropene) CP (eyclopropene) 3,3-MCP (3,3-dimethylcyclopropene

Concentration nl.l·'

0.7 0.7 500

I nsens i ti v ity Days

12 12 7

It has so far not been possible to determine the length of the protection period in all cases. Some flowers may deteriorate for other reasons before they again become ethylene sensitive, thus preventing an accurate determination. Fungi may infect some plant parts before they become sensitive to ethylene after treatment with inhibitors. Banana and tomato fruit treated remain insensitive for 12 days after treatment with CP or I-MCP at 24°C, then ripen normally. When treated with 3,3-DMCP fruit remained insensitive for 7 days [13].

Bananas treated at 8-10 day intervals failed to ripen in 40 days, but decay was noted on each end of the banana. To keep fruit for extended periods of time with I-MCP treatment, it will also be necessary to control decay organisms.

TABLE 4. Inhibitory concentrations for different compounds that prevent ethylene action in plants.

Compound Plant Concentration nl ("'

2,5-NBD Banana 55.000 DACP (dark) Carnation 700.000 DACP (light) Carnation 140 I-MCP Banana 0.7 I-MCP Carnation 0.5 I-MCP Pea (growth) 40 3,3-DMCP Banana 500 3,3-DMCP Campanula 400

Table 4 shows the effect of compounds concentration in preventing ethylene action in plants. It is required a relatively high concentration of2,5-NBD to block the receptor in bananas (55.000 nU-1). Like ethylene binding, 2,5-NBD binding is an equilibrium

49

reaction, and if the 2,5-NBD is vented away, the plant materials become sensitive to ethylene in a short time. Carnations exposed to DACP in the dark require 700.000 nl.l- 1

for protection against 10 !ll.r1 ethylene, but after the DACP is pre-irradiated with fluorescent light, 140 nl.l- 1 of DACP is sufficient. Probably the unidentified photo lysed product of DACP binds more rapidly than DACP and remains bound for many days; most of the unconverted DACP comes off the receptor within 60 minutes [10].

To prevent ethylene induced ripening of bananas requires 2 nl.l-1 I-MCP for 6 h exposure or 0.7 nI.r 1 for a 24 h exposure. It is not known if it is an equilibrium reaction or not, but since the inhibition lasts for 12 days, in a practical sense it probably can be considered as a non-equilibrium reaction. It is possible thet at least part of the regained sensitivity to ethylene is due to the systhesis of new receptors. Although these values are for bananas, they can be considered approximate for most fruits and flowers.

6. Conclusions

The new gaseous receptor-level inhibitors provide an important new way to control ethylene responses for extended periods. Much remains to be learned about them, but they appear to be capable of controlling all ethylene responses in plants Why do these compounds work? It will be necessary to know how the ethylene receptor works before this can be definitively answered. They obviously prevent ethylene from binding to the receptor, but why are they not themselves active, when many structurally diverse compounds are active?

It has been proposed [14, 15] that the high strain present in these compounds causes them to bind much more tightly and longer than ethylene and ethylene agonists. It was suggested [14, 15] that for a compound to be active it must leave the binding site after an initial activation event, and ethylene antagonists do not leave rapidly enough to induce a response. This remains to be tested experimentally.

7. Future work

To date 13 cyclopropene compounds have been shown to be antagonists of ethylene although most of these have not yet been published. Some bind to the receptor for 3, 5, 7, and 12 days. This may provide a series of compounds that can be used to block the receptor for finite periods of time. This should be useful in scientific studies and possibly in commercial applications. Many more receptor blocking compounds are possible and other differences no doubt will be noted. Since these compounds bind specifically and irreversibly to the ethylene receptor, it should be possible to study the location and action of the ethylene receptor using tritium-labelled cyclopropenes. Such studies could be useful in determining how the receptor works and whether there is more than one type of receptor. These compounds may even help in identifying the metal that has been postulated as an essential cofactor in the ethylene binding site.

50

8. Acknowledgements

This work was supported by the U.S. Department of Agriculture (Bard Grant US -2786-96-R) and the Danish Ministry of Agriculture (NON93-KVL-15).

9. References

I. Burg, S.P. and Burg, E.A. (1967) Molecular requirement for the biological, activity of ethylene. Plant Physiol. 42, 144-152. .

2. Dupille, E. and Sisler, E.C (1995) Effect of ethylene receptor antagonist on plant material, in A. Ait-Oubahou and M. EI- Otmani (eds.), Postharvest Physiology, Pathology and Technologies for Horticultural Commodities, Institute Agronomique et Veterinaire Hassan ll, Agidar, Morocco. ISBN 9981-9842-2-1, pp. 294-301.

3. Magid, R. M., Clarke, T,e. and Duncan, C. D. (1970) An efficient and convenient synthesis of 1-methylcyclopropene, J. Org. Chem. 36, 1320-1321.

4. Serek, M., Sisler, E.C. and Reid, M.S. (1994) A volatile ethylene inhibitor improves the post­harvest life of potted roses, J. Amer. Soc. Hart. Sci. 119,572-577.

5. Serek, M., Sisler, E.e. and Reid, M.S. (1995) Effects of I-MCP on the vase life and ethylene response on cut flowers, Plant Growth Regul. 16,93-97.

6. Sisler, E. C. and Pian, A. (1973) Effect of ethylene and cyclic ole tins on tobacco leaves, Tab. Sci. 17,698-672.

7. Sisler, E.C. (1991) Ethylene-binding components in plants, in A. K. Mattoo and J. e. Suttle (eds.), The Plant Hormone Ethylene, CRC Press, Boca Raton, pp. 81-99.

8. Sisler, E. e. and Blankenship, S. M. (1993a) Diazocyclopentadiene (DACP) a light sensitive reagent for the ethylene receptor in plants, Plant Growth Reg. 12, 125-132.

9. Sisler, E. e. and Blankenship, S.M. (I993b) Effect of diazocyclopentadiene on tomato ripening. Plant Growth Reg. 12, 155-160.

10. Sisler, E. C; Blankenship, S.M., Fearn, J.e. and Haynes, R. (1993) Effect of diazo-cyclo­pentadiene (DACP) on cut carnations, in J.C. Pech, A. Latche and e. Balague (eds.), Cel/ular and Molecular Aspects of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrectht, pp. 182-187.

II. Sisler, E.e. and Lallu, N. (1994) Effect of Diazocyclopentadiene (DACP) on tomato fruits harvested at different ripening stages, Postharvest Bioi. and Tech. 4, 245-245.

12. Sisler, E.e., Dupille, E. and Serek, M. (1996a) Effect of I-methylcyclopropene and methylene­cyclopropane on ethylene binding and ethylene action on cut carnations, Plant Growth Reg. 18, 79-86.

13. Sisler, E.C., Serek, M. and Dupille, E. (1996b) Comparison of cyclopropenc, 1-methylcyclopropene, and 3,3-dimethylcyclopropenc as ethylene antagonists in plants, Plant Growth Reg. 18, 169-174.

14. Sisler, E.C. and Serek, M. (\997) Inhibitors of ethylene responces in plants at the receptor level: Recent developments, Physiol Plant. 100, 577-582.

15. Sisler, E.C. and Serek, M. (1998) Compounds controlling the ethylene receptor. Bot. Bull. Acad. Sinica 40, (in press).

THE ETHYLENE SIGNAL TRANSDUCTION PATHWAY

A. B. BLEECKER, A. E. HALL, F. I. RODRIGUEZ, J. J. ESCH AND B. BINDER Department of Botany, University of Wisconsin-Madison, Madison, WI 53706

1. Introduction

The molecular details of early steps in ethylene signal transduction are becoming firmly established. Many key components have been identified through the study of mutations that affect a broad range of ethylene responses in the plant. Members of the ETR gene family can cause dominant ethylene insensitivity when mutated [1]. Loss of function mutations in EIN2 and EIN3 also result in ethylene insensitivity in the plant; while loss of function mutations in the CTRI gene leads to constitutive activation of ethylene response pathways [2]. Genetic epistasis analysis indicated that the CTRI protein acts between the ETR receptors and EIN2 and EIN3 in the signal transduction chain. The genes responsible for these all of these mutant phenotypes have been cloned by a variety of techniques and the derived amino acid sequences have provided important clues as to the biochemical functions of the gene products [3]. The ETR family shows homology to the two-component histidine-kinase receptors common in bacteria. CTR 1 shows homology to eukaryotic serine/threonine protein kinases that initiate MAP kinase cascades in eukaryotes. EIN2 is related to a family of metal transporters found in eukaryotes while EIN3 represents a family of transcription factors found only in plants. These components of ethylene signaling and their evolutionary relationships are depicted in Figure I.

While function may be inferred by these interesting sequence homologies, the actual biochemical functions of these genes are being investigated by a combination of molecular and biochemical approaches. Manipulation of these gene sequences in vitro and reintroduction of the modified genes into plants and other organisms has provided methods for the testing of specific hypotheses regarding protein function. Expression of ETRI in yeast led to the discovery that the N-terminal hydrophobic domain of the protein binds ethylene with high affinity, providing unequivocal evidence that the ETR 1 protein acts directly as the receptor [4]. Both yeast two-hybrid and in vitro biochemical experiments indicate that the transmitter domain of ETR 1 can interact with the regulatory domain ofCTRI [5], providing a direct connection between these genetically related components. Little is known about the signaling role of the EIN2 protein, whereas the EIN3 protein induces constitutive ethylene responses when overexpressed in Arabidopsis, even in an EIN2 null background [6]. The EIN3 protein binds as a homodimer to a specific target sequence in the promoter of the ERFI gene, a gene in the

51

52

plant-specific EREBP family of transcription factors [7] that is rapidly induced by ethylene. Overexpression of ERFI in Arabidopsis leads to constitutive activation of some ethylene responses, providing a functional link to the ethylene signaling pathway.

ETR1 ETR2 EIN4 ERS1 ERS2

---. CTR1

Two-Component Regulators

RAF·llke MAP·klnase Cascade?

EIN2 ---. EIN3 ---. ERF1

Nramp Metal Transporter

EIUEREBP Transcrition Factors

Eukaryotes

Figure I. Genetically identified components of ethylene signal transduction and their evolutionary origin. See text for explanation.

This exciting research provides a framework for understanding the mechanism by which the ethylene signal is processed in plants. It is the goal of researchers in this field to gain a better understanding of how the identified components interact and whether there are additional components that the direct genetic approach has failed to identify.

TM Domains

P+LI .... F

GAF Domain

Kinase Domain

Response Regulator

53

ETR1

ERS1 ]

ETR2

EIN4

ERS2

Figure 2. The ETR family of ethylene receptors from Arabidopsis. The amino acid substitutions that confer dominant insensitivity to ethylene are indicated for each family member. The canonical histidine kinase subdomains are indicated where present. See text for additional explanation.

2. The ETR Family of Ethylene Receptors

There are currently 5 members of the ETR family that have been identified in Arabidopsis (Fig. 2). All members share significant sequence homology from the N­terminal ethylene-sensor domain through the histidine kinase domain. The receptor sequence is composed of recognizable domains. The ethylene binding domain is contained within the first 128 amino acids of ETR1 [8] and is composed of three hydrophobic subdomains that have been modeled as membrane spanning helicies with the topology for the disulfied-linked homodimer shown in Figure 1. Adjacent to the sensor domain is a domain that contains a GAF motif. This sequence motif has been associated with cyclic nucleotide binding sites in some proteins and with the

54

chromophore binding domain ofphytochromes [9]. The function of this domain in the ethylene receptors is unknown. The C-terminal half of the receptors shows varying degrees of sequence homology to the catalytic domains of bacterial histidine kinases. The residues thought to be essential for histidine kinase activity are conserved in ETRI and ERSI, but are not completely conserved in ETR2, EIN4 or ERS2 [10]. The latter three members of the family are also distinguished by the presence of an additional hydrophobic region at the N-terminus. This sequence has the characteristics of a membrane-targeting signal sequence. Based on these distinguishing features and on overall sequence similarity, the members of the receptor family can be divided into two subfamilies: the ETRI-like subfamily and the ETR2-like subfamily. One member of the each subfamily lacks the C-terminal receiver domain that is present in ETRI

All members of the ETR family are functionally linked to ethylene signaling by virtue of the fact that specific missense mutations in the ethylene binding domain of any one member of the family leads to dominant ethylene insensitivity that affects responses throughout the plant [1]. Most of these mutations are known to disrupt ethylene binding activity in the yeast expressed ETRI protein. Expression studies in Arabidopsis and tomato indicate that, while all family members are expressed at some level in most tissues, the relative mRNA levels of specific family members varies from tissue to tissue [10, 11].

3. Transduction of the Ethylene Signal

In the conception of models for ethylene signal transduction, several observations must be taken into account, including the genetic dominance of mutations in receptor genes, and the fact that loss of function mutations in either CTRI [2] or in a combination of three or more receptor family members [12], leads to constitutive activation of ethylene response pathways. These findings are consistent with a model in which the receptors act in concert with CTRI to repress ethylene response pathways when ethylene is not present. In other words, ethylene acts as a negative regulator, or inverse agonist, of receptor signaling--binding of ethylene would tum the receptors off. The interactions between components in this model are depicted diagrammatically in the upper portion of Figure 1.

The inverse agonist model for ethylene signaling can account for the dominance of receptor mutants by a gain-of-function mechanism. If specific mutations disrupt ethylene binding to the sensor domain of a receptor, the mutant form of the receptor could continue to signal CTRI and keep response pathways repressed even in the presence of saturating concentrations of ethylene where all wild-type forms of the receptor have been turned off. Complete loss of function mutations in anyone receptor family member do not result in an ethylene response phenotype, indicating that there is some functional redundancy between family members. Apparently, any less than three functional members of the family are insufficient to maintain CTRI in a fully active state, leading to a constitutive response phenotype in triple-null receptor mutants.

It is not yet known how CTRI represses response pathways. By sequence, CTRI is related to RAF kinase which initiates a MAP kinase cascade in mammals. Genes representing the protein-kinase components of MAP kinase cascades are found as gene

55

families in plants [13]. It is presently not known whether any of these are directly involved in ethylene signaling. The genetic evidence indicates that CTRI operates by negatively regulating the Nramp-type metal transporter coded by EIN2 [14]. EIN2 is somehow involved in the activation of the EIN3-like family of transcription factors. The biochemical connection between the membrane-located EIN2 and the nuclear­localized EIN3 is not yet known, nor is the mechanism by which EIN3 and related proteins differentially regulate target genes in response to EIN2 signaling. Overexpression of EIN3 and the target EREBP, ERFI, both lead to some constitutive ethylene response phenotypes, indicating that differential gene expression acts early in inducing aspects of ethylene response [7].

4. The Mechanism of Ethylene Binding

The binding site for ethylene is contained within the first 128 amino acids of the ETRI protein. This domain is the most conserved between different members of the family. Preliminary results indicate that the range of isoforms of the receptor is capable of binding ethylene. The most divergent homologous domain is found in the slrl2l2 gene from the cyanobacterium Synechocystis, which shows only 25% amino acid identity with the ETRI sensor domain. Nevertheless, the slrI2l2 protein is capable of binding ethylene with high affinity [8]. The function of slrl212 is unknown and is something of a mystery because Synechocystis makes only trace amount of ethylene and no response to the gas has been identified to date. Whatever its function, the homology between the cyanobaterial domain and the plant receptor domain provide clues as to which amino acid residues within the domain are essential for ethylene binding. When the hydrophobic sub domains are modeled as membrane-spanning a-helicies, conserved residues fall along a single face of the helix for helicies 2 and 3 [8]. These conserved areas are likely to represent the ethylene binding site and are targets for site-directed mutagenesis.

Insights into the mechanism of ethylene binding have been provided by the ability to express the binding domain in yeast in an active form [4]. Yeast cells show no intrinsic saturable ethylene-binding activity, nor do they synthesize significant amounts of ethylene. Expression of ETRI protein in yeast results in IOO-fold higher binding activity than that observed in plant tissues on a fresh weight basis. Equivalent levels of binding activity in yeast were obtained by expressing a fusion protein consisting of the ETRI sensor domain fused to a bacterial glutathione-S-transferase [GST] gene. This construct was used to test the long-standing hypothesis that a transition-metal cofactor mediates the binding of ethylene with its receptor [15]. Ethylene binding in membranes extracted from yeast expressing either full-length ETRI or the GST fusion protein was enhanced lO-fold by the addition of copper sulfate. Of other transition metals tested, only silver ions had a similar effect. In addition, stoichiometric amounts of copper copurified with the GST fusion protein [8].

Mutational analysis has revealed specific amino acid residues in the ethylene binding domain that disrupt ethylene binding in the yeast-expressed ETRI protein. Of particular significance are residues Cys65 and His69. Conversion of these residues to Ser and Ala respectively led to complete loss of ethylene binding. Cys65 and His69

56

align within the conserved face of the second hydrophobic subdomain when it is modeled as an a-helix, and are particularly good candidates as ligands for the copper cofactor. In support, copper did not copurify with a mutant form of the GST fusion protein in which Cys65 was converted to Tyr [8].

Based on these results, a model for ethylene perception has been proposed in which the ethylene-binding domain consists of a Cu[I] coordinated in an electron rich hydrophobic pocket formed by membrane-spanning helicies of the ETRI protein. Interaction of ethylene with the copper ion would result in a change in coordination chemistry, which, in tum would lead to a conformational change in the receptor.

5. Two Challenges for the Future

The establishment of several components of the ethylene signal transduction pathway is a major accomplishment. However, the specific mechanisms through which these components interact to produce the ethylene response behaviors observed in the intact plant have yet to be determined.

The genetic evidence indicates that the ETR family of receptors acts through a linear pathway that includes CTRI and EIN2. If this is the case, then combinations of receptor isoforms can contribute quantitatively but not qualitatively to ethylene­response pathways downstream. Do multiple receptor-isoform interactions increase the dynamic range of the system? Ethylene binding kinetics in both plants and yeast expressing single isoforms of the receptor indicate a KD for ethylene binding of less than 0.1 mVI [4], yet ethylene responses in planta show a much wider dynamic range of ethylene concentrations than predicted by simple Michaelis/Menten kinetics [16]. Do interactions between different isoforms, or subtle differences in binding affinities in different isoforms contribute to this dynamic range? Detailed physiological analysis of plants that are null for different combinations of receptor isoforms may provide the answer. Reintroduction of modified forms of the missing receptors into these receptor­null backgrounds should provide a means to test specific hypotheses regarding the mechanisms by which receptor isoforms interact.

Analysis of ethylene binding in the yeast-expressed ETRI protein has also demonstrated that the dissociation of ethylene from the receptor occurs at a very slow rate [half-life for release of bound ethylene is II hours]. This slow rate of dissociation must be reconciled with the fairly rapid recovery from ethylene responses in vivo once ethylene has been removed. For example, seedling growth recovers to pretreatment levels within 40 minutes of removal of exogenous ethylene. Using a time lapse camera system to measure short term changes in growth rates of etiolated Arabidopsis seedlings, we have verified this fast recovery rate. We are currently testing the hypothesis that recovery rates depend on synthesis of new unoccupied receptor molecules which would activate CTRI once ethylene had been withdrawn and thus repress the response pathways. This model is consistent with the observation that some receptor isoforms are induced by ethylene [17].

57

6. Acknowledgments

Research by the author is supported by the Department of Energy [ER20029.00] and the National Science Foundation [MCB-9603679].

7. References

1. Bleecker, A B. et al. (1998) The ethylene receptor family from Arabidopsis: structure and function, Phil. Trans R. Soc Land. B 353,1405-1412

2. Kieber, J . .1. et al. (1993) 1993 CTRI, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raffamily of protein kinases, Cell 72, 427-441.

3. Johnson, P. B. and Ecker, J. R. (1998) The ethylene gas signal transduction pathway, Ann. Rev. Genet. 32: 227-254

4. Schaller, G.E. and Bleecker, AB. (1995) Ethylene-binding sites generated in yeast expressing the Arabidopsis ETRI gene, Science 270, 1809-1811.

5. Clark K.1. et al. (1998) Association of the Arabidposis CTRI Raf-like kinase with the ETRI and ERS ethylene receptors, Prac. Natl. Acad. Sci. USA 95, 5401

6. Chao, Q. et al. (1997) Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE INSENSITIVE3 and related proteins, Cell 89, 1133-1144.

7. Solano, R., et al. (1998) Nuclear events in ethylene signaling: a transduction cascade mediated by ETHYLENE INSENSITIVE3 and ETHYLENE RESPONSE FACTORl, Genes Dev. 12, 3703-3714.

8. Rodriguez et al. (1999) A copper cofactor for the ETRI receptor from Arabidopsis, Science 283, 996-998

9. Aravind, 1. and Ponting, C.P. (1998) The GAF domain: an evolutionary link between diverse phototransducing proteins, Trends Biochem. Sci. 22,458-459.

10. Hua et al. (1998) EIN4 and ERS2 are members of the putative ethylene receptor gene family, Plant Cell 10, 1321-1332

11. Tieman, D. and Klee (1999) Differential expression of two novel members of the tomato ethylene receptor family Plant Physiol. 120 (in press)

12. Hua, J. and Meyerowitz, E. M. (1998) Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana, Cell 94, 261-271

13. Treisman, R. (1996) Regulation of transcription by MAP kinase cascades, Cur. Opin. Cell BioI. 8, 205-215

14. Flemming, M. D. and Andrews, N. C. (1998) Mammalian iron transport: an unexpected link between metal homeostasis and host defense, J. Lab. Clin. Med. 132,464- 468

15. Burg, S.P. and Burg, E.A.(1967) Molecular requirements for the biological activity of ethylene, Plant Physiol. 42,144-152

16. Chen, G.Q. and Bleecker, AB. (1995) Analysis of ethylene signal transduction kinetics associated with seedling-growth responses and chitinase induction in wild-type and mutant Arabidopsis, Plant Physiol. 108, 597-607

17. Wilkinson, J.Q., Lanahan, M.B., Yen, H.-C., Giovannoni, lJ. and Klee, H.J. (1995) An ethylene­inducible component of signal transduction encoded by Never-ripe, Science 270, 1807-1809

THE ROLE OF TWO-COMPONENT SYSTEMS IN ETHYLENE PERCEPTION

1. Abstract

R.L. GAMBLE, M.L. COONFIELD, M.D. RANDLETT, AND G.E. SCHALLER Department of Biochemistry, University of New Hampshire Durham, NH USA 03824

Ethylene receptors from Arabidopsis contain domains with similarity to the two­component signal transduction systems originally identified in bacteria. The ETRI ethylene receptor, for example, has both histidine kinase and response regulator domains. We are interested in how the two-component system has been adapted for signal transduction in eukaryotes and, more specifically, ethylene signal transduction in plants. In order to biochemically characterize the histidine kinase domain of ETR 1, this portion of the protein was transgenically expressed in yeast. Auto-phosphorylation was observed upon incubation with radio labeled ATP. Based on the acid/base stability of the phospho-amino acid and site-directed mutagenesis, ETR 1 was demonstrated to contain histidine kinase activity. In addition to its enzymatic function, the histidine kinase domain ofETRI bound CTRI, a Raf-like protein kinase that acts in the ethylene signal transduction pathway. This interaction occurred in ETR 1 mutants that lacked residues required for histidine kinase activity. These data suggest that the histidine kinase domain of ETRI performs both an enzymatic and a physical role in ethylene signal transduction.

2. Introduction

The means by which plants recognize and transduce the ethylene signal has only begun to be established. Several components of the ethylene response pathway have been identified by a mutational approach with Arabidopsis [I]. The ETRI gene was identified as the result of dominant mutations that rendered the plant insensitive to ethylene [2, 3]. In contrast, the CTRI gene was identified as the result of mutations in which the plant displayed a constitutive ethylene phenotype [4]. The overall significance of these two genes in ethylene signal transduction became apparent after their cloning and sequencing. The ETRI gene product is related to members of the two­component signal transduction systems from bacteria, and contains all the conserved residues required for histidine kinase activity [3]. Biochemical analysis revealed that the ETRI protein was capable of directly binding ethylene [5], which established ETRI as an ethylene receptor. Since the initial identification ofETRl, additional genes related

59

60

to ETRI have been identified in Arabidopsis [6-8], indicating that a family of receptors may participate in ethylene perception. The CTRI gene product is related to the Raf­type serine/threonine protein kinases from mammals, indicating that ethylene signal transduction feeds into a MAP kinase cascade, with CTRI representing a MAPKKK [4]. ETRI and CTRI have recently been shown to directly interact with each other [9].

The bacterial two-component systems, to which the ethylene receptors of Arabidopsis are related, confer the ability to sense and respond to variety of environmental stimuli [10-12]. These sensory systems contain two conserved domains, termed the histidine kinase and response regulator, and for this reason are referred to as two-component systems. Histidine kinase and response regulator domains can be incorporated into proteins in a variety of ways. A common strategy is to link the histidine kinase domain to a membrane-localized receptor. These bacterial receptors function as dimers and, in response to an environmental stimulus, one monomer trans­phosphorylates another on a conserved histidine residue [II]. The phosphate is then transferred to an aspartic acid residue of a response regulator, the second component in the two-component system, which mediates downstream signaling. Some of the histidine kinases also contain a phosphatase activity that facilitates turnover of the phosphoaspartic acid of the response regulator [II, 12].

The ETRI ethylene receptor contains an ethylene-binding site in its amino-terminal half, and has regions with homology to histidine kinases and response regulators in its carboxy-terminal half. We report here that ETRI has histidine kinase activity, thereby providing evidence that ETRI may function in a manner analogous to the bacterial receptors, with ethylene regulating activity of the histidine kinase domain. We also report that the histidine kinase activity of ETRI is not required for interaction with CTRI, indicating that the histidine kinase domain ofETRI performs a physical role in addition to its enzymatic role.

3. Histidine Kinase Activity of the ETRI Ethylene Receptor

The ETRI ethylene receptor has a modular structure (Fig. lA), containing an ethylene­binding domain [5] and discrete regions with homology to histidine kinases and response regulators [3]. In order to facilitate analysis of histidine kinase activity, we expressed soluble portions ofETRl, all lacking the amino-terminal domain responsible for membrane localization and ethylene binding. We hypothesized that these soluble portions ofETRI might still retain enzymatic activity. These were expressed in yeast as fusions with glutathione S-transferase (GST). The fusions were soluble, as predicted from sequence, and could be readily purified from yeast by binding to glutathione­agarose beads [13].

Assays for histidine kinase activity were then performed directly on the GST-ETRI fusion proteins while bound to the glutathione-agarose beads (Figure IB). Purified GST-ETRI fusions were incubated with radiolabeled ATP, subjected to SDS-PAGE and then blotted to nylon membrane. Incorporated radiolabel was visualized by autoradiography. GST-fusions to wild-type ETRI were found to autophosphorylate by this assay. The stability of the incorporated phosphate was then tested by treatment with acid or base as a means of assessing the type of phosphate linkage. The phospho-

61

amino acid was resistant to treatment with 3 M NaOH, but was sensitive to treatment with I M Hel, consistent with identity of the phosphoamino acid being phospho­histidine [13].

A Hydrophobic Histidine kinase RR

III IH G1 r0 GST IH G1 r0

B H D

353659 WTQ N G1

1-·d

I - In vitro phosphorylation

1----1 Anti-ETR1 Immunoblot

Figure 1. Autophosphorylation of the ETRI ethylene receptor. (A) Features of ETRI and the GST-ETRI fusion. Positions of the conserved histidine (H) residue, GI box, and aspartic acid (D) residue are shown. (B) Kinase assays perfonned with GST-ETRI fusion proteins. Assays were perfonned with wildtype (WT) protein as well as proteins containing site-directed mutations of the conserved histidine residue, aspartic acid residue, and G 1 box. The presence of protein was confinned by immunoblot. This figure is adapted from Gamble et al. [13], copyright 1998 National Academy of Sciences, U.S.A.

To further analyze the requirements for autophosphorylation, site-directed mutations were made in ETRI (Fig. IB). These mutations were of two types--either within the catalytic domain of ETRI, or of potential sites for autophosphorylation. The G I box of histidine kinases is present in the region involved in A TP binding. Mutation of the G 1 box of ETRI abolished autophosphorylation, demonstrating the necessity of this region for enzymatic activity. Mutation of the conserved histidine (His353) predicted to be the site of autophosphorylation also eliminated the incorporation of phosphate. In contrast, mutation of the aspartic acid residue (Asp659) within the response regulator domain of ETRI did not eliminate the base-resistant autophosphorylation. These results are consistent with the mechanism of two-component systems in which the initial site of phosphorylation is a conserved histidine residue within the histidine kinase domain [II].

Truncations were used to delineate the region of ETRI required for enzymatic activity [13]. We found that the portion ofETRI from amino acids 333 to 609 retained histidine kinase activity. This region contains the predicted histidine kinase domain, but

62

lacks the response regulator domain and the region upstream of the histidine kinase domain. In addition, histidine kinase activity was found to be dependent upon the presence of divalent cations [13], showing maximal activity with Mn2+, low levels of activity with Mg2+, and no detectable activity with Ca2+.

4. Interaction of ETRI with CTRI

Based on the genetic analysis of mutations in ETRl and eTRl, ETRI acts upstream of CTRI in the pathway for ethylene signal transduction [4]. Thus a member of a two­component system acts upstream of a member of a MAP kinase pathway. Such a system has similarities to the osmosensing pathway of yeast [14]. In yeast, changes in osmolarity are sensed by a membrane associated histidine kinase (SLNl), and the signal is passed through a phospho-relay among members of a two-component system to a response regulator (SSKl); the response regulator then modulates activity of SSK2, a MAPKKK acting in the HOG 1 MAP kinase cascade.

The ETRI and ERSI ethylene receptors both interact with CTRI [9]; this interaction supports the concept of a protein complex being involved in ethylene signal transduction. We have investigated the interaction between ETR 1 and CTR 1, focusing on the role that histidine kinase activity could play in this interaction.

A portion of CTRI (representing amino acids 1 to 698 of the 821 amino acid-long protein) was co-expressed in yeast along with GST or GST-ETRI fusions. GST proteins were then affinity purified by binding to glutathione-agarose beads, and the purified proteins examined by Western blot analysis using antibodies directed against GST and CTRl. We observed that CTRI co-purified with the GST-ETRI fusion protein. However, no CTRI co-purified with control yeast expressing GST, indicating a specific interaction between CTR1 and ETRl. These results confirm the previous report that the amino-terminal portion of CTR1 can interact with the histidine kinase domain ofETRI [9].

We then examined whether CTR1 could interact with GST-ETR1 fusions in which the ETRI histidine kinase domain contained mutations that affect histidine kinase actIVIty. Two mutant versions of ETRI that eliminate autophosphorylation were examined, one in which the G 1 box was mutated, the second in which the putative site of autophosphory1ation was mutated. Both these mutations eliminate autophosphorylation of ETR1 [13]. CTR1 was found to co-purify with both mutant versions of ETR1, indicating that histidine kinase activity of ETR 1 is not required for the interaction. It is not known at this point whether autophosphorylation of ETR 1 might disrupt the interaction with CTRI.

5. Implications for Ethylene Signaling

The histidine kinase activity of ETRI indicates that the protein could function in a manner analogous to two-component systems characterized in bacteria [11]. In this model, ethylene would regulate the level of histidine kinase activity within the ETR1 ethylene receptor; after autophosphorylation, the phosphate group could be passed on to

63

downstream elements in the two-component system thereby regulating their activity. In such case, one would predict the involvement of additional components in the pathway for ethylene signal transduction, specifically a separate response regulator protein and perhaps a histidine-containing phosphotransfer protein. Plants contain both response regulators [15, 16] and phosphotransfer proteins [17], but a functional role in ethylene signaling has not yet been demonstrated.

The bacterial model for signaling by two-component systems may require modification in the case of ethylene signaling. Ethylene perception in Arabidopsis involves a family of five known proteins: ETR1, ERS1, ETR2, ERS2, and EIN4 [3,6-8]. ERS 1, like ETR1, contains a histidine kinase domain in which all the residues required for activity are conserved [6]. However, the other putative ethylene receptors contain diverged histidine kinase domains that lack residues considered essential for histidine kinase activity. One can postulate several possible functions for these diverged histidine kinase domains. First, rather than having kinase activity, they might have phosphatase activity. The precedent for this proposal is that many bacterial histidine kinases also have a phosphatase activity directed at the phosphorylated response regulator [11]. The requirements for the phosphatase activity are not as stringent as the kinase activity and may be met in the sequences of ETR2, ERS2, and EIN4. Second, rather than histidine kinase activity, the diverged members of the family might have serine/threonine kinase activity. The precedent for this proposal is that several proteins with homology to histidine kinases have been demonstrated to be serine/threonine kinases [18, 19]. Evidence exists that plant phytochromes, which represent diverged histidine kinases, may function as serine/threonine kinases [20]. Third, it may be that the diverged members lack any enzymatic activity, and that the residual histidine kinase domain functions strictly as an interaction domain.

Evidence has begun to accumulate that ethylene signaling may involve formation of a complex involving both ethylene receptors and other signaling components. Notably, the CTRI protein has been demonstrated to associate with ETRI and ERS 1 [9]. Thus, the ethylene receptors perform both enzymatic and physical roles in signal transduction. Due to this interaction between proteins, it is possible that changes in activity or conformation of ETRI could serve to regulate CTRI. Such regulation could be direct or could involve additional proteins such as other members of the two-component signaling system. In yeast, osmosensing involves a two-component system that feeds into a MAP kinase pathway [14], a situation very similar to what is found in the plant ethylene-signaling pathway. How similar these two eukaryotic pathways are will have to await further dissection of the plant ethylene signaling pathway and elucidation of the precise role that two-component systems play in delivering the ethylene signal to CTR 1.

6. Acknowledgements

We thank Joe Kieber and Caren Chang for assistance with the experiments involving CTRI. We thank Tony Bleecker for sharing his insights on the mechanism of ethylene perception. The National Science Foundation (MCB-9603679) and the New Hampshire Agricultural Research Station (Hatch 386) supported this work.

64

7. References

1. Ecker, 1.R. (1995) The ethylene signal transduction pathway in plants, Science 268, 667-674. 2. Bleecker, AB., Estelle, M.A., Somerville, e. and Kende, H. (1988) Insensitivity to ethylene

conferred by a dominant mutation in Arabidopsis thaliana, Science 241, 1086-1089. 3. Chang, C., Kwok, S.F., Bleecker, AB. and Meyerowitz, E.M. (1993) Arabidopsis ethylene

response gene ETRl: Similarity of product to two-component regulators, Science 262, 539-544. 4. Kieber, J.J., Rothenberg, M., Roman, G., Feldman, KA and Ecker, 1.R. (1993) CTRI, a negative

regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of protein kinases, Cell 72, 427-441.

5. Schaller, G.E. and Bleecker, AB. (1995) Ethylene-binding sites generated in yeast expressing the Arabidopsis ETR! gene, Science 270, 1809-1811.

6. Hua, 1., Chang, e., Sun, Q. and Meyerowitz, E.M. (1995) Ethylene sensitivity conferred by Arabidopsis ERS gene, Science 269, 1712-1714.

7. Sakai, H., Hua, 1., Chen, Q.G., Chang, e., Medrano, LJ., Bleecker, AB. and Meyerowitz, E.M. (1998) ETR2 is an ETR! -like gene involved in ethylene signaling in Arabidopsis, Proc. Natl. Acad. Sci. USA 95, 5812-5817.

8. Hua, J., Sakai, H., Nourizadeh, S., Chen, Q.G., Bleecker, AB., Ecker, 1.R. and Meyerowitz, E.M. (1998) EIN4 and ERS2 are members of the putative ethylene receptor family in Arabidopsis, Plant Cell, 10, 1321-1332.

9. Clark, K.L., Larsen, P.B., Wang, X. and Chang, e. (1998) Association of the Arabidopsis CTRI Raf-like kinase with the ETRI and ERSI ethylene receptors, Proc. Nat!. Acad. Sci. USA 95,5401-5406.

10. Stock, J.B., Ninfa, AJ.,and Stock, AM. (1989) Protein phosphorylation and regulation of adaptive responses in bacteria, Microbiol. Reviews 53, 450-490.

11. Parkinson, lS. (1993) Signal transduction schemes of bacteria, Cell 73, 857-871. 12. Swanson, R.Y., Alex, L.A and Simon, M.l. (1994) Histidine and aspartate phosphorylation: two­

component systems and the limits of homology, Trends Biochern. 19,485-490. 13. Gamble, R.L., Coonfield, M.L. and Schaller, G.E. (1998) Histidine kinase activity of the ETRI

ethylene receptor from Arabidopsis, Proc. Natl. Acad. Sci. USA 95, 7825-7829. 14. Posas, F., Wurgler-Murphy, S.M., Maeda, T., Witten, EA, Thai, T.e. and Saito, H. (1996) Yeast

HOG I MAP kinase cascade is regulated by a multistep phosphorelay mechanism in the SLN 1-YPOI-SSKI "two component" osmosensor, Cell 86, 865-875.

15. Brandstatter, I. and Kieber, J.J. (1998) Two genes with similarity to bacterial response regulators are rapidly and specifically induced by cytokinin in Arabidopsis, Plant Cell 10, 1009-1019.

16. Imamura, A, Hanaki, N., Umeda, H., Nakamura, A, Suzuki, T., Ueguchi, C. and Mizuno, T. (1998) Response regulators implicated in his-to-asp phosphotransfer signaling in Arabidopsis, Proc. Natl. Acad. Sci. USA 95,2691-2696.

17. Miyata, S.-i., Urao, T., Yamaguchi-Shinozaki, K. and Shinozaki, K. (1998) Characterization of genes for two-component phosphorelay mediators with a single HPt domain in Arabidopsis thaliana, FEBS Lett. 437,11-14.

18. Popov, K.M., Kedishvili, N.Y., Zhao, Y., Shimomura, Y., Crabb, D.W. and Harris, RA (1993) Primary structure of pyruvate dehydrogenase kinase establishes a new family of eukaryotic protein kinases, J. Bioi. Chern. 268, 26602-26606.

19. Popov, K.M., Zhao, Y., Shimomura, Y., Kuntz, MJ. and Harris, R.A (1992) Branched-chain alpha-ketoacid dehydrogenase kinase: Molecular cloning, expression, and sequence similarity with histidine protein kinases,J. Bioi. Chern. 267, 13127-13130.

20. Yeh, K.-C. and Lagarias, 1.C. (1998) Eukaryotic phytochromes:Light-regulated serine/threonine protein kinases with histidine kinase ancestry, Proc. Natl. Acad. Sci. USA 95,13976-13981.

PROTEIN-PROTEIN INTERACTIONS IN ETHYLENE SIGNAL TRANSDUCTION IN ARABIDOPSIS

1. Abstract

C. CHANG, P.B. LARSEN, K.L. CLARK, c.-K. WEN, W. DING, l.A. SHOCKEY and Z. PAN Department of Cell Biology and Molecular Genetics, University of Maryland, College Park, MD 20742 USA

We are using molecular genetic approaches in Arabidopsis thaliana in order to elucidate the mechanisms of ethylene signal transduction. In particular, we are interested in understanding how the ETRI ethylene receptor and its homologs signal to the downstream protein kinase, CTRI. A starting point for addressing this question is to examine protein-protein interactions involving the receptors and CTRI. To detect protein interactions, we are utilizing the yeast two-hybrid assay as well as in vitro protein association assays. Using these methods, we are analyzing the association between the putative regulatory domain ofCTRl and the predicted cytoplasmic portions of both ETR 1 and ERS I. In addition, we have been screening yeast two-hybrid libraries in order to identify proteins that interact with the CTRI amino-terminal domain and/or the ETRI, ETR2 and ERSI ethylene receptors.

2. Introduction

A number of protein components are known to function in the ethylene-response pathway in Arabidopsis [reviewed in I]. Here, we focus on the early events of ethylene signal transduction, which involve a family of ethylene receptors and a Raf-like protein kinase called CTRI. CTRI is a negative regulator of the pathway, because CTRI loss­of-function mutations give constitutive ethylene responses in the absence of ethylene [2]. Epistasis analysis indicates that CTRI acts downstream of each of the known ethylene receptors [3].

There are five ethylene receptor genes in Arabidopsis: ETRI, ERSl, ETR2, EIN4 and ERS2. All are considered to code for ethylene receptors based on their mutant phenotypes and sequence similarities. The encoded products share a common amino­terminal domain followed by a histidine protein kinase-like domain. In addition, ETR I, ETR2 and EIN4 have a carboxyl-terminal receiver domain. The histidine protein kinase and receiver domains are the two main elements of the "two-component" signaling system, in which histidine autophosphorylation is followed by transfer of the phosphate

65

66

to an aspartate residue in the receiver domain [4]. Reversible ethylene binding [5] and in vitro histidine autophosphorylation [6] have been demonstrated for ETR 1.

The ethylene receptors fall into two classes based on their structural similarities. ETR1 and ERSl, which are in the first class, are more closely related to each other than they are to the other three. Likewise, the three in the second class are more similar to each other than they are to ETR1 and ERS 1. Notably, both ETRI and ERS 1 possess all five sequence motifs that characterize the histidine protein kinases, whereas members of the second class lack most or all of these motifs, raising doubts as to whether this class of receptors possesses histidine kinase activity.

The ethylene receptors were initially identified by dominant mutations that confer ethylene insensitivity [7-9]. When recessive loss-of-function or null mutations were subsequently isolated in the receptor genes, the individual mutants were phenotypically wild-type, indicating that the receptors have redundant functions [10]. (The ely} mutant had a slightly shorter hypocotyl [10]). When three or more receptors were knocked out, however, constitutive ethylene responses were observed [10]. This result indicates that the receptors are normally negative regulators of the pathway. Because the negative regulator CTRI acts downstream of all the receptors (based on genetic epistasis), the receptors are deduced to be positive regulators of CTRI in the absence of ethylene binding (Fig. 1). Thus, genetic analyses suggest that ethylene binding inhibits signaling by the receptors, shutting off CTRI and resulting in ethylene responses. In the dominant insensitive receptor mutants, CTR1 must somehow be kept active to repress responses.

ETR1 ERS1

C2H4 -1 ETR2 EIN4 ERS2

-.....t.,~ CTR1 ----1 responses

Figure 1. Genetic model of early events in Arabidopsis ethylene signal transduction. Ethylene binding negatively regulates the five receptors (ETRl, ERSl, ETR2, EIN4 and ERS2), which are positive regulators of the CTRI protein kinase. CTRl, in tum, acts as a negative regulator of the pathway.

This family of ethylene receptors raises a number of questions, such as why are there multiple receptors? Do they have both unique and overlapping functions? Although genetic analysis of mutant phenotypes has indicated that the receptor genes are partially redundant, it is unlikely that they are entirely redundant (as suggested by their structural differences). We are interested in: 1) how each of the ethylene receptors signals to CTR1, and 2) how these receptors might differ in their signaling functions in terms of their protein-protein interactions. To address these questions at the biochemical level, our starting point has been to examine protein-protein interactions involving the receptors and CTRI. This has led to us to analyze direct interactions between CTRl and two of the receptors, ETRI and ERSl. In conjunction with this, we are screening two-hybrid libraries in search of proteins that might interact with the predicted cytoplasmic domain of the receptors and/or the regulatory domain of CTR1.

67

3. Association of CTRl with the ETRl and ERSl Ethylene Receptors

We have employed the yeast two-hybrid protein interaction assay [11] to test whether the ethylene receptors can interact directly with the CTRI protein kinase. As we had no particular reason for expecting this to occur, we were somewhat surprised to detect an association of the N-terminal (presumed regulatory) portion of CTRI with both the ETRI and ERSI histidine kinase domain [12]. We observed these interactions using the two-hybrid assay, as well as by in vitro protein association assays [12]. Additionally, we found that the amino-terminal domain of CTRI can associate in vitro with the receiver domain ofETRI [12]. There was no detectable interaction between the CTRI kinase domain and either ETRI or ERSl [12; Clark and Chang, unpublished].

The interaction of the CTRl N-terminal domain with ETRl and ERSI is novel in that there have been no other reports of direct interactions between a serine/threonine protein kinase and a two-component signaling protein to date. A similar association has not been seen for the corresponding components of the S. cerevisiae osmolarity­response pathway [13]. This osmolarity-response pathway has parallels with the plant ethylene-response pathway in that it is comprised of a two-component phosphorelay system coupled to a MAPK cascade [14]. However, in this yeast pathway, the osmolarity sensor (SLNI) does not detectably interact with the MAPKKK (SSK2) of the pathway [13].

Our results suggest the possibility that the regulation of CTRI activity may involve novel direct interactions with the ethylene receptors in plants. We are currently working on obtaining evidence for the interaction in plant cells and determining the functional relevance of the association. Some possible mechanisms are that CTRI, like Raf, might be activated by recruitment to the membrane, or the receptors might facilitate dimerization of CTRl. Or perhaps CTRl is directly phosphorylated by the receptors. In addition, other components are likely to be involved. A very simplistic model for CTRl regulation is that there are two alternative binding states for the regulatory domain of CTRI; perhaps it either associates with the receptors or with its own kinase domain in an ethylene­dependent fashion.

We next considered the possibility that the receptor histidine kinase domain might be phosphorylated on His353 in the yeast cells, and that perhaps the CTRI association was dependent upon this phosphorylation. We used in vitro site-directed mutagenesis to replace the codon for His353, which was shown to be the site of autophosphorylation [6], with a codon for Gin in ETRl. However, we found that this amino acid substitution had essentially no effect on the two-hybrid interaction with CTRI (Table 1). This result indicates that the two-hybrid association of CTRl and ETRI does not require the His353 residue. In contrast, a pair of point mutations creating the substitutions Ser544 to Arg and Gly545 to Asp within a putative ATP binding site (the "G2" motif) of the histidine kinase domain caused a dramatic reduction in the interaction (Table 1). We verified that this loss of interaction was not due to reduced protein expression levels in the yeast cells (data not shown). There are several interpretations of this result, but the most interesting is that binding of ATP by G2 is involved in the interaction of ETRI with CTRl; conceivably, ATP could serve as an allosteric effector at this site, rather than as a hydrolyzed substrate [4].

68

Table I. Effect of amino acid substitutions on the two-hybrid interaction of CTRI with the ETRI histidine kinase (HK) and receiver (R), as measured by p-galactosidase activity (Millar units) +/­standard error.

DNA-binding domain fusion

ETRI HK+R ETRI HK+R (H353Q) ETRI HK+R (S544R + G545D) ETRI HK+R (H353Q + S544R + G545D) Vector

Activation domain fusion

CTRI N-term CTRI N-term CTRI N-term CTRI N-term CTRI N-term

p-gal units

20.2 +/-2.8 20.9 +/-4.0 0.52+/-0.05 0.48+/-0.07 0.34+/-0.05

What about the second class of ethylene receptors, which consists of ETR2, EIN4 and ERS2? Epistasis analysis indicates that CTRI acts downstream of all five receptors. We thus expected that CTRI would similarly interact with the second class of receptors. To date, however, we have been unable to detect any interaction of CTR I with different constructs of ETR2, EIN4 and ERS2. This result may reflect differences in signaling mechanisms between the two classes of receptors. The ETR2, EIN4 and ERS2 receptors lack most or all of the sequence motifs that are characteristic of histidine protein kinases, including the 02 motif (which could be why CTR 1 is unable to interact with them). Somehow, we must reconcile the apparent lack of interaction with the genetic data, which suggests that this second class of receptors does signal through CTR I. One clue may come from our recent observation that ETR2 can interact with ETRI and ERSI (Wen and Chang, unpublished). In addition, preliminary data suggests that ETR2 can form a protein complex in yeast involving both ETRI and CTRI (Wen and Chang, unpublished). Perhaps the second class of receptors, which might lack histidine kinase activity of their own, requires interactions with ETRI and/or ERSI for ethylene signaling. Although this is a highly speculative model, such communication between the receptors might explain how the dominant receptor mutations can result in severe ethylene insensitivity. For example, a mutant receptor that is locked into a state that signals the absence of ethylene might "switch" other receptors within a complex to the non-ethylene state. We are currently investigating whether ETR2 signals to CTR I via interaction with ETR I and ERS I.

4. Two-hybrid Library Screens

Despite the direct association of the receptors with CTRI, we cannot rule out the possibility that other protein components are part of the ethylene receptor complex, and playa role in ethylene signaling or its regulation. Therefore, we have been using the two-hybrid assay to screen expression libraries for proteins that interact with the ethylene receptors and/or the amino-terminal domain of CTR I. We used three different receptor bait constructs (shown in Figure 2) to screen a two-hybrid library of etiolated Arabidopsis seedling cDNAs (obtained from the Arabidopsis Biological Resource Center, The Ohio State University). Altogether, we screened several million clones.

69

We eliminated clones that either activated the two-hybrid reporter genes on their own (in the absence of the bait construct) or gave reporter gene activity in combination with human lamin (an arbitrary control for non-specific interactions). We confirmed the positives by purification of the plasmids and re-transformation of yeast. To date, we have sequenced 43 different genes encoding products that interact with ETR 1, ETR2 and/or ERSI in the two-hybrid assay. Based on their sequences, about one third have no significant similarity to sequences in the databases. Another third of the genes have sequence homology that we think is unlikely to be significant. The remaining third have sequence homologies that are of interest to us because they are either known signaling proteins or implicate crosstalk to other signaling pathways. This latter group of positives includes a GAl homolog (which is a gene involved in the gibberellic acid signaling pathway), a SNFI homolog, a GRRI homolog, and phytochrome A. Some of the products also interact with CTRI.

ETR1 or ETR2

ERS

ethylene histidine receiver bindin£! kinase

( >t t-C) ser/thr - regulatory kinase

CTR1

• ethylene histidine binding kinase

( ~

Figure 2. Protein constructs used as baits (fused to the lexA DNA-binding domain) in two-hybrid library screens for interacting components. Portions used are shown below the schematics of the full-length proteins.

We also screened the same two-hybrid library with an amino-terminal portion of CTRI as a bait (Fig. 2). Of the 28 positive clones we have sequenced to date, 21 of these encode members of the 14-3-3 protein family. These clones represent five of the ten known 14-3-3 isoforms in Arabidopsis. None of the clones display interaction with the kinase domain of CTRI nor with negative controls (data not shown). In mammals, several 14-3-3 isoforms can interact physically with Raf, and seem to playa role in Raf kinase activation [e.g., 15-17]. These findings suggest the possibility that 14-3-3 proteins have a role in the ethylene signal transduction pathway in Arabidopsis.

We are currently seeing if we can verify any of these protein interactions functionally either in plants or in heterologous systems.

5. Acknowledgements

Our research is funded by NRI Competitive Grants Program/USDA grant 98-35304-6795, Maryland Agricultural Experiment Station grant MICR-99-25, and a University of Maryland Center for Biomolecular Structure and Organization research support award. P.L is supported by NRI Competitive Grants Program/USDA postdoctoral grant 97-35304-4921.

70

6. References

1. Ecker, J.R. (1995) The ethylene signal transduction pathway in plants, Science 268, 667-674. 2. Kieber, J.1., Rothenberg, M., Roman, G., Feldmann, K.A., and Ecker, J.R (1993) CTR1, a negative

regulator of the ethylene response pathway in Arabidopsis, encodes a member of the raf family of protein kinases, Cell 72, 427-441.

3. Roman, G., Lubarsky, B., Kieber, J.1., Rothenberg, M., and Ecker, J.R. (1995) Genetic analysis of ethylene signal transduction in Arabidopsis thaliana: Five novel mutant loci integrated into a stress response pathway, Genetics 139, 1393-1409.

4. Parkinson, J.S. and Kofoid, E.C. (1992) Communication modules in bacterial signaling proteins, Annu. Rev. Genet. 26, 71-112.

5. Schaller, E.G. and Bleecker, AB. (1995) Ethylene binding sites generated in yeast expressing the Arabidopsis ETRI gene, Science 270, 1809-1811.

6. Gamble RL., Coonfield M.L., and Schaller G.E. (1998) Histidine kinase activity of the ETRI ethylene receptor from Arabidopsis, Proc. Natl. Acad. Sci. USA 95,7825-7829.

7. Bleecker, AB., Estelle, M.A., Somerville, C., and Kende, H. (1988) Insensitivity to ethylene conferred by a dominant mutation in Arabidopsis thaliana, Science 241, 1086-1089.

8. Hua, J. Sakai, H., Nourizadeh, S., Chen, Q.G., Bleecker, A B., Ecker, J. R., and Meyerowitz, E. M. (1998) EIN4 and ERS2 are members of the putative ethylene receptor gene family in Arabidopsis, Plant Cell 10, 1321-1332.

9. Sakai, H., Hua, J., Chen, Q.G., Chang, C., Medrano, L.1., Bleecker, AB., and Meyerowitz, E.M. (1998) ETR2 is an ETRI-like gene involved in ethylene signaling in Arabidopsis, Proc. Nat!. Acad. Sci. USA 95, 5812-5817.

10. Hua, J. and Meyerowitz, E.M. (1998) Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana, Cell 94, 261-271.

II. Fields, S. and Stemglanz, R (1994) The two-hybrid system: an assay for protein-protein interactions, Trends Genet. 10, 286-292.

12. Clark K.L., Larsen P.B., Wang x., and Chang C. (1998) Association of the Arabidopsis CTRI Raf­like kinase with the ETRI and ERS ethylene receptors, Proc. Nat!. Acad. Sci. USA 95, 5401-5406.

13. Posas, F. and Saito, H. (1998) Activation of the yeast SSK2 MAP kinase kinase kinase by the SSKI two-component response regulator, EMBO J. 17, 1385-1394.

14. Posas, F., Wurgler-Murphy, S.M., Maeda, T., Witten, E.A., Thai, T.C., and Saito, H. (1996) Yeast HOGI MAP kinase cascade is regulated by a multi-step phosphorelay mechanism in the SLNI­YPDI-SSKI "two-component" osmosensor, Cell 86, 865-875.

15. FantJ, W.J., Muslin, A J., Kikuchi, A, Martin, J.A, MacNicol, AM., Gross, R.W., and Williams, L.T. (1994) Activation of Raf-l by 14-3-3 proteins, Nature 371, 612-614.

16. Freed, E., Symons, M., Macdonald, S.G., McCormick, F., and Ruggieri, R. (1994) Binding of 14-3-3 proteins to the protein kinase Raf and effects on its activation, Science 265, 1713-1716.

17. Fu, H., Xia, K., Pallas, D.C., Cui, C. Conroy, K., Narsimhan, RP., Mamon, H., Collier, RJ., and Roberts, T.M. (1994) Interaction of the protein kinase Raf-l with the 14-3-3 proteins, Science 266, 126-129.

ETHYLENE SIGNALING: MORE PLAYERS IN THE GAME

1. Abstract

D. VAN DER STRAETEN, J. SMALLE, S. BERTRAND, A. DE PAEPE, I. DE PAUW, F. VANDENBUSSCHE, M. HAEGMAN, W. VAN CAENEGHEM, and M. VAN MONTAGU Laboratorium voor Genetica, Departement Genetica, Vlaams Interuniversitair Instituut voor Biotechnologie (VIB), Universiteit Gent, K.L. Ledeganckstraat 35, B-9000 Gent, Belgium

The Arabidopsis ethylene response pathway was established by characterization of ethylene mutants that were isolated exploiting the triple response of dark-grown seedlings. The various triple response screens were not yet exhaustive; however, a large number of ethylene-related loci have been identified, and for several of these an allelic series was isolated. To increase the chance of identifying new loci, screening for mutants at developmental stages other than the etiolated seedling stage might be a useful approach. We have isolated mutants from light-grown populations, by using the ethylene response of nutrient-deficient seedlings at two stages in development. Characterization of these mutants has resulted in the identification of new loci involved in ethylene signaling.

2. Introduction

By using the triple response assay for isolating ethylene mutants and subsequent double­mutant analysis, the ethylene signal was found to be perceived through several receptors (ETRI, ETR2, ERSI, ERS2, and EIN4) and to be transduced via a linear pathway to the nucleus, where the expression of a set of primary ethylene response genes is regulated [1-5]. The receptor genes have significant homology with bacterial two-component regulators.

Downstream, the signal is transduced via CTRI that encodes a Raf-Iike protein kinase [6]. All the ctrl mutations that were found are predicted to disrupt the kinase activity [6]. Furthermore, the homology of CTRI to Raf-I suggested that a MAP kinase cascade is located downstream [7].

Several facts suggest the existence of additional components in ethylene signaling. For instance, certain mutants are affected at specific developmental stages [8]. In other mutants, the effect of the mutation is related to the presence or absence of light [9]. Therefore, developmental regulation of both ethylene biosynthesis and sensing should exist. In addition, signaling pathways are unlikely merely linear and parallel to one another, but rather form a complex network that balances and fine tunes effects of

71

72

different endogenous and exogenous factors, which control downstream gene expression. Thus, hormone signaling pathways are probably integrated with those participating in phototransduction, control of the biological clock, nutrient sensing, and stress. Bearing these facts in mind, one can design novel screens not only to isolate the missing links in the currently known ethylene pathway, but perhaps also to define additional components.

3. Novel Screening Methods

In order to identify novel components in ethylene signaling, different screening methods were designed [10-1 I]. These assays would be required to identify genes that mediate ethylene effects at developmental stages other than the etiolated seedling stage. To complement the work done on triple-response mutants, assays were set-up that allow the screening of large populations of seedlings that are grown in the light, without the requirement for supplementary greenhouse space. These methods were based on the size reduction of nutrient-deficient seedlings, in combination with the stimulatory effect of ethylene or its precursor l-aminocyclopropane-I-carboxylate (ACC) on hypocotyl elongation and leaf emergence (Figs I and 2). Besides the reduction in seedling size, the smaller and more slowly emerging leaves also allowed the analysis of hypocotyl length during a longer time interval, significantly facilitating the analysis of large populations of seedlings. In both cases, insensitive and hypersensitive mutants can be screened for in the presence of the hormone, whereas constitutive mutants can be recognized in hormone-free conditions.

4. New Players in the Game?

Both the hypocotyl elongation and leaf emergence response were used in screening populations of mutant Arabidopsis seedlings, which resulted in a large collection of candidate ethylene mutants. Some of the mutants were allelic to known ethylene mutants, whereas others were identified as novel components of the ethylene response pathway (Smalle et at., in preparation).

Three lines have been characterized genetically. One of these mutants was of special interest, because its phenotype combines both an ethylene insensitive and a partially constitutive response. In the light, the hypocotyl of this mar I (acronym for mimics ACC response 1) mutant is slightly more elongated, and leaf blades are epinastic and reduced in size. In addition, newly emerging marl rosette leaves showed an increased negative gravitropic growth pattern. Dark-grown mar 1 seedlings have a partially constitutive triple response that is characterized by a thicker hypocotyl and an exaggerated apical hook. Light- as well as dark-grown marl seedlings were also less sensitive to ethylene or ACC, indicating that the amplitude of possible ethylene responses in mar I is decreased both in a negative and positive manner. The marl mutation is dominant, and epistasis analysis that uses the light-grown phenotype allowed us to position MARl in the ethylene signal transduction pathway.

The various screens also resulted in several ACC-insensitive mutants, one of which displayed a novel mutant phenotype. The ain2 mutant is strongly insensitive to both ACC

Screening for Arabidopsis mutants in the light (hypocotyllength)

Wild type

Constitutive

Figure 1. Hypocotyl elongation screen. For details on the procedure, see Smalle et al. [10].

73

and ethylene, with a dramatic delay in flowering time and leaf senescence. Normally, these characteristics accompany ethylene insensitivity; however, in contrast to all ethylene-insensitive mutants known to date, ain2 also showed a decreased shoot apical dominance, confirming previous physiological data on the role of ethylene in this developmental process [11]. Analysis of the progeny of an ain2 X ein2 cross indicated that both mutants are allelic. Strong ethylene insensitivity normally results in a decreased germination percentage, which can be further aggravated when germination is performed in the dark. This is expected to cause an underrepresentation of strong insensitive mutants in a etiolated popUlation of mutant seedlings, and may explain why mutants such as ain2 have not been isolated so far in the various triple-response screens [8, 9, 13-15]. Therefore, screening of a light-grown population of seedlings therefore is expected to increase the chance of obtaining strongly insensitive mutants.

74

Figure 2. Leaf emergence response screen. For details on the procedure, see [II].

Besides mar J and ain2 that were isolated by monitoring hypocotyl elongation of light­grown seedlings, another new ethylene-related locus was identified by screening for leaf emergence mutants. The slo mutant showed a delay at several developmental stages, including leaf emergence. Compared to the wild type, slo seedlings were less sensitive to high concentrations of ACC or ethylene. In addition, the slo mutation enhanced the ACC resistance of etrJ and ein2 mutants, indicating that SLO acts in an ACC response pathway separate from the one defined by the ETRJ and EJN2 genes. Development of slo seedlings displayed several characteristics that can be related directly to a loss of ethylene effects, including a delay in seed germination and leaf senescence, and a reduction in root hair formation and elongation. Characterization of slo in different ecotype backgrounds and in combination with the ethylene mutants etrJ, ein2, and ctrJ also indicated a role for ethylene in cotyledon formation.

5. Perspectives

A number of mutated Arabidopsis seedlings have been screened for ethylene mutants by using two novel response assays. These screens led to the identification of at least two new ethylene-related loci. The results indicate that many more ethylene-related genes await identification and suggest that the mechanism with which higher plants sense and respond to ethylene is complex and integrated into a larger network of signal transduction pathways, including the response to light, to nutrients, and also to other hormones.

75

6. Acknowledgments

This work was supported by grants from the Fund for Scientific Research (G.028 1.98 and Krediet aan Navorsers 93-96). D.V.D.s. is a Research Associate of the Fund for Scientific Research (Flanders),

7. References

1. Chang, C., Kwok, S.F., Bleecker, AB. and Meyerowitz, E.M. (1993) Arabidopsis ethylene-response gene ETRl: similarity of product to two-component regulators, Science 262, 539-544.

2. Chao, Q., Rothenberg, M., Solano, R., Roman, G., Terzaghi, W. and Ecker, J.R. (1997) Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and related proteins, Cell 89, 1133-1144.

3. Hua, J., Chang, C., Sun, Q. and Meyerowitz, E.M. (1995) Ethylene insensitivity conferred by Arabidopsis ERS gene, Science 269,1712-1714.

4. Hua, J., Sakai, S., Nourizadeh, S., Chen, Q.G., Bleecker, AB., Ecker, J.R. and Meyerowitz, E.M. (1998) EIN4 and ERS2 are members of the putative ethylene receptor gene family in Arabidopsis, Plant Cell 10, 1321-1332.

5. Sakai, H., Hua, 1., Chen, Q.G., Chang, C., Medrano, LJ., Bleecker, AB. and Meyerowitz, E.M. (1998) ETR2 is an ETRI-Iike gene involved in ethylene signaling in Arabidopsis, Proc. Natl. Acad. Scie. USA 95, 5812-5817.

6. Kieber, J.J., Rothenberg, M., Roman, G., Feldmann, K.A. and Ecker, 1.R. (1993) CTRl, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of protein kinases, Cell 72, 427-441.

7. Ecker, J.R. (1995) The ethylene signal transduction pathway in plants, Science 268, 667-675. 8. Roman, G., Lubarsky, B., Kieber, J.J., Rothenberg, M. and Ecker, J.R. (1995) Genetic analysis of

ethylene signal transduction in Arabidopsis thaliana: five novel mutant loci integrated into a stress response pathway, Genetics 139,1393-1409.

9. Guzman, P. and Ecker, J.R. (1990) Exploiting the triple response of Arabidopsis to identifY ethylene-related mutants, Plant Cell 2, 513-523.

10. Smalle, J., Haegman, M., Kurepa, J., Van Montagu, M. and Van Der Straeten, D. (1997) Ethylene can stimulate Arabidopsis hypocotyl elongation in the light, Proc. Natl. Acad Scie. USA. 94,2756-2761.

II. Smalle,1. and Van Der Straeten, D. (1997) Ethylene and vegetative development, Physiol. Plant. 100, 593-605.

12. Abeles, F.B., Morgan, P.w. and Saltveit, M.E. (1992) Ethylene in Plant Biology, 2nd ed., Academic Press, San Diego.

13. Bleecker, AB., Estelle, M.A., Somerville, C. and Kende, H. (1988) Insensitivity to ethylene conferred by a dominant mutation in Arabidopsis thaliana, Science 241, 1086-1089.

14. Harpham, N.V.J., Berry, AW., Knee, E.M., Roveda-Hoyos, G., Raskin, I., Sanders, 1.0., Smith, AR., Wood, C.K. and Hall, M.A. (1991) The effect of ethylene on the growth and development of wild type and mutant Arabidopsis thaliana (L.) Heynh, Ann. Bot. 68,55-62.

15. Van Der Straeten, D., Djudzman, A, Van Caeneghem, W., Smalle, 1. and Van Montagu, M. (1993) Genetic and physiological analysis of a new locus in Arabidopsis that confers resistance to I-aminocyclopropane-I-carboxylic acid and ethylene and specifically affects the ethylene signal transduction pathway, Plant Physiol. 102,401-408.

THE EFFECT OF ETHYLENE AND CYTOKININ ON GTP BINDING AND MAP KINASE ACTIVITY IN ARABIDOPSIS THALIANA

1. Abstract

A.R. SMITH\ I.E. MOSHKOy2, G.Y. NOYIKOYA2 AND M.A.HALLI Ilnstitute of Biological Sciences, University of Wales, Aberystwyth, UK. 2Timiryazev Institute of Plant Physiology, Russian Academy of Sciences, Moscow, Russia

Current evidence suggests that ethylene signal transduction is mediated through protein phosphorylation . While ethylene has been shown to promote protein phosphorylation, incubation with cytokinin antagonises this effect in Triton X-I 00 solubilised membrane fractions from rosette leaves of Arabidopsis. In etr, protein phosphorylation is lower than wild type and is promoted by cytokinin. Protein phosphorylation in the mutant ctr is not only much higher than in wild type but is different in pattern. Ethylene treatment results in increased GTP binding to a monomeric G-protein in wild type membrane extracts. Constitutive GTP binding in etr is lower than in wild type. MAP kinase activity in cytosolic fractions is increased by ethylene and cytokinin antagonises this effect. In etr, MAP kinase activity is lower than in wild type but in ctr activity was enhanced. Hence, it is proposed that ethylene signal transduction, at least in part, involves small GTP-binding proteins in the mediation of a MAP kinase cascade.

2. Introduction

Enormous strides have been made over the last decade in identifying ethylene receptors and components of the ensuing transduction chain. Much of this progress has arisen from the use of Arabidopsis mutants and there is now a wide range of these where the mutated genes are well defined.

Less well defined however are the consequences of these mutations in vivo, both in terms of physiology and of biochemistry. It is already clear that there exists a family of ethylene receptors the relative functionality of which is unknown and that the transduction chain(s) is complex. Moreover, it is becoming increasingly clear that interactions occur between transduction chains for different hormones [8, 17] and that this may also be the case in relation to the transduction processes for stress responses [6, 15, 2, 3, 12] and responses to pathogens [18, 10]. In such circumstances, the consequences of inactivating individual components are unpredictable.

We describe here some investigations on aspects of the ethylene transduction chain using the Arabidopsis mutants etr. ctr and eti5 [I, 7, 5].

77

78

150

"e 125 E

a 100 0

c 0

G 75 ~

~ lI- 50

-i ~ 25 ...

o - wild typo • - oti5 E3 - etr

Figure 1. In vitro protein phosphorylation in 130kg membranes from Arabidopsis leaves. Ethylene was applied at a concentration of I III 1"1 for I h and 10" M BAP was added to the homogenisation buffer.

kDa: 94 67 43

30

20.1 -

14.4-

wild type cfr

Ethylene: - +

Figure 2. In vitro protein phosphorylation in membranes of ethylene-treated and untreated wild type and untreated ctr leaves.

79

3. Signal transduction

3.1. PROTEIN PHOSPHORYLATION

It has been demonstrated by our group and others that ethylene treatment of tobacco [16] peas [13] and Arabidopsis [17] leads to increased protein phosphorylation. Moreover, the CTRI gene shows strong homology with Raf I [7] (a MAPKK Kinase) and possesses the appropriate biochemical activity [9]. Thus, protein phosphorylation in 130kg membranes from Arabidopsis leaves was measured and the results are shown in Figure 1. The effect of ethylene in promoting phosphorylation is clear; benzyladenine (BAP) has little effect alone but strongly antagonises the ethylene effect.

As noted previously [17] consitutive protein phosphorylation is higher in eti 5 than in wild type and is promoted by BAP. In etr on the other hand, protein phosphorylation is below that found in wild type but is promoted by cytokinin. The pattern of phosphorylation is similar in each case.

In etr by contrast, protein phosphorylation is not only much higher than in wild type but the pattern is strikingly different (Fig. 2).

3.2. GTP BINDING

We have demonstrated that both in peas and in Arabidopsis [14,17] ethylene treatment leads to increased GTP binding (using a)2p GTP affinity labelling) and that such binding is associated with small monomeric G-proteins. In eti5 constitutive GTP binding is higher than in wild type but in etr the constitutive level of GTP binding is very low indeed (Fig. 3). In other work we have shown that the specific receptor­directed inhibitor methylcyclopropene (MCP) antagonises the ethylene-induced increases in GTP binding. Moreover, in peas we have found that the activation of GTP binding by ethylene can be detected within 10 min [4].

kOa 43

30

20.1-

14.4-123

Figure 3. GTP binding to Triton X-IOO solubilised l30kg membrane fractions from wild type (I), eti5 (2) and etr (3) Arabidopsis leaves.

80

KDa

94

87

43

30 -

+

Figure 4. In-gel protein kinase assay using MBP as the substrate of cytosolic fractions from ethylene-treated and untreated wild type Arabidopsis leaves.

3.3. MAP KINASE ACTIVITY

As noted in section 2.1, ethylene significantly upregulates protein phosphorylation in Arabidopsis and, as a result of this observation we have investigated the effect of ethylene on protein kinase activity in wild type and measured constitutive activity in the mutants. Figure 4 shows the result of an in-gel assay from ethylene-treated and untreated leaves using myelin basic protein (MBP) as substrate. Clearly, most activity is observable at ca. 47kDa and there is a substantial promotion by ethylene. A comparison of constitutive protein kinase activities in wild type and the three mutants is shown in Figure 5. In this case MBP phosphorylating activity was measured in samples

30

20.1

14.4

Figure 5. Constitutive in vitro MBP phosphorylation of ERKI immunoprecipitated proteins from cytosolic extracts.

81

immunoprecipitated by antibodies raised to a conserved sequence from ERK 1 (extracellular signal related kinase, a MAP kinase). The activity in etr was lower than in wild type, but higher in eti5 and ctr - in the latter case very much higher.

In further experiments cytosolic proteins from wild type leaves treated or not with ethylene were probed with antibodies raised to either the phosphorylated (on tyrosine) or non-phosphorylated forms of MAP kinase. The results are shown in Figure 6.

kDa 1 2 3 4 1 2 3 4

57

46.5-

37.5-

Figure 6. Western blot of cytosolic proteins from wild type Arabidopsis leaves. A probed with antibodies to non-phosphorylated MAP kinase. B: probed with antibodies to phosphorylated MAP kinase. Lanes I - non-phosphorylated MAP kinase control protein, 2 - phosphorylated MAP kinase control protein, 3 - cytosolic extract from untreated leaves and 4 - cytosolic extract from ethylene-treated leaves.

The specificity of the two kinds of antibody is clearly shown; both recognise nonphosphorylated MAP kinase markers whereas the antibody to phosphorylated MAP kinase recognises only phosphorylated MAP kinase. It is evident that the antibody to phosphorylated MAP kinase recognises proteins at about 47 kDa and the signal is much stronger in the ethylene treatment.

4. Discussion

The results described here tend to confirm previous suggestions that ethylene responses in Arabidopsis may be mediated, at least in part, by small GTP-binding proteins and protein phosphorylation cascades, within which latter MAP kinases playa role.

It is perhaps surprising that no ethylene sensitivity mutants have yet been characterised having a lesion in small GTP-binding proteins. The reason for this may lie either in functional redundancy or, since such G-proteins are key elements (in animals at least [11]), lethality. However, the fact that in etr constitutive GTP binding is very low provides compelling evidence that GTP binding is part of the ethylene signal transduction chain since such a reduction would be expected in a system where the receptor is disabled which is known to be the case for etr. Equally, the fact that MCP antagonises the ethylene effect on GTP binding and that the latter is activated very rapidly by the growth regulator provides strong support for a role for small monomeric

82

G-proteins. While we have not yet proved that the protein kinases involved are indeed MAP kinases sensu strictu, several lines of evidence suggest that this is indeed so, namely the facts that MBP is a superior substrate to histone and casein, that the activity is precipitated by antibodies to a MAP kinase (ERK 1), and that western blots using antibodies raised to phosphorylated MAP kinase demonstrate the upregulation, as do phosphotyrosine antibodies. Both MAPKK kinases and MAPK kinases can phosphorylate MBP but the latter are unlikely to be involved here because they phosphorylate on serine and threonine and the former are much larger proteins than those shown to be activated in this work.

The most unexpected result in the present work was the observation that in the clr mutant both protein phosphorylation and protein kinase activity are higher than in the wild type. It has hitherto been supposed that the lesion in the CTR protein led to inactivation but our data suggest another possible explanation namely that the mutation leads to constitutive activation leading to upregulation of MAP kinase as we have shown. This would not be surprising since such a scenario is well established in animals, indeed Raf proteins were first discovered through an acutely transforming murine retroviral oncogene product (v-Rat) which was a constitutively activated form of its normal cellular homologue cRafl. Clearly, if activation of CTR by ethylene is the normal transduction response then increased activity in ctr might well lead to the phenotype observed in the mutant. There are of course other explanations - for example that inactivation of CTR indirectly affects other Raf genes and gene products (of which there are at least two others in Arabidopsis).

Whatever the true explanation it is clear that the lesion in the ctr mutant does not lead to a down regulation of protein phosphorylation and protein kinase activity as had previously been suggested [7] but rather the reverse.

It seems likely that the reason for the various apparent contradictions may lie in the probable complexity of the transduction chain. In all other eukaryotes so far studied such chains show interactions, branches and feedback and there is no reason to suppose that plants will be less complex. Indeed, we ourselves have shown here and elsewhere [17] that treatment of cell-free preparations from Arabidopsis leaves with cytokinin very rapidly antagonise the upregulation by ethylene of protein phosphorylation, small GTP­binding proteins and protein kinase activity. Hence, if this scenario is indeed the case for ethylene signal transduction it is likely that manipulation of a single component of such chains will have far-reaching and complex consequences in vivo.

5. Acknowledgements

We acknowledge the support of the EU INCO-COPERNICUS programme.

6. References

I. Bleecker, AB., Estelle, M.A, Somerville, AS. and Kende, H. (1988) Insensitivity to ethylene conferred by a dominant mutation in Arabidopsis thaliana, Science 241, 1086-1089.

83

2. Bogre, L., Ligterink, W., Meskiene, I., Barker, P.J., Heberle-Bors, E., Haskisson, N.S. and Hirt, H. (1997) Wounding induces the rapid and transient activation of a specific MAP kinase pathway, Plant Cell 9,75-83.

3. Ellinger-Ziegelbauer, H., Brown, K., Kelly, K. and Seibenlist, U. (1997) Direct activation of the stress-activated protein kinase (SAPK) and extracellular signal related protein kinase (ERK) pathway by an inducible mitogen-activated protein kinase/ERK kinase kinase 3 (MEKK) derivative, J. BioI. Chem. 272, 2668-2674.

4. Hall, M.A., Smith, A.R., Novikova, G. V. and Moshkov, I.E. (1998) Ethylene signal transduction in relation to hormone sensitivity, Plant Biology. In press.

5. Harpham, N.V.J., Berry, AW., Knee, E.M., Roveda-Hoyos, G., Raskin, I., Sanders, 1.0. Smith, AR., Wood, C.K. and Hall, M.A. (1991) The effect of ethylene on the growth and development of wild type and mutant Arabidopsis thaliana (L.) Heynh, Ann. Bot. 68,55-61.

6. Jonak, V., Keigerl, S., Ligterink, W., Barker, P.J., Huskisson, N.S. and Hirt, H. (1996) Stress signalling in plants: A mitogen-activated protein kinase pathway is activated by cold and drought, Proc. Nat!. Acad. Sci. USA, 93, 11274-11279.

7. Kieber, J.J., Rothenberg, M., Roman, G., Fellman, K.A. and Ecker. J.R. (1993) CTRI, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raj family of protein kinases, Cell 72, 427-441.

8. Knctsch, M.L.W., Wang, M. and Snaar-Jagaiska, B.E. (1996) Abscisic acid induces mitogen­activated protein kinase activity in barley aleurone protoplasts, Plant Cell 8, 1061-1067.

9. Li, H., Huang, Y. and Kieber, 1.1. (1998) Biochemical and molecular characterisation ofCTRI, a protein kinase involved in ethylene signalling, 9th Int. Conf. on Arabidopsis Research, University of Wisconsin - Madison, June 24-29, 1998, Abstract 409.

10. (http://genome-www.stanford.edu/Arabidopsis/madison981). II. Ligterink" W., Kroj, T., Nieden, U., Hirt, H. and Scheel, D. (I997) Receptor-mediated activation

of a MAP kinase in pathogen defence of plants, Science 276, 2054-2057. 12. Lowy, D.R. and Willumsen, B.M. (1993) Function and regulation of Ras, Ann. Rev. Biochem. 62,

851-891. 13. Mizoguchi, T., Ishimura, K. and Shinozaki, K. (I997) Environmental response in plants: the role of

mitogen-activated protein kinases, Tibtech. 15, 15-19. 14. Novikova, G.V., Moshkov, I.E., Smith, AR. and Hall, M.A. (1993) Ethylene and phosphorylation

of pea epicotyl proteins, J.c. Pech, A Latche and C. Balague (eds.), Cellular and Molecular Aspects oJthe Plant Hormone Ethylene, Kluwer Academic Publichers, Dordrecht, pp. 371-372.

15. Novikova, G.V., Moshkov, I.E., Smith, AR. and Hall, M.A. {I 997) The effect of ethylene on GTP­binding in extracts from pea epicotyls, Planta 201, 1-8.

16. Popping, B., Gibbons, T. and Watson, M.D. (1996) The Pisum sativum MAP kinase homologue (PsMAPK) rescues the Saccharomyces hogJ deletion mutant under conditions of high osmotic stress, Plant Mol. BioI. 31, 355-363.

17. Raz, V. and Fluhr, R. (1993) Ethylene signal is transduced via protein phosphorylation events in plants, Plant CellS, 523-530.

18. Smith, AR., Berry, AW., Harpham, N.V.J., Hemsley, R.J., Holland, M.G., Moshkov, I.E., Novikova, G.V. and Hall, M.A. (1997) Ethylene signal perception and transduciton, in AK. Kanellis, C. Chang, H. Kende and D. Grierson (eds.), Biology and Biotechnology oj the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 77-86.

19. Suzuki, K. and Shinshi, H. (1995) Transient activation and tyrosine phosphorylation of a protein kinase in tobacco cells treated with a fungal elicitor, Plant Cell 7,639-647.

ETHYLENE AND METHYL JASMONATE INTERACTION AND BINDING MODELS FOR ELICITED BIOSYNTHETIC STEPS OF PACLITAXEL IN SUSPENSION CULTURES OF TAXUS CANADENSIS

1. Abstract

M. PHISALAPHONG AND J.e. LINDEN Department of Chemical and Bioresource Engineering, Colorado State University, Fort Collins, CO 80523, USA

Ethylene and methyl jasmonate (MJ) act as co-mediators of defined cellular responses in many plant systems. We postulate that specific biosynthetic steps for taxane production are regulated by allosteric regulation of ethylene binding, based on our absorption and induction modeling of pacIitaxel formation in elicited suspension cell cultures of Taxus canadensis. Binding sites for ethylene on cellular membranes from many plant genera have been established for years, and recently the transmembrane ethylene receptor protein, ETR 1, has been characterized as a two-component regulator. In attempting to model this system, we view a two-step process: MJ absorption in the membrane is directly related to MJ concentration, but its interaction with ETRI is effective only at higher concentrations. Hence, at low MJ concentrations (0-20 11M), the unmodulated ethylene binding blocks induction of enzymes that either synthesize 3-phenylisoserine and/or add the sidechain to the baccatin III ring. Sigmoidal plots of pacIitaxel and 7-xylosyl-IO-deacetyltaxol productivity versus MJ concentration indicates allosteric modulation of ethylene binding by MJ. At medium to high MJ concentrations (200-400 11M), the modulation site is saturated, and no greater productivities are seen. These data logically fit an induction model described by Mirjalili and Linden [22]. Dependence on ethylene concentration is observed (27) 10>7>3 f..lLlL) in baccatin III accumulation, but 7-xylosyl-1O-deacetyltaxol and taxol in the culture medium are maximized using continuous 7 f..lLlL headspace (estimated 70 nM dissolved) ethylene, that is supplied independently to replicated shake flasks using flow along with uniform 10 (v/v) % oxygen and 0.5 (v/v) % carbon dioxide (balance nitrogen) from a gas mixing station.

2. Introduction

Higher plants are suppliers of indispensable raw materials and drugs in the food and pharmaceutical industries. Among these is Taxol® (generic name pacIitaxel), which has been approved by the FDA for use in treatment of lung, ovarian and breast cancers; clinical trials are underway for treatment of other cancers. While many academic and

85

86

industrial research groups around the world are pursuing plant cell culture route of production, Phyton (Ithaca, NY) is leading the development of a plant cell culture process for production of pac lit axel. With their German subsidiary, Phyton Gesellschaft fur Biotechnik GmbH, a large scale (75 m3) process is being developed [6] under license to Bristol-Meyer Squibb, which recently committed $25 million for commercial production within the next five years. If successful, this process could be the technological foundation for other plant cell culture processes.

Our past work has identified approaches that enhance paclitaxel productivity in cell culture, which established complex interdependence of ethylene and methyl jasmonate (MJ) in affecting paclitaxel biosynthesis [17]. Concentrations of pac lit axel increase in a manner roughly proportional to MJ concentration (see below for discussion of allosteric relationship). The level of enhancement is dependent on ethylene concentration; optimally paclitaxel production after three weeks of growth was enhanced 30-fold over unelicited conditions using headspace gas concentrations of 0.5% CO2, 15% O2 and 7 ppm ethylene with 200 JlM MJ elicitation 8 days after culture transfer.

Through experiments described here, the understanding of the ethylene/MJ interaction is refined. T canadensis cultures are exposed to various ethylene concentrations from 0 to 20 ppm) in the heads pace continuously. MJ concentrations from 0 to 400 JlM) are added in replicated fashion to each set of cultures, and after two weeks the culture media are analyzed for taxane composition and concentration. Reproducible results from independent experiments demonstrate baccatin III concentrations are relatively unaffected compared to changes in paclitaxel levels, which increase in a manner directly proportional to the ethylene concentration. Insight to paclitaxel biosynthesis is solidified through model validation and possible interpretations are made about ethylene binding to membrane receptors.

3. Co-mediation of Ethylene and Methyl Jasmonate

The role of ethylene is difficult to understand because effects vary with developmental stage and because low concentrations can promote a process, whereas higher levels have the opposite effect [9]. Continuous presence of 7 ppm headspace ethylene (an estimated 70 nM dissolved concentration in the culture medium [17]) results in greater levels of paclitaxel than at higher ethylene concentrations. Statistical modelling data of Mirjalili and Linden [16] demonstrate the optimal concentration of ethylene for paclitaxel production between 5 and 8 ppm headspace concentration. Using optimum headspace concentrations for oxygen, carbon dioxide at 15 (v/v) percent and 0.5 (v/v) percent, respectively, were also provided using a gas mixing apparatus described [16], ethylene concentrations at or greater than 50 ppm were shown to have inhibitory effects on paclitaxel production [17].

Similarly, MJ-induced rosmarinic acid biosynthesis in Lithospermum erythrorhizon cell suspension cultures is optimal at 0.1 mM concentration of MJ; distinct inhibition occurred at higher concentrations [6]. Plant pathogen-related (PR) defense genes are synergistically induced by ethylene and methyl jasmonate. Recently ethylene was found to be involved in wound-induced gene activation in tomato, in which it acts together with MJ to regulate expression of the protease inhibitor pin2 gene [18]. A

87

correlation can be established between sensitivity to MJ and the accumulation of the transcripts in systemic tissues upon wounding [18]. Polyphenylalanine lyase activity and coumarin derivative synthesis are regulated by ethylene and methyljasmonate [14]. Xu et al. speculate the binding of ethylene to its receptors on the plasma membrane sensitize hypothetical MJ receptors on the membrane [28].

Methyl jasmonate is one of several mediators derived from lipids in the cell membrane that represent an important class of elicitors. Examples are described by Farmer [7, 25], Porat and coworkers [19], Saniewski et al. [4,20,24] and others [12, 23]. We first showed that MJ could enhance paclitaxel production [17]. Other groups continue to study MJ, [15,29]; the best reported case caused production of 112 mgIL of paclitaxel. The control cultures, with no MJ, produced about 1 mglL [15].

25,----------------------------------,

20 M J added

15

~10 1 5

o 5 10 15 20 25

-+-1().[Et1CET'rl­BA£::CAlNUI

-ill- BA£::CAlN II

-f1r- 7-X'rlCS'Il..-1Q. I:FPCET'r1... TAXa..

-+-TAXa..

Figure 1. Time course kinetics oftaxane formation by a suspension culture of Taxus cuspidata

Figure 1 represents typical time course kinetics of taxane formation by a suspension culture of Trocus cuspidata in which MJ was added eight days after culture transfer. Subsequent results presented in this paper are from cultures grown under conditions of optimal headspace concentrations at 23°C in darkness with rotary shaking at 125 rpm and harvested after 21 days of growth (14 days after elicitation). Paclitaxel was identified based on retention time identity with standards obtained from Hauser Chemical Research, Inc. (Boulder, CO) and routinely analyzed as described elsewhere [16].

4. Biosynthesis Inhibition by Methyl Jasmonate

As noted above, inhibition by MJ on paclitaxel production was observed especially at MJ concentrations greater than 200 ~M. Inhibition effects of MJ could be expressed in mathematical terms by the following equation.

88

Pobserved - Ppredicted

Ppredicted

( [MeJA] )Y - [MeJA]max

where for Figures 2 and 3, P = paclitaxel concentration. [MJ]max = 200 11M MJ, and y = a power constant that averaged 2.6 ± 0.3 from all ofthe measurements in this system.

The comparison of experimental data with the binding model and the combined binding and inhibition model are shown in Figures 2 and 3; dashed lines represent the binding model and the solid lines represent the binding model combined together with inhibition effect. Data in Figures 2A, 2C and 2D fit the binding/inhibition model better than the allosteric binding model over the range of MJ concentrations from 0-200 11M. The results in Figure 2B demonstrate that no inhibition is observed at 200 11M MJ when the ethylene concentration is 7.4 ppm.

These data are supported by an additional experiment when ethylene is held at 6 ppm and MJ concentrations are varied from 0-400 11M. Data in Figure 3 shows a close fit with the simple binding model from 0-200 11M, as seen in Figure 2B. Inhibition is then apparent at MJ concentrations greater than 200 11M. The seemingly anomalous, but of repeated observation over many years with many Taxus cell lines, of optimal paclitaxel productivity at 5-8 ppm ethylene is then perhaps explained by this co­mediation analysis.

5. Allosteric Relationships

The allosteric relationship mentioned above is seen more clearly from the results of another experiment. Twelve MJ concentrations (0-400 11M) were provided to all of the cultures at one ethylene concentration (6 ppm), one oxygen concentration (15 (v/v) percent) and one carbon dioxide concentration (0.5 (v/v) percent). Hill plots between MJ and normalized concentrations of both paclitaxel demonstrate respective linear log­log relationships for all data points but the lowest (0.5 11M) and the two greatest (300 and 400 11M) MJ concentrations where inhibition occurs (Fig. 4). The linear relationships are defined by the Hill equation, which in general form is, inhibition by MJ on paclitaxel production was observed especially at MJ concentrations greater than 200 11M. Inhibition effects of MJ could be expressed in mathematical terms by the following equation.

20

:i15 a. ~10 .. .. !:. 5

20

20

.:. 15

o 10 .. .. !:.

C2H4· 3.7 ppm __ 8 Ind Ing + Inh ib iUo n

.... exp data (3.7 ppm)

- - Bin ding mode I ................. __ ........... _ ..... _ ..... -....... __ .. -.-.... -.-.-... ~--------------I

o 50

CZH4 =7.4 ppm

50

C2H4 = 10.6 ppm

-- ---100 150

--

--200

~ - -- ;

i ---!

250

I ----100 1 50 200 250

M J (u M )

--Bindin g+lnhibiti on ... exp data (10.6 ppm)

- -B indlng mode I

-------o ~~._~~--------~------~--------~------~

o 50 100 150 200 250

C2H4=27.6 ppn

~ ,.......................................................................................................................................................................................................................................... , ---~15 t-------------------~~~.,==--====~==--~-------l .:. --10 t-----------~~~---------------~~~~

1 ~ 5t--------A.,~----------------------------~

o~~ .. ~--,---------_r-------r--------~--------~ o 150 200 250

MJ(uM)

89

Figure 2. Comparisons of experimental data with the binding and inhibition models at four ethylene concentrations: 3.7 ppm (SA); 7.4 ppm (58); 10.6 ppm (5C); and 27.6 ppm (5D).

90

109(~) = n log[ L] + log[ K] l-Y

where for Figure 4, Y = [paclitaxel] / [paclitaxel]max L = MJ concentration, n = the number of ligands bound, and K = the binding constant

The Hill plots (Fig. 4) illustrate induced paclitaxel production at one of the observed conditions (6.0 ppm headspace concentration of ethylene for concentrations between 0 and 400 IlM MJ). All data sets from other experiments were similarly analyzed; the number of bound MJ ligands calculated from the slope of the Hill plots in each experiment was between 2 and 3. The number of bound ligands (n) and binding constant (K) from all observed treatments are summarized in Table I. The value of n increases in non-linear means with ethylene concentration (7.4 <10.4 < 3.7 <27.6); recall that at 7.4 ppm ethylene optimum production occurs. We view the bound ligand in this case could represent MJ binding nonspecifically in plasma membrane, as discussed below.

Table 1. The number of bound ligands (n), binding constant (K) and inhibition factor (y) based on analysis of paC\itaxel data from all observed treatments.

Experiment set I Ethylene Bound ligand Binding const Inhibition (ppm) (n) (K) factor (y) 3.7 2.45 2.09x 10-0 2.6 7.4 2.10 3.72x 10.5 2.6 10.6 2.45 5.37x 10-0 2.6 27.6 3.10 1.00x 10-0 2.6

Experiment set II Ethylene Bound ligand Binding const Inhibition (ppm) (n) (K) factor (y) 6.0 2.09 1.20x 10-0 2.6

Another possible significance of these constants may relate MJ to ethylene interaction with receptors in ETRI. The effect of ethylene on the kinetic parameters of the model is shown in Table I. At concentrations of ethylene lower or higher than the optimal point (7.4 ppm in this study), a lower binding constant (K <10-6) is observed than at the optimal ethylene concentration (K> 10-6). The number of bound ligands (n) was slightly higher and approached 3 at non-optimal ethylene concentrations. The physical model of ETRI from the characterization work of Chang et al. [1], Chen and Bleecker [2], Wilkinson et al. [26] and W oltering et al. [27] coincidentally places two

91

ethylene molecules per homodimer two-component receiver. The allosteric model was developed assuming homodimeric receptors.

o 100 200

MJ(uM)

300 400

... 7-Xylosyl-l0-Deacetyl Taxol

III Taxol

- -Binding Model

-Binding+lnhibit

Figure 3. Comparison of experimental data with binding and inhibition models at optimum ethylene concentration and MJ concentrations greater than for Figure 2.

6. Discussion

Three possible rate limiting processes could be envisioned for the dual substrate pathway for paclitaxel biosynthesis. Ethylene and MJ interaction could be affecting a limitation due to enzyme activity, precursor availability or substrate delivery to specific organelles [3]. Direct effects on anyone or more of these three possibilities seems unlikely; indirect effects through signal transduction pathways is consistent with our hypothesis based on binding modelling and allosteric effects. Our literature review has uncovered nothing about MJ receptors or MJ binding constants. On the other hand, binding sites for ethylene on cellular membranes from many plant genera have been established for years with kinetic evidence for two polypeptides with different binding affinities [11,13], and recently the transmembrane ethylene receptor protein, ETRI, has been characterized [9]. In attempting to model this system, we view a two-step process: MJ absorption in the membrane is directly related to MJ concentration, but its interaction with the ethylene binding site, ETRI, is effective only at higher concentrations. Hence, at low to high MJ concentrations, the ethylene effect is dependent on the MJ concentration. Sigmoidal plots of pac1itaxel productivity versus MJ concentration are found, as described above. This allosteric behavior indicates modulation of ethylene binding by MJ. At medium to high MJ concentrations, the modulation site is saturated, and no greater productivities are seen.

The initial steps of the signal pathway for ethylene are at least known to have similarity to two-component regulators of eukaryotes [22]. Each component contains a conserved domain and a variable domain. Most sensor proteins consist of a variable amino-terminal domain (typically located in the periplasmic space flanked by two transmembrane domains) and a conserved carboxyl-terminal histidine kinase domain located in the cytoplasm. Signal perception on the N-terminal domain results in autokinase activity by the transfer of the phosphate from the histidine to a certain

92

aspartate residue in the cognate cytoplasmic response regulator [9].

0,5 1,5 2 2,5 -0.54_-----------------__l

s:-~ -1,5 4_------tL!'"-1l,=lL---cE~----__l

~ ~ ~4----------~~------__l

.9 -2,5 -l---------~L-----------I

log(MJ)

Figure 4. Hill plot for calculating allosteric parameters relating paclitaxel productivity to MJ concentration.

MJ may act as an "ethylene sensitivity factor" in modulation of ethylene binding to ETR1, which initiates the intracellular signal cascade that results, ultimately, in the accumulation of secondary compounds. The mode of action may involve non-specific dissolution of MJ in the membranes, decrease in the order of regions of the phospholipid bilayer, and direct alteration of ethylene binding to ETRI. This sort of phenomena has been suggested as lipid activation of enzymes resulting from interactions with annulus phospholipids that surround the membrane-embedded portion of many proteins [5,8,10,21].

7. Conclusions

Ethylene and methyl jasmonate (MJ) act as co-mediators of cellular responses in many plant systems. We postulate that specific biosynthetic steps for taxane production in plant cell culture are regulated by allosteric regulation of ethylene binding, based on our interaction and binding modeling of paclitaxel formation in elicited suspension cell cultures of T canadensis. This allosteric behavior could, but not necessarily, indicate modulation of ethylene binding by MJ.

8. Acknowledgements

The authors wish to thank the National Science Foundation Engineering Directorate Project BES-9702582 for support and M.L. Shuler (Cornell University) and D.M. Gibson (USDA/ ARS at Ithaca, NY) for cell cultures and helpful discussions.

93

9. References

1. Chang, C., Kwok, S.F., Bleecker, AB. and Meyerowitz, E.M. (1993) Arabidopsis ethylene-response gene ETRI: similarity of product to two-component regulators, Science 262, 539-544.

2. Chen, Q.G. and Bleecker, AB. (1995) Analysis of ethylene signal-transduction kinetics associated with seedling-growth response and chitinase induction in wild-type and mutant Arabidopsis, Plant Physiol. 108,597-607.

3. Ciddi, v., Srinivasan, V. and Shuler, M.L. (1995) Elicitation of Taxus sp. cell cultures for production oftaxoi. Biotechnology Letters 17, 1343-1346.

4. Czapski, l, Horbowicz, M. and Saniewski, M. (1992) The effect of methyl jasmonate on free fatty acids content in ripening tomato fruits, Bioi. Plant. 34, 71-76.

5. Dewitt, N.D., Hong, B., Sussman, M.R. and Harper, IF. (1996) Targeting of two Arabidopsis H+-ATPase isoforms to the plasma membrane, Plant Physiol. 112,833-844.

6. DOrnenburg, H. and Knorr, D. (1995) Strategies for the improvement of secondary metabolite production in plant cell cultures, Enzyme and Microbial Technol. 17,674-684.

7. Farmer, E.E. (1994) Fatty acid signalling in plants and their associated microorganisms, Plant Mol. Bioi. 26, 1423-1437.

8. Fauth, M., Schweizer, P., Buchala, A, Markstaedter, c., Riederer, M., Kato, T. and Kauss, H. (1998) Cutin monomers and surface wax constituents elicit H20 2 in conditioned cucumber hypocotyl segments and enhance the activity of other H20 2 elititors, Plant Physiol. 117, 1373-1380.

9. Gamble, RL., Coonfield, M.L. and Schaller, G.E. (1998) Histidine kinase activity of the ETRI ethylene receptor from Arabidopsis, Proc. Nat!. Acad Sci. U. S. A 95, 7825-7829.

10. Harper, IF., Binder, B.M. and Sussman, M.R. (1993) Calcium and lipid regulation of an Arabidopsis protein kinase expressed in Escherichia coli, Biochemistry 32,3282-3290.

11. Harpham, N.VJ., Berry, AW., Holland, M.G., Moshkov, I.E., Smith, AR. and Hall, M.A. (1996) Ethylene binding sites in higher plants, Plant Growth Regul. 18,71-77.

12. Holbrook, L., Tung, P., Ward, K., Reid, D.M., Abrams, S., Lamb, N., Quail, J.W. and Moloney, M.M. (1997) Importance of the chiral centers of jasmonic acid in the responses of plants, Plant Physiol. 114,419-428.

13. Holland, M.G., Berry, AW., Cowan, V.S.L., Harpham, N.V.J., Hemsley, RJ., Moshkov, I.E., Novikova, G.V., Smith, AR. and Hall, M.A. (1996) Ethylene perception and hormonal signal transmission in higher plants, Fiziologiya Rastenii (Moscow) 43, 22-30.

14. Kauss, H., Krause, K. and Ieblick, W. (1992) Methyl jasmonate conditions parsley suspension cells for increased elicitation of phenylpropanoid defense responses, Bioch. Biophys. Res. Com. 189, 304-308.

15. Ketchum, RE.B., Gibson, D.M., Croteau, R. and Shuler, M.L. (1998) The kinetics of taxoid accumulation in cell suspension cultures of Taxus following elicitation with methyl jasmonate, Biotech. Bioengin. [in press].

16. Mirjalili, N. and Linden, lC. (1995) Gas phase composition effects on suspension cultures of Taxus cuspidata, Biotech. Bioengin. 48, 123-132.

17. Mirjalili, N. and Linden, lC. (1996) Methyl jasmonate induced production of taxol in suspension cultures of Taxus cuspidata: Ethylene interaction and induction models, Biotechn. Progress 12, 110-118.

18. O'Donnell, PJ., Calvert, C., Atzom, R, Wastemack, C., Leyser, H.M.O. and Bowles, DJ. (1996) Ethylene as a signal mediating the wound response of tomato plants, Science 274,1614-1917.

19. Porat, R, Halevy, AH., Spiegelstein H, Borochov, A Botha, L. and Whitehead, C.S. (1996) Short­chain saturated fatty acids in the regulation of pollination-induced ethylene sensitivity of Phalaenopsisjlowers, Physiol. Plant. 97,469-474.

20. Saniewski, M. and Wegrzynowicz L.E. (1994) - Is ethylene responsible for gum formation induced by methyl jasmonate in tulip stem? J. Fruit Ornam. Plant Res. 2, 79-90.

21. Schaller, G.E., Harmon, AC. and Sussman, M.R (1992) Characterization of a calcium and lipid-dependent protein kinase associated with the plasma membrane of oat, Biochemistry 31, 1721-1727.

22. Schaller, G.E. (1997) Ethylene and cytokinin signalling in plants: the role of two-component systems, Essays Biochem. 32, 10 1-111.

94

23. Titarenko, E., Rojo, E., Leon, 1. and Sanchez-Serrano, 1.1. (1997) Jasmonic acid -dependent and -independent signaling pathways control wound-induced gene activation in Arabidopsis thaliana, Plant Physiol. 115,817-826.

24. Urbanek, H., Bergier, K., Saniewski, M. and Patykowski, 1. (1996) Effect of jasmonates and exogenous polysaccharides on production of alkannin pigments in suspension cultures of Alkanna tinctoria, Plant Cell Reports 15. 637-641.

25. Weber, H., Vick, B.A, and Farmer, E.E. (1997) Dinor-oxo-phytodienoic acid: a new hexadecanoid signal in thejasmonate family. Proc. Natl. Acad. Sci. U.S.A 94.10473-10478.

26. Wilkinson, 1.Q., Lanahan, M.B., Yen, H.C., Giovannoni, J.J. and Klee, H.J. (1995) An ethylene-inducible component of signal transduction encoded by never-ripe, Science 270. 1807-1809

27. Woltering, E.J., van der Bent, A, de Vrije, GJ. and van Amerongen, A (1997) Ethylene: Interorgan siganling and modeling of binding site structure, in AK. Kanellis, C. Chang, H. Kende, and D. Grierson, (eds.) Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 163-173.

28. Xu, Y., Chang, P.L., Liu, D., Narasimhan, M.L., Raghothama, K.G., Hasegawa, P.M. and Bressan, R.A (1994) Plant defense genes are synergistically induced by ethylene and methyl jasmonate, Plant Cell 6. 1077-1085.

29. Yukimune, Y, Tabata, H., Higashi, Y. and Hara, Y. (1996) Methyl jasmonate-induccd overproduction of paclitaxel and baccatin 111 in Taxus cell suspension cultures, Nat. Biotechn. 14, 1129-1132.

BARREN MUTANTS IN MAIZE-A CASE STUDY IN PLANT SIGNALING

1. Abstract

P. A. PETERSON Departments of Agronomy/Zoology-Genetics Iowa State University, Ames, IA 5001I,USA

Barren in this context indicates the complete lack of female organs, not just flowers, but the absolute lack of even female (ear) initials in the maize plant. There are at least 5 non-allelic genes in maize that when mutated cause barrenness. This has been verified by extensive allelic tests. The phenotype of each of these genes is generally similar in the female part of the plant. There is a phenotypic change in the tassel, that is quite obvious in the plants in the field, though admittedly, this has not been exhaustively verified by sufficient out crossing. Most any maize geneticist or breeder that is familiar with plants in the maize genetic or breeding nursery has observed the relationship of the maturing male and female components in the plants. In almost every case (there are occasional exceptions) the male flowering and pollen-shed occurs before the female begins silking. The gap between the two events varies, from I day to almost the end of the pollen-shedding period. It has been anecdotally assumed that hormones in the tassel control the initiation of female activity. The tassel appears to repress the female receptivity (silking) until the pollen shedding begins. This is only anecdotal and the necessary experiments have not been made to clearly show this relationship. There are mutants that vary this process but these have not been coupled with physiological investigations. Though the ba4 mutant arose in a transposon plot, the necessary molecular confirmation of this mutant has not confirmed a transposon insert. The behavior of this mutant illustrates some interesting features. The mutant expression is characterized by plants that are typically barren. The barren plants are unilaterally susceptible to anthracnose. In a segregating row, only the barren plants show anthracnose disease symptoms. The factor that is deficient and causes barrenness is suggestive that the mutant effect makes the plant susceptible to anthracnose infection. This mutant is predominantly recessive but not entirely. In crosses of these barren (obviously, as male) on to assorted wild type plants (+/+ x ba4/ba4), there is a low frequency of «escapes», that is, plants are +/ba4 and barren. But not entirely, because late, after the tassel has been fully spent, even dried, and probably 30 days, a small deformed ear appears on the very last leaf, very low in the plant. Hypothesis on ba4: That a hormone is suppressing ear formation and thus barrenness. When the plant is nearing senescence, the hormone is depleted and the ear initial finally becomes evident.

95

96

2. Introduction

The inflorescence of the monoecious maize plant is unique among the Gramineae in the sharp separation of the male and female structures. The male tassel at the terminus of the plant most often sheds pollen before the visual appearance of the receptive silks of the female ear at a lateral bud, normally at the 10th leaf [I].

Earlier studies examined the ontogeny of the growing tissues beginning with the embryo in the kernel through to the obvious protuberances of the growing point as the kernel germinates. The differentiated developing soon-to-become tassel and the lateral bulges that develop into the ears on the lateral buds become apparent very early in the germinating kernel [2, 3, 46]. A certain number of cells are destined for tassel and ear development [8]. As the plant develops, there is a phase transition [\3, 16] from the vegetative lateral buds to the reproductive lateral buds. This change in phase has been ascribed to genotypic control as evidenced in the differences among different genotypes in the initiation of the reproductive [I].

The genetic control of tassel and ear initiation has been gleaned from anatomical observations. Lejeune and Bernier [I2] found that maize plants terminate the initiation of additional axillary meristems at the time of tassel initiation. This would indicate that the top-most ear shoot is initiated on the same day as the initiation of tassel development and this event signals the end of the undifferentiated growing point. Because of this simultaneous development of tassel and ear-shoot, these authors hypothesize that this mutual control suggests some kind of hormonal control.

Physiological studies have concentrated on the levels of Indole Acetic Acid (IAA) levels as the governing feature controlling the growth and development of the ear. Professor Irvin Anderson of Iowa State University (personal communication) indicates that the tassel growing point produces significant amounts of IAA only after the V6 to V9 stage of plant growth. However, because tassel sizes in current hybrids are quite small, it is unlikely that the IAA level is a determining factor in the growth of the ear. Thus, there must be a complex of signals that determine the timing and growth of the tassel and ear.

The use of barren mutants might be a means of dissecting the signalling system in sex-organ development in maize. Mature barren stalk plants, unlike normal plants that have visible buds and a deep indentation above each bud that makes an indentation in the internode, lack any ear tissue and any indentation in the stalk.

The discovery of ba3 [15] added to the col\ection of the three previously describe ba mutants {ba J and ba20 [\1] and baf[8]}. The allelic tests of these mutants indicating independent genes and their distinguishing tassel morphology are described in the Pan and Peterson [\5] paper.

In this report, a new barren mutant (ba4) is described. This mutant arose in a transposon containing plant (94 3805-2). A description of its characteristics and the non-allelism to the previously described ba mutants is provided.

97

3. Results

3.1. INHERITANCE

The ba4 mutant was crossed to a wild type line and the FI was selfed. An example of a segregation is illustrated in Table 1. The segregation is of a typical recessive. An example of a barren plant is shown in Figure I.

Table 1. Segregation of ba plants from the self of an F I derived from cross of wild type +/+ x balba.

1. 94g 128- 6 x 2. 92 yg 128-21 x

Total

3.2. EXCEPTIONAL SEGREGATION

+ 21 25

46

ba 7 7

14

T 28 32

60

Figure 1. Barren plant illustrating the lack of an ear shoot.

Because barren plants lack ear shoots, there is an obligation to cross ba (balba) plants as males. This is important in the observation of the ba plants in the segregating row of plants derived from the cross +1+ x balba. Note that all progeny are +Iba but surprisingly, ba plants appear in a low frequency. An example of such a segregating progeny is illustrated in Table 2. These occurrences of these ba plants are termed ba­escapes. (Note, the nature of the cross obviates any contamination origin for these «escapes».)

Table 2. Segretation of ba «escapes» from the cross of +/+ x balba (ba male parent in this cross is a segregant from segregating plants in progeny 2 in Table 1).

95 g 084/116-6 +/+ x balba + 19 37 56

b 6 ~ 11

Total 25 42 67

98

Because the «escapes» were exceptional, similar crosses were made on commercial corn lines and assorted genetic lines with the other ba mutants and the progeny were planted in nursery rows. These are illustrated in Table 3.

Table 3. Segregation of ba in crosses of commercial and genetic lines x ba plants.

* 96 g A01l3 +/+ x bal/bal ** 96 g 11213 +/+ x ba2lbal '" 96 g AOll12 +/+ x baJ/baJ *'" 96 g 104/18 +/+ x baJ/baJ * 96g A01125 +/+ x ba4/ba4 ** 96 044212415-3 +/+ x ba4/ba4 *** 96 assorted genetic +/+ x ba41ba4 * 96 A01l9 +/+ x baflbaf

* AOI were commercial hybrids

** Genetic lines *** Various genetic lines

Crosses + ba T 5 100 0 100 3 50 0 50 3 55 0 55 4 107 0 107 3 55 2 57 2 41 2 43 15 235 3 238 7 93 0 93

Figure 2. Appearance of a very late «ear» of a ba plant arising from the cross of +1+ x ba/ba.

Again, ba plants appear in a low frequency among a wide variety of outcrosses. It appears that ba4 is unique in this exceptional appearance of mutant ba plants among the segregating progeny of crosses of wild type lines by ba males. Neither ba2, ba3, nor bafba4lba4) plants, leaf die-back was noticed. However, in this segregating row, only

99

the barren plants expressed this severe leaf-die-back. These infected leaves (Fig. 3) were tested in the ISU plant pathology laboratory and, were identified as infected with anthracnose. Such a segregating row is illustrated in Table 4 and Figure 4.

Table 4. Susceptibility of ba plants to anthracnose. Segregating plants arising from self (I) of +/ba (94 g/28-b) and from a backcross of+/ba x ba/ba.

Progeny 1 2

+ 10 13

ba 5 5

Infected leaves are illustrated in Figures 3 and 4.

T 15 18

Figure 3. A close up of an infected leafofa ba4 plant. Figure 4. A segregating row of plants from the self of +/ba4 illustrating that the infected plants are confined

to the ba phenotypes.

3.3. TILLERS ESCAPE THE ba EFFECT

Tillers of a maize plant are part of the same node structure of a plant, but tillers originate from lateral buds below ground. Tillers of barren plants have tillers with terminal ears. This indicates that the tillers are under a different set of signals and escape the effects of the ba mutant effects.

100

4. Discussion

That there are four non-allelic loci that as mutant result in barren plant expression indicates several pathways or genes controlling part of a general pathway that could cause barrenness. Further, there is phenotypic evidence that some of the barren mutants also affect tassel development. In the extreme bal is largely devoid of any anthesis. Further, ba2 is accompanied by a bush-like, broom-type tassel.

ba4 is unique in several ways. First, there is the occurrence ofba-escapes. Some of these ba-escapes, not all, include an abortive «ear» appearing in a very low leaf node, often, among the brace roots (Fig. 2). This would possibly indicate that a repressing signal (the ear development) is operative and that late in plant maturity the signal is depleted allowing an ear shoot to materialize. Or possibly, there is a constitutive expression of a gene that suppresses ear development but is suppressed by the ba mutation similar to the ts2 gene effect in maize [9]. The absence of the ba suppressive effect on the constitutively expressed gene would allow the expression of the female suppressing gene which in time is depleted.

The feature of anthracnose susceptibility would indicate a lack of defense against infection. The fIrst line of defense could be an ethylene response which may be related to an ethylene receptor. Whether the possibility of the ethylene form of catalyzing defense is missing in ba4 is worth entertaining.

The lack of ear initials would support the possibility that the ba effect occurs early during the differentiation of the growing point. Whether the cell signaling occurring in the growing point as indicated in Arabidopsis [7, 10, 14] is operative in these barren mutants remains for further investigation.

5. References

1. Baba, T. and Yamazaki, K. (1996) Effects of phase transition on the development of lateral buds in maize, Crop Sci. 36, 1574-1579.

2. Bonnett, O.T. (1940) Development of the staminate and pistillate inflorescences of sweet corn, 1. Agric. Res. 60,25-37.

3. Bonnett, O.T. (1948) Ear and tassel development in maize, Annual Missouri Botany Garden 35, 269-288.

4. Bonnett, O.T. (1953) Developmental morphology of the vegetative and floral shoots of maize, University of Illinois Agriculture Experiment Station Bulletin 568.

5. Bonnett, O.T. (1966) Inflorescences of maize, wheat, rye, barley, and oats: Their initiation and development, University of Illinois Agriculture Experiment Station Bulletin 72 J.

6. Cheng, P.C., Greyson, R.I. and Walden, D.B. (1983) Organ initiation and the development of unisexual flowers in the tassel and ear of Zea mays maize, structure, Am. 1. Bot. 70, 450-462.

7. Clark, S.E., Running, M.P. and Meyerowitz, E.M. (1995) CLAVATA3 is a specific regulator of shoot and floral meristem development affecting the same processes as CLAVATAJ, Development 121, 2057-2067.

8. Coe, E.H., Jr. and Neuffer, M.G. (1977) Cells in the embryo and their destinies in tassel, ear and vegetable parts (maize), Maize Genetics Cooperation Newsletter 51,62-63.

9. DeLong, A, Calderon-Urrea, A and Dellaporta, S.L (1993) Sex determination gene Tasselseed2 of maize encodes a short-chain alcohol dehydrogenase required for stage-specific floral organ abortion, Cell 74, 757-768.

10. Elliott, R.C., Betzner, AS., Huttner, E., Oakes, M.P., Tucket, W.Q.J., et al. (1996) AINTEGUMENTA, an APETALA2-like gene of Arabidopsis with pleiotropic roles in ovule development and floral organ growth, Plant Cell 8, 155-168.

101

II. Hofmeyr, 1.0.1. (1930) The inheritance and linkage relationships of barrens talk-I and barrenstalk-2, two mature plant characters of maize, Unpublished Ph.D. thesis, Department of Plant Breeding, College of Agriculture, Cornell University, Ithaca, NY.

12. Lejeune, P. and Bernier, O. (1996) Effect of environment on the early steps of ear initiation in maize (Zea mays L.), Plant, Cell Environ. 19,217-224.

13. McDaniel, C.N. and Poethig, R.S. (1989) From here to there in maize: A fate map of the shoot apical meristem of the germinating com embryo, in R. Goldberg (ed.), Molecular Basis 0/ Plant Development, Liss, New York, pp. 25-35.

14. Meyerowitz, E.M. (1998) Molecular and genetic mechanisms of shoot meristem activity: Plant architectural engineering, 18th International Congress o/Genetics (Abstracts), 84.

IS. Pan, Y.B. and Peterson, PA (1992) ba3: A new barrenstalk mutant in Zea mays L, J. Genetics and Breeding 46, 291-294.

16. Poethig, R.S. (1988) Heterochronic mutations affecting shoot development in maize, Genetics 119, 959-973.

ETHYLENE SIGNAL TRANSDUCTION PATHWAY IN CELL DEATH DURING AERENCHYMA FORMATION IN MAIZE ROOT CELLS: ROLE OF PHOSPHOLIPASES

C.J. HEl, P.W. MOROAW, B.O. COBB\ W.R. JORDAN2 AND M.e. DREWl lDepartment of Horticultural Sciences and 2Department of Soil and Crop Sciences, Texas A&M University, College Station TX 77843, USA

1. Introduction

Ethylene biosynthesis is accelerated in roots of maize when they become hypoxic (partially O2 deficient) following soil flooding. The increased concentration of ethylene to which cells close to the root tip are exposed subsequently induces premature death and degeneration of cells in the root cortex, leaving air-filled cavities (aerenchyma). The interconnected cavities improve oxygenation of the root cells, and contribute to plant tolerance of flooding.

The selective death, specifically of cells of the mid-cortex that is triggered by ethylene suggests a mechanism of programmed cell death. Previous research, using antagonists and agonists of particular steps in signal transduction [1], indicated that 0-proteins, phospholipases, phosphoinositides, increased cytosolic Ca2.,. and protein phosphorylation are likely components of an ethylene signal transduction pathway in maize roots.

The aim of the present work was to directly determine changes in the activity of phospholipase C (PLC) and phospholipase D (PLD) in relation to the initiation of cell death in response to ethylene. The rationale was that a possible role for PLC or PLD in signaling cell death would be indicated by an early change in activity of these enzymes in response to ethylene, or hypoxia. Additionally, if IP3 were acting as a signal molecule in this system, we might expect to detect a change in its concentration as a result of PLC.

2. Results

The plasma membrane fraction was prepared by the phase partitioning procedure of Widell et al. [2]. The activity of marker enzymes for possible contaminants was cytochrome C oxidase (for mitochondrial membranes) and glucose-6-phosphate dehydrogenase (for cytosol). We found that the plasma membrane fraction had little or no contamination, relative to the activities of these enzymes in the unfractionated homogenates prepared by grinding whole tissues.

103

104

At 3 d of hypoxia, when roots were exposed to 2% O2 in the aerating gas stream, the activity of PLC in the plasma membrane fraction increased strongly in the root tip, whereas plasma membrane PLO activity in the same tissues changed little. For the total cell homogenates, hypoxia caused a more general increase in PLC and PLO activity along the whole root.

As a function of time, either exogenous ethylene (l/lL.L-1 air) or hypoxia caused an appreciable increase in the activity of PLC in the apical 10 mm zone. Activity doubled within the first 30 min with ethylene, and continued to increase up to 24 h. The response to hypoxia was slower, because of the additional time taken to accelerate the production of ethylene. No comparable changes occurred in the PLC activity for the whole cell homogenate, or for PLO in either the plasma membrane fraction or the total cell homogenate. PLO activity actually decreased in response to hypoxia, in the whole cell homogenate.

At longer times, PLO activity in total cell homogenates increased steeply after 48 h, coinciding with the earliest stage in cell death and degradation detectable in the microscope.

Antagonists of signal transduction were used previously to inhibit cell death in response to hypoxia, down stream of the ethylene receptor [1]. Neomycin or EGTA, either of which block cell death in hypoxic roots, inhibited any rise in activity ofPLC or PLO in the plasma membrane fraction. For the whole cell homogenates, activities of these two enzymes increased only at longer times in hypoxic roots, and were strongly inhibited by the antagonists.

The products ofPLC activity are IP3 and OAG. We assayed for IP3 concentration in whole cell homogenates. IP3 concentration increased markedly with ethylene treatment, and to a lesser extent with hypoxia.

3. Conclusious

PLC activity in the plasma membrane fraction is an early marker for ethylene-dependent cell death in the root cortex. Increases in PLC activity take place in the apical zone, at least several hours to a day before any signs of cell death and degradation are detectable under the microscope.

The role of PLO appears to be predominantly in cell degradation, rather than in the early stages of signaling cell death.

We conclude that greater PLC activity, and a concomitant rise in IP3 concentration, could be messengers for the onset of cell death, induced by activation of the ethylene signal transduction pathway in maize roots.

4. References

1. He, C.l., Morgan, P.W. and Drew, M.C. (1996) Transduction of an ethylene signal is required for cell death and lysis in the root cortex of maize during aerenchyma formation induced by hypoxia, Plant Physiol. 112,463-472

2. Widell, S., Lundborg, T. and Larsson, C. (1982) Plasma membranes from oats prepared by partition in an aqueous polymer two-phase system, Plant Physiol. 70, 1429-1435.

ETHYLENE-DEPENDENT AND ETHYLENE-INDEPENDENT PATHWAYS IN A CLIMACTERIC FRUIT, THE MELON

1. Abstract

J.e. PECH', M. ours', R. BOTONDI', R. AYUB2, M. BOUZAYEN', J.M. LELIEVRE', F. EL YAHYAOUr 1 AND A. LATCHE' JENSAT, VA INRA, Av. de l'Agrobiopole, BPI07, Auzeville, 31326 Castanet-Tolosan, Cedex, France, 2Vniv. Estad Ponta Grossa, Dept de Fitotecnia, Pr Santos Andrade, SIN°, 84010330 Ponta Grossa-PR, Brazil

Transgenic antisense ACC oxidase melons in which ethylene has been inhibited by more than 99% have been used for discriminating between ethylene-dependent and -independent pathways. In this paper, we have compared wild type and transgenic melons in terms of cell wall-degrading enzymes, ACC synthase activity and gene expression and resistance to chilling injury. The activity of some cell wall-degrading enzymes (pectin methyl esterase and exo-polygalacturonase) were identical in wild type and transgenic fruit. These are not regulated by ethylene. On the contrary, the activity of galactanase, a-arabinosidase, [3-galactosidase, and endo-polygalacturonase was higher in wild type fruit, indicating a regulatory role for ethylene for at least a portion of activity that could correspond to specific isoforms. The increase in ACC synthase activity at the early stages of ripening occured exactly at the same time in wild type and ethylene-inhibited fruits, indicating that the initiation of ripening associated ethylene biosynthesis could occur as a developmentaly and ethylene-independent phenomenon. An ACS gene (CMe-ACSl) showed strong stimulation during ripening of wild type melons. It was also expressed in transgenic fruits but at a low level that could not directly account for the high ACS activity encountered in these fruits. Ethylene treatment of transgenic fruits stimulated the accumulation of CMe-ACSI transcripts but caused a decrease of ACS activity. These data suggest a complex regulation process of ACS by ethylene at both the transcriptional and post-transcriptional level.

2. Introduction

It is classically thought that ethylene is necessary for triggering the biochemical changes that occur during the ripening of climacteric fruits. However, in recent years, with the availability of ethylene-inhibited transgenic mutants and the characterization of naturally-occuring ethylene-insensitive mutants, the concept has emerged that some of the ripening pathways of climacteric fruits could be ethylene-independent, in other words, of the non-climacteric type [5]. Some pathways and molecular events that are

105

106

ethylene-independent have been reported in transgenic antisense ACC synthase (ACS ) [10] and ACC oxidase (ACO) [6] tomatoes. In order to further investigate the role of ethylene in individual aspects of fruit ripening we have decided to use the Cantaloupe Charentais melon as a model. Compared to the tomato, this melon has some specific ripening traits such as the accumulation of large amounts of sugars, production of abundant aroma volatiles and a very rapid ripening rate associated with a sharp climacteric peak. We have generated an antisense ACO line of this melon that exhibits almost 100% inhibition of ethylene production [I]. This line therefore represents a very good model for discriminating between ethylene-dependent and -independent pathways. In the work reported here, we have focused our efforts on cell wall degrading enzymes and ACC synthase.

3. Results

3.1. ROLE OF ETHYLENE ON THE ACTIVITY OF CELL WALL-DEGRADING ENZYMES

The wild type Charentais Cantaloupe melon undergoes a complete collapse of flesh texture within 3 to 4 days of the onset of ripening. The suppression of ethylene production in antisense ACO fruit resulted in an almost total inhibition of softening on the vine [3]. Exogenous ethylene above 2.5 ppm could fully reverse softening at a rate that was identical to the normal softening rate of wild type fruits. By comparing the activity of a number of cell wall-degrading enzymes in wild type and transgenic fruit, two types of behavior have been observed:

(i) enzymes showing the same pattern of evolution in both type of fruits (pectin methyl esterase and exo-polygalacturonase, Figs I A and I B). Their activity can be considered as ethylene-independent;

(ii) enzymes showing higher activity in wild type than in transgenic fruit either at the early (endo-polygalacturonase and galactanase, Fig. I C and D) or late stages of ripening (a-arabinosidasse and 13-galactosidase, Fig. I E and F). The portion of activity which is increased in wild type fruit can be considered as ethylene-dependent. It is conceivable that the two different portions of activity correspond to different isoforms. At least two isoforms of 13-galactosidases have been separated in muskmelons [7]. Isoform I was constituvely present in fruit at all stages of development, while isoform II appeared when fruit ripening was initiated. In addition, it has been shown that 13-galactosidases are encoded by gene familes in the apple [8] and in the tomato [2]. Recently Sozzi et at. [9] have found that the activity of one of the 13-galactosidase isoforms of tomato (I)-gal II) was ethylene-dependent. Its activity decreased in transgenic antisense ACC synthase tomatoes, while they increased sharply during the ripening in wild type tomatoes. T he existence of several isoforms of a-arabinosidases has not yet been documented, to our knowledge.

I-~ 750 LU

~~ 600

~~ 450 u:!:

il 300 ~I:: ~ 150

A

~ O'-----'---'-_...I-_..L...---lL......l 28 32 36 40 44 48

DAYS AFTER POLLINATION

8----------6

4

2

32 36 40 44 48 52 56 DAYS AFTER POLLINATION

100~--------------~

~ :> 80

~~ LU- 60 ~.~ ~i 40

I ~ 20

E

32 36 40 44 48 52 56 DAYS AFTER POLLINATION

107

ti 3.0 ,...------------. «~ ~~ ~.= 2.3 ~E en:::: ~ g 1.5 ~i tiiE ~ KI 0.8 z-1=0 fd[ a.. 0.0 L-L_.L........L.---L_.L........L.---L-I

32 36 40 44 48 52 56 DAYS AFTER POLLINATION

80,...---------~

32 36 40 44 48 52 56 DAYS AFTER POLLINATION

32 36 40 44 48 52 56 DAYS AFTER POlliNATION

Figure 1 . Activity of cell wall-degrading enzymes in wild type melon (e)and, antisense ACO melon (0) A: exo-polygalacturonase, B: endo-polygalacturooase, C: pectin methylesterase, D: galactaJlase, E: a-arabinosidase, F: fJ-galactosidase.

108

3.2. RELATIONSHIP BETWEEN ETHYLENE AND ACC SYNTHASE

We have previously demonstrated [4] that the levels of ACC and ACC synthase activity started to increase at the same time in antisense ACO and in wild type melons, indicating that the induction of ACC synthesis was an ethylene-independent event. In addition, the level of ACC and ACC synthase activity reached a peak around the maximum climacteric and decreased rapidly thereafter in wild type fruits. In transgenic fruits, ACC and ACS activity increased for several days to reach levels that were respectively about 10 and 3 times higher than in the wild type, and then slowly declined. Ethylene treatment of transgenic fruit resulted in a decrease in ACS activity. These results suggest that ACS activity is negatively regulated by ethylene and that ethylene suppression in transgenic fruits allowed the development of ACS activity to proceed at a high rate. In order to investigate the regulation of ACS gene expression, we have studied the expression of 2 ACS genes isolated in melons by Yamamoto et al. [11] using RT-PCR with gene-specific primers.

CM-ACSl CM-56.10

Wild Type

DAP

34 37 41 43 46

Internal C2H4 0.02 - 0.06 - 1.6 - 58 - 37 (ppm)

ACS activity 0.02 - 0.09 -2.38 -15.2 - 1.1 (nmol. h-I.g- I FW)

Antisense

49DAP +C2H4

Od 1d 4d

0.01 - 0.02 - 0.02

14.1 - 11.9 - 1.7

Figure 2. Pattern of accumulation ofCMe-ACSl mRNA, internal ethylene and ACC synthase activity in wild type and antisense ACO melon fruits harvested at different stages of development (DAP, Days After Pollination). The accumulation of CMe-ACSl mRNA was estimated by RT-PCR using the constitutively expressed CMe-56.1O gene of unknown function as an internal control. Antisense fruits were treated on the vine with a continous flow of 50 ppm ethylene for 1 or 4 days.

109

CMe-ACS2 mRNA could not be detected in the flesh of both antisense and wild type fruits. It has been reported to be expressed in the placenta only [11]. On the contrary, CMe-ACSI exhibited strong stimulation of expression during ripening of wild type fruit (Fig. 2). It was also expressed in transgenic melons, but at such a low level that it could not account for the very high ACS activity found in these fruits. In addition, CMe-ACSI expression was strongly stimulated by ethylene treatment of antisense ACO fruits while ACS activity was depressed (Fig. 2). Attempts to isolate other ACS cDNA sequences in transgenic fruit by RT-PCR using consensus degenerate primers have failed. We hypothesize that ethylene has opposite effects on the transcriptional (stimulation) and post-transcriptional (inhibition) regulation of CMe-ACSI gene expression.

4. Conclusions

A summary of ethylene-dependent and independent events that have been described here, in Guis et al. [3-4] or still unpublished is presented in Table 1. Obviously, ethylene is not required for the development of all biochemical events occuring during melon fruit ripening. By extension, it can be concluded that the ripening of climacteric fruits comprises a portion of non-climacteric behavior. The observation that an upsurge in ACS activity occured in the absence of ethylene indicates that developmental factors are responsible for the development of the competence of the fruit to synthesize ethylene. Understanding this important step will involve the elucidation of the transcriptional and postranscriptional regulation of ACS gene expression. Overall these data show that antisense ACO melons represent a valuable tool for understanding the role of ethylene in the various ripening pathways and the development of competence of the fruit to ripen.

TABLE 1: Ethylene-dependent and independent pathways in the melon. The sign* indicates that only part of the activity (probably corresponding to some isoforrns) is ethylene-dependent.

Ethylene-dependent General metabolism Yellowing of the rind Softening Aroma volatiles Climacteric respiration Detachment of peduncle Chilling injury Activities of enzymes Galactanase* a-arabinosidase* ~-galactosidase * Endo-polygalacturonase* ACC synthase (negative feedback) ACC N-malonyltransferase*

Ethylene-independent

Coloration of the flesh Accumulation of sugars and organic acids Loss of acidity (late ripening) Accumulation of ACC

Pectin methyl esterase Exo-polygalacturonase

ACC synthase (induction at onset of ripening)

110

5. Acknowledgements

We would like to acknowledge the support of the EU (FAIR CT-96-1138) and a bilateral French-Italian Galileo programme (N°97011) between the University of Viterbo (IT) and ENSAT, Toulouse (FR).

6. References

I. Ayub, R., Guis, M., Ben Arnor, M., Gillot, L., Roustan, J.P., Latche, A, Bouzayen, M. and Pech, lC. (1996) Expression of ACC oxidase antisense gene inhibits ripening of cantaloupe melon fruits, Nature Biotech. 14,826-866.

2. Carey, AT., Holt, K., Picard, S., Wilde R., Tucker, G.A., Bird, e.R.. Schuch, W. and Seymour, G.B. (1995) Tomato exo-( 1-4)- 13-D-galactanase. Isolation, changes during ripening in normal and mutant tomato fruit and characterization of related cDNA clone, Plant Physiol. 108, 1099-1107

3. Guis, M., Botondi, R., Ben Arnor, M., Ayub, R., Bouzayen, M., Pech, J.e. and Latche, A (1997) Ripening-associated biochemical traits of cantaloup charentais melons expressing an antisense ACC oxidase transgene, J. Amer. Soc. Hort. Sci. 122,748-751.

4. Guis, M., Bouquin, T., Zegzouti, H., Ayub, R., Ben Arnor, M., Lasserre, E., Botondi, R., Raynal, J., Latche, A, Bouzayen, M., Balague, C. and Pech lC. (1997) Differential expression of ACC oxidase genes in melon and physiological characterization of fruit expressing an antisene ACC oxidase gene, in AK. Kanellis et al. (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 237-337.

5. Lelievre, J.M., Latche, A., Jones, 8., Bouzayen, M. and Pech, J.e. (1997) Ethylene and fuit ripening, Physiol. Plant. 101,727-739.

6. Picton, S., Barton, S.L., Bouzayen, M., Hamilton ,AJ., Grierson, D. (1993) Altered fruit ripening and leaf senescence in tomatoes expressing an antisense ethylene-forming enzyme transgcne, Plant J. 3, 469-481.

7. Ranwala, AP., Suematsu, C. and Masuda, H. (1992) The role of 13-galactosidases in the modification of cell wall components during muskmelon fruit ripening, Plant Physiol. 100, 1318-1325.

8. Ross, O.S., Wegrzyn, T., MacRae, E.A. and Redgwell, R.l (1994) Apple 13-galactosidase. Activity against cell wall polysaccharides and characterization of related cDNA clones, Plant Physiol. 106, 521-528.

9. Sozzi, G.O., Camperi, S.A, Cascone, O. and Fraschina, A.A. (1988) Galactosidases in tomato fruit ontogeny: decreased galactosidase activities in antisense ACC synthase fruit during ripening and reversal with exogenous ethylene, Aust. J. Plant Physiol. 25. 237-244.

10. Theologis, A, Oeller, P.W., Wong, L.M., Rottmann, W.H. and Gantz .D. (1993) Use of a tomato mutant constructed with reverse genetics to study ripening, a complex developmental process, Dev. Genet. 14, 282-295.

II. Yamamoto, M., Miki, T., Ishiki, Y., Fujinami, K., Yanagisawa, Y., Nakagawa, H., Ogura, N., Hirabayashi, T. and Sato, T. (1995) The synthesis of ethylene in melon fruit during the early stage of ripening, Plant Cell Physiol. 36, 591-596.

ISOLATION AND CHARACTERIZATION OF NOVEL TOMATO ETHYLENE­RESPONSIVE cDNA CLONES INVOLVED IN SIGNAL TRANSDUCTION, TRANSCRIPTION AND mRNA TRANSLATION

1. Abstract

H. ZEGZOUTl, B. JONES, P. FRASSE, B. TOURNIER, J. LECLERCQ, A. BERNADAC AND M. BOUZA YEN ENSAT-INRA Toulouse, Avenue de ['Agrobiopole, BP ] 07, 3]326 Castanet-Tolosan Cedex, France

In order to gain more information on the molecular basis by which ethylene regulates the ripening process, we used the differential display approach to isolate early ethylene­responsive (ER) genes from late immature-green tomato fruit. Among the isolated ER clones many correspond to regulatory genes involved either in signal transduction or in transcriptional and post-transcriptional regulation. ER43 and ER50 share significant homology with a GTP-binding protein and a Raf kinase from the CTR] type, respectively. ER24 is homologous to the multibridging factor MBFI, a component of the TAF complex (TATA box binding protein associated factor). Finally, ER49, a putative mitochondrial translational elongation factor is potentially involved in the ethylene postranscriptional regulation of gene expression.

2. Introduction

The phytohormone ethylene orchestrates a variety of physiological processes in plants including senescence, fruit ripening, abscission [I]. This hormone also plays an important role in physiological responses to environmental stresses such as water deficit [2], mechnical wounding [3], and pthogen attack [4 The tremendous progress made in the recent years in elucidating the mechanisms involved in the perception and transduction of the ethylene signal [5, 6] are still not sufficient to explain the diversity of plant responses to the hormone. The identification of early ethylene-regulated genes is another strategy towards understanding the molecular basis of ethylene action and its role in physiological processes. Within the last decade, a number of ethylene-regulated genes have been isolated and characterized through differential screening techniques [7]. However, the limited number of clones isolated so far cannot account for the tremendous biochemical and physiological modifications that occur in response to ethylene during fruit ripening or flower senescence. In an attempt to identify novel genes involved in the

111

112

ethylene response, we screened for early ethylene-regulated genes in late immature green tomato fruit using the mRNA differential display approach [8, 9].

A

Up regulated

Down regulated

B

ER30

Ethylene o 15' 5H

Ethylene +1·MCP

o 1~ 5h 1~ 5h

Figure I. A. Sections of denaturing polyacrylamide gels exhibiting the 3 types of ethylene­regulated mRNAs detected by differential display. Untreated fruit (0), ethylene-treated fruit 15 min (15 ') or 5 hours (5h). B. Northern blot analysis of the effectiveness of the ethylene treatment using ER30 (tomato E4 homologue) as a probe.

3. Results

3.1. IDENTIFICATION OF ETHYLENE-REGULATED cDNAS DIFFERENTIAL DISPLAY

BY

Differential display was used to compare mRNAs isolated from late immature green tomato fruit, unable to produce ripening-related ethylene either untreated or treated with ethylene (50 IlI.r!). A typical differential display showed three classes of differentially regulated clones: (i) ethylene up-regulated; (ii) ethylene down-regulated; and finally (iii) transiently induced (Fig. lA).

Among the ethylene-regulated cDNA fragments isolated in this study, many corresponded to clones already characterized as ethylene responsive. In order to validate our experimental model, we used ER30 as a control gene. This clone corresponds to the tomato E4 gene that has been shown to be up-regulated by ethylene in tomato fruit [10]. Northern analysis (Fig. lB) showed that ER30 is strongly induced

113

upon 5 hours ethylene treatment. In addition, this induction is totally suppressed by the use of I-methy1cyclopropene (I-MCP), a potent inhibitor of ethylene action [11]. These results clearly demonstrate the effectiveness of the ethylene treatment and the appropriateness of the plant material chosen for this study.

The differential display based screening performed in this study led to the isolation of nineteen cDNA clones (Table 1), corresponding to novel s;thylene-responsive genes (ER clones) that show differential regulation during the ripening process. Among the isolated ER clones, several display homology to regulatory genes that may participate in the ethylene response at the levels of signal transduction, transcription and translation.

TABLE 1. Tomato ethylene-regulated cDNA clones.

Clone

ER5 ER6 ER21 ER24 ER28 ER33 ER43 ER49 ER50 ER60 ER66 ER68 ER69 ER15,ER27 ER31,ER34 ER35,ER55

Sequence homology

lea-like gene (L. esculentum) Sequence F21M12.12 (A. thaliana) Hsc70 gene (L. esculentum) Transcriptional coactivator MBFl (B. mari) Enolase (L. esculentum) Putative protein (A. thaliana) Small GTP-binding prot. (Pisum sativum) Elongation factor Ts (s. platensis) CTRI-like protein kinase (A. thaliana) Catalase (N. plumbaginifalia) FIN21.9 similar to extensin (A. thaliana) RNA helicase DBP2 (s. cerevisiae) Methionine synthase (c. rase us) Unknown Unknown Unknown

3.2. ER24, A GENE ENCODING A PUTATIVE TRANSCRIPTION FACTOR

ER24, an early and transiently induced clone in ethylene-treated late immature-green fruit (Fig. 2), is highly homologous to a transcriptional coactivator known as multiprotein bridging factor 1 (MBFl) isolated from the silkworm Bombyx mori [12]. MBFl is a transcriptional cofactor that binds to the TATA box-binding protein (TBP) and an enhancer-associated activator to form an active transcription complex. Based on its sequence homology and its tight regulation by ethylene and during ripening of tomato fruit (Fig. 2), ER24 may conceivably be one of the bridging proteins that link Ethylene Responsive Element Binding Proteins (EREBPs) to the TATA box-binding protein allowing transcription of ethylene-regulated genes to proceed.

3.3. ER49 ENCODED PROTEIN IS POTENTIALY INVOLVED IN POST­TRANSCRIPTIONAL REGULATION OF GENE EXPRESSION

ER49, which bears a putative mitochondrial localisation sequence at its N-terminal, encodes a mitochondrial protein that shows homology to both the prokaryotic translation

114

elongation factor EF-Ts [13] and the bovine mitochondrial EF-Tsml [14]. The ethylene responsiveness of ER49 (Fig. 3) suggests that the hormone controls gene expression at the post-transcriptional level. According to the bacterial model, the EF -Ts is required to

Ethylene

o 15' 5h

Ubi 3 ER24

Ripening

MG Br Tu R

Figure 2. RT-PCR analysis of ER24 mRNA expression in response to ethylene and during ripening. Tomato ubiquitin mRNA (Ubi 3) was used as an internal control during the PCR amplification.

recycle EF-Tu, another elongation factor, which in turn promotes the binding of aminoacyl-tRNA to ribosomes allowing translation to proceed. It is well known that in climacteric fruits such as the tomato there is a sharp increase in respiration at the onset of ripening [1]. While the mitochondria is the major organelle involved in this increase in respiration, the regulation of genes encoding mitochondrial proteins is still poorly understood. Here, we show that ER49 mRNA accumulate in response to ethylene and during ripening (Fig. 3) which raise the possibility that it plays a role in the increase of mitochondrial metabolic activity during tomato fruit ripening.

Ethylene o 15' 5h

Ubi 3

ER49

Ripening MG Br Tu R

Figure 3. RT-PCR analysis ofER49 mRNA expression in response to ethylene and during ripening. Tomato ubiquitin mRNA [Ubi 3) was used as an internal control during the PCR amplification

lIS

3.4. ER GENES ENCODING COMPONENTS OF SIGNAL TRANSDUCTION PATHWAYS

In tomato fruit, ethylene has been shown to regulate its own transduction pathway through the induction of the Nr gene which encodes an ethylene receptor [IS]. We have isolated ER50, which is identical to a serine/threonine kinase clone from tomato [16] and shows strong homology to the Arabidopsis CTRI gene, the negative regulator of the ethylene signal transduction pathway in Arabidopsis thaliana [17]. However, unlike CTRl, the expression of ER50 gene was found to be strongly up regulated by ethylene and during fruit ripening (Fig. 4).

Ethylene o 15' 5h

Ubi 3 ER50

Ripening MG Br Tu R

Figure 4. RT-PCR analysis ofER50 mRNA expression in response to ethylene and during ripening. Tomato ubiquitin mRNA [Ubi 3) was used as an internal control during the PCR amplification

Like CTR1, the ERSO predicted protein shows typical characteristics of the RAF protein kinase family known to be involved in the transduction of regulatory signals through MAP kinase cascades [18]. To investigate the putative role of ERSO in the ethylene signal transduction pathway, transgenic tomato plants under and overexpressing the gene have been generated and are currently being analysed.

The ER43 predicted protein is highly homologous to the rab/ypt-related small GTP­binding protein family which has been shown to play a role in vesicular transport between different compartments of eukaryotic cells [19]. ER43 is another ethylene regulated gene (Fig. S) potentially involved in signal transduction. In animal systems, the activation of MAP kinase cascades following the perception of external regulatory signals occurs through the small GTP-binding protein RAS [20]. The putative interaction between ERSO and ER43 , a RAF-like kinase and a RAS-like protein respectively, will be investigated using the yeast two hybrid approach.

4. Conclusions

Our work allowed the isolation of a large number of cDNA fragments corresponding to novel ethylene-regulated (ER) clones. The expression studies of the ER genes indicated

116

that ethylene-responsive genes can be up-regulated, down-regulated and transiently induced. Also, the alteration of gene expression by ethylene can be rapid (minutes) or delayed (hours). Sequence analysis revealed significant homologies with known genes for a number of the clones, while for others, no homologous sequences were found in the databases.

Ethylene Ripening

o 15' 5h MG Br Tu R

Ubi 3

ER43

Figure 5. RT-PCR analysis of ER43 mRNA expression in response to ethylene and during ripening. Tomato ubiquitin mRNA (Ubi 3) was used as an internal control during the PCR amplification

To gain more information about the putative function of the ER genes, spatio­temporal expression of these genes is currently being completed. Finally, the involvement of the encoded proteins in the ripening process as well as in other developmental and physiological processes is being studied through the generation of mutant transgenic lines showing altered expression of the ER genes.

5. References

1. Abeles, F.B., Morgan, P.W. and Salveit, M.E. (1992) Ethylene in Plant Biology, San Diego: Academic Press, 2nd ed.

2. Apelbaum, A and Yang S.F. (1981) Biosynthesis of stress ethylene induced by water deficit, Plant Physiol. 68,594-596

3. Boller, T. and Kende, H. (1980). Regulation of wound ethylene synthesis in plants, Nature 286, 259-260.

4. Boller, T. (1991) Ethylene in pathogenesis and disease resistance, in AK. Mattoo and J.C. Suttle (eds.), The Plant Hormone Ethylene, CRC Press, Boca Raton, pp. 293-314.

5. Bleecker, AB. and Schaller, G.E. (1996) The mechanism of ethylene perception, Plant.Physiol.lll,653-660.

6. Ecker, J.R. (1995) The ethylene signal transduction pathway in plants, Science 268, 667-675. 7. Deikman, J. (1997) Molecular mechanisms of ethylene regulation of gene transcription, Physiol.

Plant. 100, 561-566. 8. Liang, P. and Pardee, AB. (1992) Differential display of eukaryotic messenger RNA by means of

the polymerase chain reaction, Science 257, 967-971. 9. Zegzouti, H., MartY, C., Jones, B., Bouquin, T., Latche, A, Pech, J-c. and Bouzayen, M. (1997)

Improved screening of cDNAs generated by mRNA differential display enables the selection of true positives and the isolation of weakly expressed messages, Plant Mol. BioI. Rep. 15,236-245.

117

10. Lincoln, lE., Cordes, S., Read, E. and Fischer, R1. (1987) Regulation of gene expression by ethylene during Lycopersicon esculentum [tomato) fruit development, Proc. Natl. Acad. Sci. USA 84,2793-2797.

11. Sisler, E.C., Serek, M. and Dupille, E. (1995) Comparison of cyclopropene, 1-methylcyclopropene, and 3,3-dimethylcyclopropene as ethylene antagonists in plants, Plant Growth Reg. 17, 1-6

12. Takemaru, K.i., Li, F.Q., Ueda, H. and Hirose, S. (1997) Multiprotein bridging factor 1 [MBFl) is an evolutionarily conserved transcriptional coactivator that connects a regulatory factor and TAT A element-binding protein, Proc. Natl. Acad. Sci. USA 94, 7251-7256.

13. Blank, l, Nock, S., Kreutzer, R and Sprinzl, M. (1996) Elongation factor Ts from Thermus thermophilus overproduction in E. coli, quaternary structure and interaction with EF Tu, Eur. J Biochem. 236,222-227.

14. Xin, H., Woriax, V., Burkhart, W. and Spremulli, 1.1. (1995) Cloning and expression of mitochondrial translational elongation factor Ts from bovine and human liver, J Bioi. Chem. 270, 17243-17249.

15. Wilkinson, lQ., Lanahan, M.B., Yen, H-C., Giovannoni, J.J. and Klee, H.1. (1995) An ethylene inducible component of signal transduction encoded by Never-ripe, Science 270, 1807-1809.

16. Wang, Y. and Li, N. (1997) A cDNA sequence isolated from the ripening tomato fruit encodes a putative protein kinase, Plant Physiol. 114, 1135.

17. Kieber, J.1., Rothenberg, M., Roman, G., Feldman, K.A. and Ecker, lR. (1993) CTRI, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of protein kinases, Cell 72, 427-441

18. Avruch, l, Zhang, X.F. and Kyriakis, lM. (1994) Rafmeets Ras: completing the framework of a signal transduction pathway, Trends Biochem. Sci. 19,279-283.

19. Zerial, M. and Stenmark, H. (1993) Rab GTPases in vesicular transport, Curro Opin. Cell.Biol. 5, 613-620.

20. Heidecker, G., Kolch, W., Morrison, O.K. and Rapp, U.R (1992) The role of Raf-l phosphorylation in signal transduction, Adv. Cancer Res. 58, 53-73.

ANALYSIS OF GENE EXPRESSION AND MUTANTS INFLUENCING ETHYLENE RESPONSES AND FRUIT DEVELOPMENT IN TOMATO

1. Abstract

J. GIOVANNONI, E. FOX, P. KANNAN, S. LEE, V. PADMANABHAN AND J. VREBALOV Department of Horticultural Sciences Crop Biotechnology Center, Texas A&M University, College Station, TX 77843-2133

Efforts in numerous laboratories including our own have focused upon the isolation of specific genes which regulate the ripening process and related fruit quality characters. Together these efforts have resulted in the isolation of genes involved in numerous aspects of the ripening phenotype including cell wall metabolism, ethylene biosynthesis and perception, pigment biosynthesis, and susceptibility to post-harvest pathogens. Specific efforts in our laboratory are focused in two general areas. The first is toward isolation and characterization of genes which represent upstream global developmental regulators of ripening such as the ripening-inhibitor (rin) and non-ripening (nor) genes. We are currently characterizing genes which we believe represent both target loci. Our second focus is on analysis of ethylene signal transduction components and analysis of corresponding gene expression and function during the ripening process. We have isolated a putative tomato homologue of the Arabidopsis CTRI gene and have shown that it is ethylene regulated during tomato fruit development. This represents a second component of ripening-related ethylene signal transduction, in addition to the Never-ripe ethylene receptor, whose mRNA accumulation is itself under ethylene control. In addition, we have shown through genetic mapping that a putative tomato constitutive ethylene response mutant (£pi; Epinastic) does not represent a mutation in the tomato CTR 1 gene TCTRI. EpilEpi; NrlNr double-mutant analysis suggests that the Epi mutation represents a step in ethylene responses limited to ethylene-mediated cell size effects.

2. Introduction

The ripening of climacteric fruits such as tomato is influenced by hormonal, developmental and environmental stimuli. Our group is especially interested in the mechanisms and regulation of ethylene signal transduction and the identification of developmental switches which regulate the ripening process via initiation of the ethylene cascade. We have isolated a CTRI-like gene from tomato (TCTRJ) and have shown its

119

120

expression to be regulated during fruit maturation by both ethylene and developmental stage. Function of the TCTRI gene is being addressed via targeted repression and over­expression of the endogenous gene in transgenic plants. We are also characterizing the putative constitutive ethylene response mutant of tomato, Epi (Epinastic), and through double mutant analysis with the ethylene receptor mutant Nr have evidence that Epi regulates a subset of ethylene responses related to regulation of cell expansion. As such, the Epi mutant results in constitutive leaf epinasty, triple-response, and reduced leaf cell size, but does not directly influence fruit ripening, leaf senescence, or pedicel abscission. Efforts toward elucidation of developmental regulators of climacteric ripening continue to focus on map-based cloning of the rin and nor loci. Toward this end we have recently constructed a lOX tomato BAC library and have isolated BAC clones containing both target genes. Candidate cDNAs corresponding to both genes have been isolated and are currently being characterized.

2.1. TOMATO AS A MODEL SYSTEM FOR FRUIT RIPENING

Tomato has long served as a model system for plant genetics, development, pathology, and physiology, resulting in the accumulation of substantial information regarding the biology of this economically important organism. In recent years the most widely studied aspects of tomato biology include the development and ripening of their fleshy fruits. Although Arabidopsis has surpassed most plant systems as a model for basic plant biology research, the area of fruit ripening continues to thrive using tomato as the system of choice. This is due simply to the fact that the developmental program which results in the dramatic expansion and ripening of carpels in tomato (and in many other economically and nutritionally important species) does not occur in Arabidopsis. Nevertheless, examination of tomato gene sequences homologous to those previously described in Arabidopsis, and especially those related to ethylene signal transduction, has resulted in significant advancement of our collective understanding of the molecular mechanisms underlying fruit ripening control. Specific efforts in our research group are focused toward analysis of tomato fruit ripening and ethylene signal transduction via the use of cloned gene sequences and mutants. Our overall objective is genetic characterization of hormonal and developmental regulatory systems which regulate ethylene responses and the ripening process in tomato.

Considerable attention has been directed toward understanding the molecular basis of fruit development, and in particular ripening, during recent years with the majority of effort directed toward the tomato system [1]. The role of ethylene in regulating climacteric ripening has been demonstrated at molecular level [2], and the in vivo functions of fruit development and ripening-related genes including HMG-CoA reductase, polygalacturonase (PG), pectin methyl-esterase, ACC synthase, ACC oxidase, phytoene synthase, and the NR ethylene receptor have been tested via antisense gene repression and/or mutant complementation in tomato. For example, the cell wall pectinase, PG, was shown to be necessary for ripening-related pectin depolymerization and pathogen susceptibility, yet to have little effect on fruit softening [3, 4, 5]. Inhibition of phytoene synthase resulted in reduced carotenoid biosynthesis and reduction in fruit and flower pigmentation [6]. Reduced ethylene evolution resulting in

121

ripening inhibition occurred with ACC synthase and ACC oxidase antisense [7, 8] while introduction of a dominant mutant allele of the NR ethylene receptor resulted in tomato plants inhibited in virtually every measurable ethylene responses including fruit ripening [9, 10].

Further analysis of transgenic and mutant tomato lines inhibited in ethylene biosynthesis or perception demonstrates that climacteric ripening represents a combination of ethylene regulation and developmental control. Indeed the gene encoding the rate limiting activity in ethylene biosynthesis, ACC synthase, is itself initially induced during ripening by a developmental signaling system that remains to be defmed [11]. In addition, tomato geneticists have identified several mutants including ripening-inhibitor (rin) and non-ripening (nor) which are apparently blocked at steps prior to ethylene biosynthesis suggesting that these mutants represent required components of the developmental regulatory system which precedes ethylene biosynthesis [12]. In summary, years of research on tomato fruit development has resulted in a large collection of allelic variants influencing the continuum of fruit development including ripening [13]. Together the available and rapidly expanding collection of natural, induced, and transgenic mutants represent an unparalleled resource for continued analysis of fruit development and ethylene response. Critical steps toward exploitation of these genetic resources for expanded understanding of ripening regulation will include 1) extensive physiological and genetic characterization of phenotypic effects resulting from alteration of specific ripening-related genes, 2) identification of specific genes corresponding to known mutational effects, and 3) examination of tomato genes homologous to those isolated from, and characterized in, other plant systems and hypothesized to influence the fruit ripening process such as Arabidopsis ethylene signal-transduction genes.

2.2. GENETIC CHARACTERIZATION OF ETHYLENE SIGNAL TRANSDUCTION IN TOMATO

Analysis of tomato ethylene response has centered on analysis of mutant and transgenic plants altered in ethylene biosynthesis or perception. Antisense repression of the E8 oxidase resulted in delayed fruit ripening and elevated ethylene biosynthesis, together suggestive of a defect in ethylene perception and/or signaling [14]. While the in vivo function of the E8 protein is unclear, a role in maintaining receptor oxidation and activity has been suggested and is consistent with the antisense E8 phenotype [15]. The fact that E8 is fruit and anther-specific would suggest that alternate genes or pathways play similar roles in other tissues. Additional E8 family members have been suggested based on RFLP mapping [16], however none have been cloned or characterized to date. In Arabidopsis only one E8 homologue has been identified and this gene shows expression in numerous tissues as contrasted to the fruit and anther-specific expression of the characterized tomato E8 gene [17].

The NEVER-RIPE gene is the best characterized ethylene signaling component of tomato to date. The Nr mutation blocks a continuum of ethylene responses including inhibition of the seedling triple response and incomplete fruit ripening [18]. The Nr gene was cloned, sequenced and shown to have high homology to the ETRI and ERS

122

genes of Arabidopsis with greater structural similarity to the later [9]. All three genes have significant homology to members of the "two component" class of protein kinases [19]. The reduction of ethylene binding capacity in Etrl mutants [20] and yeast expressing a mutant ETRI cDNA [21], in combination with the fact that the ETRI gene product is apparently involved in protein phosphorylation, suggests that ETRI (and presumably Nr and ERS) is likely to encode an ethylene receptor which conveys signal transduction via modification of protein phosphorylation. Recent introduction of the dominant mutant Arabidopsis ETRI-I allele of ETRI into petunia and tomato both demonstrates a conserved signaling system in these species and the potential for practical exploitation of ethylene receptor sequences in a range of crop species [22].

The tomato Epinastic (Epz) mutant likely represents and additional component of ethylene signal transduction [23]. The Epi mutation was originally characterized as a semi-dominant, single locus mutation resulting in leaf epinasty, vertical growth, minimal branching, and highly branched root structure. These effects are consistent with ethylene over-production or constitutive ethylene signaling [24]. Although elevated ethylene biosynthesis has been reported in some tissues of the Epi mutant, treatment with inhibitors of ethylene biosynthesis or action had little effect on mutant phenotype, suggesting that Epi represents a lesion in ethylene signaling [23]. As described below, double mutant analysis suggests that the Epi locus influences a subset of ethylene responses particularly those related to regulation of cell expansion. The Arabidopsis ctr 1 mutant is also characterized by constitutive ethylene signal transduction, and the corresponding CTRI gene has been isolated and shown to have homology to the Raj family of protein kinases [25]. We have isolated a tomato fruit ripening-induced gene with similarity to Arabidopsis CTRI which we have designated TCTRI. Genetic mapping studies indicate that TCTRI is non-allelic with Epi. Current efforts include characterization of TCTRI function in transgenic tomato plants.

3. Results

3.1. CHARACTERIZATION OF EPI,NR andEPI;NR DOUBLE MUTANTS

In order to better understand the relationship of the Epi mutant to ethylene signaling systems in tomato single and double mutants (with Nr) were analyzed for ethylene response phenotypes. Tomato plants homozygous for the mutant Epi allele are characterized by vertical growth, minimal lateral branching, and leaf epinasty [26]. In addition, Epi seedlings demonstrate a constitutive triple-response phenotype as was previously shown by Fujino [23]. While Epi tissues are known to overproduce ethylene, treatment of seedlings with inhibitors of ethylene action or biosynthesis did not result in reversion of the mutant phenotype [23], suggesting that Epi may represent a constitutive ethylene signaling mutant. The Arabidopsis ctr 1 mutant is a constitutive ethylene response mutant and the corresponding CTRI gene has Raj kinase homology [25]. Two tomato CTRI-like genes have been isolated (TCTRI, P. Kannan and J. Giovannoni, unpublished; TCTR2, R. Hackett and D. Grierson, unpublished) and were both shown via RFLP mapping to be non-allelic with the Epi locus (data not shown).

123

Table I summarizes the ethylene-associated phenotypes of normal, Epi/Epi, NrlNr, and EpilEpi; NrlNr lines. In summary, the Epi;Epi line showed a constitutive seedling triple-response, leaf epinasty, reduced leaf cell size, delayed inflourescence development, and inhibition of lateral shoot development. No notable effects were observed on fruit ripening, pedicel abscission or petal senescence. The Nr;Nr mutant showed inhibition of virtually all ethylene-associated responses observed including a lack of the seedling triple-response, larger leaf cell size, inhibition of petal senescence, fruit ripening and pedicel abscission as has been reported previously [16, 18]. Analysis of Epi/Epi; NrINr double mutants revealed that seedlings and leaves show a constitutive ethylene response while fruit displayed incomplete ripening characteristic of the Nr mutation (E. Fox and J. Giovannoni, unpublished). In addition, double mutant fruit showed reduced cell size and inhibited lateral shoot development similar to Epi/Epi and inhibited pedicel abscission, and petal senescence similar to NriNr. These results suggest that Epi represents a component of ethylene signal transduction that does not operate in all stages of development, and in particular, has no role during fruit ripening. In short, virtually all Epi effects are observed in the double mutant lines suggesting that Epi is in fact epistatic to Nr. However, Epi influences only a subset of ethylene effects in tomato so that non-effected aspects of tomato development (such as fruit ripening) yield the Nr characteristic in double mutant lines. Our best interpretation of these results is that Epi influences a subset of ethylene responses in tomato associated primarily will cell expansion responses (Fig. 1).

TABLE 1. Ethylene responses of normal and mutant lines

Genotype TR E R PA PS CS

Normal +/- +/- +/+ +/+ +/+ intermediate Epi/Epi +/+ +/+ +/+ +/+ +/+ small NrlNr -/- -/- -/- -/- -/- large EpilEpi; +/+ +/+ -/- -/- -/- small NrlNr

xly - 10 ppm ethylene or 20 uM ACC / air TR = triple-response; E = leaf epinasty; R = ripening P A = pedicel abscission; PS = petal senescence; CS = cell size

3.2. MOLECULAR AND FUNCTIONAL CHARACTERIZATION OF A TOMATO CTR1-LIKE GENE: TCTRl

Southern blot hybridization of the Arabidopsis CTRl full-length cDNA to tomato genomic DNA (at high stringency) indicates the presence of 2 - 3 related sequences in the tomato genome (data not shown). One strongly hybridizing band appeared predominantly with each of the restriction enzymes tested, suggestive of one highly homologous locus. A breaker stage tomato fruit cDNA library was screened using the CTRl cDNA as probe, and resulted in the isolation of a partial cDNA which hybridizes

124

to the Arabidopsis CTRl cDNA at high stringency. 5' and 3' RACE-PCR were employed to isolate near full-length overlapping sequences which have been fused to form a single contiguous cDNA. The tomato cDNA has 70% DNA sequence identity, and 62% amino acid identity, with CTRI. We have tentatively named this cDNA TCTRI (P. Kannan and J. Giovannoni, unpublished).

Nr Inhibited triple-response Increased leaf cell size Ihibited epinasty Inhibited fruit ripening Delayed petal senescence Delayed pedicel abscission

Constitutive triple-response in seedlings Red uced leaf cell size Leaf epinasty

Nrl Epi

Figure 1. Summary of Epil£pi, Nr/Nr and £pil£pi;NrINr double mutant phenotypes. The Nr/Nr line displayed inhibition of virtually every ethylene-related phenotype scored while the £pil£pi line showed constitutive ethylene-related phenotypes for a subset of responses. Double mutants displayed all of the phenotypes observed in the Epil£pi parents and Nr/Nr phenotypes for all parameters not significantly influenced by the £pi mutation.

Preliminary gene expression analysis indicates that the TCTR 1 transcript is approximately 3 kb in length, which is similar to that reported for CTRI [25]. Of particular interest was the observation that TCTRl is induced during ripening, and by exogenous ethylene in mature green fruit (data not shown). TCTRI is additionally ethylene inducible in the rin and nor mutants, and expressed at lower levels in both ripening and ethylene treated Nr fruit. This pattern of expression in fruit is similar to that observed for the Nr ethylene receptor [9].

Genetic mapping studies of TCTRI and TCTR2 indicated that neither gene is allelic with Epi. To asses the role of TCTRI in tomato ethylene responses we have created a number of constitutive and fruit-specific DNA constructs for Agrobacterium-mediated T-DNA transfer. These constructs are shown in Figure 2 and represent means for both repression of the endogenous TCTRI mRNA and over/ectopic expression of the TCTRI transcript in tomato. Transformation with all constructs has been initiated and primary transform ants are available. Analysis of transgenic tomato plants altered in TCTR 1

125

expression will permit functional analysis of this gene and assessment of its role in tomato ethylene signal transduction.

3' .... 5'

~Tll I CaMV 35s promote~ TCTRI ~ ~ pBI121

3' ... 5'

~Tll E8Promoter TCTRI ~ ~ pBI121

5' .. 3'

2:Tll E8 Promoter TCTRI ~

~ pBI121

Figure 2. DNA constructs for altering TeTRI expression in transgenic tomato plants. Constitutive (CaMV35s) and fruit-specific (ES) promoters have been used to generate both sense and antisense constructs in the binary plant transfonnation vector pBI121. The NPTII gene is included for selection of transform ants on kanamycin containing media.

3.3. MAP-BASED CLONING OF DEVELOPMENTAL REGULATORS OF TOMATO FRUIT RIPENING

In an effort to gain insight into the genetic regulation of ethylene biosynthesis, response, and additional components of fruit ripening control, which are influenced in part or solely by factors outside the sphere of ethylene effects, we have continued efforts toward map-based cloning of the rin and nor loci. rin and nor are non-allelic yet result in similar phenotypes including inhibition of climacteric ethylene biosynthesis and fruit ripening, and ripening of fruit from both mutants cannot be induced with exogenous ethylene [27]. In addition, rin and nor have been mapped to chromosomes 5 and 10, respectively, and both have been shown to reside in regions of tomato chromosomes sufficiently saturated with DNA markers for chromosome walks [15]. Recent progress has resulted in the development of BAC and Y AC contigs which span both loci (J. Vrebalov, V. Padmanabhan, D. Ruezinsky, R. White and J. Giovannoni, unpublished) and use of said high molecular weight clones as hybridization probes to isolate candidate RIN and NOR cDNAs. Mutant complementation with putative RIN and NOR cDNAs is in progress.

126

4. Conclusion

Comprehensive understanding of the mechanisms underlying the fruit ripening process in climacteric fruits such as tomato will require analuysis of both hormonal and developmrnental pathways which regulate this process. Eventual understanding of the function of genes such as EPI, TCTRI, RIN and NOR, which represent putative components of both ethylene-signaling and developmental regulatory systems, will be important steps toward comprehension of how evolution has selected and modified control mechanism for both general whole plant ethylene response and specific coordinated events such as fruit ripening.

5. References

1. Hobson, G. and Grierson, D. (1993) Tomato, in G.B. Seymour, J.E. Taylor, G.A Tucker (eds.) Biochemistry of Fruit Ripening, Chapman and Hall, London pp 405-442.

2. Gray, J.E., Picton, S., Giovannoni, J.1. and Grierson, D. (1994) The use of transgenic and naturally occurring mutants to understand and manipulate tomato fruit ripening. Plant, Cell Environ. 17, 557-571.

3. Smith, c., Watson, C., Ray, J., Bird, c., Morris, P, Schuch, W. and Grierson, D. (1988) Antisense RNA inhibition of polygalacturonase gene expression in transgenic tomatoes, Nature 334, 724-726.

4. Giovannoni, 1., DellaPenna, D., Bennett, A and Fischer, R. (1989) Expression of a chimeric polygalacturonase gene in transgenic rin (ripening inhibitor) tomato fruit results in polyuronide degradation but not fruit softening, Plant CellI, 53-63.

5. Kramer, M., Sanders, R., Sheehy, R., Melis, M., Kuehn, M. and Hiatt, w. (1990) Field evaluation of tomatoes with reduced polygalacturonase by antisense RNA, in A Bennett, and S. O'Neill, (eds.), Horticultural Biotechnology, Alan R. Liss, pp 347-355.

6. Fray, R. and Grierson, D. (1993) Identification and genetic analysis of normal and mutant phytoene synthase genes of tomato by sequencing, complementation, and co-suppression, Plant Mol. BioI. 22,589-602.

7. Oeller, P.W., Wong, L.M., Taylor, L.P., Pike, D.A. and Theologis, A (1991) Reversible inhibition of tomato fruit senescence by antisense l-aminocyclopropane-l-carboxylate synthase, Science 254, 427-439.

8. Hamilton, A, Lycett, G. and Grierson, D. (1990) Antisense gene that inhibits synthesis of the hormone ethylene in transgenic plants, Nature 346, 284-287.

9. Wilkinson, J., Lanahan, M., Yen, H., Giovannoni, J. and Klee, H. (1995) An ethylene-inducible component of signal transduction encoded by Never-ripe, Science 270,1807-1809.

10. Yen, H., Shelton, A, Howard, L. Vrebalov, J. and Giovannoni, 1. (1997) The tomato high pigment (hp) locus maps to chromosome 2 and influences plastome copy number and fruit quality. Theor. AppliedGen. 95, 1069-1079.

II. Theologis, A, Oeller, P., Wong, L., Rothmann, W. and Gantz, D. (1993) Use of a tomato mutant constructed with reverse genetics to study fruit ripening, a complex developmental process, Dev. Gen. 14,282-259.

12. Giovannoni, J., Noensie, E., Ruezinsky, D., Lu, x., Tracy, S., Ganal, M., Martin, G., Pillen, K. and Tanksley, S. (1995) Molecular genetic analysis of the ripening-inhibitor and non-ripening loci of tomato: a first step in genetic map-based cloning of fruit ripening genes, Mol. Gen. Gen. 248, 195-206.

13. Rick, C. (1980) Tomato linkage survey, Rep. Tomato Genet. Coop. 30,2-17. 14. Penarrubia, D., Aguilar, M., Margossian, L. and Fischer, R. (1992) An antisense gene stimulates

ethylene hormone production during tomato fruit ripening, Plant Cell 4, 681-687.

127

15. Theologis, A. (1992) One rotten apple spoils the whole bushel: the role of ethylene in fruit ripening, Cell 70, 181-184.

16. Yen, H., Lee, S., Tanksley, S., Lanahan, M., Klee, H. and Giovannoni, J. (1995) The tomato Never-ripe locus regulates ethylene-inducible gene expression and is linked to a homologue of the Arabidopsis ETR1 gene, Plant Physiol. 107, 1343-1353.

17. Trentmann, S. and Kende, H. (1995) Analysis of Arabidopsis cDNA that shows homology to the tomato E8 cDNA, Plant Mol. BioI. 29, 161-166,

18. Lanahan, M.B., Yen, H.C., Giovannoni, lJ. and Klee, H.J. (1994) The Never Ripe mutation blocks ethylene perception in tomato, Plant Cell 6, 521-530.

19. Koshland, D. (1995) The two-component pathway comes to eukaryotes, Science 262,532. 20. Bleeker, A., Estelle, M., Somerville, C. and Kende, H. (1988) Insensitivity to ethylene conferred by

a dominant mutation in Arabidopsis thaliana, Science 241, 086-1089. 21. Schaller, G. and Bleeker, A. (1995) Ethylene-binding sites generated in yeast expressing the

Arabidopsis ETR1 gene, Science 270, 1809-1811. 22. Wilkinson, J., Lanahan, M., Clark, D., Bleeker, A., Chang, C., Meyerowitz, E. and Klee, H.

(1997) A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in heterologous plants, Nature Biotech. 15,444 - 447

23. Fujino, D., Burger, D. and Bradford, K. (1989) Ineffectiveness of ethylene biosynthetic and action inhibitors in phenotypically reverting the Epinastic mutant of tomato (Lycopersicon esculentum Mill.), J. Plant Growth Reg. 8, 53-61.

24. Ecker, J.R. (1995) The ethylene signal transduction pathway in plants, Science 268, 667-675. 25. Kieber, J., Rothenberg, M., Roman, G., Feldman, K. and Ecker, J. (1993) CTRl, a negative

regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raffamily of protein kinases, Cel/n, 427-441.

26. Ursin, V. (1987) Morphogenetic and physiological analyses of two developmental mutants of tomato, Epinastic and diageotropica, Ph.D. Dissertation, University of Cali fomi a, Davis.

27. Tigchelaar, E.C., McGlasson, W.B. and Buescher, R.W. (1978) Genetic regulation of tomato fruit ripening, HortScience 13, 508-513

ETHYLENE AS THE INITIATOR OF THE INTER-TISSUE SIGNALLING AND GENE EXPRESSION CASCADES IN RIPENING AND ABSCISSION OF OIL PALM FRUIT

1. Abstract

J. HENDERSON AND D. J. OSBORNE Oxford Research Unit, The Open University, Foxcombe Hall, Boars Hill, Oxford, United Kingdom, OX1 5HR. UK

The ripening and shedding of the oil palm fruit has unusual characteristics. The onset of ripening is not initiated by a rise in ethylene production. The induction of a mesocarp lipase, the start of carotene and lipid synthesis and the steady accumulation of 13-carotene and triacylglycerol proceeds for some 20 days without a detectable formation of ethylene. Then, at a critical stage of late ripeness, ethylene is produced by mesocarp tissue and during the next 8-10 hours rises many-fold. Coincident with this ethylene rise, the mesocarp synthesises a highly active 13-1,4-glucanhydrolase (Cellulase 1) of pI 6.0. These two events are followed closely by translucency of the central cells of the fruit abscission zone and the expression there of a zone-specific cellulase (Cellulase 2) and newly induced exo- and endo-polygalacturonases. On the palm, the fruit is shed naked; the subtending tepals that remain on the bunch abscind some two days later with different enzymes involved. In mutant non-abscinding palms, that do not shed their fruit in the field, links in these inter-tissue co-ordinated events are disrupted. The rise in fruit mesocarp ethylene does not signal fruit abscission, although it is coincident with the induction of mesocarp cellulase 1. Also, the Cellulase 2 induced in the abscission zone is unlike that of the wild type. The association of non-shedding with an abnormal cellulase function is now the basis of transformation efforts to remodel the oil palm.

2. Introduction

There are two major economically important oil crops grown today. The soybean, a dicotyledonous field plant grown for its seeds in temperate climates has already been genetically manipulated for improved yield and lipid composition. The other, the oil palm, is a monocotyledon plantation crop grown for its fruits in tropical and semi­tropical countries, mainly SE Asia, Africa and South America.

The oil palm fruit yields two types of triacylglycerol; composed mainly of palmitic and oleic acids from the mesocarp and lauric acid from the kernel [1]. Yields of these valuable lipids have been increased some 25-30% since the 1960s through breeding

129

130

programmes, improved plantation management and the introduction of clonal material generated via tissue culture propagation procedures from elite palms. Current restrictions to a further improvement of crop yields lie in the mechanisms that control fruit ripening and abscission and the problems these cause for harvesting.

2.1. THE PROBLEM

Several hundred fruit are produced in large, tight bunches (25-30kg). At maturity, the fruit are bright orange with a purple region around and below the stigma, but this orange colour is obscured in the densely-packed fruit. Only when a few fruit fall to the ground is the whole bunch harvested. At that stage, the outer fruit are fully ripe and at maximum triglyceride content but the inner fruit are less mature and still capable of further synthesis. As soon as a fruit starts the abscission process, net lipid production in the mesocarp ceases and instead, the triacylglycerol is hydrolysed with liberation of the free fatty acids so spoiling oil quality. For this reason, harvested bunches are transported on the same day to the plantation factory for steam killing and oil extraction. The industry, therefore, seeks the means to synchronise the ripening of the fruit on the bunch and to delay the time for shedding. With the goal of remodelling the oil palm to achieve these objectives, we have explored the factors that regulate both the ripening and the shedding of this valuable fruit to discover the most appropriate gene targets for man ipulation.

3. Fruit Ripening

3.1. THE SIGNAL FOR RIPENING

By c.120 days after anthesis, the pale yellow fruit reaches full size. Shortly after, it starts to synthesise and deposit triacylglycerol in specific oil-bearing cells in the mesocarp, in association with a newly-expressed lipase activity [2] and a synthesis of carotenes (Fig. I). There is no detectable rise in ethylene production and the signal for the induction of these events remains unknown [3].

In the next c.20 days, the fruit ripens and turns bright orange except for the region of high anthocyanin content around the stigma. At c.140-l45 days after anthesis, the fruit starts to produce ethylene which rises to high levels over the next 8-10 hours. Again, the signal initiating this rise is unknown, but it is coincident with a disruption of membrane integrity in the large oil-bearing cells, as seen by transmission electron microscopy (Fig. 2A). No deterioration is observed in cells surrounding the vascular elements (Fig. 2B).

I 350 Q N I '0 I ~

~ x ~ 250

1)1: .!::!. u.. C'I ii:

VI C'I c 2. ~ 150

OJ VI L.. OJ C OJ OJ +­

+- C o OJ '- 0 50 8 I

o ~.---................................. . , , , ,

50 90 130 Day s after anthesi s

9 I P

f

170

7

5

3

o

OJ C QJ

>-:!: I.J..I

Figure 1. Carotene accumulation, lipase activity [2] and ethylene production [3] during fruit development and ripening. Triacylglycerol deposition [8] also begins c.12S daa and parallels lipase activity

131

Figure 2. TEMs of ripe mesocarp. A. Large oil-containing cell. B. Lignified cell with surrounding parenchyma.

3.2. INDUCTION OF CELLULASE 1

With the initiation of ethylene production in the mesocarp, a specific mesocarp cellulase is also newly expressed over the next 8-10 h and cellulase activity rises (Fig. 3). This expression is ethylene-induced, being initiated by added ethylene or ACC and suppressed by inhibitors of ACC synthase and/or ACC oxidase. No other polysaccharide-cleaving enzymes are induced in the mesocarp at this stage.

132

1 90

FRUIT: .. 7"0 T x

~ 0 Nol separa led 50 ~ x -;;; )( _,1(- .... '" 0 70 . Separa Ii ng /' .. .... .c

~ "--s; x Separa led / .. 3-0 "';s / \ .£ .. Ethylene production I .. ::: LL .. 10

en ~ I

~ -- C 50 1 x 10

"0 I .". .1 x o-e -0 . 1 QJ >. I

u +- ::J -:;; 0-6 "0

30 0 :+= '-u 1 0... « r Q-4 QJ

QJ 0'" C

III QJ

E 10 I 0-2 >-. :-/,: . .c .3 +-(jj w --- - --

___ 4 (> 0 LJ 0

120 125 130 135 140 145 150 155 160 165

Days after anthesis

Figure 3_ Mesocarp cellulase activity and ethylene production of individual fruit during ripening and abscission_

4. Fruit Shedding and the Initiation of Abscission

Within a further 9-\ 0 hours of the rise of ethylene and Cellulase I in the mesocarp, the cells of the fruit-pedicel abscission zone become translucent, round up and separate. In this short period, major enzymic changes take place within these cells. Two exo-acting and another (possibly two) endo-acting polygalacturonase activities are newly expressed, together with a zone specific cellulase (Cellulase 2). In association, a ~­galactosidase and a ~-l ,3-glucanhydrolase are up-regulated approximately four-fold.

4.1. INDUCTION OF POL YGALACTURONASES

Fractionation of the polygalacturonases and their location on activity gels (Fig. 4) indicates exo-activities resembling those of the peach abscission zone (and unlike the tomato fruit) but endo-activity with similar pIs and immunorecognition to that of the tomato fruit [4, 5]. Extraction of zone material at low pH (1.6) followed by column fractionation indicates that almost all PG endo-activity corresponds to PG2 with little conforming to a PG 1 complex [6].

40

.. e: 'e .. e: 30 0

:;:: u d L.. --0 E 20 c:

~ 10 u «

VOID AND BUFFER WASH

pi 6.2--6.4

I --'" ':' x ~

I , : 1 , i

pi 9.3 pI 9.0

I-, , , ,

2 : 3 : ' , I I ,

I ,

500

~

oS 300

W d

Z 100~

O~~~~~.----~---"~~~--~ o 5 15 25 35 45

Fraction Number

Figure 4. Fractionation of polygalacturonase isoenzyrnes by cation exchange chromatography from the abscission zone tissue of separated ripe fruit. The fractions containing PG activity from each peak were combined, concentrated by ultrafiltration, fractionated on IEF gels (PI 3.5-9.5) and silver stained for protein. IEF activity gels confirmed the pI 6.2-6.4 isoforms, and acid activity gels (pH 5.5) confirmed the pI 9.3 and 9.0

4.2. INDUCTION OF CELLULASE 2

133

During the change to translucency in abscission zone cells, and over the same period as the new expression of the zone exo- and endo-polygalacturonases occurs, a new cellulase activity is co-induced in the zone. This cellulase (Cellulase 2) differs from the Cellulase 1 of the mesocarp. Whereas the mesocarp Cellulase 1 has a broad pH range of activity extending from pH 3.0 to an optimum of pH 5.5-5.8 and a pI of approx. 6.0 (as detected on IEF and acidic activity gels), the zone Cellulase 2 has a more restricted range with low activity below pH 4.8 (Fig. 5) and no detectable activity at pI 6.0.

5. The Quest for Non-abscinding Mutants

As part of the overall programme to modity fruit ripening and abscission, mutant palms with non-abscinding characteristics were sought amongst the Malaysian plantation population. One such palm has been identified that does not shed its fruit although in all

134

other respects its growth and development appears normal. The progress of fruit ripening is similar to that of other wild-type palms including the rapid (over 8-10 hours) rise in ethylene production and the induction of a mesocarp-type Cellulase 1. Unlike normal palms, however, fruit shedding does not follow upon the rise in ethylene and the meso carp-specific cellulase expression. Instead, the fruit remains upon the palm until it rots and no Cellulase 2 or polygalacturonase activities develop at the zone.

,.. .~ 60 on .s: ..; .. 'C

i>E ;:.. 40 .... >

:;::: u «

20

",)1

tr'

,

1--- T Mesocarp j,/ ""-, / , \ " \

Figure 5. pH-dependent cellulase activity in ripe mesocarp and separated zone tissue. Enzyme extract + CMC substrate incubated for 3h (n = 5, bar = s.d)

These fruit are not, however, incapable of abscission for if spikelets of fruit are removed from the bunch the fruit present upon them will commence a slow abscission, taking some 1-3 days to completion instead of the wild-type speed of 8-10 hours. The abscission zone therefore clearly possesses functional target cells for separation. Analyses of the enzyme activities induced during the post-harvest off-the-palm abscission indicates induction of the normal polygalacturonase gene expressions as well as the induction of a new cellulase activity. This zone cellulase activity does not, however, resemble Cellulase 2 of the wild-type zone (Fig. 6). Instead its fractionation and pH characteristics more closely resemble those of the mesocarp Cellulase 1 (Fig. 5). Careful analyses of other enzymes with a potential for cell wall modification or degradation have indicated no differences between the mutant and wild-type enzyme cohort at abscission, other than that of the Cellulase 2. For this reason the differences in the Cellulase 2 gene expressions in mutant and wild-type zones is one focus for the remodelling of oil palm fruit abscission. The difference is not necessarily attributable to a different gene expression, for it could as well be due to a post-transcriptional or post­translational modification of the same gene product. Additionally, the cell wall composition or sugar linkages in the abscission zone of the mutant could be different from that of wild-type and 13C CP-MAS NMR analysis has indicated that there are such differences although these may not be causal to non-shedding.

w VI o .3 w

LJ

20

"'----Normal Zone

3-5 4·0 4·5 5·0 5·5 6·0 6·5 7·0 75

pH

Figure 6. pH-dependent cellulase activity in ripe wild-type and mutant separated zone tissue. Enzyme extract + CMC substrate incubated for 3h (n = 5, bar = s.d)

135

It appears that if the correct abscission signal is conveyed from the mutant mesocarp it is not perceived or exploited in the zone as long as the fruit remain upon the palm. A further possibility suggests that the Cellulase I of the mutant is abnormal and fails to produce an additional oligosaccharide signal that is required (in addition to ethylene) for the induction of the specific polygalacturonases and Cellulase 2 of a normal and rapidly separating zone. Indeed, we already have evidence for the presence of an abscission­accelerating oligosaccharide fragment in bean leaf abscission [7] and in normal separating wild-type zones of the oil palm (unpublished data).

The critical stages for a proposed inter-tissue signalling control of ripening and abscission and a perceived role for cellulases in the achievement of these events in the oil palm is set out in Figure 7.

6. Acknowledgements

A BBSRC ROPA Award and Unilever pIc funding is acknowledged. We thank Ms H. Davies for transmission electron micrographs and Mrs Vivian Reynolds for camera­ready preparation of the manuscript. This work was carried out during the tenure (DJO) of a Leverhulme Fellowship.

136

SIGNAL ?

NOT ETHYlENE

SIGNAL ffilYLENE

+/­oligo­

sacchilride

FRUIT RIPENING lipase Induction -lipid Synthesis­

carotenj Synthesis

FULLY RIPE MESOCARP Oil (ell Membrane Disintegration

I Ethylene Production Cetlula.se1 Induction ___ ...,

'

MUTANT 7 LESIONS .

! ABSCISSION ZONE , Cellulase 2 Induction _ -- J

Exo-& Endo- Polygalacturonase I ExpreSSion

Middle Lamella ~issolution

t FRUIT ABSCISSION

Figure 7. Signalling cascade in the ripening and abscission of wild-type oil palm fruit

7. References

1. Hartley, C.W.S. (1988) The Oil Palm, Third Edition, Longman Group, UK. 2. Henderson, J. and Osborne, DJ. (1991) Lipase activity in ripening and mature fruit of the oil palm.

Stability in vivo and in vitro, Phytochemistry 30, 1073-1078. 3. Henderson, l and Osborne, DJ. (1994) Inter-tissue signalling during the two-phase abscission in

oil palm fruit, J. Exp. Bot. 45, 943-951. 4. Bongbi, C., Rascio, N., Ramina, A. and Casadoro, G. (1992) Cellulase and polygalacturonase

involvement in the abscission ofleafand fruit explants of peach, Plant Mol. Bioi. 20, 839-848. 5. Ali, Z.M. and Brady, CJ. (1982) Purification and characterization of the polygalacturonases of

tomato fruits, Aust. J. Plant Physiol. 9, 155-169. 6. Pressey, R. (1988) Re-evaluation of the changes in polygalacturonase in tomatoes during ripening,

Planta 174, 39-43. 7. Thompson, D.S. and Osborne, D.l (1994) A role for the stele in inter-tissue signalling in the

initiation of abscission in bean leaves (Phaseolus vulgariS L.), Plant Physiol. 105,341-347. 8. Bafor, M.E. and Osagie, A.U. (1986) Changes in lipid class and fatty acid composition during

maturation of mesocarp of oil palm (Elaeis guineensis) variety Dura, J. Sci. Food Agric. 37, 825-832.

ETHYLENE PERCEPTION AND RESPONSE IN CITRUS FRUIT

1. Abstract

X. CUBELLS-MARTINEZ, J.M. ALONSO, M.T. SANCHEZ­BALLEST A AND A. GRANELL instituto de Biologia Molecular y Celular de Plantas, UP V-CSIC, Universidad Politf!cnica de Valencia, Spain

Most of our knowledge of the plant hormone ehylene in fruit comes from studies conducted with climacteric fruit where ethylene has a key importance. Citrus fruit are probably one of the most studied non-climacteric fruits and still the role of ethylene in certain aspects of fruit development is a matter of debate. In this paper we substantiate the hypothesis that in the flavedo of the fruit, many of the molecular changes associated with maturation of the peel are mediated by ethylene. The nature of some of the genes regulated by ethylene is presented. The posibility that ethylene responsive genes may be regulated by modulation of ethylene sensitivity in the flavedo is discussed and the strategy for more confidently answer this question by using a transgenic approach is presented.

2. Introduction

Fruit ripening/maturation is a complex process which involves changes in a number of characteristics such as colour, texture and flavour. Fruits have traditionally been classified into climacteric and non-climacteric depending on the presence or absence of a large transient increase in respiration and in the synthesis of the plant hormone ethylene at the onset of ripening. The citrus fruit is a non-climacteric fruit and maturation extends over a period of months during which the internal composition changes gradually, making the fruit palatable. The peel also "matures", although in this tissue the most conspicuous change refers to the colour of the flavedo (outer coloured part of the rind). Environmental factors such as temperature, light and nutritional state are important for the induction of co lor transition in citrus fruit peel [1 I]. In fact a first evidence that the developmental programme of peel "ripening" can be separated from that of the pulp is evidenced in tropical regions where the high constant temperatures prevent the peel from developing the characteristic rind colour of citrus, while the pulp matures normally.

Although the peel of Citrus fruit is able to produce significant amounts of ethylene under certain conditions [I7, 23] sound fruit behave as a typical non-climacteric fruit,

137

138

exhibiting only low constant levels of ethylene production throughout maturation. Thus, the role of endogenous ethylene has been a matter of debate [5, 21, 22] but the latest results using ethylene antagonists indicate that low basal levels of bound ethylene may indeed be required for degreening of the flavedo [12]. Treatment of full-size fruit with ethylene induces a number of changes at the morphological [21], physiological and biochemical levels similar to those observed during natural degreening of the fruit that occurs during ripening and is therefore used as a commercial practice [14]. The pulp however show no physiological response to ethylene, neither do gibberellins modify the pulp ripening programme. Flavedo maturation is associated with changes at the biochemical and gene expression level [4, 7]. But in contrast to the wealth of information concerning climacteric fruit, we know very little of the molecular changes during maturation of non-climacteric fruits.

3. Differential Gene Expression during Flavedo Maturation in the Citrus Fruit

The biochemical characterization of the enzymes responsible for the changes occurring during Citrus flavedo maturation, mainly pigment changes, sugars and volatiles is difficult because of the presence of secondary metabolites (phenolic compounds, terpenes, flavonoids, etc) which interfere with the determination of enzyme activities. A molecular approach based on 2D-gel protein analysis of the in vivo and in vitro synthesized polypeptides [4] provided a broad qualitative approach to the molecular changes occurring during flavedo maturation. In this study it was shown that maturation of the flavedo was accompanied by the specific synthesis of mRNAs and proteins, and that ethylene was able to induce in the flavedo the accumulation of a similar set of polypeptides. Ethylene induced also the accumulation of an additional class of mRNAs and polypeptides that were not detected during flavedo maturation, either because they were not expressed during maturation or they expression was transient and escaped to the analysis. Later studies are leading to the identification of specific mRNAs which are helping to understand the changes occurring during maturation of the citrus flavedo [1, 2,3].

3.1. GENES AND PROTEINS RELATED TO THE TRANSFORMATION FROM CHLOROPLAST TO CHROMOPLAST

During the maturation of the citrus fruit, the flavedo undergoes a transition from photosynthetic to a non-photosynthetic stage, which is affected by environmental, nutritional, hormonal and genetic factors [11]. This transformation is associated with the differentiation of chloroplast to chromoplast and involves many changes, those dealing with color, such as chlorophyll degradation and carotenoid biosynthesis being the most evident.

The levels of chloroplast polypeptides decrease during flavedo maturation [11] and this is also observed at the mRNA level as shown for RubisCO and chlorophyll alb binding transcripts (see Figure 1). The activity of a plastid enzyme, chlorophyllase, which seems to playa role in chlorophyll degradation, was shown to increase in Citrus

139

fruit peel in response to ethylene due to de novo synthesis of the protein [27]. Furthermore gibberellic acid, which has an antagonistic effect on the chloro to chromoplast transformation, reverts the ethylene inducing effect [27].

The increased levels of a non photosynthetic Fd in maturing flavedo, which can be also induced by ethylene may provide the Fd required for the dioxygenase step of chlorophyll degradation [25] and also observed in senescing tissues [2,26].

Another important component of the color change occurring in the flavedo during maturation is the increase in carotenoids. Carotenoid biosynthesis appears to require the presence of the vitamin thiamin. It is interesting that thiamin and thi mRNA levels, which probably encodes an enzyme involved in the biosynthesis of this vitamin, accumulate in the flavedo during development and maturation and that the levels of thi mRNA can be further increased by ethylene treatment but reverted by the inhibitor of flavedo degreening gibberellin [18].

The possibility of a nutritional control of flavedo degreening has been proposed by Huff [16]: high C/N ratios will favour the transformation of chloroplast to chromoplast. Interestingly, the mRNA for a sucrose phosphate synthase accumulates in the flavedo during maturation [unpublished results, and also in the pulp: 19]. It is known that the total sugar content of the peel increase in parallel to the natural degreening of the peel of fruits attached to the tree [11]. In this respect it is interesting that low temperatures have been reported to bring about sugar accumulation and this would favour the transformation of chloroplast into chromoplast [11].

UCE,PR

Rubisco Cab

NP-Fd, Thi, SPS, VacPro, PR

PAL,Phyto

LTP, Glucanase

Unknown

CERS

_lilliE. maturation_

Figure 1. Gene expression during flavedo fruit maturation. VCE: ubiquitin conjugating enzyme; PR: pathogenesis related protein; RubisCO: small subunit of Ribulosebisphosphate carboxylase/oxygenase, Cab: Chlorophyl alb binding protein; NP-Fd: non-photosyntehtic ferredoxin; SPS: sucrose-phosphate synthase; PAL: phenylalanine ammonia lyase; Phy: phytoalexin biosynthesis gene; L TP: lipid transfer protein; GIucanase:B-I,3-glucanase, CERS: citrus ethylene response sensor.

140

3.2. GENES INVOLVED IN PROTECTION AGAINST PATHOGENS AND ENVIRONMENTAL STRESSES

A number of mRNAs accumulating in the flavedo corresponds to proteins possibly involved in protecting the tissue (and therefore the fruit) from pathogens. This is the case for a ~-1,3-glucanase, aPR of unknown function, a non-specific LTP and a protein related with a phytoalexin biosynthetic enzyme (unpublished results). It is interesting that thiamin (thi gene reported to accumulate in flavedo maturation and in response to ethylene) may also be important as an inducer of the accumulation ofPR proteins.

Another set of proteins seems to be there to protect the fruit against environmental stress. This is the case for genes induced by low temperatures, a gene with homology with a water-stress inducible protein and a CytP450 and PAL which are involved in the biosynthesis or secondary metabolites, some of which may have a role in protecting the fruit against pathogens or as sunscreens.

3.3. SENESCENCE RELATED GENES

A gene with homology with a vacuolar processing enzyme (VacPro) which also accumulates in senescent tissues and the fact that most of the maturation associated mRNAs can be found in ethylene-treated leaves and/or senescent leaves indicates that overlapping gene expression programmes occur in the flavedo during degreening and in leaf senescence. It is interesting that no increase in mRNAs homologous to cystein proteinases of the papain type involved in general digestion of protein was observed in the flavedo during colour change (unpublished). This result confirms previous observations that during flavedo maturation no increase in general proteolytic activity or protein decline was observed [10].

4. Effect of Ethylene and Ethylene Action Inhibitors on Fruit-maturation Associated Gene Expression. Tissue Specificity

Different mRNAs accumulating in the flavedo during maturation can be induced, although at specific rates and sensitivities, by exogenous treatment with ethylene (Fd, VacPRo, many of the pathogen-related genes). Interestingly, this can be done at any stage of fruit development, and most of these genes can also be induced by ethylene in leaves (not in all cases for roots) and in flowers during natural opening and senescence. Particularly striking is that ethylene not only upregulates genes whose mRNAs accumulate during flavedo maturation but also have a down regulatory effect on the levels of Cab and RubisCO whose levels decrease during maturation. Fd and Thi for instance are induced by ethylene in a similar manner as occurs during normal maturation. Application of ethylene action inhibitors lower the endogenous levels of most of maturation associated genes (for instance Fd and VacPro), but not all of them (a specific PR, other unknown mRNAs and CERS remain constant).

141

Exogenous treatment with ethylene induces on the other hand a number of mRNAs that were not found to accumulate during flavedo maturation under normal conditions [1,4].

5. Do Flavedo Cells Modulate their Level of Sensitivity to Ethylene during Maturation? Future Directions

Citrus fruit tissues are able to produce ethylene [17] and to respond to ethylene [3, 27 and this paper]. Furthermore it was shown that Citrus tissues are able to bind ethylene as determined by the ethylene displacement assay of Sisler [13]. The concentration of ethylene required to occupy half of the binding sites present in citrus leaves was estimated to be 0.15~LlL [13] that is in the range of ethylene conc. required to elicit a molecular response as determined in ours and other people studies. Although similar binding experiments were not conducted in fruit tissues, our studies of dose response using ethylene inducible genes as probes indicates that the flavedo and leaves have similar levels of ethylene sensitivity.

Using a combination of PCR and library screening we have isolated cDNAs and genomic clones for a Citrus homologue (cERS) of the ethylene response sensor [ERSINR; 15; 28] which we found to be developmentally regulated during flavedo maturation. CERS expression can be further stimulated by exogenous treatment with ethylene and by environmental stresses. Expression data supports that environmental and developmental regulation of CERS modulate the expression of ethylene related genes during normal flavedo maturation [Cube lis et al. in preparation].

The availability of flavedo specific genes (our results) would enable us to place a mutated form of citrus ERS that confers dominant insensitivity to ethylene (assayed first in yeast as in 24) under the control of a flavedo specific promoter and introduce this construct into Citrus plants following an efficient method of transformation reported recently [20]. Study of the plants modified to overexpress of the ethylene insensitive ERS form in the flavedo would help to clarify the role on ethylene in natural flavedo degreening and maturation. On the other hand over expression of ethylene biosynthetic gene or wt ERS under the control of the specific promoter may yield plants where the internal and external maturation coincide in time. Additional advantages of using a mutCERS involves introducing the ethylene insensitive character by linking mutCERS to and abscission specific promoter like those of cellulase genes [8] to delay or diminish organ abscission.

6. Conclusions

The astounding diversity of tissues which can become fleshy (see review by Coombe, [9] and differentiate into a fruit anticipates the existence of a wide variety of developmental and ripening behaviors. In dealing with this, the division of fruits in climacteric and non-climacteric, despite of being useful results too simplistic. This is further reinforced when it is becoming clear that in addition to ethylene, other

142

developmental cues play an important role in climacteric fruit ripening and conversely that ethylene may also regulate some aspects of ripening in non-climacteric citrus fruits such as in citrus. Despite their low basal levels endogenous ethylene appears to be responsible for part of the changes in gene expression occurring during flavedo maturation by the environmental and developmental regulation of ethylene sensitivity mediated by CERS.

Flavedo Maturation

Environmental cues ~ Developmental factors

~r .. m~~r1ti~ 1 Ethylene independent Ethylene-mediated Ethylene independent Changes Changes Changes

Figure 2. Schematic representation of different components of flavedo maturation and the interplay of environmental and developmental factors in modulating ethylene sensitivity.

7. Acknowledgement

This research was supported by the Spanish Ministry of Science and Education grant ALI96-0506-C03-3.

8. References

1. Alonso, 1.M. and Granell, A. (1995) A putative vacuolar processing protease is regulated by ethylene and also during fruit ripening in Citrus fruit, Plant Physiol. t09,541-547.

2. Alonso, 1.M., Charnarro, 1. and Granell, A. (1995) A non-photosynthetic ferredoxin gene is induced by ethylene in Citrus organs, Plant Mol. BioI. 29, 1211-1221.

3. Alonso, I.M., Charnarro, 1. and Granell, A. (1995) Evidence for the involvement of ethylene in the expression of specific RNAs during maturation of the orange, a non-climacteric fruit, Plant Mol. BioI. 29, 385-390.

4. Alonso, 1.M., Garcia- Martinez, 1.1. and Charnarro, 1. (1992) Two dimensional gel electrophoresis pattern of total, in vivo and in vitro translated polypeptides from orange flavedo during maturation and following ethylene treatment, Physiol. Plant. 85, 147-156.

5. Apelbaum, A., Goldschmidt, E.E. and Ben-Yehoshua, S. (1976) The involvement of endogenous ethylene in the induction of color changes in "Sharnouti" orange, Plant Physiol. 57, 836-838.

6. Buchanan-Wollaston, V. (1997) The molecular biology ofleafsenescence, J.Exp. Bot. 48, 181-199. 7. Bums, I.K., and Baldwin, E.A. (1994) Glycosidase activities in grapeffruit flavedo, albedo and juice

vesicles during maturation and senescence, Physiol. Plant. 90,37-44. 8. Burns, 1.K., Lewandowski, DJ., Nairn, 1. and Brown, G.E: (1998) Endo-l,4-B-glucanase gene

expression and cell wall hydrolase activities during abscission in Valencia orange, Physiol. Plant. t02,217-225.

9. Coombe, B.G. (1976) The development of fleshy fruits, Ann. Rev. Plant Physiol. 27,207-228

143

10. Goldschmidt, E.E. (1986) Maturation, ripening, senescence, and their control: a comparison between fruit and leaves, in S.P. Monselise (ed.), Handbook of fruit set and development, CRC Press, Inc., pp. 483-491.

II. Goldschmidt, E.E. (1988) Regulatory aspects of chloro-chromoplast interconversion in senescing Citrus fruit peel, Isr. J. Bot. 37, 123-130.

12. Goldschmidt, E.E., Huberman, M. and Goren, R. (1993) Probing the role of endogenous ethylene in the degreening of citrus fruit with ethylene antagonists, Plant Growth Regut. 12,325-329.

13. Goren, R. and Sisler, E.C. (1986) Ethylene binding characteristics in Phaseolus, Citrus and Ligustrum plants, Plant Growth Regul. 4,43-54.

14. Grierson, W., Cohen, E., and Kitagawa, H. (1986) Degreening, in W.F. Wardowski, S. Nagy and W. Grierson (eds.), Fresh citrusfruils, Westport Connecticut: AVI Publishing CO. Inc., pp 253-274.

IS. Hua, 1., Chang, C., Sun, Q. and Meyerowitz, E. (1995) Ethylenc insensitivity conferred by Arabidopsis ERS, Science 269, 1712-1714.

16. Huff, A (1983) Nutritional control of degreening and regreening in Citrus peel segments, Plant Physiol. 73,243-249.

17. Hyodo, H. (1981) Ethylene production by citrus fruit tissues, Proc. Int. Soc. Citriculture 880-882. 18. Jacob-Wilk, D., Goldschmidt, E.E., Riov, J., Sadka, A. and Holland, D. (1997) Induction ofa Citrus

gene highly homologous to plant and yeast Ihi genes involved in thiamine biosynthesis during natural and ethylene-induced fruit maturation, Plant Mol. Bioi. 35, 661-666.

19. Komatsu, A., Takanokura, Y., Omura, M., and Akihama, T. (1996) Cloning and molecular analysis of cDNAs encoding three sucrose phosphate synthase isoforms from a citrus fruit (Citrus unshiu Marc.), Mol. Gen. Gen. 252,346-351.

20. Pena, L., Cervera, M., Juarez, J., Ortega, c., Pina, J.A, Duran-Vila, N. and Navarro, L (1995) High efficiency Agrobacterium-mediated transformation and regeneration of citrus, Plant Sci. 104, 183-191.

21. Purvis, AC. (1981) Sequence and chloroplast degreening in calamondin fruit as influenced by ethylene and AgN03, Plant Physiol. 66,624-627.

22. Purvis, AC. and Barmore, C.R. (1981) Involvement of ethylene in chlorophyll degradation in peel of citrus fruits. Plant Physiol. 68, 854-856.

23. Riov, J. and Yang, S-F. (1982) Autoinhibition of ethylene production in citrus peel discs, Plant Physiol. 69,687-690.

24. Schaller, G.E. and Bleecker, AB. (1995) Ethylene-binding sites in yeast expressing the Arabidopsis ETRI gene, Science 270,1809-1811.

25. Schellengerg, M., Matile, P. and Thomas, H. (1993) Production of a presumptive chlorophyll catabolite in vitro: requirement for reduced ferredoxin, Planta 191,417-420.

26. Smart, C.M., Hosken, S.E., Thomas, H., Greaves, JA, Blair, B.G. and Schuch, W. (1995) The timing of maize leaf senescence and characterization of senescence-related cDNAs, Physiol. Plant. 93,673-82.

27. Trebitsh, T., Goldschmidt, E.E. and Riov, J (1993) Ethylene induces de novo synthesis of chlorophyllase, a chlorophyll degrading enzyme, in Citrus fruit peel, Proc. Natl. Acad. Sci. USA 90, 9441-9445.

28. Wilkinson, JR., Lanahan, M.B., Hsiao-Ching, Y., Giovannoni, J.J. and Klee, H.J. (1995) An ethylene-inducible component of signal transduction encoded by never-ripe, Science 270, 1807-1809.

PHYTOCHROME B AND ETHYLENE RHYTHMS IN SORGHUM: BIOSYNTHETIC MECHANISM AND DEVELOPMENTAL EFFECTS

1. Abstract

S.A. FINLAYSON 1, C-J. HE3, I-J. LEEI, M.C. DREW3, J.E. MULLET2

AND P.W. MORGAN1

/ Department of Soil and Crop Sciences, 2 Department Biochemistry and Biophysics, 3 Department of Horticulture, Texas A&M University, College Station, Texas 77843, USA

The sorghum cultivar 58M exhibits reduced photoperiodic sensitivity resulting in early flowering and shows shade avoidance behavior even under non-shaded conditions. This cuItivar possesses a mutation in a PHYB gene, presumed to result in a non-functional phytochrome B protein. Both mutant and wild-type plants produce ethylene in a rhythmic cycle, with peaks near mid-day; however, peak ethylene production by the mutant (phyB) is about 10 times greater than the wild-type's. Under bright light, the ethylene rhythm is circadian, and correlates with rhythmic abundance of ACC oxidase (ACCO) mRNA and ACCO enzyme activity. Under simulated shade, in which the wild­type plant is a near phenocopy of the phyB mutant, the wild-type plant produces ethylene rhythms similar to those observed in the mutant. ACCO mRNA abundance shows a high amplitude rhythm in both cuItivars, but does not translate into enzyme activity under these conditions. The high amplitude ethylene rhythms produced in both cuItivars by simulated shading are diurnal but not circadian, and are caused by rhythmic accumulation of ACC. Fumigation of seedlings with I ppm ethylene in a rhythm like that produced by the plants themselves results in a reduction of shoot elongation in both cultivars; however, the fresh and dry weights ofthe roots and shoots are reduced only in the wild-type. While most of the differential ethylene is produced by the shoot, roots of the phyB mutant produce two to three times as much ethylene as the wild-type. Hypoxic treatment of roots induces ethylene production and aerenchyma only in the wild-type. These results suggest that some aspects of seedling development may show reduced sensitivity to ethylene as a result of the phyB mutation.

2. Introduction

Light rules the world of the plant. Because of the importance of light in the life of the plant, plants have evolved sophisticated mechanisms to sense the duration and quality of light they are exposed to, and to use this information to regulate their growth and development in a manner complimentary to the signals they receive. One sensing

145

146

mechanism which plays a major role in higher plants utilizes the protein chromophore complexes known as phytochromes. The phytochrome family is comprised of several different members, some of which have not had clear functions ascribed. Two phytochromes which seem to play major roles in the life of the plant, phytochrome A and phytochrome B, have been studied in some detail. Phytochrome A has been typically described as a light labile phytochrome and is thought to be responsible for the far-red high-irradiance response [9]. Responses to the red/ far-red balance of light and classical responses reversible by red/far-red light are principally attributed to phytochrome B. In situations in which plants are shaded, phytochrome B may be involved in sensing the reduced R:FR and low irradiance, resulting in a growth habit designed to allow the plant to escape from the shaded environment. This phenomenon, termed the shade avoidance response, includes the rapid and excessive elongation of the shoot at the expense of root growth, reduced chlorophyll content, and other symptoms. Crop stands exhibiting this response due to self-shading can be expected to produce reduced yields due to unproductive allocation of resources [9].

Sorghum is a C4 grain of tropical origin, closely related to rice and maize. Sorghum initiates floral development more rapidly when exposed to short photoperiods, and for this reason is described as a qualitative short-day plant. Several genes involved in decreasing the time required to flower (and therefore mature) under non-inductive photoperiods (long days) have been characterized in sorghum [8]. Similarities to known phytochrome mutants in other species suggested that one of these maturity alleles (Ma3) encoded a phytochrome B gene [3]; subsequent experiments demonstrated the absence ofa light stable phytochrome in a cultivar possessing the mutant allele [1], and mapping and sequence analysis of the gene provided definitive evidence that Ma3 encodes PHYB, with the mal allele encoding a mutant form (PhyB-J) which is prematurely truncated and presumably non-functional [2]. Compared to the wild-type 100M, the near isogenic cultivar 58M possessing the mutant phyB-l allele shows excessive shoot elongation, less chlorophyll, reduced tillering and flowers very early even under non-inductive days [3].

The application of gibberellins can elicit dramatic shoot elongation, and promote flowering- mimicking loss of phytochrome B function. Analyses of gibberellin levels in the phyB-l mutant cultivar showed that while peak GA levels are about the same as in the wild-type plant, the levels of the GAs in both cultivars followed a diurnal rhythm, and the timing ofthe peak level was different between the two cultivars [5].

We have previously reported the phenomenon of circadian ethylene rhythms in sorghum [4]. Both the wild-type and phyB-l mutant cultivars produce ethylene in a circadian rhythm, with peaks occurring during the light period. However, the amplitude of the ethylene rhythm is approximately ten times higher in the phyB-l mutant. While a diurnal rhythm can be produced with either photo or thermoperiods alone, both signals are required for circadian entrainment. Extreme shading can be simulated by growing seedlings under a regimen of dim, far-red enriched light. Wild type seedlings grown in this way exhibit a shade avoidance phenotype, very similar to that constitutively expressed by the phyB-l mutant, which itself remains largely unaffected by this treatment. Simulated shading also causes the wild-type seedlings to produce high amplitude ethylene rhythms similar to those constitutively produced by the phyB-l

147

mutant. The correlation of high amplitude rhythms with the shade avoidance phenotype suggests that endogenous ethylene rhythms may be involved in this response.

100M "Normal" Ught

20 8 20

Figure I. Density scans of diurnal northern blots of sorghum, harvested every 3 hours, probed with SAC02

3. Mechanism of Rhythmic Ethylene Production

The mechanistic basis for the rhythmic production of ethylene was investigated in seedlings grown under both "normal" light and simulated shading environments, by analyzing ACC oxidase mRNA abundance and enzyme activity and ACC levels. Under "normal" light, abundance of the ACC oxidase mRNA SAC02 shows dramatic diurnal oscillations in the phyB-1 mutant, but it is present only at very low levels in the wild­type plant (Fig. I). ACC oxidase enzyme activity in the phyB-l mutant follows a pattern consistent with SAC02 mRNA abundance, with peak activity near the middle of the day, coincident with ethylene evolution. Again, ACC oxidase enzyme activity in the wild-type plant is much lower than that observed in the phyB-1 mutant (data not shown). The rhythms of both SAC02 mRNA abundance and ACC oxidase activity persist in constant light demonstrating the circadian nature of these phenomena. ACC levels did not correlate well with ethylene production in either cultivar, although ACC levels were higher in the phyB-l mutant (data not shown).

Seedlings grown in simulated shade differed from those grown in "normal" light in the mechanism of rhythmic ethylene production. SAC02 mRNA abundance from both cultivars grown in simulated shade showed diurnal rhythms (Fig. I); however, ACC oxidase enzyme activity did not correlate with these rhythms, nor with the ethylene

148

produced by the seedlings (data not shown). Analysis of ACC levels in both cultivars indicates that under simulated shade, high amplitude ethylene rhythms are a consequence of rhythmic abundance of ACC (data not shown). Interestingly, the simulated shade environment was unable to elicit circadian entrainment of the ethylene rhythm.

SSM 100M

Figure 2. Inhibition of sorghum shoot elongation with 1 ppm ethylene

4. Developmental Effects

r 20 '-'

i 15

~ 10

1 5

o~"--'"'"''''''" ............. '"''"-..... SSM 100M

Figure 3. Effect of 1 ppm ethylene on sorghum shoot dry weitgh

Ethylene is known to play a promotive role in shoot elongation in deep water rice; however, in most systems studied it has been shown to be inhibitory to both shoot and root elongation. Does the high amplitude ethylene rhythm observed in the phyB-I mutant, and in the wild-type plant under simulated shading, contribute to the shade avoidance phenotype? Conversely, is the ethylene produced a consequence of the phenotype? Perhaps shading, or the loss of PHYB function, renders the plant insensitive to ethylene, releasing ethylene biosynthesis from a feedback inhibition loop. To test the involvement of ethylene in the growth response of the seedlings, and to assay the plants' sensitivity to ethylene, seedlings were fumigated with 1 ppm ethylene for 3 h per day in a manner simulating the natural high amplitude ethylene rhythm. Shoot elongation was inhibited by ethylene fumigation in both cultivars, with more dramatic inhibition observed in the wild-type plants (Fig. 2). Furthermore, both the wild-type's shoot and root dry weights were decreased with ethylene treatment, while the phyB-I mutant's were unchanged, or slightly increased (Fig. 3).

The formation of aerenchyma, lysogenous air spaces in the root cortex, are known to be induced by ethylene. As an additional measure of ethylene sensitivity, aerenchyma development in roots subjected to hypoxia treatment (which induces root ethylene production) was measured. While most of the additional ethylene produced by the phyB-I mutant originates in the shoot, roots of this cultivar also generate approximately two to three times as much ethylene as the wild-type. Roots of the phyB-I mutant were found to possess a constitutive low level of aerenchyma development. Hypoxia treatment was not able to induce further aerenchyma formation in the mutant, but it was

149

found to strongly promote aerenchYiila in roots of the wild-type plant (Fig. 4). Ethylene exposure produced similar effects as hypoxia treatment (data not shown).

5

control hypoxia

oa.-....... """"''''''''_.J...-__ ~ __ SSM 100M

Figure 4. Induction of aerenchyma in sorghum by hypoxia

5. Discussion

Two different mechanisms appear to be involved in the production of high amplitude ethylene rhythms, one as a consequence of loss of PHYB function, and the other in response to simulated shade. Both of these mechanisms generate a shade avoidance response in the plant. Under "normal" light conditions, rhythmic ethylene production is a consequence of cycling ACC oxidase enzyme activity, resulting from rhythmic fluctuations in the abundance of ACC oxidase mRNA. Circadian ethylene rhythms in Stellaria have also been demonstrated to arise from mRNA abundance driven ACC oxidase enzyme activity [6]. Conversely, variations in ACC levels drive diurnal ethylene rhythms in Chenopodium [7] and in sorghum under conditions simulating shade.

We are accumulating evidence that some aspects of growth and development in the phytochrome B deficient mutant show reduced sensitivity to ethylene. The inhibitory effects of ethylene fumigation (Fig. 2) suggest that ethylene is not the cause of increased shoot elongation in either the phyB-l mutant, or the wild-type plant grown in simulated shade. The lack of an ethylene effect on dry matter accumulation in the phyB-l mutant, and the inability of hypoxia to induce aerenchyma formation in the mutant's roots lends support to the thesis that loss of PHYB function may reduce the plant's sensitivity to some aspects of ethylene action.

6. Acknowledgments

Supported by USDA-NCRIGP grant #97-35304-4820 (PWM).

150

7. References

1. Childs, K.L., Cordonnier-Pratt, M-M., Pratt, L.H. and Morgan, P.W. (1992) Genetic regulation of development in Sorghum bieolor. VII. mal flowering mutant lacks a phytochrome that predominates in green tissue, Plant Physiol. 99, 765-770.

2. Childs, K.L., Miller, F.R., Cordonnier-Pratt, M-M., Pratt, L.H., Morgan, P.W. and Mullet, J.E. (1997) The sorghum photoperiod sensitivity gene, MaJ, encodes a phytochrome 8, Plant Physiol. 113,611-619.

3. Childs, K.L., Pratt, L.H. and Morgan, P.W. (1991) Genetic regulation of development in Sorghum bieolor. VI. The mal allele results in abnormal phytochrome physiology, Plant Physiol. 97, 714-719.

4. Finlayson, S.A, Lee, 1-1. and Morgan, P.W. (1998) Phytochrome 8 and the regulation of circadian ethylene production in sorghum, Plant Physiol. 116, 17-25.

5. Foster, K.R. and Morgan, P.W. (1995) Genetic regulation of development in Sorghum bieolor. IX The mal allele disrupts diurnal control of gibberellin biosynthesis, Plant Physiol. 108,337-343.

6. Kathiresan, A, Reid, D.M. and Chinnappa, c.c. (1996) Light and temperature entrained circadian regulation of activity and mRNA accumulation of I-aminocyclopropane-I-carboxylic acid oxidase in Stellaria longipes, Planta 199, 329-335.

7. Machackova, I., Chauvaux, N., Dewitte, W. and Van Onckelen, H. (1997) Diurnal fluctuations in ethylene formation in Chenopodium rubrum, Plant Physiol. 113,981-985.

8. Quinby, J.R. (1967) The Maturity Genes of Sorghum, in AG. Norman, (ed.), Advances in Agronomy, Vol 19, Academic Press, New York, pp. 267-305.

9. Smith, H. (1995) Physiological and ecological function within the phytochrome family, Ann. Rev. Plant Physiol. Plant Mol. BioI. 46,289-315.

INVOLVEMENT OF ETHYLENE BIOSYNTHESIS AND ACTION IN REGULA TION OF THE GRA VITRO PIC RESPONSE OF CUT FLOWERS

1. Abstract

S. PHILOSOPH-HADAS 1, H. FRIEDMAN 1, R. BERKOYITZ­SIMANTOy1, I. ROSENBERGER 1 , EJ. WOLTERING2, A.H. HALEyy3 AND S. MEIR 1

JDepartment of Postharvest Science of Fresh Produce, ARO, The Volcani Center, Bet Dagan 50250, Israel; A TO-DLO, P.o.Box 17, 6700 AA Wageningen, The Netherlands; and 3The Kennedy-Leigh Centre for Horticulture Research. Faculty of Agriculture, The Hebrew University of Jerusalem, Rehovot 76100, Israel

Placing cut snapdragon (Antirrhinum majus L.) spikes horizontally induced elevated ethylene production rates. The imposition of curvature was preceded (2 h after gravistimulation) by an asymmetrical distribution of ethylene between lower and upper longitudinally halved stem sections, in favor of the lower halves. A corresponding gradient of free IAA could be detected only 30 min after gravistimulation. This lAA gradient was rapidly reversed after 1-24 h of gravistimulation, showing higher IAA levels in the upper stem halves. Additionally, one ACC synthase (ACS) gene, isolated from the bending zone of horizontal spikes, was apparently not expressed in IAA-treated stems. Thus, the gravity-induced ethylene asymmetry does not reflect an asymmetrical distribution of free IAA, but rather possibly exhibits a stress response imposed by change of stem orientation. Abolishing the ethylene gradient across the stem by applying various ethylene inhibitors [CoCI2, aminoethoxyvinyl-glycine (A YG), silver thiosulfate (STS), 2,5-norbomadiene (NBD), or I-methylcyclopropene (I-MCP)], by exposure to ethylene (1-10 ~I r\ or by using Ca2+ antagonists [LaCl3, EGTA, 1,2-bis (2-aminophenoxy)ethane-N ,N,N',N'-tetraacetic acid (BAPT A) or trans-l ,2-cyclohexane dinitro-N,N,N',N'-tetraacetic acid (CDTA)], significantly inhibited curvature. This indicates that the ethylene gradient is correlated with bending. The results therefore suggest a role for ethylene in mediating the progress of the gravitropic response.

2. Introduction

One of the major postharvest problems of several cut flowers with actively growing spikes is their bending in response to gravity, mainly during their horizontal transport [5]. The prevailing model of Cholodny and Went [7, 12] tries to explain this negative

151

152

gravitropic response of shoots on the basis of excess IAA accumulation in the lower side of the stem, thereby causing growth asymmetry that leads to its reorientation. Apart of IAA and other plant hormones [6], ethylene was found to be involved in various gravireacting systems. Thus, upon their reorientation from the vertical to the horizontal, graviresponding plant organs showed increased ethylene production and formation of an ethylene gradient [3, 4, 6, 8, 9, 13-15]. Based on the reported role of auxin-induced ethylene production in growth promotion of vegetative tissues [1, 16], it could be assumed that ethylene may mediate the gravitropic response induced by IAA [1, 9]. However, the role of ethylene in gravitropism is still controversial, since in only a few cases ethylene inhibitors could block the gravitropic response [9, 13, 14].

The present study tries further to elucidate the role of ethylene in the gravitropic response of snapdragon spikes, in relation to IAA, to formation of an ethylene gradient across the stem and to increased ethylene production in response to shoot reorientation.

3. Materials and Methods

Experiments were performed with snapdragon (Antirrhinum majus L.) freshly cut spikes. All treatments were performed as previously described [4, 9], in a standard controlled environment room maintained at 20c C with 60-70% relative humidity and 24-h light (14 f.Ullol m-2s-1). Spikes (60 cm long) were pulsed vertically with the various solutions for 24 h, and then placed horizontally in 1-1 plastic cylinders, containing organic chlorine, for an additional 24 h. Kinetics of stem bending was estimated by monitoring with a protractor the curvature angle of 10 spikes at hourly intervals.

NBD was applied during 24 h of gravistimulation at a concentration of 4000 fll rl as described previously [9, 15], to groups of 10 snapdragon spikes (60 cm long) placed horizontally in 30-1 plastic barrels kept at 20cC in darkness. I-MCP was applied before gravistimulation at a concentration of Ifll rl by enclosing vertical snapdragon spikes (20 cm long) in 2-1 jars for 2 h in the light at 20cC. Exogenous ethylene was applied during 10 h of gravistimulation at concentrations of 0.2, 1, 10 or 25 fll rl to snapdragon spikes kept in 2-1 jars in light or darkness.

For measurements of ethylene production rates 5-cm stem segments were excised from the bending zone of treated and untreated spikes at various time intervals following gravistimulation, as described previously [4, 9]. Ethylene production of longitudinally halved stem sections, enclosed in sealed 25-ml Erlenmeyer flasks for 1 h at 20c C, was monitored by a gas chromatograph.

Endogenous free IAA levels were determined in longitudinally halved 5-cm stem sections (2 g) excised from the bending zone of snapdragon spikes at various time intervals following gravistimulation. IAA was purified by HPLC and GC-MS [2]. Total RNA was isolated from 5-cm stem sections excised from the bending zone of horizontal spikes and vertical spikes treated with either water or IAA (10-3 mM). From each sample, ACS genes were cloned by performing RT-PCR using degenerate primers to ACS. PCR fragments with expected length of approximately 1200 bp were purified from the gel and cloned. From each sample, 10-14 independent clones were sequenced.

153

4. Results and Discussion

4.1. EFFECT OF GRA VISTIMULA TION ON ETHYLENE PRODUCTION

Placing cut snapdragon spikes horizontally induced elevated ethylene production rates (Table 1). Consequently, as previously reported [3, 4, 6, 9,13-15], an ethylene gradient between lower and upper longitudinally halved stem sections, in favor of the lower halves, was formed within 2 h of gravistimulation and was maintained during 24 h, (Table 1). During this period longitudinally halved stem sections excised from vertical stems, did not show any gradient of ethylene formation (Table 1). The development of the gradient was closely correlated with the angle of curvature (Table 1). These results suggest that ethylene is involved in the gravitropic process of snapdragon spikes.

TABLE 1. Effect of stem orientation on ethylene production rates across the stem bending zone in relation to the angle of curvature. Results represent means ± SE of 10 spikes. UH, upper halves; LH, lower halves.

Time of Ethylene production rates (nl gFW-1 h-1)

gravistimulation or Vertical spikes Horizontal spikes vertical position (h) Side A SideB UH LH

0 2 6

10 24

1.8 ± 0.3 2.1 ± 0.4 1.8 ± 0.3 2.1 ± 0.4 14.5 ± 2.3 18.7± 2.0 22.8 ± 3.0 49.6 ± 1.9 41.1 ± 2.4 37.6 ± 1.6 45.0 ± 7.0 93.7 ± 6.0 23.0 ± 1.4 23.9 ± 0.8 22.7 ± 1.8 43.5 ± 2.5

3.6 ± 0.4 5.3 ± 0.5 4.2 ± 0.2 8.2 ± 0.5

TABLE 2. Effect of gravistimulation on distribution of free lAA across the bending zone of snapdragon stem. lAA was isolated from 2g tissue taken from 10 spikes. UH, upper halves; LH, lower halves.

Time of gravistimulation (h) o

0.5 1.0 1.5 2.0

24

Free 1AA content (ng gFW-1 h-1)

UH LH 2.21 1.50 4.30 12.30 3.39 1.58 2.00 0.50 3.70 1.57 7.80 1.10

Angle of curvature (0)

180 ± 0.0 180 ± 0.0 lSI ± 3.7 130± 2.9

91 ± 3.7

4.2. RELATIONSHIP BETWEEN GRAVITY-INDUCED ETHYLENE AND IAA

Increased ethylene production rates may result from increased ACS activity, which is known to be induced by IAA [16]. Thus, the gravity-induced ethylene asymmetry across the stem may merely reflect the asymmetric distribution of IAA, which is postulated by the Cholodny-Went theory [7, 12]. Our data show that a gradient of free IAA in favor of the lower stem half could be detected only 30 min after gravistimulation (Table 2). This

154

IAA gradient was rapidly reversed after 1 h of gravistimulation, showing higher IAA levels in the upper stem half, that were maintained up to 24 h (Table 2). This suggests that the gravity-induced ethylene gradient across the spike (Table 1) does not necessarily result from a corresponding gravity-induced gradient of IAA.

To further confIrm these unexpected results, we have cloned several ACS genes in the stem bending zone following treatment with exogenous IAA or gravistimulation. From each sample, 10-14 independent ACS clones were isolated. Based on their sequences, these ACS clones were classifIed in 3 different groups, designated as ACS 1, ACS2 and ACS3, which showed about 60% homology to each other. Table 3 shows that ACS2 seems to be IAA-induced, while ACS3 seems to be associated with gravistimulation and not induced by IAA. These results further support the suggestion outlined above that the gravity-induced ethylene asymmetry does not reflect an asymmetrical distribution offree IAA, but rather may possibly exhibit a stress response.

TABLE 3. Distribution of ACS clones in the bending zone of snapdragon stems following IAA treatment or gravistimulation.

Treatments Number of ACS independent clones ACS 1 ACS2 ACS3

VerticalIH20 Vertical I IAA Horizontal I H20

550 280 824

4.3. IS ETHYLENE NECESSARY FOR THE BENDING RESPONSE?

In order to establish a direct involvement of ethylene in the gravitropic process, further studies with ethylene inhibitors were performed. Unlike previous studies with Kniphofia spikes [15], and similar to other stem systems [13, 14], all ethylene inhibitors tested remarkably delayed curvature formation of snapdragon spikes following 8 h of gravistimulation (Table 4). Moreover, as previously reported [9], several ethylene inhibitors (CoCh, STS and NBD) also signifIcantly inhibited spike bending following 24 h of gravistimulation (Table 4). The lack of complete inhibition obtained by A VG or I-MCP (Table 4) could probably be ascribed to insufficient concentrations. These results indicate that ethylene is necessary for the gravitropic response of snapdragon spikes, probably for mediating the promotion of the growth process involved [1,4].

TABLE 4. Inhibition of snapdragon spikes bending by ethylene inhibitors during gravistimulation. Data (means of 10 spikes) are presented as percentage of control untreated spikes. N.d., not determined.

Ethylene inhibitor

AVG (I mM) CoCI2 (6.7 mM) STS (1.5 mM) NBD (40001-11 )"1)

I-MCP (1 flll"l)

% Inhibition of the bending angle 8h 24h 40 0 90 95 67 n.d. 47

73 88 o

155

4.4. ROLE OF ETHYLENE GRADIENT IN GRA VITROPISM

Although the existence of the gravity-induced ethylene gradient was reported in several bending stems [3, 6, 13-15], its role in the process is still not understood. Therefore, attempts were made in this study to examine the effect on stem curvature of abolishing the ethylene gradient by various means. The ethylene synthesis inhibitor, CoCh completely blocked stem curvature (Table 4), by abolishing the ethylene gradient through inhibition of ethylene synthesis in both upper and lower stem halves. Based on the assumption that the gradient of ethylene production across the stem (Table 1) reflects presumably a similar gradient of ethylene action, the inhibition of curvature obtained by the 3 ethylene action inhibitors assayed (STS, NBD and I-MCP) (Table 4), indicates that this gradient is necessary for the bending process.

Conversely, neutralizing the gravity-induced differential endogenous ethylene production by saturating the whole stem with excess concentrations of exogenous ethylene (1 or 10 III rl) inhibited bending by 42 and 37%, respectively. The inhibitory response was obtained only when exposure to ethylene was performed in the light. This further implies a possible involvement of ethylene in the growth response following gravistimulation [4], which may be differently manifested in light or darkness [11].

A further confirmation for the role of the gravity-induced ethylene gradient across the stem was provided by the studies with calcium antagonists, which imply that cytosolic Ca2+ plays an important role in the gravitropic response of snapdragon spikes [4, 8, 9] and other gravibending systems [12]. The results of Table 5 clearly show that all Ca2+ antagonists inhibited bending of snapdragon spikes, with LaCh and CDT A being the most effective during 24 h of gravistimulation. These two Ca2+ antagonists are of particular interest, since they blocked spike curvature by eliminating the ethylene gradient in opposite manners. Thus, while LaCl3 prevented ethylene gradient by increasing ethylene production rates of both upper and lower stem· halves [4], CDT A prevented the gradient by reducing ethylene production rates of the lower stem half [9]. Taken together these results indicate that the development of this ethylene gradient could be an important prerequisite for development of stem curvature, since abolishment of an ethylene gradient by various inhibitors and in different manners eliminates bending.

TABLE 5. Inhibition of the bending angle of snapdragon spikes by various calcium antagonists during gravistimulation. Data (means of 10 spikes) are presented as percentage of control untreated spikes.

Ethylene inhibitor

LaCI3 (10 mM) EGTA (20 mM) CDTA(10mM)

BAPTA(5 mM)

% Inhibition of the bending angle 8 h 24 h 100 100 56

100 100

10 100 52

It may, therefore, be concluded that the gravity-induced ethylene, which does not seem to result from the gravity-induced IAA redistribution, has an independent role in

156

the bending process. This role might be associated with its possible effects on growth [I, 4] and/or changing sensitivity of the tissue to auxin [10].

5. Acknowledgments

Supported by grant No. 95/26 from DIARP, The Joint Dutch-Israeli Agricultural Research Program, and by grant No. IS-2434-94 from BARD, The United States-Israel Binational Agricultural Research and Development Fund. Contribution from the ARO, The Volcani Center, Bet Dagan, Israel, No. 434-98.

6. References

1. Burg, S.P. and Burg, E.A (1967) Auxin stimulated ethylene formation: its relationship to auxin inhibited growth, root geotropism and other plant processes, in F. Wightman and G. Setterfield (eds.), Biochemistry and Physiology of Plant Growth Substances, Press, Ottawa, pp. 1275-1294.

2. Chen, K-H., Miller, AN., Patterson, G.W. and Cohen, J.D. (1988) A rapid and simple procedure for purification of indole-3-acetic prior to GC-SIM-MS analysis, Plant Physiol. 86, 822-825.

3. Clifford, P.E, Reid, D.M. and Pharis, R.P. (1983) Endogenous ethylene does not initiate but may modifY geobending - a role for ethylene in autotropism, Plant Cell Environ. 6, 433-436.

4. Friedman, H., Meir, S., Rosenberger, I., Halevy, AH., Kaufman, P.B. and Philosoph-Hadas, S. (1998) Inhibition of the gravitropic response of snapdragon spikes by the calcium channel blocker lanthanum chloride, Plant Physiol. 118(2), (in press).

5. Halevy, AH. and Mayak, S. (1981) Senescence and postharvest physiology of cut flowers - Part 2, Hortic Rev. 3, 59-143.

6. Kaufman, P.B., Pharis, R.P., Reid, M.D. and Beall, F.D. (1985) Investigations into the possible regulation of negative gravitropic curvature in intact Avena sativa plants and in isolated stem segments by ethylene and GAl, Physiol Plant. 65,237-244.

7. Li, Y., Hagen, G. and Guilfoyle, TJ. (1991) Gene expression from an auxin-inducible promoter supports the Cholodny-Went theory on tropisms, Plant Cell 3, 1167-1175.

8. Philosoph-Hadas, S., Meir, S., Rosenberger, I. and Halevy, AH. (\995) Control and regulation of the gravitropic response of cut flowering stems during storage and horizontal transport, Acta Hortie. 405, 343-350.

9. Philosoph-Hadas, S., Meir, S., Rosenberger, I. and Halevy, AH. (1996) Regulation of the gravitropic response and ethylene biosynthesis in gravistimulated snapdragon spikes by calcium chelators and ethylene inhibitors, Plant Physiol. 110,301-310.

10. Rorabaugh, P.A. and Salisbury, F.B. (1989) Gravitropism in higher plants shoots. VI. Changing sensitivity to auxin in gravistimulated soybean hypocotyls, Plant Physiol. 91, 1329-1338.

11. Smalle, J., Haegman, M., Kurepa, J., Van Montagu, M. and Van der Straeten, D. (1997) Ethylene can stimulate hypocotyl elongation in the light, Proc. Natl. Acad. Sci. USA 94, 2756-2781.

12. Trewavas, AJ. (ed.) (1992) Tropism forum: What remains of the Cholodny-Went theory? (A multi-author discussion), Plant Cell Environ. 15, 757-794.

13. Wheeler, R.M. and Salisbury, F.B. (1981) Gravitropism in higher plant shoots. I. A role for ethylene, Plant Physiol. 67,686-690.

14. Wheeler, R.M., White, R.G. and Salisbury, F.B. (1986) Gravitropism in higher plant shoots. IV. Further studies on participation of ethylene, Plant Physiol. 82, 534-542.

15. Woltering, E.J. (1991) Regulation of ethylene biosynthesis in gravistimulated Kniphofia (hybrid) flower stalks, J. Plant Physiol. 138,443-449.

16. Yang, S.F. and Hoffman, N.E. (1984) Ethylene biosynthesis and its regulation in higher plants, Annu. Rev. Plant Physiol. 35,155-189.

EtHYLENE AND FLOWER DEVELOPMENT IN TOBACCO PLANTS

1. Abstract

D. DE MARTINIS 1•2, I. HAENEN\ M. PEZZOTTe, E. BENVENUT02

AND C. MARlANII ICatho/ie University of Nijmegen, Department of Botany, Plant Cell Laboratory. Toernooiveld 1, 6525ED, Nijmegen, The Netherlands; 2ENEA Dipartimento lnnovazione, Divisione Bioteenologie ed Agrieoltura. C.R. Casaecia, C.P.2400, Roma; 3Universita' di Perugia, Faeolta di Agraria, lstituto di Miglioramento genetieo Vegetale, Borgo XXgiugno 74,06122, Perugia,ltaly

To study the role in plant reproduction of a pistil-specific gene encoding for the ethylene-forming enzyme (ACC oxidase), we constructed transgenic tobacco plants in which the expression of the ACC oxidase gene was inhibited. Transgenic flowers showed female sterility due to an arrest in megasporogenesis. Pollen tubes were able to reach the ovary but did not penetrate into the immature ovule. Flower treatment with an ethylene source resulted in the recovery of ovule development as well as restored guidance of the pollen tube tip into the ovule micropyle. These results demonstrate that the plant hormone ethylene is necessary to trigger the very early stages of female sporogenesis and ultimately to enable fertilisation.

2. Introduction

The role of the plant hormone ethylene in plant reproduction has been studied in a number of flower types with regards to pollen tube/style interaction [24], pollination­induced flower senescence [21] and fruit ripening [7, 16, 17]. So far, little is known about the role of ethylene in early pistil development. In monocots, namely orchid, Zang and O'Neill [26] have shown that pollination and auxin regulate ethylene production and ovary development. In Petunia flowers, the expression of the gene family encoding for the ACC oxidase, is temporally regulated during pistil development [21]. The authors suggest that ethylene plays a role in reproductive physiology by regulating the maturation of the secretory tissues of the pistil. In Arabidopsis, the gene encoding for a member of the ethylene receptor family ETR2, recently cloned [9, 20], is preferentially expressed in the inflorescences, floral meristems, developing petals and ovules thus indicating a possible tissue-specific role of ethylene. However, the role of ethylene in

157

158

pistil development has not been elucidated yet. We are currently involved in the study of the cellular and molecular mechanisms that rule flower development and fertilization and we isolated a tobacco pistil-specific cDNA encoding for the ethylene-forming enzyme ACC oxidase (ACO). To understand the role of ethylene during pistil development, we used a transgenic gene silencing approach to down-regulate ACO gene expression. Here we report the characterisation of the ACO gene, in the tobacco ovary during development, and we describe the ovule morphology of transgenic plants in which the ACO mRNA accumulation was greatly reduced. We show that ACO down­regulation influences ovule development and the process of fertilisation. The phenotype obtained is reversible if an ethylene source becomes available to the flower, thereby demonstrating a direct involvement of the hormone in ovule development.

A STAGE 1 2 3 4 5 6 7 8 9 10 11 12

Figure 1. Temporal and spatial characterisation of ACO gene expression in the ovary during tobacco flower development. We monitored ACO gene epression in the ovary during the 12 stages of tobacco flower development [6, II]. IOJ.lg of total ovary RNA from flowers at different stages (\ to 12) of flower development were loaded. A) The RNA gel blots were hybridised with labelled full-length ACO cDNA. The filters were stripped and rehybridised with labelled tobacco ribosomal cDNA (rRNA). For in situ hybridisation the ovaries from tobacco flowers at different developmental stages were used. Hybridisation was visualized as red/purple color on the ovules. Photograph were taken using brigth-field microscopy. B) In situ hybridisation with the antisense ACO probe of a developing ovule at flower stages I to 4. The single integument is stil a primordia and does not envelop the nucellus. C) in situ hybridisation with the antisense ACO probe of a sample at the same stage as in B). Size bar IOOJ.lm. (cw) carpel wall, (fn) funiculus, (i) integument, (nu) nucellus, (ov) ovules, (pI) placenta.

3. ACO Gene Expression during Tobacco Ovary Development

The ACO gene is mainly expressed in the pistil - in the stigma, in the transmitting tract of the style and in the ovary - and it is not detectable in the pollen nor in the anther [Weterings K., Pezzotti M., Cornelissen M., Mariani C., unpublished]. Figure IA shows ACO gene expression in the ovary during flower development. The expression is first detectable in the ovaries of young flower buds at stage 4-5 [6, 11]. During flower development, the ovules arise from the placenta as a finger-like structures composed of the funiculus, that attaches the ovule to the placenta, the integument primordia and the nucellus that harbors the megasporocyte [2]. The expression pattern of ACO is detectable since the very early stages of flower/ovule development and gradually

159

increases until anthesis (stage 12) when the ovules are completely differentiated [23]. In situ hybridisation in wild-type tobacco shows that ACO transcript accumulation within the ovary is preferential on the ovules (Figs 1B, C), on the funiculus, on the integument primordia and on the nucellus.

AC03'end cDNA S3 promoter............ .,/" NOS ter .

A) RB -------lC==~=:J--.---------+ +--LB S30CA

B) RB __ ~~romotel ADH i,/ ACO full length

-+-

NOSter. ______ LB 35ACO

Figure 2. Constructs used for plant trasformation. A) We constructed a chimaeric antisense gene consisting of the 690-bp 3' end fragment of the ACO cDNA, cloned in reverse orientation under control of the pistil­specific Petunia inflata promoter S3 [IS] into a plant expression vector, BINl9 [1]. Transgenic tobacco plants were regenerated after Agrobacterium-mediated transformation essentially as described previously [22]. B) We also generated transgenic plants expressing the ACO full-length cDNA in sense orientation, under control of the 35SCaMV promoter, in order to inhibit the gene by 'co-suppression' (Fig. 2B). Both promoters confer pistil expression of the gene encoding for ~-glucuronidase (GUS) in transgenic tobacco plants (unpublished observation). Transgenic plants were selected on the basis of kanamycin resistance, transferred into the greenhouse and analysed for flower phenotype.

4. ACO Gene Silencing in Transgenic Tobacco

As the product of the ACO gene is the last enzyme in ethylene biosynthesis, its expression in plant cells suggests the production of ethylene. To understand a possible role of ethylene in ovule development, we produced transgenic tobacco plants in which

A ~ rL"J .....

<::I '" U U

'" <::I

i It") i ;J I'f')

ACO

rRNA

Ovary

~ rL"J .....

<::I '" U U

'" <::I .... It") i M ~ I'f') rL"J

Stigma/Style

Figure 3. ACO gene expression and ACO activity in wild-type and transgenic tobacco at anthesis. A) Northern blot analysis of the transformants. RNA was isolated from dissected ovaries (OV) and stigma/style (ST) portions of wild-type, 35 aco 14 and S30caS pistils at anthesis. 1 0 ~g of total ovary RNA and 5 ~g of total stigma and style RNA were loaded. The RNA gel blots were hybridised with labelled full-length ACO cDNA. The filters were stripped and rehybridised with labelled tobacco ribosomal cDNA (rRNA) to ensure an equable loading and transfer of RNA within the same tissue.

160

ACO gene expression was silenced by two different approaches (described in Fig. 2). We selected the transgenic plants at flowering stage on the basis of lack of seed setting and flower morphology (small flowers, not shown). We produced heterozygous T1 generations by backcrossing wild-type flowers with transgenic pollen. The progenies resulting from these crosses segregated for the same floral phenotype as observed in the primary transformants. As the transgenic pollen was capable of fertilising and transmitting the trans gene, our results indicate that the lack of seed set in transgenic plants was not caused by male sterility but had to be related to a pistil defect. Northern blot analysis of the transgenic plants revealed the level of ACO transcript accumulation in the wild-type and transgenic tobacco (Fig. 3). In the ovary of the transformants S30caS and 35aco14 the presence of the ACO rnRNA was no longer detectable. Interestingly, we could not obtain ACO down-regulation in the stigma and style of the plants harbouring the antisense construct, whereas we obtained a clear reduction using the co-suppression approach.

Figure 4. Differential Interference Contrast images (DIC) of the most observed phenotypes from the transgenic flowers at anthesis. A) A mononucleate megasporocyte partially surrounded by the integument. B) A binucleate megasporocyte , presumably a dyad produced after the first meiotic division. In all the samples, the nucellus (nu) still clearly surrounds the megasporocyte (m) is clearly visible. Size bar: 50 J.lm.

5. Megasporogenesis Is Arrested in Ovules of Sterile Plants

Cytological analysis revealed that the ovules of the female-sterile transgenic plants were arrested in development. Figure 4 shows that at flower anthesis (stage 12), the ovules of all the transgenic plant lines S30ca and 35aco always showed the main traits of early ovule morphogenesis: presence of the nucellus (Fig. 4 A, B), callose accumulation within the nucellus (not shown) and absence of the embryo sac. These results clearly showed that ACO down-regulation in the tobacco ovary inhibited integument growth and megasporogenesis, suggesting that ethylene controls ovule development.

161

6. Ethylene Restores Fertilty in the Transformed Plants

To demonstrate the direct involvement of ethylene in regulating ovule development we provided an ethylene source to the transgenic flowers. Thus, we treated transgenic flowers either with ethephon (2-chloroethylphosphonic acid), which hydrolytic breakdown leads to evolution of ethylene [25]. Although it has been shown that some ethephon effects are not due to ethylene release [14], in general ethephon closely mimics the ethylene-related physiological changes and induces gene expression in different plants, including Arabidopsis [14] and tobacco [18, 24]. To quantify whether the different treatment mentioned above could affect ovule development and therefore fertility, pollinated etephon-treated flowers were allowed to set seeds. Preliminary results show that seed set increases significantly in transgenic flowers upon treatment with an ethylene source. Cytological analysis revealed that ovules could reach maturity and recover their functionality after ethephon treatment and be fertilized (Fig. 5).

These results demonstrate that the action of ethylene is necessary to tobacco plants in order to produce mature and functional ovules [4].

A B

Figure 5. Ovule morphology and fertilisation in ethephon-treated transgenic flowers. A) A fully developed ovule with a normal embryo sac from a transenic flower after ethephon treatment (DIe image). B) A detail of a pollen tube targeting a micropyle (arrow) in ethephon -treated transgenic flowers indicates a recovered functionality of the ovules (Scanning Electron Microscope image). Size bar lO0f.llll. (es) embryo sac, (fu) funiculus, (1) integument, (mp) micropyle, (pt) pollen tube.

162

7. Discussion

We analysed the role ethylene in the reproductive processes of tobacco. Unlike in orchid, in tobacco we can exclude the presence of a pollination induced signal to initiate maturation of the ovule. At anthesis the ovules are at the end of the megagametogenesis. The embryo sac is present and cellularization and early differentiation of the egg cell and the synergids has occurred [23]. We isolated from a tobacco pistil cDNA library a clone corresponding to the mRNA encoding for the ethylene-forming enzyme, (ACC oxidase, accession number at EMBL data banle X98493) ACO. The pattern of expression of the ACO gene we isolated is specifically linked to the reproductive tissues of the pistil and suggests a specific role of this member of the ACO gene family in the reproductive physiology of the tobacco flower. Using two distinct gene-silencing approaches, we successfully down-regulated ACO gene expression within the ovary. The two sets of transformants showed a similar female sterility. Cytological analysis revealed that in the transgenic plants, ovules did not complete megasporogenesis and did not produce an embryo sac. This is the first evidence of a direct role of ethylene in ovule development. Moreover, the fact that the supply of an ethylene source was sufficient in itself to recover fully developed and functional ovules clearly demonstrated that ethylene alone induces ovule maturation at this stage [4]. Ethylene acts through receptor encoded by a gene family in Arabidopsis and tomato [3, 8, 13]. One of these gene family members, the gene encoding for the ethylene receptor ETR2, shows an expression pattern enhanced in the developing carpels especially in the funiculi and in the ovules since the early stages of megasporogenesis [9, 20]. These observations and our findings suggest that ethylene controls ovule development. Moreover, it has been shown that genes necessary for ovule and female gametophyte development, such as AINTEGUMENTA (ANT) [5, 12] encode for putative transcription factors that present homology with the ethylene-responsive element binding proteins (EREBPs) [18]. Thus, ethylene may act through a phosphorylation-dephosphorylation cascade (summarized in the scheme below) [3, 8, 10, 19], leading to activation of flower-specific, ethylene­inducible transcription factors to regulate the expression of genes necessary for ovule development. So far, we could not detect any expression of ANT within the tobacco ovary using an ANT-specific Arabidopsis probe. However, we can not exclude the presence of flower-specific EREBPs. The cloning of those factors and the characterisation oftheir expression in the tissues of the ovules will elucidate the mode of action of ethylene in regulating ovule development.

ACC ~ C2H4 ---. .•....•.•• I' ---. ---. ACCoxidase percePtion!. gene ovule

transduction response development

163

8. References

1. Bevan, MW, (1984) Binary Agrobacterium vectors for plant transformation, Nucleic Acids Res. 12,8711-8722.

2. Bouman, F. (1984) The Ovule, in B. M. Johri (ed.), Embryology of Angiosperms, Springer, pp. 123-157.

3. Chang, C., Kwok, S.F., Bleecker, AB. and Meyerowitz, E.M. (1993) Arabidopsis ethylene­response gene ETR1: similarity of product to two component regulators, Science 262,539-544.

4. De Martinis D. and Mariani C., Silencing of the ethylene-forming enzyme gene expression results in a reversible inhibition of ovule development in transgenic tobacco plants, (Submitted)

5. Elliott, R.C., Betzner, AS., Huttner, E., Oakes, M.P., Tucker, W.Q., Gerentes, D., Perez, P. and Smyth, D.R. (1996) AINTEGUMENTA, an APETALA2-like gene of Arabidopsis with pleiotropic roles in ovule development and floral organ growth, Plant Cell 8, 155-168.

6. Goldberg, R.B. (1988) Plants: novel developmental processes, Science 240, 1460-1467. 7. Hamilton, AJ., Lycett, G.W. and Grieson, D. (1990), Antisense gene that inhibits synthesis of the

hormone ethylene in transgenic plants, Nature 346, 284-287. 8. Hua, J., Chang, C., Sun, Q. and Meyerowitz, E.M. (1995), Ethylene insensitivity conferred by

Arabidopsis ERS gene, Science 269, 1712-1714. 9. Hua, J., Sakai, H., Nourizadeh, S., Chen, Q.J., Bleecker, AB., Ecker, J.R. and Meyerowitz, E.M.

(1998) EIN4 and ERS2 are members of the putative ethylene receptor gene family in Arabidopsis, Plant Cell 10, 1321-1332.

10. Kieber, J.J., Rothenberg, M., Roman, G., Feldmann, K.A. and Ecker, J.R. (1993) CTRI a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of protein kinases, Cell,72, 427-441.

II. Koltunow, AM., Truenettner, J., Cox, KH., Wallroth, M. and Goldberg, R.B. (1990) Different temporal and spatial expression pattern occur during anther development, Plant Cell 2, 1201-1224.

12. Klucher, KM., Chow, H., Reiser, L. and Fischer, R.L., (1996) The AINTEGUMENTA gene of Arabidopsis required for ovule and female gametophyte development is related to the floral homeotic gene APETALA2, Plant Cell 8, 137-153.

13. Lashbrook, C.C., Tieman, D.M. and Klee, H.I. (1998) Differential reguation of the tomato ETR gene family throughout plant development, Plant J. 15, 243-252.

14. Lawton, KA, Potter, S.L., Uknes, S. and Ryals, J. (1994) Acquired resistance signal transduction in Arabidopsis is ethylene independent, Plant Cell 6, 581-588.

15. Lee, H.S., Huang, S. and Kao, T. (1994) S proteins control rejection of incompatible pollen in Petunia inflata, Nature 367, 560-563.

16. Lincoln, J.E., Cordes, S., Read, E. and Fischer, R. (1987) Regulation of gene expression by ethylene during Lycopersicum esculentum (tomato) fruit development, Proc. Natl. Acad Sci. USA 84, 2793-2797

17. Oeller, P.W., Lu, M.W., Taylor, L.P., Pike, D.A. and Theologis, A (1991) Reversible inhibition of tomato fruit senescence by antisense RNA, Science 254, 437-439.

18. Ohme-Takagi, M. and Shinshi, H. (1995) Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element, Plant Cell 7, 173-182.

19. Raz, V. and Fluhr, R. (1993) Ethylene signal is transduced via protein phosphorilation events in plants, Plant CellS, 523-530.

20. Sakai, H., Hua, J., Chen, Q.J., Chang, C., Medrano, L.1., Bleecker, AB. and Meyerowitz, E.M. (1998) ETR2 is an ETRI-like gene involved in ethylene signalling in Arabidopsis, Proc. Nat/. Acad. Sci. USA 95, 5812-5817.

21. Tang, x., Gomes, AM.T.R., Bhatia, A and Woodson, W.R. (1994) Pistil-specific and ethylene­regulated expression of 1-aminociclopropane-l-carboxylate oxidase genes in Petunia flowers, Plant Cell 6, 1227-1239.

22. Tavazza, R., Ordas, R.I., Tavazza, M., Ancora, G. and Benvenuto, E. (1988) Genetic transformation of Nicotiana clevelandii using a Ti plasmid derived vector, J. Plant Physiol. 133, 640-644.

23. Tian, H.Q. and Russel, S.D. (1997) Calcium distribution in fertilized and unfertilized ovules and embryo sacs of Nicotiana tabacum L., Planta 202,93-105.

164

24. Wang, H., Wu, H.M. and Cheung, A.Y. (1996) Pollination induces mRNA poly(A) tail-shortening and cell deterioration in flower transmitting tissue, Plant J. 9, 715-727.

25. Yang, S.F. Ethylene evolution from 2-chloroethylphosphonic acid, Plant Physiol. 44, 1203-1204 26. Zhang, X.S. and 0' Neill, S.D. (1993) Ovary and gametophyte development are coordinately

regulated by auxin and ethylene following pollination, Plant CeliS, 403-418.

ACC OXIDASE EXPRESSION AND LEAF ONTOGENY IN WHITE CLOVER

1. Abstract

M.T. McMANUS, D.A. HUNTER, S.D.YOO AND D. GONG Institute of Molecular BioSciences, Massey University, Private Bag 11222, Palmerston North, New Zealand

During leaf ontogeny in white clover (Trifolium repens L.), significant production of ethylene occurs at the apex and from newly initiated leaves, and then again from senescent leaf tissue. A combination of RT-PCR and 3'- RACE, and Southern analysis has been used to identifY three distinct ACC oxidase genes (designated TRA CO 1, TRAC02 and TRAC03) from leaf tissue of white clover. TRACOI is expressed specifically in the apex, TRAC02 is expressed in the apex, and in developing and mature green leaves, with maximum expression in developing leaf tissue, and TRAC03 is expressed in senescent leaf tissue. Using protein purification techniques, three isoforms of ACC oxidase have been identified, one in mature green tissue (designated MG1) and two in senescent tissue (designated SeI, Sell). Some biochemical properties of each isoform are described.

2. Introduction

The ethylene biosynthetic pathway has now been characterised with two committed enzymes in the pathway identified, l-aminocyclopropane-l-carboxylate (ACC) synthase [EC 4.4.1.14] and ACC oxidase [EC 1.4.3] [8,21]. ACC synthase is proposed to be the rate-determining step in the pathway, with many inducers of ethylene biosynthesis acting through stimulation of this enzyme [8,19,21]. The enzyme is known to be coded for by a multi-gene family in several plant species, with many of these genes cloned from a wide variety of tissues, and in response to a variety of stimuli [5].

By contrast, the ability of most plant tissues to convert ACC to ethylene was interpreted originally as evidence that regulation of ACC oxidase was not a major control point of ethylene biosynthesis [21]. However, following the successful demonstration of enzyme activity, in vitro, [20], ACC oxidase has now been purified to homogeneity and characterised from apple fruits [5], and partially purified and characterised from a range of tissues including apple, avocado and pear [5] and mandarin fruit [4].

In concert with these biochemical studies, genes coding for the enzyme have now been cloned from a wide variety of tissues in many plants [5], with the emerging view

165

166

that the expression of the ACC oxidase gene family, in common with ACC synthase, is highly-regulated in plants. As such, it constitutes an extra tier of control of ethylene biosynthesis. Differential expression of ACC oxidase genes has now been observed in orchid flowers, mungbean epicotyls, Petunia floral tissues [5], broccoli floral tissue [16], in tomato [1], melon leaf tissues [11,12], carnation floral tissues [18], sunflower seedling tissue [14], geranium floral tissue [3], and in leaf tissue of Nicotiana glutinosa [10]. Much of this research on the differential expression of ACC oxidase has been conducted on fruit and floral tissue. Comparatively fewer studies have been undertaken on the regulation of ACC oxidase gene expression during leaf development [1, 2, 7, 11], although ethylene is an important regulator ofleaf ontogeny [15]. In this study, we have examined the expression of ACC oxidase both at the transcriptional and translational level during leaf ontogeny in white clover (Trifolium repens L.).

3. Leaf Development in White Clover

The rooting at a single node and the subsequent outgrowth of a stolon of white clover over a dry matrix (to inhibit root formation) produces a full programme of leaf development along the stolon from initiation at the apex through maturation, senescence and then necrosis. This growth system also produces plants in which the number of leaves attached to the stolon reaches a constant number as the production rate is balanced by the senescence rate. Leaf development is defined using total chlorophyll (a + b) as an indicator of maturity. In the example shown (Fig. 1), chlorophyll levels increased during leaf expansion (up to leaf 5), the levels reached a maximum from leaf 6 to 14 (the mature green stage), after which chlorophyll levels decline (onset and senescent stage). These discrete stages of leaf development can also be identified using a measure of quantum efficiency of PSII (FjFm). Here, changes in the ratio almost precisely mirrored chlorophyll content, thus acting as confirmation of the identification of three stages ofleaf development (developing; mature green; senescent).

4. Ethylene Production and ACC Oxidase Expression during Leaf Ontogeny

4.1. ETHYLENE PRODUCTION AND ACC OXIDASE ACTIVITY

Two stages of significant ethylene production, in vivo, are observed routinely during leaf ontogeny in white clover. In the example shown (Fig. 2A), the first was observed at the apex, which declined to reach a minimum value by leaf 3. Minimum evolution of ethylene was observed from leaves 4 to 10 (the mature green leaf stage), after which a second stage of significant ethylene evolution was observed. Here, the rate of ethylene production gradually increased through to leaf 16 (coinciding with the senescent stage) and only decreased again in necrotic tissue (data not shown).

>. u s:::::

.!!! u !E G>

ttl u E G> ,c u 0 ..... 0 ,c Il.

::-E

LL --> LL -

0.6

0.5

0.4

0.3

0.2

0.1

o o 2 4 6 8 1 0 12 14 16 18 20

Leaf number

167

2500

2000 >. ,c_

1500 e~ .20) ,c_

1000 UO) :::L

S -0

500 I-

o

Figure 1. Stages of leaf development along a single stolon of white clover defined by total chlorophyll levels ( • ), and quantum efficiency ofPSII (Fv/Fm) (. ).

ACO enzyme activity, in vitro, was detected in the apex, increased to reach a maximum in leaves 4 to 9, after which the activity steadily declined (Fig. 2). The pattern of ACO activity observed, therefore, is synchronous with chlorophyll levels measured during leaf ontogeny, but contrasts with the trend of ethylene evolution which is virtually undetectable in mature green tissue before increasing again at the onset of leaf chlorosis.

4.2. ACC OXIDASE GENE EXPRESSION

RT-PCR was used to amplity cDNA sequences from RNA isolated from the apex, mature green, onset of senescence and senescent leaf tissue using primers designed to conserved domains within ACC oxidase genes sequenced from several other plant species. Sequencing of clones from each tissue revealed three distinct sequences designated TRACOl, TRAC02 and TRA C03 , and homology comparison of the three ACC oxidase DNA sequences produced values ranging from 75 to 84% [6]. These sequences accounted for the major portion of the coding region and so to produce gene­specific probes, 3'-RACE was used to amplity the (normally more diverse) 3' untranslated region [5]. The homology comparison of the 3 '-untranslated regions is provided in Table 1, where homology values are now between 55 to 61%. These 3'­untranslated regions were used in northern analysis to determine the constitutive expression of each ACC oxidase gene (Fig. 2).

168

12 2.5

~ 10 2 c .>- 0 .. .e ;i.-u . ::I.e !lIO 1.5 03: (I) ... ~IL til Q. 6 !lICI (I) CI :9 E 1 5i::I >(-

- C 0...1 4 >--o c .e .... 0- 0.5 w <C 2

0 0 Kb

TR-AC01 • -1.35

TR-AC02 ~ - 1.35

TR-AC03 - 1.35 .t-.:

Apex 1 2 3 4 6 8 9 10 11 13 14 15 16

Leaf Number

Figure 2. A. Stages of leaf development along a single stolon of white clover defined by ethylene evolution (.) and ACO activity, in vitro (e). B. Northern analysis of ACO gene expression during leaf ontogeny in white clover [modified from 6].

Table 1. Nucleotide homology values (as percentages) between the 3' -untranslated regions of three ACC oxidase sequences generated by RT-PCR and 3' RACE [6].

TRACOl TRAC02 TRAC03

TRACOl

61 55

TRAC02

61

59

TRAC03

55 59

TRACOI is expressed almost exclusively in the apex, with a much lower intensity of hybridization discernible in leaf 1, and no detectable hybridization in leaf 2 or any other leaf along the stolon. TRAC02 is detectable in the apex, shows maximal expression in leaves 1 to 2, before gradually decreasing in intensity such that no clearly discernible

169

expression can be observed by leaf 13. The expression of TRAC03 is clearly detectable fIrst in leaf 9 then increases to reach maximum in leaves 13 to 16.

5. Characterisation of ACC Oxidase Isoforms

The expression of TRACOI followed most closely the activity, in vitro, of ACC oxidase (Fig. 2). Therefore, in terms of ACC oxidase activity, there is no corresponding increase in activity in chlorotic tissue to match the induction of TRAC03 determined by northern analysis. To examine the concept of ACC oxidase isoforms more closely, particularly in senescent tissue, purification of stage-specific isoforms has been initiated. Using hydrophobic chromatography, followed by gel fIltration and ion-exchange column chromatography, three distinct ACC isoforms have been identifIed in mature green and senescent leaf tissue (Table 2). In addition to differences in the elution profIle after column chromatography, the two senescent isoforms (designated SeI and Sell) had a different molecular weight (determined by SDS-PAGE) when compared to the mature green (MGI) isoform. No detailed isoform analysis has been undertaken in apical tissue.

6. Discussion

In this study, we have shown that three distinct ACC oxidase genes are expressed differentially during leaf ontogeny in white clover. The maximal expression of two of these genes coincides with the two peaks of ethylene evolution observed. The expression of TRACOI is predominantly in the apex, while the expression of TRAC03 almost precisely matches the increase of ethylene evolution during leaf senescence.

Ethylene evolution from the apex has been reported in several plant species [15], with some consensus that in dicotyledonous plants the role of the hormone is to limit cell expansion in younger leaves [9, 13, 15]. However, expression of an apex-specifIc ACC oxidase has not been reported previously. As yet we cannot say which ofthese tissues that comprise the apex specifically express TRACOI, but tissue localisation of this expression should provide significant clues as to the role of ethylene in developing leaves.

Ethylene evolution from senescent leaves is now well documented, and senescent leaves of many species can convert ACC to ethylene [15, 17]. In common with this study, a similar pattern in which two genes of ACC oxidase are differentially expressed in mature green and senescent leaf tissue has also been reported for tomato [1], melon [12] and tobacco [10]. In white clover, the examination of ACO gene expression has been extended with the measurement of corresponding ACC oxidase activity. Detectable ACC oxidase activity coincides more closely with TRAC02 gene expression. Some ACO activity is observed in the apex, but in leaves from nodes 13 to 16, where the expression of TRAC03 is induced, there is no concomitant increase in detectable enzyme activity, in vitro. Leaf tissues from many species have been shown to convert ACC to ethylene which is evidence that an ACC-dependent ethylene forming system is

170

functional, in vivo [15]. However, we are not aware of any studies In which ACO activity, in vitro, has been demonstrated in senescent leaf extracts.

Table 2. Summary of purification properties of three ACC oxidases identified in mature green and senescent leaf tissue of white clover.

Tissue Hydrophobic Ion-Exchange Molecular Mass (kDa) (Isoform) Elution Elution

[%(NH4)S04] [NaCI (mM)] Gel Filtration SDS-PAGE

Mature Green 0.0 260 - 370 37 37 MGJ) Senescent (SeI) 0.6 105 37 34 (Sell) 0.0 370 - 480 37 34

To examine further whether any ACC oxidase isoforms coincide with TRAC03 transcript accumulation in senescent leaf tissue, preliminary purification of the enzyme has been undertaken. Using these procedures, one isoform has been identified in mature green leaf tissue (MGI), and two in senescent leaf extracts (SeT and Sell). We can speculate that MGI is encoded for by TRAC02, and TRAC03 encodes one of the senescent isoforms. Indeed, Southern analysis using the reading frame from TRAC03 indicated that there may be two closely related genes (Hunter, D.A., unpublished data) which might correspond to Sel and Sell. Southern analysis using the 3' -untranslated region ofTRAC03 as probe indicates a single gene suggesting that if two closely related genes are present in white clover, they have diverse 3' -untranslated regions [6].

The results presented here show that the two peaks of ethylene production during leaf ontogeny coincide with the expression of distinct ACC oxidase genes. Given that the ethylene produced at each leaf developmental stage in white clover induces quite separate responses (modulation of leaf growth in the apex; regulation of senescence in mature tissues), it is interesting to speculate that the regulation of biosynthesis of the hormone may be intimately linked to its competence to respond to it. An examination of the molecular basis for the control of transcription for each member will be an important part in establishing such a link.

7_ Acknowledgements

This work is funded by the New Zealand Foundation for Research, Science and Technology (Contract Number: C 10 635), and the New Zealand Agricultural and Pastoral Research Institute (AgResearch) by provision of a PhD study award to D.H. We thank Prof. S.F. Yang and Dr. A. D. Campbell, Dept. ofVeg. Crops, Univ. of California, Davis, for the provision of ACC oxidase primers and help with the use of RT-PCR to generate the reading frame sequences for TRAC02 and TRAC03, and Dr. Dennis

171

Greer, HortResearch, Palmerston North for assistance with the measurement of quantum efficiency of PSI I.

8. References

1. Barry, C.S., Blume, B., Bouzayen, M., Cooper, w., Hamilton, A1. and Grierson, D. (1996) Differential expression of the I-aminocyclopropane-l-carboxylate oxidase gene family of tomato, Plant J. 9, 525-535.

2. Bouquin, T., Lasserre, E., Pradier, l, Pech, J-C. and Balague, C. (1997) Wound and ethylene induction of the ACC oxidase melon gene CM-ACOI occurs via two direct and independent transduction pathways, Plant Mol. Bioi. 35, 1029-1035

3. Clark, D.G., Richards, C., Hilioti, Z., Lind-Iversen, S. and Brown, K. (1997) Effect of pollination on accumulation of ACC synthase and ACC oxidase transcripts, ethylene production and flower petal abscission in geranium (Pelargonium x hortorum L.H. Bailey), Plant Mol. Bioi. 34, 855-865.

4. Dupille, E. and Zacarias, L. (1996) Extraction and biochemical characterization of wound-induced ACC oxidase from Citrus peel, Plant Sci. 114, 53-60.

5. Fluhr, R. and Mattoo, A.K. (1996) Ethylene - Biosynthesis and perception, Crit. Rev. Plant Sci. 15, 479-523.

6. Hunter, D.A., Yoo, S.D., Butcher, S.M. and McManus, M.T. (1998) Expression of 1-aminocyclopropane-l-carboxylic acid (ACC) oxidase during leaf ontogeny in white clover, Plant Physiol. (submitted)

7. John, I., Drake, R., Farrell, A, Cooper, W., Lee, P., Horton, P. and Grierson, D. (1995) Delayed leaf senescence in ethylene-deficient ACC-oxidase antisense tomato plants: molecular and physiological analysis, Plant J. 7, 483-490.

8. Kende, H. (1993) Ethylene biosynthesis, Annu. Rev. Plant Physiol. Plant Mol. Bioi. 44,283-307 9. Kieber, J.J., Rothenberg, M., Roman, G., Feldmann, K.A. and Ecker, lR. (1993) CTRI, a negative

regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of protein kinases, Cell 72, 427-441.

10. Kim, S.K., Choi, D" Lee, M.M., Lee, S.H. and Kim, W.T. (1998) Biotic and abiotic stress­relatedexpression of l-aminocyclopropane-l-carboxylate oxidase gene family in Nicotiana glutinosa L., Plant Cell Physiol. 39, 565-573.

11. Lasserre, E., Bouquin, T., Hernandez, J.A., Bull, J., Pech, J-C. and Balague, C. (1996) Structure and expression of three genes encoding ACC oxidase homologs from melon (Cucumis melo L.), Mol. Gen. Genet. 251,81-90.

12. Lasserre, E., Godard, F., Bouquin, T., Hernandez, J.A, Pech, J-C., Roby, D. and Balague, C. (1997) Differential activation of two ACC oxidase gene promoters from melon during plant development and in response to pathogen attack, Mol. Gen.Genet. 256,211-222.

13. Lee, S.H. and Reid, D.M. (1996) The role of endogenous ethylene in the expansion of Helianthus annuus leaves, Can. J. Bot. 75, 501-508.

14. Liu, J-H., Lee-Tamon, S.H. and Reid, D.M. (1997) Differential and wound-inducible expression of 1-aminocyclopropane-l-carboxylate oxidase genes in sunflower seedlings, Plant Mol. Bioi. 34, 923-933.

15. Osborne, D.1. (1991) Ethylene in leaf ontogeny and abscission, in AK. Mattoo and J.C. Suttle (eds.), The Plant Hormone Ethylene, CRC Press, Boca Raton, pp. 193-214.

16. Pogson, 8.1., Downs, C.G. and Davies, K.M. (1995) Differential expression of two 1-aminocyclopropane-l-carboxylic acid oxidase genes in broccoli after harvest, Plant Physiol. 108, 651-657.

17. Roberts, lA, Tucker, G.A. and Maunders, M.l (1985) Ethylene and foliar senescence, in J.A. Roberts and G.A.Tucker (eds.), Ethylene and Plant Development, Butterworths, London, pp. 267-275.

18. ten Have, A and Woltering, E.J. (1997) Ethylene biosynthetic genes are differentially expressed during carnation (Dianthus carophyllus L.) flower senescence, Plant Mol. Bioi. 34, 89-97.

19. Theologis, A (1992) One rotten apple spoils the whole bushel: The role of ethylene in fruit ripening, Cell 70, 181-184.

172

20. Ververidis, P. and John, P., (1991) Complete recovery in vitro of ethylene-forming enzyme activity, Phytochemistry 30, 725-727.

21. Yang, S.F. and Hoffman, N.E. (1984) Ethylene biosynthesis and its regulation in higher plants, Annu. Rev. Plant Physiol. 35, 155-158.

INTERACTION OF ETHYLENE WITH JASMONATES IN THE REGULATION OF SOME PHYSIOLOGICAL PROCESSES IN PLANTS

1. Abstract

M. SANIEWSKI 1, J. UEDA2 AND K. MIYAMOT02

J Research Institute of Pomology and Floriculture, Pomologiczna 18, 96-100 Skierniewice, Poland; 2College of Integrated Arts and Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Sakai, Osaka 599-8531, Japan

Jasmonates are considered to be candidates for a new type of plant hormone. It is well known that jasmonates stimulate ethylene production in different experimental systems. Here we review several interesting topics such as the relationships between ethylene and jasmonates in fruit growth and ripening, in gum induction and in response to physical injury, pathogen infection and herbivore and insect attack. The role of ethylene in the senescence and abscission of leaves promoted by jasmonates is presented and the interaction of ethylene with jasmonates in the conductivity of cells and in tiller production is also described. Moreover, the important role of jasmonates as signal molecules in response to stress is reported.

2. Introduction

Ethylene is the most simple olefin and is widely distributed in the plant kingdom as an important gaseous plant hormone, influencing a diverse range of plant growth and developmental processes. Jasmonates, mainly jasmonic acid (JA) and methyl jasmonate (JA-Me), are considered to be candidates for a new type of plant hormone showing various physiological effects on plant growth and development [1-7]. Recently, there has been a focus of attention on the interaction between ethylene and jasmonates because of stimulating effect that jasmonates have on ethylene production. In the previous Ethylene Symposium, Saniewski [8] reported that jasmonates affect the biosynthesis of ethylene through stimulation of ACC synthase and ACC oxidase activities, resulting in a large increase in ethylene production. In this review we look at the interaction of ethylene with jasmonates in regulation of some physiological processes, and describe their function as signal molecules.

173

174

3. Relationship between Methyl jasmonate and Ethylene in Fruit Ripening

Apples, similarly to tomatoes, are climacteric fruit. It is well known that young apple fruit produce large amounts of ethylene [9] and that immature cv. Golden Delicious apple fruit contain high levels of JA and JA-Me [10]. Methyl jasmonate stimulates ethylene production, ACC content and ACC oxidase activity in pre climacteric apples and inhibits these processes in climacteric and postclimacteric apples [8, 11].

Recently, Fan et al. [12] studied changes in endogenous jasmonates during early development of apple fruit in relation to ethylene production and other physiological events. The concentration of endogenous JA was 138 ng gO! fresh weight 24 days after full bloom and decreased as the fruit developed until 136 days after bloom (2.6 ng gO! in apple harvested 101 days after full bloom). The changes in JA were coincident with changes in ethylene production, respiration and anthocyanin accumulation during early developmental stages of apple fruit. They were also consistent with the reported responses to exogenous jasmonates, suggesting jasmonic acid may be involved in regulation of early fruit development [12].

To determine whether or not jasmonates playa role in the regulation of climacteric fruit ripening, the endogenous concentrations of jasmonates were measured during the onset of ripening of apple cv. Golden Delicious and tomato fruits cv. Cobra [13]. JA and JA-Me concentrations increased transiently prior to the rapid increase in ethylene biosynthesis in both apple and tomato fruits and decreased at later stages of fruit ripening. In apple discs, JA-Me modulated ethylene synthesis depending on developmental stage and concentration of applied JA-Me. Transient (12 hr) treatment of preclimacteric apple discs with exogenous JA-Me at low concentrations (1-100 IlM) promoted ethylene biosynthesis. Activities of both ACC synthase and ACC oxidase were stimulated by JA-Me at this concentration range. These results suggest jasmonates may playa role together with ethylene in regulating the early steps of climacteric fruit ripening [13].

Response of color changes to JA-Me vapor treatment depended on the apple fruit developmental stage, with the maximum effect occurring as fruit began to produce ethylene [14]. It is possible that a combination of jasmonate and ethylene could be used to promote commercially desirable color changes in apples [14].

JA-Me treatment caused a higher respiratory activity and ethylene production in white strawberries, grown in vitro, while a decrease in CO2 and ethylene evolution was observed in red ripe and dark-red overripe fruits [15].

4. The interaction of ethylene with jasmonates in response to wounding

The involvement of ethylene in wounding, including physical injury, herbivore or insect attack and pathogen infection has been intensively reported [16-19]. There are several reports which describe that ethylene production, ACC content, and activities of ACC synthase and ACC oxidase are promoted by wounding [20-22]. Jasmonates are also associated with the wound response and have been shown to strongly induce the expression of wound- or defense-related genes in plants suffering from physical injury or

175

pathogen infection, resulting in the accumulation of proteinase inhibitors (PI) and other pathogen-related proteins [17, 18,23, 24]. The interaction of ethylene with jasmonates during the wound response has also been reported. Ethylene and jasmonates act together to regulate PI gene expression during the wound response [17]. This effect could be inhibited by inhibitors of JA and ethylene biosynthesis [17]. Combinations of ethylene and jasmonates causes the synergistic induction of pathogenesis-related gene expression including osmotin mRNA [25]. On the other hand, the functional mechanisms of ethylene and jasmonates in wound response are not clear. Xu et al. [25] suggested that the binding of ethylene to its receptor on the membrane might sensitize jasmonate receptors on the membrane. It has also been suggested that ethylene partially regulates the endogenous level of jasmonates based on a study using inhibitors of biosynthesis of ethylene and JA [17]. It remains to be demonstrated whether ethylene acts upstream, downstream or in concert with JA [26].

5. The Interaction of Ethylene with Jasmonates in Gum Induction

Gum is a secretion mainly consisting of polysaccharides exuded onto the surface of fruit or tree trunks when plants suffer from several kinds of stresses including physical injury, insect atack and pathogen infection. Exudate gums are complex, branched hetero­polysaccharides comprising residues of galactose, arabinose and glucuronic acid with other sugars also present in small or trace quantities [27]. Tulip gum consists of glucuronoarabinoxylan (GlcN:Ara:Xyl = 1:2:3) in the presence of calcium and potassium [28]. Gum formation in tulip bulbs or stone fruit trees is induced by ethylene and the ethylene-releasing compound, ethephon [27,29]. It has been found that JA-Me causes a strong induction of gum formation in the bulb, stem and the basal part of the leaves of tulips [30]. Saniewski and W~grzynowicz-Lesiak [31] showed that JA-Me stimulated ethylene evolution and ACC oxidase activity during gum induction in tulip stems. The application of ACC caused an evolution of ethylene much higher than that of JA-Me, but did not induce gum formation. Neither did the endogenous ethylene induced by auxins, IAA and NAA, induce gummosis in the tulip stems [32]. It has recently been shown that the application of ACC together with JA-Me greatly accelerates gum formation in tulip stems in comparison with JA-Me treatment alone [33]. These results suggest that while JA-Me it stimulates the production of ethylene in tulip it induces gum formation in tulip stems independently of ethylene. The relationship between ethylene and jasmonates in gum formation has been clearly shown in relation to several varieties of stone fruit [34]. The role of ethylene in the process is that it may promote jasmonate biosynthesis and/or stimulate the susceptibility of plant tissues to endogenous jasmonates.

6. The Interaction of Ethylene with Jasmonates in Abscission

Abscission is usually evoked at the end of senescence of leaves, flowers and fruit with the formation of an abscission zone at the base of the organ involved. The abscission

176

zone consists of a few layers of cells whose cell walls undergo intensive digestion processes leading to loss of adhesion between cells [35]. In some plant tissues, ethylene promotes senescence when it was exogenously applied, resulting in abscission. JA-Me promotes senescence and abscission as well. Veda et al. [36, 37] showed that JA-Me promotes the formation of an abscission zone in bean petiole explants without an increase in ethylene production. Jasmonates had no effect on the content of non­cellulosic polysaccharides in the pulvinus and the petiole sides of the abscission zone, but reduced the total amount of cellulosic polysaccharides. The total activity of cellulase were dramatically stimulated by JA-Me [36]. JA-Me greatly promoted leaf abscission of Kalanchoe blossfeldiana at different growth stages commensurate with an increase in CO2 evolution and only a slight stimulation of ethylene production. This suggests that that JA-Me-induced leaf abscission in this plant is not related to ethylene [38]. In intact or cut shoots of peach, ethylene accelerated the onset of leaf abscission compared with JA-Me. However, stimulation of leaf abscission in peach shoots was observed by the application of ethylene together with JA-Me [M. Saniewski, J. Veda, K. Miyamoto, unpublished results].

7. The Interaction of Ethylene with Jasmonates in Senescence

Senescence is one of the physiological processes programmed into cell death, and is associated with an increase of ethylene production in some cases. Since JA-Me was first isolated as a senescence-promoting substance in 1980 [39], jasmonates biosynthesized via lipid peroxidation of membrane by lipoxygenase and other enzymes have been considered to play an important role in senescence [40]. Several papers report that JA­Me stimulates ACC synthase and ACC oxidase activities andlor ethylene production in olive leaf discs [41] and in detached rice leaves [42], respectively. In contrast, JA-Me did not affect the ethylene production, ACC oxidase activity and ACC content in intact tulip leaves [43,44]. Similar observations were found in detached rice leaves [45], and flag leaves and ears of wheat plants [46]. Judging from these observations, jasmonates affect the biosynthetic pathway of ethylene resulting in the stimulation of ethylene production andlor an increase in the sensitivity of plant tissues to ethylene [45, 47]. Although jasmonates elicite similar physiological effects to ethylene, the mechanisms by whichjasmonates induce senescence might be different from those of ethylene [46].

8. Relationship between Jasmonates and Ethylene in Germination of Seeds

Jasmonates inhibit germination of non-dormant seeds (lettuce, sunflower, rape, amaranth, flax, oat, wheat, cocklebur, stratified seeds of apple), but stimulate germination of dormant seeds (Acer tataricum, A. platanoides, Malus domestica [48, 49]. The physiological role of jasmonates in seed germination remains unclear. K~pczyftski and Bialecka [48] found that the inhibitory effect of JA-Me on Amaranthus caudatus seed germination was partially or completely reversed (depending on the concentration of JA-Me applied) by ethephon, ACC and gibberellins - GA3 and GA4+7•

177

Nojavan-Asghari and Ishizawa [49] showed that the inhibition of germination of cocklebur (Xanthium pennsylvanicum) seeds by JA-Me was nullified by exogenous ethylene. JA-Me inhibited ethylene production before seed germination through both the inhibition of ACC biosynthesis and the conversion of ACC to ethylene. The authors suggested that the inhibition of ethylene production by JA-Me results in the retardation of the germination of cocklebur seeds.

JASMONATES interact .J.. .J..

increase stimulate ethylene biosynthesis

1-+ the sensitivity (increase ACC synthase and ACC to ethylene oxidase activities)

.J.. .J.. .J.. p H Y S I 0 L 0 G I C A L PHENOME N A

and/or

ETHYLENE interact .J.. .J..

increase the sensitivity to stimulate jasmonates 1----+ jasmonates biosynthesis .J.. .J.. .J.. .J..

P H Y S I 0 L 0 G I CAL P HENOM E N A

Figure 1. Possible mode of the interaction of ethylene withjasmonates in control of physiological processes

9. The Interaction of Ethylene with Jasmonates in Other Physiological Processes

In addition to the interactions between ethylene and jasmonates described above, other relationships between ethylene and jasmonates have been also reported. JA-Me had little or no effect on leakage from cells of sunflower seedlings. However, ethylene synergistically promoted an effect in combination with JA-Me [50]. Dathe et al. [51] showed an interesting interaction between ethylene and jasmonates in tiller production of spring barley. The application of JA followed by a treatment with ethephon led to a significant increase in tiller production. Neither jasmonates nor ethephon alone were able to cause these effects. The authors suggested that jasmonates appears to increase the sensitivity of plant tissues to ethylene by influencing the level of other plant hormones.

10. Possible Mode of Action of the Interaction between Ethylene with Jasmonates in Physiological Processes

It appears that jasmonates represent an integral part of the signal transduction chain between stress signal(s) and stress response(s) and that ethylene interacts with

178

jasmonates in many physiological processes. Physiological processes affected by the compounds may be regulated by a signal network in which individual signals mediated by ethylene and jasmonates 'cross-talk' [13, 25, 52]. The most difficult problem to solve is to understand the mechanisms by which ethylene interacts with jasmonates. Considering the findings described in this review, we propose one possible schema (Fig. I). Jasmonates may increase the endogenous levels of ethylene and/or might sensitize ethylene receptors on the membrane. On the contrary, ethylene might also affect the endogenous levels of jasmonates and/or the binding of ethylene to its receptor on the membrane might sensitize jasmonates receptors on the membrane.

11. Acknowledgements

This work was partially supported by a Grant No PB 1811P06/95/08 from State Committee for Scientific Research (Poland) to MS.

12. References

1. Creelman, RA and Mullet, J.E. (1997) Biosynthesis and action of jasmonates in plants, Annu Rev. Plant Physiol. Plant Mol. Bioi. 48,355-381.

2. Creelman, RA and Mullet, J.E. (1997) Oligosaccharides, brassinolides, and jasmonates: Nontraditiona regulators of plant growth, development, and gene expression, Plant Cell 9, 211-1223.

3. Hamberg, M. and Gardner, H.G. (1992) Oxylipin pathway to jasmonates: biochemistry and biological significance, Biochim. Biophys. Acta 1165, 1-18.

4. Koda, Y. (1992) The role of jasmonic acid and related compounds in the regulation of plant development, Inter. Rev. Cytol. 135, 155-198.

5. Miyamoto, K., Oka, M., and Ueda, J. (1997) Update on the possible mode of action of the jasmonates: Focus on the metabolism of cell wall polysaccharides in relation to growth and development, Physiol. Plant. 100,631-638.

6. Sembdner, G. and Parthier, B. (1993) The biochemistry and the physiological and molecular actions ofjasmonates, Annu. Rev. Plant Physiol. Plant Mol. BioI. 44, 569-589.

7. Stawick, P.E. (1992) Jasmonates, gene, and fragrant signals, Plant Physiol. 99, 804-807. 8. Saniewski, M. (1997) The role ofjasmonates in ethylene biosynthesis, in AK. Kanellis, C.Chang,

H. Kende and D. Grierson (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 39-45.

9. Walsh, C.S. and Solomos, T. (1987) Ethylene evolution by apple fruits during their early-season growth and development, Sci. Hortic. 32, 203-211.

10. Meyer, A, Miersch, 0., B6tttner, C., Dathe, W. and Sembdner, G. (1984) Occurrence of the plant growth regulator jasmonic acid in plants, J. Plant Growth Regul. 3, 1-8.

11. Fan, X., Mattheis, J.P., Fellman, J.K. and Patterson, M.E. (1997) Effect of methyl jasmonate on ethylene and volatile production by Summerred apples depends on fruit developmental stage, J. Agric. Food Chem. 45,208-211.

12. Fan, x., Mattheis, J.P., Fellman, J.K. and Patterson, M.E. (1997) Changt's in jasmonic acid concentration during early development of apple fruit, Physiol. Plant. 101,328-332.

13. Fan, x., Mattheis, J.P. and Fellman, J.K. (1998) A role ofjasmonates in climacteric fruit ripening, Planta 204,444-449.

14. Fan, x., Mattheis, J.P. and Fellman, J.K. (1998) Responses of apples to postharvest jasmonate treatments, J. Amer. Soc. Hort. Sci. 123,421-425.

IS. Perez, AG., SanZo C., Olias, R and Olias, J.M. (1997) Effect of methyl jasmonate on in vitro strawberry ripening, J. Agric. Food Chern. 45,3733-3737.

179

16. Kacperska, A (1997) Ethylene synthesis and a role in plant responses to different stressors, in AK. Kanellis, C. Chang, H. Kende and D. Grieson (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 39-45.

17. O'Donnell, PJ., Calvert, C., Atzom, R, Wastemack, C., Leyser, H.M.O. and Bowles, DJ. (1996) Ethylene as a signal mediating the wound response to tomato plants, Science 274, 1914-1917.

18. Seo, S., Sano, H., and Ohashi, Y. (1997) Jasmonic acid in wound signal transduction pathways, Physiol. Plant. 101,740-745.

19. Yang, S.F. and Hoffman, N.E. (1984) Ethylene biosynthesis and its regulation in higher plants, Annu. Rev. Plant Physiol. 35, 155-189.

20. Dunlap, J.R. and Robacker, K.M. (1994) Wound induced ethylene production from excised muskmelon fruit tissue, J. Hort. Sci. 69, 189-195.

21. Hyodo, H., Hashimoto, C., Morozumi, S., Hu, W. and Tanaka, K. (1993) Characterization and induction of the activity of l-aminocycIopropane-l-carboxylate oxidase in the wounded mesocarp tissues ofCucurbita maxima, Plant Cell Physiol. 34, 667-671.

22. We<rzynowicz-Lesiak, E. and Saniewski, M. (1991) The effect of mechanical wounding of different organs of Hippeastrum x hybr. hort. on ethylene-forming enzyme activity, Bull. Pol. Acad. Sci., Bioi Sci. 39,373-377.

23. Koiwa, H., Bressan, R.A and Hasegawa, P.M. (1997) Regulation of protease inhibitors and plant defense, Trends Plant Sci. 2,379-384.

24. Wastemack, C. and Parthier, B. (1997) Jasmonate-signalled plant gene expression, Trends Plant Sci. 2,302-307.

25. Xu, Y., Chang, P.F.-L., Liu, D., Narasimhan, M.L., Raghothama, K.G., Hasegawa, P.M. and Bressan, R.A (1994) Plant defense genes are synergistically induced by ethylene and methyl jasmonate, Plant Cell 6, 1077-1095.

26. Penninckx, l.AM.A., Eggermont, K., Terras, F.RG., Thomma, B.P.H.J., De Samblanx, G.W., Buchala, A, Metraux, J.-P., Manners, J.M. and Broekaert, W.F. (1996) Pathogen-induced systemic activation of a plant defensin gene in Arabidopsis follows a salicylic acid-independent pathway, Plant Cell 8, 2309-2323.

27. Boothby, D. (1983) Gummosis ofstone-fruit trees and their fruits, J. Sci. Food Agric. 34, 1-7. 28. Saniewski, M., Veda, J., Miyamoto, K. and Horbowicz, M. (1999) Gum induction by methyl

jasmonate in tulip stem: Relevance to its chemical composition, Acta Hortic. (in press). 29. Kamerbeek, G.A. and De Munk, WJ. (1976) A review of ethylene effects in bulbous plants,

Scientia Hortic. 4, 101-115. 30. Saniewski, M. and Puchalski, J. (1988) The induction of gum formation in the leaf, stem and bulb

by methyljasmonate in tulips, Bull. Pol. Acad. Sci., Bioi. Sci. 36,35-38. 31. Saniewski, M. and We<grzynowicz-Lesiak E. (1994) Is ethylene responsible for gum formation

induced by methyl jasmonate in tulip stem?, J. Fruit Ornamental Plant Research 2, 79-90. 32. Saniewski, M., Kawa, L., and We<grzynowicz, E. (1990) Influence of different concentrations of

auxins and silver thiosulphate on stem growth and ethylene production in tulips, Bull. Pol. Acad. Sci., Bioi. Sci. 38, 51-56.

33. Saniewski, M., Miyamoto, K. and Veda, J. (1998) Gum formation by methyl jasmonate in tulips shoots is stimulated by ethylene, J. Plant Growth Regul. (in press).

34. Saniewski, M., Miyamoto, K. and Veda, J. (1998) Methyl jasmonate induces gum and stimulates anthocyanin accumulation in peach shoots, J. Plant Growth Regul. (in press).

35. Sexton, R and Roberts, J.A (1982) Cell biology of abscission, Annu. Rev. Plant Physiol. 33, 133-162.

36. Veda, J., Miyamoto, K. and Hashimoto, M. (1996) Jasmonates promote abscission in bean petiole explants: Its relationship to the metabolism of cell wall polysaccharides and cellulase activity, J. Plant Growth Regul. IS, 189-195.

37. Veda, J., Miyamoto, K., Momotani, Y., Kato, J. and Kamisaka, S. (1992) Promotive effect of jasmonic acid on the abscission of bean petiole explants in relation to the metabolism of cell wall polysaccharides, in Y. Masuda (ed.), Plant Cell Walls as Biopolymers with Physiological Functions, Yamada Science Foundation, Osaka, pp. 307-312.

38. Saniewski, M. and We<grzynowicz-Lesiak, E. (1995) Methyl jasmonate-induced leaf abscission in Kalanchoe blossfeldiana, Acta Hortic. 394,315-324.

180

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

50.

51.

52.

Veda, J. and Kato, l (1980) Isolation and identification of a senescence-promoting substance from wormwood (Artemisia absinthium L.), Plant Physiol. 66,246-249. Baker, lE., Wang, C.Y. and Terlizzi, D.E. (1985) Delay senescence in carnations by pyrazon, phenidone analogues, and tiron, HortScience 20, 121-122. Sanz, L.C., Fernandez-Maculet, lC., Gomez, E., Vioque, B. and Olias, J.M. (1993) Effect of methyl jasmonate on ethylene biosynthesis and stomatal closure in olive leaves, Phytochemistry 33, 285-289. Chou, C.M. and Kao, C.R. (1992) Stimulation of I-aminocyclopropane-I-carboxylic acid dependent ethylene production in detached rice leaves by methyl jasmonate, Plant Sci. 83, 137-141. Puchalski, l, Klim, P., Saniewski, M. and Nowacki, l (1989) Studies of some physiological processes during tulip leaf senescence induced by methyljasmonate, Acta Hortic. 251, 107-114. Puchalski, l, Saniewski, M. and Klim, P. (1985) The effect of methyl jasmonate on tulip leaf senescence and peroxidase patterns, Acta Hortic. 167,247-257. Tsai, F.-Y., Hung, K.T. and Kao, C.R. (1996) An increase in ethylene sensistivity is associated withjasmonate-promoted senescence of detached rice leaves, J. Plant Growth Regul. 15,197-200. Beltrano, J., Ronco, M.G., Montaldi, E.R. and Carbone, A. (1998) Senescence of flag leaves and ears of wheat hastened by methyljasmonate, J. Plant Growth Regul. 17,53-57. Hung, K.T. and Kao, C.H. (1996) Promotive effect of jasmonates on the senescence of detached maize leaves, Plant Growth Regul. 19,77-83. K,<pczyllski, J. and Bialecka, B. (1994) Stimulatory effect of ethephon, ACC, gibberellin A3 and ~+7 on germination ofmethyljasmonate inhibited Amaranthus caudatus L. seeds, Plant Growth Regul. 14,211- 216. Nojavan-Asghari, M. and Ishizawa, K. (1998) Inhibitory effect of methyl jasmonate on the germination and ethylene production in cocklebur seeds, J. Plant Growth Regul. 17, 13-18. Emery, R.lN. and Reid, D.M. (1996) Methyl jasmonate effects on ethylene synthesis and organ­specific senescence in Helianthus annuus seedlings, Plant Growth Regul. 18, 213-222. Dathe, W. (1992) Effects of jasmonic acid and ethephon on tillering to maturity in spring barley, Ann Bot. 69, 237-222. Mirjalili, N. and Linden, J.C. (1996) Methyl jasmonate induced production of taxol in suspension cultures of Taxus cuspidata: Ethylene interaction and induction models, Biotechnol. Prog. 12, 110-118.

ISOLATION OF DEVELOPMENTALLY-REGULATED GENES IN IMMATURE TOMATO FRUIT: TOWARDS AN UNDERSTANDING OF PRE­RIPENING DEVELOPMENT

B. JONES, H. ZEGZOUTI, P. FRASSE, AND M. BOUZA YEN ENSAT-INRA Toulouse, Avenue de l'Agrobiopole BP 107, 31326 Castanet Tolosan Cedex, France

1. Introduction

While the means by which ethylene triggers and co-ordinates climacteric fruit ripening are becoming clearer, the developmental cues required to signal a readiness to ripen remain unknown. In climacteric fruit such as the tomato, ethylene production remains at a basal level and is auto inhibitory throughout early development. Then, at the onset of ripening, fruit gain the capacity to both respond to and to synthesise dramatically increased levels of the hormone. This, in tum, results in the changes in gene expression, which drive the ripening process [1]. Developmental regulation of a competence to ripen is thought to involve the disappearance, or reduction below a certain threshold, of ripening inhibitors or conversely the appearance of essential components of the ripening process. In order to investigate the attainment of a competence to ripen, we have used a combination of degenerate, gene family-specific primers and mRNA Differential Display [2, 3] to isolate genes which show either up- or down-regulation prior to the onset of ripening.

2. Results

2.1. DR CLONES

A number of developmentally-regulated (DR) clones have been isolated including those with homology to: a H+ transporting ATPase; seed storage proteins; Ca2+/Calmodulin­dependent, SNF 1· and SIT protein kinases; AP2/EREBP domain containing proteins; and members of the ARF and AUX/IAA gene families.

2.2. DRI2: A MEMBER OF THE ARF GENE FAMILY

DRI2, the first gene to be further characterised, shows an increased accumulation of its mRNA at the immature green (\G) stage, a dramatic decline between the IG and mature green (MG) stages and thereafter an increase in mRNA abundance throughout ripening. The changes in DR12 mRNA accumulation occur before the onset of increased

181

182

endogenous ethylene production, indicating that DRl2 is developmentally regulated. DR12 is a tomato homolog of members of the ARF (auxin response factor) protein family. Members include, ARFI and ARF3 (ETT) [4]. Evidence from mutations in ARFs indicates that they play key roles in organogenesis and organ patterning. ARF 1 binds to a cis-acting element, TGTCTC, found in the promoters of early auxin­responsive SAUR, AUXlIAA and auxin-responsive ACC synthase genes [5, 6, 7]. Interestingly, in addition to the developmental regulation, DRl2 was shown to be up­regulated by auxin and strongly down-regulated by exogenous ethylene (5h, 20ppm).

2.3. ETHYLENE REGULA nON OF AUXIIAA GENE F AMIL Y MEMBERS

AUXIlAA genes are putative transcription factors and have been shown to form homo­and heterodimers and to interact with ARFs [5, 8, 9]. In an attempt to understand the significance of the effect of ethylene on DR12, A UXlIAA homo logs were isolated from tomato and their expression patterns studied. Tomato AUXlIAA homo logs (DRI-DRll) show complex patterns of developmental, auxin and ethylene-regulated expression. One of the most interesting results was that ofDR3 which, in contrast to DR12, was strongly up-regulated by ethylene.

3. Conclusions

Auxin and ethylene have been shown to interact at several levels [7]. Ethylene regulation ofDR3 and DRl2 is further evidence of an interaction and another indication of the complexity of cellular responses to hormone signalling. We are currently using several techinques including A. tumifaciens-mediated transformation to determine the significance for tomato fruit development of the developmental and ethylene regulation.

4. References

1. Lelievre, J.M., Latche, A, Jones, B., Bouzayen, M., and Pech, lC. (1997) Ethylene and fruit ripening. Physiol. Plant. 101,727-739.

2. Liang, P. and Pardee, AB. (1992) Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction, Science 257, 967-971

3. Zegzouti, H., Marty, C., Jones, B., Bouquin, T., Latche, A, Pech, J.C. and Bouzayen, M. (1997) Improved screening of cDNAs generated by mRNA differential dispaly enables the selection of true positives and the isolation of weakly expressed messages, Plant Mol. Bioi. Rep.15, 236-245.

4. Ulmasov, T., Hagen, G. and Guilfoyle, TJ. (1997) ARFl, a transcription factor that binds to auxin response elements, Science 276, 1865-1868

5. Oeller, P.W., Keller, J.A., Parks, J.E., Silbert, J.E. and Theologis, A (\ 993) Structural characterization of the early indoleacetic acid-inducible genes, PS-IAA4/5 and PS-IAA6, of pea (P. sativum 1.), Mol. BioI. 233, 789-998

6. Abel, S., Nguyen, M.D., Chow, W. and Theologis, A (\995) ACS4, a primary indoleacetic acid­responsive gene encoding l-aminocyc1opropane-I-carboxylate synthase in Arabidopsis thaliana. Structural characterization, expression in Escherichia coli, and expression characteristics in response to auxin, J. Bioi. Chem. 270, 19093-19099

7. Sessions, A, Nemhauser, J.1., McColl, A, Roe, J.1., Feldmann, K.A and Zambryski, P.C. (1997) ETTIN patterns the Arabidopsis floral meristem and reproductive organs, Development 124,4481-4491

8. Ulmasov, T., Murfett, J., Hagen, G., Guilfoyle, TJ. (1997) AuxllAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements, Plant Cell 9, 1963-1971

9. Kim, J., Harter, K. and Theologis, A (\997) Protein-protein interactions among the AuxilAA proteins, Proc. Natl. Acad. Sci. USA 94,1l786-11791

INTERACTION BETWEEN ETHYLENE AND ABSCISIC ACID IN THE REGULATION OF CITRUS FRUIT MATURATION

F. ALFEREZ AND L. ZACARlAS /nstituto de Agroquimica y Tecnologia de Alimentos (CS/C), Apartado de Correos 73, 46100 Burjassot, Valencia, Spain

Fruit ripening is a complex process involving a number of physiological and biochemical changes which are thought to be under hormonal and environmental control. Although the ripening of Citrus fruits is not associated with a transient increase in the biosynthesis of ethylene, recent physiological and molecular evidence has indicated that this plant hormone may be involved in the control of fruit maturation [I, 2]. Alonso et al [2] isolated a number of ethylene-induced cDNAs in the peel of Navel oranges and showed that some of the mRNAs corresponding to these cDNAs were up regulated during fruit maturation and suggested that ethylene is implicated in the regulation of some aspects of Citrus fruit maturation. Since ethylene production remains very low during the process, changes in the sensitivity of the tissue to the basal ethylene levels may operate. Furthermore, Abscisic Acid (ABA) has also been shown to be involved in the maturation of Citrus fruits but its role is far from understood. Goldschmidt et al. [3] demonstrated an increase in ABA during natural and ethylene­induced senescence of Citrus flavedo. Richardson & Cowan [4], comparing changes in ABA in different Citrus varieties, indicated that full colour was achieved when ABA in the skin started to decline. We have recently described the characterization of a spontaneous bud mutation of Navelate orange, named 'Pinalate,' which is affected in colour development and is ABA-deficient [5]. This mutant provides an interesting experimental system to study the involvement of ABA in the hormonal mechanisms governing fruit growth and maturation. In this work we report a comparative analysis of the maturation process in 'Navelate' oranges (Citrus sinensis L., referred to as wild type, WT) and 'Pinalate'. The role of ethylene and its potential interaction with ABA in the regulation of Citrus fruit coloration are discussed.

'Pinalate' mature fruit develops a yellow skin colour. HLPC analysis of the carotenoid and xanthopyll contents indicated that flavedo tissue (colour part of the skin) of the mutant accumulated a higher amount of the initial carotenoids. The concentration of xanthophylls was about 6-times lower than in WT fruits, indicating that the mutation may have affected in ~-carotene desaturase activity [5]. ABA content in the flavedo tissue was also substantially reduced [5]. In both genotypes, the initial signal of degreening took place at the same time, but in 'Pinalate' progressed at a much lower rate. During transformation from chloroplast to chromoplast the ABA content increased 4-5 times in the WT flavedo but remained very low in the mutant, less than 20% of wild type. The rate of degreening was also delayed in detached mature-green fruits from the ABA-deficient mutant, even though ethylene production was higher. The endogenous ABA content in the flavedo increased approximately two-fold in detached WT fruits but declined steadily in the mutant. Application of ABA (0,5 mM) to the mutant accelerated

183

184

the rate of fruit degreening, indicating that the mutation did not affect the sensitivity to ABA. This treatment did not affect WT fruits, suggesting that the endogenous ABA status at this developmental stage may be sufficient to induce the response. Application of the ethylene action inhibitor 2,5-norbomadiene (NBD) strongly reduced the rate of fruit coloration in WT and suppressed by about 50% the increase in ABA respective to air-treated fruits. In the mutant, however, no effect was observed during the first days of treatment but thereafter slightly reduced the rate of chlorophyll loss, suggesting that one of the initial ethylene actions may be in inducing ABA content during the onset of coloration. In both genotypes, exogenous ethylene (l01l1 r1) counteracted the effect of NBD on degreening and on ABA content. Prolonged NBD treatment (7-15 days) did not inhibit the process, since fruit from both genotypes degreened at a lower rate. These results suggest that factors other than ethylene are also involved in the process., probably the low ABA levels in the skin of the fruits (by chemical inhibition in WT or by genetic lesion in the mutant) may be still sufficient for the process to proceed. Application of ethylene (10111 r1) accelerated fruit degreening in mature-green fruits of both genotypes although at lower rate in the mutant, indicating that at least part of the ethylene action, or at latter stages, may be independent of ABA.

The overall results clearly indicate that a complex hormonal relationship operates during coloration of Citrus fruits. Ethylene plays a role in inducing chlorophyll breakdown and also increasing the ABA content in the skin. The observation that the ethylene-induced effects were similar in the flavedo of the ABA-deficient mutant indicates that ethylene regulates the process by a direct mechanism and independently of ABA. It can be suggested that both ethylene and ABA may activate different pathways in the metabolic sequence leading to fruit coloration. ABA deficiency did not modifY the initiation of chlorophyll loss but it proceeded to a lower rate. In the ethylene insensitive mutant ertI-I of Arabidopsis, leaf senescence was delayed but once initiated it progressed as in the wild type plant, suggesting that ethylene regulates the timing of leaf senescence [6]. Our results suggest that a similar mechanism may be acting in the degreening of Citrus fruits, in which ethylene would regulate the initiation and ABA the rate of the process.

References

1. Goldschmidt, E.E., Huberman, and Goren, R. (1993) Probing the role of endogenous ethylene in the degreening of citrus fruit with ethylene antagonists, Plant Growth Regul. 12, 325-329.

2. Alonso, J.M., Chamarro, J. and Granell, A. (1995) Evidence for the involvement of ethylene in the expresion of specific RNAs during maturation of the orange, a non-climacteric fruit, Plant Malec. Bioi. 29,385-390.

3. Goldschmidt, E.E., Goren, R., Even-Chen, Z. and Bittner, S. (1973) Increase in free and bound abscisic acid during natural and ethylene induced senescence of Citrus fruit peel, Plant Physiol. 51, 879-882.

4. Richardson, G.R. & Cowan, A.K. (1995) Abscisic acid content of Citrus flavedo in relation to colour development,J. Hart. Sei.70, 769-773.

5. Zacarias, L., Alferez, F., Mallent, D. and Lafuente, M.T. (1997) Understanding the role of plant hormone during development and maturation of citrus fruits through the use of mutants, Acta Hortie. 463,89-95.

6. Grbic, L., and Bleecker, A.B. (1995) Ethylene regulates the timing of senescence in Arabidopsis, Plant J. 8, 595-602.

INTERACTIONS BETWEEN ABSCISIC ACID AND ETHYLENE IN ETHYLENE­FORMING CAPACITY OF PRECLIMACTERIC APPLE FRUITS

l. LARA 1 AND M. VENDRELL 1.2

IUdL-IRTA, Alcalde Rovira Roure 177,25198 Lieida, Spain, 2ClD-CSIC, Jordi Girona 18-26, 08034 Barcelona, Spain

1. Introduction

Ethylene plays a key role in ripening of apple fruit. Elucidation of the factors controlling climacteric ethylene biosynthesis is therefore of interest for achieving a global knowledge of the processes leading to fruit maturation and ripening.

Interaction with other plant hormones, and speciaIly with abscisic acid (ABA), seems to be of importance in this regard. It has been reported previously that ABA treatment enhances ethylene production in apples [4], as well as in other plant tissues [3], although the mechanism of this enhancement is not well established. Recent work (Lara and VendreIl, submitted) shows a strong correlation between endogenous ABA and ACC contents during the preclimacteric period in Granny Smith apple fruits, and sensitivity of fruit tissues to growth regulators also appears to be a factor controlling climacteric ethylene biosynthesis and ripening process.

Although ACC synthase (ACS) is recognised to be a major regulatory step in ethylene biosynthesis, this regulation seems to depend as much on ACS activity as on the tissue capacity to convert ACC to ethylene. In the present work, the effects of ABA­and ethylene-treatments on the development of ethylene-forming capacity (EFC) in pulp and peel tissues of preclimacteric immature as compared to preclimacteric mature apple fruits are reported. Evidence is provided that ABA treatment results in a specific increase in ACO protein.

2. Material and Methods

Preclimacteric Granny Smith apple fruits were collected either two months before commercial harvest (R2) or at commercial harvest (Ho). Immediately after harvest, fruits were either injected with I mM ABA or exposed for 48 h to 250 Ill. rl ethylene, and thereafter kept at 20°C during three weeks. Ethylene production, EFC and ACC content were measured periodically in both pulp and peel tissues of four fruits. Total soluble proteins of samples were blotted onto PVDF. Antibodies raised against apple ACC oxidase were used to monitor the accumulation of ACO protein in our samples.

3. Results and Discussion

ACO protein was not detectable at harvest either in pulp or in peel. However, a remarkable induction of ACO protein accumulation was found in both pulp and peel of R2 ABA-treated fruit (Fig. 3), which was not detected either in untreated or in ethylene-

185

186

treated fruit. This pattern was parallel to that observed in EFC (Fig. 2) and in ethylene production (Fig. 1), as well as in ACC content of pulp (Fig. 4A), proving an accordingly significant ACS activity. Pulp and peel tissues of Ho fruit were both ABA- and ethylene-responsive, although response was somewhat more intense in ABA-treated fruit. Higher ethylene production rates in ethylene-treated as compared to untreated fruit (Fig. 1) in spite of similar EFC and ACC contents (Fig. 2 and 4) suggest that ACS activity was also enhanced by ethylene treatment.

, TbJa,~lIIIerh&rw·tJ

1--1..lI*e ..... _ABA "'EIIMeDe I

Figure I. Ethylene production in H_2 and Ho Granny Smith apples.

A

B

'''"'. -==,-":"---:-:-----:o------c' TImstDaysllllerharvesO

I--Untreated "ABA _EtbyIen! I

Figure 2. EFC in pulp (A) and peel (B) of H.2 and Ho Granny Smith apples.

4. Acknowledgements

A

u ...... 2]-H.

+lmMABA ~ +3S0 ...... e~

Dll)'safleJ'harvest o 7 14 l..

Days IllIoor '-"-t o 7 14 :n

B

[2J Ho .­... _/

Figure 3. Immunoblot of ACO protein in pulp (A) and peel (B) of H-2 and Ho Granny Smith apples.

A

B

Figure 4. ACC content in pulp (A) and peel (B) of H-2 and Ho Granny Smith apples.

The authors are grateful to Dr. Dilley from Michigan State University (USA) and to Dr. A. Latche from ENSAT (France) for the generous gift of apple ACO antibody. I. Lara is a recipient of a grant from INIA and of a TMR-Euroconference Programme (TMR­ERBFMMACT95-0032) fellowship. This work was supported by project INIA-9672.

5. References

1. Dominguez, M. and Vendrell, M. (1994) Effect of ethylene treatment on ethylene production, EFE activity and ACC levels in peel and pulp of banana fruit, Postharvest Bio!. Technol. 4, 167-177.

2. McMurchie, E.J., McGlasson ,W.B. and Eaks, I.L. (1972) Treatment of fruit with propylene gives information about the biogenesis of ethylene, Nature 237, 235-236.

3. Riov, J., Dagan, E., Goren, R. and Yang, S.F. (1990) Characterization of abscisic acid-induced ethylene production in citrus leaf and tomato fruit tissues, Plant Physiol. 92,48-53.

4. Vendrell, M. and Buesa, C. (1989) Relationship between abscisic acid content and ripening of apples, Acta Hart. 258, 389-396.

SOIL COMPACTION: IS THERE AN ABA-ETHYLENE RELATIONSHIP REGULATING LEAF EXPANSION IN TOMATO?

A. HUSSAIN, J.A. ROBERTS, C.R. BLACK AND LB. TAYLOR Division of Plant Science, School of Biological Science, University of Nottingham, Sutton Bonington Campus

Compacted soils exhibit increased bulk density and shear strength, resulting in impeded root growth and a reduced ability to absorb water and nutrients. Our research has provided good evidence that root-sourced chemical signals co-ordinate plant responses to soil compaction, and that abscisic acid (ABA) is an important component of this signalling system. However, although an inverse relationship between xylem sap ABA concentration and stomatal conductance was demonstrated, root-sourced ABA was not responsible for the observed inhibition of leaf expansion in barley plants under compacted soil conditions [2]. Indeed, the increased xylem sap ABA concentration exhibited by wild type plants were shown to maintain leaf expansion as compared to an isogenic ABA deficient mutant genotype during "sub-critical" compaction stress. Subsequent studies using a split-pot approach have shown that the observed reduction in leaf expansion in compacted soil is mediated by a root-sourced signal, which was unlikely to be ABA. A possible candidate as the second root-sourced signal is ethylene, as its production is increased under compacted conditions [3] and it can be transported from stressed roots to the shoots as its precursor, ACC [I]; this hypothesis is currently under investigation.

We have developed a novel split-pot approach so as plants develop, their roots become divided between uncompacted (1.1 g cm·3) and compacted soil (1.5 g cm·3).

This method has enabled tomato to be examined despite its susceptibility to impeded rooting conditions. This species offers the key advantage that genotypes are available with limited capabilities for producing ABA and ethylene. Wild type (Ailsa Craig), ABA deficient mutant (notabilis) and a genetically modified genotype with an impaired ability to synthesise ethylene (ACO I AS; [1]) were supplied with ethephon (+eth; 400 l.tI r I), to establish the role of elevated ethylene production, whilst the physiological action of ethylene was inhibited by applying silver thiosulphate (+STS; I mM).

Differing growth responses were induced, with leaf expansion being greatest in control plants ACO I AS and least in notabilis (Fig. 1). Ailsa Craig demonstrated an intermediate rate of leaf expansion, suggesting a positive role for higher xylem sap ABA concentrations found in this genotype and ACOI As (Fig. 4) as was also the case for barley [2]. Stomatal conductance and xylem sap ABA concentration were inversely correlated (Figs 3 and 4).

187

188

Figure 1: Leaf area (cm2) 300 300,,--:::-::-,--------, 25 Ailsa Craig 250 AC01""

300,------, 250 notabilis

15

10

200

150

100

200

150

100

14mlf§U ec '. 14Qc/,IOOlllo &! 14m; a I ~o 30 12 sa f31g 12 AS - 12

10 10 10

8 8 8

6 6 6

4 4 4

2 2 2

o 0 0 10 20 30 10 20 30 10 20

Figure 3: Stomatal conductance (mmol m-2 S-l)

500 Ailsa Craig 500.-:-==-::------, 400 400 ACOIAS

100

30

500

400

300

200

100

~

• Control

D +STS IlJ +eth

--Control

...•... +STS

--- +eth

-' -~

notabilis 101214 16 182022 24 26 28 30 ~o 1214 1618 202224 262830 010 1214 16 18 20 22 24 26 28 30

Figure 4: Xylem sap ABA concentration (J-lInol m-3) 250 250,..--------,

~-~ :: ~ ACOhs

150

250 notabilis 200

100

50

10 20 30 111 20 30 10 20 30

Day after emergence Day after emergence Day after emergence

Treatment with ethephon greatly reduced leaf expansion in both wild type and ACOI As plants and increased ethylene evolution from the leaves (Fig. 2). Partial phenotypic reversion was achieved in notabilis by blocking the action of ethylene with STS, indicating an inhibitory role for ethylene in mediating leaf growth. The impact of increased ethylene production on leaf expansion is therefore apparently opposed by the antagonistic effect of root-sourced ABA, which helps to maintain shoot growth.

References

1. English, P.J., Lycett, G.W., Roberts, J.A. and Jackson, M.B. (1995) Increased I-aminocyclopropane-I­carboxylic acid oxidase activity in shoots of flooded tomato plants raises ethylene production to physiological active levels, Plant Physiol. 109, 1435-1440.

2. Mulholland, B.J., Black, C.R., Taylor, LB., Roberts, J.A. and Lenton, J.R. (1996) Effect of soil compaction on barley (Hordeum vulgare 1.) growth I, Possible role for ABA as a root-sourced chemical signal, J. Exp. Bot. 47, 551-556.

3. Sarquis, LN., Jordan, W.R. and Morgan P.W. (1991) Ethylene evolution from maize (Zea mays 1.) seedling roots and shoots in response to mechanical impedance, Plant Physiol. 96, 1171-1177.

USE OF I-METHYLCYCLOPROPENE TO MODULATE BANANA RIPENING

D.C. JOYCE', AJ. MACNISH', PJ. HOFMAN2, D.H. SIMONS' AND M.S. REID3 IThe University of Queensland, Gatton College, QLD 4345, Australia; 2Queensland Horticulture Institute, 19 Hercules Street, Hamilton, QLD 4007, Australia; 3University of California, Davis, CA 95616, U.S.A.

1. Introduction

Premature and rapid ripening are two ethylene-related postharvest problems of banana fruit. Ethylene binding inhibitors such as diazocyclopentadiene (DACP) delay fruit ripening, even when applied at late stages [2]. However, constraints prohibit commercial use of DACP [2]. I-Methylcyclopropene (l-MCP), an alternative and irreversible ethylene binding inhibitor, prevents fruit ripening [1]. This study investigated effects of I-MCP applied before or after ethylene gasing.

2. Materials and Methods

Mature bananas (Musa sp. cv. 'Williams') were treated with: (i) 0, 3.75, 7.5 or 15 ilL 1-MCP/L (12 h, 20°C), or (ii) 15 ilL I-MCP/L for 0, 3, 6, 9 or 12 h (20°C). Half of the untreated and I-MCP treated fruit from each experiment were then exposed to 100 ilL ethylene/L (12 h, 20°C). Additionally, fruit were treated with 10 mL propylene/L (24 h, 20°C) followed by treatment of subsamples with 15 flL I-MCP/L (12 h, 20°C) immediately or at 12 h intervals over 108 h after propylene. Control fruit were untreated, I-MCP or propylene treated. Fruit were ripened in a completely randomised design at 20°C and 70-90% RH, and scored daily for skin colour (l =green - 8=brown) and hand firmness (1 =hard - 5=over soft). Shelf life (SL) and eating-ripe life (EL) were time (days) to reach or maintain eating ripe condition (firmness=4 with colour <8), respectively. Ethylene production was measured for single fruit sealed injars.

3. Results

Treatment with 3.75 flL I-MCP/L extended SL of+ and - ethylene-treated fruit by 4.2-and l.7-fold, respectively (Fig. IA). Fifteen flL I-MCP/L for 3 h extended SL by 4.6-fold, versus ethylene only fruit (Fig. 18). Exposure to 15 ilL I-MCP/L immediately, 12, 24, 36,48 or 60 h after propylene treatment extended SL by factors of 4.5, 3.6,3.1, 2.3, 1.3, and 1.2-fold, respectively (Fig. 2). EL of fruit treated with I-MCP 48 h after propylene treatment (12 h after peak ethylene production) was extended by 4.4-fold.

189

190

40 (AJ

-en 30 >-III :E!.

~ 20 -Iii .<:: 10 en

OLL __ ~ ____ ~ ______ ~-L~ __ -L __ ~ __ ~ ____ ~

0.00 3.75 7.50 15.00 0 3 6 9 12

Concentration (Ill 1-MCP/l) Exposure time (h)

Figure 1. Shelf life (days) of bananas treated with I-MCP at different concentrations (A) or exposure times (B), with (e) and without (_) subsequent exposure to ethylene. Vertical bars represent s.e.m. (n=IO [A], n=7 [BD.

40 2.0

1.5 c:

-en 30 0

iU' ti :::JC

~ U.c:

Z. 20 1.0 eo c. .>< .s; Ol::J Ol e :i. Cl Ol-e

0 >, ...J 10 0.5 = w

0 0.0 0 12 24 36 48 60 72 84 96 108

Timing of 1-MCP treatment (hr after propylene gasing)

Figure 2. Longevity (days) as shelf life (e) or eating-ripe life (.) and ethylene production (bars) of bananas treated with propylene followed by 1-MCP immediately or at 12 h intervals over 108 h. Vertical lines represent s.e.m. (n=3). SL and EL for I-MCP controls = 39.0 ± 0.6 and 2.7 ± 0.3 and propylene = 7.0 ± 0.0 and 4.0 ± 0.6.

4. Conclusion

1-MCP delayed or slowed ripening of prec1imacteric and climacteric bananas, respectively. 1-MCP treated prec1imacteric fruit eventually ripen, possibly due to synthesis of new ethylene receptors. I-MCP treatment became less effective as ripening progressed, especially after peak ethylene production. Nevertheless, I-MCP treatment extended the EL of fruit when applied at later ripening stages, which may be a commercial advantage. Thus, I-MCP promises improved control of banana fruit ripening when applied before (prec1imacteric) or after (climacteric) ethylene gasing.

5. References

1. Serek, M., Sisler, E.C. and Reid, M.S. (1995) I-Methylcyclopropene, a novel gaseous inhibitor of ethylene action, improves the life of fruits, cut flowers and potted plants, Acta Hart. 394,337-45.

2. Sisler, E.C. and Lallu, N. (1994) Effect of diazocyclopentadiene (DACP) on tomato fruits harvested at different ripening stages, Post. Bioi. and Techn. 4, 245-54

ENDO-P-MANNANASE ACTIVITY DURING LETTUCE SEED GERMINATION AT HIGH TEMPERATURE IN RESPONSE TO ETHYLENE

1. Abstract

W.M. NASCIMENTO, DJ. CANTLIFFE AND DJ. HUBER Department of Horticultural Sciences, IF AS, University of Florida, Gainesville, FL 3261 1-0690, USA

The role of endo-p-mannanase (EBM) during lettuce seed germination at 35°C and the influence Ie of ethylene in EBM regulation were investigated. Seeds of 'Dark Green Boston' (DOB) and 'Everglades' (EVE) were germinated in water, 1-aminocyclopropane-I-carboxylic acid (ACC), or aminoethoxyvinylglycine (A VG). Seeds were also primed in polyethylene glycol (PEG), or PEG + ACC, PEG + AVG. Untreated seeds germinated 100% at 20°C. At 35°C, EVE germinated 100%, whereas DGB germinated only 4%. Seed priming or adding ACC during incubation increased germination at 35°C. AVG inhibited seed germination ofDGB at 35°C. Higher enzyme activity was observed in EVE compared with DOB seeds. Providing ACC either during priming or during germination increased EBM activity, whereas A VG decreased activity. Higher ethylene production was detected in EVE than DOB during germination at 35°C. The results suggest that ethylene overcomes the inhibitory effect of high temperature in thermosensitive lettuce seeds by weakening of endosperm due to increased EBM activity.

2. Introduction

The lettuce seed embryo is enclosed within a 2-4 cell layer endosperm that is comprised mainly of galactomannan polysaccharides. The endosperm delays or prevents germination, acting as a physical barrier to radicle protrusion, especially under high temperature conditions. Weakening of the endosperm layer of lettuce seeds is a pre­requisite to radicle protrusion at high temperatures [5]. Cell wall-associated endo-p­mannanase was expressed in lettuce seed endosperm prior to radicle protrusion [2]. Exogenous ethylene overcomes the inhibitory effect of high temperature on lettuce seed germination [I]; however, the role of ethylene is still unknown. We investigated the influence of ethylene or ACC on endo-p-mannanase activity during germination of lettuce seed at high temperature.

3. Materials and Methods

Seeds from thermosensitive cv. Dark Green Boston (DOB) and thermotolerant cv. Everglades (EVE), [5] were primed for three days at 15°C under constant light in an aerated solution of polyethylene glycol (PEG), PEG + 10 mM of I-aminocyclopropane-

191

192

I-carboxylic acid (ACC), or PEG + 10 mM of aminoethoxyvinylglycine (A VG). Seeds were germinated at 20 and 35°C under constant light. Nonprimed seeds were also germinated in water, ACC, or A VG. Endo-~-mannanase activity was assayed by gel­diffusion [4]. Ethylene was measured using a gas chromatograph equipped with an alumina column and a flame ionization detector.

4. Results and Discussion

Higher endo-~-mannanase (EBM) activity and ethylene production were observed for seeds germinated at 20 (data not shown) than at 35°C. High temperature might reduce protein synthesis directly or inhibit factors involved in EBM production by the endosperm. Higher EBM activity was observed in seeds from a thermotolerant genotype and on seeds primed with ACC (Table I). Greater ethylene production and seed germination at 35°C were also observed under these conditions (Table 1). Sung et al. [5] reported that thermotolerant or primed seeds required less force to penetrate the lettuce endosperm than did thermosensitive genotypes or nonprimed seeds. Adding ACC during seed germination also increased enzyme activity and seed germination at 35°C (Table 1). EBM is involved in endosperm cell wall hydrolysis in other species, causing endosperm weakening [3]. Ethylene exposure led to weakening of lettuce endosperm tissue; however, this action was not correlated with its effect on germination [1]. Even so, our results suggest that EBM might be regulated by ACC or ethylene, and that increased EBM activity before radicle protrusion might contribute to lettuce endosperm weakening, especially at high temperatures.

Table I. Lettuce seed germination, endo-13-mannanase activity and ethylene production of 'Dark Green Boston' {DGBl and 'Everglades' {EVE) at 35°C.

Germination Mannanase activity· Ethylene production· Treatment (%) (pmol min,i) (pi (gseedsr i h· i )

DGB EVE DGB EVE DGB EVE Nonprimed (NP) + H2O 4 100 00 1.1 0.0 342 NP+ACC 92 100 1.0 1.7 1705 3356 NP+AVG 56 100 0.0 0.0 0.0 0.0 PEG 96 99 1.3 81.1 534 629 PEG+ACC 100 100 2.1 100.3 713 3233 PEG+AVG 93 93 1.1 4.8 0.0 0.0 • Enzyme activity and ethylene production were assayed from seeds I h before radicle protrusion

5. References

I. Abeles, F.B. (1986) Role of ethylene in Lactuca sativa cv 'Grand Rapids' seed germination, Plant Physiol. 81, 780-788.

2. Dutta, S., Bradford, KJ. and Nevins, DJ. (1997) Endo-13-mannanase present in cell wall extracts oflettuce endosperm prior to radicle emergence, Plant Physio/. 133, 155-161.

3. Groot, S.P.c. and Karseen, C.M. (1987) Gibberellins regulate seed germination in tomato by endosperm weakening: A study with gibberellin-deficient mutants, Planla 171, 525-531.

4. Still, D.W., Dahal, P. and Bradford, KJ. (1997) A single-seed assay for endo-13-mannanase activity from tomato endosperm and radicle tissues, Plant Physiol. 113, 13-20.S.

5. Sung, Y., Cantliffe, DJ. and Nagata, R. (1998) Using a puncture test to identify the role of seed coverings on thermotolerant lettuce seed germination, J. Amer. Soc. Hort Sci. (in press).

ETHYLENE AND GIBBERELLIN IN SECONDARY DORMANCY RELEASING OF AMARANTHUS CAUDATUS SEEDS

J. K~PCZYNSKI, M. BIHUN Department of Plant Physiology, University ofSzczecin, Felczaka 3a, 71-412 Szczecin, Poland

1. Introduction

Although studies on ethylene and seed germination began 70 years ago many questions remain [1, 2]. Especially the knowledge on the role of ethylene in the release of secondary dormancy in seeds is insufficient. This work shows reactions of secondary dormant (thermodormant) Amaranthus caudatus seeds to ethylene, ACC, GA3, ethylene + GA3 and effect of GA3 on ethylene production and ACC oxidase activity in vivo.

2. Materials and Methods

To induce secondary dormancy, non-dormant commercially available Amaranthus caudatus seeds were presoaked for 1 day at 45°C in darkness. Seeds were germinated in darkness at 25°C. Ethylene production was measured by withdrawing a I ml sample into a Hewlett-Packard 5790 gas chromatograph equipped with a flame ionization detector and Poropack Q packed column. All experiments were repeated twice with 3-5 replications.

3. Results and Conclusions

Ethylene or ACC released secondary dormancy in A. caudatus seeds (Table I). It may indicate that these seeds have an ethylene-response mechanism and suggest that seeds do not germinate because of an insufficient level of endogenous ethylene. Likewise, GA3 at 10.3 M completely released secondary dormancy in these seeds. GA3 at 10.6 M enhanced ethylene action indicating cooperation between these hormones (Fig. I). ACC markedly increased ethylene production and slightly seed germination after 16 h of incubation (Table 2). GA3 did not affect ethylene production, ACC conversion to ethylene and germination. After 28 h both ACC and GA3 stimulated ethylene production and seed germination. GA3 enhanced both ACC conversion to ethylene and germination. Thus GA3 seems to be involved in control of ACC oxidase activity in vivo in germinating seeds.

193

194

TABLE I. The effect of ethylene, ACC or GA3 on Amaranlhus caudalus seed germination (%) after 2 and 5 days at 25°C. Seeds with radicle approximately 2 mm long were considered as germinated. SD for 2 days < 6.4 %; SD for 5 days < 5.1 %.

Days

2 5

Water Ethylene, I fUll 5.4 12.6

;:!e 0

C .2 1;; c § '" 0

100

80

60

40

20

0 Ethylene. I pili GAJ.IO.('M

57.0 98.6

LI, 0 0

Treatment

+ 0

ACC, 10-3 M

30.4 82.0

~ .. o +

46.8 90.8

Figure I. The effect of GA3 and ethylene on germination of secondary dormant Amaranlhus caudalus seeds after 2 (n) and 5 (~ days at 25°e. SD < 6.4%.

TABLE 2. The effect of GA3 (10-3 M) and ACC (10-3 M) on ethylene production and germination of Amaranlhus caudatus seeds at 25°C. Seeds with radicles less than 2 mm (radicle protrusion) and longer than 2 mm were counted. For ethylene determinations, 200 seeds were incubated in 4 ml flasks for 2 h at 25°e. SD < 1.3 pMIl 00 seeds/h; SD < l.l %.

16

Treatment Ethylene, pM/IOO seeds/h

Water 0.7 GA3 0.9 ACC 5.1

ACC+ GA3 6.8

4. References

Incubation time, hours

Radicle, % <2 >2

o 0 0.2 0 1.7 0.9 1.7 0.9

Ethylene, pM/lOO seeds/h

8.6 15.1 21.8 53.1

28

Radicle, % <2 >2

5.0 2.2 33.4 11.9 31.2 10.7 28.5 20.6

I. Esashi, Y. (1991) Ethylene and seed germination, in AK. Matoo and J.e. Suttle (eds.), The Plan I Hormone Elhylene,CRC Press, Boca Raton, pp. 133-157.

2.K~pczynski, J. and K~pczynska, E. (1997) Ethylene in seed dormancy and germination, Physiol. Plan!. 101,720-726.

REGULATION AND FUNCTION OF POLLINATION-INDUCED ETHYLENE IN CARNATION AND PETUNIA FLOWERS

I. Abstract

M. L. JONES', W.R. WOODSON2 and J.T. L1NDSTROM3

I Department of Horticulture and Land~cape Architecture, Colorado State University, Fort Collins, CO 80523, USA; 2Department of Horticulture and Land~cape Architecture, Purdue University, West Lafayette, IN 47907, USA; 3 Department of Horticulture, University of Arkansas, Fayetteville, AR 72701, USA

In many flowers pollination accelerates ethylene biosynthesis and developmental changes observed during the natural senescence of unpollinated flowers. A burst of ethylene production from the stigma! style is often the first detectable post-pollination event. We are interested in the nature of the pollen-pistil interaction that induces ethylene biosynthesis and the role of ethylene in triggering subsequent post-pollination phenomena including ovary development and senescence of the corolla. In carnations we have identified a pollination responsive ACC synthase that is up regulated by I hour after pollination in styles. We have demonstrated that the regulation of this gene by pollination is independent of ethylene action, but that ethylene action within the pollinated style is required to initiate subsequent post-pollination events in the ovary and petals. Using Petunia hybrida as a model we have shown that pollen-borne ACC is synthesized in the haploid pollen grain by a pollen specific ACC synthase gene. Using transgenic plants that fail to accumulate ACC in their pollen we have shown that pollination-induced ethylene production and ACC synthase mRNA accumulation in the style is not dependent on ACC in the pollen grain. With the identification of pollination responsive ACC synthase genes and the use of pollen that is deficient in potential elicitors it should be possible to identify the primary pollination signal in Petunia and carnation flowers.

2. Introduction

The pollination of angiosperm flowers initiates a series of developmental processes that result in the ripening of fruit and dispersal of seeds. In many longer-lived flowers, pollination accelerates ethylene biosynthesis and developmental changes observed during the natural senescence of unpollinated flowers. These processes include ovule differentiation, ovary development, pigmentation changes, corolla senescence and corolla abscission. While most flowers contain fully developed ovules prior to pollination, orchids lack ovules at anthesis and ovary development and ovule

195

196

differentiation are induced by pollination [29]. Pollination-induced changes in perianth pigmentation have been reported in Cymbidium and lupine flowers [22, 30] and accelerated corolla senescence or wilting has been extensively studied in flowers of petunia, carnation and orchid [3, 4, 7, 8, 15, 33]. In addition to premature senescence, flowers such as Digitalis, Cyclamen and Pelargonium abscise their petals shortly after pollination [9, 21, 25]. The dramatic changes in the perianth induced by pollination are thought to contribute to the efficiency of pollination by discouraging visits from future pollinators [23].

3. Pollination-induced Ethylene

In many species, including carnation, petunia, and orchids, an increase in ethylene biosynthesis from the stigma is the first detectable post-pollination event. This ethylene production occurs within the first few hours after pollination, prior to pollen germination [10, 13, 15, 16, 17, 18]. The role of this early stylar ethylene in triggering post-pollination phenomena like petal senescence is not understood, but there is increasing evidence that pollination-induced ethylene regulates post-pollination developmental events. Flowers that are insensitive to ethylene due to treatment with inhibitors of ethylene action [11] or due to the expression of the mutated ethylene receptor (etrl-l) [28] do not exhibit pollination-induced corolla senescence. We have shown that preventing ethylene perception only in the pollinated style by treatment with DACP also effectively prevents pollination-induced corolla senescence [11]. These results illustrate the importance of stylar ethylene in regulating post-pollination events.

The inhibition of pollination-induced ethylene by treatment of the style with A VG (an inhibitor of ACC synthase) indicates that this ethylene biosynthesis is dependent on ACe synthase activity in the style [10, 31]. In order to investigate the regulation of ACC synthase by pollination, RT-PCR was utilized to identifY pollination-responsive ACC synthase genes. In carnations, an ACC synthase (DCACS3, GenBank #AF041937) was identified that shares 65.8% and 83.8% amino acid identity with carnation ACC synthases DCACSI and DCACS2 respectively. Very low levels of DCACS3 mRNA can be detected in unpollinated styles and increase by 1 hour after pollination (Fig. IA). ACC synthase transcripts from DCACS2 and DCACS3 are also up-regulated by pollination but correspond to the second and third peaks of ethylene production detected from pollinated styles [11]. The increase in DCACS3 mRNA abundance following pollination is independent of ethylene action, as it is not prevented when pollinated flowers are treated with the ethylene action inhibitor 2,5-norbornadiene (NBD) (Fig. 1 B).

In petunia flowers, ethylene production by the stigma has been shown to increase within 5 minutes after the application of pollen [18]. This increase in ethylene production is inhibited by A VG, but not by inhibitors of RNA synthesis [18]. The rapid nature of the response suggests that ethylene synthesis involves the activation of an existing enzyme or transcription of existing ACC synthase mRNAs. While the regulation of most members of the ACC synthase gene family has been found to be at the level of transcription [12], post-transcriptional regulation of ACC synthase has been demonstrated [5, 6]. The identification of an ACC synthase gene in petunia with high

197

levels of transcript at anthesis supports the possible post-transcriptional regulation of ACC synthase by pollination (Data not shown). The regulation of this gene following pollination is currently being investigated.

Time after pollination (hours)

o 1 4 6 10 12 14 16 18 24 36 48 A.

DCACS1

DCACS2

DCACS3

rRNA

AIR NBD

B. 0 1 6 12 18 24 48 1 6 12 18 24 48

DCACS3

rRNA

Figure lAo Expression of DCACSI, DCACS2, and DCACS3 in carnation styles at various times after pollination. Gene specific probes containing the 3' untranslated regions of tbe ACC syntbase cDNAs were used for hybridization. B. Expression of DCACS3 in carnation styles following pollination in air or 2,5- norbomadiene (NBD).

4. Post-pollination Signaling

The induction of physiological and biochemical processes at sites distal to the initial site of pollen perception suggests that a translocated signal, which precedes the growing pollen tube, signals a compatible pollination to the ovary and petals. The identity of this pollination signal is unclear, but it has been proposed to be auxin [4] or ACC [18, 26, 27] deposited on the stigma by the pollen or the gaseous phytohormone ethylene itself [1,4,32]. In Phaiaenopsis, it has been proposed that the primary pollination signal, the signal that induces rapid ethylene biosynthesis from the style, is a pollen-borne factor that may be distinct from the translocated pollination signal [2, 17]. A secondary signal is then translocated from the stigma to the ovary and petals coordinating the subsequent post-pollination events. Evidence for the existence of a translocated pollination signal has been provided in a series of experiments in which the removal of petunia styles at time points beyond 6 hours after pollination failed to prevent accelerated corolla senescence [8].

4.1. PRIMARY POLLINATION SIGNALS

198

In the flowers of carnation [16] and petunia [18], increased stylar ethylene is detectable within 1 hour after pollination, before any evidence of pollen tube gennination or penetration of the stigma [13, 16]. This initial burst of ethylene biosynthesis is believed to be in response to a chemical on the surface of the pollen and not associated with the growth of pollen tubes. The application of foreign pollen rrom unrelated species or incompatible petunia pollen elicits the early burst of ethylene production rrom petunia styles, but this ethylene production is not sustained and does not lead to ovary growth or premature corolla senescence [10, 20]. Similarly, compatible pollen that has been killed by heat or radiation induces only transient ethylene production by the style and has no impact on floral longevity [10]. The application of incompatible Dianthus pollen (sp 87-290) to carnation styles also was found to induce only transient ethylene production by the style [13]. This transient ethylene production appears to be induced by a pollen factor rather than a physical contact stimulus, as the application of inert beads to the styles does not induce ethylene production [Woodson, unpublished]. With the identification of pollination responsive ACC synthase genes it will be possible to detennine the nature of the pollen-pistil interaction that results in ethylene biosynthesis by the style.

OCACSI

OCACS2

OCACS3

rRNA

"0 E o u

o I

~cJ

Figure 2. Expression of OCACS I, OCACS2, and OCAC3 in carnation styles from flowers treated with 100 J.lM 2,4-0 or 10 J.lL·L-] ethylene for 24h.

4.1.1. Role of Auxin in Pollination-induced Ethylene Auxin that is deposited on the stigmatic surface by the pollen grain itself has been implicated in the induction of early ethylene production by the style. Auxin has been proposed as a potential pollination signal because the application of auxin to orchid stigmas leads to increased ethylene production and ovary development similar to that occurring in response to pollination, and it is known that orchid pollinia contain auxin [1,34]. In Phalaenopsis, Phal-ACS2 mRNA accumulates in the stigma within 1 hour of pollination. The exogenous application of auxin to the stigma mimics both pollination induced ethylene biosynthesis and up-regulation of Phal-ACS2 [2]. In contrast to the response in orchids, application of auxin to carnation and petunia stigmas has not been shown to result in increased ethylene production or any other post-pollination phenomena [18, 19]. The pollination responsive ACC synthase DCACS3, was found to be up-regulated in the style following uptake of 2,4-0 by the flower (Fig. 2). The ethylene independent regulation of DCACS3 by pollination and its responsiveness to

199

2,4-D suggests that auxins may play a role in the regulation of post-pollination development and signaling in carnation flowers, but there is not enough evidence to determine if auxins are serving as the primary pollination signal.

4.1.2. Role of ACC in Pollination-Induced Ethylene In carnation and petunia flowers, the application of ACC to the stigma results in a transient increase in ethylene that is not sustained and does not induce corolla wilting [10, 19]. This result coupled with the discovery that pollen from different sources contained varying amounts of ACC led to the proposal that diffusion of ACC from the pollen to the stigma could account for the portion of ethylene produced by the style immediately after pollination [26]. Petunia pollen can contain as much as 1500 11mol ACC/g [10, 20], whereas carnation pollen has less than 25 11mOI ACC/g [l3, 26]. Singh et al., [20] reported that the endogenous ACC content of pollen correlated with the amount of ethylene produced by the styles immediately after pollination, and concluded that this early ethylene was due solely to the conversion of pollen-borne ACC to ethylene. In support of this conclusion, it is known that an unpollinated petunia stigma at anthesis already has high levels of ACC oxidase activity and the ability to convert applied ACC to ethylene [18, 24].

0.8 :i' 0.7 ~ 0.6 .... 0.5 ,e 04 ... il 0.3 ~ 0.2 r.;s 0.1

o

Figure 3. Ethylene production by wild-type Mitchell petunia styles (nL I style) following pollination with either wild-type Mitchell petunia pollen or transgenic pollen (AI). Transgenic pollen contains undetectable levels of ACC due to the pollen specific expression of deaminase.

Contrasting data from experiments by Larsen et al., [13] have shown that Starlight carnation pollen contains only 4 11mol ACC/g, insufficient ACC to sustain the 1-2111 of ethylene produced by the style within the fIrst 2 hours after pollination [13]. The application of A VG, an inhibitor of ACC synthase, to petunia and carnation styles has been found to effectively block pollination-induced ethylene production by the style, indicating that this early ethylene is dependent on ACC synthase activity [10, 31]. The rapid induction of ACC synthase activity in the styles of petunia following pollination also provides evidence that ACC synthesized in the style rather than pollen-borne ACC is the precursor of this pollination-induced ethylene [18]. The creation of transgenic

200

lines of Petunia hybrida cv Mitchell with undetectable levels of ACC in the pollen due to the pollen-specific expression of ACC deaminase has provided the opportunity to evaluate the role of pollen-borne ACC in pollination-induced stylar ethylene biosynthesis [14]. The application of transgenic pollen (AI) to wild-type Mitchell petunia stigmas resulted in the same level of stylar ethylene production as pollinations with wild-type pollen containing approximately 1600 nmol ACC/ g pollen (Fig. 3). These pollinations resulted in fertilization and theproduction of viable seed [Data not shown]. Pollination of 'White Sim' carnations with transgenic petunia pollen also resulted in accumulation of the pollination responsive ACC synthase transcript DCACS3 in styles within 2 hr of pollination (Fig. 4). DCACS3 mRNAs were also up-

DCACS3

rRNA

Figure 4. Expression of DCACS3 in carnation styles 2h after the application of pollen. Pollen sources included two types of Dianthus pollen, cv Starlight and sp. 87-29G that represent a compatible and an incompatible pollen source, respectively. Wild-type and low ACC transgenic petunia pollen (AI4) cv Mitchell was also applied.

regulated following the application of wild-type Mitchell petunia pollen and an incompatible Dianthus pollen (sp 87-29G) to White Sim styles. These recent experiments provide evidence for the involvement of a pollen-factor in early pollination-induced ethylene production, but indicate that this elicitor is not ACe.

5. References

1. Arditti,1. (1979) Aspects of the physiology of orchids, Adv. Bot. Res. 7,421-655. 2. Biu, A.Q. and O'Neill, S.D. (1998) Three I-aminocyclopropane-I-carboxylate synthase genes

regulated by primary and secondary pollination signals in orchid flowers, Plant Physiol. 116, 419-428.

3. Borochov, A. and Woodson, W.R. (1989) Physiology and biochemistry of flower petal senescence, Hortie. Rev. 11, 15-43.

4. Burg, S.P. and Dijkman, M.J. (1967) Ethylene and auxin participation in pollen induced fading of Vanda orchids, Plant Physiol. 42,1648-1650.

5. Chappell, J., Hahlbrock, K. and Boller, T. (1984) Rapid induction of ethylene biosynthesis in cultured parsley cells by fungal elicitor and its relationship to the induction of phenylalanine ammonia-lyase, Planta 161,475-480.

6. Felix, G., Grosskopf, D.G., Regenass, M., Basse C.W., and Boller T. (1991) Elicitor-induced ethylene biosynthesis in tomato cells. Characterization and use as a bioassay for elicitor action, Plant Physiol. 97, 19-25.

7. Gilissen, L.1.W. (1976) The role ofthe style as a sense-organ in relation to wilting of the flower, Planta 131,201-202.

8. Gilissen, L.J.W. and Hoekstra, F.A. (1984) Pollination-induced corolla wilting in Petunia hybrida rapid transfer through the style of a wilting-inducing substance, Plant Physiol75, 496-498.

201

9. Halevy, AH., Whitehead, C.S., and Kofranek, AM. (1984) Does pollination induce corolla abscission of cyclamen flowers by promoting ethylene production? Plant Physiol. 75, 1090-1093.

10. Hoekstra, FA and Weges, R (1986) Lack of control by early pistillate ethylene of the accelerated wilting of Petunia hybrida flowers, Plant Physiol. 80,403-408.

II. Jones, M.L. and Woodson, W.R. (1997) Pollination-induced ethylene in carnation. Role of stylar ethylene in corolla senescence, Plant Physiol. 115,205-212.

12. Kende, H (1993) Ethylene biosynthesis, Ann. Rev. Plant Physiol. 44, 283-307. 13. Larsen, P.B., Ashworth, E.N., Jones, M.L., Woodson, W.R. (1995) Pollination-induced ethylene in

carnation. Role of pollen tube growth and sexual compatibility, Plant Physiol. 108, 1405-1412. 14. Lei, C-H., Lindstrom, IT., and Woodson, W.R. (1996) Reduction of I-aminocyclopropane-l­

carboxylic acid (ACC) in pollen by expression of ACC deaminase in transgenic petunias, Supplement to Plant Physiol. 111, 149.

15. Nichols, R (1977) Sites of ethylene production in the pollinated and unpollinated senescing carnation (Dianthus caryophyllus) inflorescence, Planta 135, 155-159.

16. Nichols, R., Bufler, G., Mor, Y., Fujino, D.W., and Reid, M.S. (1983) Changes in ethylene production and l-aminocyclopropane-I-carboxylate content of pollinated carnation flowers, J. Plant Grawth Regul. 2, 1-8.

17. O'Neill, S.D., Nadeau, lA, Zhang, X.S., Bui, AQ., and Halevy, AH. (1993) Interorgan regulation of ethylene biosynthetic genes by pollination, Plant Cell 5,:419-432.

18. Pech, J-C., Latche, A, Larrigaudiere, c., and Reid, M.S. (1987) Control of early ethylene synthesis in pollinated petunia flowers, Plant Physiol. Biochem. 25,431-437.

19. Reid, M.S., Fujino, D.W., Hoffinan, N.E., and Whitehead, C.S. (1984) I-aminocyclopropane-I­carboxylic acid (ACC) The transmitted signal in pollinated flower? J. Plant Growth Regul. 3, 189-196.

20. Singh, A, Evensen, K.B., Kao, T-H. (1992) Ethylene synthesis and floral senescence following compatible and incompatible pollinations in Petunia inflata, Plant Physiol. 99,38-45.

21. Stead, AD. and Moore, K.G. (1979) Studies on flower longevity in Digitalis: pollination induced corolla abscission in Digitalis flowers, Planta 146,409-414.

22. Stead, AD. and Reid, M.S. (1990) The effect of pollination on the colour change of the banner spot of Lupinus albifrons (Bentham) flowers, Ann. Bot. 66, 655-663.

23. Stead, AD. (1992) Pollination-induced flower senescence: a review, Plant Growth Regul. 11, 13-20.

24. Tang, x., Gomes, AM.T.R., Bhatia, A, Woodson, W.R. (1994) Pistil-specific and ethylene -regulated expression of I-aminocyc\oporpane-I-carboxylate oxidase genes in petunia flowers, Plant Cell 6, 1227-1239.

25. Wallner, S., Kassalen, R., Burgood, l, and Craig, R. (1979) Pollination, ethylene production and shattering in geraniums, HortScience 14, 446.

26. Whitehead, C.S., Fujino, D.W., and Reid, M.S. (1983) Identification of the ethylene precursor, 1-aminocyclopropane-I-carboxylic acid (ACC), in pollen, Sci. Hortic. 21,291-297.

27. Whitehead, C.S., Fujino, D.W., and Reid, M.S. (1983) The roles of pollen ACC and pollen tube growth in ethylene production by carnations, Acta Hort. 141, 221-227.

28. Wilkinson, lQ., Lanahan, M.B., Clark, D.G., Bleeke,r AB., Chang, C., Meyerowitz, E.M., Klee, H.J. (1997) A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in heterologous plants, Nature Biotech. 15,444-447.

29. Wirth, M. and Withner, C.L. (1959) Embryology and development in the Orchidaceae, in c.L. Withner (ed.), The Orchids: A SCientific Survey, The Ronald Press Company, New York, pp. 155-188.

30. Woitering, E.1. and Somhorst, D. (1990) Regulation of anthocyanin synthesis in Cymbidium flowers: effects of emasculation and ethylene, J. Exp. Bot. 136,295-299.

31. Woltering, E.1., Van Hout, M., Somhorst, D., and Harren, F. (1993) Roles of pollination and short­chain saturated fatty acids in flower senescence, Plant Growth Regul. 12, 1-10.

32. Woltering, E.1., Somhorst, D., and van der Veer, P. (1995) The role of ethylene in interorgan signaling during flower senescence, Plant Physiol. 109, 1219-1225.

33. Woodson, W.R., Park, K.Y., Drory, A, Larsen, P.B., and Wang, H. (1992) Expression of ethylene biosynthetic pathway transcripts in senescing carnation flowers, Plant Physiol. 99, 526-532.

34. Zhang, X.S. and O'Neill, S.D. (1993) Ovary and gametophyte development are coordinately regulated by auxin and ethylene following pollination, Plant CellS, 403-418.

-mERotEoP SlIORT-CHAIN SATURATED FATTY ACIDS IN INDUCING SENSITIVITY TO ETHYLENE

1. Abstract

A. H. HALEVyl and C. s. WHITEHEAD2 J The Hebrew University of Jerusalem, Dept. of Horticulture P.o.B 12, Rehovot 76100, Israel, 2 Rand Afrikaans University, Dept. of Botany, Johannesburg, South Africa

Ethylene is involved in the regulation of many processes in plants. In order for ethylene to be effective, the tissue must be sensitive to the hormone. In the following, we present data supporting the role of short-chain fatty acids in inducing the sensitivity to ethylene in two processes: the pollination-induced petal senescence and the promotion of flowering in iris.

2. The Role of Short-chain Saturated Fatty Acids in Pollination-induced Sensitivity to Ethylene

In most flowers, pollination induces considerable acceleration of senescence, which may be manifested differently in different flowers [for reviews see 3, 6, 15].

In recent years, we chose Phaiaenopsis flowers as the major model system for our studies on pollination-induced senescence because of their unique properties. The unpollinated intact flowers are long-lasting and may live for up to 3 months, while pollination is rapidly followed by the appearance of visible senescence symptoms, which are detectable within one day. In Phaiaenopsis pollen, germination begins 5 to 6 days, and fertilization more than 40 days, after pollination, whereas senescence symptoms are observed in less than one day. This indicates that the pollination signal(s) are transported in orchids soon after pollination, well before pollen germination and fertilization [13, 19].

Pollination-induced senescence is preceded or accompanied by enhancement of ethylene production by the flower, and application of ethylene to flowers can mimic the effects of pollination. It is generally accepted, therefore, that ethylene production is a major cause for pollination-induced senescence [9]. Our earlier work with cyclamen [5] and petunia [17] showed that the promotive effect of pollination on corolla abscission cannot be caused merely by stimulation of ethylene production. Apart from the promotion of ethylene evolution, pollination also renders the tissue sensitive to ethylene. This means that ethylene is necessary but not sufficient to induce the pollination-promoted senescence syndrome by itself. Therefore, it seems that pollination

203

204

induces at least two signals, one is ethylene and the other is a "sensitivity factor" which renders the tissue sensitive to ethylene.

We have followed the change in ethylene production and sensitivity to ethylene following Phalaenopsis flower pollination [11]. The sensitivity to external ethylene was detennined in flowers placed continuously in aminooxy acetic acid (AOA), an inhibitor of ACC synthase, which eliminated the endogenous ethylene biosynthesis. It was found that increased sensitivity to ethylene could be detected between 2 to 4 hours after pollination, and it peaked 6 hours later, while the increase in ethylene production could be detected only after 12 to 14 hours and it peaks 30 hours after pollination. This indicates that the "sensitivity signal" is the first signal moving into the petals, long before the ethylene biosynthesis signal.

It is clear that the pollination induced sensitivity does not depend on ethylene production, since it occurred also in flowers treated with AOA, which prevents the increase in ethylene synthesis. The identity of the "sensitivity factor" has been sought.

Results with petunia [6, 17] and Phaiaenopsis indicated that ABA and jasmonic acid can not be this factor. Application of these regulators increased sensitivity to ethylene, but their endogenous levels did not increase in the perianth at the time of the increase in sensitivity. Our results also indicate that ethylene and ACC can not be the pollination signal inducing sensitivity to ethylene [6, 12].

Another candidate is auxin. Orchid pollen contains substantial amounts of auxin [1, 15] and application of IAA to the stigma of Phalaenopsis flowers mimicked the effect of pollination on ethylene production and the increase in ACC synthase and Ace oxidase mRNAs [10]. In other flowers, however, applied auxin did not mimic the pollination effect [15].

We have presented supporting evidence that short-chain (C7 to e 10) saturated fatty acids (SCSF A) and especially octanoic acid (Cg) may be the "sensitivity factor" or at least part of the pollination-induced sensitivity signals. Applications of these acids to the stigmas of petunia [17] and carnation [18] flowers mimicked the effect of pollination on sensitivity to ethylene. A substantial increase in the level of these acids was detected in the stylar exudates and the corolIas a few hours after pollination. Following pollination these acids are synthesized in the stylar tissue and transported rapidly to the corollas, where they induced an increase in ethylene sensitivity.

In Phaiaenopsis flowers, application of octanoic acid to the stigmas greatly enhanced the sensitivity to ethylene of AOA treated flowers. A substantial increase in octanoic acid and other SCSF As was found in the gynoecia and perianths of pollinated flowers 6 hours after pollination at the time of the increase in ethylene sensitivity, followed by a sharp decrease at 12 and 24 hours, at the time of the increase in ethylene production [4]. These results support the view that these compounds promote flower senescence by enhancing ethylene sensitivity.

3. The Role of Short-chain Fatty Acids in Promotion of Ethylene-mediated Flower Induction in Iris

Ethylene is known to stimulate flowering in a number of geophytes [7, 8]. Exposure of Dutch iris bulbs to ethylene enhances flowering and increases·the flowering percentage,

205

especially in smaller bulbs, which normally produce only vegetative plants [8]. The flower-inducing effect of ethylene was found to correlate with an ethylene-induced increase in respiration similar to that found in other species [7, 8]. We have examined the possibility that treatment of dormant Dutch iris bulbs with octanoic acid will increase ethylene sensitivity and improve the stimulating effect of ethylene on flowering of bulbs of different sizes, and that these acids may playa role in the natural differences in ethylene sensitivity that exists between bulbs of different sizes [2].

Flowering of precooled iris bulbs (CV. Sapphire Beauty) increased with an increase in bulb size. In small bulbs flowering was limited to 16% compared to 65% in medium bulbs. Treatment with ethylene resulted in the stimulation of flowering in bulbs of all sizes.

Treatment with octanoic acid increased the sensitivity of the bulbs to ethylene. The biggest effect of octanoic acid on ethylene sensitivity was observed in small bulbs where both the rate and final percentage of flowering were markedly stimulated.

In determination of the endogenous content of the SCSF As we have found that octanoic acid is the most abundant of the SCSF As in the range of C7.C IO in bulbs of all sizes, and its endogenous level increases with an increase in bulb size. Since a natural increase in ethylene sensitivity was observed with an increase in bulb size, and since the response of bulbs of different sizes to treatment with ethylene correlated well with the increase in octanoic acid content, it seems that larger bulbs are naturally more sensitive to ethylene than smaller ones due to a higher octanoic acid content.

4. The Mode of Action of Short-chain Fatty Acids in Increasing the Sensitivity to Ethylene

The lipid bilayers of biomembranes provide the fluid environment for membrane protein activity. Therefore, their physical properties are a major factor governing membrane enzyme activities [14]. We examined whether SCSFAs are able to modulate membrane lipid order [4]. Different ratios of octanoic acid to the other lipids had no effect on the polarization value of liposomes and microsomal membranes of Phalaenopsis petals as measured by 1,6-diphenyl-l,3,5-hexatriene (DPH), a fluorescent probe that incorporates itself deep within the lipids' hydrophobic core. However, when we used densyl pyrrolidine (DNSP), which partitions closer to the membrane surface, we found that at low ratios, octanoic acid decreases liposome and microsomal membrane polarization values, whereas at high ratios the values were similar to controls. Thus, octanoic acid seems to affect the order of the lipids just beneath the phospholipid head groups. This is expected, since octanoic acid is a short fatty acid (Cg), and should affect lipid order only in the region near the membrane surface, not deep in the hydrophobic core of the lipid bilayer.

We also examined whether the effects of octanoic acid on lipid order also occur in vivo, following pollination or stigmatic application of octanoic acid. Again, no effect of pollination and octanoic acid on lipid order was found when measured using DPH. However, when using DNSP we found that 10 h after pollination, at peak ethylene sensitivity, there was a significant decrease in the microsomal membrane polarization

206

values in both the column and the perianth. In addition, stigmatic application of octanoic acid mimicked the effect of pollination on the membrane polarization values.

In carnation flowers and banana fruits, exogenous application of octanoic acid resulted in an increase in ethylene binding to the tissue [16,18]. In human tissues, membrane fluidity is known to affect receptor function [14]. We suggest that in a similar fashion SCSF As affect ethylene sensitivity by increasing the membrane fluidity in specific regions of the lipid bilayer, thereby increasing ethylene binding to its membrane associated receptors.

5. Acknowledgement

We would like to acknowledge with great appreciatIOn the excellent work of our colleagues and graduate students who participated in these studies: Ron Porat, Amihud Borochov, Hana Spiegelstein (Rehovot, Israel), Louise Botha (Johannesburg, South Africa) and Sharman O'Neill (Davis, CA, USA).

6. References

1. Arditti, 1. (1979) Aspects of orchid physiology. in H. Woolhousc (ed.). Advances In Botanical Research, Academic Press, London, pp. 421-655.

2. Botha, M.L., Whitehead, C.S. and Halevy, All (1998) Effect of octanoic acid on ethylene-mediated flower induction in Dutch iris, Plant Growth Regul. 25. 47-5\.

3. Halevy, AI·I. and Mayak, S. (1981) Senescence and postharvest physiology of cut flowers, part II, Hort. Rev. 3,59-143.

4. Halevy A.H., Porat, R., Spiegelstein. H., Boroehov, A .. Botha, L. and Whitehead. C.S. (1996) Short­chain saturated fatty acids in the regulation of pollination-induced ethylene sensitivity of Phalaenopsis flowers, Physiol. Plant. 97,469-474

5. Halevy AH .. , Whitehead, C.S. and Kofranek, AM. (1984) Does pollination induce corolla abscission of cyclamen flowers by promoting ethylene productionry Plant Physiol. 75. 1090-1093.

6. Halevy, A.H. and Whitehead, C.S. (1989) Pollination induced corolla abscission and senescence and the role of short-chain saturated fatty acids in the process, in D.J. Osborne and M.B. Jackson (eds.). Cell Separation in Plants, NATO ASI Series, Springer-Verlag, Berlin, 35, 221-331.

7. Han, SS., Halevy, A.B., Sachs. R.M. and Reid, M.S. (1990) Enhancement of growth and flowering of Trileleie laxa by ethylene,.J. Am. Soc. Hortic. SCI. 115,482-486.

8. Imanishi, H. and Yue. D. (1986) Respiration and carbohydrate changes during ethylene-mediated flowers induction in Dutch iris, Sci. Hortic. 59. 275-284.

9. Larsen, P.B., Woltering, E.J. and Woodson, W.R. (1993) Ethylene and intcrorgan signaling in flowers following pollination, in J. Schultz and I. Raskin, (cds). Plant Signals In InteractIOns With Other Organisms, Current Topics in Planl Physiology. Am. Soc. Plant Physiol. Rockville, MD, II. 171-181.

10. O'Neill, SD, Nadeau, J.A, Zhang, Z.S., Bui. AQ. and Ilalevy, A.H. (1993) Interorgan regulation of ethylene hiosynthesis genes by pollination. Plant CellS, 419-432.

II. Porat R., t\. Borochov, AH. Halevy and S\). O'NeilL (1994) Pollination induced senescence in Phalaenopsis petals. The wilting process, ethylene production and sensitivity to ethylene. Planl Growth Regul. 15, 129-136.

12. Porat, R., Reiss, N., Atzron R .. Halevy. All. and Horochov. A. (1995) Examination of the possible involvement of lipoxygenase and jasmonates in pollination induced senescence of Phalaenop.Hs and Dendronium orchid flowers. Physiol. Plant. 94. 205-210.

13. Porat, R. Nadeau, lA., Kirby, J.A., Sutter, E.G. and O'Neill Sf) (1998) Characterization of the primary pollen signal in the postpollination syndrome of Phalaenop.m flowers, Planl Groll'th Regilt. 24, 109-117.

207

14. Shinizky, M. (1984) Membrane fluidity and cellular functions. in. M. Shinitzky (ed.). Physiology of J'vfembrane f1uidity, CRC Press, Boca Raton, pp. I-51.

15. Stead, A.D. (1992) Pollination induced flower senescence: a review, Plant Growth Regul. 11,13-20. 16. Whitehead C.S. and Bosse, c.A. (1991) The effect of ethylene and short-chain saturated fatty acids

on ethylene sensitivity and binding in ripening bananas, J. Plant Physiol. 137,358-362. 17. Whitehead S.c. and Halevy, A.H. (1989). Ethylene sensitivity: the role of short-chain saturated fatty

acids in pollination induced senescence of Petunia hyhrida, Plant Growth Regul. 8, 41-54. 18. Whitehead, S.c. and Vaseljevic, D. (1993) Role of short-chain saturated fatty acids in control of

ethylene sensitivity in senescing carnation flowers, Physiol. Plant. 88, 250-342. 19. Zhang, X.S. and O'Neill, SD. (1993) Ovary and gametophytc are coordinately regulated by auxin and

ethylene following pollination, Plant CeliS, 403-418.

APOPTOTIC CELL DEATH IN PLANTS: THE ROLE OF ETHYLENE

I. Abstract

E. J. WOL TERING, A. J. DE JONG AND E. T. Y AKIMOVA Agrotechnological Research Institute (ATO-DLO), PO Box 17, 6700 AA Wageningen, The Netherlands

Programmed cell death (PCD) applies to cell death that is a normal part of the life of a multicellular organism; it results in controlled disassembly of the cell. In animal systems, PCD is synonymous with apoptosis, a cell death process characterized by a distinct set of morphological and biochemical features and breakdown of DNA at internucleosomal sites resulting in a DNA-ladder pattern on agarose gels. These typical changes are thought to be mediated by a class of specific cysteine proteases called caspases. Although numerous processes in plants conform to the general definition of PCD there is no a priori reason that a relationship exists with the caspase-mediated cell death process in animal cells that is commonly called PCD or apoptosis. Treatment of tomato suspension cells with chemicals known to induce apoptosis in animal systems induced cell death. This chemical-induced cell death was accompanied by development of morphological features typical for animal apoptosis and DNA laddering indicating that apoptotic cell death was induced. Treatment of the cells with ethylene or l-aminocyclopropane-I-carboxylic acid (ACC) greatly stimulated, while inhibitors of ethylene biosynthesis or action effectively blocked chemical-induced cell death. These results indicate that ethylene is a mediater of apoptotic cell death in plants.

2. Programmed Cell Death and Apoptosis

According to the general definition of programmed cell death (PCD), it applies to cell death that is a normal part of the life of a multicellular organism, PCD is found throughout the animal and plant kingdoms. PCD is an active process in which a cell suicide pathway is activated resulting in controlled disassembly of the cell. Besides cell death as a result of normal development, cell death resulting from environmental stress (e.g. infection by pathogenic organisms, wounding and low concentrations of toxins) often occurs through controlled disassembly of the cell and can therefore also be termed PCD. In contrast, when cell death is caused by severe injury such as heating, freezing or high concentrations of toxic chemicals, it is characterized by cellular swelling and lysis and called necrosis. Numerous examples of cell death in plant development have been described that conform to the general definition of PCD. Some examples of cell death

209

210

events in maize that occur at a specific developmental stage were described by Buchner et al. [2]; among these are:

Roots Death of root cap cells Aerenchyma formation following hypoxia

Reproductive organs Floral organ abortion during male and female flower formation Megaspore abortion Tapetal layer degeneration

Shoots Tracheary element differentiation Senescence of leaves and other plant parts

Seeds Degeneration of suspensor and endosperm Degeneration of aleurone layer during germination

In addition, localized cell death has been described following pathogen assault (Hypersensitive Response, HR) and treatment with low concentrations of ozone. Although all these examples of cell death conform to the general definition of PCD, this does not necessarily mean that cell death occurs in all cases through the same mechanism.

3. Apoptosis in Animal Cells

In animal cell types, different forms of PCD have been described based on morphological characteristics of dying cells [3]. In many cases, however, PCD takes the form of apoptosis and, in animal biology, PCD has become synonymous with apoptosis. Apoptosis is derived from a Greek word describing the process of leaves falling from trees or petals falling from flowers. Apoptosis is characterized by a distinct set of morphological and biochemical features such as cell shrinkage, blebbing of the plasma membrane, condensation and fragmentation of the nucleus and cleavage of ON A at internucleosomal sites. The final feature of apoptosis is the fragmentation of the cell into plasma membrane bound "apototic bodies" that are being phagocytosed by other cells [22, 23]. Although other forms of animal PCD have been described that do not conform to the apoptosis features listed above, it is not clear yet whether the different peD morphologies reflect differences in the underlying molecular mechanism. Some of the controlling factors in animal apoptosis have recently been identified. Apoptosis, either induced by developmental factors or by external stimuli, is often associated with a class of highly speci fie proteases that are now called caspases (cystenyl aspartate-specific proteases). Caspases are synthesized as inactive pro-enzymes containing an N-terminal peptide (prodomain) and a large and small subunit and require aspartic acid at the cleavage site resembling their own targets. The active caspase is a hetero tetramer containing two small and two large subunits. Therefore, autoprocessing and trans-activation among

211

caspases appears possible and suggests that caspases act in a cascade of proteolytic events. All caspases contain a conserved active site motif (QACxG, where x = R, Q or G). Caspases are thought to be responsible for cleavage of critical substrates including Poly (ADP-ribose) polymerase, lamins and apoptosis inhibitors like BcI-2 or lAP's (discussed below) together resulting in breakdown of the nuclear matrix and DNA yielding the apoptotic morphology. Caspases are among the most specific of proteases and highly efficient. This is consistent with the observation that apoptosis is not accompanied by indiscriminate protein digestion rather, only a select set of proteins is cleaved, resulting in loss or change of function [5, 17].

In animal systems, numerous other mediators of apoptosis have been identified. Most prominently, a family of proteins related to BcI-2 have been implied in mediation among others the activity of certain caspases. Bcl-2 family members may be pro- or anti-apoptotic. Bcl-2 related proteins show homology in 1 to 4 regions designated Bcl-2 homology (BH) domains. A feature of this family is the ability of its members to interact with each other to form hetero or homo dimers that show structural homology to channel forming proteins. BcI-2 proteins are predominantly located in the mitochondrial, ER, and outer nuclear envelope membranes and may in association with other proteins of this family (e.g. Bcl-XL' Bad, Bax) induce or suppress the release of e.g. mitochondrial factors. Regulation of transport of small molecules (e.g. cytochrome C and caspase-like proteases) across the mitochondrial membranes may be one mechanism by which members of this family could regulate cell death [13]. Another group of endogenous proteins are the lAP's (inhibitors of apoptosis) that presumably inhibit apoptosis through inhibition of caspase activity. lAP genes were first isolated from baculoviruses and later also mammalian counterparts were discovered [4]. lAP proteins generally contain a RING-finger motive at their C-terminal thought to be involved in protein-protein interactions and 2 or 3 imperfect amino acid repeats of approximately 65 residues in length at their N-terminus (Called B1R domains).

Another protein involved in apoptosis is DAD-l (Defender against Apoptotic cell Death). The dad-l gene was originally isolated during complementation studies in a temperature-sensitive mutant hamster cell line that undergoes PCD when incubated at non-permissive temperatures. The mutant DADI protein, which contains a single amino acid substitution, rapidly degrades upon shift to this restrictive temperature. This degradation proceeds the onset of PCD, suggesting that it may be the event that triggers PCD [16]. Subsequent cloning of the DADI gene from humans, Xenopus leavis, mouse, Caenorhabditis elegans, rice, Arabidopsis thaliana and pea demonstrated a substantial evolutionary conservation.

A protein sequence comparison revealed that human DAD-l is 40% identical to the Saccharomyces cerevisiae OST-2 protein. OST-2 was cloned as a subunit of the yeast enzyme oligosaccharyltransferase (OST). OST catalyzes the transfer of preassembled high mannose oligosaccharides to glycosylation sites of newly synthesized proteins in the lumen of the rough endoplasmic reticulum. Temperature-sensitive OST2 yeast mutants are defective in N-linked glycosylation of proteins in vivo and in glycosylation of synthetic peptide substrates in vitro. The assumption that DAD-l represents a possible fourth subunit of the mammalian OST was confirmed when DAD-l was shown to copuriry with the other three OST subunits and could be chemically cross-linked to them [12]. Furthermore, the yeast two-hybrid assay was used to reveal interaction

212

between DAD-I and the OST48 subunit [9], while DAD-I was shown to be an essential component of the OST complex and is therefore required for oligosaccharyltransferase activity [20]. The exact role of DAD-I in inhibiting PCD, however, is still not clear. Whether apoptosis occurs in a specific cell or tissue may depend on a delicate balance between pro- and anti-apoptotic factors.

4. Apoptotic cell death in plants

A variety of processes that occur during plant development conform to the general definition of PCD, i.e. cells at a specific location or with a specific function die at a specific moment in time [2, 10]. This, however does not mean that there is any relationship to the caspase-mediated process of cell death in animal cells that is commonly called PCD or apoptosis. To establish whether a particular process represents true apoptosis it is necessary to determine the involvement of specific proteases and to study the morphological features of the dying cells. In a recent review on PCD during plant growth and development, Beers [1] concludes that in some processes, e.g. mycotoxin-induced cell death in protoplasts and during plant pathogen­induced cell death, true apoptosis may occur but that in general nonapoptotic PCD pathways are essential to normal plant growth and development.

The observations that at least in some plant cell death processes (e.g. the hypersensitive response) a striking similarity to animal apoptotic phenotype exists (e.g. nuclear condensation and formation ofapoptotic bodies) indicate that a pathway similar to animal apoptosis may exist in plant cells [IS, 21].

Except for DAD-I, no plant homologs to the key players in animal apoptosis (e.g. caspases, BcI-2 family proteins) have been described. However, there are sound indications that a pathway similar to caspase mediated apoptosis exists in plant cells:

Chemical-induced cell death in tomato cell suspensions is accompanied by characteristic features of apoptosis. Specific caspase inhibitors were shown to be potent inhibitors of cell death in this system [6]. Bacteria-induced cell death during the HR in tobacco can be blocked by caspase inhibitors, and caspase-like proteolytic activity has been detected following infection with tobacco mosaic virus [7]. Transgenic tobacco plants expressing the baculovirus p35 gene, which presumably codes for an animal caspase inhibitor, showed a delayed HR-cell death after challenge with virus or bacteria [7]. Use of anti BcI-2 antibodies have suggested that BcI-2 like proteins are present in plant cells and localize to mitochondria, plastids and nuclei [8].

To increase our understanding of the plant PCD pathway, we studied chemical­induced cell death in suspension-cultured tomato cells. The cells were treated with chemicals known to induce apoptosis in animal cells. Several observations indicated that these cells undergo apoptosis in a way comparable to animal cells [6].

Like in animal systems, treatment of the cells with !J.M concentrations of e.g. camptothecin (topo-isomerase I inhibitor), staurosporine (protein kinase inhibitor)

213

or fumonisin-B I (fusarium toxin) reproducibly induced cell death (25 to 40% in 24h). In samples stained with the DNA-specific dye, Hoechst 33258, we observed characteristic changes in nuclear morphology such as chromatin condensation, and in some cases fragmentation of the nucleus into distinct DNA-containing (apoptotic) bodies. Gel electroforesis of DNA from treated samples showed a DNA laddering pattern typical for apoptotic cells. Addition of nM concentrations of specific caspase inhibitors suppressed chemical­induced cell death.

Together these are sound indications that plant cells may be stimulated to undergo a cell death process that is similar or at least comparable to animal apoptosis. The results indicate that caspase-like proteases may be involved. This system was used to study the possible involvement of ethylene in plant apoptosis.

5. The Role of Ethylene in Plant Apoptosis

If we consider senescence of flower parts such as leaves, flowers or fruits being a form of PCD than it is obvious that ethylene plays a role. In many species, ethylene is one of the endogenous signals that mediate senescence processes. If the question is asked if ethylene is involved in plant apoptosis only few examples can be found in the literature.

Cell death induced by plant pathogens has been shown to yield a number of characteristic symptoms of apoptosis and recently the role of ethylene in pathogen­induced cell death has been evaluated in ethylene insensitive NR-tomatoes. Following infection of these mutants, greatly reduced disease symptoms were observed, indicating ethylene involvement in (apoptotic) cell death [14]. Also in a number of other systems where cell death is accompanied by typical apoptotic features, ethylene was associated with increased cell death.

Cell death during aerenchima formation shows features of apoptosis and was found to be dependent on ethylene [11]. Cell death during maize endosperm development is accompanied by occurrence of DNA ladders and was associated with increases in ethylene production. Apoptosis could be hastened by treatment with ethylene and blocked by ethylene inhibitors [24]. Flower petal and ovary senescence in pea is accompanied by appearance of TUNEL positive nuclei and DNA laddering. Inhibitors of ethylene action delayed senescence processes and blocked DNA degradation. Furthermore, ethylene treatment induced senescence, DNA breakdown and down regulation of dad-I gene expression in petals, that could be blocked by ethylene inhibitors [18, 19].

As described above, the tomato suspension culture represents a system where apoptotic, possibly caspase-mediated, cell death can be induced by chemicals such as camptothecin, staurosporine or fumonisin B I. We used camptothecin treated cells to study the possible involvement of ethylene. Camptothecin at concentrations that

214

induced cell death did not stimulate ethylene production (Table 1). This was not due to the inability of the cells to produce ethylene because treatment with e.g. xylanase did induce elevated amounts of ethylene. This indicates that the cell death-inducing activity of camptothecin is not related to increased ethylene biosynthesis.

TABLE I. Effect ofxylanase and camptothecin on ethylene production of suspension cultured tomato cells.

Treatment Time (h) Ethylene production (nLig FW/h)

control 0 0.18 4 0.14 8 0.13 12 0.14

Xylanase (10 iJ.g/ml) 4 0.51 8 1.03 12 1.23

Camptothecin (5 J.!M) 4 0.12 8 0.10 12 0.10

TABLE 2. Effect of ethylene, ACC and inhibitors of ethylene biosynthesis and action on camptothecin-induced cell death in suspension cultured tomato cells.

Treatment Concentration Cell death (% after 24h}

Control 5 Camptothecin 5iJ.M 26 Ethylene 10 iJ.LlL (liquid phase) 5 ACC 10 J.!M 4 AVO 10iJ.M 4 STS 20iJ.M 5 Camptothecin + Ethylene 5 iJ.M + 10 iJ.LlL 53 Camptothecin + ACC 5iJ.M+IOiJ.M 61 Camptothecin + AVO 5 iJ.M+ 10iJ.M 8 Camptothecin +A VO + Ethylene 5 J.!M + 10 J.!M + 10 iJ.LlL 57 Camptothecin + STS 5 J.!M +20 iJ.M 7 Camptothecin + STS + Ethylene 5 iJ.M + 20 iJ.M + 10 iJ.LlL 8

Treatment of the cells with relatively high concentrations of ethylene did not have any effect on short term viability of the cells (Table 2). Concentrations up to 100 ppm in the headspace, giving about 10 ppm in the liquid phase, were applied during 24 h. In response to this treatment, a significant increase in ACC oxidase activity was measured within 5h of treatment, indicating that the cells were responsive to the gas (data not shown). Also addition of ACC to the nutrient medium, despite its stimulating effect on ethylene production, did not induce cell death. This shows that ethylene is not a primary trigger of cell death in these cells

When ethylene or ACC were applied to camptothecin-treated cells, a significant increase in cell death was observed as compared to camptothecin treatment alone (Table 2). Experiments with inhibitors of ethylene production (aminoethoxy vinylglycine

215

[AVG]) or ethylene action (silver thiosulphate [STS]) revealed that ethylene, even the low basal level (Table 1), apparently is a crucial factor mediating camptothecin-induced cell death (Table 2).

Presently it is not clear how ethylene interacts with camptothecin-induced cell death. It seems that exposure to ethylene sensitizes the cells to camptothecin. The established system will further be exploited to elucidate the role of ethylene in apoptosis and to isolate genes associated with chemical-induced apoptosis.

6. Acknowledgement

This work was financially supported by c-DLO and EU-FAIR CT 95-0225. Elena Yakimova was supported by a grant from the International Agricultural Centre, Wageningen, The Netherlands.

7. References

I. Beers, E.P. (1997) Programmed cell death during plant growth and development, Cell Death and Difforentiation 4, 649-661.

2. Buckner, B., Janick-Buckner, D., Gray, J. and Johal, G.S. (1998) Cell-death mechanisms in maize, Trends Plant Science 3, 218-223.

3. Clarke, P.G.H. (1990) Developmental cell death: morphological diversity and multiple mechanisms, Anat. Embryol. 181, 195-213.

4. Clem, RJ. and Duckett, C.S. (1997) The iap genes: unique arbitrators of cell death, Trends in Cell Bioi. 7,337-339.

5. Cohen, G.M. (1997) Caspases: the executioners ofapoptosis, Biochem. J. 326, 1-16. 6. De Jong, AJ., Yakimova, E.T., Hoeberichts, F.A, Maximova, E. and Woltering, EJ., Caspase-like

proteases are involved in apoptotic cell death in plants, submitted. 7. Del Pozo, O. and Lam, E. (1998) Caspases and programmed cell death in the hypersensitive

response of plants to pathogens, Curro Bioi. 8,1129-1132. 8. Dion, M., Chamberland, H., St-Michel, C., Plante, M., Darveau, A, Lafontaine, lG., and Brisson,

L.F. (1997) Detection of a homologue ofbcl-2 in plant cells, Biochem. Cell. Bioi. 75,457-461. 9. Fu, J., Ren, M. and Kreibig, G. (1997) Interactions among subunits of the oligosaccharyl

transferase complex, J. Bioi. Chem. 47,29687-29692. 10. Greenberg, J.T. (1996) Programmed cell death: A way oflife for plants, Proc. Natl. Acad. Sci. USA

93, 12094-12097. II. He, C-J., Morgan, P.W. and Drew M.C. (1996) Transduction of an ethylene signal is required for

cell death and lysis in the root cortex of maize during aerenchima formation induced by hypoxia, Plant Physiol. 112,463-472.

12. Kelleher, OJ. and Gilmore, R. (1997) DAD I , the defender against apoptotic cell death, is a subunit of the mammalian oligosaccharyltransferase, Proc. Natl. Acad. Sci. USA 94,4994-4999.

13. Kumar, S. (1997) The Bcl-2 family of proteins and activation of the ICE-CED-3 family of proteases: A balancing act in apoptosis, Cell Death and Differentiation 4, 2-3.

14. Lund, S.T., Stall, R.E. and Klee, HJ. (1998) Ethylene regulates the susceptible respons to pathogen infection in tomato, Plant Cell to, 371-382.

15. Morel, lB. and Dangl, lL. (1997) The hypersensitive response and the induction of cell death in plants, Cell Death and Differentiation 4, 671-683.

16. Nakashima, T., Sekiguchi, T., Kuraoka, A, Fukushima, K., Shibata, Y., Komiyama, S. and Nishimoto, T. (1993) Molecular cloning of a human cDNA encoding a novel protein, DADI, whose defect causes apoptotic cell death in hamster BHK21 cells, Mol. Cell. BioI. 13,6367-6374.

17. Nicholson, D.W. and Thornberry, N.A. (1997) Caspases: killer proteases, Trends Biochem. Sci. 22, 299-306.

216

18. Orzaez, D. and Granell, A. (1997) The plant homologue of the defender against apoptotic death gene is down-regulated during senescence of flower petals, FEBS Leu. 404, 275-278.

19. Omiez, D. and Granell, A. (1997) DNA fragmentation is regulated by ethylene during carpel senescence in Pisum sativum, PlantJ. 11,137-144.

20. Sanjay, A., Fu, J. and Kreibich, G. (1998) DADI is required for the function and the structural integrity of the oligosaccharyl transferase complex, J. Bioi. Chem. 40, 26094-26099.

21. Wang, 1., Li, J., Bostock, R.M. and Gilchrist, D.G. (1996) Apoptosis: A functional paradigm for programmed cell death induced by a host-selective phytotoxin and invoked during development, Plant CellS, 375-391.

22. Wyllie, A.H. (1987) Apoptosis: cell death in tissue regulation, J. Pathol. 153,313. 23. Wyllie, 1995 The genetic regulation of apoptosis, Curro Opinion in Genet. Development 5,97-104 24. Young, T.E., Gallie, D.R. and DeMason, D.A. (1997) Ethylene mediated programmed cell death

during maize endosperm development of wild type and shrunken2 genotypes. Plant Physiol. 115, 737-751.

CLONING OF TOMATO DADI AND STUDY OF ITS EXPRESSION DURING PROGRAMMED CELL DEATH AND FRUIT RIPENING

1. Abstract

F.A. HOEBERICHTS\ L.H.W. VAN DER PLAS2, and EJ. WOLTERlNG 1

IAgrotechnological Research Institute A TO-DLO, P.o. Box 17, 6700 AA Wageningen, The Netherlands; 2Wageningen Agricultural University, Laboratory of Plant PhYSiology; Arboretumlaan 4, 6703 BD Wageningen, The Netherlands

The dad! gene product is involved in suppression of programmed cell death during Caenorhabditis elegans embryogenesis. Homologues have been cloned from several animal and plant species. We isolated a dad! cDNA clone from tomato and found that the predicted gene product shows significant homology with various DAD I proteins. Northern analysis showed that, during camptothecin-induced programmed cell death in tomato suspension cells, dad! mRNA levels did not show the expected decrease. During tomato fruit ripening, expression levels in pericarp tissue incrp<lsed or decreased, depending on the tomato variety.

2. Introduction

Programmed cell death (PCD) is a process aimed at eliminating harmful or unnecessary cells during growth and development of multicellular organisms. In animals, a number of gene products have been reported to be involved in regulating the cell death process. Many of these genes are highly conserved among invertebrates and vertebrates [I].

As is the case in animals, PCD is indispensable for normal growth and survival of plants. It plays an essential role in for example xylogenesis, the hypersensitive response, and embryogenesis [2]. Although various reports show that some characteristics of PCD (e.g. the occurrence of genomic DNA fragmentation) are shared between animals and plants [3-6], the only gene involved in animal PCD of which a homologue was identified in plants so far is dad! (defender against apoptotic cell death). This gene was originally isolated from a temperature-sensitive mutant hamster cell line that undergoes PCD when incubated at non-permissive temperature [7]. Subsequent cloning of dad! from other species demonstrated a substantial evolutionary conservation [8-12]. Moreover, both the Arabidopsis and the C. elegans dad! gene product can efficiently rescue the mutant hamster cells from apoptosis [9, II]. A role for C. elegans DADI as a peD suppressor was suggested mainly by studies of transgenic nematodes

217

218

overexpressing dad]. Expression of either human or C. elegans dad] is sufficient to suppress developmentally PCD in C. elegans embryos [9]. Surprisingly, a protein sequence comparison revealed that human DADI is 40% identical to the Saccharomyces cerevisiae OST2 protein. OST2 was cloned as a subunit of the yeast enzyme oligosaccharyltransferase (OST), which is involved in N-Iinked glycosylation of nascent polypeptides [13]. The assumption that DAD! represents an essential fourth subunit of the mammalian OST was confirmed recently [14]. In plants, expression of dad] was studied during senescence of pea petals. Upon flower anthesis, dad] expression decreases dramatically in senescing petals. Petals of flowers where senescence was delayed using ethylene-action inhibitors maintain high levels of dad] mRNA transcripts [12].

To investigate its possible role in PCD, a dad] cDNA clone was isolated from tomato. We studied its expression patterns in suspension-cultured tomato cells undergoing PCD and in ripening tomato fruits.

3. Results

The Le-dad] cDNA was cloned from tomato (Lycopersicon esculentum cv. Prisca) using degenerate primers and RACE reactions. Comparison of the deduced amino acid sequence with various other DADI proteins shows that DADI is highly conserved throughout both the animal and plant kingdoms (Table I).

TABLE 1: Degree of identity and similarity of various DAD proteins, calculated using ClustalW software. The sequences used in this comparison are from: Lycopersicon esculentum (Le); Arabidopsis thaliana (At, X95585); Pisum sativum (Ps, U79562); Caenorhabditis elegans (Ce, X89080) Homo sapiens (Hs, D15057); and Saccharomyces cerevisiae (Sc, U32307).

In our laboratory, we are using camptothecin-treated cell suspensions as a model system for studying PCD in plants. Camptothecin, a chemical known to induce PCD in mammalian cells, induces cell death when added to suspension cultured tomato cells. This cell death is accompanied by typical PCD-related nuclear morphological changes. Treatment with camptothecin also induces fragmentation of nuclear DNA [15]. Genomic DNA isolated from cells treated with camptothecin shows a ladder of DNA fragments that differ in size by just under 200 basepairs. This indicates that the DNA is specifically cut at internucleosomal sites, a PCD hallmark (Fig. 1). These data indicate that camptothecin induces PCD in suspension cultured tomato cells.

~~ bp

219

Figure 1. Degradation of genomic DNA into nucleosomal fragments of distinct sizes (DNA laddering). Cells were treated with 10 J.lM of camptothecin for 48 hrs. Samples were taken after 24 (ca 24h) and 48 (ca 48h) hours. Control samples (non­treated) cells were taken at the same time points (co 24h, co 48h). According to fluorescein diacetate viability staining, 69% of the cells had died after 24 hours, 77% after 48 hours, while control cells contained about 6% dead cells. 5 J.lg of genomic DNA was loaded on a 1.5% agarose gel, blotted, and hybridised with Sau3A digested randomly labelled total genomic DNA.

Expression of the Le-dadl gene in amptothecin-treated tomato suspension cells was investigated by northern analysis. Le-dadl expression hardly changes during peD, and after 48 hours transcript levels do not structurally differ from those in control cells (Fig. 2).

Focusing on postharvest characteristics of tomato fruits, northern analysis of Le­dadl mRNA levels during tomato fruit ripening was carried out. In wildtype tomato fruit, dadl expression did not show a consistent pattern during ripening. Depending on the tomato variety, transcript levels increased or decreased (Fig. 3).

t=O

4. Discussion

Figure 2. Expression of Le-dadl during camptothecin­induced PCD. After camptothecin was added to suspension-cultured tomato cells (t=0), samples were taken at 24 and 48 hours (ca 24h; ca 48h). Samples from non-treated control cells were taken at the same time (co 24h; co 48h). Per lane, 14 J.lg of RNA were separated on agarose gel, transferred to a nylon mem­brane, and hybridised with a probe, consisting of the complete Le-dad1 coding region.

DADI is a protein that is believed to be a conserved peD suppressor [9]. Here, we show that the identified tomato DADI is highly homologous to other DADI proteins. Using camptothecin-treated tomato suspension cells, we studied dadl mRNA levels during peD. It was demonstrated that addition of camptothecin induces the appearance of typical peD hallmarks, such as internucleosomal DNA degradation, within 24 hours. Unexpectedly, no correlation between proceeding peD and decreasing levels of dadl mRNA could be found. Recently, it was shown that DADI is an OST subunit, which suggests DADI may influence peD only indirectly [13, 14]. Our results advocate this assumption, rather than supporting DAD1's role as a direct negative peD regulator. Furthermore, Le-dadl expression does not show a consistent pattern during tomato fruit ripening, implying that DADI does not have a regulatory role during the ripening process.

220

MG BR OR RR MG BR OR RR

prisco flom

Figure 3. Expression of Le-dadl in pericarp tissue during tomato fruit rip­ening. Fruits were harvested from two different varieties (Prisca and Flora) at four different time points; mature green (MG), breaker (BR), omnge (OR), and red ripe (RR). Per lane, 121lg of RNA were loaded on gel.

5. Acknowledgements

This work was supported by the E.U. (FAIR CT95-0225).

6. References

1. Vaux, D.L., and Korsmeyer, S.1., (1999) Cell death in development, Cell 96, 245-254. 2. Pennel, RI. and Lamb, C., (1997) Programmed cell death in plants, Plant Cell 9, 1157-1168. 3. Ryerson, D.E. and Heath, M.e., (1996) Cleavage of nuclear DNA into oligonucleosomal fragments

during cell death induced by fungal infection or by abiotic treatments, Plant Cell 8, 393-402. 4. Wang, M., Oppedijk, B., Lu, X., Van Duijn, B. and Schilperoort, R.A., (1996) Apoptosis in barley

aleurone during germination and its inhibition by abscisic acid, Plant Mol BioI 32, 1125-1134. 5. Orzaez, D. and Granell, A., (1997) DNA fragmentation is regulated by ethylene during carpel

senescence in Pisum sativum, Plant Journal 11, 137-144. 6. Yen, C.R. and Yang, C.R., (1998) Evidence for programmed cell death during leaf senescence in

plants, Plant Cell Physiol39, 922-927. 7. Nakashima, T., Sekiguchi, T., Kuraoka, A., Fukushima, K, Shibata, Y., Komiyama, S. and

Nishimoto, T., (1993) Molecular cloning of a human cDNA encoding a novel protein, DADI, whose defect causes apoptotic cell death in hamster BHK21 cells, Mol Cell 8iol13, 6367-6374.

8. Apte, S.S., Mattei, M.G., Seldin, M.F. and Olsen, B.R, (1995) The highly conserved defender against the death (DADI) gene maps to human chromosome 14q11-q12 and mouse chromosome 14 and has plant and nematode homologs, FEBS Letters 363,304-306.

9. Sugimoto, A., Hozak, RR, Nakashima, T., Nishimoto, T. and Rothman, J.H., (1995) DAD-I, an endogenous programmed cell death suppressor in Caenorhabditis elegans and vertebrates, EMBO J. 14, 4434-4441.

10. Tanaka, Y., Makishima, T., Sasabe, M., ichinose, Y., Shiraishi, T., Nishimoto, T. and Yamada, T. (1997) Dad-I, a putative programmed cell death suppressor gene in rice, Plant Cell Physiol 38, 379-383.

II. Gallois, P., Makishima, T., Hechtt, V., Despres, B., Laudie, M., Nishimoto, T. and Cooke, R .. , (1997) An Arabidopsis thaliana cDNA complementing a hamster apoptosis suppressor mutant, PlantJ. 11, 1325-1331.

12. Orzacz, D. and Granell, A., (1997) The plant homologue of the defender against apoptotic death gene is down-regulated during senescence of flower petals, FEBS Letters 404, 275-278.

13. Silberstein, S., Collins, P.G., Kelleher, D.1., and Gilmore, R., (1995) The essential OST2 gene encodes the 16-kD subunit of the yeast oligosaccharyltransferase, a highly conserved protein expressed in diverse eucaryotic organisms, J Cell BioI 131, 371-383.

14. Kelleher, D.J. and Gilmore, R., (1997) DADI, The defender against apoptotic cell death, is a subunit of the mammalian oligosaccharyltransferase, Proc Natl Acad Sci USA 94,4994-4999.

IS. De Jong, A.J., Yakimova, E.T., Hoeberichts, F.A., Maximova, E., and Woltering, E.1., Caspase­like proteases are involved in apoptotic cell death in plants, submitted

RNASE ACTIVITY IS POST-TRANSLATIONALLY CONTROLLED DURING THE DARK-INDUCED SENESCENCE PROGRAM

I. Abstract

D. R. GALLIE AND S.-c. CHANG Department of Biochemistry, University of California, Riverside, CA 92507-0129, USA

The activities of RNases and nucleases in wheat leaves are subject to control by stresses such as heat shock and prolonged darkness. Examination of one 27 kDa RNase revealed that heat shock resulted in a reduction of its activity without altering the level of the protein, suggesting post-translational control. During dark-induced senescence, all RNase and nuclease activities increase and the increase in 27 kDa RNase activity is controlled by ethylene. Examination of the 27 kDa RNase revealed that the increase in its activity was not accompanied by an increase in the level of the protein. Two­dimensional RNase activity gels and western analysis demonstrated that the 27 kDa RNase exists as multiple isoforms and that the activity of all isoforms increases during dark-induced senescence. These observations demonstrate that the increase in 27 kDa RNase activity is controlled post-translationally but is not achieved through changes in its isoelectric state.

2. Introduction

The regulation and cellular role of RNases in plants is still poorly understood. For instance, the RNase(s) involved in mRNA turnover have yet to be identified in plants or, indeed, in any higher eukaryote. However, RNase activities have been identified and, in some respects, characterized in several plant species [reviewed in 8]. In wheat, three RNase activities have been observed [3]. An acidic RNase (approximately 20 kDa) is ubiquitous in plant species that is often localized to the vacuole or endoplasmic reticulum or secreted from the cell [8]. The other two are neutral RNases that differ both in size and in their catalytic requirements. One RNase is approximately 27 kDa in size and is inhibited by salt or MgCI2 whereas the other is composed of a group of RNases (the major species of which is 26 kDa in size) whose activity is stimulated by salt or MgCI2 [3]. All three RNase activities are induced as part of the senescence program [4] as has been shown for specific RNases in Arabidopsis and other species [8, 13]. The neutral RNases are present at only a low level in untreated wheat leaves but are induced to a high level during senescence [4].

221

222

We previously observed that heat shock results in a coordinate loss of translational efficiency and an increase in mRNA stability in plants [7]. mRNA stability increases following a heat shock and the increase is a function of the severity of the stress [7]. Following a 15 min exposure to 37°C, the functional half-life of a reporter mRNA increased 50%, but increased 5-fold following a 42°C heat shock, and nearly 9-fold following a 45°C heat shock. The thermally-induced increase in mRNA half-life could be a result of two non-mutually exclusive possibilities: a reduction in the amount or activity of those RNases responsible for mRNA degradation, or a sequestration of mRNAs from RNase attack.

A number of studies have shown that exposure to heat shock results in profound changes at almost every level of gene expression including translation. Although heat shock results in a rapid disassembly of polyribosomes and the repression of translation from non-hsp mRNAs, these mRNAs are not destroyed, but appear to be maintained in heat-shock granules (HSGs) that include heat shock proteins [10, 11]. The HSGs associate with the cytoskeleton forming perinuclear complexes in plants [1, 11], in invertebrates [2, 9], and vertebrates [6]. The non-hsp mRNAs are subsequently recruited for translation upon recovery [12]. The sequestration of mRNAs following heat shock suggests that mechanisms have evolved throughout many species to conserve mRNAs until recovery ensues.

Our observation that the stability of mRNAs increase in plants following a heat shock [7] suggested that in addition to the possibility of sequestration, the increase in stability might result from a decrease in expression and/or the repression of intracellular RNase activities. Direct analysis of RNase and nuclease activities in wheat leaves demonstrated that the activity of all detectable RNases decreased following a heat shock [5]. RNase activity in extracts or following purification was heat stable even following renaturation from boiling in the presence of SDS, demonstrating that the heat-mediated reduction in RNase activity in leaves is not a result of thermal lability of the enzyme itself. Analysis of the 27 kDa neutral RNase by westerns demonstrated that the level of RNase protein did not decrease following a heat shock, suggesting that the observed decrease in its activity in heat-shocked leaves may be due to post-translation control [5]. Using two-dimensional (2D) RNase activity gels, three isoforms of this RNase was observed. 2D gel/western analysis demonstrated that the most acidic isoform predominated in control leaves whereas the most basic isoform predominated in leaves following a heat shock which correlated with the heat-shock-induced reduction in RNase activity and the increase in mRNA half-life [5]. These data suggested that the heat-induced dephosphorylation of RNase might playa role in the observed decrease in RNase activity and increase in mRNA stability that occurs as part of the heat shock response.

The activity or expression of RNase and nucleases in wheat leaves is also induced following prolonged growth in the dark [3, 4]. Because the observations concerning the control of RNase activity following a heat shock suggested regulation at the post­translational level, we examined whether the dark-induced p27 RNase activity involves changes in its level or activity and whether the induction involves changes in the distribution of its isoforms using 2D-RNase activity gels and 2D-gel/western analysis.

223

Days of germination in light: 0 2 4 6 8 10 12 14 16 20

Nucleases

p27 RNase

p27 RNase

1 2 3 4 5 6 7 8 9 10

Days of germination in dark: 0 2 4 6 8 10 12 14 16 20

Nucleases

p27 RNase

p27 RNase

123 4 5 6 7 8 9 10 Figure 1. p27 RNase activity and protein expression are non-coordinately regulated during dark-induced senescence. Extracts from seedlings germinated in the light (top two panels) or dark (bottom two panels) were assayed for p27 RNase activity (top panel in each set) using activity gels and for p27 protein (bottom panel in each set) using western analysis. 10 ~g of protein was used for western analysis whereas 2 ~g protein was analyzed in the RNase assay.

3. Materials and Methods

3.1. RNASE ACTIVITY GELS, 2D-GEL ELECTROPHORESIS, AND WESTERN ANALYSIS

RNase activity gels were performed using 12% SDS-PAGE gels containing 100 ~glml wheat ribosomal RNA as described [5]. For 2D gel electrophoresis, the protein samples were precipitated with acetone and resuspended in 9.5 M urea with 2% ampholites (a

224

3: 1 mixture of pH 5-8:pH 3-lO ampholites). 5-50 f.lg of protein (depending on the analysis being performed) was analyzed as described [5]. For western analysis, the protein was resolved and transferred to nitrocellulose membrane using semi-dry transblotting. Western analysis was performed as described [5] and the RNase signal detected using chemiluminescence.

4. Results and Discussion

To examine the expression and activity patterns of the p27 RNase in light and dark grown leaves, wheat seed were germinated under conditions of light or dark up to 20 days. Aqueous extracts made from the leaves/coleoptile collected at intervals (from 2-20 days) or from seed (for the 0 day time point) were assayed for RNase activity on 12% SOS-PAGE gels containing RNA. Extracts were also resolved on 12% SOS­PAGE gels that were then transferred to membranes for western analysis using anti-p27 RNase antibodies [5]. No p27 RNase activity was observed in mature seed (see lane 1, Fig. 1). However, in seed germinated in either the light or dark, p27 RNase activity was observed by 2 days, which then increase by 4 days. p27 RNase activity decrease to a low but detectable level during subsequent growth in the light but remained constant in dark-grown seedlings until 12 days whereupon activity increased substantiaIly. Nuclease activity was also induced from 14-20 days in the dark. The level of p27 protein in either the light or dark-grown seedlings as revealed by western analysis followed the activity pattern of RNase in light-grown seedlings but not that of dark­grown seedlings (Fig. 1). A high level of p27 protein was observed in dry seed although p27 RNase activity was not detected. The level of p27 protein increased up to 4 days of germination in either the light or dark but then decreased during subsequent growth. This pattern of expression differs significantly from the changes in activity observed in dark-grown seedlings, particularly from 14-20 days of growth when an sharp increase in activity is observed at a time in which the level ofp27 protein remains constant (Fig. 1). These data suggest that the regulation of p27 RNase activity during dark-induced senescence is controlled post-translationally. We had previously observed that heat shock results in a rapid and substantial decrease in the level ofp27 RNase activity [5] and that p27 is present as multiple isoforms whose distribution changes following a heat shock [5]. As a heat shock resulted in no change in the level of p27 protein, a post-translational regulatory mechanism was the most likely explanation for the heat-shock-induced changes in p27 RNase activity. In order to examine whether the non-coordinate control ofp27 RNase activity and protein during dark-induced senescence is controlled post-translationally through alterations in the distribution of its isoforms, extracts made from light and dark-grown wheat leaves were assayed for p27 RNase activity using 20 activity gels and for protein using 20-gel/western analysis. Light grown seedlings shifted into the dark or dark-grown seedlings shifted into the light were also examined. Multiple isoforms of p27 RNase activity were observed in either dark-grown seedlings or those initially grown in the light and then shifted to dark for 12 days (Fig. 2). The number of isoforms observed by the activity assay is greater than that detected by western analysis as previously observed [5], suggesting that the additional isoforms are highly active but not abundant

225

(I) (I) (I) (I)

~ ~ ~ ~

~ ~ ~ ~ ~ N N N p. p. p.

\I")

\Ci

\I") , t

v)

\0 ~

0\ rri

~ .:d ~ ~ !:::: b/) c.. CI i3: ;:1 a • a • i .....

~ ~ -§b ~ ~ 0 0

\I")

\Ci

\I")

v)

\0 ~

~ ('l

<tS en

<tS '" ~ (I) (I) c.. ~ ~ ~

~ ~ ...2 (I) r--- r---r--- 'U ~ 'U

~ ~ ('l ('l

~ :::I Z P. Z P. Z rI)

0 rI)

Figure 2. The distribution ofp27 RNase isoforms in RNase activity gels (left panels) and western analysis (right panels) of light and dark-grown seedlings. Soluble protein from wheat leaves were separated using two­dimensional activity gels or westerns using isoelectric focusing in the first dimension followed by SDS-PAGE in the second.

226

species of the p27 RNase or that they are immunologically distinct. These isoforms observed in dark-grown seedlings were also observed at a lower level in dark-grown seedlings shifted to the light for 12 days. As p27 RNase activity is just detectable in light-grown seedlings, this indicates that recovery from the dark-induced senescence program to the level observed in light-grown seedlings requires a period longer than 12 days. Although just detectable, the activity pattern of p27 in light-grown seedlings was similar to that observed in seedlings subjected to the various dark treatments. Western analysis indicated that p27 exists as three prominent isoforms in light-grown seedlings (Fig. 2) as previously observed [5]. The number and distribution of isoforms in dark­grown seedlings was similar although an additional, basic isoform not observed in light­grown seedlings was detected (Fig. 2). It is unlikely that this represents the means by which RNase activity is induced as each individual isoform increases in activity during dark-induced senescence.

From these observations, we conclude that induction of this ethylene-regulated RNase is part of the dark-induced senescence program and that its activity is induced primarily through post-translational means. Because each individual p27 isoform increases following dark treatment and that changes in its isoelectric state between light and dark-grown seedlings are minimal, the activation of p27 RNase activity during dark-induced senescence through changes in its isoelectric state can be ruled out.

5. References

I. Apuya, N.R and Zimmerman, 1.L. (1992) Heat shock gene expression is controlled primarily at the translational level in carrot cells and somatic embryos, Plant Cell 4, 657-665.

2. Arrigo, A-P. (1987) Cellular localization of HSP23 during Drosophila development and following subsequent heat shock, Dev. Bioi. 122,39-48.

3. Blank, A and McKeon, T.A (1991) Three RNase in senescent and nonsenescent wheat leaves, Plant Physiol. 97,1402-1408.

4. Blank, A and McKeon, T.A (1991) Expression of three RNase activities during natural and dark­induced senescence of wheat leaves, Plant Physiol. 97, 1409-1413.

5. Chang, S.-c. and Gallie, D.R (1997) RNase activity decreases following a heat shock in wheat leaves and correlates with its post-transcriptional modification, Plant Physiol. 113, 1253-1263.

6. Collier, N.C. and Schlesinger, M.1. (1986) The dynamic state of heat shock proteins in chicken embryo fibroblasts, J. Cell Bioi. 103, 1495-1507.

7. Gallie, D.R, Caldwell, C., and Pitto, L. (1995) Heat shock disrupts cap and poly(A) tail function during translation and increases mRNA stability of introduced reporter mRNA, Plant Physiol. 108, 1703-1713.

8. Green, P.l. (1994) The ribonucleases of higher plants, Ann. Rev. Plant Physiol. Plant Mol. Bioi. 45, 421-445.

9. Leicht, B.G., Biessmann, H., Palter, K.B., and Bonner, 1.J. (1986) Small heat shock proteins of Drosophila associate with the cytoskeleton, Proc. Nat!. Acad. Sci. USA 83, 90-94.

10. Nover, L., Scharf, K.-D., and Neumann, D. (\983) Formation of cytoplasmic heat shock granules in tomato cell cultures and leaves, Mol. Cell. Bioi. 3, 1648-1655.

II. Nover, L., Scharf, K.-D., and Neumann, D. (1989) Cytoplasmic heat shock granules are formed from precursor particles and are associated with a specific set ofmRNAs, Mol. Cell. Bioi. 9, 1298-1308.

12. Storti, RY., Scott, M.P., Rich, A, and Pardue, M.L. (1980) Translational control of protein synthesis in response to heat shock in D. melanogaster cells, Cell 22, 825-834.

13. Taylor, C.B., Bariola, P.A., del Cardayre, S.B., Raines, R.T., and Green, P.J. (\993) RNS2: a senescence-associated RNase of Arabidopsis that diverged from the S-RNases before speciation, Proc. Nat!. Acad. Sci. USA 90, 5118-5122.

ETHYLENE REGULATION OF ABSCISSION COMPETENCE

1. Abstract

c.c. LASHBROOK AND H.J. KLEE Horticultural Sciences Department, University of Florida, 1301 Fifield Hall, Gainesville, FL. 32611-0690, USA

Abscission, the process by which plants shed organs, occurs at a specialized site known as the abscission zone. Plant organ detachment is regulated by multiple developmental, hormonal and environmental cues. Cotton is an agronomically important crop that exhibits high rates of premature abscission in response to both biotic and abiotic signals. The developmental acquisition of abscission competence in cotton is associated with significant alterations in ethylene biosynthesis and perception in the abscission zone, adjacent petiole or pedicel tissue, and terminal organ, e.g. leatblade or flower. Abscission of aerial tissues triggered by environmental cues may be dependent upon regulated ethylene action in additional organs including roots. Our research aims to establish the molecular genetic mechanisms by which regulation of ethylene biosynthesis and perception throughout the cotton plant contributes to abscission competence. Here, we report on the cloning of four members of the cotton ACC oxidase gene family from floral abscission zones. Gh-ACO gene expression was evaluated in multiple tissues of plants engaged in drought stress-mediated leaf abscission. Gh-AC02 mRNA accumulated in wilting roots and shoots of stressed plants, declining upon rehydration. Other Gh-ACO mRNAs were not significantly regulated in these tissues. Accumulation of Gh-AC02 mRNA in wilting roots is presumed to be dependent upon ACC synthesis catalyzed by one or more root-localized ACC synthases.

2. Introduction

Ethylene is an integral component of the mechanisms by which plants sense and respond to their surroundings. The synthesis of ethylene in response to such diverse stresses as flooding, drought, and dim light illustrates the central role played by this hormone in coordinating plant responses to the environment. Ethylene also promotes and integrates many of the developmental transitions within a typical plant life cycle. Thus, ethylene accelerates seed germination, inhibits shoots elongation, modulates the timing of senescence and promotes organ detachment [I]. Early plant physiological analyses of abscission established that the acquisition of abscission competence is associated with significant changes in ethylene biosynthesis and perception throughout

227

228

tissues of the subtending organ [3,4, 17]. Here, we consider the molecular mechanisms by which developmental and environmental abscission cues lead to the modulation of ethylene synthesis and perception, and how in tum regulated ethylene may confer abscission competence.

3. Ethylene Mediated Abscission Competence as a Whole Plant Process

The abscission zone consists of a tier of morphologically and/or biochemically distinct cells containing a cell separation layer where enzymically-mediated organ shed occurs. Many cell wall hydro lases that degrade substrates within the separation layer are auxin­inhibited and ethylene activated [7, 12, 14, 29]. Prior to abscission, auxin flux from tissues of the subtending organ maintains the separation layer in an ethylene insensitive state [2]. Regulated depletion of auxin and synthesis of ethylene subsequently activates cell wall disassembly within the separation layer, leading to organ shed.

Initiation of the abscission process takes place in non-abscission zone tissues upon receipt of an abscission stimulus. In a leaf petiole abscising in response to natural aging, perception of the stimulus may occur within the senescing leaf blade. In a leaf petiole abscising in response to drought stress, the cue may be perceived in roots far removed from the abscission zone. How is an abscission stimulus perceived in an aging leatblade or in a stressed root system processed and transduced into a common response within a detaching petiole? Significant evidence suggests that ethylene plays a central role in promoting and coordinating complex abscission responses.

3.l. PERCEPTION OF THE ABSCISSION STIMULUS OCCURS OUTSIDE OF THE ABSCISSION ZONE

3.1.1. Role of Ethylene Synthesis and Perception Distal to the Abscission zone Regulated ethylene synthesis and perception in distal tissues prior to organ shed may be a common feature of plant abscission systems. Beyer [3] demonstrated that detachment of a cotton leaf at its petiole was dependent upon ethylene perception by the leafblade, implicating a role for tissues distal to the abscission zone in conferring abscission competence. Increased ethylene biosynthesis within terminal organs is also observed prior to organ shed. For example, naturally aging cotton leaves synthesize ethylene for several days prior to abscission [22]. Ethylene production in petioles increases prior to natural leaf drop [4]. Up to 10-fold increases in ethylene production are observed in immature and mature cotton bolls. before abscission and dehiscence, respectively [17, 18]. The purpose of producing ethylene in distal tissues may be to activate cell wall modifying enzymes in the nearby cell separation layer.

3.1.2. Role of Ethylene Synthesis and Perception Proximal to the Abscission zone Numerous abscission responses are induced by environmental cues acting proximal to the site at which organ shed will occur. Jordan et al. [11] have reported that cotton leaves under water stress are "predisposed" to abscission promotion by ethylene, implicating a change in ethylene sensitivity within stressed tissues. However, more attention has been given to the changes in ethylene biosynthesis that occur in tissues

229

proximal to abscission zones destined to abscise. In tomato, flooding of plants results in shoot epinasty and organ abscission. Three flooding-induced ACC synthases have been localized to root tissues [23, 24]. ACC flux to aerial portions of the tomato plant and conversion of ACC to ethylene by ACC oxidase is correlated with the epinastic [5, 8] and, presumably, abscission responses. One purpose of regulated ethylene biosynthesis or precursor production in proximal tissues may be to relay abscission signals over considerable distances to sites of response.

3.2. THE ABSCISSION RESPONSE OCCURS IN THE CELL SEPARATION LAYER

3.2.1. Role of Ethylene Synthesis and Perception within the Abscission zone The response of an abscission zone to ethylene is developmentally determined. Leaf position determines whether or not a cotton organ will detach in response to exogenously provided ethylene; young leaves are preferentially shed [21, 28]. Floral buds approaching anthesis rarely shed while the rate of young boll abscission is maximal within a week after anthesis [9]. Differential ethylene sensitivity within abscission zones is presumed to be dependent upon the regulated expression of ethylene receptors. In cotton, at least three ETRI homologs coordinate ethylene perception processes in flower abscission zones [Lashbrook and Klee; unpublished]. In tomato, three members of the ethylene receptor gene family are expressed in abscission zones of leaves and flowers [16, 25, 30, 31]. LeETRI, also known as eTAEI, is expressed at constitutive levels in all plant tissues surveyed, including leaf and flower abscission zones [16, 30]. LeETR2 (TFE27) and LeETR3 mRNA levels remain quite uniform within abscission zones as tomato flowers open, senesce, abscise or set fruit [16]. The contributions of individual receptors to regulation of ethylene sensitivity within abscission zones has yet to be established

The origin of ethylene perceived by abscission zone receptors appears to include hormone synthesized distal to the abscission zone (Section 2.1.1.). Abscission zone cells also appear to have the capacity to synthesize hormone. Multiple cDNAs corresponding to ACC synthases and ACC oxidases have been cloned from abscising cotton abscission zones [Lashbrook and Klee, unpublished; and see Section 3.1.].

4. Abscission-Related Ethylene Biosynthetic Enzymes and Receptors in Cotton

4.1. MOLECULAR CLONING OF ABSCISSION ZONE ACC SYNTHASES, ACC OXIDASES AND ETHYLENE RECEPTOR HOMOLOGS

A UniZap cDNA library (Stratagene) was prepared from abscission zone mRNA isolated from ethylene-treated floral explants. Screening of the library with Arabidopsis ETRI [6], tomato ACC synthase [26] and tomato ACC oxidase [to] led to the isolation of two receptor homologs, eight ACC synthases and three ACC oxidases. Screening of the library with a mix of PCR amplification products of reverse-transcribed abscission zone mRNA yielded an additional ACC oxidase.

230

4.2. ACC OXIDASE GENE EXPRESSION IN COTTON ABSCISSION ZONES

All four Gh-ACO genes were induced in abscission zones of ethylene-treated flower bud explants, with the mRNA for AC03 accumulating to the highest level (Fig. I).

Gh·AC01

Gh·AC02

Gh·AC03

Gh·AC04

+ Abscission Status

Figure 1. ACC oxidase mRNA accumulation in cotton buds abscising in response to C2H.t. The Gh·AC03 autoradiograph was exposed for one· third the time as the others.

4.3. ACC OXIDASE GENE EXPRESSION IN ROOTS AND SHOOTS DURING WATER STRESS AND REHYDRA nON

Abscission of cotton leaves and young buds in response to water stress usually occurs following rehydration [19, 20, 27]. When watering of six-week-old plants with 7-9 expanded leaves was discontinued, moderate leaf wilting was evident by the third day and severe wilting by the fifth. By day five, abscission of a number of first and second true leaves had occurred. Rehydration of plants on day five rapidly restored turgor and initiated the abscission of additional first and second true leaves (data not shown).

Northern analysis of total RNAs isolated from stressed tissues revealed the accumulation of Gh-AC02 mRNA in wilting roots and epicotyls, with RNA abundance declining upon plant rehydration (Fig. 2). In contrast, expression of Gh-AC04 was relatively constitutive throughout water stress and rehydration and Gh-ACOI mRNA was not detected at all (Fig. 2). These data may suggest that Gh-AC02 is the primary ACC oxidase enzyme responsible for water stress-induced ethylene production in roots and shoots of cotton.

231

5. Concluding Remarks

Cotton abscission is accompanied by significant changes in ethylene metabolism and sensitivity. Technical advances have provided the molecular genetic tools required to determine the genes that control these changes and the mechanisms by which changes in their expression determine where and when cotton organs abscise. Molecular genetic modification of proteins conferring tissue-specific ethylene insensitivity would represent an important means of potentially reducing abscission-associated crop losses.

Attempts to identify genes important for abscission have frequently targeted cell wall hydro lases expressed in abscission zones [12-14, 29]. Molecular genetic manipulation of one such gene, cell, reduced the incidence of tomato flower abscission by up to one-third but could not completely inhibit abscission [15]. It is likely that cell separation is dependent upon multiple cell wall enzymes exhibiting potentially complex substrate specificities. In view of ample evidence for regulated ethylene sensitivity and metabolism in tissues distal and proximal to the abscission zone preceding organ shed, it is reasonable to suspect that transgenic manipulation of ethylene-related genes within these tissues could modulate abscission incidence. A molecular physiological approach to the study of ethylene synthesis and perception throughout the whole plant engaged in organ abscission is a critical step to defining and modifying early determinants of abscission competence.

Roots Epicotyls

Gh-AC01

Gh-AC02

Gh-AC04

c c c c 0 0 0 0 = = = = I!! I!! I!! I!! ~ "0

OJ .:!::: "0 "0

.:!::: .:!::: >- >- >-ai ai .r::. .r::. i ai .r::. .c

0 ! ! 0 ! ! :;.. l\! "S .r::. "0 >- l\! ~ .r::. "0 ~ :E u. <') ~ :E <') ..-

Figure 2. ACC oxidase mRNA accumulation in roots and epicotyls throughout water stress and rehydration.

232

6. Acknowledgements

The technical assistance of Rebecca Laurie is gratefully acknowledged. This work was funded by a USDAINRICGP Postdoctoral Fellowship (97-35100-4192) to c.c.L. and a gift from the Monsanto Co. to H.J.K.

7. References

I. Abeles, F.B., Morgan, P.W. and Saltveit, M.E. (1992) Ethylene in Plant Biology, 2nd Edition, Academic Press, San Diego.

2. Addicott, I'.T. (1982) Abscission, University of California Press, Berkeley. 3. Beyer, E.M. (1975) Abscission: The initial effect of ethylene is in the leaf blade, Plant Physiol. 55,

322-327. 4. Beyer, E.M. and Morgan, P.W. (1971) Abscission: The role of ethylene modification of auxin

transport, Planl Physio/ 48, 208-212. 5. Bradford, KJ. and Yang, S.F. (1980) Xylem transport of I-aminocyelopropane carboxylic acid, an

ethylene precursor, in waterlogged tomato plants. Plant Physiol. 65,322-326. 6. Chang, e., Kwok, S.F., Bleecker, A.B. and Meyerowitz, E.M. (1993) Arabidopsis ethylene

response gene Elrf: similarity of product to two-component regulators. Science 262, 541-544. 7. del Campillo, E. and Bennett, A.R. (1996) Pedicel breakstrength and cellulase gene expression

during tomato flower abscission, Plant Physiol. 111,813- 820. 8. English, PJ., Lycett, G.W., Roberts, JA and Jackson, M.B. (1995) Increased 1-

aminocyclopropane carboxylic acid oxidase activity in shoots of flooded tomato plants raises ethylene production to physiologically active levels, Plant Physiol. 109,1435-1440

9. Guinn, G. and Brummett, D.L. (1988) Changes in abscisic acid and indoleacetic acid before and after anthesis relative to changes in abscission rates of cotton fruiting forms, Plant Physiol. 87, 629-631.

10. Holdsworth, MJ., Bird, e.R., Ray, J., Schuch, W. and Grierson, D. (1987) Structure and expression of an ethylene-related mRNA from tomato, Nuc!. Acids Res. 15,731-739.

II. Jordan, W.R., Morgan, P.W. and Davenport. T.L. (1972) Water stress enhances ethylene-mediated leaf abscission in cotton, Plant Physiol. 50, 756-758.

12. Kalaitzis, P., Koehler, S.M. and Tucker, M.1.. (1995) Cloning of a tomato polygalacturonase expressed in abscission, Plant Molec. BioI. 28,647-656.

13. Kalaitzis, P., Solomos, T. and Tucker, M.L. (1997) Three different polygalacturonases are expressed in tomato leaf and flower abscission. each with a different temporal expression pattern. Plant Physiol. 113, 1303-1308.

14. Lashbrook, c.e., Gonzalez-Bosch, C. and Bennett, A.B. (1994) Two divergent cndo-I3-I,4-glucanasc genes exhibit overlapping expression in ripening fruit and abscising flowers, Plant Cell 6,1485-1493.

15. Lashbrook, e.C., Giovannoni, JJ., Hall. B.D., Fischer, R.L. and Bennett, A.R. (1998) Transgenic analysis of tomato endo-I3-I,4-glucana~e gene expression. Role of cell in floral abscission, Plant J. 13,303-310

16. Lashbrook, e.e., Tieman, D.1.. and Klee, HJ. (1998) Differential regulation of the tomato ETR gene family throughout plant development, Plant J. 15. 243-252.

17. Lipe, J.A. and Morgan, P.W. (1972) Ethylene: Role in fruit abscission and dehiscence proccsses, Plant Physio/' 50,759-764.

18. Lipe, J.A and Morgan, P.W. (1973) Ethylene. a regulator of young fruit abscission, Plant Physiol. 51,949-953.

19. McMichael, B.\.., Jordan, W.R. and Powell, R.D. (1972) An efTect of water stress on ethylene production by intact cotton petiolcs, Plant Physiol. 49,658-660.

233

20. McMichael, B.L., Jordan, W.R and Powell, RD. (1973) Abscission process in cotton: induction by plant water deficit, Agron. J. 65,202-204.

21. Morgan, P.W. and Durham, .JI. (1973) Leaf age and ethylene-induced abscission, Plant Physiol. 52,667-670. .

22. Morgan, P.W., He, C.-J. and Drew, M.C. (1992) Intact leaves exhibit a climacteric-like rise in ethylene production before abscission, Plant Physiol. 100, 1587-1590.

23. Olson, D.C., Oetiker, J.H. and Yang, S.F. (1995) Analysis of LE-ASC3, a l-aminocyclopropane carboxylic acid synthase gene expressed during flooding in the roots of tomato plants, J. Bioi. Chern. 270, 14056-14061.

24. Shiu, O.Y., Oetiker, J.H., Yip, w.K., and Yang, S.F. (1998) The promoter of LE-ACSl, an early flooding-induced l-amino-cyclopropane-I-carboxylate synthase gene of the tomato, is tagged by a SOL3 transposon, Proc. Nat. Acad. Sci. U.s.A. 95, 10334-10339.

25. Payton, S., Fray, R.G., Brown, S. and Grierson, D. (1996) Ethylene receptor expression is regulated during fruit ripening, flower senescence and abscission, Plant Mol. Bioi. 31, 1227-1231.

26. Rottman, W.H., Peter, G.F., Oeller, P.W., Keller, J.A., Shen, N.F., Nagy, B.P., Taylor, L.P., Campbell, AD.and Theologis, A (1991) l-aminocyclopropane carboxylate synthase in tomato is encoded by a mUltigene family whose transcription is induced during fruit and floral senescence, J. Mol. Bioi. 222,937-961.

27. Stockton, J.R., Donben, L.D. and Walhood, Y.T. (1961) Boll shedding and growth of the cotton plant in relation to irrigation frequency, Agron. J. 53,272-275.

28. Suttle, J.e. and Hultstrand, J.F. (1991) Ethylene-induced leaf abscission in cotton seedlings: The physiological bases for age-dependent differences in sensitivity, Plant Physiol. 95,29-33.

29. Tucker, M.L., Sexton, R, del Campi\lo, E. and Lewis, L.N. (1988) Bean abscission cellulase. Characterization of a cDNA clone and regulation of gene expression by ethylene and auxin, Plant Physiol. 88, 1257-1262.

30. Zhou, D., Kalaitzis, P., Matoo, AK. and Tucker, M.L. (1996) The mRNA for an Etrl homologue in tomato is constitutively expressed in vegetative and reproductive tissues, Plant Mol. Bioi. 30, 1331-1338.

31. Zhou, D., Matoo, AK. and Tucker, M.L. (1996) Molecular cloning ofa tomato cDNA encoding an ethylene receptor, Plant Physiol. 110, 1435.

ROLE OF ETHYLENE SENSITIVITY IN MEDIATING THE CHILLING­INDUCED LEAF ABSCISSION OF IXORA PLANTS

1. Abstract

R. MICHAEU 1, S. PHILOSOPH-HADAS 1, J. RIOy2 AND S. MEIRI I Department of Postharvest Science of Fresh Produce. ARO. The Volcani Center. Bet Dagan 50250; and 2The Kennedy-Leigh Centre for Horticulture Research. Faculty of Agriculture. The Hebrew Universityof Jerusalem. Rehovot 76100. Israel

Exposing intact ixora (Ixora coccinea) plants or petiole explants to chilling (3 days/3, 7 or 9°C) resulted in 20-80% abscission of mature, non-senescent leaves, manifested only 2 days after transfer to 20°e. The degree of leaf abscission increased with reduction of the chilling temperature. Chilling exposure induced also a significant increase in ethylene production rates in petiole explants during the initial 4 h after transfer to 20°C. A similar pattern of increased ethylene production was obtained in petiole explants treated with a-naphthaleneacetic acid (NAA) or with the antioxidant butylated hydroxyanisole (BHA), although these compounds significantly reduced the chilling­induced leaf abscission. On the other hand, application of the ethylene biosynthesis inhibitor, aminoethoxyvinylglycine (AYG), which reduced ethylene production of petiole explants by 60%, inhibited leaf abscission by 70%. However, treating intact plants with the ethylene action inhibitor, I-methylcyclopropene (l-MCP) prior to chilling, completely prevented their chilling-induced leaf abscission. These results suggest that endogenous ethylene is essential for the chilling-induced leaf abscission. Exposure of intact plants to exogenous ethylene (3- \0 Ill/I) for 1-3 days or treating petiole explants with I-aminocyclopropane-l-carboxylic acid (ACC), significantly enhanced their leaf abscission only when they had been pre-exposed to chilling. These results indicate that abscission induced by chilling is closely correlated with increased sensitivity of the abscission zone (AZ) to ethylene rather than with chilling-induced ethylene production. NAA and BHA inhibited both the chilling-induced and the ACC­enhanced leaf abscission of petiole explants. This indicates the possible involvement of oxidative processes, probably of IAA, in the chilling-induced leaf abscission that is mediated by sensitivity to ethylene. It is therefore proposed, that chilling initially induces oxidative processes in the AZ, which then reduces IAA levels resulting in increased sensitivity of the AZ to ethylene, which finally causes leaf abscission.

235

236

2. Introduction

Being of tropical origin, Ixora (lxora coccinea) potted plants exhibit susceptibility to low temperatures (below 12°C), manifested by abscission of mature, non-senescent green leaves [8]. It is generally agreed that the initial event in chilling injury is a direct effect of low temperature on cellular constituents, which results in changes in membrane features and/or conformational changes in enzymes and structural proteins [11]. This includes also induction of peroxide and IAA oxidase [7] and involvement of free radicals produced during lipid oxidation [13]. Accumulated evidence suggests that all these chilling-associated events may be derived from the oxidative stress imposed initially in the tissue upon exposure to low temperature [3]. It was also shown that petiole abscission in bean explants was directly associated with oxidative processes induced by unsaturated fatty acids [18]. Considering these indications, it is possible that the chilling-induced leaf abscission is also mediated through an oxidative stress.

In addition to cellular events, it is well established that when plants are subjected to a variety of stresses including chilling, they respond by increased ethylene production rates [9], observed usually in the post-chilling [9] or during [5] the chilling period.

It is generally accepted that leaf abscission results from an altered balance of auxin and ethylene in the AZ [2, 4, 6, 10, 14, 16]. Ethylene enhances the abscission of leaves and fruits by promoting the activity of hydrolytic enzymes, which cause cell separation in the AZ [1,2,6]. This depends on the sensitivity of the tissue to ethylene, which is regulated in turn by auxin transport to the AZ [4,14]. Thus, high levels of auxin in the AZ delay the ethylene-induced rise in the activity of the hydrolytic enzymes [10].

The present study has examined the involvement of ethylene, auxin and oxidative stress in the chilling-induced leaf abscission of ixora intact plants and petiole explants following exposure to low temperatures. The results show that chilling-induced leaf abscission in ixora is mainly derived from increased sensitivity of the AZ to ethylene.

3. Materials and Methods

3.1. PLANT MATERIAL

Experiments were performed with mature ixora (lxora coccinea) potted plants. Two different plant systems were used in the various experiments: 1) intact plants containing only mature, dark green and fully expanded leaves, after removal of buds, inflorescence and young leaves. 2) Petiole explants (Fig. lA), containing a 2.5-cm stem segment, two AZ in the junction between the petiole and the stem, and a 4-5-mm leaf blade section.

3.2. ANATOMICAL CHARACTERIZATION OF THE PETIOLE AZ

Longitudinal sections of the petiole AZ tissue (Fig. IA) were prepared before exposure of intact plants to chilling, immediately after chilling, and 6 and 48 h after transferring chilling-treated plants to 20°C. AZ sections were immediately fixed in formaldehyde (37-40%): acetic acid: ethyl alcohol (95%): water, 10:5:50:35 (v/v/v/v) solution and embedded in paraffm. AZ sections were then cut longitudinally with a rotary microtome (Spencer 820, American Optical) to 12 /lm sections, and stained with

237

Safranin / Fast green (Sigma, USA). The stained sections were then examined under a light microscope.

3.3. CHILLING TREATMENTS

Intact plants or petiole explants were exposed in the dark to various chilling temperatures (3, 7 or 9°C) for three days. Control plants or explants were kept for the desired periods at 20°C in the dark. For chilling treatment, petiole explants were placed in wells (I-cm in depth and O.5-cm in diameter) in a 96-well ELISA plate, containing 300 !ll of 5 mg mr' active chlorine complexed as sodium dichloroisocyanureate (TOG-6, Assia Reisel, Israel) to avoid contamination. ELISA plates were incubated on a layer of moistened paper in trays covered with perforated polyethylene to avoid desiccation.

3.4. EVALUATION OF LEAF ABSCISSION

Intact plants or petiole were transferred from the chilling temperature to a standard observation room, maintained at 20°C, 60-70% RH and a 12-h photoperiod at a light intensity of 14 !lmol m-2 s-1. Leaf abscission following chilling and other treatments was evaluated daily at the observation room, by monitoring the number of leaves abscised after slightly shaking intact plants, or applying a slight pressure with the fingers on the leaf blade edge of petiole explants. Groups of 10 marked leaves in intact plants or 10 petiole explants (containing 20 AZ's) served as one replicate. Results are presented as percentage of cumulative leaf abscission at 20°C until a steady state level was reached.

3.5. DETERMINATION OF LEAF SENESCENCE PARAMETERS

Samples of leaf tissues (0.5 g) were extracted by boiling for 30 min in 80% ethanol for amino acid and chlorophyll determination, as previously described [12]. Water content of leaves was estimated on the basis of dry weight (DW) according to the equation: (FW-DW) / (DW).

3.6. APPLICATION OF CHEMICALS

NAA (0.1 mM; Assia-Reisel, Israel), BHA (0.66 mM; Xedafen; Xeda, France), ACC (0.01 mM; (Sigma, USA) or A VG (0.1 mM; Sigma, USA) were applied to petiole explants before the chilling treatment. NAA or BHA was applied to intact plants by spraying leaves in a solution containing 0.02% of the surfactant L-77 (Agan chemicals, Ashdod, Israel). The petiole explants prepared from the treated plants were placed in ELISA plates containing organic chlorine (as described in section 3.3), and subsequently exposed to chilling. ACC or AVG were applied in the wells of the ELISA plates, and the petiole explants were directly pre incubated in the test solutions for 24 h at 20°C, prior to the chilling treatment.

3.7. DETERMINATION OF ETHYLENE PRODUCTION RATES

238

Samples of three petiole explants were enclosed after chilling in 50-ml Erlenmeyer flasks on a filter paper moistened with 0.5 ml of distilled water. Flasks were then covered with parafilm and incubated at 20°C. Ethylene production rates were monitored at hourly intervals (1, 4 and 6 h) during this post-chiIIing period by replacing the parafilm covers with rubber serum caps for 1 h. Ethylene concentration in the flasks was then analyzed by injecting a 2-ml gas sample into a gas chromatograph (Varian), equipped with an alumina column and a flame ionization detector.

4. Results and Discussion

4.1. CHARACTERIZATION OF THE CHILLING-INDUCED LEAF ABSCISSION IN INTACT PLANTS AND PETIOLE EXPLANTS

Exposure of intact ixora plants or petiole explants to chilling temperatures (below 12°C) for 3 days in the dark resulted in a significant increase in leaf abscission (Table 1). Leaf abscission in intact plants was initially observed 2 days after chilling, reaching a steady state level during the third day after transferring the plants to the observation room (data not shown). On the other hand, control non-chiIIed petiole explants exhibited 20% leaf abscission already after 3 days of dark incubation at 20°C prior to their transfer to the observation room (data not shown), and reached 50% abscission 3 days after being transferred to 20°C in photoperiodic light (Table I). Leaf abscission, which occurred in control explants without chilling, may be considered as an artifact of the explant system that is unrelated to their chilling-induced leaf abscission.

The percentage of chilling-induced leaf abscission of both intact plants and petiole explants increased as the temperature decreased (Table I). Thus, 100% of the leaves were abscised in plants and explants incubated at 3°C for 3 days, while only 35-40% leaf abscission occurred after incubation of plants at 9°C for the same period. Incubation at 7°C for 3 days caused 65% and 75% leaf abscission in intact plants and petiole explants, respectively (Table 1). This relationship between the severity of the chilling injury and the severity of the chilling stress is a well-known phenomenon in various chilling susceptible systems [15].

TABLE 1. Effect of various chilling temperatures on leaf abscission in intact plants and petiole explants of ixora. Results are expressed as percentage of cumulative leaf abscission, monitored after 3 days at the observation room and represent means ± SE of 3 experiments.

Chilling temperature (0C)

20 (control) 3 7 9

Leaf abscission (%) Intact plants Petiole explants

o 50±5 100 100 65± 10 75 ± 10 35 +5 n.d.

Amino acid, chlorophyll and water content were similar in leaves abscised from chilled intact phillts and in leaves detached from non-chilled intact plants (Table 2). This indicates that ixora leaves abscised before any senescence symptoms, such as

239

cholorophyll, protein and water loss, could be measured, and hence, this chilling­induced leaf abscission was not correlated with senescence. Thus, chilling-induced leaf abscission cannot be explained on the basis of changes in the auxin-ethylene balance due to senescence [1, 2, 14, 16], but rather on changes induced by the chilling stress itself.

TABLE 2. A comparison ofleaf senescence parameters between leaves detached from non-chilled plants and leaves abscised from chilled plants. Parameters were determined on the 2nd day after storage at 20 or 4°C

Senescence parameter

Amino acids (J..lmol/gFW) Chlorophyll (mg/gFW) Water content (FW-DW/DW)

Type ofleaves Detached from non-chilled plants Abscised from chilled plants

6.63 ± 1.67 6.09 ± 0.37 1.26 ± 0.14 1.32 ± 0.27 2.37 ± 0.42 2.04 ± 0.12

v

Figure I. Photomicrographs of an ixora petiole explant (A) and of longitudinal sections of the AZ prepared immediately (8) or 48 h (C & D) following the chilling treatment (3 days at rC). Magnification xlO in (8); x40 in (C) and (D). G = grove, P = parenchyma cells, V = vascular system.

4.2. CHARACTERIZA nON OF THE ABSCISSION ZONE

The AZ between the petiole and the stem of ixora plants (Fig. I A) is a primary tissue, since it is present as a clear, distinctive tissue with specific cells also throughout normal leaf development. Anatomical analysis of petiole AZ excised from non-chilled plants,

240

from plants immediately following chilling (Fig. I B) or plants 6 h after chilling shows, that it consists of 10-20 layers of specific cells, that differ both in shape and size from the surrounding parenchymatous cells. Thus, morphological changes in the petiole AZ could be initially observed only after 48 h of the post-chilling period (Figs. I C, D). These changes were initially manifested in maceration of the AZ cells (Fig. 1 C), followed later on by enlargement of the grove, leading to formation ofa separation layer and a fracture that fmally separated completely the stem from the petiole (Fig. I D).

4.3. INVOLVEMENT OF ETHYLENE, AUXIN AND OXIDATIVE STRESS

The involvement of ethylene, auxin (NAA) and the antioxidant BHA in the chilling­induced leaf abscission was further examined with petiole explants. The chilling stress resulted in increased ethylene production which peaked 4 h after chilling, reaching rates of 4-5 nl gFWI hoI (data not shown), and lasted for about 6 h after the termination of the chilling treatment (Fig. 2A). Such induction of higher ethylene production rates after chilling stress is a typical response of plants, as to other stresses [9].

A VG significantly reduced ethylene production rates of explants during the first h (Fig. 2A) and 4 h (data not shown) after chilling, but did not nullify it, while NAA and BHA had no significant effects on ethylene production monitored either 1 or 6 h after chilling (Fig. 2A). On the other hand, ACC significantly enhanced ethylene production in explants for 6 h after chilling, with or without NAA or BHA (Fig. 2A).

The effects of these compounds on leaf abscission of explants are illustrated in Fig. 28. The results show that a 70% leaf abscission was obtained in chilled explants incubated in water, already two days after the chilling treatment (Fig. 2B). This chilling-induced leaf abscission was significantly reduced on the second day after chilling to 30, 2 or 10%, in AVG-, NAA- or BHA-treated explants, respectively (Fig. 2B). This suggests that NAA and BHA inhibited both the chilling-induced and the ACC-enhanced leaf abscission of petiole explants, with NAA being more effective. On the other hand, the data show that even the residual ethylene production rate of 1 nl gFWI h- I , obtained in A VG-treated explants (Fig. 2A), was enough to enable a 30% leaf abscission (Fig. 2B). It seems, therefore, that NAA and BHA, which did not affect ethylene production rates of explants (Fig. 2A), were more effective than the ethylene synthesis inhibitor A VG in reducing the chilling-induced leaf abscission (Fig. 2B).

Since A VG was not effective in completely nullifying endogenous ethylene production in explants, attempts were made to antagonize ethylene action in intact plants by exposing them to the relatively new ethylene action inhibitor, I-MCP, which is supposed to block irreversibly all ethylene receptors [17]. Our data show that the chilling-induced leaf abscission was totally prevented after exposure of intact plants (either before or after chilling) to I-MCP. These results clearly indicate that like in other abscission systems [2, 7, 15, 16], the endogenous ethylene rise induced by chilling is essential for the abscission process in ixora. However, this ethylene rise cannot explain solely the leaf abscission induced by the chilling stress, since NAA and BHA seem to reduce the process through modifying the sensitivity of the AZ to ethylene rather than by affecting endogenous ethylene levels.

To further confirm this suggestion, we have examined the effect of exogenous ethylene on leaf abscission of non-chilled and chilled intact plants. Exposure of non-

241

chilled intact plants to ethylene (3-10 11111) for 1-3 days in the dark at 20°C did not cause any leaf abscission [8]. However, exposure of chilled (3 days at 7°C) plants to the same ethylene concentrations significantly enhanced their leaf abscission already on the first day after chilling (data not shown). These results strongly suggest that the chilling treatment significantly increases the AZ tissue sensitivity to ethylene.

Three approaches were examined in this study for reduction of the chilling-induced leaf abscission in petiole explants and intact plants: auxin (NAA), antioxidants (BHA) and inhibitors of ethylene synthesis (A VG) or action (I-MCP). The results show that NAA and BHA reduced leaf abscission by reducing the chilling-induced sensitivity of the AZ to ethylene, whereas ethylene inhibitors reduced the process through their effects on endogenous ethylene production and action. While the effects of I-MCP [17] and A VG [9] are well understood, and the NAA effects regarding the AZ sensitivity to ethylene are well-documented [2, 7, 16], the inhibitory effect of the antioxidant BHA is relatively new. Our data suggest that oxidative processes [18], imposed initially in the tissue upon its exposure to low temperatures [11], are involved in the induction period leading to abscission.

-""" 6 I

.c

"""

c::::J 1 h I'I2J111J 6 h

I 5 ~ ~

LL

~4 c -w 3 z

W ..J 2 > ::I: l- i w

0 ~rn ~

A. _

-

~ -

100

~80 -z ~60 ~

~40 III c(

20

o

~

c:::::J Day 1 B. ~Day2 -

fI: --

r _1'"1 r

Figure 2. Effect of AVa (0.1 mM), NAA (0.1 mM), BHA (0.66 mM) or ACC (0.01 mM) on ethylene production rates (A) and on the chilling-induced leaf abscission (B) of ixora petiole explants. All compounds were applied to petiole explants prior to their exposure to chilling (3 days at 7°C). Results in (A) represent means ± SE oD replicates of3 explants, each consisting of2 AZ's. Results in (B) are expressed as percentage of cumulative leaf abscission, monitored daily (empty or shaded bars) at the observation room, and represent means ± SE of 4 replicates of 10 explants.

In summary, the results of the present study demonstrate that the chilling stress alters the sensitivity of the AZ to ethylene, most likely through increased oxidative processes, which may lead in tum to reduction of IAA levels. The increase in the AZ

242

sensitivity to ethylene rather than the chilling-induced initial ethylene burst, seems to mediate the abscission process manifested in leaf drop within 2-3 days after transfer to 20°C. The IAA treatment seems to prevent abscission by maintaining high levels of endogenous IAA in the AZ, thereby rendering this tissue insensitive to ethylene. The antioxidant treatment may prevent abscission possibly by suppressing oxidative IAA catabolism and maintaining its transport throw the AZ.

5. Acknowledgment

Contribution from the Agricultural Research Organization, The Volcani Center, Bet Dagan, Israel, No. 433-98.

6. References

1. Bayer, Jr., E.M. (1975) Abscission: the initial effect of ethylene is in the leaf blade, Plant Physiol. 55,322-327.

2. Brown, K.M. (1997) Ethylene and abscission, Physiol. Plant. 100,567-576. 3. Doulis, AG., Debian, N., Kingston-Smith, AH. and Foyer, H. (1997) Differential localization of

antioxidants in maize leaves, Plant Physiol. 114, 1031-1037. 4. Ernest, L.C. and Valdovinos, 1.G. (1971) Regulation of auxin levels in Coleus blumei by ethylene,

Plant Physiol. 48, 402-406. 5. Faragher, J.D., Mor, Y. and Johnson, F. (1987) Role of I-Aminocyclopropane-I-carboxylic acid

(ACC) in control of ethylene production in fresh and cold stored rose flowers, J Exp. Bot. 38, 1839-1840.

6. Goren, R. (1993) Anatomical, physiological, and hormonal aspects of abscission in Citrus. Hort. ReViews, 15, 145-182.

7. Lyons, J.M. and Asmundson, C.M. (1965) Solidification of saturated/unsaturated fatty acid mixture and its relationship to chilling sensitivity in plants, J. Amer. Oil Chem. Soc. 42, 1056-1058.

8. Meir, S., Yihye, E., Reuveni, Y. and Philosoph-Hadas, S. (1994) Ethylene and auxin regulation of chilling-induced leaf abscission in, BioI. Plant. 36, S127.

9. Morgan, P.W. and Drew, M.C. (1997) Ethylene and plant responses to stress,. Physiol. Plant. 100, 620-630.

10. Osborne, DJ. (1991) Ethylene in leaf ontogeny and abscission, in AK. Mattoo and J.C. Suttle (eds.), The Plant Hormone Ethylene, CRC press, London, pp. 194-214.

11. Parkin, K.L., Marangoni, A, Jackman, R.L., Yada, R.Y. and Stanley, D.W. (1989) Chilling injury: a review of possible mechanisms, J. Food Biochem. 13, 127-153.

12. Philosoph-Hadas, S., Meir, S. and Abaroni, N. (1991) Effect of wounding on ethylene biosynthesis and senescence of detached spinach leaves, Physiol. Plant. 83,241-246.

13. Prasad, T.K., Anderson, M.D., Martin, B.A. and Stewart, C.R. (1994) Evidence for chilling­induced oxidative stress in maize seedlings and a regulatory role for hydrogen peroxide, The Plant Cell 6, 65-74.

14. Riov, J. and Goren, R. (1979) Effect of ethylene on auxin transport and metabolism in midrib section in relation to leaf abscission of woody plants, Plant Cell Envir. 2,83-89.

15. Saltveit, M.E. and Morris, L.L. (1990) Overview on chilling injury of horticultural crops, in C. Y. Wang (ed.), Chilling Injury of Horticultural Crops, CRC Press, Inc. Boca Raton, pp. 3-15.

16. Sexton, R. (1995) Abscission, in M. Pessarakli (ed.), Handbook of Plant and Crop Physiology, Marcel Dekker, New York, NY, pp. 497-525.

17. Sisler, E.C. and Serek, M. (1997) Inhibition of ethylene responses in plants at the receptor level: Recent developments, Physiol. Plant. 100,577-582.

18. Veda 1., Morita, Y. and Kato, 1. (1991) Promotive effect of Cl8-unsaturated fatty acid on the abscission of bean petiole explants, Plant Cell Physiol. 32, 983-987.

EXPRESSION OF ABSCISSION-RELATED ENDO-~-1,4-GLUCANASES

I. Abstract

G. CASADORO, L. TRAINOTTI AND C.A. TOMASIN Dipartimento di Biologia, Universita' di Padova, Viale G. Colombo 3, 1-35121 Padova, Italy

Activation of abscission by ethylene involves the expression of specific hydro lases whose activity is believed to weaken the structure of cell walls at the level of the zones where the actual shedding will occurr. To this purpose, the role played by endo-~-I,4-glucanase (EGase) appears particularly interesting, so two genes encoding abscission EGases in peach (ppEGl) and in pepper (caEG2), respectively, have been studied. Promoter analysis for the two genes has been carried out in transgenic plants by studying the expression of the l3-glucuronidase (GUS) reporter gene driven by the two promoters. In both cases, a similar pattern of GUS expression was observed in tobacco and Arabidopsis, respectively. In particular, expression of GUS was observed at the level of abscission zones, besides other tissues undergoing cell separation events. Contrary to what occurs in planta, where the expression of the abscission EGase genes appears to be up-regulated by ethylene, a similar effect was not observed for the studied chimeric genes in the transgenic plants.

2. Introduction

It has long been known that ethylene is involved in the physiology of abscission [1]. When young and healthy leaves are treated with this gaseous hormone, a special structure will differentiate at the proximal end of the petiole within a short time from the beginning of the treatment. Plants prior to the natural shedding of organs also normally produce this structure, named abscission zone (AZ). It consists of a few layers of ceils, which undergo a number of metabolic changes finally leading to loss of adhesion and cell separation [6].

Following activation by ethylene, the cells of an abscission zone will start to express genes coding for hydrolases such as endo-~-I ,4-glucanases (EGases) and polygalacturonases [3]. The activity of these enzymes is believed to cause a dismantling of the cell walls at the level of the abscission zone. Albeit information about perception of ethylene and early steps of the signal transduction pathway have recently been obtained [5], the mode by which ethylene activates genes encoding cell wall hydro lases in such a tissue-specific manner remains unknown.

243

244

To try to elucidate this process, endo-j3-1,4-glucanases have been chosen as model enzymes since their expression can be highly increased by ethylene in abscission zones [1, 10]. In particular, it has been shown that specific EGase genes are highly transcribed in abscission zones of peach and pepper plants. In both species the enzyme endo-j3-1,4-glucanase is encoded by a mUltigene family whose members are differentially expressed in different cell separation events. pCell is the transcript that is specifically involved in the abscission of leaves and fruits of peach [12], while cCel2 is the transcript highly expressed in abscission zones ofleaves and flowers of pepper [11].

In this study we report data about promoter analysis of the genes encoding pCell and cCe12, respectively. In particular, this analysis has been carried out in transgenic plants by studying the expression of the j3-glucuronidase (GUS) reporter gene driven by different regions of the two promoters.

3. Results

The genes encoding the pCell and cCe12 mRNAs have been used to obtain the promoters to be analyzed. Genomic clones were isolated and named ppEG 1 (Prunus persica EGase 1) and caEG2 (Capsicum annuum EGase 2), respectively. A fragment of 1650 bp of the ppEGI gene and a fragment of 1894 bp of the caEG2 gene (Fig. 2), respectively, were fused to the GUS reporter gene [8] and used to transform by means of A. tume/adens either tobacco or Arabidopsis plants. Transformation of tobacco was made with the leaf disc method [4], while Arabidopsis was transformed by the vacuum infiltration method [2].

The two large promoter fragments gave a similar pattern of GUS expression in tobacco. Cultivated tobacco is able to shed flowers, while the senescent leaves wilt on the plant. As expected, the promoters of both abscission EGase genes were able to drive expression of GUS in abscission zones of flowers. However, expression of GUS was consistently found with both promoters in other tissues, namely the stigma of flowers and the cortical cells surrounding the lateral root primordia. Also in Arabidopsis the two different promoters were able to drive expression of GUS in abscission events, so the blue colour was observed at the level of abscission zones of the flower components which are normally shed in this plant, that is sepals, petals and stamens (Fig. lA). However, contrary to what was found in tobacco, GUS was expressed in very young anthers, but not in flower stigma (Fig. IB). In tobacco, the three tissues where expression of GUS was observed are all characterized by high levels of endogenous EGase activity [12]. This suggests that transcription factors able to activate a tobacco EGase gene might also be able to bind heterologous EGase promoters, thus causing expression of GUS in those tissues. As for Arabidopsis, similar analyses were impossible to perform due to the minute sizes ofthe tissues involved.

In order to try and explain the tissue-specificity of expression of GUS, deletions of the two promoters (Fig. 2) were used to prepare a series of constructs to be analyzed in transgenic tobacco. The shortest fragment of ppEG 1 , the chimeric gene 31-GUS, was able to drive expression of GUS only at the level of the flower abscission zones (Tab. 1). Constructs 30-GUS and 29-GUS, ranging from 599 to 1014 bp, besides the flower AZ, caused expression of GUS also in the flower stigma. As for the lateral root

245

primordia, the blue colour indicating expression of GUS could be observed only when the whole promoter region (1650 bp construct 27-GUS) was used.

In the case of the caEG2 deletions, the small promoter region (S-GUS, 391 bp) was already able to drive expression of GUS similar to that of the large fragment. The only significant difference between the variously sized fragments was an increase in promoter strength, which paralleled the increase in promoter size.

The possible ability of ethylene to influence expression of GUS in the transgenic plants could only be examined in transformants bearing the ppEG I promoter, and the result was that no apparent promotive effect was observed.

Figure 1. Flowers of transgenic Arabidopsis plant harbouring either 27-GUS or M-GUS stained for GUS activity. In old flowers (A) the typical blue staining is detected in abscission zones of sepals, petals and stamens. In very young flowers the blue staining is evident in anthers.

Table I: Schematic representation 6fthe different tissue-specificity of GUS expression shown by different promoter fragments of the ppEGl gene.

Chimeric gene Fragment length AZ stigma Lateral root (in bp) primordia

31-GUS 406 + 30-GUS 599 + + 29-GUS 1014 + + 27-GUS 1650 + + +

246

1894 bp 11 ..... 1 .. 1 ..... ----II---~I~II-I

o High homology between ppEG1 and caEG2

1 ERE (ATTTCAAA, 7/8 bp), senescence type (7)

• ERE (GCCGCC, 6/6 bp), PR type (9)

L-GUS

868bpl I M-GUS

391bP ....... S-GUS

Pepper caEG2

1650 bp .. I-----I! ..... -II-I 27-GUS

1014 bp I I

599 bp

29-GUS

I I 3O-GUS

406 bp ........ 31-GUS

PeachppEG1

Figure 2. Fragments of the caEG2 and ppEGI promoters that have been fused to the GUS reporter gene and used to assay their regulatory capacity in either tobacco or Arabidopsis plants. ERE: ethylene-responsive element; PR: pathogenesis-related.

4. Discussion

Two EGase genes, which are specifically expressed in abscission zones following activation by ethylene, were isolated and studied in transgenic tobacco and Arabidopsis with the aim to understand the regulation of their tissue-specific expression. The promoters of the two genes did not share any apparent sequence similarity, but for a fragment of about 20 bases in a region not far from the TAT A box (Fig. 2) [13]. On this basis, the only common feature we expected to observe was expression of GUS at the level of abscission zones, and this was true for both promoters in both tobacco and Aabidopsis AZs, thus confirming the idea that the two EGase genes encode abscission EGases.

However, expression of GUS was also seen in other tissues where cell separation events were going on, and the tissues involved were the same for both promoters. So, in spite of the poor sequence similarity, the two promoters had the same regulatory ability, although their behaviour varied in different plants. In particular, while expression of GUS was observed at the level of the female part (stigma) of the tobacco flowers, in Arabidopsis the blue colour was observed at the level of the male component (anthers) of the flower. This finding suggests that the two promoters might be related to more general senescence processes that require cell separation events. Moreover, it is clear from these results that the type of plants where the promoters were assayed could play an important role in determining the type of tissues where the reporter gene could be expressed. In other words, the heterologous system where the promoters were assayed did not behave as a passive system reflecting the only regulatory ability of the introduced foreign promoters.

Contrary to what occurs in planta, where a high rate of expression for both EGase genes was observed following activation of abscission by ethylene, at least in the case of the ppEG 1 gene, the promoter seemed to be insensitive to the hormone. A search for the presence of known ethylene-responsive elements (ERE) showed that in the ppEG 1 promoter (Fig. 2) there was only one ERE of the PR-type [9]. Strictly speaking, in the promoter of the caEG2 gene there was no ERE, albeit a number of these motifs were found which had 7 bases out of the 8 bases determined for a senescence-related ERE in carnation [7].

247

These data suggest that the possible ERE of the two promoters might be located outside the regions analyzed by us. However, we cannot exclude the possibility that ethylene actually triggers the «abscission» genetic programme, a part of which is the expression of EGase genes whose activation by ethylene would therefore be indirect.

5. Acknowledgments

Our research work is supported by grants from CNR and MURST. We wish to thank Mr. Franco Fattore for growing and taking care of the pepper and tobacco plants used in this work. L.T. thanks the TMR-ERBFMMACT95-0032 for providing him with a fellowship to attend the Ethylene Symposium in Santorini.

6. References

I. Abeles, F.B., Morgan, P.W. and Saltveit, M.E. Jr. (1992) Ethylene in Plant Biology, 2nd edn. Academic Press, San Diego.

2. Bechtold, N., Ellis, 1. and Pelletier, G. (1993) In planta Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants,. C.R. Acad. Sci. Paris, Sciences de la Vie/Life sciences, 316, 1194-1199.

3. Bonghi, c., Rascio, N., Ramina, A. and Casadoro, G. (1992) Cellulase and polygalacturonase involvement in the abscission of leaf and fruit explants of peach, Plant Mol. Bioi. 20, 839-848.

4. Fisher, D.K. and Guiltinan, M.J. (1995) Rapid, efficient production of homozygous transgenic tobacco plants with Agrobacterium tumefaciens: a seed-to-seed protocol, Plant Mol. Bioi. Reporter 13,278-289.

5. Fluhr, R. (1998) Ethylene perception: from two-component signal transducers to gene induction, Trends in Plant Science 3,141-146.

6. Gonzales-Carranza, Z.H., Lozoya-Gloria, E. and Roberts, l.A. (1998) Recent developments in abscission: shedding light on the shedding process, Trends in Plant Science 3, 10-14.

7. Itzhaki, H., Maxon, J.M. and Woodson, W.R. (1994) An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-s-transferase CGST!) gene, Proc.Natl. Acad. Sci. USA 91, 8925-8929.

8. Jefferson, R.A., Kavanagh, T.A. and Bevan, M.W. (1987) GUS fusion: ~-glucuronidase as a sensitive and versatile gene fusion marker in higher plants, EMBO J. 6, 3901-3907.

9. Ohme-Takagi, M. and Shinshi, H (1995) Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element, Plant Cell 7, 173-182.

10. Sexton, R. and Roberts, J.A. (1982) Cell biology of abscission, Annu. Rev. Plant Physiol. 33, 133-162.

II. Trainorti, L., Ferrarese, L., Poznanski, E. and Dalla Vecchia, F. (1998) Endo-~-I,4-glucanase activity is involved in the abscission of pepper flowers, J. Plant Physiol. 152,70-77.

12. Trainorti, L., Spolaore, S., Ferrarese, L. and Casadoro, G. (1997) Characterization of ppEGI, a member ofa multigene family which encodes endo-~-1,4-glucanase in peach, Plant Mol. BioI. 34, 791-802.

13. Trainorti, L., Tomasin, c.A. and Casadoro, G. (1998) Characterization of caEG2, a pepper endo-B-1,4-glucanase gene involved in the abscission of leaves and flowers, This book.

DIFFERENTIAL DISPLAY AND ISOLATION OF cDNAS CORRESPONDING TO mRNAS WHOSE ABUNDANCE IS INFLUENCED BY ETHYLENE DURING PEACH FRUIT LET ABSCISSION

l. Abstract

A. RAMINAI, C. BONGHII, J.J. GIOYANNONI2, B. RUPERTI 1 AND P. TONUTTI 1

I Department of Environmental Agronomy and Crop Science, University of Padova, Strada Romea 16-Agripolis-35020 Legnaro, Padova, Italy 2Department of Horticultural Sciences, Texas A&M University, College Station TX 77843, USA

A screening via mRNA differential display resulted in the identification and cloning of nine partial cDNAs corresponding to putative peach ftuitlet abscission-related genes. Five of the nine genes were induced by propylene mediated abscission and four were specifically repressed during this process. None of the isolated genes were specifically induced only in the abscission layer, while at least two corresponded to mRNAs which accumulate in adjacent tissues. DNA sequence analysis demonstrated that two cDNAs show homology to major latex and ~ I ,3-glucanase genes. The major latex-like gene is specifically expressed only in pedicels prior to abscission and is down-regulated by propylene. The 13 I,3-glucanase transcript accumulation is detected in all examined tissues following propylene treatment. The major latex protein and ~ I,3-glucanase genes have been implicated in abscission-related wound healing and plant pathogen defense, respectively.

2. Introduction

Previous research has shown that exogenous ethylene or propylene hastened peach ftuitlet abscission, under both field and lab conditions [5, 18]. Ruperti et al. [19] observed that propylene-flushed peach ftuitlet explants showed a consistent increase in ethylene biosynthesis in abscission zone (AZ3) and surrounding tissues (Non zones, NZ) within 12 h of treatment. In many plants, AZs have been shown to respond to both ethylene and propylene at the molecular level via the induction and accumulation of specific mRNAs and proteins [7, 13, 19]. So far studies of ethylene-regulated AZ proteins have been primarily focused on characterization of cell wall hydro lases. Specifically, 13 1,4-endoglucanase and polygalacturonases have been implicated in abscission of peach fruit and leaves[5], bean leaves [6, 21] and tomato flowers [8, 10].

249

250

Both enzymes are induced by ethylene and accumulate to high levels in AZs of their respective tissues [5, 6, 8, 10].

In addition to cell wall hydrolases, a number of additional genes encoding pathogenesis-related (PR) proteins have been shown to be induced during abscission and in response to ethylene in bean and elder [7, 20].

In peach, with the exception of hydrolytic enzymes, no knowledge exists regarding mRNAs and related polypeptides, which accumulate during abscission. In order to identify mRNAs whose expression is influenced by ethylene during peach fruitlet abscission we have employed mRNA differential display [11]. Recently this technique has been used to isolate plant genes that are expressed in a tissue-specific manner [15, 22]. Here we report the cloning of nine partial cDNAs corresponding to novel mRNAs that show differential accumulation in AZ versus NZs and in response to the ethylene analog propylene.

3. Results

3.1. COMPARISON OF mRNA POPULATIONS

Combinations of eight random primers and three anchor primers were used for a total of 24 differential display amplifications of each RNA sample (pedicel, AZ3 and mesocarp, each plus or minus propylene). Approximately 70 bands were amplified with each primer set on average. Among the estimated 10,080 amplified bands resulting from all differential display reactions performed, 17 were unique to propylene-treated AZ3 and NZ RNAs, while 6 were present only in the AZ3 and NZ tissues prior to treatment. Examples of target differential display-PCR products are shown in Fig. I.

Regions of polyacrylamide gels containing differentially expressed products were isolated and eluted for DNA, which was re-amplified with the same primers used for the original differential display reaction.

3.2. ANALYSIS OF mRNA ACCUMULA nON USING DISPLAY -PCR PRODUCTS AS PROBES

To verify the authenticity of the differential display bands, re-amplified display-PCR fragments were used to probe total RNA gel-blots, carried out as described by Ruperti et al. [19], representing AZ3 and NZ tissues plus or minus propylene treatment. All clones (DD I-DD9) hybridized to RNA species ranging in size from 0.8-1.9 kb. Among the probes derived from RNAs prior to propylene-treatment, DDl and DD4 were detected only at time 0, while DD2 and DD3 were down-regulated during the propylene-induced abscission.

Of the clones selected and derived from propylene-treated RNAs, three (DD5, DD6, DD7) hybridized to mRNAs which were detected only after induction of the abscission process, while two (DD8 and DD9) showed some mRNA prior to propylene treatment and a significant increase of transcript accumulation in association with abscission. Tissue-specific expression among the three tissues examined was shown only for DDI and DD4. RNA gel-blot analysis of DDI confirmed the differential display pattern of

251

pedicel-specific mRNA accumulation. The 004 display-PCR product was observed in both AZ3 and mesocarp, while mRNA accumulation suggests expression primarily in mesocarp prior to propylene treatment. This result is likely due to PCR normalization of the AZ3 cDNA. We have observed similar strong display-PCR amplification products resulting from relatively rare messages as determined from subsequent RNA gel-blot analysis.

Pd o 48

DDI

DD5

AZ3 o 48

M o 48

Figure 1. Differential display denaturing polyacrylamide gel exhibiting ethylene­enhanced or repressed mRNA. Total RNAs from Pedicel (Pd), Abscission zone (AZ3) and Mesocarp (M) at time zero (0) and after 48 h (48) of propylene treatment were reverse transcribed with the anchor primer H-TlIG. The resultant cDNAs were PCR amplified with the same 3' anchor primer and 5'-AAGCTTTGGTCAG-3' (DOl), or S'AAGCTTGATTGCC-3' (DDS) as random primer, respectively. Arrows indicate isolated bands.

Propylene-induced clones (005, 006, 007, 008, 009) were detected via display­PCR in all tissues treated with propylene, and this relative expression pattern was confirmed via RNA gel-blot analysis. An increasing gradient of hybridization signal was observed for 006, 007, 008 and 009 from the pedicel, through AZ3 to the mesocarp, while a similar message accumulation throughout was observed for 005.

3.3. MOLECULAR CLONING AND CHARACTERIZATION OF DIFFERENTIAL DISPLAY cONA FRAGMENTS

Nine display-PCR fragments derived from four time 0 RNAs, and five 48 hour propylene-treated RNAs, were cloned, sequenced, and the resulting data utilized in database searches. Sequence analysis revealed that display-PCR insert sizes ranged from 184 to 470 bp (including primer sequences) and that these sequences were predominantly AT-rich.

Based on comparison to the National Center for Biotechnology Information nonredundant database, only two clones (001 and 005) had significant homology to

252

previously cloned genes. 001 shows significant amino acid homology to the carboxyl­terminus of a major latex protein from opium poppy (36% identity and 54% similarity; Papaver somniferum;[14]) and the predicted polypeptide of the Sn-l wound-related gene from bell pepper (35% identity and 57% similarity; Capsicum annuum; [17]).

The deduced amino acid sequence of the 005 putative coding region shows similarity to basic 1,3 glucanases from tobacco [16], potato[2] and bean [9]. Conserved structural features include a protein kinase-phosphorylase site (TER) and a putative C­terminal extension of 16 amino acids, including a potential glycosylation site (NTTN). No other DO clone showed significant homology to any sequences in the database at either the nucleotide or amino acid level.

Southern analyses were carried out to characterize genes corresponding to DOl and DD5. The hybridization pattern individuated by DDt probe suggests that it is a member of a small gene family, while 005 strongly recognizes only one DNA fragment for all restriction enzymes used and one additional weaker fragment with EcoRI indicating the presence of a single gene and a putative related gene.

4. Discussion

Among the estimated 10,080 bands generated by our peach differential display analysis, only 0.25% showed significant changes of expression pattern among the six tissue/treatments analyzed. While DOl is specific to non-propylene treated pedicels, and DD4 is primarily expressed in untreated mesocarp, no display-PCR products demonstrating AZ3-specific expression were observed. McManus and Osborne [13] compared the profiles of polypeptides extracted from pulvinus, AZ and petioles of ethylene-treated bean leaves and found, apart from some concentration differences, a similar pattern in all three tissue types suggesting few tissue-specific abscission-related genes. In addition, Tucker et al. [23] observed that accumulation of cellulase mRNA (encoding one of the most important enzymes regulating abscission) while most abundant in bean leaf AZ, was also induced in ethylene-treated stems and petioles. In summary, data presented here and by others suggests a relatively small repertoire of abscission-related genes, few of which are truly tissue-specific.

Two of the 9 clones described in this report did show specific expression in the more cleanly isolated pedicel and mesocarp tissues. mRNAs corresponding to both DOl (pedicel-specific) and DD4 (mesocarp-specific) were detected only before propylene­treatment and associated abscission. Subsequent cloning and sequence analysis suggest that DDt has significant homology with a major latex protein from opium poppy [14] and the predicted polypeptide of the wound-related Sn-l gene from bell pepper [17]. The poppy and pepper polypeptides are also related and are likely involved in the sealing off of plant tissue wounds [17]. It would seem plausible that the DOl gene product would play a similar role during abscission for protection of the exposed pedicel against infection and wounding after fruit detachment, especially considering that DDt mRNA accumulates only in the pedicel and prior to abscission. Furthermore, while DDt may pro-actively protect against the eminent exposure resulting from abscission, the Sn-l gene product was shown to increase in green fruit after 15 hr of wounding presumably as a reactive response [17], thus demonstrating a fundamental

253

difference in the regulation of these similar gene products. Finally, Aggelis et al. [I] have isolated a cONA (MEL 7) from a ripe melon cONA library which also shows homology to the major latex proteins, and to which they have proposed a similar protective role. MEL7 mRNA from a ripe melon cONA library accumulates during early ripening stages and is also present at low levels in other melon tissues. Unlike 001, Mel 7 mRNA is induced by ethylene but also apparently repressed by wounding. Southern analyses suggest that 001, Mel7, Snl and major latex protein are members of gene families which, considering different expression, probably have multiple regulatory motifs, including positive and negative regulation by both wounding and ethylene.

A series of five propylene-induced clones (DDS - 009) have also been identified including one (DDS) showing significant homology with basic ~-1 ,3 glucanases from tobacco, potato, and bean. However gene organization of peach basic ~-1,3 glucanases appears more similar to that one in bean [9] and tobacco [16] where a single gene and an additional related gene are present respectively, while differs from that one in potato where a multigene family is found [2]. Basic ~-I, 3 glucanases are involved in plant defense against potential pathogens and mRNAs coding for such enzymes have been shown to be induced by infection, elicitor treatment, ethylene, and wounding [3, 4]. Although ethylene-inducible, DDS did not show tissue-specific expression in that no difference in mRNA accumulation was observed among pedicels, AZ3 and mesocarp following ethylene treatment. This lack of specificity suggests that this clone may accumulate in response to ethylene-regulated process coordinated with the abscission process. For example, during bean leaf abscission, genes whose products are not likely directly involved in organ shed, rather in functions related to tissue senescence and protection against pathogens invasion, are also induced resulting in the accumulation of pathogenesis-related proteins in the abscission zone and adjacent tissues [7].

Two clones (008 and 009) demonstrate an increasing gradient in mRNA accumulation from pedicel, through AZ3, to the mesocarp. A similar gradient has been observed for ethylene content [19], suggesting that expression of the corresponding genes have not been saturated in their ethylene responses and thus are regulated by ethylene concentration [12]. Database searches revealed no significant homology for either of these clones or for 002, 003, 004, or 006. We are currently isolating full­length cONAs corresponding to these genes in an effort to obtain more complete sequence information, which may shed light on their respective functions during peach fruitlet abscission. In addition, to assess at which extent the isolated clones are fruitlet abscission related, expression analysis in other peach vegetative and reproductive tissues is in progress.

5. References

1. Aggelis, A, John, I., Karvouni, Z. and Grierson, D. (1997) Characterization of two cDNA clones for mRNAs expressed during ripening of melon (Cucumis mela L.) fruits, Plant Mol. BioI. 33, 313-322.

2. Beerhues, L. and Kombrink, E. (1994) Primary structure and expression of mRNAs encoding basic chitinase and 1,3-beta-glucanase in potato, Plant. Mol. Bio.124, 353-367.

3. Boller, T. (1987) Hydralitic enzymes in plant disease resistance, in T. Kosuge and E.W. Nester (eds.), Plant-Microbe Interactions: Molecular and Genetic Perspectives, Macmillian, New York, pp. 385-413.

254

4. Boller, T. (1988) Ethylene and the regulation of antifungal hydrolases in plants, in BJ. Miflin (ed.), Oxford Surveys of Plant Molecular and Cell Biology, Oxford University Press, Oxford, pp. 145-174.

5. Bonghi, c., Rascio, N., Ramina, A and Casadoro, G. (1992) Cellulase and polygalacturonase involvement in the abscission ofleafand fruit explants of peach, Plant Mol. Bioi. 20,839-48.

6. del Campillo, E., Reid, P.D., Sexton, R.and Lewis, L.N. (1990) Occurrence and localization of 9.5 cellulase in abscising and no abscising tissue, Plant Cell 2, 245-254.

7. del Campillo, E. and Lewis, L.N. (1992) Identification and kinetics of accumulation of proteins induced by ethylene in bean abscission zone, Plant Physiol. 98, 955-961.

8. del Campillo, E. and Bennett, AB. (1996) Pedicel breakstrength and cellulase gene expression during tomato flower abscission, Plant Physiol. 1I1, 813-20.

9. Edington, B.V., Lamb, CJ. and Dixon, R.A (1991) cDNA cloning and characterization of a putative 1.3-f3-D-glucanase transcript induced by fungal elicitor in bean cell suspension cultures, Plant Mol Bioi. 16,81-94.

10. Kalaitzsis, P., Koehler, S.M. and Tucker, M.L. (1995) Cloning of tomato polygalacturonase expressed in abscission, Plant Mol. Bioi. 28,647-656.

II. Liang, P. and Pardee (1992) Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction, Science 257, 967-971.

12. Lincoln, J.E. and Fischer, R.L. (1988) Diverse mechanisms for the regulation of ethylene-inducible gene expression, Mol. Gen. Gen. 212, 71-75.

13. McManus, M.T. and Osborne, DJ. (1989) Identification of leaf abscission zone as a specific class of target cells for ethylene, in DJ. Osborne and M.B. Jackson (eds.), Cell Separation in Plants Springer-Verlag Berlin, Heindelberg, pp 201-210.

14. Nessler, C.L., Kurz, W.G. and Pelcher, L.E. (1990) Isolation and analysis of the major latex protein genes of opium poppy, Plant Mol. Bioi. 15, 951-953.

15. Oh, B.J., Balint, D.E. and Giovannoni, lJ. (1995) A modified procedure for PCR-based differential display and demonstration of use in plants for isolation of genes related to fruit ripening, Plant Mol. Bioi. Rep. 13, 70-8.

16. Ohme-Takagi, M. and Shinshi, H. (1990) Structure and expression of a tobacco beta-I,3-glucanase gene, Plant Mol. Bioi. 15,941-946.

17. Pouzeta-Romero, J., Klein, M., Houlne, G., Schantz, M.L., Meyer, B.and Schantz R (1995) Characterization of a family of genes encoding a fruit specific wound-stimulated protein of bell pepper (Capsicum annuum): identification of new family of transposable elements, Plant Mol. Bioi. 281011-1025.

18. Ramina, A, Rascio, N. and Masia, A (1989) The abscission process in peach: structural, biochemical and hormonal aspects, in DJ. Osborne and M.B. Jackson (eds.), Cell Separation in Plants Springer-Verlag Berlin, Heindelberg, pp 233-238.

19. Ruperti, B., Bonghi, C., Tonutti, P. and Ramina, A (1998) Ethylene biosynthesis in peach fruitlet abscission, Plant Cell Environ. (in press)

20. Roberts, J.A, Coupe, S.A, Withelaw, C.A. and Taylor, J.E. (1997) Spatial and temporal expression of abscission-related genes during ethylene-promoted organ shedding, in AK Kanellis, C. Chang, H. Kende and D. Grierson (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publisher, Dordrecht, pp 185-190.

21. Sexton, R., Tucker, M.L., del CampiIIo, E.and Lewis, L.N. (1989) The cell biology of bean leaf abscission, in D.l Osborne and M.B. Jackson (eds.), Cell Separation in Plants Springer-Verlag Berlin, Heindelberg, pp 69-78.

22. Tienam, D. and Handa, AK. (1996) Molecular cloning and characterization of genes expressed during early tomato (Lycopersicum esculentum Mill.) fruit development by mRNA differential display, J. Amer. Soc. Hort. Sci. 121, 52-56.

23. Tucker, M.L., Sexton, R., del Campillo, E. and Lewis, L.N. (1988) Bean cellulase. Characterization of a cDNA clone and regulation of gene expression by ethylene and auxin, Plant Physiol. 88, 1257-1262.

THE EFFECT OF AUXINS AND ETHYLENE ON LEAF ABSCISSION OF FICUS BENJAMINA

1. Abstract

N.S. AL-KHALIFAH! and P.G. ALDERSON2

'King Abdulazjz City for Science and Technology (KACST), P.D. Box 6086, Riyadh 11442, Saudi Arabia, 2 University of Nottingham, School of Biological Sciences, Sutton Bonington Campus, Loughborough, Leics., LEI25RD, UK

Removal of part of the new fully expanded leaf lamina of Ficus benjamina cv. Exotica had no effect on abscission of the petiole, whereas removal of the whole lamina caused abscission within 48 hours. One drop (1 1-11 of 0.1 mg!"!) of either indole acetic acid (IAA), indole butyric acid (IBA) or naphthalene acetic acid (NAA) applied to the petiole resulted in a delay in its abscission. IAA delayed the abscission for 5 days, whereas IBA and NAA treated petioles started to abscise after 3 days. By 14 days, comparable numbers of the IAA and NAA treated petioles had abscised, however less of the IBA treated petioles had abscised. The time of application of IAA to petioles in relation to removal of the distal part of the lamina also influenced the delay of abscission. No accumulation of ethylene was observed when the removed leaf laminas were held in sealed culture vessels. In contrast, ethylene accumulation occurred in vitro in sealed culture vessels containing shoots of F. benjamina on MS medium supplemented with 0.2 mgr! benzylaminopurine (BAP). Sealing and size of culture vessel significantly enhanced the percentage of leaves which abscised. Injection of ethylene into cultures immediately after sealing increased abscission, even when the ethylene inhibitor, silver thiosulphate, was present.

2. Introduction

Leaf abscission is a common response of plants to stress imposed by external or internal factors, and hormonal, nutritional and other physiological factors interact to control the onset and rate of abscission [1]. In F. benjamina, abscission has been related to changes in environmental conditions, e.g. water stress and low light intensity [10, 13]. Auxin (fAA) is the major growth hormone controlling abscission in many plants, and when the ability of leaves to produce auxin diminishes, i.e. when they become senescent, they tend to abscise [I]. Removal of the leaf lamina will lead to abscission of the remaining petiole, however this can be delayed by applying auxin to

255

256

the petiole. This paper reports a study of the role of auxin in the abscission ofleaves of F. benjamina by removing its source (leaf lamina) and applying auxins as a substitute, and on the possible relationship with ethylene production by the system.

3. Materials and Methods

3.1. THE EFFECT OF PARTIAL OR COMPLETE REMOVAL OF THE LEAF LAMINA ON ABSCISSION OF THE PETIOLE

Plants of F. benjamina cv. 'Exotica' were grown in Levington M2 compost (Fisons UK) in pots in a glasshouse at 20-26°C until they were 40-50 cm in height, with supplementary lighting to provide a photoperiod of 16 hours and light intensity of >80 Ilmolm-2s-1. Three new fully expanded leaves on each of four plants were used for each of the following treatments: (i) distal y.. of the lamina removed, (ii) distal Yz of the lamina removed, (iii) distal % of the lamina removed, (iv) the whole lamina removed and (v) the whole lamina removed and 1 III of 0.1 mgr1 IAA applied to the petiole stump. The incidence of petiole abscission was recorded for each treatment at intervals of24 hours up to 120 hours as the cumulative number of petioles which had dropped or which dropped when lightly touched with forceps.

3.2. THE EFFECT OF TYPE OF EXOGENOUS AUXIN AND TIME OF APPLICATION ON ABSCISSION OF THE PETIOLE

Leaf lamina were removed leaving petioles which were treated with one drop (l Ill) of either IAA, IBA or NAA (all at 0.1 mgr1). Twelve petioles were treated with each auxin and twelve control petioles did not receive any auxin. Starting at 48 hours from setting up the treatments, the incidence of abscised petioles was recorded at 24 hour intervals for 14 days.

Using four plants, 1 III of 0.1 mgr1 IAA was applied to the petiole of twelve leaves 15 min, 30 min, 1 hour, 2 hours, 24 hours and 48 hours after removal of the lamina. These treatments were compared to a control (no auxin). Removed laminas were held in sealed culture vessels for 3 days to monitor ethylene accumulation, as described below.

3.3. THE EFFECT OF SIZE OF CULTURE VESSEL AND PLANT DENSITY ON ETHYLENE ACCUMULATION

Single shoots of F. benjamina cv. 'Cleo' were cultured in vitro for 10 weeks in 70 ml glass jars containing 15 ml MS medium [8] supplemented with 0.2 mgr1 BAP, or 3 shoots in 350 ml glass jars containing 40 ml of the same medium. At the end of this period, five of the 70 ml jars and five of the 350 ml jars were sealed with Nescofilm (Bando Chemicals, Tokyo) for four weeks, after which ethylene was monitored by taking a 1 ml sample from the head-space of each vessel and injecting it into a gas chromatograph (GC, PV 4500, Pye-Unicam, Phillips, UK) fitted with an alumina Fl JJ column (JJ Chromatography Ltd, Kings Lynn, UK) maintained at operating

257

temperature of 110°C and equipped with a flame ionisation detector heated to 130°C. Nitrogen and hydrogen were supplied as the carrier gases at flow rate of 40 ml min'! and an air flow rate of 500 ml min'! was used. The system was calibrated prior to each reading by injecting 1 ml of 10 ppm ethylene, i.e. ethylene at 1% in nitrogen [7]. The three treatments comprised normal 70 ml jars, sealed 70 mljars and sealed 350 mljars.

3.4. THE RESPONSE OF F. BENJAMINA CULTURES TO INTERNAL AND EXTERNAL SOURCES OF ETHYLENE

Shoot tips of 'Cleo' were sub-cultured individually in 100 ml glass jars containing 20 ml MS medium supplemented with 0.2 mgr! BAP and 0.5 mgr! GA3. In one treatment (STS), the medium was supplemented with 12.5 mlr! silver thiosulphate (stock solution prepared by dissolving 5 g silver nitrate plus 0.85 g sodium thiosulphate in 1 litre of water). The cultures were grown for 8 weeks until there were between 4 and 8 leaves per jar. The numbers of green and abscised leaves were recorded, then 5 replicates of cultures with and without STS were sealed and the remainder were left unsealed. Eight weeks after sealing, the numbers of green and abscised leaves were recorded and ethylene was monitored. The culture vessels which had not previously been sealed were sealed, and 5 ml of 10 ppm ethylene was injected in three replicates of each of the four treatments based on the time of sealing and presence of STS, i.e. early versus late sealing and with and without STS. Three weeks after injecting the ethylene, the number of green and abscised leaves were recorded and the concentration of ethylene in culture vessels was monitored.

4. Results

Partial removal of the leaf lamina had no effect on abscission of the petiole (Fig. 1). Even retention of one quarter of the leaf lamina provided sufficient stimulus for the petiole not to be abscised. In contrast, removal of the whole leaf lamina caused 100% abscission within 72 hours. The addition of a drop of IAA delayed abscission for 120 hours, but it eventually reached 100% after 14 days.

All of the auxins tested delayed abscission compared to the control. IAA retarded abscission for 5 days, whereas IBA and NAA treated petioles started to abscise after 3 days. After 14 days, 78% and 89% of petioles had abscised in the IAA and NAA treatments respectively, however only 33% of the IBA treated petioles had abscised. All of the control petioles had abscised by day 5.

The application of auxin to petioles 15 min, 30 min, 1 hour and 2 hours after removal of the lamina delayed their abscission for 5 days, at which time 10% of each treatment had abscised (Fig. 2). The control petioles, and those treated after 24 hours or 48 hours, started to abscise within 3 days. Abscission increased with time showing a similar response for all treatments, however by day 14 the control treatment had reached 100% abscission, whereas the 15 min treatment showed at least 50%. Accumulation of ethylene was not detected in the sealed culture vessels containing removed laminas.

258

#. c 0 'w .!!l 0 U) ..n «

~

t j

~

i j

100 r--'

80 I

60 ! I

40 I I

! /

r: ~-------------(J-fi--.

20 I

0~-4*~**--~~_4--+__+~~1_~--~~ 1< ; ; ; ; + ; + • ; --+-...J 7 9 10 11 12 13 14 15

Figure J. Effect of partial or complete removal ofleaf lamina on the abscission of petioles in F. benjamina cv. "exotica" (n=12) • V. lamina + 114 lamina

1 2 3 4 5 6 8

100

80

60

40

20

o 1

0.5

0.4

0.3

0.2

0.1

0'

Time (days)

~

/~------Jl.'/-- ___ -------------~ %" K"'"

* .+- ..... Xc

k )f-. -'K *" ~ "* ···x ....

----~.~. --- ..... ~ _. 2 3 4 5 6 789

Time (days)

x

x x x

x x

. =</'""'

o 'I. lamina • whole lamina * whole lamina+IAA added

10 11 12 13 14

Figure 2. Effect of the time of auxin application after removal of leaf lamina on abscission of petioles in F. benjamina cv.

15 "exotica" (n=12)

---'---'- -'---"-l

!

.15 min + 30 min o I hour .2 hours * 24 hours • 48 hours A no auxin

Figure 3. The '" x' relationship -L~"'c~ ___ --><~ between ethylene

-0.1 I ~~" "~ J' production in the

L _________________ ~ cultures of F. 5 25

0.5.

0.4

0.3 i

0.2

0.1

• • 0

-0.1 0 20

45 65

Total green leaf area (cm~)

•

.. • • •

40 % of leaves abscised

85

• . ....-.

60

•

benjamina and green leaf area (Y'=O.0314058· O.0041X, R=O.614)

Figurei-. The relationship between ethylene production in the cultures of F. benjamina and the percentage of

80 leaves abscised (Y'=O.0358+0.004 173X, R=O.64 7)

259

The ethylene concentration in sealed 70 ml culture vessels was significantly higher than in the unsealed vessels and was five times greater than in the sealed 350 ml vessels. During the period that the vessels were sealed, growth of the cultures (i.e. leaf number and leaf area) was promoted. At the end of the fourth week, abscission was stimulated resulting in a reduction in green leaf area, which was correlated with the increase in ethylene concentration (Fig. 3). However, the total area of the abscised leaves was not affected by ethylene concentration. The sealing and the volume of the vessel affected the percentage of leaves, which abscised, and the relationship with ethylene was significant (p:::;;0.001) (Fig. 4).

Sealing of the culture vessels did not increase the accumulation of ethylene in the STS treatments, as ethylene production was clearly inhibited by STS in the medium. The presence of STS removed any differences between the early and late sealed cultures as regards leaf production and leaf abscission. The injection of ethylene increased abscission only in cultures, which had been sealed late, with and without STS.

5. Discussion

Auxin appeared to be responsible for delaying or preventing the abscission of F. benjamina leaves. Auxins produced in the leaf lamina are transported through the petiole into the stem and, when the leaf ages or is exposed to removal of the lamina or physiological damage, the auxin status declines reSUlting in abscission [1, 3]. Removal of as much as three quarters of the leaf lamina of F. benjamina did not result in abscission, even after two weeks. This indicates that a small part of the leaf is capable of producing enough auxin to prevent abscission. Delaying leaf abscission by the application of auxin on the distal end of the petiole has also been reported for bean and Coleus [2]. The prolific growth of callus from tissues of F. benjamina in vitro supports the view that the plant is rich in auxins, and that, as soon as the transport of auxin is disturbed, abscission will occur.

The time of applying the auxin to the petiole after removal of the leaf lamina revealed that the abscission zone is "insensitive" to the absence of auxin for up to 2 hours. When auxin was applied at or after 24 hours, there was a delay in the abscission of some of the petioles as compared with the petioles not receiving any auxin. This suggests that the lag phase (Stage I) of the time course of abscission of F. benjamina leaves is less than 24 hours, after which the separation phase (Stage II) takes place depending on the availability of ethylene either as wound ethylene or applied ethylene, which is necessary to trigger and complete separation during the ensuing 24 hour period [9]. Complete separation of 100% of the control (no auxin) petioles of F. berljamina took between 72 and 96 hours. Osborne [9] reported that full separation of leaves may take 90 hours, and it is known that the duration of the lag phase is dependent on the auxin status of the tissue [5].

The abscission of leaves by plants of F. benjamina grown in a glasshouse and exposed to environmental stress is considered to be ethylene mediated [4, 11]. The accumulation of ethylene has been reported by Jackson et al. [6] for plants grown in

260

vitro and less so for plants grown in vivo. In the present study, sealing in vitro cultures of F. benjamina, even though it increased ethylene accumulation and the level of this accumulation decreased with the increase in volume of culture vessel, did not increase leaf abscission until the cultures had been sealed for a long time. This suggests that ethylene may not be the key factor in leaf abscission in F. benjamina in vitro or in vivo. In the presence of STS there was less accumulation of ethylene in cultures, however this did not prevent abscission. This supports the findings of Steinitz et al. [12], that STS did not reduce leaf abscission. It is possible that the conclusion reached by Addicott [1], namely that ethylene accumulation may follow abscission rather than preceding it, is more appropriate for F. benjamina, however further experimentation is required to prove this.

6. References

1. Addicott, F.T. (1991) Abscission: shedding of parts, in AS. Raghavendra (ed.), PhySiology of Trees, John Wiley & Sons, New York.

2. Devlin, RM., Francis, H. and Witham, R.D. (1983) Plant Physiology. Wadsworth, California. 3. Galston, AW. and Davis, PJ. (1970) Control Mechanisms in Plant Development, Prentice-Hall

Inc., Englewood. 4. Graves, W.R and Gladon, R.I. (1985) Water stress, endogenous ethylene and Ficus ber1famina

leaf abscission, HortScience 20, 273-275. 5. Jackson, M.B. (1970) Ethylene, the natural regulator ofleaf abscission, Nature 225, 1019-1022. 6. Jackson, M.B., Belcher, AR and Brain, P. (1994) Measuring shortcomings in tissue culture

aeration and their consequences for explant development, in PJ. Lumsden, J.R Nicholas and WJ. Davies (eds.), Physiology, Growth and Development of Plants in Culture, Kluwer Academic Publishers, Dordrecht, pp. 191-203.

7. Joyce D.C., Reid, M.S. and Evans, RY. (1990) Silver thiosulfate prevents ethylene-induced abscission in holly and mistletoe, HortScience 25, 90-92.

8. Lemos, E.E.P. and Blake, J. (1994) Leaf abscission in micropropagated sugar apples (Annona squamosa L.), in PJ. Lumsden, J.R Nicholas and W.J. Davies, WJ. (eds.), Physiology and Development of Plants in Culture, Kluwer Academic Publishers, Dordrecht, pp 227-233.

9. Murashige, T. and Skoog, F. (1962) A revised medium for rapid growth and bioassay with tobacco tissue cultures, Physiol Plant. 15,473-497.

10. Osborne, DJ. (1973) Internal factors regulating abscission, in T.T. Kozlowski (ed.), Shedding of Plant Parts, Academic Press, London.

11. Peterson, J., Sacalis, J.N. and Durkin, DJ. (1980) Promotion of leaf abscission in intact Ficus benjamina by exposure to water stress, J. Amer. Soc. Hort. Sci. 105, 788-793.

12. Reid, M.S. (1985) Ethylene and abscission, HortScience 20, 45-50. 13. Steinitz, B., Benijaacov, J., Ackerman, A and Hagiladi, A (1987) Dark storage of three cultivars

of bare-root Ficus benjamina foliage plants, Scientia Hort. 32,315-322. 14. Turner, M.A, Reed, D.W. and Morgan, D.L. (1987) A comparison of light acclimatization

methods for reduction of interior leaf drop in Ficus spp, J. Env. Hort. 5, 102-104.

EFFECT OF ETHYLENE ON THE OXIDATIVE DECARBOXYLATION PATHWAY OF INDOLE-3-ACETIC ACID

1. Abstract

R. GOREN, L. WINER AND J. RIOV The Kennedy-Leigh Centre for Horticultural Research, The Hebrew University of Jerusalem, Rehovot 76100, Israel

Auxin-ethylene interactions are involved in various physiological processes. One of the common examples for this is the abscission process in which ethylene-induced reduction in auxin level in the abscission zone is a prerequisite for the ability of ethylene to act directly in this tissue to induce the synthesis of cell wall degrading enzymes. In Citrus (Citrus sinensis L. Osbeck), ethylene treatment significantly induces the degradation of indole-3-acetic acid (IAA) via the oxidative decaroboxylation pathway, resulting in the accumulation of indole-3-carboxylic acid (lCA). The suggested pathway, leading to the formation of ICA, is as follows: IAA~indole-3-methanol~indole-3-aldehyde~ICA. In the present study we were able to verify the above steps by the isolation of the enzymes involved and the identification of their products. Ethylene has been found to stimulate only the first step of this pathway, i.e. IAA decarboxylation, which leads to the formation of indole-3-methanol. It has long been suggested that peroxidase or a specific form of the peroxidase complex ("IAA oxidase") catalyze this step. However, we did not observe any significant effect of ethylene on the peroxidase system. An alternative possibility that the stimulative effect of ethylene on IAA catabolism results from increased formation of H20 2, a co­factor for peroxidase, has been verified either by direct measurements of H20 2 or by assaying the activity of enzymes which reduced H20 2 or respond to formation of oxygen species in ethylene-treated tissues. An additional support for this possibility comes from experiments demonstrating that IAA decarboxylation in control tissue was enhanced to the level detected in ethylene-treated tissues by application ofH20 2•

2. Introduction

Auxin-ethylene interactions play a role in various physiological processes. A good example for this is the abscission process, in which auxin retards abscission whereas ethylene stimulates it. The classical model of natural leaf abscission prostulates that the elevated level of ethylene in the senescing leaves triggers abscission by lowering auxin level in the leaf blade and inhibiting its transport to the abscission zone [9, 10]. The mechanism by which ethylene reduces the endogenous level of indole-3-acetic acid

261

262

(lAA) has been widely investigated. Ethylene has been shown to increase the conjugation and the decarboxylation of both exogenous and endogenous IAA [11 and literature cited therein]. Sagee et al. [11] have shown that ethylene significantly enhanced the catabolism of [14C]IAA to indole-3-carboxylic acid (lCA) in citrus leaf tissues, indicating that increased oxidative decarboxylation of IAA may be the major mechanism by which ethylene reduces IAA level in citrus tissues.

In vitro studies of the oxidative decarboxylation of IAA catalyzed by horseradish peroxidase or cell-free systems indicate that 3-methyleneoxindole and indole-3-aldehyde (lAId) are the major metabolites [13]. However, if a suitable electron donor is added to the reaction mixture, a substantial amount of indole-3-methanol (1M) is formed [6]. 1M and ICA have been established as natural constituents in plant tissues [12, 14] and these indoles or their glucose esters are formed after application of labelled IAA to plant organelles and excised tissues other than Citrus [1, 16]. ICA is thought to be derived from 1M via lAId [6].

The aim of the present research was to elucidate the biochemical pathway of IAA catabolism leading to the formation ofICA and particularly to define at which step(s) of this pathway ethylene exerts its stimulative effect.

3. Materials and Methods

3.1. PLANT MATERIAL

Leaves from the current year spring flush were taken from established trees of Citrus sinensis [L.] Osbeck, cv 'Shamouti Orange'. Leaves were separated to midrib and blade sections after treatment with ethylene.

3.2. ETHYLENE TREATMENT

Whole leaves were treated with 40lll.rl ethylene by means of a flow system. For studying the effect of ethylene concentration and 2,5-norbomadiene (NBD) on IAA decarboxylation, leaves were incubated in sealed 20L containers, and ethylene was injected into the containers to obtain the desired concentration.

3.3. IAA DECARBOXYLATION

Three hundred mg ofleafblade or midrib sections were incubated in 1 ml of20 mM K­phosphate-citric acid buffer (pH=4.6) with 200,000 dpm of ['4C]IAA (Amersham). The 14C02 released during incubation for 1 h in sealed flasks was trapped by 'Soluene' (packard) adsorbed on two filter paper discs, 8 mm in diameter. Radioactivity in the discs was determined by means of a liquid scintillation counter. When the effect of various inhibitors and cofactors was studied, they were preincubated with the tissue for 30 min before the addition oflabelled IAA.

263

3.4. ENZYME ACTIVITY

3.4.1. Peroxidase Guaiacol-peroxidase activity was assayed in crude extracts (60 mM K-phosphate buffer, pH=6.2) or purified fractions by measuring the increase in absorbance at 420 nm between 15 and 45 sec. after the initiation ofthe reaction.

Peroxidase from different cell compartments was obtained by successive extractions of midrib tissue as follows: (a) Free space peroxidase by centrifuging at 1,500 x g for 5 min. (b) Ionic bound peroxidase by extraction with 100 mM KCI followed by centrifugation as above. (c) Cytosolic peroxidase by grinding in K-phosphate buffer.

Peroxidase isozyme pattern was determined by vertical starch gel electrophoresis [2].

3.4.2. fAA oxidase IAA oxidase activity was determined in crude extracts (100 mM K-phosphate buffer, pH=6.0) or purified fractions by measuring the residual IAA in the reaction mixture at 530 nm with Salkowsky reagent.

3.4.3. Glutathione reductase Glutatione reductase was assayed in crude extracts (60 mM K-phosphate buffer, pH=6.2) containing 200 mg.ml-1 polyvinylpolypyrrolidone. Activity was determined by measuring the conversion of NADPH to NADP at 340 nm in the presence of oxidized glutathione.

3.5. DETERMINATION OF ENDOGENOUS H20 2

H20 2 was determined by two different methods: (a) Horseradish peroxidase-catalyzed oxidation of scopoletin, which results in the quenching of its flourescence, in the presence of H20 2 leaking from midrib sections [4]. (b) Oxidation of 3,3'­diaminobenzidine tetrachloride infiltrated into the tissues. The amount of H20 2 is evaluated by the area of dark spots appearing as a result of the reagent oxidation.

4. Results and Discussion

Incubation of partially purified protein fractions obtained from extracts of midrib tissue with 1M or lAId revealed the presence of two enzymes in the extracts: (a) 1M oxidase, which catalyzes the conversion of 1M to lAId (Winer, Goren and Riov, in preparation) and (b) lAId oxidase, which catalyzes the conversion of lAId to ICA [17]. These observations confirm that the oxidative decarboxylation of IAA indeed involves the following steps: IAA~IM~IAld~ICA [6]. Activity of the above two enzymes was unaffected by ethylene, and, therefore, we focused on the first step of the pathway, i.e. the decarboxylation of lAA to 1M.

Ethylene treatment increased the decarboxylation of IAA in leaf tissues by many folds. The effect of ethylene on IAA decarboxylation was more pronounced in midrib tissue than in leaf blade tissue and all further studies were conducted with midrib tissue. A time-course study showed that the decarboxylation of IAA was quite rapid, occurring mostly during the first h after the addition of labelled IAA. IAA decarboxylation

264

increased with the rise of ethylene concentration from zero to 40 /lLr' and then leveled off. NBD, an inhibitor of ethylene action, blocked the stimulative effect of ethylene on IAA decarboxylation at 4000 /lLr', indicating that the stimulative effect of ethylene on IAA decarboxylation is specific.

It has long been suggested that IAA decarboxylation is catalyzed by peroxidase [cf. 2]. Although we observed that ethylene stimulated peroxidase activity by 1.5-fold, it is not likely that this increase is responsible for the enhanced decarboxylation induced by ethylene. Peroxidase activity under normal conditions is quite high and, therefore, it does not seem reasonable that it is the limiting factor in IAA decarboxylation. Ethylene did not induce significant changes in the peroxidase isozyme profile nor in peroxidase activity in various cell compartments, ruling out the possibility that ethylene affects a specific peroxidase, which is responsible for IAA decarboxylation. Furthermore, comparison of the distribution of IAA oxidase to that of peroxidase in gel filtration fractions showed a quite similar pattern of distribution.

Phenolic compounds are known to regulate the oxidation of IAA by peroxidase [7]. Accordingly, we studied the effect of chlorogenic acid and caffeic acid, which have been shown to inhibit peroxidase activity, on ethylene-induced IAA decarboxilation. Both compounds inhibited completely the reaction, indicating that peroxidase also catalyzes the ethylene-stimulated IAA decarboxylation.

Since we were unable to obtain significant evidence that increased peroxidase activity is responsible for the stimulation of IAA decarboxylation by ethylene, we investigated the possibility that increased formation of H20 2 following ethylene treatment is the causal agent for the ethylene effect. Addition of 5 mM H20 2 to control and ethylene-treated midrib sections significantly enhanced IAA decarboxylation. In the presence of H20 2, IAA decarboxylation in the control was only slightly lower than that in ethylene-treated tissue. This suggests that H20 2 may be the limiting factor in IAA decarboxylation, and that ethylene acts in this system by stimulating its synthesis. This assumption is supported by the observations that endogenous H20 2 concentration in ethylene-treated tissue was significantly higher than that in the control. These observation are in accordance with previous reports showing elevated H20 2

concentrations under various conditions which are also characterized by increased ethylene biosynthesis [5]. A close relationship between the rise of ethylene biosynthesis and the level of peroxides has been shown to occur during senescence of plant tissues [15].

Additional evidence for the increase in H20 2 concentration by ethylene is provided by the significant increase in glutathione reductase activity in ethylene-treated midrib tissue. Glutathione peroxidases, to which group glutathione reductase belongs, is a family of multiple isozymes which catalyze the reduction of H20 2, organic hydroperoxides and lipid hydroperoxide by reduced glutathione, and thus help to protect the cells against oxidative stress. Increased activity of the enzyme can be considered as a response to the accumulation of peroxides in the tissues. Meir et al. [8] also observed an increased activity of glutathione reductase under chilling stress, which also induced increased IAA decarboxylation.

In conclusion, we provided evidence that the stimulation of the oxidative decarboxylation pathway of lAA by ethylene involves only increased decarboxylation of IAA, which leads to the formation of 1M. 1M is then oxidized spontaneously to ICA

265

via lAId. The decarboxylation of IAA is catalyzed by peroxidase, the activity of which is regulated by the availability of H20 2. The enhancement of IAA decarboxylation was not accompanied by a significant increase in peroxidase activity. Thus, increased decarboxylation of IAA by ethylene can be explained by accumulation of H20 2

following treatment with the hormone.

5. References

1. Brown, B.H., Crozier, A, and Sandberg, G. (1986) Catabolism of indole-3-acetic acid in chloroplast fractions from light-grown Pisum sativum L. seedlings, Plant Cell. Environ. 9, 527-534.

2. Gaspar, T., Goren, R., Huberman, M., and Dubucq, M. (1978) Citrus leaf abscission. Regulatory role of exogenous auxin and ethylene on peroxidases and endogenous growth substances, Plant, Cell Environ. 1, 225-230.

3. Grambow, HJ. and Langenbeck-Schwich, B. (1983) The relationship between oxidase activity, peroxidase activity, hydrogen peroxide, and phenolic compounds, in the degradation of indole-3-acetic acid in viiro, Planta 157,131-137.

4. Holm, T.R., George, G.K. and Barcelona, MJ. (1987) Fluorometric determination of hydrogen peroxide in groundwater, Anal. Chemi. 59, 582-586.

5. Ievinsh, G. and Ozola, D. (1997) Ethylene and the defense against endogenous oxidative stress, in higher plants, in AK. Kanellis, C. Chang, H. Kende and D. Grierson (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 217-228.

6. Langenbeck-Schwich, B. and Grambow, HJ. (1984) Metabolism of indole-3-acetic and indole-3-methanol in wheat leaf seedlings, Physiol. Plant. 61,125-129.

7. Lee, T.T., Starratt, AN., and Jevnikar, J.J. (1982) Regulation of enzymic oxidation of indole-3-acetic acid by phenols: structure-activity relationships, Phytochemistry 21,517-523.

8. Meir, S., Michaeli, R., Riov, J. and Philosoph-Hadas, S. (1998) Involvement of oxidative processes and plant growth substances in the chilling-induced leaf abscission of ixora flowering potted plants, 17'h Inti. Con! Plant Growth Substances, Chicago.

9. Morgan, P.W. (1984) Is ethylene the natural regulator of abscission? in Y. Fuchs and E. Chalutz (eds.), Biochemical, Physiological and Applied Aspects of Ethylene, Martinus Nijhoff Dr. Junk, The Hague, pp. 231-240.

10. Osborne, DJ. (1989) Abscission, CRC Crit. Rev. Plant Sci. 8,103-129. 11. Sagee, 0., Riov, J. and Goren, R. (1990), Ethylene-enhanced catabolism of [14C]indole-3-acetic

acid to indole-3-carboxylic acid in citrus leaf tissues, Plant Physiol. 92,54-60. 12. Sandberg, G., Jensen, E., and Crozier, A (1984) Analysis of indole-3-carboxylic acid in Pinus

sylvestris needles, Phytochemistry 23, 99-102. 13. Sembdner, G., Gross, D., Liebisch, H.-W. and Schneider, G. (1980) Biosynthesis and metabolism

of plant hormones, in 1. MacMillan (ed.), Hormonal Regulation of Development, I. Encyclopedia of Plant Physiology (New Series), Vol. 9, Springer-Verlag, Berlin, pp. 281-444.

14. Sundberg, B., Sandberg, G. and Jensen, E. (1985) Identification and quantification of indole-3-methanol in etiolated seedlings of Scots pine (Pinus sylvestris L.), Plant Physiol. 77,952-955.

15. Sylvestre, I., Droillard, M.-J., Bureau, 1.M. and Paulin, A (1989) Effects of the ethylene rise on the peroxidation of membrane lipids during senescence of cut carnations, Plant Physiol. Biochem. 27, 407-413.

16. Weise, G. and Grambow, HJ. (1986) Indole-3-methanol-p-D-glucoside and indole-3 acitic acid degradation in wheat leaf segments, Phytochemistry 25, 2451-2455.

17. Winer, L., Riov, J. and Goren, R. (1993) Catabolism of indole-3-acetic acid in citrus leaves: identification and characterization of indole-3-aldehyde oxidase, Physiol. Plant. 89,220-226.

AN ARABIDOPSIS ETRI HOMOLOGUE IS CONSTITUVEL Y EXPRESSED IN PEACH FRUIT ABSCISSION ZONE AND MESOCARP

P. TONUTTI, C. BONGHI, B. RUPERTI, A. SCAPIN AND A. RAMINA Department of Environmental Agronomy and Crop Science, University of Padova Agripolis, 35020 Legnaro, Padova, Italy

1. Introduction

Ethylene perception in plants is coordinated by multiple hormonal receptor candidates sharing sequence similarity with prokaryotic environmental sensor proteins known as two-component regulators. A series of experimental evidences indicates that Arabidopsis ETRI plays a primary role in a coordinating ethylene perception and response [2]. Arabidopsis ETRI represents just one member of a family of ethylene receptor candidates in this species [3]. The isolation of the Arabidopsis ETR 1 has facilitated exploitation of other species as model systems for studying ethylene perception. Arabidopsis ETRI homologues have been identified in several species. Herein some preliminary data on an Arabidopsis ETRI homologue found in peach are presented.

2. Results

2.1. PP-ETRI CLONE ISOLATION AND GENE FAMILY ORGANIZATION OF PEACH ETRI HOMOLOGUE

To isolate Arabidopsis ETRI homologous peach genes, a genomic library from Prunus persica L. Batsch, cv Springcrest, was constructed in ADASH II vectors. The library was screened, as described by Sambrook et ai., [4], using a cDNA encoding for ETRI Arabidopsis [I]. This screen identified 4 positive recombinant phage. These phages, after digestion by EcoRI, have been analyzed in Southern analysis, carried out with ETR 1 cDNA, that revealed a 4.3 kb hybridization band in each phage. A partial sequencing of the PP-ETRI genomic clone pointed out that it included the histidine kinase domain end and the beginning of the receiver domain. This region showed high homology with apple [accession number AF 032448] (>90%), tomato [6] and Arabidopsis [I] (>80%) ETRI. Southern analysis performed using a PP-ETRI cDNA probe on genomic DNA digested with EcoRI, BamHI and PstI indicates that at least three or more ETRl Arabidopsis homologous genes exist in peach.

267

268

2.2. PP-ETRI GENE EXPRESSION

PP-ETRI expression has been studied throughout peach fruit development, which is traditionally divided into four stages (Sl, S2, S3 and S4). Sl and S4 are characterized by high ethylene biosynthetic rates, whereas during S2 and S3 ethylene biosynthesis remains at a basal level. Northern analysis, carried out as described by Tonutti et al., [5], shows that PP-ETRI mRNA (2.8 kb) is constitutively expressed in mesocarp throughout fruit development. The same pattern was observed for TAEI (ETRI homologue in tomato) during tomato fruit ripening [6]. In activated fruitlet abscission zone (AZ3) and surrounding tissues (pedicel and mesocarp), no difference in terms of PP-ETRI expression has been observed, although significant changes in ethylene biosynthesis were recorded. In tomato leaf and flower abscission system (abscission zone and adjacent tissues), no difference of TAEI mRNA accumulation was detected. Moreover, treatments with ethylene or inhibitors of its action performed in the same tissues did not affect TAEI expression level. This would suggest that TAEI transcription is ethylene-independent [6].

3. Conclusions

An Arabidopsis ETRI homologous clone (PP-ETR1) has been isolated from a peach genomic library. Southern analysis suggests that at least three or more ETRI related genes exist in peach. PP-ETRI appears to be constitutively expressed in mesocarp and in fruitlet abscission system. During the abscission induction, no changes of PP-ETRI expression were observed in abscission zone and surrounding tissues.

4. Acknowledgements

The authors gratefully acknowledge the gift of the cDNA coding for Arabidopsis ETRI by Dr. C. Chang, Department of Cell Biology and Molecular Genetics, University of Maryland, College Park.

5. References

1. Chang, C., Kwok, S.F., Bleecker, AB. and Meyerowitz, E.M. (l993) Arabidopsis ethylene response gene ETRI: similarity of product to two-component regulators, Science 262, 541-544.

2. Chang, C. and Stuart, R.C.(1998) The two component system, Plant Physiol. 117, 723-731. 3. Sakai, H., Hua, 1., Chen, Q.G., Chang, C., Medrano, L.J. Bleecker, AB. and Meyerowitz, E M.

(l998) ETR2 is an ETRI-Iike gene involved in ethylene signaling in Arabidopsis. Proc. Natl. Acad. Sci USA 95, 5812-5817.

4. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning a Laboratory Manual, Cold Spring Harbor Laboratory, New York.

5. Tonutti, P., Bonghi, C., Ruperti, B., Tomielli, G.B and Ramina, A (1997) Ethylene evolution and 1-aminocyclopropane-I-carboxylate oxidase gene expression during early development and ripening of peach fruit, J. Amer. Soc. Hort. Sci. 122, 642-647.

6. Zhou, D, Kalaitzis, P., Matoo, AK. and Tucker, M.L. (l996) The mRNA for an ETRI homologue in tomato is constitutively expressed in vegetative and reproductive tissues, Plant Mol. Bioi. 30, 1331-1138.

CHARACTERIZATION OF CAEG2, A PEPPER ENDO-B-l,4-GLUCANASE GENE INVOLVED IN THE ABSCISSION OF LEAVES AND FLOWERS

L. TRAINOTTI, C.A. TOMASIN AND G. CASADORO Dipartimento di Biologia, Universita' di Padova, Viale G. Colombo 3, /-35 I 2 I Padova, Italy

1. Introduction and Results

In pepper high amounts of endo-f3-1,4-glucanase (EGase; E.C. 3.2.1.4) activity are expressed during the abscission of leaves and flowers. Like in other plants, also in pepper this enzyme is encoded by a mUltigene family and the cCel2 mRNA is the transcript of the EGase gene specifically expressed at very high levels in leaf and flower abscission zones (AZ) following activation by ethylene treatments [3]. Very low amounts of cCel2 mRNA can also be detected in flowers and in roots. In order to understand the regulation of cCel2 expression, we have isolated its cognate gene, named caEG2 (f,;;apsicum qnnuum ~ndoQlucanase 2, EMBL accession no.: AJOI0950), and we have started its characterization. The sequence of a 6632 bp fragment of pepper genomic DNA revealed that it contains the whole coding region and flanking sequences at both 5' and 3' ends. After determining the transcription start site at position 3257 by means of 5' primer extension, the caEG2 coding region was positioned between 59 bp of 5' untranslated region (UTR) and 272 bp of 3' UTR. The coding region is 100 % identical to that of the cCel2 cDNA [3] used to isolate this gene, and it appears to be spaced by 5 introns, the biggest of which is 216 bp long (intron 5) while the smallest (intron 4) is 81 bp long. The 6 exons are different in size ranging from 93 bp (ex on 3) to 769 bp (exon 6). Intron-exon boundaries follow the Hanley and Schuler [I] rule. They are conserved among caEG2 and the other two abscission EGase genes known so far in higher plants (peachppEGI [4] and bean BAClO [2]) but for exon 2 which corresponds to the sum of exons 2 and 3 of the other two genes (Fig. I).

2 3 4 5 6 7

bean BAC10

5 6 7

peachppEG1

3 4 5 6

pepper caEG2

O"----___ ~1000 bp

Figure J. Comparison of the pepper caEG2 gene with other higher plant abscission EGase genes: bean BACIO [2] and peach ppEGJ [4]. Shaded boxes indicate 5' and 3' UTRs.

The large 5' flanking region (3256 bp) bears no significant homology to any characterized promoter of genes either regulated by ethylene or more specifically

269

270

involved in the abscission process, but for a short fragment not far from the TAT A box that gives a significant homology score with the peach ppEG 1 promoter (Fig. 2).

1 -160 1-150 1-140 1-130 ATGTCCCATTTTGGCGCATTTGATCCCGTGACAAGCATGACA 1P1P~Gl

I I I I I I I I I I I I I I I I I " I I I I I I I I I I I I I I I I I I I I I

I I I I I I I I

TTCGTCTCATTTGTCGCAGTTGATCCCGTGAATTATATTATA c~G2 1-200 1-190 :-180 1-170 Figure 2. Alignment of the ppEGI and caEG2 5' flanking sequences. Positions are relative to the transcription start site (+ I).

Four GUS fusions have been prepared so that the four chimeric genes contain the 59 bp of 5' UTR plus different portions of the 5' flanking region (3256 bp for the biggest and 332 bp for the smallest). These constructs have been used to transform tobacco and Arabidopsis plants that have been analyzed for the expression of GUS. In the transgenic tobacco plants, which contain the smallest construct the typical blue GUS staining was detected at the level of flower abscission zones, stigmas and lateral root primordia, thus showing that 332 bp of 5' flanking region are sufficient to drive expression of GUS in senescence-related cell separation phenomena. Furthermore, these results confmn similar data obtained with a large portion of the ppEG 1 promoter [4]. In Arabidopsis, the smallest construct is sufficient to drive GUS expression at the level of the abscission zones present in the flower, that is in the AZs of sepals, petals and stamens. Surprisingly but consistently, GUS expression was also detected in anthers of young flowers.

Nuclear extracts from abscission zones of pepper leaves were reacted with different regions of the 5' flanking portion of caEG2 and analyzed in gel shift assays. Only two fragments named CT23-24 and 108 ranging from -538/-316 and -335/222, respectively, gave specific band shifts. Experiments are in progress to elucidate the regulatory mechanism of caEG2 and to better understand the tissue specificity of its expression, beside its responsiveness to gaseous hormone ethylene.

2. Acknowledgments Our research is supported by grants from CNR and MURST. L.T. thanks the TMR­ERBFMMACT95-0032 for providing him with a fellowship to attend the Ethylene Symposium in Santorini, Greece.

3. References

1. Hanley, B.A., and Schuler, M.A. (1988) Plant intron sequences: evidence for distinct groups of introns, Nucl. Acids Res. 16, 7159-7174.

2. Koehler, S.M., Matters, O.L., Nath, P., Kemmerer, E. and Tucker, M.L. (1996) The gene promoter for a bean abscission cellulase is ethylene-induced in transgenic tomato and shows high sequence conservation with a soybean abscission cellulase, Plant Mol. BioI. 31,595-606.

3. Trainotti, L., Ferrarese, L., Pomanski, E. and Dalla Vecchia, F. (1998) Endo-p-I,4-glucanase activity is involved in the abscission of pepper flowers, J Plant Physiol. 152, 70-77.

4. Trainotti, L., Spolaore, S., Ferrarese, L. and Casadoro, O. (1997) Characterization of ppEGl, a member of a muitigene family which encodes endo-p-I,4-glucanase in peach, Plant Mol. BioI. 34, 791-802.

CELLULASE GENE EXPRESSION IN ETHYLENE-TREATED GERANIUM FLOWERS

Z. HILIOTl, S. LIND-IVERSEN, C. RICHARDS and K. M. BROWN Department of Horticulture, The Pennsylvania Slate University, University Park, P A 16802, USA

I. Introduction

Abscission of floral organs after pollination is a common phenomenon in many plant species. The time between induction and completion of the abscission process varies widely among species. Generally completion of abscission of floral structures is faster than abscission of leaves and fruits (2.5-8 h vs 10-48 h) [2]. Anatomical studies in the abscission zone (AZ) reveal cell separation in the middle lamella and extensive swelling and disorganization of the semicrystalline bundles, microfibrils, in the primary wall of the abscission zone cells. It has become evident that hormones participate and have a regulatory role in abscission. The plant hormone ethylene increases cell expansion, which generates mechanical forces facilitating cell separation, and increases expression of genes associated with abscission. Cell wall hydro lases such as cellulases are commonly associated with abscission [3]. In geranium (Pelargonium xhorlorum), exogenous application of ethylene induces petal abscission within 2 hours of treatment [I]. In the present study, the expression of three cellulases, PCXIO, PCX59 and PCXI02 was investigated in geranium tissues including petal abscission zone. The effect of ethylene on the mRNA levels of the three cellulases was also determined.

2. Results

In general, the three cellulases showed expression in all tissues of the plant examined (Figs. I and 2). High level of expression of all three cellulases was found in petal abscission zones (base of ovary and sepals, basal portion of petals). Expression of PCXIO, PCX59 and PCXI02 was detected in roots, stems and leaves (Fig. I). Well developed floral buds at 2-3 days prior to anthesis stage exhibited high level of expression for all three cellulase genes (Fig. I). In the upper pistil (stigma, style, sterile ovary, upper half of ovary) both PCX I 02 and PCX59 were highly expressed (Fig. 2). Ethylene treatment for 45 min decreased the abundance of the three cellulase mRNAs both in upper pistil and petal AZ (Figs. 2 and I). Interestingly, the abundance of PCX59 and PCXI02 mRNAs increased after 2 h of ethylene treatment in whole pistils to exceed levels present in the controls. It is possible that mRNA levels of the third cellulase, PCX 1 0 were low and overshadowed by those of PCX 102 since the sizes of the probes were similar. Expression of PCX I 02 and PCX59 in pistils of harvested florets enclosed in jars for 2 h (120C) was slightly lower than that of 0 h controls.

271

272

"0 ::l ,-... .D ,-... on til 0 '<T ...... e .... '-' '-' .....

N 0 = 0 N 0 <I' <I' r:i: -< -< ~

...... ~ 00

PCX102 368 bp PCX10 308 bp

PCX59 208 bp

Figure 1. Expression of different cellulases in petal abscission zones (AZ) of florets untreated (0) and treated with I DI.I-1ethylene for 45 min (45). RNA was also extracted from roots, stems, leaves and floral buds. Ribonuclease protection assay was used to quantity the mRNA levels of the cellulases in ten micrograms of total RNA

PCX102

PCX59

Whole pistils ,-...

o

U S-o 0 N N

368 bp

208 bp

Figure 2. Expression of different cellulases in whole pistils and upper pistil (UP) tissues. Whole pistils were freshly harvested (0), harvested and treated with I 'J 1.1-1 ethylene for 120 minutes (120), or harvested and held in air for 120 minutes (120C). Upper pistils were freshly harvested (UP (0» or treated with 111.1-1 ethylene for 45 minutes (UP (45». Levels of the different PCX mRNAs were quantified by ribonuclease protection assay in ten micrograms of total RNA

3. Conclusions

The expression of PCXIO, PCX59 and PCX102 was not restricted only to petal abscission zone but was also present in all geranium tissue samples. Ethylene treatment resulted in reduced expression ofthe cellulases after 45 minutes in both upper and lower (AZ) pistils (Figs. 1 and 2), but after 120 minutes, the expression rose again to levels higher than controls (Fig. 2), indicating complex temporal regulation of these genes by ethylene.

4. References

1. Evensen, K.B., Page, AM., and Stead, AD. (1993) Anatomy of ethylene-induced petal abscission in Pelargonium xhortorum, Ann. Bot. 71, 559-566.

2. Sexton, R., and Roberts, 1.A (1982) Cell biology of abscission, Annu. Rev. Plant Physiol. 33, 133-162.

3. Sexton, R., Lewis, L.N., Trewavas, Al, and Kelly, P. (1985) Ethylene and abscission, in lA Roberts and G.A Tucker (eds.), Ethylene and Plant Development, Butterworths, London, pp. 173-196.

USE OF I-METHYLCYCLOPROPENE TO PREVENT FLORAL ORGAN ABSCISSION FROM ETHYLENE-SENSITIVE PROTEACEAE

A.J. MACNISH 1, D.C. JOYCE 1, J.D. FARAGHER2, AND M.S. REID3 iThe University of Queensland, Gatton College, QLD 4345, Australia; 2Institute for Horticultural Development, South Eastern Mail Centre, VIC 3176, Australia; 3University of California, Davis, CA 95616, USA

I. Introduction

Ethylene elicits floral organ abscission from cut inflorescences of some Australian Proteaceae [I]. A novel ethylene binding inhibitor, I-methylcyclopropene, prevents abscission for a number of ornamentals [2, 3]. The efficacy of I-MCP in preventing ethylene-induced floral organ abscission from Australian Proteaceae was determined.

2. Materials and Methods

I-MCP concentration, exposure time or temperature experiments were conducted with Grevillea'Sylvia'. Treatments were: (i) 0,5,10 or 20 nL I-MCP/L (12 h, 20°C), (ii) 10 nL I-MCP/L for 0, 3, 6, 9 or 12 h (20°C), and (iii) 10 nL I-MCP/L for 12 h at 0, 5, 10 or 20°C, respectively. Similarly, Dorrigo waratah (Alloxylon pinnatum), G. 'Sandra Gordon' and waratah (Telopea speciosissima) inflorescences were treated with 0 or 10 nL I-MCP/L (12 h, 20°C). Immediately following I-MCP treatment, half of the untreated and I-MCP treated inflorescences in each experiment were exposed to 10 ilL ethylene/L for 12 h at 20°C. Inflorescences in vases were then arranged in a completely randomised design at 22 ± 2°C and 70% RH. Vase life was judged as per Figure I and Table I. Floral organ abscission was assessed daily as proportion of the initial number (A. pinnatum and T. speciosissima) or on a 1=<10% - 5=>80% scale (Grevillea).

3. Results

I-MCP at low concentration, for short exposure time and at low temperature prevented flower abscission and extended vase life of ethylene treated G. 'Sylvia' (Fig. I A, B, C, respectively). Flower wilting, opening and perianth discolouration were not prevented by I-MCP treatment (data not shown). Similarly, I-MCP provided protection for A. pinnatum, G. 'Sandra Gordon' and T. speciosissima. Vase lives were longer and abscission was less compared to inflorescences treated only with ethylene (Table I).

273

274

6

~ ~ 7 • •• •

(A) ~L (C)

4

2

o o 5 10 15 20 0 3 6 9 12 0 5 10 15 20 Concentration (nL 1-MCP/L) Exposure time (h) Temperature eC)

Figure 1. Vase lives of G. 'Sylvia' treated with I-Mep at different concentrations CAl, exposure times (8) [with C-) and without (e) ethylene] or temperatures (e) [+ I-Mep, + ethylene (_), - I-Mep, + ethylene Ce), + I-Mep, - ethylene ( ..... ), -I-Mep, - ethylene (T)]. Vertical bars indicate s.e.m. (n=IO). Vase life was time to ;:0- 10% flower abscission, moderate wilting, and/or perianth discolouration.

Table 1. Vase lives of A. pinnatum, G. 'Sandra Gordon' and T. speciosissima treated with ± I-Mep (day 0) and then ± ethylene (day I). Floral organ abscission after treatment is presented as a proportion (%) or a score. Within columns, data followed by a different letter are significantly different (L.SD. P=0.05, n=IO).

Treatment Alloxylon pinnatum Grevillea 'Sandra Gordon' Telopea speciosissima Vase life Abscission Vase life b Abscission Vase life Abscission a (days) (%) (days) score C(days) (%)

No ethylene o nL I-MePIL 5.0 ab 2.2 6.0 b 1.0 5.1 ab 3.6 10 nL I-Mep/L 5.8 a 2.0 6.4 a 1.0 5.5 a 1.6

Plus ethylene o nL I-MePIL 4.3 b 3.4 2.0 c 3.3 4.3 b 11.7 10 nL I-Mep/L 5.8 a 0.2 5.8 b 1.0 5.9 a 1.1

Vase life was time to a;:o- 20% perianth abscission,;:O- 10% flower wilting, and/or moderate discolouration; b;:o-10% flower abscission, moderate wilting or perianth discolouration; or, C;:o- 20% perianth abscission.

4. Conclusion

I-MCP was effective at low concentration (5 nL I-MCP/L), for short exposure time (3 h) or at low temperature (O°C) in preventing abscission and thereby extending longevity of G. 'Sylvia' exposed to ethylene. Treatment was equally effective at 0 and 20°C, in contrast to results for carnation [3]. l-MCP also protected A. pinnatum, G. 'Sandra Gordon' and T. speciosissima against ethylene. Thus, I-MCP treatment can be used to prevent floral organ abscission for ethylene-sensitive Australian Proteaceae.

5. References

1. Joyce, D., Jones, R. and Faragher, J. (1993) Postharvest characteristics of native Australian flowers, Postharvest News and 1riformation 4, 6IN-67N.

2. Serek, M., Sisler, E.C. and Reid, M.S. (1994) Novel gaseous ethylene binding inhibitor prevents ethylene effects in potted flowering plants, J. Am. Soc. Hort. Scie. 119, 1230-3.

3. Sisler, E.c., Dupille, E., and Serek, M. (1996) Effect of I-methy\cyclopropene and methylenecyclopropene on ethylene binding and ethylene action on cut carnations. Plant Growth Regul. 18, 79-86.

EFFECTS OF SELENIUM UPTAKE BY TOMATO PLANTS ON SENESCENCE, FRUIT RIPENING AND ETHYLENE EVOLUTION

B.PEZZAROSSA 1, F. MALORGI02 AND P. TONUTTl3

Ilstituto per la Chimica del Terreno, CNR, Pisa, Italy 2Dipartimento di Biologia delle Piante Agrarie, University of Pisa Italy 3 Dipartimento di Agronomia Ambientale e Produzioni Vegelali, University of Padova, Italy

1. Introduction

Selenium is an essential element for animal nutrition [3], but the metabolic significance of Se in plants is not well known. In the genus Astragalus Se has been recognized as micronutrient and its effect on plant growth is different in accumulator and non accumulator species: in the former Se stimulates growth, whereas in the latter plant growth is strongly inhibited. Shrift [2] hypothesized that Se is an essential microelement in the accumulator species. Most of the cultivated plants are non accumulator and in maize it has been shown that Se can also affect plant development retarding leaf senescence [5]. Aim of this work was to assess the effect of selenium on tomato plant growth and yield, on leaf senescence and fruit ripening and the possible relationship with ethylene biosynthesis.

2. Results

Sodium selenate added to the soil (to give concentrations of 2.5, 5, and 10 ppm of Se) affected tomato plant growth and development. Although the first inflorescence appeared at the same time in all plants, 82 days after transplanting only fruits of control started to ripen. At this date, dry matter weight of roots and fruits was significantly reduced in all treated plants. A decrease of leaf dry matter weight was observed in plants grown at 5 and 10 ppm of Se. Only the highest concentration reduced stem dry weight. In treated plants, selenium accumulated at higher levels in leaves than in fruits: the higher was the selenate concentration in soil, the higher resulted the selenium content in leaves (Table I). In fruits of the 10 ppm treated plants the selenium concentration was lower than that of the 2.5 and 5 ppm treatments (Table. I). A delay of the onset of senescence and a prolonged life were observed in selenate treated plants: at 134 days after transplanting, when leaves of control plants appeared totally desiccated, senescence was advanced in 2.5 ppm treated plants and only some yellowing was present in the 5 ppm ones. No visible senescence symptoms were observed in 10 ppm treated plants. Moreover, at this date, plants grown at 5 and 10 ppm selenate, besides immature and mature green fruits, still had several flowers.

Fruits of treated plants (particularly at the highest selenate concentrations) reached the mature green (MG) stage later than control fruits. In detached fruits the ripening process was delayed if selenate was present in the growing substrate: compared to

275

276

control, MG and breaker stages lasted longer in all selenate treated fruits. By comparing ethylene evolution rates of fruits measured at the same ripening phase (Table 2), it appeared that a reduction of the hormone biosynthesis occurred at the Pink stage in 5 and 10 ppm treated fruits and at the Breaker and Red stages only for the highest concentration. In experiments carried out with tomato fruit disks, incubated up to 24h in selenate solutions ranging from 0.1 to 10 JlM, no significant effects on ethylene evolution were observed.

TABLE L Selenium content (Jlglg D.W.) in leaves and fruits of tomato plants grown at different selenate concentrations, 82 days after transplanting. Se (ppm) Leaves Fruits o 0.95 0.28

2.5 260 71.9 5 282 76.3 10 307 45.2

3. Conclusions

In tomato (a non accumulator specie) plants selenium accumulates particularly in the leaves. At the concentrations used in this trial symptoms of Se toxicity were not observed. Besides affecting plant growth, Se is strongly effective in retarding leaf senescence and delaying fruit ripening. In animals Se, as essential constituent of enzyme glutathione peroxidase [I], acts as antioxidant decreasing oxidative stress and its anti­aging effects have been described. Our data show that also in tomato plants Se strongly affects development and the senescence process. Although Se seems to have no direct effects on ethylene biosynthesis, a decreasing trend (in 2.5 and 5 ppm treatments) and a significant reduction (in 10 ppm treatment) of ethylene evolution have been monitored during fruit ripening. The physiological aspects of this behaviour remain to be elucidated.

TABLE 2. Comparison of ethylene evolution rates (nl/g/h) of fruits at the same ripening stage. Se(ppm) o 2.5 5

10

4. References

MG 0.7 a 0.6 a 1.2 a 1.1 a

Breaker 13.8 a 10.1 ab

9.4 ab 3.6 b

Pink 44.1 a 35.6 ab 16.7 c 22.7 b

Red 19.6 a 29.9 a 17.2 a 8.2 b

I. Rotruc, J.T., Pop, AL., Ganthe, H.E., Swanso, A.B., Hafema, D.G. and Howkstra, W.G. (1973) Selenium:biochemical role as a component of glutathione peroxidase, Science 179, 588-590.

2. Shrif, A. 1969. Aspects of selenium metabolism in higher plants. Ann. Rev Plant Physiol. 20,475-494.

3. Underwood EJ. (1977) Trace Elements in lIuman and Animal :Vutrition, 4th cd. Academic Press, New York.

4. Zasoski, R.J. and Burau, R.G. (1977) A rapid nitric-perchloric acid digestion procedure for multi­element tissue analysis, Comm. Soil Sci. and Plant Anal. 8,425-436.

5. Zhao-Linchuan, Yu-BingGao, Zhao, L.e., Yu, B.G. (1996) Regulation of maize leaf senescence by selenium, J. Nanjing Agric. Univ. 19,22-25.

ETHYLENE ENHANCES THE ANTIFUNGAL DlENE CONTENT IN IDIOBLASTS FROM AVOCADO MESOCARP

1. Abstract

D. PRUSKY, A. LEIKIN-FRENKEL AND L. MADI Department of Postharvest Science of Fresh Produce, The Volcani Center, Bet Dagan 50250, Israel

It has previously been demonstrated that exposure of whole avocado fruits cv. Fuerte to 40 ~I!I ethylene for 3 h enhances the level of antifungal l-acetoxy-2-hydroxy-4-oxo-heneicosa-12, 15-diene (diene) in the fruit pericarp transiently, without affecting disease resistance to C. gloeosporioides. Exposure of 1-2 mm slices of fruit pericarp and mesocarp to ethylene enhanced the level of the antifungal diene in the mesocarp only. Since most of the antifungal diene in the mesocarp is compartmentalized in idioblasts the effect of ethylene was tested on isolated idioblasts. Exposure of idioblasts to ethylene increased the level of antifungal diene twofold within 3 hs. This effect was temperature dependent. Three hours exposure of idioblasts to ethylene at 35°C doubled the diene content compared to less than 50% increase after three hours at 20°C. Incubation of idioblast with [2_14C] malonyl- CoA or [I_14C] acetate in the presence of ethylene, showed the incorporation of the label into a compound that co-chromatographed with the antifungal diene. NMR identified the compound induced by ethylene and released from the cells as the antifungal diene. cDNA libraries were constructed from mesocarp tissue of ethylene treated and untreated fruits. Using the castor stearoyl-acyl carrier protein (ACP) desaturase gene, a putative stearoyl (ACP) desaturase clone of avocado, was detected. Transcripts of this clone were 2.5 fold higher in the ethylene treated than in the untreated tissue. The present report will discuss the possibility that ethylene can induce the synthesis of the antifungal diene in idioblasts of avocado fruits.

2. Introduction

Colletotrichum gloeosporioides attacks avocado fruits during growth in the orchard. The pathogen germinates and penetrates unripe fruit but remains quiescent until harvesting [I]. After harvest, fruit ripening is accompanied by activation of fungal development and appearance of decay symptoms. Resistance of unripe fruit to postharvest pathogens is related to the presence of preformed antifungal compounds in fruit pericarp (peel). The most active of them was found to be an antifungal diene [2]. The level of this compound decreases during ripening thus enabling the activation of the

277

278

quiescent infections and symptom expression [I]. Metabolism of the antifungal diene and increased susceptibility after harvest is mediated by lipoxygenase. The activity of this enzyme is, in tum, regulated by the levels of a non-specific inhibitor in the peri carp identified as epicatechin whose levels decrease markedly in ripe fruits [I].

Enhanced levels of the antifungal diene caused by biotic and abiotic elicitors may depend on the balance between rates of synthesis and breakdown of the compound [I]. Two possibilities exist for maintaining fungitoxic levels of antifungal compounds in the tissue of ripening fruits: (I) prevention of catabolism, (ii) induction of synthesis.

Several biotic and abiotic elicitors that increased the levels of the antifungal diene also led to higher levels of epicatechin [3]. These results seem to imply that abiotic elicitors may enhance the levels of antifungal diene by inhibiting its catabolism. On the other hand, increase of antifungal diene may result from the induced synthesis of the compound. The synthesis of the antifungal diene may originate from acetate and malonate, like fatty acids, or be a secondary product of lipid metabolism [4].

The location of the sites of biosynthesis of the antifungal compounds in avocado fruits has never been described. A previous report by Kobiler et al. [5] described the presence of antifungal compounds compartmentalized in specific oil cells in the mesocarp of avocado. Interestingly, about 85% of all antifungal compounds within the mesocarp were located in these cells which suggested the possibility that the synthesis of antifungal compounds may occur in specific idioblasts. In the present work we have shown that ethylene treatment that increases the level of the antifungal diene in whole fruits, has a similar effect on isolated idioblasts. Ethylene enhanced both the biosynthesis of the diene in the idioblast and the release of antifungal lipids out of the idioblast. Results suggest that idioblast are important as the source of compounds involved in the postharvest defense process of avocado fruits.

3. Results and Discussion

3.1. RESPONSE OF AVOCADO FRUIT TISSUES TO EXOGENOUS CZH4 EXPOSURE

Exposure of freshly harvested unripe avocado fruits to ethylene enhanced the levels of the antifungal diene in the peri carp and the mesocarp of the fruit 24 h after treatment [6]. The increase in the level of the antifungal diene in the pericarp was described as a direct effect of ethylene on the regulation of the breakdown of the antifungal diene in the tissue. Ardi et al. [6] found that ethylene activated phenyl propanoid metabolism, especially tlavonone-3-hydroxylase, at a transcriptional level and resulted in an increase of epicatechin. Present results show that exposure of avocado fruits to 40 fllll C2H4 for 6 h almost doubled the level of the antifungal diene content in the peri carp in cv. Fuerte (Fig. I). Concentration of the antifungal diene in the mesocarp of fruits exposed to 40 fll/I CZH4 for 3 h also increased by 80% (Fig. 2). However, when slices of either pericarp or mesocarp were sampled from freshly harvested fruits and then exposed to CZH4, only the mesocarp showed a 40% increase in the diene content (Fig. 2). Since Kobiler and co-workers [5] indicated that 85% of the antifungal diene in the mesocarp is

279

located in idioblast cells, a similar ethylene treatment was applied to isolated idioblast cells.

1500

:!: 1250

co .~ 1000

.::

.E> 750 co ::l... SOO ., c: ., 0 250

0

0 2

.•.... 1 ..... ~ .... .I

3 4 Time (h)

5 6 7

Figure 1. Antifungal diene content in the avocado fruit pericarp after 40 j.!1!1 ethylene treatment of freshly harvested fruits cv. Fuerte at 20° C. After each period of treatment, the peri carp was sampled and the diene extracted. Bars indicate the SE for each sampling time.

~o r-----------------------------------------------~

4000

Z'" 3500 ..c: 01 'w 3000 ~ ..c: '" 25<)0

~ ~2000 01 ~

CI> 1!5<lO C CI> o 1000

5<)0

Whole fruit Slices Whole fruit Slices

Pericarp Mesocarp

Figure 2. Antifungal diene content in the peri carp and mesocarp of avocado fruits cv. Fuerte exposed to ethylene before and after sampling. A. Antifungal diene in the pericarp of freshly harvested fruits exposed to 40 j.!l/l C2H. for 3 h and on peri carp slices exposed to the same conditions after sampling. B. Antifungal diene in the mesocarp of freshly harvested fruits exposed to 40 j.!111 C2H4 for 3 h and on mesocarp slices exposed to the same conditions after sampling from the fruit. Bars indicate the SE for each sampled treatment.

280

The minimal time required for the idioblasts cells to respond to C2H4 stimulus and show an increase in diene level was 60 min (Fig. 3). Maximal increase of antifungal compounds was obtained at 35° C. At this temperature antifungal the diene production increased 2 fold compared to untreated cells. This indicates that an abiotic elicitor like ethylene is affecting the synthesis in the preformed compound and it is reasonable to suggest that idioblast are responsive for the modulation of the antifungal diene in the mesocarp.

3000

.. 2500 li ~ 2000

~ ~ 1500

:a. 1000 ::L. II C .!! 500 c

0 0 50 100 150 200

Tlmelmln)

Figure 3. Antifungal diene content in idioblast of avocado fruit mesocarp cv. Fuerte exposed for different periods to 40 IJlII C2~ at 20DC. Bars indicate the standard error for each sampling time.

Compartmentation of preformed antifungal compounds in oil cells has been reported also for other plant [7]. The polyacetylenic compound falcarindiol, is localized in extracellular oil droplets in carrot root periderm and pericycle [12]. The preformed antifungal compound gossypol is associated with pigment glands in cotton [13]. The preformed furanocoumarins from parsley are present in oil ducts and also free in the host epidermal cells [14]. In all these cases resistance to pathogen by the antifungal compounds was conferred by high amounts of free and not compartmentalized compounds.

3.2. INCORPORATION OF [14C] LABELED PRECURSORS TO IDIOBLASTS COMPOUNDS.

The hypothesis that the antifungal diene is synthesized in idioblast was supported by the incorporation of [2_14C] malonyl-CoA and [1_14C] acetate into a compound that initially co-chromatographed with the antifungal diene in TLC, HPLC and was finally characterized as the antifungal diene (Fig. 4). Ethylene treatment of idioblast cells incubated in the presence of [1- 14C] acetate and [2- 14C] malonyl CoA enhanced the incorporation of both labeled materials. Not only the cells incorporated the precursors but they were also transformed into a compound that co-chromatographed with the diene by ~LC and HPLC (Fig. 4). Boiled cells did not show any transformation of labeled precursors in the presence or absence of ethylene (results not shown), indicating

281

that a metabolically active system is involved. When pericarp and mesocarp slices were exposed to etnylene in the presence of [1_14C] acetate they did incorporate

!! 200 co c co :a CC<r<toI .. 150 _C2H4 .. " II i!

100 '" e-3 .5

i 50

.3 0

Boiled Ha-Acetate Malonyl-CoA

Figure 4. Effect of ethylene on the incorporation of [14C] labeled precursors by idioblasts from avocado fruit mesocarp of cv. Fuerte. Idioblast cells were exposed to 38 !lifl C2H4 at 35°C and after 3h filtered, washed and extracted. The extracts were analyzed by TLC, the spots with a similar Rf as the diene standard error for each sampled treatment standard were scraped off and the incorporated label measured by liquid scintillation counting. Bars indicate the SE fPr each sampled treatment.

and transform this precursor into a compound that co-chromatograph with the antifungal diene by TLC. Mesocarp slices transformed 5% of the incorporated material into the putative diene and pericarp slices transformed only 0.7% of it (Fig. 5). Whereas purified idiobJast cells transformed 37% of the labeled material into diene under similar conditions (Fig. 5), indicating the higher efficiency of the cells compared to other tissues, to transform precursors into the antifungal diene.

The observations of large lipoidal inclusions in the plastid of similar developing oil cells has led to the conclusion that these organelles also may be involved in oil synthesis in other cases [8]. Observations in cells of Citrus deliciosa [9] and Poncirus trifoliata [10] support this conclusion. Terpene-producing trichomes and oil cavities in Citrus have smooth endoplasmic reticulum, which may be involved in oil synthesis [9, 11] or in the transport of oil from the plastids to the oil cavity [9].

3.3. EFFECT OF ETHYLENE TREATMENT ON THE EXPORT OF THE DIENE FROM lDIOBLASTS

Present results indicate that ethylene treatment to pericarp does not induce an increase in the antifungal diene content unless the treatment is applied to whole fruits. This suggests that whereas the biosynthesis of the diene occurs in the oil cells, the compound may be relocated to other parts of the fruits. Ethylene treatment of idioblasts in the presence of floating mesocarp lipids (FL fraction) enhanced the diene content in the

282

cells and in the lipid media (Table I). The accumulation of the diene in the lipid media doubled after 6-h treatment compared to a 3-h treatment only. When idioblast cells and the lipid media were separated before ethylene treatment, no change in the diene level was observed suggesting that no synthesis of the diene occurs in the lipid media (not shown results).

40

l 3S

0 30 = ~ 25

i 20

I 15

!l 10 .5

:! 5

.:! 0 Pericalp Mesocarp Idicblas1s

Figure 5. [1_1~C] acetate transfonnation into diene by pericarp, mesocarp and isolated idioblasts cells from avocado cv. Fuerte exposed to 40 j..llll ethylene for 3h at 35°C. After exposure of equivalent amounts of tissue to the precursor, they were separated from the incubation medium, washed and the antifungal diene was extracted. The extracts were applied to TLC plates, the spots with Rf 0.47 (like the diene standard) were scraped and the incorporated label measured by liquid scintillation. The acetate transfonned into diene was calculated as the ratio between the radioactivity measured in the diene spot related to the total radioactivity applied to the TLC plate x 100.

Table 1. Effect of ethylene (40 j..LI/l) on the diene content of idioblasts incubated in the presence of meso carp lipids*

Diene concentration*** Time Idioblasts** Mesocarp lipids

(h) Control C2H. Control C2H4

3 740±45 1 250±l 00 1 87±20 300±32 6 800±50 1 600±l 50 190±25 640±55

*Mesocarp lipids were separated from the idioblast cells by vaccum filtration of the floating layer (FL) ** 1-2xl06 cells were incubated in the presence of 2m I of meso carp lipids ,at 35° C for 3 h. *** Diene concentrations is presented as I-lg per total cells ± SE j..l

283

The material released in the presence of ethylene treatment was extracted and fractionated by TLC and NMR identified the component with Rf 0,47 as the described antifungal diene. The proton NMR spectrum showed 8: 0.90( CH3), 1.32 [(CH2)n, 2.1O(CH3COO-), 2.43(CH2C=O,t) 2.60 (CH2C=O,d), 2.78(bisallylic CH2,t), 3.15 (OH,s), 4.10 (AcO-CH2-), 4.30 (-CHOH m), 5.36 (-CH=CH-,m).

Since neither epicatechin nor lipoxygenase activity could be detected in the idioblasts cells [5], the increase in the level of the diene is clearly not the result of inhibition of diene breakdown but the result of direct biosynthesis [1]. This does not preclude the possibility that other cells have the possibility to synthesize the antifungal diene, particularly because the increase of the diene at the site of fungal infection in the fruit peel would need a significant relocation of the antifungal compound. The elucidation of this process may shed light for understanding the basis of fruit defense and its possible regulation. Present results provide the basic tools for approaching deeper studies on the biosynthetic and transport queries, presently in progress.

3.4. BIOSYNTHESIS OF THE ANTIFUNGAL DIENE

The approach to study the biosynthetic pathway include the construction of cDNA libraries of ethylene and non-ethylene treated fruits, a subtraction library resulting from the ethylene treated and not treated libraries and the study of expression of putative genes involved in the biosynthesis of the antifungal diene. As a first stage for the isolation of genes involved in the biosynthesis of the diene it was tested as an heterologous probe the castor bean Stearoyl-ACP-desaturase to test the ethylene and non ethylene eDNA libraries. After screening 4x104 clones in both libraries, 23 clones of the ethylene treated compared to 5 from the non-ethylene treated cDNA libraries showed positive reaction to the heterologus probe.

Sequence of one clone showed 80% homology with the Stearoyl-ACP-desaturase from castor bean, that the putative Stearoyl-ACP-desaturase from avocado is activated during ethylene treatment. We are in the way to isolate genes more closely related to the final processes for biosynthesis of the antifungal diene.

4. Acknowle.!lgements

This work was supported by grants funded by BARD, GIARA and CDR-AID

5. References

1. Prusky, D. and N. T. Keen. (1993) Involvement of preformed antifungal compounds and the resistance of subtropical fruits to fungal decay, Plant Disease 77, 114-119.

2. Prusky, D., Keen, N. T., Sims, 1. 1. and Midland, S. L. (1982) Possible involvement of an antifiI!1gal compound in latency of Colletotrichum gloeosporioides in unripe avocado fruits, Phytopathology 72,1578-1582.

3. Karni, L., Prusky, D., Kobiler, I., Bar-Shira, E. and Kobiler, D. (1989) Involvement of epic ate chin in the regulation of antifungal diene concentration during activation of quiescent Colletotrichum gloeosporioides infections of ripening avocado fruits, Physiol. Mol. Pl. Path. 35, 367-374

4. Oeissman, T.A. and Crout, D.H.O. (1969) Organic Chemistry of Secondary Plant Metabolism.

284

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

Kobiler, 1, Prusky, D., Midland, S., Sims, J.J. and Keen, N. T. (1993) Compartmentation of antifungal compounds in oil cells of avocado fruit mesocarp and its effect on susceptibility to Colletotrichum gloeosporioides, Physiol. Mol. Pl. Path. 43, 319-328. Ardi, R., Kobiler, I., Keen, N.T. and Prusky D. (1998) Involvement of epicatechin biosynthesis in the resistance of avocado fruits to postharvest decay, Physiol. Mol. Pl. Path. (in press). Arnelunxen, F. and Gronau, G. (1969) Elektronmikroscopsche untersuchungen an den Oolzellen von Acarus calamus L., Zeitscheiftfur Pj1anzenphysiologic 60, S 156-168. Bosabalidis, A and Tsekos, I. (1982) Ultrastructural studies on the secretory cavities of Citrus deliciosa Ten. II. Development of the essential oil-accumulating in the central space of the gland and process of active secretion, Proto plasma 112,63-70. Henrich G., Schultze, W. and Wegener, R. (1980) Zur kompartimetierung der synthese von mono­und sesquiterpenen das atherischen ols bei Poncirus trifoliata, Proto plasma 103,115-129. Thompson w.w., Platt-Aloia, K.A. and Endress, AG. (1976) Ultrastructure of oil gland development in the leaf of Citrus cinensis L., Bot Gaz 137, 330-340. Garrod, B. and Lewis, B.G. (1980) Probable role of oil ducts in carrot root tissue, Trans. Br. Mycol. Soc. 75, 166-169. Bell, AA (1969) Phytoalexin production and Verticillium wilt resistance in cotton, Phytopathology 59,1119-1127. Jahnen, W. and Hahlbrock, K. (1988) Differential regulation and tissue-specific distribution of enzymes ofphenylpropanoid pathways in developing parsley seedlings, Planta 173,453-458. Folch, J., Lees, M. and Sloane-Stanley, G.A. (1957) A simple method for the isolation and purification of total lip ides from animal tissues, J. BioI. Chern. 226, 497-509. Prusky, D., Plumbley, R. and Kobiler, I. (1991)Modulation of natural resistance of avocado fruits to Colletotrichum gloeosporioides by CO2, Physiol. Mol. Pl. Path. 39, 325-334. Platt, K. A and Thompson, W. W. (1992) Idioblast oil cells of avocado: distribution, isolation, ultrastructure, histochemistry, and biochemistry, Int. J. Plant Sci. 153,301-310.

STIMULATED ETHYLENE PRODUCTION IN TOBACCO (NICOTIANA TABACUM L., CV. KY 57) LEAVES INFECTED SYSTEMICALLY WITH CUCUMBER MOSAIC VIRUS YELLOW STRAIN

l. Abstract

Z. CHAUDHRY" S. FUJIMOT02, S. SATOH2, T. YOSHIOKA2, S. HASE1 AND Y. EHARAI J Lahoratory of Plant Pathology and 2 Bio-adaptation, Graduate School of Agricultural Science, Tohoku University, Tsutsumidori-amamiyamachi, I­I, Aoha-ku, Sendai 981-8555, Japan

Ethylene production was stimulated in the leaves of tobacco (Nicotiana tabacum L. cv. Ky 57) infected systemically with cucumber mosaic virus yellow strain (CMV -V). A transient peak of ethylene production per fresh-weight base appeared 2 weeks after inoculation when the mosaic symptoms of green, yellow and white sectors covered about 40% or the leaf area. The increase in ethylene production was accompanied by the increase in I -aminocyclopropane- I -carboxylate (ACC) content and activities of ACC synthase and ACC oxidase in systemically-infected leaves. Application of aminooxyacetic acid or I,IO-phenanthroline suppressed the multiplication of the virus and development of mosaic symptoms besides ethylene production, suggesting a causal relationship of the stimulated ethylene production in the symptoms development. A partial cDNA encoding a putative ethylene receptor was isolated by RT-PCR from virus-infected tobacco leaves. The abundance of mRNA corresponding to the eDNA increased during mosaic symptoms development in tobacco leaves after systemic infection with the virus.

2. Introduction

Virus infection to plants causes a multitude of symptoms, depending on the combination of host plants and viruses, which ranges from mosaics, necrosis or chlorosis with growth retardation in infected plants (systemic infection) to necrotic local lesion formation (hypersensitive local infection). Ethylene production occurs with the onset of hypersensitive response which results in the formation of necrotic local lesions [1,2,3, 4, 5]. For instance ethylene production from leaves of tobacco cv. Samsun NN increased several folds 48 h after infection with TMVas compared to the non-infected leaves [6]. On the other hand, there have been no reports that showed the increased ethylene production during the systemic infection of virus onto tobacco plants. Balazs el

al. [7] reported no increase of ethylene production in the tobacco plants (cv. Xanthi-nc)

285

286

infected systemically with cucumber mosaic virus (CMV). De Laat and Van Loon [8] reported that the systemic infection with TMV W U I caused no increase in ethylene production in tobacco cvs. Samsun and Sam sun NN. Recently, we examined the ethylene production from tobacco (cv. Ky 57) leaves infected systemically with CMV yellow strain (CMV-Y) and found an increased ethylene production [9]. Also, we obtained a partial cDNA from CMV-Y-infected tobacco leaves, which encodes a putative ethylene receptor, and found that its mRNA abundance increased with the development of mosaic symptoms.

3. Stimulated Ethylene Production in Tobacco cv. Ky 57 Leaves Infected Systemically with CMV-Y

Tobacco (Nicotiana tabacum L. cv. Ky 57) seeds were germinated and grown on a peat moss-based culture medium under a 14-h light (27°C) / 10-h (22°C) regime. Seedlings with four leaves were transplanted to soil in I-liter plastic pots and allowed to grow for 3 weeks. Plants with their 6th leaf of about 15 cm in length were inoculated with CMV­Y or mock onto the 6th leaf. The virus was transported to the upper part of the plants and caused yellow/white mosaic symptoms on the 7th leaf and above, and the most severe symptom appeared on the 9th leaf probably because of phyllotaxis [10]. Thus, the systemic symptoms development was investigated with the 9th leaf.

The mosaic symptoms appeared 5 to 7 days after the inoculation of CMV -Y as yellow sectors were formed. Then, the relative area of green, yellow and white sectors changed during the progress of mosaic symptoms over 4 weeks by the transition of green sectors to yellow ones, then to white ones [10]. The mosaic symptoms developed about 40% of the leaf area and gained white sectors in addition to green and yellow ones at 2 weeks after inoculation. The mosaic area covered 80% and 95% of the leaf area 3 and 4 weeks after inoculation, respectively. The leaf of mock control plants remained healthy green over 4 weeks.

Figure 1 shows changes in fresh weight, ethylene production per leaf base as well as per fresh-weight base of the 9th leaf of CMY -Y - and mock-inoculated control plants during 4 weeks after inoculation. The 9th leaf was a meristematic leaf at the time of inoculation, grew after that and reached its maximum size 3 weeks later in mock control plants.

Systemic infection of CMV -Y caused growth retardation as one of the major symptoms in the whole plants and this was also seen with the 9th leaf (Fig. I A). In the mock control plants, ethylene production expressed per leaf base was small at the time of inoculation, increased and attained maximum 2 weeks after inoculation, and decreased thereafter. Ethylene production of the CMV-Y-infected leaf changed similarly but surpassed that of mock control at the 2nd and 3rd weeks of infection (Fig. I B). The enhanced ethylene production in CMV -Y -infected leaves was more clearly demonstrated when the ethylene production was expressed per fresh-weight base (Fig. lC). In mock control leaves, the rate of ethylene production was highest in the youngest leaves (0.48 nmolg-1h-1), and kept to decrease thereafter. In contrast, in CMV­Y -infected leaves the rate of ethylene production remained high (around 0.4 nmolg-1h-1) until the 2nd week of infection. The maximum ethylene production rate of 0.48 nmolg-

287

Ih-1 was observed on the 2nd week, when the mosaic symptoms developed to about 40% of the leaf area. The ethylene production rate declined to 0.04 nmolg-1h- 14 weeks after inoculation (90 % mosaic symptoms covered the infected leaves).

ACC content was highest (5 nmolg-') in control leaves at the time of inoculation (0 week), rapidly decreased at the 1st week and remained low (below 0.4 nmolg-') thereafter. In the CMV-Y-infected leaves, ACC content similarly changed, but with a transient increase at the 2nd week of infection. At that time the ACC content of CMV­V-infected leaves was five times that of non-infected control ones.

0.5

~ u _ 0.4 = ... ~ ~ 0.3 0. ...

~ IDe 02 ~"O . £ e til .:. 0.1

1 4

Weeks after Inoculation

Figure 1. Changes in fresh weight (A), ethylene production per leaf base (8) and ethylene production per fresh-weight base (C) ofCMV-Y-infected (0) or mock control (e) leaves of tobacco cv. Ky 57.

When ACe contents were compared among different mosaic sectors (green, yellow and white sector) of CMV -Y -infected leaves and the healthy green tissue of non­infected leaves at the 2nd week, the green sectors of the CMV-Y-infected mosaic leaves contained the maximum amount of ACC (3.27 nmolg-1), followed by the yellow and white ones that contained 1.43 and 0.30 nmolg-I, respectively. The green sector of the CMV -Y -infected leaves contained much more ACC than the green tissues of non­infected control leaves; 3.60 nmolg-1 vs. 0.60 nmolg-'.

The in vivo ACC synthase activities of leaf tissues were estimated by measuring ACC production during incubation under Nz, which inhibits the oxidative conversion of

288

ACC to ethylene [8]. In the mock control leaves, the activity of ACC production was low with the rates of 0.067 and 0.005 nmolg-'h-' at the 15t and 2nd weeks of infection, respectively. Whereas, in CMV -Y -infected leaves, the activity of ACC production was high with the rates of 0.136 and o. \07 nmolg-'h-' at the 1st and 2nd weeks of infection, respectively. Furthermore, AOA (aminooxyacetic acid), a competitive inhibitor of ACC synthase [13], inhibited an accumulation of ACC in the CMV -Y -infected leaves which were incubated under N2•

ACC oxidase activities were extracted from the mock control and CMV -Y -infected leaves and assayed in vitro. The activities were 2- and 4-fold higher in the CMV -Y­infected leaves than the mock control ones at 0.7 and 1.6 week of infection, respectively.

4. Role of Stimulated Ethylene Production in Mosaic Symptom Formation

Ethylene stimulates senescence of leaf tissues causing their color changes from green to yellow [II]. Pritchard and Ross [12] showed that yellow flecks were induced in tobacco leaves by treatment with ethylene. Therefore, we suspected that the stimulated ethylene production has a role in the development of yellow/white mosaics in the infected leaves of tobacco. Thus, we investigated the effects of AOA or I, I 0-phenanthroline (Ph) on the development of mosaic symptoms in tobacco cv. Ky 57 leaves infected systemically with CMV -Y. Ph is an inhibitor of ACC oxidase [14, 15]. AOA at 0.5 mM or Ph at I mM were applied to the 7th through 9th leaves on the next day of CMV -Y inoculation. The application of inhibitors were repeated twice at 2-day intervals.

It was confirmed that AOA or Ph decreased ethylene production of the 9 th leaf to the levels similar to and lower than that of the mock control, respectively, at 7th day after inoculation. The 9th leaf of the plants infected with CMV-Y showed typical mosaic symptoms at 7th day and later of infection. On the other hand, the leaf treated with AOA or Ph showed little or no appearance of mosaic symptoms at 7th day, but, they eventually showed a mosaic development at 12th day of infection. It was evident that AOA and Ph delayed the appearance of the mosaic symptoms. The results suggested that the stimulated ethylene production caused by systemic infection with CMV -Y plays a regulatory role in the development of mosaic symptoms in tobacco cv. Ky57.

5. Ethylene Receptor Gene in CMV-Y-infected Tobacco cv. Ky 57 Leaves

In order to reveal further the role of stimulated ethylene production in mosaic symptoms formation, we planned to use transgenic tobacco plants with modified ethylene perception. As the first step toward such an experiment, we investigated an ethylene receptor gene by obtaining its cDNA from CMV -Y -infected leaves and finding changes in its mRNA abundance during the development of mosaic symptoms.

Total RNA was isolated from CMV-Y-infected leaves, on which the green-yellow mosaic area spread over about 20 % of the leaf area, and used for a template for

289

polymerase chain reaction (PCR) with primers derived from Arabidopsis ETRl gene [16]. RT-PCR with these primers and total RNA as a template amplified a product of about 760 bp in size. The PCR product was cloned into pT7 Blue T-Vector (Novagen). The nucleotide sequences of the insert from 8 independent colonies were determined and found to be identical.

The cDNA (Accession No. AF039921) has a 723-bp long open reading frame. Alignments of the cDNA protein showed a close homology to the amino acid residues 110 through 349 of Nr protein in tomato [17], the identity was 94.6 %. Also, the deduced amino acid sequence has homology to reported ethylene receptor proteins in the corresponding region; 73.0 % to eTAEI [18] in tomato, 75.1 % to ERS [19] and 73.0 % to ETRI [16] in Arabidopsis, and 71.5 % to NT-ETRI in tobacco [20]. Since Nr in tomato is a homolog of ERS in Arabidopsis, the cDNA was named pNT -ERS.

A 0.5 .....-------------,

s::: o'C,' 0.4 1-----1--------1 '€-9 :::I~ ~..:= 0.3 1-----Q..bI) g:a ~~ 0.2

~'-'

B

0.11------

0 .... -...._ ...

pNT-ERS

L25

mock 0% 20% 50% 80%

mock 0% 20% 50% 80%

% ofmosalc symptoms in the whole leaf area

Figure 2. Changes in ethylene production rates (A) and abundance of mRNA of pNT-ERS (B) in CMV-Y-infected tobacco leaves during development of mosaic symptoms. In B, the PCR product is 645 bp in size, and the product of 300 bp in size is that for the ribosormal protein L 25 as the control for PCR efficiency.

Changes in the abundance of mRNA corresponding to pNT-ERS were examined during mosai(f symptoms development in tobacco leaves after systemic infection with CMV -Y (Fig. 2). In this experiment, ethylene production occurred most abundantly in the leaf showing 20%-mosaic area, and it decreased as the mosaic symptoms spread

290

over the leaf area (Fig. 2A). RT-PCR analysis was done with the primers designed according to the nucleotide sequence of the pNT-ERS cDNA. It was shown that the mRNA corresponding to pNT-ERS was already present in the healthy non-infected tobacco leaves but its abundance gradually increased as the mosaic area developed after systemic infection with CMV-Y (Fig. 2B).

6. Discussion

The present investigation revealed the stimulated ethylene production in tobacco cv. Ky 57 leaves infected systemically with CMV -Y as compared to the non-infected leaves. Also there were coccomitant increases in ACC content and activities of ACC synthase and ACC oxidase in the CMV-Y-infected leaves. The results shown in Fig. IB and C suggested that the enhanced ethylene production in CMV -Y -infected leaves was caused by the increased activity of ethylene production, but not by a stabilization of the initial activity existed in the youngest leaves. These findings together indicated that the enhanced ethylene production in CMV -Y -infected leaves was caused by the increase in ACC synthase and ACC oxidase activities, resulting in increased turnover of ACe.

The present results contrasted with those reported previously by Balazs et al. [17] and De Laat and Van Loon [18] in which no increase in ethylene production occurred in tobacco infected systemicaly with CMV or TMV, respectively. The discrepancy might result from differences in the combination of host tobacco cultivars and virus species and strains between the present study and the foregoing ones.

It has been suggested that ethylene plays a role in the systemic acquired resistance, the induction of expression of genes for pathogenesis-related proteins, or the development of local lesion symptoms [21]. The present findings showed that ethylene was synthesized actively in the green sector of the CMV -Y -infected mosaic leaves, as judged by the highest ACC content in it. Taking into account the observation that ethylene stimulates senescence of leaf tissues causing their color changes from green to yellow [II], we can speculate that the ethylene produced abundantly in the green sectors was probaply responsible for the transition of green sectors to yellow ones, and then to white ones. Actually, application of ADA or Ph suppressed the development of mosaic symptoms besides ethylene production, suggesting a causal relationship of ethylene production in the symptoms development.

We could obtain by PCR-c1oning the cDNA in partial-length for a putative ethylene receptor, pNT-ERS. The close homology between pNT-ERS and Nr seems to relate to that both tobacco and tomato plants belong to the same family, Solanaceae. The pNT­ERS mRNA was already present in the healthy non-infected tobacco leaves but its abundance increased as the mosaic area developed after systemic infection with CMV­Y. This change did not agree with that of ethylene production rate, but agreed roughly with the development of mosaic area; both increasing toward the late stage of systemic infection with CMV-Y. These observations may imply some relationship between the expression of pNT-ERS and the development of mosaic symptoms. In the present study. however, we did not obtain the cDNA for NT-ETR I [20]. It will be of interest to know the pattern of expression, if any, of the NT-ETR I during mosaic symptom development in tobacco leaves after systemic infection ofCMV-Y.

291

7. References

1. Nakagaki, Y., Hirai, T. and Stahmann, M.A.(1970) Ethylene production by detached leaves infected with tobacco mosaic virus, Virology 40,1-9.

2. Gaborjany, R., Balazs, E. and Kiraly, Z. (1971) Ethylene production, tissue senescence and local virus infections, Acta Phytopathol. Acad Sci. Hung. 6, 51-55.

3. Pritchard, D.W. and Ross, A.P. (1975) The relationship of ethylene to formation of tobacco mosaic virus lesions in hypersensitive responding tobacco leaves with and without induced resistance, Virology 64, 295-307.

4. De Laat, A.M.M. Vonk, C.R. and Van Loon, L.C. (1981) Regulation of ethylene biosynthesis in virus-infected tobacco leaves. I. Determination of the role of methionine as the precursor of ethylene, Plant Physiol. 68, 256-260.

5. Otsubo, N., Seo, S., Yamashita S., Koga, M. and Ohashi, Y. (1996) Ethylene biosynthesis is important for necrotic local lesion formation in tobacco, Plant Cell Physiol. 37, s196.

6. De Laat A.M.M. and Van Loon, L.C. (1982) Regulation of ethylene biosynthesis in virus-infected tobacco leaves. II. Time course of levels of intermediates and in vivo conversion rates, Plant Physiol. 69,240-245.

7. Balazs, E., Gaborjany, R., Toth, A. and Kiraly, Z. (1969) Ethylene production in Xanthi tobacco after systemic and local virus infection, Acta Phytopathol. Acad. Sci. Hung. 4, 355-358.

8. De Laat A.M.M. and Van Loon, L.C. (1983) The relationship between stimulated ethylene production and symptoms expression in virus-infected tobacco leaves, Physiol. Plant Path. 22, 261-273.

9. Chaudhry, Z., Yoshioka, T., Satoh, S., Hase, S. and Ehara, Y. (1998) Stimulated ethylene production in tobacco (Nicotiana tabacum L. cv. Ky 57) leaves infected systemically with cucumber mosaic virus yellow strain, Plant Sci. 131, 123-130.

10. Miyashita, K., Fukai, M., Karasawa, A., Hashiba, T. and Ehara, Y. (1994) Virus accumulation in the leaves showing mosaic symptoms in tobacco plant infected with cucumber mosaic virus, Ann. Phytopathol. Soc. Jap. 60, 761-762.

11. Abeles, A.B., Morgan, P.W. and Saltveit, M.E., Jr. (1992) Ethylene in Plant Biology, 2nd ed., Academic Press Inc., San Diego, CA, U.S.A.

12. Pritchard, D.W. and Ross, A.P. (1975) The relationship of ethylene to formation of tobacco mosaic virus lesions in hypersensitive responding tobacco leaves with or without induced resistance, Virology 64,295-307.

13. Yang, S.F. and Hoffman, N.E. (1984) Ethylene biosynthesis and its regulation in higher plants, Annu. Rev. Plant Physiol. 35,155-189.

14. Apelbaum, A., Burgoon, A.C., Anderson, J.D., Solomos, T. and Lieberman, M. (1981) Some characteristics of the system converting l-aminocyclopropane-l-carboxylic acid to ethylene, Plant Physiol. 67, 80-84.

15. Bouzayen, M., Felix, G., Latcht, A., Pech, J-C. and Boller, T. (1991) Iron: an essential cofactor for the conversion of l-aminocyclopropane-I-carboxylic acid to ethylene, Planta 184,244-247.

16. Chang, C., Kwok, S.P., Bleecker, A.B. and Meyerowitz, E.M. (1993) Arabidopsis ethylene response gene ETR1: Similarity of product to two-component regulators, Science 262,539-544.

17. Wilkinson, lQ., Lanahan, M.B., Yen, H-C., Giovannoni, lJ. and Klee, H.J. (1995) An ethylene­inducible component of signal transduction encoded by Never-ripe, Science 270,1807-1809.

18. Zhou, D., Kalaitzis, P., Mattoo, A.K. and Tucker, M. (1996) The mRNA for an ETRI homologue in tomato is constitutively expressed in vegetative and reproductive tissues, Plant Mol. Bioi. 30, 1331-1338.

19. Hua, J., Chang, C., Sun, Q. and Meyerowitz, E.M. (1995) Ethylene insensitivity conferred by Arabidopsis ERS gene, Science 269,1712-1714.

20. Knoester, M., Henning, J., Van Loon, L.C., Bol, J.F. and Linthorst, J.M. (1997) Isolation and characterization of a tobacco cDNA encoding an ETRI homolog (accession no. AF022727) (pGR 97-188), Plant Physiol. 115, 1731.

21. Bol, J.F., Buchel, A.S., Knoester, M., Baladin, T., Van Loon, L.c. and Linthorst, H.J.M. (1996) Regulation of the expression of plant defence genes, Plant Growth Regul. 18,87-91.

ACC DEAMINASE IS CENTRAL TO THE FUNCTIONING OF PLANT GROWTH PROMOTING RHIZOBACTERIA

1. Abstract

B. R. GLICK, J. LI, S. SHAH, D.M. PENROSE AND B.A. MOFFATT Department of Bi%gy, University of Waterloo, Waterloo, Ontario, Canada N2L 3G 1

In addition to the more well known mechanisms that are used by plant growth promoting rhizobacteria (PGPR), these organisms contain the enzyme 1-aminocyclopropane-I-carboxylic acid (ACC) deaminase, which has no known function in bacteria, and use this enzyme to lower plant ethylene levels resulting in an increase in root length. Mutants of one PGPR strain that lack ACC deaminase activity were no longer able to promote the elongation of canola seedling roots. All bacterial isolates that are able to grow on ACC as a sole nitrogen source contain ACC deaminase and promote root elongation. The effect of ACC deaminase-containing PGPR on canola seedlings is identical to the effect of the ethylene inhibitor A VG. Treatment of canola seeds with ACC deaminase-containing PGPR results in a lowering of ACC levels in both roots and shoots. When an ACC deaminase gene was expressed in soil pseudomonads that did not contain this enzyme activity and did not stimulate canola root elongation, the transformants gained both ACC deaminase activity and canola root elongation activity. These data are explained in terms of a model in which a PGPR binds to canola seed coats and, during seed imbibition, the bacterium sequesters and then hydrolyzes ACC from the seed, thereby lowering the level of ethylene that can form during early plant development.

2. Introduction

Plant growth promoting rhizobacteria (PGPR) are free-living soil bacteria that bind to the roots of plants and, using a variety of mechanisms, stimulate plant growth [6]. PGPR can act as biological disease control agents, promote root or shoot growth, enhance germination, stimulate biological nitrogen fixation by Rhizobia, provide resistance to a variety of both biotic and abiotic stresses and facilitate the development of plants from tissue culture [6, 7,18,19].

The enzyme l-aminocyclopropane-I-carboxylate (ACC) deaminase, which cleaves ACC into ammonia and a-ketobutyrate [15], has been found to be present in a number of PGPR. However, only plants synthesize ethylene from ACC; although some bacteria can synthesize ethylene they do so by another mechanism [2,23]. Therefore, it is likely

293

294

that soil bacteria that contain ACC deaminase can lower the level of ACC and hence the concentration of ethylene in the plants with which they associate. Some of the properties of this enzyme are summarized below in Table I.

TABLE 1. Reported properties of bacterial ACC deaminases [14, IS, 16].

- Cleaves ACC to form ammonia and a-ketobutyrate - Trimer molecular weight - \05 kDa - Subunit molecular weight -3SkDa - Requires pyridoxal phosphate - Sulfhydryl enzyme - Km for ACC = I-IS mM - Induced by low levels (i.e., I OOmM) of ACC - Temperature optimum -30°C - pH optimum -8.5 - Allows bacteria to utilize ACC as sole N source - Cytoplasmically localized

3. Results and Discussion

In an effort to better understand the role of ACC deaminase in the mechanism that some PGPR use to stimulate plant growth and development, several different types of experiments were undertaken. (i) Ethylene has previously been shown to be an inhibitor of root elongation in several different plant systems [1]. However, PGPR, such as Pseudomonas putida GRI2-2, that contain the enzyme ACC deaminase can lower ethylene levels within plant roots and shoots by decreasing the plant ACC content (Fig. 1). Consistent with this model, the roots of ethylene sensitive plants (such as canola, tomato and lettuce) were invariably found to be longer when ACC deaminase­containing bacteria were added either directly to the seed or to the soil in which the seeds were later planted [10, 12]. (ii) The PGPR strain P. putida GR12-2 was chemically mutagenized with nitrosoguanidine and three independent mutants that were no longer able to proliferate on a minimal medium that contained ACC as a source of nitrogen were selected [8]. Upon examination of these three mutants it was determined that they were all devoid of any measurable ACC deaminase activity and they no longer promoted the elongation of canola roots under gnotobiotic conditions [8]. Thus, in all three instances, the ability of a PGPR to promote the root elongation of canola seedlings depended upon the bacterium having ACC deaminase activity. (iii) Our model of plant growth stimulation by bacterial ACC deaminase predicts that any bacterium that contains this enzyme and is capable of binding to plant seeds or roots in the soil, should also be able to lower the ACC content of the seed and/or root and thereby relieve ethylene inhibition of root growth in plants that are sensitive to ethylene. That is, any soil bacterium that contains ACC deaminase activity should also have the ability to act as a PGPR. Consistent with this prediction, we have found that each of the strains of bacteria that were isolated from seven different soil samples (one strain from each soil sample) in two geographically disparate locations (i.e., Waterloo, Ontario and Southern California) were able to utilize ACC as a nitrogen source and to promote canola

295

seedling root elongation under gnotobiotic conditions, i.e., to be a PGPR [9]. (iv) The increase in the length of the roots of young (five to seven day old) ethylene sensitive plant seedlings following treatment of the seeds with wild-type P. putida GR12-2 was similar to the response of these plants when their seeds were treated with the ethylene inhibitor, L-a-(aminoethoxyvinyl)-glycine, i.e. AVG [12]. Similarly, the plants that were stimulated to the greatest extent by treatment with either P. putida GR12-2 or AVG were those that were the most sensitive to root length inhibition by the chemical ethylene generator ethephon, (2-chloroethyl) phosphonic acid [12]. (v) When an ACC deaminase gene that was isolated from a strain of Enterobacter cloacae that acts as a PGPR was introduced on a broad-host-range plasmid [21] into two different soil pseudomonads that did not have either ACC deaminase or PGPR activity, both of these bacterial strains acquired both a significant level of ACC deaminase activity and the ability to promote canola root elongation (Fig. 2).

A B

Seed treabnent Seed treatment

Figure 1. (A) Amount of ACC/~g protein in the roots and (B) root length, of 4.5 day old canola plants grown under gnotobiotic conditions from seeds treated with MgS04, P. putida OR12-2 or AVO. Error bars indicate standard error.

The role that the enzyme ACC deaminase plays in the mechanism that PGPR utilize to promote plant growth may be conceptualized as follows (Fig. 3; [11]): PGPR that are free living in the soil are motile and can move toward and then bind tightly to the surface of either a seed or root in their immediate vicinity [5, 13]. Both seed and (particularly) root exudates can serve as a source of carbon (and possibly nitrogen as well) for the bacteria that are bound to their surface. In return for the carbon (and nitrogen) that the bacteria find in the exudate, they in tum may synthesize and secrete phytohormones, especially indoleacetic acid (IAA); secrete siderophores that can bind iron and then be taken up by the plant, thus helping to provide the plant with a sufficient amount of iron from the soil; solubilize phosphate from the soil and make it more readily available to the plant; and (as described here) lower plant ACC and hence plant ethylene levels. Some PGPR, such as Azospirillum, may also provide fixed nitrogen to the plant although the importance of this mechanism to plant growth and development is controversial [3].

296

E. cloaca. P. pulida P. pulida P. fluor. CAL2 + ACC-D

P. fluor. + ACC-D

Figure 2. The ability of various bacterial strains to promote the elongation of canola roots under gnotobiotic conditions. Each root elongation experiment included 80-90 seeds per treatment. The growth medium for E. cloacae, P. putida and P. jluorescens was DF salts [4] containing either 0.2% (w/v) (NH.)2S0. or 3unM ACC. The entire experiment was repeated twice. E. cloacae CAL2 [21] is a paPR strain that contains ACC deaminase. The P. putida and P. jluorescens strains were transformed with the same broad-host-range plasmid vector that was used to introduce the cloned ACC deaminase gene into these strains.

The IAA that is synthesized and secreted by a PGPR bound to the surface of either the seed or root of a developing plant may be taken up by the plant and, in conjunction with the endogenous plant IAA, can either stimulate plant cell proliferation and/or elongation or stimulate the activity of the enzyme ACC synthase to convert S­adenosylmethionine (SAM) to ACC [17]. Some of the ACC is exuded from plant roots or seeds (along with other small molecules normally present in seed or root exudates), taken up by PGPR, and cleaved by the enzyme ACC deaminase. The uptake and subsequent hydrolysis of ACC by PGPR decreases the amount of ACC outside of the plant, and to maintain the equilibrium between internal and external ACC levels the plant exudes increasing amounts of ACC.

As a consequence of providing plants with IAA, PGPR cause plants to synthesize more ACC_ than they would otherwise need. PGPR then stimulate ACC exudation from the plant, providing PGPR with a unique source of nitrogen in the form of ACC which cannot be utilized by the vast majority of soil microorganisms. This enables PGPR to proliferate under conditions where other soil bacteria cannot grow. The direct consequences of the interaction ofa plant with an ACC deaminase-containing PGPR are lowering of the level of ACC within a plant, reduction of the concentration of plant ethylene and a decreased extent of ethylene inhibition of root elongation.

Cell Elongation and Proliferation

" SAM ~ 1 ACC Synthase

ACC

l~~ Ethylene

1 Root Elongation

Plant Seed or Root

4. Acknowledgements

PGPR

IAA = indoleacetic acid ACC = 1 aminocyclopropane-

1-carboxylic acid SAM = S-adenosylmethionine

297

Figure 3. Model of the interaction of an ACC deaminase-containing PGPR with a plant seed or root. Following attachment of the bacterium, it is well positioned to take up the amino acids and other small molecules that are exuded by seeds or roots. The amino acid tryptophan as well as some other amino acids can stimulate the ability of the bacterium to synthesize lAA, with, in some cases, tryptophan being both a precursor and an inducer of IAA biosynthesis [20]. The newly synthesized lAA is secreted by the bacterium and may be taken up by the plant. At low concentrations of lAA root cells may be stimulated to proliferate and/or elongate; however, high concentrations of IAA stimulate ACC synthase thereby increasing the level of ACe. Some of the ACC may be converted into malonyl-ACC, (I­

aminobutyric acid or a-aminobutyric acid, or exuded from the plant. In the presence of oxygen, the remainder of the ACC may be converted to ethylene by ACC oxidase, with the ethylene acting as an inhibitor of root elongation. In the presence of a PGPR, some of the exuded ACC is taken up by the bacterium and hydrolyzed by ACC deaminase. To maintain the gradient between internal and external ACC the plant exudes increasing amounts of ACC which are continuously removed by the bacterium.

The work described in this manuscript was supported by the Natural Sciences and Engineering Research Council of Canada and by Agrium, Inc_ (Saskatoon, Saskatchewan)_

298

5. References

I. Abeles, F.B., Morgan, P. W. and Saltveit, M.E., Jr. (1992) The biosynthesis of ethylene, in Ethylene in Plant Biology, 2nd edition, Academic Press, San Diego, pp. 26-55.

2. Billington, D.C., Golding, B.T. and Primrose, S.B. (1979) Biosynthesis of ethylene from methionine. Isolation of the putative intermediate 4-methylthio-2-oxobutanoate from culture fluids of bacteria and fungi, Biochem. J. 182,827-837.

3. Boddey, R.M. and Dobereiner, J. (1994) Biological nitrogen fixation associated with graminaceous plants, in Y. Okon (ed.), Azospirillum Plant Associations, CRC Press, Boca Raton, pp. 119-135.

4. Dworkin, M. and Foster, 1. (1958) Experiments with some microorganisms which utilize ethane and hydrogen, J. Bacteriol. 75, 592-60 I.

5. Fallik, E., Sarig, S. and Okon, Y. (1994) Morphology and physiology of plant roots associated with Azospirillum, in Y. Okon (ed.), Azospirillum Plant Associations, CRC Press, Boca Raton, pp. 77-85.

6. Glick, B.R. (1995) The enhancement of plant growth by free-living bacteria, Can. J. Microbiol. 41, 109-11 7.

7. Glick, B.R. and Bashan, Y. (1997) Genetic manipulation of plant growth-promoting bacteria to enhance biocontrol ofphytopathogens, Biotechnol. Adv. 15,353-378.

8. Glick, B.R., Jacobson, C.B., Schwarze, M.M.K. and Pasternak, lJ. (1994) I-Aminocyclopropane­I-carboxylic acid deaminase mutants of the plant growth promoting rhizobacterium Pseudomonas putida GR12-2 do not stimulate canol a root elongation, Can. J. Microbiol. 40,911-915.

9. Glick, B.R. Karaturovlc, D.M. and Newell, P.c. (1995) A novel procedure for rapid isolation of plant growth-promoting pseudomonads, Can. J. Microbiol. 41,533-536.

10. Glick, B.R., Liu, C., Ghosh, S. and Dumbroff, E.B. (1997) Early development of canola seedlings in the presence of the plant growth-promoting rhizobacterium Pseudomonas putida GR 12-2, Soil BioI. Biochem. 29, 1233-1239.

II. Glick, B.R., Penrose, D.M. and Li, J. (1998) A model for the lowering of plant ethylene concentrations by plant growth-promoting bacteria, J. Theor. BioI. 190,63-68.

12. HaJI, J.A., Peirson, D., Ghosh, S. and Glick, B.R. (1996) Root elongation in various agronomic crops by the plant growth promoting rhizobacterium Pseudomonas putida GRI2-2, Isr. J. Plant Sci. 44: 37-42.

13. Hong, Y., Glick, B.R. and Pasternak, 1.J. (1991) Plant-microbial interaction under gnotobiotic conditions: A scanning electron microscope study, Curro Microbiol. 23, 111-114.

14. Honma, M. (1985) Chemically reactive sulfhydryl groups of l-aminocyclopropane-1-carboxylate deaminase, Agric. BioI. Chem. 49, 567-571.

IS. Honma, M. and Shimomura, T. (1978) Metabolism of I-aminocyclopropane-I-carboxylic acid, Agric. Bioi. Chem. 42, 1825-1831.

16. Jacobson, C.B., Pasternak, 1.1. and Glick, B.R. (1994) Partial purification and characterization of ACC deaminase from the plant growth-promoting rhizobacterium Pseudomonas putida GRI2-2, Can. J. Microbial. 40,1019-1025.

17. Kende, H. (1993) Ethylene biosynthesis, Annu. Rev. Plant Physiol. Plant Mol. BioI. 44,283-307. 18. Lazarovits, G. and Nowak, 1. (1997) Rhizobacteria for improvement of plant growth and

establishment, HortScience 32,188-192. 19. Nowak, 1. (1998) Benefits of in vitro ybiotization of plant tissue cultures with microbial inoculants,

In Vitro Cell. Dev. Bioi. 34, 122-134. 20. Patten, C.L. and Glick, B.R. (1996) Bacterial biosynthesis of indole-3-acetic acid, Can. J.

Microbiol. 42, 207-220. 21. Shah, S., Li, J., Moffatt, B.A. and Glick, B.R. (1997) ACC deaminase genes from plant growth

promoting rhizobacteria, in A. Ogoshi, K. Kobayashi, Y. Hemma, F. Kodema, N. Kondo and S. Akino (eds.) Plant Growth-Promoting Rhizobacteria. Present Status and Future Prospects, OECD, Paris, pp. 313-315.

22. Shah, S., Li, J., Moffatt, B.A. and Glick, B.R. (1998) Isolation and characterization of ACC deaminase genes from two different plant growth promoting rhizobacteria, Can. J. Microbial., in press.

23. Sato, M., Urushizaki, S., Nishiyama, K., Sakai, F. and Ota, Y. (1987) Efficient production of ethylene by Psuedomonas syringae pv. glycinea which causes halo blight in soybeans, Agric. BioI. Chem. 51, 1177-1178.

THE ROLE OF ETHYLENE IN THE FORMATION OF CELL DAMAGE DURING OZONE STRESS

Does ozone induced cell death require concomitant AOS and ethylene production?

1. Abstract

R. KETTUNEN, K. OVERMYER AND J. KANGASJARVI Institute of Biotechnology, University of Helsinki, POB 56 (Viikinkaari 5 D), FIN-00014 Helsinki, Finland

Ozone (03) forms activated oxygen species (AOS) in the apoplasm and causes the plant cell itself to produce AOS in an oxidative burst. In sensitive plants, this leads to the formation of hypersensitive response (HR) -like lesions, the formation of which has the characteristics of programmed cell death. 0 3 exposure upregulates ethylene biosynthesis; in sensitive plants the elevated level of stress ethylene emission is correlated with the damage level. If ethylene perception or biosynthesis is prevented the damage formation is reduced. AOS formation, ethylene biosynthesis and damage formation show similar spatial distribution in 0 3 treated leaves. Taken together these findings suggest that both AOS and ethylene together are involved in the induction of cell death in 0 3 exposed plants.

2. Introduction

Short high concentration peaks of the phytotoxic atmospheric pollutant ozone (03)

induce the formation of hypersensitive response (HR) -like lesions in sensitive plants. Concomitant with the damage induction process are an oxidative burst and stress ethylene biosynthesis where the levels of ethylene emission early in the course of exposure determines the extent of damage that appears later. As early as 1976 Tingey et al. [25] have described the correlation between ethylene and ozone-induced lesion development and to this day increased stress ethylene evolution remains the best marker of 0 3 sensitivity [28]. However, the exact role of 0 3 induced stress ethylene in damage formation has remained unclear.

Ozone requires stomatal gas exchange for entry into the leaf in order to exert its toxicity in the apoplast. Reactions with extracellular structures result in the production of activated oxygen species (AOS) such as superoxide anion (02.), hydroxyl radical, and hydrogen peroxide (H20 2) [9]. These AOS trigger the plant itself to produce an oxidative burst. The oxidative burst is a key event in the induction of the hypersensitive response (HR) to incompatible pathogens. The HR is a localized cell death response

299

300

and exhibits characteristics of programmed cell death. Through the activation of a battery of defenses the HR serves to halt pathogen ingress and results in both local and systemic immunity [2]. 0 3 acts as an elicitor inducing AOS synthesis in a manner similar to those seen in plant-pathogen interactions [20, 22]. This suggests that Or induced and pathogen-induced plant responses may be mechanistically similar and that 0 3 responses and damage are the result of deleterious firing of pathways normally associated with the HR.

Ethylene has an important role in regulating and modulating plant responses to both abiotic and biotic stresses (for example, to wounding, hypoxia, heavy metals, and pathogens) by upregulation of plant defense systems. Some defense genes, such as genes encoding basic PR proteins are responsive to ethylene [6], while others, typified for example by Arabidopsis defensin 1.2, require both ethylene and jasmonic acid for their induction [18]. Among the many roles in plant growth and development exercised by ethyleri'e two are of particular interest in 0 3 response; ethylene as a regulator of defense responses and as a regulator of cell death. For example, treating plants with ethylene 24 hours prior to exposure results in decreased 0 3 damage; ethylene-induced ascorbate peroxidase activity protected pea plants against the effects of H20 2, the pro­oxidant herbicide paraquat, and 0 3 [11]. Involvement of ethylene in the regulation of cell death has been shown during pea carpel senescence [16], in hypoxia-induced aerenchyma formation of the maize root cortex [7] and in maize endosperm development [29]. Although ethylene is not necessary for cell death in the HR, it is formed during this process and has been shown to promote cell death and contribute to symptom formation in the susceptible response to virulent pathogens [3, 10].

The first committed step in ethylene biosynthesis, conversion of S-adenosyl methionine (SAM) to I-aminocyclopropane-I-carboxylic acid (ACC) is catalyzed by ACC synthase (ACS). ACC oxidase (ACO), in turn, oxidizes ACC to ethylene. Both ACS and ACO are encoded by mUltigene families. These genes show differential expression during plant growth and development and respond differentially to various external stimuli [15]. 0 3 induces ethylene synthesis in plants when a threshold concentration has been exceeded [9, 19,20] via the upregulation ofa specific subset of biosynthetic genes: these have thus far been shown to include the Arabidopsis AT-ACS6 [27], the tomato LE-ACS2 [26] and LE-ACOJ, and the potato ST-ACS4 and ST-ACS5 [21]

3. Model Plants Used

We have focused on two model plant species in our studies. Tomato (Lycopersicon esculentum cv. Roma, Ailsa Craig, Pearson) is a classical model system for ethylene studies. Its ethylene biosynthesis gene families are among the best characterized and the cultivars available show a good variety of 0 3 susceptibility. Therefore it is most suited for studies of ethylene biosynthesis. Arabidopsis thaliana ecotype Colombia (Col-O) is a genetic model plant that is well suited for the study of 0 3 response [23,24] as well as for the isolation of new mutants. Utilizing this we have isolated from tolerant background mutants, which form visible damage (HR-like lesions) following a single peak 0 3 exposure. Arabidopsis also offers a large number of well-characterized

301

mutants including mutants defining the steps involved in ethylene perception and signal transduction. 03-sensitive mutants, Col-O wildtype (wt), and signal transduction mutants have been used for the dissection of 0 3 induced defense and cell death pathways.

4. Results and Discussion

4.1. ETHYLENE EMISSION IS CORRELATED WITH LEAF INJURY

The correlation between 0 3 sensitivity and ethylene emissions has also been seen in our model plants. In Arabidopsis, the 0 3 induced ethylene emissions of four different 0 3 sensitive mutant lines and the tolerant Col-O parental line were assayed [17]. Characteristically, the sensitive lines showed either significantly higher ethylene peaks or prolonged and elevated ethylene emissions as compared to the 0 3 tolerant Col-O. In these experiments ACC levels and damaged leaf area were also monitored. Ethylene emissions tightly followed the increased ACC concentrations and the percentage of damaged leaf area showed good correlation with both the increased ACC levels and ethylene emission levels.

The 03-induced ethylene biosynthesis can be detected both as the transcriptional induction of ACO- and ACS-genes, and at protein level as increased enzymatic activities [26]. Inhibition of ethylene biosynthesis by applying inhibitors, such as the ACS inhibitor aminoethoxyvinylglycine (AGV) or the ACO inhibitors CoCh and BAS 111..W, during 0 3 stress led to a reduction in the degree of leaf damage. Thus, these results confirm the earlier observations [12, 14] showing that ethylene biosynthesis is required for 0 3 damage formation.

4.2. RADICAL PRODUCTION, ETHYLENE BIOSYNTHESIS AND DAMAGE ARE SPATIALLY RELATED

Several different radicals have been detected during 0 3 breakdown and the Orinduced oxidative burst [9, 13]. However the mechanism of generation and roles of these radicals has remained unclear. Using nitro blue tetrazolium (NBT) staining [8] we have localized O2- production in nascent lesions of 03-exposed 0 3 sensitive Arabidopsis mutant line 2-20. O2- production continues in the healthy tissue adjacent to lesions during lesion growth (Fig. lA and IB).

It should be emphasized that superoxide production, lesion spread, and increased ethylene emissions all occurred at the same time [17]. In Col-O wt plants production was localized in discrete points randomly distributed throughout the leaf. Infiltration with diphenylene iodonium (DPf), an inhibitor of the plasma membrane NADPH oxidase, dose dependently reduced the extent of 0 3 damage in mutant line 2-20. This suggests a role for extracellular O2- (and possibly HzOz or other radicals downstream of Oz) which is derived from the plasma membrane NADPH oxidase. In order to test if Oz- was sufficient to trigger lesions in line 2-20 we have used an assay where Oz- can be generated in vitro with xanthine and xanthine oxidase (X/XO) and cell death is monitored as ion leakage. Such application of XIXO resulted in the dose dependant induction of cell death in both Col-O and line 2-20. Moderate radical treatment with this

302

system resulted in the differential induction of cell death preferentially in line 2-20 and thus establishes that exogenously applied extracellular Or is sufficient to trigger the cell death response in this mutant.

Figure 1. A Light micrograph of a NBT stain visualizing extracellular O2'

production (dark spots indicate O2-) at 4 hrs in 0 3 exposed 0 3 sensitive Arabidopsis mutant line 2-20. B. UV-epifluorescent micrograph of the same leaf as in A. UV-excited autofluorescent phenolics compounds (white spots) define the position of lesions. C. GUS stain visualizing LE-ACOI promoter activity in 0 3 exposed tomato. D. Typical 03-induced damage pattern of the same tomato cultivar shown in C, Photographed at 24 hrs. All samples recieved a 6 hr x 250 ppb 0 3 exposure then were removed to c1eain air. Times indicated as hrs after exposure begin.

As in Arabidopsis, the spatial localizations of AOS production and damage corralated well in leaves of tobacco [22]. Also the induction of ethylene biosynthesis genes appears to be spatially related to AOS and damage formation. In transgenic tomato plants carrying the ACOI promoter fused to the uidA reporter gene [4], ozone­induced GUS staining regulated by the ACOI promotor activity had a spatial distribution similar to that of the damage pattern (Fig. I C and 1 D).

4.3. EXOGENOUS ETHYLENE PROMOTES CELL DEATH

In order to test the role of increased ethylene emissions Col-O wt, gthylene insensitive mutant (ein2-1), and mutant line 2-20 Arabidopsis were exposed first to 0 3 and subsequently to either ethylene gas or clean air. The ethylene exposed plants showed an increase in damage as compared to controls that had been exposed to 0 3 alone. Increased damage was reflected both at the level of increased ion leakage and increased visible damage. This effect was seen in Col-O wt and line 2-20 mutant plants but not in the ein2-1 plants. The otherwise tolerant Col-O wt plant exposed to 0 3 and ethylene

303

showed light visible damage and the sensitive mutant showed a marked increase in the level of damage resulting in nearly complete destruction of the rosette. Furthermore, when plants were exposed to 0 3 concentrations (>350 ppb) that resulted in visible damage even in the 0 3 tolerant Col-O, no damage was evident in the ein2-1 mutant plants.

It has been proposed that ethylene promotes 0 3 toxicity by reacting chemically with 0 3 to produce dangerous activated ethylene radicals which initiate lipid peroxidation [12, 14]. However, if ethylene were acting as a non-specific agent of oxidative damage its effect would not be expected to require ethylene perception and signal transduction. We have shown that the cell death promoting action of exogenously applied ethylene is blocked in ein2-1. In light of our fmdings and recent evidence implicating ethylene as a modulator of programmed cell death, we propose that Orinduced ethylene acts as a modulator of cell death. Signals downstream of the ethylene receptor are one of the factors required for the activation of a programmed cell death pathway in ozone exposed plants.

We have also tested the effect of exogenous ethylene (added as ACC) in our X/XO in vitro cell death assay. Application of exogenous ACC in this system increased the level of cell death in both mutant 2-20 and the Col-O wt. The effect of ACC was tested with the ein2-1 mutant and the enhancement ofXIXO induced cell death was found to depend on ethylene perception, excluding the possibility of a direct effect of ACC or ethylene per se. Further support for our conclusions has been seen in tomato where it was shown that norbomadiene, an inhibitor of ethylene perception, blocked 0 3 enhanced increase in ion leakage [1].

Both in vitro and in intact ein2-1 plants there was a tendency towards slightly elevated cell death (ion leakage) in response to radical treatments. This may suggest a role for ethylene responsive defenses in preventing oxidative damage. However, it must be emphasized that this was only detectable by ion leakage and none of the treatments resulted in visible damage to ein2-1.·

5. Concluding Remarks

In addition to enhanced transcriptional activity of ethylene biosynthesis genes during 0 3 stress, reversible phosphorylation may relate AOS formation and ethylene biosynthesis at the post-transcriptional level. Enhanced ACS activity could be prevented by addition of the protein kinase inhibitor K-252a during an 0 3 treatment, and, vice versa, ACS activity increased when the protein phosphatase inhibitor Calyculin A was added to non-Ortreated leaves [26]. Similarly, application of protein kinase inhibitors to soybean cells blocked subsequent production of H20 2 in elicited cells, and phosphatase inhibitors induced the oxidative burst even in the absence of elicitors [5]. The interesting question here is whether these two phosphorylation processes are parallel or dependent on each other. In other words, the effects ofkinase/phosphatase-inhibitors on signal transduction may influence AOS production, ACS activity, and ethylene perception as well.

Other questions arise from the close correlation between 03-triggered AOS production and ethylene with respect to cell death. AOS and ethylene seem to be

304

required for cell death, possibly together with some other yet unknown factors. Dissection of their interplay during pcd requires detailed studies .

..--­OtherAOS

+

Figure 2. Schematic representation of the processes reviewed in this article. Abbreviations used: Ag++, silver ions; ACC, I-aminocyclopropane-I-carboxylic acid; ACS, ACC synthase; ACO, ACC oxidase; AOS, activated oxygen species; AVG, aminoethoxyvinylglycine; Co++, cobalt ions; CTRI, CONSTIUTIVE TRIPLE REPSONSE protein; DPI, diphenylene iodonium; EIN2, ETHYLENE INSENSITIVE 2 protein; KIN, kinase; NBD, norbomadiene; 0,', superoxide anion; 0 3, ozone; Pase, phosphatase; SAM, S-adenosyl methionine; XlXO, xanthine Ixanthine oxidase.

6. Acknowledgments

This work was supported by the Academy of Finland grants 43671,33200 and 37995.

7. References

1. Bae, G.Y., Nakajima, N., Ishizuka, K. and Kondo, N. (1996) The role in ozone phytotoxicity of the evolution of ethylene upon induction of I-aminocyclopropane-I-carboxylic acid synthase by ozone funigation in tomato plants, Plant Cell Physiol. 37,129-134.

2. Bent, A (1996) Plant disease resistance genes: Function meets structure, Plant CellS, 1757-1771. 3. Bent, AF., Innes, R.W., Ecker, J.R. and Staskawicz, BJ. (1992) Disease development in ethylene­

insensitive Arabidopsis thaliana infected with virulent and avirulent Pseudomonas and Xantomonas pathogens, Mol. Plant-Microbe Interact. 5, 372-378.

4. Blume, B. and Grierson, D. (1997) Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli, Plant J. 12, 731-746.

5. Chandra, S. and Low, P.S. (1995) Role of phosphorylation in elicitation of the oxidative burst in cultured soybean cells, Proc. Natl. Acad. Sci. USA 92,4120-4123.

305

6. Enyedi, Al, Yalpani, N., Silverman, P. and Raskin, L (1992) Signal molecules in systemic plant resistance to pathogens and pests, Cell 70, 879-886.

7. He, C.-J., Morgan, P.W. and Drew, M.e. (1996) Transduction of an ethylene signal is required for ceIl death and lysis in the root cortex of maize during aerenchyma formation induced by hypoxia, Plant Physiol. 112,463-472.

8. Jabs, T., Dietrich, RA and Dangl, J.L. (1996) Initiation of runaway cell death in an Arabidopsis mutant by extracellular superoxide, Science 273,1853-1855.

9. Kangasjarvi, J., Talvinen, J., Utriainen, M. and Karjalainen, R. (1994) Plant defense systems induced by ozone, Plant Cell Environ. 17,783-794.

10. Lund, S., Stall, R and Klee, H. (1998) Ethylene regulates the susceptible response to pathogen infection in tomato, Plant Cel/IO, 371-382.

II. Mehlhorn, H. (1990) Ethylene-promoted ascorbate peroxidase activity protects plants against hydrogen peroxide, ozone and paraquat, Plant Cell Environ. 13, 971-976.

12. Mehlhorn, H., O'Shea, lM. and Wellburn, AR. (1991) Atmospheric ozone interacts with stress ethylene formation by plants to cause visible plant injury, J. Exp. Bot. 42, 17-24.

13. Mehlhorn, H., Tabner, B. and Wellburn, AR (1990) Electron spin resonance evidence for the formation of free radicals in plants exposed to ozone, Physiol. Plant. 79, 377-383.

14. Mehlhorn, H. and Wellburn, AR. (1987) Stress ethylene formation determines plant sensitivity to ozone, Nature 327, 417-418.

15. Oetiker, lH., Olson, D.C., Shiu, Y. and Yang, S.F. (1997) Differential induction of seven 1-aminocyclopropane-I-carboxylate synthase genes by elicitor in suspension cultures of tomato, Plant Mol. BioI. 34, 275-286.

16. Orzaez, D. and GraneIl, A (1997) DNA fragmentation is regulated by ethylene during carpel senescence in Pisum sativum, Plant J. 11, 137-144.

17. Overmyer, K., Kettunen, R, Kuittinen, T., Saarma, M., Betz, C., Langebartels, C., Sandermann, H., Jr. and Kangasjarvi, l (1999) The induction of cell death in an ozone-sensitive arabidopsis mutant: The role ofsuperoxide and ethylene, (Manuscript in preparation).

18. Penninckx, LAM.A., Thomma, B.P.HJ., Buchala, A, Metraux, l-P. and Broekaert, W.F. (1998) Concomitant activation ofjasmonate and ethylene response pathways is required for induction ofa plant defensin gene in Arabidopsis, Plant Cel/IO, 2103-2113.

19. Sandermann, H., Jr. (1996) Ozone and plant health, Annu. Rev. Phytopathol. 34, 347-366. 20. Sandermann, H., Jr., Ernst, D., Heller, W. and Langebartels, C. (1998) Ozone: an abiotic elicitor of

plant defence reactions, Trends Plant Sci. 3,47-50. 21. Schlagnhaufer, C.D., Arteca, RN. and Pell, EJ. (1997) Sequential expression of two 1-

aminocyclopropane-I-carboxylate synthase genes in response to biotic and abiotic stresses in potato (Solanum tuberosum L.) leaves, Plant Mol. BioI. 35, 683-688.

22. Schraudner, M., Moeder, W., Wiese, C., van Camp, W., Inze, D., Langebartels, C. and Sandermann, H., Jr. (1998) Ozone-induced oxidative burst in the ozone biomonitor plant, tobacco Bel W3, Plant J. 16,235-246.

23. Sharma, Y. and Davis, K. (1994) Ozone-induced expression of stress-related genes in Arabidopsis thaliana, Plant Physiol. 105, 1089-1096.

24. Sharma, Y.K., Le6n, J., Raskin, L and Davis, K.R. (1996) Ozone-induced responses in Arabidopsis thaliana: the role of salicylic acid in the accumulation of defense-related transcripts and induced resistance, Proc. Natl. Acad. Sci. USA 93, 5099-5104.

25. Tingey, D.T., Standley, C. and Field, R.W. (1976) Stress ethylene evolution: a measure of ozone effects-on plants, AtmospheriC Environment 10,969-974.

26. Tuomainen, J., Betz, C., Kangasjarvi, J., Ernst, D., Langebartels, e. and Sandermann, H., Jr. (1997) Ozone induction of ethylene emission in tomato plants: Regulation by differential transcript accumulation for the biosynthetic enzymes, Plant J. 12,1151-11632.

27. Vabala, J., Schlagnhaufer, C.D. and Pell, EJ. (1998) Induction of an ACC synthase cDNA by ozone in light-grown Arabidopsis thaliana leaves, Physiol. Plant. 103,45-50.

28. Wellburn, FAM. and Wellburn, AR (1996) Variable patterns of antioxidant protection but similar ethene emission differences in several ozone-sensitive and ozone-tolerant plant selections, Plant Cel/ Environ. 19,754-760.

29. Young, T.E., Gallie, D.R and DeMason, D.A. (1997) Ethylene-mediated programmed cell death during maize endosperm development of wild-type and shrunken2 genotypes, Plant Physiol. lIS, 737-751.

FLOODING-INDUCED SENSITISA TION TO ETHYLENE IN RUMEX PALUSTRIS AND THE POSSIBLE INVOLVEMENT OF A PUTATIVE ETHYLENE RECEPTOR GENE

1. Abstract

W.H. VRIEZENl.2, C. MARIANIl AND L.A.C.J. VOESENEK2

I Department of Experimental Botany, and 2 Department of Ecology, University of Nijmegen, Toernooiveld I, 6525 ED, Nijmegen, The Netherlands

Rumex palustris, a flooding tolerant plant, increases the petiole elongation rate in response to complete submergence. This response can be partly mimicked by enhanced ethylene levels and low oxygen concentrations. A cDNA homologous to the ethylene­response sensors (ERS/ETRl) from Arabidopsis thaliana was isolated from a R. palustris cDNA library. This cDNA, RP-ERSl, was 242lbp long and shared 66% nucleotide homology with ETRI and ERS in their coding regions. The expression level of RP-ERSI was induced by exposing plants to 3% oxygen and an increase in mRNA concentration could be detected 20 minutes after the beginning of the treatment, preceding the first significant increase in elongation that was observed after 40 to 50 minutes. Experiments with ethylene synthesis and action inhibitors demonstrated that a functioning ethylene signaling pathway is necessary for the stimulation of the petiole elongation rate by low oxygen concentrations. These results suggest that the regulation of the RP-ERS I gene plays a role in the strength of the petiole elongation response R. palustris plants upon flooding.

2. Introduction

Rosettes of wetland Rumex species such as R. palustris accommodate to submergence by stimulating petiole elongation. This petiole response requires ethylene and gibberellin [8, 10]. Continues ethylene production and physical entrapment of the gas causes a 100-fold rise in the endogenous ethylene concentration in R. palustris within 24h of submergence [I, II]. However, an ethylene enriched atmosphere is only responsible for 80% of the elongation as compared to petiole elongation rate upon submergence in R. palustris. We found that low oxygen concentrations also enhances petiole elongation in R. palustris and that this response was ethylene dependent. Low oxygen sensitised the petiole tissue to ethylene and this increase in responsiveness is preceded by an increase in the expression level of a gene coding for a putative R. palustris ethylene receptor.

307

308

A RP-ERSI

28SrRNA

time (h) o 2 3 4 5 6 8 10 12 24 48

B RP-ERSI

28SrRNA

Figure I. RP-ERSI messenger accumulation in petioles (A) and in leaf blades (B) at different times after submergence.

time (h) after de-submergence 0.5 1 2 4 14 COS24 0.5 2 4 14

6 Air A RP-ERS.l

4

28S rRNA

B RP-ERSl' CO S24

28SrRNA

C RP-ERSI

28S rRNA

D RP-ERS1

28SrRNA

Figure 2. RP-ERSI messenger levels in leaves before (CO) and after 24h of submergence (S24) and during subsequent de-submergence in different atmospheres. De-submergence in: (A) air (21 % oxygen, 0.033% C02 in nitrogen gas); (B) air + 5J.l1l1 ethylene; (C) 3% oxygen, 0.033% C02 in nitrogen gas; (D) 3% oxygen; 0.033% C02 in nitrogen gas + 5J.l1I1 ethylene. The graphs on the right represent the relative mRNA concentration corrected for the loaded amount of RNA.

309

3. Results

3.1. RP-ERSI mRNA LEVEL IS MODULATED DURING SUBMERGENCE

We isolated a full-length cDNA clone (RP-ERS1; 2421bp long) which shares 66% nucleotide homology with ETRI [2]. Upon alignment of the deduced amino acid sequence with other known ethylene-response genes, RP-ERSI appeared to be a homologue of ERS [4] and like this it lacks the receiver domain which is present in ETRI. In order to analyse RP-ERSI transcript accumulation under flooding stress, we performed RNA blot hybridisations with RNA isolated from petioles and leaf blades of 26-to 30-day-old R. paiustris plants. Figure 1 shows that the level of RP-ERSI transcript (2.4kb) in untreated R. pa/ustris plants (t=Oh; Fig. 1) was low but detectable. In contrast, when the plants were submerged, an increase in the transcript level could be observed within 2h of submergence with the highest levels between 3h and 8h under water. The pattern of mRNA accumulation was similar in both tissues, petioles and leaf blades, although the overall transcript levels were higher in the petioles.

After lowering the water level to just above the roots (de-submergence), an immediate decrease in RP-ERSI gene expression in the shoot was observed, and Ih after de-submergence accumulation of the transcript reached almost the basal level (Fig. 2A). In general, when plants are exposed to flooding stress, endogenous ethylene and carbon dioxide concentrations increase and the oxygen level declines [9]. The impact of these changes on the expression level of RP-ERSI was investigated by de-submerging R. pa/ustris plants in mixtures of these gases in concentrations that mimic partly the underwater situation. Northern blot analysis of RNA isolated from leaves of plants de­submerged in air with 5~I/1 ethylene (Fig. 2B) showed that ethylene prevents the mRNA concentration to decrease to basal levels, as it does in air. De-submergence in an atmosphere with low oxygen concentration (Figs 2C and 2D) induced the RP-ERSI transcript levels to values higher than under submergence.

3.2. LOW-Oz-CONCENTRATION-INDUCED PETIOLE ELONGATION

The stimulating effect of ethylene on the petiole elongation in R. palustris is well described by Voesenek and Blom [10]. Besides ethylene, also low oxygen concentrations exerted this stimulating effect. Figure 3 shows clearly enhanced petiole elongation rates at oxygen concentrations between 2 and 11 %. Treatment of R. pa/ustris plants with inhibitors of ethylene action and biosynthesis showed that petiole elongation in an atmosphere containing 3% oxygen is induced via ethylene [12]. Figure 4 shows that this growth increase is inhibited by 2, 5-norbornadiene (NBD), a competitive inhibitor of ethylene action. This effect could be counteracted by applying ethylene (1 O~l/l), underlining the competitive action of NBD. NBD did not influence the growth under 21 % oxygen. These observations demonstrated that 3% oxygen stimulated petiole growth indirectly via the plant hormone ethylene.

310

30

OL-~5~~1~0--~1~5--~20~­Oxygen concentration (%)

Figure 3. Elongation of the youngest petiole (n=8; means ± SE) of R. palustris in response to a range of O2 concentrations.

200 A

~ c 150 .g §b c .9 " 100

..!l .g & ~ .~

& 21%02

Figure 4. Elongation of the youngest petiole (n=8; means ± SE) of R. palustris in an atmosphere containing 21 (A) or 3% O2

(8) in the presence and absence of 2, 5-norbomadiene (NBD).

Raskin and Kende [7] showed that in deepwater rice low oxygen levels stimulate elongation via an increased production of ethylene. In order to test whether low oxygen levels have an effect on the synthesis rate of ethylene, which in tum generates the increased petiole growth, we measured the ethylene production rate during treatment with low oxygen concentrations. The average ethylene production by control plants was 4.8nll(g DW*h) (SE=1.3nll(g DW*h) during the first 24h. Ethylene production by plants exposed to 3% oxygen was 3.8nll(g DW*h) (SE=0.6nl/(g DW*h) [13]. In summary, oxygen exerted its effect on the petiole growth level independently of an increased ethylene concentration in R. pa/ustris. This was also reflected by the ethylene-response curves of R. pa/ustris during exposure to 21 and 3% oxygen [12]. The [Rlso of 0.26 ± 0.12JlIlI ethylene under 21% oxygen decreased to 0.04 ± 0.02Jll/l ethylene during exposure to 3% oxygen. In summary, exposure of R. pa/ustris plants to low oxygen concentrations increased the rate of the elongation response at basal ethylene concentration.

3.3. LOW-OTCONCENTRATION-INDUCED RP-ERSI GENE EXPRESSION

Low oxygen concentration induced petiole growth and stimulated also the RP-ERSI mRNA accumulation (Figs 2 and 3). This correlation suggests a causal relation between enhanced elongation and receptor gene expression. In this respect we studied the precise timing of both events. Figure 5 shows that the growth rate increased significantly after 40 to 50 min of exposure to 3% oxygen. The RP-ERSI messenger concentration increased within 20 min after the switch to 3% oxygen to a well detectable level and reaches a maximum after 2h, in this experiment [12].

311

4. Discussion

We showed that RP-ERSI gene activity increased after submergence especially in the petioles, the tissue with the highest elongation rate. RP-ERSI gene activity is probably stimulated by accumulated ethylene and low oxygen concentration during submergence.

Low oxygen concentration alone can also stimulate the petiole elongation response of R. palustris. This stimulation is nonetheless dependent on ethylene action and takes place without an increase in ethylene concentration. The RP-ERSI messenger concentration increased before the first significant increase in growth rate of the youngest full-grown petiole during exposure to 3% oxygen (Fig. 5). RP-ERSI exhibit strong sequence homology with

~1.5 §

ETRI and the other members of the ~ ethylene receptor gene family from ..c:1.0

Arabidopsis, that are considered to act as ! receptors. Therefore, we assume that RP- ~ ERS 1 is also an ethylene receptor protein ....l0.5

in R. palustris. The increase of RP-ERSI mRNA levels upon exposure to low oxygen concentration and the subsequent increase of responsiveness to ethylene

A suggests an increase in sensitivity to this

-80 -40

hormone caused by an increased RP-ERSI concentration of receptor proteins. This mRNA conc.

simple hypothesis, however, does not • agree with recent studies of loss-of-

B o 20

o 40 80 120 time (min)

40 60 120 240 360 time (min)

function mutations of several Arabidopsis ethylene receptor genes [5]. Single, double, triple and quadruple mutant analysis of four members of the ethylene receptor family showed that knocking out the ethylene receptors leads to constitutive

Figure 5. Growth rate (n=5-6; means ± SE) during 10-min intervals of the youngest full-grown leaves of R. palustris with (closed symbols) and without (open symbols) 3% oxygen treatment (A). The bats represent the relative concentration of RP-ERSI messenger after the switch to 3% oxygen (B).

ethylene responses. This suggests that the ethylene responses are repressed by the receptors instead of induced. According to this model, RP-ERSl seems to have the opposite function as the putative ethylene receptors studied in Arabidopsis. Although this seems unlikely, it is possible to make a model that could explain this function. RP­ERSl could bind to CTRl (the negative regulator of the ethylene responses; [6]), as do ETRI and ERS from Arabidopsis [3], but fails to activate it. A higher concentration of RP-ERS 1 will sequester the free molecules of CTRI available in the cell, thus abolishing the ethylene response inhibition. However, we have not determined if RP­ERSl really binds ethylene, nor if it interacts with CTRI. Furthermore, the presence of unknown regulating factors that can modify the ethylene signal transduction in R. palustris can not be excluded. Therefore extensive research is necessary to explain the regulation of the responses induced by the ethylene signal transduction pathway in R. paiustris.

312

5. Acknowledgements

We thank Kees Blom for critical reading of the manuscript.

6. References

I. Banga, M., SIaa, EJ., BJorn, C.W.P.M. and Voeseriek, L.ACJ. (1996) Ethylene biosynthesis and accumulation under drained and submerged conditions: A comparative study of two Rumex species, Plant PJrysiol. 112,229-237.

2. Chang, c., Kwok, S.F., Bleecker, AB. and Meyerowitz, E.M. (1993) Arabidopsis ethylene­response gene ETR]: Similarity of product to two-component regulators, Science 262, 539-544.

3. Clark, K.L., Larsen, P.B., Wang, X. and Chang, C. (1998) Association of the Arabidopsis CTRI Raf-like kinase with the ETRI and ERS ethylene receptors, Proc. Natl. Acad. Sci. USA 95, 5401-5406

4. Hua, J., Chang, C. and Meyerowitz, E.M. (1995) Ethylene insensitivity conferred by Arabidopsis ERS gene, Science 269, 1712-1714.

5. Hua, J. and Meyerowitz, E.M. (1998) Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana, Cell 94, 261-271.

6. Kieber, lJ., Rothenberg, M., Roman, G., Feldmann, K.A and Ecker, J.R. (1993) CTR], a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raffamily of protein kinases, Cel/72, 427 -441.

7. Raskin, I. and Kende, H. (1984) Regulation of growth in stem sections of deepwater rice, Planta 160,66-72.

8. Rijnders, lG.H.M., Yang, Y.Y., Kamiya, Y., Takahashi, N., Barendse, G.W.M., Blom, C.W.P.M. and Voesenek, LACJ. (1997) Ethylene enhances gibberellin levels and petiole sensitivity in flooding-tolerant Rumex palustris but not in flooding-intolerant R. acetosa, Pianta, 103, 20-25.

9. Stiinzi, J.T. and Kende, H. (1989) Gas in the internal air spaces of deepwater rice in relation to growth induced by submergence, Plant Cell Physiol. 30,49-56.

10. Voesenek, L.ACJ.and BJorn, C.W.P.M. (1989) Growth responses of Rumex species in relation to submergence and ethylene, Plant Cell Environ. 12,433-439.

11. Voesenek, LAC.J., Banga, M., Their, R.H., Mudde, C.M., Harren, FJ.M., Barendse, G.W.M. and BJorn, C.W.P.M. (1993) Submergence-induced ethylene synthesis entrapment, and growth in two plant species with contrasting flooding resistances, Plant Physiol. 103, 783-791.

12. Voesenek, L.AC.J., Vriezen, W.H., Smekens, MJ.E., Huitink, F.H.M., Bogemann, G.M. and BJorn, C.W.P.M. (1997) Ethylene sensitivity and response sensor expression in petioles of Rumex species at low O2 and high CO2 concentrations, Plant Physiol. 114,1501-1509.

13. Vriezen, W.H., Van Rijn, C.P.E., Voesenek, L.ACJ. and Mariani, C. (1997) A homologue of the Arabidopsis thaliana ERS gene is actively regulated in Rumex palustris upon flooding, Plant 1. 11, 1265-1271.

INTERACTIONS BETWEEN OXYGEN CONCENTRATION AND CLIMACTERIC ONSET OF ETHYLENE EVOLUTION

1. Abstract

T. SOLOMOS Department of Natural Resource Science and Landscape Architecture. University of Maryland, College Park. MD 20742

The most significant action of low oxygen on the senescence of detached plant organs is the retardation of the onset of the climacteric rise in ethylene evolution. We have observed that this aspect of low oxygen is saturable, in that for oxygen to delay the climacteric rise in ethylene evolution in apples and carnation flowers its concentration must be reduced below about 6.078 kPa. In cut carnation flowers, 4.5% oxygen delays the accumulation in mRNA of both ACC-oxidase and -synthase by about 6-7 days beyond that found in air samples. In contrast, low oxygen enhances the activity of alcohol dehydrogenase (ADH). In flowers kept under 1.52 kPa O2 there is no accumulation of ACC-synthase or -oxidase transcripts for 17 days, the duration of the experiment. The data thus indicate that there is a mechanism that responds to low oxygen by retarding the synthesis of enzymes associated with normal senescence while at the same time enhancing the synthesis of anoxic proteins, yet without inducing anaerobic fermentation. Preliminary results indicate that a heme-containing protein may be involved in the "sensing" of the concentration of oxygen.

2. Introduction

Although the commercial use of controlled atmosphere (CA) storage is very extensive, the mode of action of low O2 and/or high CO2 is not well understood. The overt physiological responses of detached horticultural crops to hypoxic stress include a retardation of the climacteric rise in ethylene, a decrease in respiration, and a decrease in the rate of ripening of fruits whose ripening has been initiated either naturally or in response to exogenous C2H4 application. At present it is not clear whether these responses are indirect, due to the inhibitory effects of low O2 on ethylene action, or whether they are the direct result of low O2 itself. The fact that hypoxia engenders similar respiratory responses in tissues other than fruits where C2H4 is not at issue, e.g., potato tubers and sweet potato roots [I, 6], indicates that hypoxia exerts metabolic responses beyond those related to the senescence of horticultural crops in general and fruit ripening in particular.

In this presentation we shall address questions concerning the quantitative aspects of

313

314

hypoxia on the three physiological effects mentioned above.

3. Results and Discussion

Firstly, concerning the retarding effects of hypoxia on the onset of the climacteric rise in Cz~ evolution, it was reported previously that they are saturable, in that before Oz can induce the delay, its concentration must drop below a certain level [2]. A case in point occurs in "Gala" apples, where the climacteric onset is delayed when the concentration of O2 decreases below 6.08 kPa O2 (Fig. 1). In cut carnation flowers the climacteric rise in CO2 output, which is the result of the increase in C2H4 evolution, is delayed when the Oz concentration drops to 5.07 kPa O2 [3]. The delay in the rise in CZH4 evolution cannot be attributed to the restriction of the oxidation of ACC because in initiated bananas the initial decrease in C2H4 by hypoxia recovers with time, while imposition of hypoxia at the preclimacteric stage completely suppresses the increase in C2H4

evolution for 20 d (Fig. 2). Neither can the retarding effects of hypoxia on the timing of the climacteric onset of CZH4 evolution be attributed to the inhibition of C2H4 action, because hypoxia extends the vase-life of cut carnations to three times that of those treated with inhibitors of C2~ action [3]. In short, the data indicate that low Oz delays the onset of the C2H4 climacteric by inhibiting the developmentally regulated genes that lead to the induction of CZH4 biosynthesis. In carnation flowers 4.56 kPa O2 delays the accumulation of the ACC-synthase transcript by about 6-7 days beyond that of the

200

~12 %02 1 Ii:i 00 160 z 0 0 a: 120 IU _13%~1 I-

~ ~ ::i! l ~ 4% 0 2 1 :J 80 0 0 I- \ I a% 0. I 00

~ 40 .c--0 \

It.-lt.-lt.

0 a 20 40 flO 80 100

% OXYGEN

Figure I. Effect of O2 levels on the onset of the C2H. climacteric in 'Gala' apples.

flowers kept in air, whereas 1.5% O2 totally suppresses it for 17 days (Fig. 3). Similar results are also observed with the synthesis of ACC-oxidase transcripts (Fig. 4). These results verify previous observations showing that O2 concentrations below 5.07 kPa O2 retard the onset of the climacteric rise in C2H4 evolution [3]. The decrease by hypoxia in the rate of ripening is also saturable. For instance, in avocados, in order that Oz may

315

decrease the rise in the activity and accumulation of protein and mRNA transcripts of enzymes associated with ripening, its concentration should be decreased below 7.60 kPa O2 [4]. Furthermore, the degree of inhibition is inversely related to O2 partial pressure. Collectively, the results indicate that the delaying effects of hypoxia on the timing of the C2H4 climacteric are saturable and cannot be attributed to the inhibition of either C2H4

biosynthesis or action but rather to a slow-down of the developmentally regulated processes that lead to the induction of ACC-synthase and -oxidase. In addition, the suppression in initiated fruits of the induction of enzymes associated with ripening is also saturable.

1.00

0.90

r\''" 0.80

0.70

..c: 0.60 \ 1..------"">4-'" , .. 0, C)

'<t 0.50 :::c N I II 0 0.40 ,

c 0.30 \ ;I

1-~ t 2.53 kPs 0.

0.20 !:

\ 0.10

... 0.00

0 4 8 12 16 20

DAYS IN TREATMENT

Figure 2. Effect of2.5% O2 on the rate ofC2H4 evolution in bananas treated with C2H4•

ITR:t...2--7-..---Q....;1;.,;,;.5;,..:%.::..2,;;;;O;..;:X..:.,Y~~EN:..:--1"..7 --1'_~5 % ~XYG~~

Figure 3. Northern blot of ACC synthase of carnations kept in air, 1.5% O2, and 4.5% O2 • Numbers at the top of the lanes indicate days under treatment.

3"16

o A2~ 1.5r OXYGEN 4.5%OXYGEN ............... O""-..;;I4r...-_Z'-""-.,I;2_...l7r...-_1,u.O'--17 I 2 7 10

Figure 4. Northern blot of ACC-oxidase of carnations kept in air, 1.5% O2, and 4.5% O2. The numbers at the top of the lanes indicate days under treatment.

Secondly, with respect to the respiratory diminution by low O2, previous results show that it is biphasic, in that it includes an initial decrease at relatively high O2

concentrations, followed by a rapid decline as O2 approaches zero. Furthermore, the initiation of the respiratory decrease cannot be attributed either to the resistance of O2

diffusion or to the restriction of cytochrome oxidase [1, 2, 5] but rather to a "regulatory" protein which has a much lower affinity for O2 than does cytochrome oxidase, and whose restriction by low O2 leads to a feedback inhibition of the initial steps of glucose oxidation.

In order to determine the apparent Km for O2 of the "regulatory" protein we used peeled sweet potato roots, which do not produce C2H4 but which respond to its exogenous application with a climacteric-type respiratory rise. In addition, the shape of the curve obtained by plotting the rate of CO2 output vs. O2 concentration is biphasic [2].

We developed a model in which a root measured 10 cm. long and 3 cm in radius. In conformity with the model, we divided it into 29 concentric, hollow cylinders, each 0.1 cm thick. The root in the model also consisted of a solid cylinder at its center. We solved Fick's time-independent second law of diffusion equation for hollow and solid cylinders [7]. From the observed rates of CO2 output, the dimensions of the root and the diffusivity of O2 through the flesh, we calculated both the O2 concentration and the rate of respiration profiles across the root. The Km for O2 was varied so that the calculated internal O2 concentration in air equaled that observed experimentally. Figure 5 shows that when the Km for O2 was 1.78%, the calculated rate of CO2 output was similar to the observed rate. It should also be noted that the decrease in the rate of CO2 output occurred when the O2 concentration decreased below 6%.

3.1. HYPOXIA AND INDUCTION OF ANOXIC ENZYMES

The metabolic ramifications of hypoxia transcend those related to the senescence of detached plant organs. For instance, pre-treatment of plant tissues with hypoxia improves their ability to survive subsequent anoxia [8, 9]. These effects involve

317

biochemical responses, such as enhancem~nt of the glycolytic potential with the synthesis of anoxic enzymes [10], as well as the synthesis ofaerenchyma in roots [11]. Exposure of carnation petals to 1.25 kPa O2 for three days augments the activity of ADH, which in turn results in a rise in ethanol synthesis and a period of survival in subsequent anoxia which is longer than that of the flowers that have been kept in air [9]. In the case of avocados, the same range of O2 concentrations, which suppresses the induction of enzymes associated with ripening induces the synthesis of anoxic isoforms of ADH [4]. In preclimacteric bananas, hypoxia enhances the activities of pyruvate decarboxylase and ADH (Fig. 6), as well as sucrose synthase, an anoxic protein [2]. Preliminary results with carnation flowers indicate that the induction of anoxic proteins appears also to be saturable (unpublished observations).

30 r---------------------------------,

Figure 5. Observed and calculated rates of CO2 output in sweet potatoes as a function of O2•

This experimental evidence suggests that in plant tissues there is an oxygen "sensor" which, on the one hand, suppresses the rate of senescence and, on the other, induces anoxic proteins. An oxygen "sensor" has been found in Nrfixing bacteria, where it regulates the expression of the nitrogenase gene [12], and in higher animals, where it regulates the Erythropoietin gene [13]. It has been demonstrated that the oxygen sensor is a high-spin iron heme protein [12]. It is thus feasible that the affinity for O2 of the "sensor" could be reduced by substituting Fe2+ for either C02+ or Ni2+. If this is the case, then the addition of the above ions to the holding solution of cut carnations may result in the induction of anoxic proteins in air. Moreover, Ni2+ should be a stronger inhibitor

318

than C02+. The data presented in Table 1 tend to support this hypothesis.

0.30 1.00

[K] B 2.52 kP. I PYFlOVA.T':= D~C,<loFlBO)lYLAo!IJ: I

0.24 I A DH AC TlV lTV I .-:c 0.00 :c " ' "":"01 01

m 0 0.18 " 0.00 c: >-oj ,,-.,

.t= IR ~w

ID 1;:-

~ 0.12

"l 0.40

QJ

0 "6 E E " 0.00 ." 0.00

0.00 0.00 00 00

DAYS IN STORAGE DAYS IN STORAGE

Figure 6. Activities of ADH (A) and PDC (B) in bananas kept either in air for 3 days or 2.5% O2 for 20 days.

Table 1. ADH activity in carnation flowers kept for 3 days in water, 5 mM CoCh and 5 mM NiCh. The numbers in parentheses are the STD of two flowers.

Treatment

Water

5 mMCoCh

5mMNiCh

4. References

ADH Activity nmol.ethanol/mg protein/min

4.13 (0.05)

13.03 (2.39)

15.24 (1.95)

1. Solomos, T. (1982) Effects of low O2 concentration on fruit respiration: Nature of respiratory diminution, in D.G. Richardson and M. Meheriuk (eds.), Controlled Atmospheres for Storage and Transport of Perishable Agricultural Commodities, Oregon State University, Timber Press, Beaverton, pp 161-170.

2. Solomos, T. and Kanellis, AK. (1997) Hypoxia and fruit ripening, in AK. Kanellis, C. Chang, H. Kende, and D. Grierson (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 239-252.

3. Solomos, T. and Gross, K. (1997) Effects of hypoxia on respiration and the onset of senescence in cut carnation flowers (Dianthus caryophyllus L.), Postharvest BioI. and Technol. 10, 145-153.

4. Kanellis, AK., Solomos, T. and Roubelakis-Angelakis, K.D. (1991) Suppression of cellulase and polygalacturonase and induction of alcohol dehydrogenase isoenzymes in avocado mesocarp subjected to low O2 stress, Plant Physiol. 96, 269-274.

5. Tucker, M.L. and Laties, G.G. (1985) The dual role of oxygen in avocado fruit respiration: Kinetic analysis and computer modeling of diffusion-affected kinetics, Plant Cell Envir. 8, 117-127.

6. Mapson, L.W. and Robinson, J.E. (1962) Terminal oxidases of potato tuber, Bioch. 1. 82, 19-25. 7. Solomos, T. (1987) Principles of gas exchange in bulky plant tissues, HortSci. 22,766-771.

319

8. Saglio, P.H., Drew, M.C. and Pradet, A. (1988) Metabolic acclimation to anoxia induced by low (2-4 kPa partial pressure) oxygen treatments (hypoxia) in root tips of Zea mays, Plant Physiol. 86,61-66.

9. Chen, X. and Solomos, T. (1966) Effects of hypoxia on cut carnation flowers (Dianthus caryophyl/us L.): Longevity, ability to survive under anoxia, and activity of alcohol dehydrogenase and pyruvate kinase, Postharvest BioI. Technol. 7,317-329.

10. Sachs, M.M., Subbaiah, C.C. and Saab, LN. (1996) Anaerobic gene expression and flooding tolerance in maize, J. Expt. Bot. 47: I-IS.

11. Drew, M.e., Jackson, M.B. and Giffard, S. (1979) Ethylene-promoted adventitious rooting and development of cortical air spaces (aerenchyma) in roots may be adaptive response to flooding in Zea mays L., Planta 1536, 217-224.

12. Giles-Gonzalez, M.A., Gonzales, G. and Peruz, M.R. (1995) Kinase activity of oxygen sensor FixL depends on spin state of its heme iron, Biochemistry 34,232-236.

13. Goldberg, M.A., Dunning, S.P. and Hunn, F. (1988) Regulation of erythropoietin gene. Evidence that the oxygen sensor is a heme protein, Science 242, 1412-1415.

MANIPULATION OF THE EXPRESSION OF HEME ACTIVATED PROTEIN HAPSc GENE IN TRANSGENIC PLANTS

1. Abstract

W. GHERRABy 1,2, A. MAKRIS2, 1. PATERAKI 1, M. SANMARTIW, P. CHATZOPOULOS4 AND A. K. KANELLIS 1,3,5

ilnstitute of Viticulture, Vegetable Crops and Floriculture, National Agricultural Research Foundation, PO Box 1841, GR-711 10 Heraklion, Crete, Greece; 2 Mediterranean Agronomic Institute of Chania, PO Box 85, GR-731 00 Chania, Crete, Greece; 3Institute of Molecular Biology and Biotechnology, FORTH, PO Box 1527, GR-711 10 Heraklion, Crete, Greece; 4Dept. of Agricultural Biology and Biotechnology, Agricultural University of Athens, Iera Odos 75, GR-118 55 Athens, Greece; 5 Dept. of Pharmaceutical Sciences, Aristotle University ofThessaloniki, GR-540 06 Thessaloniki, Greece

To better understand the regulation of respiratory metabolism during hypoxia, we have isolated a gene, HAP5c (Heme Activated Erotein), from Arabidopsis thaliana that shows 65% amino acid identity with the yeast HAP5, one of the subunits of CCAA T­binding factor. This binding factor is a transcriptional activator of nucleus encoded­mitochondrial genes, and genes involved in heme biosynthesis. Transgenic Arabidopsis thaliana and tobacco plants bearing an antisense to HAP5c and a sense HAP5c, respectively, have been produced which showed altered growth and flower structure. The significance of these findings is discussed in relation to fruit ripening and senescence.

2. Introduction

2.1. REGULATION OF GENE EXPRESSION BY HEME

The term "heme" (an alternative spelling is "heam") is defined by the IUB enzyme commission as any tetrapyrolic chelate of iron. The four major groups of cytochromes a, b, c and d are defined as heme proteins, because they contain heme which is a small organic non-protein portion as a prosthetic group. The latter mayor may not be covalently bound to the apoprotein depending upon the cytochrome type [6]. Heme serves also as a prosthetic group in some oxygen-binding proteins such as catalases. Its function is intimately entwined with that of molecular oxygen. Heme plays a regulatory role in many different processes in a wild variety of organisms [17], so it is not

321

322

surprising that heme serves as an intermediate in the signaling mechanism for oxygen levels in yeast cells. Most of the heme activated genes fall into two categories: those encoding respiratory functions such as the cytochrome subunits, and those encoding oxidative damage repair functions such as catalase and manganese superoxide dismutase. On the other hand, the expression of the second set of genes is repressed by heme. Most of these genes are regulated by the action of ROX 1, encoding the heme­dependent repressor [10]. The expression of the ROXI gene is transcriptionally activated by heme [11], thus heme repression of ROX I-regulated genes results from the heme-dependent transcriptional activation of the repressor gene.

2.2. HEME ACTIY ATED PROTEINS

Two distinct heme activated protein (HAP) complexes: HAPI and HAP2/3/4/5 have been shown to be heme-dependent transcriptional activators. The properties of these complexes have been reviewed by Zitomer and Lowery, [24].

In yeast, S. cerevisiae, the CCAAT -binding factor has been shown to be a heteromeric complex containing HAP2, HAP3, HAP4 and HAP5 [7, 8, 13, 14].

The HAP2, 3 and 4 genes were identified because mutations in any of these genes abolish the activity of the CCAA T box in vivo, thereby blocking the expression of nuclear genes encoding mitochondrial proteins and preventing the growth of mutants on lactate medium [7, 8, 18, 23]. HAP5, on the other hand, was isolated by the two­hybrid methods using essential core sequences of HAP2 as bait [13]. HAP2, HAP3 and HAPS form a heteromeric complex called HAP2/3/5, in which all the subunits of the complex are required for the assembly and CCAAT-binding activity [13].

2.3. COUNTERPARTS OF THE HAP2/3/4/S COMPLEX IN OTHER EUKARYOTES

CCAA T -box -related motifs have also been identified in the promoters of a variety of vertebrate genes. A range of transcription factors has been shown to bind to CCAA T boxes, with varying levels of specificity [4, 19], and each is thought to playa distinct role in gene expression or DNA replication [20].

In mammals, the CCAAT-binding factor is known as CBF (NF-Y or CPl), and consists also of three subunits: CBF-A, CBF-B and CBF-C. The homologies between yeast HAP2 and HAP3, and their mammalian counterparts CBF-B and CBF-A respectively, are sufficiently extensive to allow the assembly of functional hybrids [3]. The identification of the last subunit, CBF-C, confirmed that in mammalians, as well as in yeast, three subunits are essential for DNA-binding [12].

The rat CBF-C subunit (counterpart of HAPS) allows formation of a protein-DNA complex with yeast HAP2 and HAP3, suggesting that the DNA-binding and subunit interaction functions of these polypeptides are interchangeable and their functions are completely conserved between yeast and rodents [21]. Similar implications have been made previously, based on the same experiment using human counterparts CBF-B and CBF-A [2].

Furthermore, homologues of both HAP2 and HAP3 have been isolated from yeast Schizosaccharomyces pombe [16, 23].

323

2.4. COUNTERPARTS OF THE HAP2/3/4/5 COMPLEX IN PLANTS

A homologue of HAP2 has been reported to be isolated from Brassica napus [1], and a protein with similarity to HAP3 has been isolated from maize [9].

Recently, the three necessary components of the HAP complex function have been isolated from Arabidopsis thaliana [5]. Surprisingly, multiple forms of each HAP homologue were found in Arabidopsis. Three independent Arabidopsis HAP subunit 2 (AtHAP2) cDNAs were cloned by functional complementation of yeast hap2 mutant, and two independent forms of each of AtHAP3 and AtHAP5 cDNAs (HAP5a and HAP5b, whose accession numbers are, respectively, Y13725 AND Y13726), were detected in the expressed sequence tag database. Additional homologues (two of AtHAP3 and one of AtHAP5) have been identified from available Arabidopsis genomic sequences.

An Arabidopsis homologue of the HAP5 protein was independently isolated in a yeast genetic screen as an enhancer of pseudohyphal filamentation [22]. The isolated gene, which is 625bp, is a third isoform ofHAP5 that may be called HAP5c. The latter clone has been used in the present study.

In this study, we intend to alter the function of the heteromeric CCAAT-binding complex by altering the function of its essential component HAP5c by either antisensing or over-expressing AtHAP5c in Arabidopsis and tobacco plants, respectively. This approach was based on the fact that yeast mutants ofHAP5 exhibited retarded growth, thus by altering the expression HAP5 in plants we expect to obtain transgenic plants with altered growth.

3. Results and Discussion

3.1. TRANSFORMATION OF ARABIDOPSIS WITH ANTISENSE TO ATHAP5C

We transformed Arabidopsis plants using the vacuum infiltration method with a construct consisted of the promoter 35S of cauliflower mosaic virus (CaMV), downstream of which the open reading frame of cDNA HAP5c was inserted in the reverse orientation, between the HindIII and XbaI restriction sites in the pGA643 binary vector.

The growth of plants in the selective media provided initial phenotypic evidence for the efficient transformation. Further, PCR (Polymerase Chain Reaction) was carried out using the genomic DNA of transformed Arabidopsis as a template and primers of the CaMV 35S-promoter and the forward HAP5c, in order to avoid amplification of the endogenous HAP5c gene. The PCR products were subsequently run on a gel and hybridized to the cDNA HAP5c probe under high stringency conditions. To confirm the presence of the expected antisense RNA transcript of HAP5c, and study its effect on the expression of the endogenous gene, RNA samples from transformed plants as well as wild type Arabidopsis were isolated, electrophoresized, blotted and hybridized to the HAP5c probe under high stringent conditions. The transcript of the antisense HAP5c transgene was detected with a size of around O.6kb in all the transgenic plants that were

324

analyzed, while it was absent in the wild type plants. The transcript of the endogenous HAP5c was detected, with a size of around O.9kb, relatively in higher amounts in the wild type than in the transgenic plants.

3.2. EXPRESSION OF THE ANTISENSE HAP5C RESULTED IN DIFFERENT PHENOTYPES IN INDIVIDUAL PLANTS

Targeting the endogenous HAP5c by expression of its antisense in Arabidopsis resulted in different types of transgenic plants. The first type did not show any visible effect as compared to the control (wild type Columbia), despite the presence of the antisense RNA. The second type of transgenic Arabidopsis manifested slower growth and therefore, seeds were collected one month later as compared to the control. In the third type of transgenic Arabidopsis, the phenotype was more accentuated. In addition to the slow growth, the plants were sterile and dwarf. The leaves were dark-green, small and wavy. The stems were weak as compared to wild type plants.

3.3. OVEREXPRESSION OF HAP5C IN TRANSGENIC TOBACCO

Tobacco plants [ecotype "Samsun"] were transformed with the Arabidopsis HAP5c gene using the particle gun bombardment method. The construct consisted of the promoter 35S transcript of CaMV, downstream of which the full length of the Arabidopsis HAP5c gene was inserted in the sense orientation between the EcoRI and Not! restriction sites in the pAM35S plasmid.

Examination of tobacco transgenic plants revealed that all the plants were sterile and some of them exhibited retarded growth. Three types of abnormalities were observed in the flowers. The first type of flowers consisted of short stamens, which were unable to reach the carpel. The second type of flowers showed alterations in the organ identity of the stamens, which were transformed to carpel structure. Finally, in the third type flowers, the stamens were transformed in petal-like structure.

Another significant observation about these tobacco plants was the existence of normal flowers, carrying normal stamens, together with altered flowers in the same plant. Nevertheless, none of these flowers was able to produce seeds.

4. Discussion

As a first approach in manipulating the expression of the HAP complex in plants, the Arabidopsis HAP5c was expressed in the antisense and sense orientations in Arabidopsis and tobacco plants, respectively. Retarded growth and male sterility were observed in both transgenic plants. It is expected that inhibition of HAP5c expression would prevent the assembly and functioning of the HAP complex. Consequently, this would result in the alteration of the function of a wide array of genes including the mitochondrial inner membrane protein cytochrome c. It is therefore attempting to speculate that the HAP complex is activating the turnover of some processes occurring in mitochondria during plant growth and development.

325

HAP complex offers a very promising field of research, in postharvest physiology. As ripening of many fruits, such as tomatoes, is accompanied by a peak in respiration (referred to as climacteric) and a concomitant burst of ethylene synthesis, it would be very interesting to mimic the effect of suppression of HAP5c on fruit ripening and reduce respiration in order to have fruits with delayed ripening characteristics.

On the other hand, knowing that HAP5c suppression in a plant may result in male sterility, it could be utilized in producing transgenic plants that are male sterile.

5. Acknowledgments

This work was supported by the grant F AIR95-0225 of the European Commission.

6. References

I. Albani, D.and Robert, L. S. (1995) Cloning and characterization of Brassica napus gene encoding a homologue of the B subunit of a heteromeric CCAAT -binding factor, Gene 167, 209-213.

2. Becker, D.M., Fikes, J.D. and Guarente, L. (1991) A cDNA encoding a human CCAAT-binding protein cloned by functional complementation in yeast, Proc. Nat!. Acad Sci.USA 88,1968-1972.

3. Chodosh, L.A, Olesen, J.T., Hahn, S., Baldwin, AS., Guarente, L. and Sharp, P.A. (1988) A yeast and a human CCAAT-binding protein have heterologous subunits that are functionally interchangeable, Cel/53, 25-35.

4. Dorn, A, Bollekens, J., Staub, A, Benoist, C. and Mathis, D. (1987) A mUltiplicity of CCAAT box-binding proteins, Cel/50, 863-872.

5. Edwards, D., Murray, J.A.H. and Smith, AG. (1998) Multiple genes encoding conserved CCAAT­Box Transcription factor complex are expressed in Arabidopsis, Plant Physiol. 117, 1015-1022.

6. Goodwin and Marcer (1989) Plant Respiration, Introduction to Plant Biochemistry Pergamon International Library of Science, Oxford.

7. Forsburg, S.L. and Guarente, L. (1989) Communication between mitochondria and the nucleus in regulation of cytochrome genes in the yeast Saccharomyces cerevisiae, Annu. Rev. Cell. BioI. 5, 153-180.

8. Hahn, M. and Guarente, L. (1988). Yeast HAP2 and HAP3: transcriptional activators in a heteromeric complex. Science 240, 317-321.

9. Li, x.Y., Mantovani, R. Hoofi, H.R., Andre, I., Benoist, C. and Mathis, D. (1992) Evolutionary variation of the CCAAT-binding transcription factor NF-Y, Nucleic Acids Res. 20, \087-1091.

10. Lowery, C.V. and Zitomer, R.S. (1984) Oxygen regulation of anaerobic and aerobic genes mediated by a common factor in yeast, Proc. Natl. Acad Sci. USA. 81, 6129-6133.

11. Lowery, C.V. and Zitomer, R.S. (1988) ROXI encodes heme-induced repression factor regulating ANB 1 and CYC7 of Saccharomyces cerevisiae, Mol. Cell Bioi. 8,4651-4698.

12. Maity, S.N., Sihna, S., Ruteshouser, E.C. and Crombrugghe, B. (1992) Three different polypeptides are necessary for DNA-binding of the mammalian heteromeric CCAAT binding factor, J. Bioi. Chem. 267, 16574-16580.

13. McNabb, D.S., Xing, Y. and Guarente, L. (1995), Cloning of yeast HAPS: a novel subunit of a heteromeric complex required for CCAAT binding, Genes & Dev 9, 47-58.

14. Olesen, J.T., Hahn, S. and Guarente, L. (1987) Yeast HAP2 and HAP3 activators both bind to the CYCI upstream activation site, UAS2 in an independent manner, Cell 51, 953-961.

15. Olesen, J.T. and Guarente, L. (1990) The HAP2 subunit of yeast CCAAT transcriptional activator contains adjacent domains for subunit association and DNA-recognition: model for the HAP2/3/4 complex, Genes and Dev. 4,1714-1729.

16. Olesen, J.T., Fikes, J.D. and Guarente, L. (1991), The Schizosaccharomyces pombe homologue of Saccharomyces cerevisiae HAP2 revels selective and stringent conservation of the small essential core protein domain, Mol. Cell. BioI. 11,611-619.

326

17. Padmanaman, G., Vencateswar, V. and Rangarajan, P.N., (1989) Hearn as a multifunctional regulator, Trends Biochem. Sci. 14, 492-496.

18. Pinkham, J.L., Olesen, J.T. and Guarente, L. (1987) Sequence and nuclear localization of the S. cerevisiae HAP2 protein, a transcriptional activator, Mol. Cell. Bioi. 7, 578-585.

19. Raymondjean, M., Cereghini, S. and Yaniv, M. (1988) Several CCAAT box binding-proteins coexist in eucaryotic cells, Proc. Natl. Acad. Sci. USA 85, 757-761.

20. Santoro, C., Mermod, N., Andrews, P.C. and Tjian. R. (1988), A family ofCCAAT box binding proteins active in transcription and DNA replication: cloning and expression of multiple cDNAs, Nature 334, 218-224.

21. Sinha, S., Maity, S.N., Lu, J., Ruteshouser, E.C. and Crombrugghe, B. (1995) Recombinant rat CBF-C, the third subunit of CBFINFY, allows formation of a protein-DNA complex with CBF-A and CBF-B and with yeast HAP2 and HAP3, Proc. Natl. Acad Sci. USA. 92, 1624-1628.

22. Tili, E. (1997) Isolation of novel Arabidopsis proteins which enhance pseudohyphal formation and are likely to be candidates in plant development and stress responses, Master thesis, International Center for Advanced Mediterranean Agronomic Studies, Mediterranean Agronomic Institute of Chania, Chania, Greece.

23. Xing, Y., Fikes, J.D., and Guarente, L. (1993) Mutations in yeast HAP2IHAP3 define a hybrid CCAAT box binding domain, EMBD. J. 12,2647-4655.

24. Zitomer, R.S. and Lowery, C.V. (1992) Regulation of gene expression by oxygen in Saccharomyces cerevisiae, Microbiol. Rev. 56, I-II.

ETHYLENE AND POLYAMINE SYNTHESIS IN CHERIMOYA FRUIT UNDER HIGH CO2 LEVELS

Adaptative Mechanism to Chilling Damage

1. Abstract

M.T. MUNOZ, M.1. ESCRIBANO AND C. MERODIO Departamento de Ciencia y Tecnologia de Productos Vegetales, Instituto del Frio, Ciudad Universitaria, 28040-Madrid, Spain

In this work, we studied the effect of short-term high CO2 treatment (20% CO2 plus 20% O2 for 3 days) on both ethylene and polyamine synthesis in cherimoya fruit stored at 20 and 6°C. The decrease in putrescine content, with no variation in ADC activity, and the accumulation of both spermidine and spermine confirm the preferential transformation of the diamine into polyamines in COz-treated fruit. The absence of autocatalytic or basal ethylene production with no variation in ACC oxidase activity may be due to deviation to the SAM pool towards polyamine synthesis by high CO2 treatment. These metabolic changes may be responsible for the effect of high CO2 levels on delaying cherimoya fruit ripening and maintaining fruit quality during storage at chilling temperature. Our results are discussed in light of the role attributed to polyamines in cytoplasmic pH regulation.

2. Introduction

The essential biological roles and high sensitivity to external conditions have made polyamines, ethylene and their biosynthetic enzymes the subject of numerous studies in postharvest physiology. In addition to their antagonistic effects on ripening and senescence, polyamines and ethylene have been shown to have a common intermediate in their biosynthetic routes, namely S-adenosylmethionine (SAM). In this way, a correlation has been established between polyamine effects and the inhibition of ethylene production in fruit. Applying polyamines has been shown to inhibit ethylene production in a variety of plant tissues by reducing the activities of l-aminocyc1opropane-l-carboxylic acid (ACe) synthase and ACC oxidase [7, 9] and by modulating the flux of SAM towards polyamine synthesis [5, 10].

Several postharvest technologies, in turn, while conserving fruit quality, enhance endogenous levels ofpolyamines, primarily spermidine (Spd) and spermine (Spm) [14]. It appears that high, nonstressing CO2 levels suppresses developmentally regulated processes which precede and are necessary for the onset of cherimoya fruit ripening [2]. Furthermore, short-term high CO2 treatment at the chilling temperature also improve

327

328

cherimoya tolerance to low temperature storage and effectively retains fruit quality [4]. Such as pretreatment caused a large and transient increase in y-aminobutyric acid (GABA) levels and provoke the co-ordinated accumulation of some pathogenesis-related proteins (chitinase-like and [3-glucanase proteins) that was not observed in fruit stored in air [13].

In this work, we investigate the effect of exposure of cherimoya fruit to short-term high CO2 levels at ripening temperature (20°C) and at chilling temperature (6°C) on both ethylene and polyamine synthesis. This work raises a new interesting possibility in demonstrating that high CO2 seems to reduce ethylene synthesis through increase in Spd and/or Spm titers. Our results are discussed in light of the role attributed to polyamines in the perturbations of the homeostasis of the intracellular pH in cherimoyas stored at chilling temperature.

3. Materials and Methods

Cherimoya (Annona cherimola, Mill., cv. 'Fino de Jete') fruit were divided into two groups and stored in the dark at 20 and 6°C. At each temperature, two lots were placed in separate respiration chambers (20L) in a continuous flow of air or 20% CO2 plus 20% O2

for 3 days. Ethylene production and ACC oxidase activity were determined by gas chromatography. The content in free putrescine (put), Spd and Spm was quantified by HPLC with fluorescence detection. We have also determined the activity of arginine decarboxylase (ADC), enzyme responsible for Put synthesis in cherimoya fruit [3], by isotopic techniques.

4. Results

4.1. ETHYLENE PRODUCTION AND ACC OXIDASE ACTIVITY IN UNTREATED AND CO2-TREATED FRUIT

After 3 days at 20°C the untreated fruit had ripened, showing typical climacteric peak ethylene production. At ripening temperature, high COz-pretreatment inhibited autocatalytic ethylene production. Such treated fruit proved to have low ethylene levels, similar to the figures for freshly harvested fruit. However, ACC oxidase_activity increased to the same level than in ripe untreated fruit (Table 1).

Untreated fruit stored at 6°C maintained low levels of ethylene production and ACC oxidase activity (Table 1). In COrtreated fruit a drop in ethylene production to nearly undetectable levels was recorded with no variation in ACC oxidase activity that remained unchanged with respect to untreated fruit.

4.2. POLY AMINE LEVELS AND ADC ACTIVITY IN UNTREATED AND COr TREATED FRUIT

At ripening temperature, high CO2-treated fruit showed higher Spd and Spm levels than untreated fruit. With respect to putrescine synthesis, as shown in Table 2, 3 days of 20% CO2 treatment constrained Put accumulation, although ADC activity was slightly higher than in ripe untreated fruit.

Table I. Ethylene production and ACC oxidase activity in untreated and CO2-treated cherimoya fruit stored at ripening and chilling temperatures

Treatment

After harvest 20"C 20"C + CO2

6°C 6°C + CQa

Ethylene production (!!LI kg I h)

0.53 ± 0.27 22.03 ± 2.44 0.56 ± 0.06 0.63 ± 0.20 0.05 ± 0.01

ACC oxidase activity (nmoll h I mg)

44.70 ± 2.90 140.35 ± 3.12 131.70 ± 13.70

38.79 ± 3.00 51.49 ± 6.42

Data are average ± SE of two separate experiments (n=6)

329

During storage at 6°C, both with and without CO2 treatment, Spd and Spm metabolism undergoes a significant decrease. However, in CO2-treated fruit both polyamines levels were 20% higher than the figures for untreated fruit. At chillingJemperature storage the main features on putrescine synthesis were the steep rise in ADC activity in untreated cherimoyas and the effect of high CO2 in suppressing the rapid increase in such activity. It should be noted that despite the higher ADC activity levels, Put titers in such fruit remained unchanged after 3 days of storage at 6°C. According to these results, the enzyme ADC could be a good marker for analyzing the susceptibility to stress conditions and for studying the efficiency of technologies applied to overcome chilling damage.

Table 2. Polyamine levels and ADC activity in untreated and CO2-treated cherimoya fruit stored at ripening and chilling temperatures

Treatment Spermine

After 6.55 ± 0.50 harvest 12.33 ± 0.10 20°C 15.17 ± 0.57 20°C + CO2 2.48 ± 0.22 6°C 3.56 ± 0.42 6°C + CO2

Spermidine (omoll g fw)

113.19 ± 7.99 89.34 ± 2.31

100.27 ± 0.50 67.61 ± 3.91 90.36 ± 1.46

Data are average ± SE of two separate experiments (n=6)

Putrescine

32.62 ± 1.94 95.11 ± 3.35 60.58 ± 1.40 35.12 ± 0.63 46.43 ± 2.27

ADC activity (pmoll h I mg )

16.31 ± 0.10 34.14 ± 0.91 38.74 ± 0.50 67.16 ± 1.59 21.26 ± 1.75

330

5. Discussion

5.1. ETHYLENE AND POLYAMINE SYNTHESIS IN UNTREATED AND CO2-

TREATED FRUIT STORED AT RIPENING TEMPERATURE

The rate of ethylene production in cherimoya has been shown to be markedly affected by low O2 or high CO2 concentrations in the atmosphere [12 and references therein]. However, the mechanism whereby high CO2 regulates ethylene biosynthesis during fruit ripening is still not understood. At 20°C, CO2 pretreatment inhibited autocatalytic ethylene production, while ACC oxidase activity increase at the same level than in ripe untreated fruit. Several authors have reported that ACC oxidase transcripts accumulate earlier than ACC synthase [1], suggesting that stimulation of ACC oxidase leads to ACC conversion to ethylene, which in turn induces ACC synthase transcripts and generates more ACC for ethylene production [6]. In cherimoya this chain of events is disrupted by high CO2 postharvest treatment, indicating low ACC availability for ethylene conversion prior to ACC synthase induction. The preferential incorporation of Put into Spd and/or Spm may be responsible for the lower levels of SAM available for endogenous ACe synthesis and therefore for autocatalytic ethylene production. We assume that at ripening temperature (Fig. 1) CO2 inhibits autocatalytic ethylene production by maintaining higher levels of Spd and/or Spm in treated fruit, rather than by directly impacting ethylene synthesis or action.

5.2. ETHYLENE AND POLYAMINE SYNTHESIS IN UNTREATED AND COT TREATED FRUIT STORED AT CHILLING TEMPERATURE

At 6°C, autocatalytic ethylene production is inhibited through its effect on Ace oxidase activity. Many reports have shown that ACC conversion to ethylene is the limiting step in ethylene production at low temperatures [8, 15, 16], whereas ACC synthase is induced by chilling injury and other kinds of stress [11]. In treated fruit, basal ethylene production was suppressed along with no variation in AeC oxidase_activity. We suppose (Fig. 1), that the preferential synthesis of Spd and mainly Spm joint to the low rate of ATP­utilizing processes at the chilling temperature essentially limits basal ethylene production in eOTtreated fruit.

6. Concluding Remarks

Cherimoya fruit is susceptible to chilling injury at 6°C and many investigations have focused on treatments to increase tolerance to chilling injury or to reduce the severity of the resulting symptoms. It is possible that to improve tolerance to low temperature storage it could be necessary to keep or activate the defense mechanisms in the fruit. Moreover, the defense mechanisms trigger by treatments should be related with their ability to counter the perturbations caused by chilling damage. We observed that high CO2

treatment caused a large and transient increases in GABA and polyamines levels that are not observed in chilled fruit. Bearing in mind the role attributed to these compounds in pH regulation, as adaptative responses to stress-related cytosolic acidification, and the significant movement of cytoplasmic signal to lower Jill values in chilled cherimoya fruit (unpublished results), it is possible to conclude that the activation of pH regulatory mechanism is involved in the adaptation of cherimoya fruit to storage at low temperature.

I High COz at 20°C I Methionine

ATP -.:

Autocatalytic synthesis _ - - - -X - - - __

6,:

... ACCS ACCO

SAM ----..... ~ ACC ----"""P~ Ethylene

SAMDC 1 SAMdc 1- ADC

Spd/Spm Putrescine.- - - Arginine synthase

SPERMIDINE AND SPERMINE

I High COz at6°C I Methionine

I ATP --. I

I ACCS .­

SAM ------------.~ ACC

SAMDC 1 SAMdc

Spd/Spm I--­Synthase,

Putrescine +-

Spermidine and Spermine

ACCO

-----~~ Ethylene

ADC - Arginine

331

Figure I. Model of metabolic competition for ethylene and polyamine synthesis in Co,-treated chcrimoya fruit at ripening (20°C) and chilling temperature (6°C). ACCS: ACC synthase; ACCO: ACC oxidase; SAMDC: SAM decarboxylase.

332

7. Acknowledgements

This work as supported by grant from CICYT (ALI96-0506-C03-02).

8. References

1. Avni, A, Bailey, B.A., Mattoo, AK. and Anderson, J.D. (1994) Induction of ethylene biosynthesis in Nicotiana tabacum by a Trichoderma viride xylanase is correlated to the accumulation of 1-aminocyclopropane-l-carboxylic acid (ACC) synthase and ACC oxidase transcripts, Plant Physiol. 106, 1049-1055.

2. Del Cura, 8., Escribano, M.I., Zamorano, J.P. and Merodio, C. (1996) High carbon dioxide delays postharvest changes in RuBPCase and polygalacturonase-related protein in cherimoya peel, J. Am. Soc. Hort. Sci. 121,735-739.

3. Escribano, M.I., Aguado, P., Reguera, RM. and Merodio, C. (1996) Conjugated polyamine levels and putrescine synthesis in cherimoya fruit during storage at different temperatures, J. Plant Physiol. 147, 736-742.

4. Escribano, M.I., Del Cura, B., Muiloz, M.T. and Merodio, C (1997). The effect of high carbon dioxide at low temperature on ribulose 1,5-biphosphate carboxylase and polygalacturonase protein levels in cherimoya fruit, J. Am. Soc. Hort. Sci. 122, 258-262.

5. Even-Chen, Z., Mattoo, AK. and Goren, R (1982) Inhibition of ethylene biosynthesis by aminoethoxyvinylglycine and by polyamines shunts label from 3,4-[14C]methionine into spermidine in aged orange peel discs, Plant Physiol. 69, 385-388.

6. Fluhr, R, and Mattoo, AK. (1996). Ethylene: Biosynthesis and Perception, Crit. Rev. Plant Sci. 15, 479-523.

7. Ke, D. and Romani, R.J. (1988) Effects of spermidine on ethylene production and the senescence of suspension-cultured pear fruit cells, Plant Physiol. Biach. 26, 109-116.

8. Larrigaudiere, C. and Vendrell, M. (1993) Short-term activation of the conversion of 1-aminocyclopropane-I-carboxylic acid to ethylene in rewarmed Granny Smith apples, Plant Physiol. Bioch. 31,585-591.

9. Lee, M.M., Lee, S.H. and Park, K.Y. (1997) Effects of spermine on ethylene biosynthesis in cut carnation (Dianthus caryophyllus 1.) flowers during senescence, J. Plant Physiol. 151,68-73.

10. Lee, S.H. and Park, K.Y. (1991) Compensatory aspects of the biosynthesis of spermidine in tobacco cells in suspension culture, Plant and Cell Physiol. 32,523-53 I.

11. Mathooko, F.M. (1996) Regulation of ethylene biosynthesis in higher plants by carbon dioxide, Postharvest Bioi. Technol. 7, 1-26.

12. Merodio, C. and De La Plaza, J.1. (1997) Cherimoya, in S.K. Mitra (ed.), Postharvest Physiology and Storage o/Tropical and Subtropical Fruits, CAB international, pp. 269-293.

13. Merodio, C., Munoz, M.T., Del Cura, B., Buitrago, D. and Escribano, M.1. (1998) Effect of high CO2

level on the titres of y-aminobutyric acid, total polyamines and some pathogenesis-related proteins in cherimoya fruit stored at low temperature, J. Exp. Bot. 49, 1339-1347.

14. Wang, C.Y. (1993) Approaches to reduce chilling injury of fruits and vegetables, Hort. Reviews 15, 63-95.

15. Wang, c.Y. and Adams, D.O. (1982) Ethylene production by chilled cucumbers (Cucumis sativus 1.), Plant Physiol. 66,841-843.

16. Watkins, C.B., Picton, S. and Grierson, D. (1990) Stimulation and inhibition of expression of ripening-related mRNAs in tomatoes as influenced by chilling temperatures, J. Plant Physiol. 136, 318-323.

EFFECTS OF COPPER AND ZINC ON THE ETHYLENE PRODUCTION OF ARABIDOPSIS THALIANA

1. Abstract

J. MERTENS 1 , J. VANGRONSVELD1, D. VAN DER STRAETEN2

AND M. VAN POUCKE1

J Limburgs Universitair Centrum, Universitaire Campus, B-3590 Diepenbeek, Belgium, 2Universiteit Gent, Ledeganckstraat 35, B-9000 Gent, Belgium

The effects of toxic concentrations of the redox active metal copper and the redox inactive zinc on the ethylene production of intact, seven days old Arabidopsis thaliana (L.) Heynh. seedlings, were studied kinetically in an open flow system. Major differences in the metal stimulated increases in ethylene production were found. Using reaction rate experiments, this stimulation was shown to be entirely enzymatic in case of zinc treatment and partly enzymatic, partly non-enzymatic in case of copper addition. The existence of non-enzymatic copper stimulated ethylene production was confirmed using an oxygen-free atmosphere. By inhibiting ACC synthase activity, ACC could be indicated as the major precursor of both enzymatic and non-enzymatic copper stimulated ethylene production.

2. Introduction

Relative to ethylene production under normal conditions, plants produce considerable amounts of ethylene when stressed by mechanical injury, chemicals, chilling and freezing, desiccation, waterlogging or pathogens [1, 2, 3, 4]. This increase was called 'stress ethylene'. Various metals stimulate ethylene production in intact plants [5, 6, 4, 7, 8]. It was soon accepted that in higher plants, the ACC dependent ethylene pathway is involved in this 'stress' ethylene production [4, 9]. However several researchers [10, 11] suggested that metal induced stress-ethylene could be generated in an ACC­independent manner. Other studies indicated that free-radical generating systems could be at least partially involved in ethylene production. Unfortunately, the experiments in these studies were conducted on isolated tissues, such as leaf discs [12], on in vitro systems containing microsomal membranes [13, 14], or on systems using purified enzymes [15]. The experiments presented here are performed to investigate the ethylene production of Arabidopsis thaliana (L.) Heynh. under conditions of metal toxicity. Copper and zinc were used as a model for comparing the effects of a redox­active substance (copper) with the effects of redox-inactive substance (zinc).

333

334

3. Material and Methods

Arabidopsis thaliana (L.) Heynh. ecotype C24 was used as plant material. Seeds were germinated after a 5 day vemalisation treatment at 4 - 7°C. Plants were grown hydroponically in controlled chambers on rockwool using 50 % Hoagland solution, 16 hours light (22°C) - 8 hours darkness (17°C) cycle, 65 % relative humidity and 150 !lmol m-2.s-1 fotosynthetically active light. Copper or zinc were applied as sulphates. All concentrations are final concentrations unless mentioned otherwise. Ethylene was measured in a flow-through system [16]. Each sample was placed in a 2 liter flask, flushed with ethylene-free air and allowed to equilibrate for at least two hours prior to measurement. Ethylene concentration was determined using gas chromatography with flame ionisation detection. Aqueous solutions 0.1 mM A VG were added exogenously.

4. Results and Discussion

4.1. ETHYLENE PRODUCTION OF ARABIDOPSIS

Starting with 4 days old seedlings, the progression of ethylene production was followed by regular measurements during the following two weeks. Table 1 clearly shows a high ethylene production at the start of the experiment and a peak on day 11, and a low production around day 7 and 13.

Table 1. Ethylene production of light grown Arabidopsis thaliana seedlings at different ages (days after germination; data± SE)

Age (days)

4 7 II 13 19

0.074 ± 0.016 0.013 ± 0.007 0.054 ± 0.011 0.010 ± 0.008 0.032 ± 0.010

The high productions around 4 and 11 days correspond morphologically with the opening of the hook and expansion of the photosynthetic cotyledons on the one hand and the emergence of the first leaf pair on the other hand. Usual rates for intact green seedlings at this developmental stage (8 to 12 days) range from 0.8 nl ethylene.h- l .

gFWI for com to 4.7 nl for wheat and 6.1 nl for soybean. If the ethylene production of 7 and 11 days old Arabidopsis thaliana seedlings is recalculated on a fresh weight basis, on average 0.7 and 2.0 nl C2Iit .h-l • gFW-1 respectively, is produced, which is in accordance with the range mentioned above.

335

4.2. EFFECTS OF COPPER AND ZINC ON ETHYLENE PRODUCTION

Cu 2+ or Zn 2+ ions are supplied to the seedlings in concentrations of 25, 100 or 500 J.lM. Both metals cause an increase in ethylene production (Figs la and Ib). However, the kinetics and intensity of stimulation of ethylene production show marked differences depending on the metal used. Generally, copper effects are lasting, while effects of zinc are transient. Application ofthe lowest copper concentration (25 J.lM) causes a five-fold increase .. With zinc, the lowest concentration (25 J.lM) only slightly increases ethylene production. By raising the copper concentration to 500 J.lM a ten-fold increase is found. Increasing the zinc concentration to 500 J.lM only results in a five-fold initial increase. These results suggest the existence of differences in the way ethylene production responds to either copper or zinc addition.

0,18 A ,....,

"i":; 0,16 0

..:::; 0,14 q.

0,12 '0 E a.

0,1 '-" c

--0- Control --0- Cu 25 IJM -I:r- Cu 100 IJM -Cu 500 IJM

--<>- Control -c-Zn25 IJM --i:r- Zn 1 00 IJM -Zn5001JM

~ 0,08 :::l' 'C

~ 0,06 Q.)

0,04 c Q.)

>-.s::: 0,02 ill

o 0100 200 300 400 0100 200 300 400

Time (minutes) Time (minutes)

Figure I a and I b. Effect of different copper and zinc concentrations on the ethylene production of Arabidopsis thaliana (copper or zinc were added at 0 minutes, data ± SE) .

4.3. EFFECT OF TEMPERATURE ON COPPER AND ZINC STIMULATED ETHYLENE PRODUCTION

Studying the effect of temperature on reaction kinetics allows to differentiate between enzymatic and non-enzymatic reactions, in vivo as well as in vitro. Generally, a rise or decrease in temperature should correspond with a certain rise or decrease in reaction velocity. Theoretical differences have been calculated for a non-enzymatic reaction for a decrease from 22°C to 7°C. This decrease in temperature should correspond, in non­enzymatic reactions, with a decrease in reaction velocity of only 5%. Enzymatically

336

catalysed reactions show much larger decreases or increases as a function of temperature, in a physiological range. A decrease or increase of 1 °C should result in -at least- a 3-fold decrease or increase, respectively. Experiments were performed establishing this ratio for a decrease in temperature from 22°C to 7°C, for 500 IlM of both zinc and copper. Table 2 shows that zinc-induced ethylene production follows an enzymatic pathway, as the decrease in reaction velocity is proportionally larger than 3. In the presence of copper, ethylene is synthesised by a mixed enzymatic - non­enzymatic system, as the proportional decreases are clearly intermediate between pure enzymatic and non-enzymatic. From these data it can be calculated, that about 65 % of the copper-induced ethylene release is produced non-enzymatically.

Table 2. Proportional reduction in reaction rate (22°C 17°C) for copper or zinc stimulated etbylene production (data ± SE)

Time after addition (minutes)

180 210 240

Proportional reduction (500IlMZn)

3.8 ±0.5 4.6±0.7 4.1 ±0.6

Proportional reduction (500 11M Cu)

2.0 ±0.5 2.1 ± 0.6 2.3 ±0.7

4.4. ETHYLENE PRODUCTION IN AN OXYGEN FREE ATMOSPHERE

In order to confirm the existence of the non-enzymatic production of ethylene, ethylene production was measured with an non functional ACC-oxidase, due to lack of the substrate O2, inhibiting the fmal step in ethylene biosynthesis, the whole enzymatic pathway would be blocked. Addition of 500 IlM copper results in a marked increase in ethylene production (Fig. 2), while adding 500 IlM zinc has no effect.

4.5. INFLUENCE OF A VG ADDITION ON COPPER INDUCED ETHYLENE PRODUCTION

A VG is a potent inhibitor of ACC synthase activity. Addition of 0.1 mM A VG to shoot and root in the presence of 500 IlM copper (Fig. 3), results in a steady decrease of the ethylene production, starting from a level slightly lower than copper-induced ethylene to almost no production at all. This result suggests that, when copper is added, ACC is the major precursor of ethylene in both enzymatic and non-enzymatic conversion. Using these data one can calculate the amount of ACC converted to ethylene to be approximately 2.5 nmol.gFW I .

5. Conclusion

'""' 0,18 -r-------------, ~ 0,16

q. 0,14

~ 0,12

e .~

0,1

0,08

0,06 ~ a. 0,04

~ 0,02

>- o ~

---¢-- Zn 500 \.1M

--0- Cu 500 \.1M

100 200 300 400 Time (minutes)

Figure 2. Effect of anoxia on copper or zinc stimulated ethylene production in 7 days old Arabidopsis thaliana, (data ± SE).

337

Zinc and copper induced increases of ethylene production of intact seven days old Arabidopsis thaliana L. seedlings were shown to be, at least partly, based on diferent mechanisms. In case of zinc, stimulation is entilely enzymatic while the copper induced increase should be in part non-enzymatic.

~ 0,18 -r-------------, ~

..:::; 0,16

~ 0,14

~ 0,12

.s 0.1 c .Q 008 ti ' .g 0,06

a. 0.04 Q)

~ 0,02

---¢-- Cu 500 \.1M

--0- Cu 500 \.1M + AVG

~ O+----r--~~--~--_+~ o 100 200 300 400

Time (minutes)

Figure 3. Effect of A VG on copper stimulated ethylene production in 7 days old Arabidopsis thaliana (data ± SE)

338

6. References

1. Abeles, B. (1973) Ethylene in Plant Biology, Academic Press, New York. 2. Yang, S.F. and Pratt, HK (1978) The physiology of ethylene in wounded plant tissues, in G Kahl

(ed.), Biochemistry of Wounded Plant Tissues, Walter de Gruyter, Berlin, pp. 595-655. 3. Yu, Y.B. and Yang, S.F. (1980) Biosynthesis of wound ethylene, Plant Physiol. 66,281-285. 4. Hogsett, W.E., Raba, RM. and Tingey, D.T. (1981) Biosynthesis of stress ethylene in soybean

seedlings: Similarities to endogenous ethylene synthesis, Physiol. Plant. 53, 307-614. 5. Lau, O. and Yang, S.F. (1976) Stimulation of ethylene production in the mung bean hypocotyls by

cupric ion, calcium ion and kinetin, Plant Physiol. 57,88-92. 6. Goren, R and Siegel, S.M. (1976) Mercury-induced ethylene formation and abscission in citrus and

coleus explants, Plant Physiol. 57,628-631. 7. Rodecap, KD., Tingey, D.T. and Tibbs, J.H. (1981) Cadmium-induced ethylene production in bean

plants, Z Pjlanzenphysiol. 105,65-74. 8. Fuhrer, l. (1982) Ethylene biosynthesis and cadmium toxicity in leaf tissue of beans, Plant Physiol.

70, 162-167. 9. Yang, S.F. and Hoffinan, N.E. (1984) Ethylene biosynthesis and its regulation in higher plants, Annu.

Rev. Plant Physiol. 35,155-189. 10. Sandmann, G. and Boger, P. (1980) Copper-mediated lipid peroxidation processes in photosynthetic

membranes, Plant Physiol. 66, 797-800. 11. Mattoo, AK, Baker, J.E. and Moline, H.E. (1986) Induction by copper ions of ethylene production

in Spirodela olighorrhiza. Evidence for a pathway independent of I-aminocyclopropane-I­carboxylic acid, J. Plant Physiol. 123, 193-202.

12. Kacperska, A and Kubacka-Zebalska, M. (I989) Formation of stress ethylene depends both on ACC synthesis and on the activity of free radical-generating system, Physiol. Plant. 77,231-237.

13. Lynch, D.V., Sridhara, S. and Thompson, lE. (1985) Lipoxygenase-generated hydroperoxides account for the non-physiological features of ethylene formation from l-aminocyclopropane-I­carboxylic acid by microsomal membranes of carnations, Planta 164, 121-125.

14. Mc Rae, D.G., Baker, lE. and Thompson, J.E. (1982) Evidence for involvement of the superoxide radical in the conversion of l-aminocyclopropane-I-carboxylic acid to ethylene by pea microsomal membranes, Plant Cell Physiol. 23, 375-383.

15. Gardner, H.W. and Newton, l.W. (1987) Lipid hydroperoxides in the conversion of 1-aminocyclopropane-l-carboxylic acid to ethylene, Phyto. 26,621-626.

16. De Greef, J.A and De Proft, M. (1978) Kinetic measurements of small changes in an open system designed for plant physiological studies, Physiol. Plant. 42, 79-84.

ETHYLENE DEPENDENT AERENCHYMA FORMATION IS CORRELATED WITH DIVERSE GENE EXPRESSION PATTERNS

D. B FINKELSTEIN!, S. A. FINLAYSON1, M. C. DREW2, W. R. JORDAN!, R. A. WING3 AND P. W. MORGAN! Dept. of Soil & Crop Science i Dept. of Horticultural Scienci, Texas A &M University, Agronomy Dept. 3, Clemson University

1. Introduction

Previous research has shown that soil compaction and hypoxic soils substantially reduce crop root profiles [1]. Under both stresses, the roots of maize form air channels known as aerenchyma by the selective lysis of cortical cells [2]. Both mechanical impedance and hypoxic stress are mediated by signal transduction pathways which induce ethylene synthesis, cellulase activity [3] and gene expression. Aerenchyma formation in maize roots is ethylene-dependent [4]. This process is a gene-driven, tissue-localized process consistent with the definition of programmed cell death. However, by examining gene expression in response to other stresses, such as wounding and submergence, distinct classes of genes emerged. One class of genes is induced primarily by mechanical impedance. A second class of genes was induced by hypoxia and submergence. Lastly, genes that are homologs with animal programmed cell death genes were uncovered.

2. Materials and Methods

A variety of methods were employed to isolate full length cDNAs and cDNA fragments that encode genes associated with mechanical impedance, hypoxia, and programmed cell death. Directed RT-PCR and differential display and cDNA library screening were the primary methods. RNA was isolated from untreated root tips and from mechanically impeded root tips of maize. The RNA pools were then reverse transcribed with polyT primer and PCR amplified with a second random primer. The resultant PCR products were separated by PAGE and visualized by silver staining. Polymorphic bands that appeared repeatedly were removed from the gel, re-amplified, ligated into a plasmid vector, transformed into E. coli, and identified by automated sequencing. Radioactively labeled cloned were hybridized on total RNA northern blots and visualized by exposure to X-ray film. Next a cDNA library was constructed from maize root tip mRNA that was hypoxically treated (2 d 4% O2). Each differential display fragment of interest was used to probe the library. Clones were tentatively identified by sequencing. Northern analysis of RNA from diverse ethylene-related stresses were performed using cDNA clones as probes. Based on the identification of a DADl homolog (defender against

339

340

apoptotic death) which may be a regulator of glycosilation, a tunicamycin treatment was also performed. Tunicamycin is a specific inhibitor ofN-linked glycosilation.

Designation

KI2CC N4CC KI6AC-H KI6AC-L K18CA AP3GG M5CG-C ACC5 CELL

Designation

202 2lH8 26021 IM22 41K16 24Ll6 IH22 31B22 28L9

Table 1. Differential Display and RT-PCR fragments

Size (bp)

282 567 458 308 330 603 413 228 506

Induction

Hypoxia Mech.lmp. Hypoxia Hypoxia Hypoxia Hypoxia Hypoxia Hypoxia Unconfirmed

Table 2. cDNA Library Clones

Induction

Tunicamycin Tunicamycin Wounding Submergence

Homolog

tRNA-leueyl synthetase 60S riboprotein L25 Zeon gag protein Transmembrane protein Unknown Unknown Gag/pol protein Musa sp. ACC synthase Tomato cellulase 4

Homolog

DAD] GRANDDAD (unique gene) ACCoxidase

Weak induction by Tunicamycin and Submergence Mech. Impedance, Submergence and Hypoxia Wounding

60S riboprotein L25 Cysteine protease Tonoplast Integral Protein LP3 (Pinus drought gene) Trypsin inhibitor Constitutive

Tunicamycin and Submergence SlAH2 (Drosophila gene)

3. Results and Discussion

Differential display fragments and cDNA clones are shown in Tables I and 2. Two gene fragments were identified by sequence homology as retrotransposons, which may appear anywhere within the genome and which have no known physiological significance. Therefore, only those fragments of potential physiological interest where used to find cDNA clones from the hypoxic root tip library. Most of the cDNA clones examined were primarily induced by submergence or by tunicamycin. Both mechanical impedance and hypoxia induced the tonoplast integral protein (24Ll6) and the 60S riboprotein (N4CC/IM22). Only wounding induced the maize LP3 homolog (lH22) and the ACC synthase gene (26021). Together these gene expression patterns draw clear distinctions between hypoxia, mechanical impedance and other ethylene-related stresses such as wounding.

The induction of proteins associated with efficient protein translation, a tRNA synthetase and a riboprotein, indicate a level of regulation beyond transcription. This fmding is consistent with other observations in oxygen deprived maize roots [5]. The tonoplast integral protein was found recently in maize root tips [6] in situ hybridized to

341

proto-xylem, a pre-cell death cell line. Discovery of cell death associated genes such as the DAD1 homolog and Seven in absentia homolog (Siah2) from Drosophila in our study suggests plant cell death pathways may include some animal gene homologs.

Of special interest was the unique gene GRANDAD (G protein receptor and defender against apoptotic cell death) which had a high degree of nucleotide sequence homology to DAD1 yet is expected to encode an entirely unrelated G protein-coupled receptor. Using sequencing chemistries that minimize secondary structural problems, this full-length cDNA was revealed to have a second reading frame. This frame was interrupted by gt-ag bounded intron-like stretches that contained stop codons. This second frame, if spliced, would encode a maize DAD1. In fact, the predicted protein sequence of this putative DAD1 shares slightly more amino acid identity with the Arabidopsis DAD1 than the uninterrupted partial cDNA DAD1 also cloned here.

4. References

1. Morgan, P.W. and Drew, M.C. (1997) Ethylene and plant responses to stress, Plant Physiol. 100, 620·630.

2. He, C.J., Drew, M.C. and Morgan, P.W. (1994) Induction of enzymes associated with Iysigenous aerenchyma formation in roots of Zea mays L. subjected to mechanical impedance and hypoxia, Plant Physiol. 112,463472.

3. He, C.J., Morgan, P.W. and Drew, M.C. (1996) Transduction of an ethylene signal is required for death and lysis in the root cortex of maize during aerenchyma formation induced by hypoxia, Plant Physiol. 112,463472.

4. Drew, M.C., Jackson, M.B., Giffard, S.C. and Campbell, R. (1981) Inhibition by silver ions of gas space (aerenchyma) formation in adventitious roots of Zea mays L. subjected to exogenous ethylene or oxygen deficiency, Planta 153, 217-224.

5. Bailey-Serres J. and Dawe, R.K. (1996) Both 5' and 3' sequences of maize adhl mRNA are required for enhanced translation under low-oxygen conditions, Plant Physiol. 112, 685-695.

6. Chaumont, F., Barrieu F., Herman E.M. and Chrispeels, M.B. (1998) Characterization of a maize tonoplast aquaporin expressed in zones of cell division and elongation, Plant Physiol. 117, 1143-1152.

ETHYLENE BIOSYNTHESIS IN RUMEX PALUSTRlS UPON FLOODING

W.H. VRIEZEN,,2, L.A.C.l VOESENEK2 AND C. MARIANI' 'Department of Experimental Botany, and 2Department of Ecology, University of Nijmegen, Toernooiveld 1, 6525 ED, Nijmegen, The Netherlands

1. Introduction

Rumex palustris, is a flooding-resistant semi-terrestrial species that responds to flooding with rapid growth stimulation of the shoot, especially of the petioles of the youngest leaves. This induction of cell elongation requires enhanced levels of ethylene and is furthermore increased when low oxygen concentrations are applied [5]. Under drained conditions, leaves of R. palustris continuously produces small amounts of ethylene [4]. Upon submergence the production rate remains unchanged, but the ethylene concentration in the tissues of the plants increases from 0.05 ~I/I to I 111/1 within Ih This ethylene accumulation can be explained by the reduced diffusion rates of gases in water [2]. This diffusion barrier can also cause hypoxic conditions in the tissues of submerged plants [3].

To study the regulation of the genes involved in ethylene biosynthesis, we isolated cDNAs corresponding to the ACC synthase and ACC oxidase genes and used these to research the pattern of gene expression in submerged R. palustris plants.

2. Results

Partial cDNAs encoding ACC synthase and ACC oxidase were generated by RT-PCR on poly(At mRNA from R. palustris leaves. Isolated fragments which showed high homology to known ACC synthase or ACC oxidase sequences from other species were subsequently used to isolate full-length clones from a R. palustris cDNA library made from leaf RNA of plants that were submerged for 24h. One cDNA clone with high similarity (>65%) to ACC synthases of mustard leaf and soybean (Database accession numbers: X72676 and X67100) was isolated and was designated RP-ACS1, Two different, but highly homologous (96%) ACe oxidase cDNAs were isolated and the genes were designated as RP-ACOI and RP-AC02. These cDNAs were used as a probe for northern analysis to study the regulation of ethylene biosynthetic genes in petioles of elongating leaves during submergence of R. palustris. Figure 1 shows that the RP­ACSI messenger concentration increased transiently during the first hours of the day under aerated as well as under submerged conditions. Submergence seemed to have

343

344

A aerated conditions B submerged conditions

o 1 2' 3 4 5 Ei 8 10 12 24 Time (h) 0 2 3 4 5 6 8 10 12 24

RP-ACS1 _.

RP-AC01 : __ •••

I 2BS rRNA 1."" •••••• w.

Figure 1. Time course for mRNA accumulation of ACC synthase and Ace oxidase genes in petioles of R, paiustris under aerated conditions (A) and under submerged conditions (B),

an inducing effect on the RP-ACSI mRNA concentration after 12h, when compared with the aerated condition. RP-ACOI expression increased strongly during submergence and remained at high level at least till 48h after inundation (Fig. lB).

3. Discussion

The ethylene release from aerated R. paiustris plants displayed a circadian rhythm with a high level of ethylene release during the day and relative low level during night-time [5]. The RP-ACSI mRNA levels also showed higher levels at the beginning of the day, which might be a result or the cause of this rhythmic ethylene release. ACC oxidase mRNA concentration remained at a constant low level under aerated conditions (Fig. lA), but was clearly induced by submergence. Submergence, however, did not stimulate the ethylene production rate in R. paiustris [4] suggesting that the increased ACC oxidase mRNA concentration did not result in a higher ACC oxidase activity.

4. References

1. Banga, M., SIaa, E.J., Blom, C.W.P,M. and Voesenek, L.AC.J. (1996) Ethylene biosynthesis and accumulation under drained and submerged conditions, Plant Physiol. 112,229-237.

2. Jackson, M.B. (1985) Ethylene and responses of plants to soil waterlogging and submergence, Annu. Rev. Plant Physiol. 36, 145-174.

3. St6nzi, J.T. and Kende, H. (1989) Gas in the internal air spaces of deepwater rice in relation to growth induced by submergence, Plant Cell Physiol. 30, 49-56.

4. Voesenek, L.A.C.J., Banga, M., Thier, R.H., Mudde, C.M., Harren, F.M., Barendse, G.W.M. and Blom, C.W.P.M. (1993) Submergence-induced ethylene synthesis, entrapment, and growth in two plant species with contrasting flooding resistances, Plant Physiol. 103,783-791.

5. Voesenek, L.AC.J., Vriezen, W.H., Smekens, M.J.E., Huitink, F.H.M., Bogemann, G.M. and Blorn, C.W.P.M. (1997) Ethylene sensitivity and response sensor expression in petioles of Rumex species at low O2 and high CO2 concentrations, Plant Physiol. 114,1501-1509.

APOPLASTIC ACC IN OZONE- AND ELICITOR- TREATED PLANTS

W. MODER1, J. KANGASJARVr2, E.F. ELSTNER3, C. LANGEBARTELS 1 and H. SANDERMANN JR.I IGSF - National Research Center for Environment and Health, Institute of Biochemical Plant Pathology, D-85764 Neuherberg, Germany; 2Institute of Biotechnology and Division of Genetics, Department of Biosciences, University of Helsinki, FIN-00014 Helsinki, Finland, 3 Lehrstuhl for Phytopathologie, Technical University Miinchen, D-85350 Weihenstephan, Germany

1. Introduction and Results

Emission of the gaseous plant hormone ethylene is a common response of many plant species to exposure with the air pollutant ozone [I]. The amount of ethylene emitted correlates well with the degree of necrotic lesions on middle-aged leaves. Ozone­induced ethylene is formed via the normal biosynthetic pathway. Specific isoforms of SAM synthetase, ACC oxidase and ACC synthase are induced [2]. The highly selective response resembles that of plant-pathogen interaction. Here we elaborate on the role of I-amino-cyclopropane-I-carboxylic acid (ACC), the ethylene precursor, in ozone responses of plants.

Vicia faba L. cv. Troy and Nicotiana tabacum L. cv. Bel W3 plants are very sensitive to ozone. After treatment with 120 - 150 nl rl ozone for 5 h, the plants showed visible necrotic lesions after 24 h. We found maximum induction of ACC synthase after 2 h and of ACC levels after 3 - 5 h. When the apoplastic washing fluid (A WF) was obtained from ozone treated leaves,S - 40 % of the total free ACC content was detected in the apoplast with a delay of 1 - 2 hours (Fig. I).

300 Q)£ j ~ 200 1:0. G)-oOJ u! 100 U.ll! <.s

ACC Leaf extract .--..

ACC Apoplast

o >.-Q----D---{]

o 1 234 5 0 1 234 5 0 1 2 3 4 5

Time[h]

50 ~

40 u: "",

30 '5 E

20 .s U

10 ~

o

Figure I. Time course of ACC synthase activity and ACC content in leaf extract and apoplastic washing fluid (AWF) of Vicia /aba plants exposed to 120 - 130 nl )" ozone for 5 hours (e). Means <D SE (n=3), (0, untreated control).

345

346

To evaluate the degree of cytosolic contamination due to the infiltration technique or a possibly increased membrane permeability caused by the ozone treatment other constituents of the A WF were examined. The contamination of the A WF with the cytosolic marker enzyme hexosephosphate isomerase (HPI) was found to be < 0.1 % in Viciafaba and < 0.5 % in tobacco. Low molecular weight compounds like polyamines (tobacco) and the major phenolic compounds (kaempferol derivatives, Vida) were also detected in amounts lower than 1.5 % of the total leaf content.

After infiltration of various elicitors (chitosan, crude cell wall preparations from Phytophthora megasperma and Colletotrichum lindemuthianum, provided by 1. Ebel (Miinchen) and H. Kauss (Kaiserslautern), respectively) into the leaf intercellular space with a blunt tip syringe, apoplastic ACC levels were also elevated. However, there were distinct differences in the response of the two species towards the various elicitors. Tobacco showed a strong response to chitosan and the C. lindemuthianum preparation and only a weak one to the Pmg preparation, whereas Pmg induced the strongest response in Vidafaba. After 8 h the ACC contents were back to control levels.

Infiltration of ACC (30 11M) with a blunt tip syringe into sectors of the leaf led to transient increases also in sectors adjacent to the infiltrated area (10 and 20 mm distance). This corresponds to the results of Spanu and Boller [3] who found elevated ACC levels in a small distance of necrotic lesions after infection with Phytophthora irifestans whereas ACC synthase activity was only increased in the necrotic area. About 70 % of the infiltrated ACC was transformed to ethylene in the first 5 h, the level of ACC-conjugates was also increased after 5 h.

The above results show that a pronounced portion of the ozone- and elicitor-induced ACC is exported into the apoplastic fluid ofleaves, where it can serve as a substrate for ACC oxidase [4] or a peroxidase. ACC may also playa role in short distance signalling as reported by O'Neill et al. [5] for orchid flower development.

2. References

1. Sandermann, H., Ernst, D., Heller, W. and Langebartels, C. (1998) Ozone: an abiotic elicitor of plant defence reactions, Trends Plant Sci. 3,47-50.

2. Tuomainen, J., Betz, C., Kangasjllrvi, J., Ernst, D., Yin, Z.H., Langebartels, C. and Sandermann, H. (1997) Ozone induction of ethylene emission in tomato plants: regulation by differential accumulation of transcripts for the biosynthetic enzymes, Plant J. 12,1151-1162.

3. Spanu, P. and Boller, T. (1989) Ethylene biosynthesis in tomato plants infected by Phytophthora infestans, J. Plant Physio!. 134, 533-537.

4. Rombaldi, C., Lelievre, J.-M., Latche, A, Petiprez, M., Bouzayen, M. and Pech, J.C. (1994) Immuno-cytolocalization of l-aminocyclopropane-1-carboxylic acid oxidase in tomato and apple fruit, Planta 192,453-460.

5. O'Neill, S.D., Nadeau, JA, Zhang, X.S., Bui, AQ. and Halevy, AH. (1993) interorgan regulation of ethylene biosynthetic genes by pollination, Plant Cell 5,419-432.

ACC SYNTHASE ISOZYMES OF TOMATO (LE-ACSIB & LE-ACS6) THAT ARE INDUCIBLE ONLY BY TOUCH

M. TATSUKI AND H. MORI Graduate Course of Biochemical Regulation, Nagoya University, Nagoya Japan

1. Introduction and Results

In response to mechanical stimuli such as wind or touch, plants undergo physiological and developmental changes that enhance resistance to subsequent mechanical stress. This response has been termed thigmomorphogenesis [1]. Because both exogenous ethylene treatment and touch stimulation lead to a decrease in elongation and radial expansion, and ethylene release increases after touch stimulation, it has been assumed that ethylene mediates plant growth response to touch. Ethylene also functions as a mediator of the emergency response, when plants sense irregular stimuli such as wounding and invading pathogens. Under these conditions, ethylene induces the expression of a number of enzymes involved in mechanisms that protect plant individuals from total death.

To further understand the molecular regulation of ethylene production by external stimuli, we have isolated cDNA clones (LE-ACSIB, 2, 3, 4, 6) encoding 1-aminocyclopropane-l-carboxylate synthase (ACS), which is the key enzyme in ethylene biosynthesis, from tomato [2] and examined the expression of stress-inducible ACS isogenes in tomato.

Firstly, the expressions of the ACS isogenes in leaves in response to touch stimuli were investigated (Fig. lA). Ten minutes after touch treatment, LE-ACS6 mRNA rapidly increased in abundance and then decreased to the basal level within I h. The mRNA level of LE-ACSI B also increased following touch. The maximum level of LE­ACSI B transcription was lower than that of LE-ACS6. On the other hand, the level of LE-ACSI B mRNA remained elevated for up to 1 h, although the mRNA level of LE­ACS6 had already decreased at I h. The other isogenes (LE-ACS2, 3, 4) were not detected. PI-II was also not detected in touched leaves (data not shown). This result suggests that touch treatment does not cause the type of cell damage that induces the defense genes.

To investigate whether the level of response is affected by the dose of touch stimuli, the accumulation of transcripts was compared in plants subjected to different intensities of touch. As the amount of touch stimulation was increased, the expressions of LE­ACSIB and LE-ACS6 also increased (Fig. IB). These results indicate that the system that senses the stimuli is capable of detecting differences in the strength of the stimulation.

347

348

It has been reported that ethylene release increases within 30 min after wounding in leaves [3]. Therefore, We investigated the expression of LE-ACSIB and LE-ACS6 mRNA in wounded leaves. The levels of the LE-ACSIB and LE-ACS6 mRNA were increased by wounding and reached a maximum level at 30 min and then gradually decreased to the control level within 2 h (data not shown).

To clarify the role of LE-ACSIB and LE-ACS6 in the early ethylene production in wounded fruits, we examined the expression of ACS isogenes in wounded fruits (Fig. Ie). The mRNA levels of LE-ACSIB and LE-ACS6 increased dramatically 30 min after wounding, declined slightly at 1 h, and decreased to the control level thereafter. The LE-ACS2 mRNA began to accumulate about 2 h after wounding, while the LE-ACSJ B and LE-ACS6 mRNA levels had decreased to their basal levels by this time. These results indicate that not only the expression of LE-ACS2, but also the expressions of LE­ACSI Band LE-ACS6 were induced by wounding and that the three ACS isogenes were sequentially expressed in response to wounding in mature green fruits. Based on these results, we assume that early ethylene production was caused by the rapid and transient expression of these isogenes

Because the LE-ACSIB and LE-ACS6 mRNAs were induced by touch stimuli in leaves, we investigated whether LE-ACSI Band LE-ACS6 were also induced in touched fruits. LE-ACSIB and LE-ACS6 mRNA were detected 30 min after rubbing and decreased to the basal level within 4 h. On the other hand, the LE-ACS2 mRNA did not increase by rubbing (Fig. 1D).

We conclude as follows: The expressions of the LE-ACSI Band LE-ACS6 mRNAs were rapidly and transiently induced in both seedlings and fruits after touch stimuli that did not involve cell damage. These results indicate that wounding is not essential for eliciting the LE-ACSI Band LE-ACS6 mRNAs; on the contrary, LE-ACS2 requires cell damage for expression. Both LE-ACSI Band LE-ACS6 mRNAs were accumulated in a dose-dependent manner (Fig. lB). However, the kinetics of LE-ACSI B expression was slightly different from that of LE-ACS6 in touched seedlings (Fig. lA), and only LE­ACSIB mRNA was detected in etiolated seedlings (data not shown). These results suggest that LE-ACSIB and LE-ACS6 may have different signal transduction pathways and gene regulatory mechanisms.

2. References

I. Biro, R.L. and Jaffe, M.1. (1984) Tigmomorphogenesis: Ethylene evolution and its role in the changes observed in mechanically perturbed been plants, Physiol. Plant 62, 405-411

2. Mori, H. et. a., (1993) Structural characteristics of ACC synthase isozymes and differential expression of their genes, in l.C. Pech, A. Latche and C. Balague (eds.), Cellular and Molecular Aspects of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 1-6

3. 0' Donnell, P.l., et. al. (1996) Ethylene as a signal mediating the wound response of tomato plants, Science 274,1914-1917

ACS1 (C)

ACS1B

Time after Touch (min) ACS2

(8)

ACS1B

ACS6

ACS6

2X 4X 10X20X

00.5 1 2 4 6 8 1012 Time after Wounding (h)

(D)

ACS1

ACS2

ACS6

349

o 0.51 2 4 Time after Touch (min)

Figure 1. Expression of ACS isogenes by various stimuli. (A): By touch in leaves, (B): Dose response in leaves, (C): By wounding in mature green fruits, (0): By touch in mature green fruits.

ETHYLENE PERCEPTION IN TOMATO: LOTS OF GENES, LOTS OF FUNCTIONS

1. Abstract

H. KLEE, D. TIEMAN AND C. LASHBROOK University of Florida, Department of Horticultural Sciences, PO Box 110690, Gainesville, FL 32611, USA

Significant progress has been made in characterizing the components of ethylene signal transduction in plants in recent years. The tomato is an excellent model for studying developmental regulation of ethylene perception. Several ethylene-mediated developmental processes including fruit ripening, floral abscission and floral senescence exhibit differential hormone sensitivity. We have focused on characterization of the family of genes encoding ethylene receptors in tomato. To date, we have identified five members of this family. The proteins display major structural differences, suggesting that they may not be entirely functionally redundant. Further, expression of each gene family member is spatially distinct. The differential expression of these quite divergent proteins suggests several levels at which regulation of ethylene perception is possible.

2. Introduction

Phytohormones play essential roles in regulating many aspects of plant development. While regulation of hormone synthesis and catabolism are critical to many aspects of growth and differentiation, hormone action is also mediated at the level of sensitivity [4, 20]. Sensitivity to hormones is modulated both spatially and temporally during the life cycle. For example, adjacent cells in an organ can respond differentially to a hormone as occurs during organ abscission or, sensitivity of an organ to a hormone may change over time as occurs during fruit ripening. The tomato fruit is an excellent model for differential regulation of hormone perception during development. The focus of our laboratory is to define how differential sensitivity to ethylene is regulated during development of the tomato plant.

Ethylene is a readily diffusible hormone with an important role integrating the developmental effects of internal signals and external stimuli, regulating such diverse developmental processes as fruit ripening, abscission, senescence, and defense against pathogens [1]. In addition to developmental control over ethylene biosynthesis, there is regulation of its perception in certain tissues. For example, ripening of mature tomato fruits does not occur uniformly. It initiates within the locule and spreads to the pericarp where it then proceeds from the blossom end to the stem end. Since ethylene is

351

352

diffusible within the fruit, asynchronous ripening must result from differential ethylene perception. Modulation of sensitivity also precedes the increase in ethylene synthesis at the onset of ripening. Experiments conducted on avocado [7], apple [10], and tomato [22] indicate that immature fruits do not ripen in response to exogenous ethylene. While these fruits do perceive ethylene, as evidenced by activation of some ethylene­inducible genes such as ACC oxidase, they do not initiate the developmental sequence that leads to ripening. Further, exposure of immature fruits to ethylene, while it does not initiate ripening, does hasten its onset. Thus, immature fruits have a capacity to measure cumulative exposure to ethylene and use this as a developmental clock.

We identified a tomato mutant that is altered in its ability to perceive ethylene. Never ripe (Nr) is a semidominant mutant in which fruits fail to ripen [14]. Nr exhibits a number of pleiotropic effects indicative of ethylene insensitivity throughout the plant including impaired in floral abscission and significant delays in leaf and flower petal senescence. The molecular basis for the ethylene insensitivity is a single nucleotide change that causes a proline to leucine (P36L) change in the ethylene receptor, NR [21].

3. The Arahidopsis ethylene receptor family

In recent years, there has been significant progress in elucidating the ethylene signal transduction pathway [3, 12]. Several Arahidopsis genes involved in ethylene signal transduction including CTRI [13], EIN2 (Joe Ecker, personal communication), EIN3 [6], and ETRI [5] have been isolated. One of the mutant alleles of ETRl, etrl-l, exhibits a complete lack of measurable ethylene response [2]. Schaller et al. have shown that ETRI is membrane associated, acts as a dimer [18] and, when expressed in yeast, binds ethylene [17]. Ethylene binding is abolished in ethylene-insensitive mutant proteins and is localized to the amino terminal transmembrane portion of the sensor domain. These experiments define ETRI as an ethylene receptor. The ETRI family in Arabidopsis currently consists of five proteins [11]. The ETRl, ETR2 and EIN4 genes were initially identified by mutations that cause dominant ethylene insensitivity. The ERSI gene was identified by its homology to ETRI. Subsequently, it was shown to confer dominant ethylene insensitivity by use of an engineered mutant trans gene. The ERS2 gene was identified as an EST with homology to ETRI. The ERS2 protein is structurally divergent from all of the other genes identified thus far. It is not known whether this gene encodes a genuine ethylene receptor but an engineered mutant transgene confers dominant ethylene insensitivity in Arahidopsis [11].

The ETRI protein is homologous to the prokaryotic family of signal transducers known as two-component regulators. In bacteria, the two components, referred to as the sensor and the response regulator, act to modulate responses to a wide range of environmental stimuli [16]. Based on comparisons to the prokaryotic proteins, ETRI can be structurally separated into three domains. The sensor domain (amino acids 1-313) contains three closely spaced hydrophobic stretches that have been postulated to span a membrane. In prokaryotes, this domain is responsible for sensing the ligand. All of the known mutations ofETRl lie within the three hydrophobic regions. The second domain has extensive sequence identity to histidine kinases and the protein has been shown to have in vitro histidine kinase activity [8]. Notably, ETR2 and ERS2 lack the

353

histidine that is autophosphorylated. The third domain is the response regulator. This region has sequence identity to the response regulator portion of bacterial two­component systems and contains an aspartate that is phosphorylated in bacterial proteins. In prokaryotes, there are two classes of these signal-transducing proteins, those that contain a response regulator domain and those that do not. In bacteria, the response regulator may act as a modulator of activity by accepting the phosphate without activating downstream signal transduction components [19]. As in bacteria, some members of the plant ETRI family are missing the response regulator domain; ERS 1 and ERS2 proteins lack the third domain while the other three proteins contain it. That some of these proteins maintain this domain with a high degree of conservation while others completely lack it, suggests an important but unidentified function for the response regulator domain.

4. The tomato ethylene receptor family

The well defmed roles of ethylene in mediating tomato fruit ripening, petal wilt and flower abscission illustrate the advantages of tomato as a model system for studying ethylene responsiveness. Of particular interest to us have been the dominant alleles of ETRI [2, 9]. Our work has focused on tomato genes that are homologous to ETRI, their functions in regulating ethylene perception and the biological consequences of mutations in gene family members. At the molecular and biochemical level, we first demonstrated developmental regulation of an ethylene receptor when we showed that Nr expression is significantly increased during fruit ripening [21]. The low level of Nr expression in immature fruits followed by a I5-fold rise in expression during ripening correlates both with the endogenous rate of ethylene synthesis and the known increase in ethylene responsiveness of developing fruits.

We have isolated four additional members of the tomato Nr gene family. For consistency in nomenclature, they have been named Le-ETRI-5 in the order of their cloning. However we continue to refer to Le-ETR3 as Nr. cDNAs for two of the genes, Le-ETRI (eTAEI) [23] and Le-ETR2 [24], were independently isolated in the lab of Mark Tucker. There are several structural features that distinguish the individual members of the tomato ethylene receptor family (Fig. 1). Every Arabidopsis and tomato protein has conserved all of the amino acids that, when mutated, cause ethylene insensitivity as well as the cysteines involved in dimerization. All of the proteins that retain the response regulator domain have conserved the aspartate that can potentially act as a phosphate receiver. Among the tomato proteins, only NR lacks the response regulator domain. LeETR5 lacks the histidine as well as the other functional domains that define the histidine kinase. Molecular modeling programs identify three potential membrane spanning domains in LeETR 1, LeETR2 and NR and a potential for a fourth domain in LeETR4 and LeETR5. This extra domain is located within amino terminal extensions that are absent from the other proteins and appear to target the amino terminus to the cytoplasm. While we do not yet understand the significance of this observation, all of the information together indicates that the gene family encodes proteins that are potentially quite different in structure and perhaps in function.

354

Response Sensor Histidine Kinase Regulator

LeETRl Hi ••.. .. ,: :J:J:::I::::::IO:L4#(

LeETRl .:::1:::::::'.::1:[':: :::::0::::

NR

LeETR4 .+lilllllllllllllll:JlllE::::II::::::::.:::::::·~.::::=:IO!'::::::::~

LeETRS • i ::,::::: •.. : :::.;:::;' ·;:::;mtj::L::

Figure 1. Schematic representation of the structures of the tomato ethylene receptor proteins. The shaded areas within the first domain represent potential membrane-spanning segments. Shaded areas within the second domain represent conserved elements of the histidine kinase. The shaded area within the third domain represents the conserved region of the response regulator, including the aspartate that may become phosphorylated.

Why would tomato contain five or more receptors to a single hormone? Our working hypothesis is that different gene family members mediate differential responses of the plant to ethylene throughout growth and development. Differential responses to various stimuli may be accomplished via regulated gene expression, homo- vs. heterodimer formation, different binding constants for ethylene, or specific interactions with as yet unidentified modulators of activity. Alternatively, the plant may have evolved five or more ethylene receptors that are functionally redundant. It is also clear that each gene is regulated in a very different manner. While only Nr is ethylene regulated, every receptor exhibits distinct spatial regulation. The complement of receptors differs markedly in each tissue ([15] and D. Tieman, unpublished). The plant may have evolved each gene to respond to different environmental and developmental cues in distinct ways. Thus, ability to respond to ethylene by any tissue could be regulated qualitatively and quantitatively by which receptors are present. Experiments in progress involve transgenic plants that either over- or under-express each of the gene family members. Using this reverse genetic approach, we feel that we will be able to identify unique roles for each receptor, assuming that each does have distinct functions.

355

5. Acknowledgement

We would like to acknowledge the support of the USDA NRI program for support of this research.

6. References

1. Abeles, F. B., Morgan, P. W. and Saltveit, M. E. (1992) Ethylene in Plant Biology, Ed. 2, Academic Press, San Diego.

2. Bleecker, A, Estelle, M., Somerville, C. and Kende, H. (1988) Insensitivity to ethylene conferred by a dominant mutation in Arabidopsis tOOliana, Science 241, 1086-1089.

3. Bleecker, A B. and Schaller, G. E. (1996) The mechanism of ethylene perception, Plant Physiol 111,653-660.

4. Bradford, K. and Trewavas, A (1994) Sensitivity thresholds and variable time scales in plant hormone action. Plant Physioll05, 1029-lO36.

5. Chang, C., Kwok, S. F., Bleecker, A B. and Meyerowitz, E. M. (1993) Arabidopsis ethylene­response gene ETRI: similarity of products to two-component regulators, Science 262, 539-544.

6. Chao, Q., Rothenberg, M., Solano, R, Roman, G., Terzaghi, W. and Ecker, J. (1997) Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE­INSENSITIVE3 and related proteins, Cell 89, 1133-1144.

7. Eaks, I. L. (1980) Respiratory rate, ethylene production and ripening response of avocado fruit to ethylene or propylene following harvest at different maturities, J Amer Soc Hort Sci 105, 744-747.

8. Gamble, R, Cornfield, M. and Schaller, G. E. (1998) Histidine kinase activity of the ETRI ethylene receptor from Arabidopsis, Proc. Nat. Acad. Sci. USA 95, 7825-7829.

9. Guzman, P. and Ecker, 1. (1990) Exploiting the triple response of Arabidopsis to identifY ethylene­related mutants, Plant Cell 2, 513-523.

10. Harkett, P., Hulme, A, Rhodes, M. and Wooltorton, L. (1971) The threshold value for physiological action of ethylene on apple fruits, J Food Technol6, 39-45.

II. Hua, 1., Sakai, H., Nourizadeh, S., et al. (1998) EIN4 and ERS2 are members of the putative ethylene receptor gene family in Arabidopsis, Plant Cell 10, 1321-1332.

12. Kieber,1. J. (1997) The ethylene response pathway in Arabidopsis, Annu. Rev. Plant Physio.l Plant Mol. BioI. 48,277-296.

13. Kieber, 1. J., Rothenberg, M., Roman, G., Feldmann, K. A and Ecker, J. R (1993) CTRI, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raj family of protein kinases, Cell 72, 427-441.

14. Lanahan, M. B., Yen, H. -C., Giovannoni, 1. J. and Klee, H. 1. (1994) The Never ripe mutation blocks ethylene perception in tomato, Plant Cell 6, 521-530.

15. Lashbrook, C., Tieman, D. and Klee, H. (1998) Differential regulation of the tomato ETR gene family throughout plant development, Plant J. 15,243-252.

16. Parkinson, J. (1993) Signal transduction schemes of bacteria, Cell 73, 857-871. 17. Schaller, G. E. and Bleecker, A B. (1995) Ethylene binding sites generated in yeast expressing the

Arabidopsis ETRI gene, Science 270, 1809-1811. 18. Schaller, G. E., Ladd, A N., Lanahan, M. B., Spanbauer, 1. M. and Bleecker, A B. (1995) The

ethylene response mediator ETRI from Arabidopsis forms a disulfide-linked dimer, J. BioI. Chern. 270, 12526-12530.

19. Stock, 1., Surette, M., Levit, M. and Park, P. (1995) Two-component signal transduction systems: structure-function relationships and mechanisms of catalysis, in J. Hoch and T. Silhavey (eds.), Two-component Signal Transduction, ASM Press, Washington, D.C., pp. 25-52.

20. Trewavas, A (1983) Is plant development regulated by changes in the concentration of growth substances or by changes in the sensitivity to growth substances? TIBS 8,354-357.

21. Wilkinson, 1. Q., Lanahan, M. B., Yen, H. -C., Giovannoni, J. 1. and Klee, H. J. (1995) An ethylene-inducible component of signal transduction encoded by Never-ripe, Science 270, 1807-1809.

356

22. Yang, S F. (1987) The role of ethylene and ethylene synthesis in fruit ripening, in W. Thompson, E. Nothnagel and R. Huffaker (eds.) Plant Senescence: Its Biochemistry and Physiology, The American Society of Plant Physiologists, Rockville, MD, pp. 156-165.

23. Zhou, D., Kalaitzis, P., Mattoo, AK., and Tucker, M.L. (1996) The mRNA for an ETRl homologue in tomato is constitutively expressed in vegetative and reproductive tissues, Plant Mol. BioI. 30, 1331-1338.

24. Zhou, D., Mattoo, AK. and Tucker, M.L. (1996) Molecular cloning of a tomato cDNA encoding an ethylene receptor, Plant Physiol. 110, 1435-1436.

HORTICULTURAL PERFORMANCE OF ETHYLENE INSENSITIVE PETUNIAS

1. Abstract

D.G. CLARKI, H.J. KLEE2, J.E. BARRETTI, AND T.A. NELLI I University of Florida, Department of Environmental Horticulture, PO Box 110670, Gainesville, Florida 32611, USA, 2University of Florida, Department of Horticultural Sciences, PO Box 110690, Gainesville, Florida 32611, USA

To determine the potential for use of biotechnology to produce ethylene insensitive floriculture crops, we designed several experiments to measure horticultural performance of transgenic CaMV35S-etrl-1 petunias. Delayed floral senescence is observed at varying degrees in transgenic plants depending on production environment. Flowers grown in cooler greenhouse environments show greater delays in pollination­induced and natural flower senescence than those grown in warmer environments. Fruit set of self pollinated CaMV35S-etr I-plants was reduced compared to wild type plants, and was also dependent on production environment. Transgenic plants grown in warmer environments showed reduced fruit set after self pollination compared to those grown in cooler environments. Fruit ripening is delayed, and adventitious root formation is significantly reduced in transgenic CaMV35S-etrl plants compared to wild type plants. These observations lead us to suggest that tissue specific ethylene insensitivity will be required to produce ethylene insensitive floriculture crops with extended flower life.

2. Introduction

The involvement of ethylene in flower senescence has been well documented in a number of plant species [1,2,3,4,5,6]. Much of the knowledge about ethylene's role in flower senescence has been gained from studies on species such as carnation, petunia, orchid, and geranium, and much of the basic research concerning floral senescence and abscission caused by ethylene has been conducted on factors relating to ethylene biosynthesis. Recently, Wilkinson et al. [7] showed that the mutant Arabidopsis etrl-I gene could be transformed into tomato, tobacco, and petunia plants to confer ethylene insensitive mutant phenotypes to normal plants. More specifically, pollination-induced flower petal abscission of tomato is inhibited by constitutive expression of etr I-I. Flower petals on these plants remain turgid more than four times longer than normal

357

358

petals, and remain attached to the plant indefinitely during ovary expansion. Transformation of etr 1-1 into petunia results in delayed corolla senescence after both pollination and exogenous ethylene treatment. Normally, petunia flowers treated with 1-2 1-lU-1 ethylene in a jar for 12-18 hours senesce within 24 hours - pollinated petunia flowers produce a copious amount of ethylene that leads to accelerated petal wilting in 2 days. etrl-1 petunia flowers show a delayed flower wilting phenotype in response to ethylene treatment and pollination. Flowers treated with 2 1-lJ.r1 ethylene do not wilt until 4 days after the onset of treatment, and in most cases, petal wilting occurs due to vascular blockage of water in stem vase solutions. Pollinated etr 1-1 flowers last an average of 4-5 times longer than controls after pollination, and in most cases, petal wilting occurs due to the developing fruit breaking the vascular connections of the corolla [7].

Since constitutive expression of etr 1-1 can be used in heterologous plants to obtain desirable commercial traits, it is likely that physiological processes other than fruit ripening and flower senescence may also be altered. The key to use of this technology for control of ethylene sensitivity in commercial floriculture crops will ultimately depend on critical analysis of transgenic plants under production greenhouse conditions. To investigate these factors, we have conducted experiments to determine the horticultural performance of ethylene insensitive petunia plants with regard to floral senescence as wen as sexual and vegetative reproduction. In conducting these experiments, we also observed that environmental conditions under which ethylene insensitive plants are studied have a significant influence on plant responses that are altered by constitutive ethylene insensitivity.

3. Floral Senescence

In an effort to determine the extent to which conferred ethylene insensitivity influences floral senescence, we transformed 'V26' petunias with CaMV35S-etrl-l using the protocol of Jorgensen et al. [8] to produce the line V3-33. We also used a similar transformed line 44568 [7] as well as a previously unreported line, 44609, which were both generated in the 'Mitchell Diploid' genetic background. When growing these plants, we have observed that transgenic plants do not differ from controls in terms of the time it takes them to grow from seed germination to anthesis of the first flower. Of the three transgenic lines we have investigated, 44568 produces flowers slightly earlier than controls, 44609 produces flowers slightly later than controls, and V3-33 flowers are produced in the same amount of time as controls. These results suggest that the role of ethylene perception in the floral induction process of petunia is minimal.

In a series of experiments conducted to investigate different factors affecting flower senescence, we treated excised flowers of all transgenic lines, plus controls, with air or 2 /lLr 1 of ethylene gas for 18 hours, then subsequently monitored them for petal wilting over five days. Petals on air-treated control flowers consistently wilt within 24-36 hours after the onset of exogenous ethylene treatment whereas transgenic flowers and air-treated control flowers take four to five days to wilt. We found that flower longevity of ethylene treated transgenic flowers can be further extended beyond air treated controls by re-cutting the stems daily to reduce vascular blockage. Eventually

359

transgenic flowers become faded in color or infected with Botrytis before they wilt due to ethylene treatment. We did not find significant differences between transgenic lines for the amount of flower life extension after ethylene treatment, but it is likely that the lack of a photosynthetic carbon source and vascular blockage on excised flowers hastens their demise and could alter results. It is evident from our observations that conferred constitutive ethylene insensitivity via these means should be adequate for use in preventing the detrimental effects of ethylene with commercially important cut flowers such as carnation and orchid.

Further analysis of ethylene insensitive petunia flowers during normal senescence and after pollination reveals that there are environmental factors that affect the extent to which ethylene insensitivity delays floral senescence. When control plants are grown in a 'normal' greenhouse under Florida conditions (high light intensity, warm temperatures, high relative humidity), their flowers wilt in five to six days after anthesis, and approximately two days after pollination. Under 'ideal' conditions (high light intensity, cool temperatures and moderate relative humidity), their flowers wilt in six to seven days after anthesis and approximately two days after pollination. Under 'normal' conditions, transgenic flowers last 0.3-0.4X longer than controls after anthesis and 3-3.5X longer after pollination, but under 'ideal' conditions transgenic flowers last 2-3X longer than controls after anthesis, and up to 8X longer after pollination. We have also observed that differences exist between transgenic lines for delayed pollination­induced floral senesence under' ideal' conditions, with 44568 and 44609 flowers lasting twice as long after pollination as V3-33 flowers. Differences in rate of senescence after pollination can not be attributed to the fact that 44568 and 44609 originated from transformation of 'Mitchell Diploid' and V3-33 originated from transformation of 'V26'. Although control plants of these two cultivars have different growth habits under similar production conditions, they undergo ethylene-induced, pollination­induced and normal flower senescence at the same rates. Although we do not know the basis of these differences between plants derived from separate transformation events in different genetic backgrounds, our data suggest that various levels of ethylene insensitivity may be conferred in plants, and traditional genetic selection of appropriate lines will be possible. To date, there have been no reports on the performance of transgenic CaMV35S-etrl-l plants under different environmental conditions, but our data clearly indicate that both normal and pollination-induced flower senescence of petunia are delayed by conferred consitutive ethylene insensitivity. Our data also suggest that critical field trials must be performed on these plants under different growing conditions to determine the extent to which they will perform in the production greenhouse and in the landscape. To the physiological geneticist, these plants should serve as key experimental tools for use in studying the role of ethylene perception in plant responses under a wide variety of environmental stimuli.

4. Sexual Reproduction

One of the most important factors determining commercial success of many floriculture crops is the ability to reproduce a large number of consistent quality seeds. To determine if ethylene insensitve petunias reproduce normally under different

360

environmental conditions we measured the rate of fruit set, as determined by the percentage of self-pollinations leading to the production of fruit containing viable seeds. Under 'normal' and 'ideal' greenhouse conditions, pollinated control petunia flowers produce fruit containing viable seeds 90 and 95% of the time, respectively. Under 'normal' conditions, fruit set of ethylene insensitive 44568 and 44609 petunias is reduced by 54% and 23%, respectively compared to controls. Under 'ideal' greenhouse conditions, 44568 petunias produce 8% fewer fruit containing seeds, and 44609 petunias produce 23% fewer fruit than controls. We have not observed further decreases in seed yield per fruit produced on transgenic plants, but our data indicate that additional effort may have to be employed under commercial seed production conditions to obtain desired numbers of seeds from ethylene insensitive plants. Currently, research is being conducted in our laboratory to determine whether this reduction in fruit set may be improved by using ethylene insensitive paternal parents instead of maternal parents to efficiently produce F I hybrid seeds. The dominant nature of the etr 1-1 mutation leads us to believe that commercial seed production success can be achieved in this manner if ethylene does not have a significant role in pollen tube germination and subsequent growth through the pistil. Although we do not know the role of ethylene in fruit development of petunia, our data suggest that ethylene may be a significant factor, especially under adverse environmental conditions.

An observation that could have an important implication for commercial seed production of ethylene insensitive transgenic floriculture crops concerns fruit ripening. It is not surprising that petunia plants transformed with CaMV35S-etrl-1 produce fruit that exhibit delayed ripening. Wilkinson et al. [7] transformed tomato with a nearly identical genetic construct as the one used in our work with petunia, to confer the 'Never ripe' fruit phenotype. Normally, self pollinated control petunias produce fruit that turn brown and dehisce approximately 27-28 days after pollination regardless of whether they are produced under 'normal' or 'ideal' conditions. Self pollinated ethylene insensitive petunias produce fruit that take approximately 15-20% longer to ripen than controls. We have also observed that fresh seeds produced from ethylene insensitive petunias do not germinate well unless they are allowed to sit in storage for a significant amount of time or treated with GA3 (gibberellin A3). This observation supports similar findings by Bleecker et at. [9], who showed that fresh seeds from mutant etr 1-1 Arabidopsis plants required treatment with 5 11M GA3 during seed imbibition to induce germination at wild type levels. When combined, these results suggest that ethylene may playa significant role in the maturation of seeds of many plant species that are sensitive to ethylene. For the commercial seed producer, it means that efficient production of ethylene insensitive plants via FI hybrid seeds might be best achieved by using inbred ethylene insensitive lines as the paternal parent in making crosses in order to offset the delays in fruit ripening and subsequent reduction in seed germination.

5. Vegetative Reproduction

Another important factor that determines commercial success of many floriculture crops is the ability to reproduce plants via rooting of vegetative cuttings. The involvement of

361

ethylene in the formation of adventitious roots has been well documented, although there are various reports of both inhibitory and promotive effects of ethylene on rooting even within the same species [10]. In a preponderance of commercial floriculture crops, increased rooting efficiency of cuttings is achieved by the application of auxin at the onset of propagation. In experiments conducted in our laboratory we observed that constitutive ethylene insensitivity significantly reduces adventitious root formation in vegetative petunia cuttings, and cannot be reversed with the application of auxin at concentrations that significant increase rooting of control cuttings. Cuttings taken from control petunia plants produce approximately 12X more adventitious roots than 44568 petunias, and after three weeks of propagation, 44568 petunias produce almost no roots. Treatment with 1000 ~g.g.1 IBA (indole-3-butyric acid) leads to a doubling of the number of adventitious roots formed by control cuttings whereas no significant increase is observed on ethylene insensitive 44568 cuttings. Additional experiments conducted with the ethylene insensitive tomato mutant 'Never ripe' [II) have produced similar results to those observed with petunia. Cuttings taken from 'Never ripe' plants display significantly reduced adventitious root formation that cannot be over come with auxin treatments at concentrations that significantly increase rooting in controls. Interestingly, 'Never ripe' tomato cuttings produce a few adventitious roots whereas ethylene insensitive petunia cuttings showed an almost complete inhibition in root formation. This observation could be due to the fact that 'Never ripe' is not as strong a mutation as etrl-l, and/or because ethylene insensitivity in 44568 petunia is driven by the stronger CaMV35S promoter, whereas the 'Never ripe' mutation is driven by a weaker endogenous promoter. When combined, all of these observations suggest that ethylene plays a central role in adventitious root formation of both tomato and petunia. Future experiments focused on determining the temporal and spatial regulation of adventitious root formation in more precise terms are warranted, and could lead to a much clearer picture of the nature of the interaction between auxin and ethylene in the adventitious rooting process.

Table I. Effects of constitutive ethylene insensitivity on horticultural performance characteristics of petunia. Effects denoted by an asterisk (*) have been observed to vary depending on environmental conditions during plant growth.

Characteristic

Ethylene-induced floral senescence Pollination-induced floral senescence Normal floral senescence Fruit set Fruit ripening Adventitious root formation

Effect

delayed

delayed· delayed· slightly reduced· delayed significantly reduced

362

6. Conclusions

It has been clearly demonstrated that constitutive expression of the mutant elr 1-1 gene from Arabidopsis in petunia, tomato and tobacco confers ethylene insensitivity that leads to desirable commercial characters such as delayed fruit ripening and delayed flower senescence [7]. It is evident from our work on horticultural performance of ethylene insensitive CaMV35S-etr1-1 petunias that ethylene plays a critical role in many other physiological factors as well. Although ethylene-induced, pollination-induced, and normal senescence of these plants is significantly delayed, we have observed that other physiological responses to ethylene that may hinder the commercial development of this technology. Among the physiological 'side effects' of constitutive ethylene insensitivity is a slight reduction in fruit set after self-pollination, delayed fruit ripening, and significantly reduced adventitious root formation on vegetative cuttings. Reductions in fruit set and delayed fruit ripening are likely characteristics that can be overcome in commercial FI hybrid seed production by taking advantage of the dominant nature of the etr1-1 mutation, and by using inbred ethylene insensitive paternal parents in making cross-pollinations. Data obtained from experiments on adventitious root formation clearly indicate that constitutive ethylene insensitivity will most likely not be a viable technology for use in commercial floriculture crops that are sensitive to ethylene and reproduced by vegetative propagation. Further research should be conducted to engineer such crops with ethylene insensitivity driven by tissue specific gene promoters to allow for normal levels of adventitious root formation.

7. Acknowledgements

The authors wish to thank Erika Gubrium and Donna Clevenger for their assistance in greenhouse experiments. This research was supported by The Fred C. Gloeckner Foundation, Inc.

8. References

1. Clark, D.G., Richards, C., Hilioti, Z., Lind-Iversen, S., and Brown, K. (1997] Effect of pollination on accumulation of ACC synthase and ACC oxidase transcripts, ethylene production and flower petal abscission in geranium (Pelargonium Xhortorum L.H. Bailey), Plant Mol. BioI. 34,855-865.

2. O'Neill, S.D., Nadeau, lA, Zhang, X.S., Bui, AQ., and Halevy, AH. (1993) Interorgan regulation of ethylene biosynthetic genes by pollination, Plant CellS, 419-432.

3. Park, K.Y., Drory, A, and Woodson, W.R. (1992) Molecular cloning of an l-arninocyclopropane­I-carboxylate synthase from senescing carnation flower petals, Plant Mol. BioI. 18,377-386.

4. Singh, A., Evensen, K.B., and Kao, T.H. (1992) Ethylene synthesis and floral senescence following compatible and incompatible pollinations in Petunia iriflata. Plant Physiol. 99, 38-45.

5. Tang, x.Y., Gomes, AM.T.R., Bhatia, A, and Woodson, W.R. (1994) Pistil-specific and ethylene-regulated expression of I-arninocyclopropane-I-carboxylate oxidase genes in petunia flowers, Plant Cell 6, 1227-1239.

6. Woodson, W.R., Park, K.Y., Drory, A, Larsen, P.B., and Wang, H. (1992) Expression of ethylene biosynthetic pathway transcripts in senescing carnation flowers, Plant Physiol. 99, 526-532.

363

7. Wilkinson, lQ., Lanahan, M.B., Clark, D.G., Bleecker, AB., Chang, c., Meyerowitz, E.M., and Klee, H.J. (1997) A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in heterologous plants, Nature Biotechn. 15,444-447.

8. Jorgensen, R.A., Cluster, P.O., English, J., Que, Q., and Napoli, C.A (1996) Chalcone synthase cosuppression phenotypes in petunia flowers: comparison of sense vs. antisense constructs and single-copy vs. complex T-DNA sequences, Plant Mol. BioI. 31, 957-973.

9. Bleecker, AB., Estelle, M.A, Somerville, c., and Kende H. (1988) Insensitivity to ethylene conferred by a dominant mutation in Arabidopsis Ihaliana, Science 242, 1086-1089.

) O. Mudge, K. W. () 988) Effect of ethylene on rooting, in T.D. Davis, B.E. Haissig, N. Sankhla, (eds.) Adventitious Root Formation in Cuttings. Advances in Plant Sciences Series Vol. 2. Dioscorides Press, Portland, pp. 150-) 61.

II. Lanahan, M.B., Yen, H-C., Giovannoni, J.1., and Klee, H.1. (1994) The never ripe mutation blocks ethylene perception in tomato, Plant Cell 6, 521-530.

ROLE OF ETHYLENE IN AROMA FORMATION IN CANTALOUPE CHARENTAIS MELON

1. Abstract

A.D. BAUCHOT1, D.S. MOTTRAM2, A.T. DODSON2 AND P. JOHN 1

I Department of Agricultural Botany, School of Plant Sciences, and 2Department of Food Science and Technology, The University of Reading, Reading RG6 6AS, UK

The heads pace of ACC oxidase antisense hybrid Cantaloupe Charentais melon has been sampled, analysed by GC-MS and compared to that of the corresponding non­transformed hybrid fruit. The main volatiles extracted in non-transformed hybrids fruit were esters, with an overwhelming contribution by acetates. In antisense hybrid fruit the total volatiles were 60% to 85% lower than those of the non-transformed hybrids. Odour values of major esters were calculated. The most potent odorants were ethyl butanoate and branched-chain esters such as ethyl 2-methylpropanoate and ethyl 2-methylbutanoate. In transformed melons, potent odorant levels were less than 5% those of non-transformed hybrids. By contrast, volatiles with low odour values such as 2-methylpropyl acetate and 2-methylbutyl acetate were a half to a fifth those of non­transformed hybrids. Analysis of the biosynthetic pathways of the branched-chain esters that have valine and isoleucine as precursors demonstrates that ethylene specifically controls the production of the most potent odorants.

2. Introduction

Charentais melons (Cucumis melo L) from the Cantalupensis group are appreciated because of their very aromatic flavour but their self-life is usually very short. To improve its storage and handling characteristics, a Charentais melon line has been recently transformed with an l-aminocyclopropane-I-carboxylic acid oxidase (ACO) antisense gene, and ripening was delayed via strong reduction of ethylene synthesis [I, 2].

In melon, aroma development is strongly associated with ripening and represents a major characteristic in the overall quality of the fruit [3]. Esters are the main components of the melon aroma with a significant proportion of them are branched­chain esters derived from valine and isoleucine [4, 5]. The availability of antisense fruit allowed us to investigate which esters were ethylene-dependent.

365

366

3. Materials and methods

3.1. PLANT MATERIAL

This work was carried out on Charentais melons (Cucumis melD var. cantaiupensis, Naud. cv Vedrandais). The progeny of a line transformed with an ACO gene in antisense orientation [1] was used as antisense parental line (AS) to generate transformed FI hybrids. Control melons were bred using the equivalent line without the ACO antisense gene (nT). Four other parental lines (PLl, PL2, PL3 and PL4) conferring important agronomic traits (such as resistance to pathogens or improved agronomic performances) were crossed with the nT and the AS lines. Four non­transformed hybrids (PLl-nT, PL2-nT, PL3-nT and PL4-nT) and 4 transformed hybrids (PLl-AS, PL2-AS, PL3-AS and PL4-AS) have been generated. Plants were grown in Almeria, Spain, by Tezier Iberica following standard cultural practices.

Non-transformed fruit were harvested when their rind turned yellow. Antisense fruit were harvested when the first leaf next to the fruit yellowed. Headspace analysis was performed on fruit that were air-freighted to the UK, stored 3 days at l2°C and held overnight at 20°C before analysis. The aim of this postharvest storage was to simulate transport and distribution from production sites to consumption sites.

3.2. AROMA EXTRACTION

Headspace concentration on Tenax TA trapping followed by thermal desorption on GC­MS. Five plugs (l cm diameter, 2 cm long, about 109 of tissue) were excised from the equator of each fruit, weighed, and transferred in a 250 mL flask. Headspace volatiles were purged onto Tenax TA traps as previously described [6]. 1,2-Dicholorobenzene was added to the trap before the collection as internal standard.

3.3. GAS CHROMATOGRAPHY-MASS SPECTROPHOTOMETRY

All analyses were performed on a Hewlett Packard 5972 mass spectrometer, fitted with a HP5890 Series II gas chromatograph according to the procedures established in our laboratory [6].

Volatiles were identified by comparison of each mass spectrum with spectra from authentic compounds analysed in our laboratory, or with spectra in reference collections (NISTIEPAINIH Mass Special database). Quantification of the volatiles was based on the relation between their peak areas and that of the internal standard.

4. Results and Discussion

4.1. ESTER ANALYSIS

A total of over 80 compounds were identified in the headspace volatiles of the melons. The most abundant esters are listed in Table 1. The main compounds identified in non­transformed Charentais melon headspace were esters, with ethyl acetate, and 2-

367

methylpropyl acetate and 2-methylbutyl acetate, derived from valine and isoleucine respectively. These 3 esters represented at least 60% of the total volatiles collected from the non-transformed fruit.

4.2. VARIATION BETWEEN HYBRIDS

Although aroma profiles of the 4 non-transformed hybrids considered showed similar trends, major quantitative variations were sometimes encountered (Table 1). It could be attributed to differences in the maturity stages [3], although variations between the hybrids are likely to be responsible [7].

4.3. EFFECT OF ACO ANTISENSE ON AROMA PROFILE

Despite the variations encountered, the effect of ACO antisense gene was dramatic. Only 20 to 30% of the total acetates detected in non-transformed fruit were present in the antisense fruit (Table 1). The effect of the ACO antisense gene was higher on propanoates and butanoates. It was more marked on PL2-AS and PL4-AS fruit as compared to PLl-nT and PL3-nT fruit. The significant reduction of ethyl acetate, in ACO antisense hybrids, shows that the availability of either or both moieties (ethyl and acetate) of the ester was reduced or that their condensation, catalysed by an alcohol acetyltransferase [8] is regulated by ethylene.

4.4. ODOUR VALUES

Odour values are used to indicate which compounds have a strong impact in an aroma [9]. They are obtained by dividing the concentration of the compounds by their known odour threshold values in water (Table 2). In relative terms, PLl-nT fruit seemed to be the less aromatic among the 4 non-transformed lines. The efficiency of ACO antisense gene on aroma quality was highest on the fruit from parental lines PL2 and PL4, with the odour values of some esters decreasing by more than 90% compared to the corresponding non-transformed fruit. The ACO antisense gene seemed to be least effective on fruit from PL3-AS hybrids.

Acetates, showed low odour values and were generally the least depleted by the ACO antisense gene. Compounds such as ethyl 2-methylpropanoate, ethyl 2-methylbutanoate and ethyl butanoate could be considered as potent odorants for all non­transformed hybrids except for PLl-nT. They were the most affected by the transformation. Valine and isoleucine are the precursors of the branched-chain esters considered here [5] and as well as their respective isomers: 2-methylpropyl acetate and 2-methylbutyl acetate. For hybrids where the ACO antisense gene induced the most successful repression of potent aroma, the levels of reduction of ethyl esters (such as ethyI2-methylpropanoate, ethyl2-methylbutanoate and ethyl butanoate), compared with those of corresponding acetates show that the pathways leading to each class are not affected to the same extent.

368

TABLE 1. Main esters identified in the headspace of melon plugs excised from non-transformed (nT) and ACO antisense (AS) hybrids.

Approximate quantity (ng/g)

Comeound 'Ll-nT 'LI-AS 'L2-nT 'L2-AS 'L3-nT 'L3-AS 'L4-nT 'L4-AS acetates ethyl acetate 185 38 322 40 458 189 664 42 I-methylethyl acetate Tr 1 1 2 tr tr tr 1 n-propyl acetate 45 17 44 16 45 4 17 12 2-methylpropyl acetate 147 72 168 105 114 31 94 53 butyl acetate 91 38 146 61 89 21 55 16 2-methylbutyl acetate 128 68 103 34 112 25 71 32 pentyl acetate 3 2 8 2 4 1 2 tr 4-pentenyl acetate 6 tr hexyl acetate 40 26 84 32 68 11 44 10 3-hexen-l-yl acetate 50 8 105 18 59 7 12 1 heptyl acetate Tr tr 3 I 1 tr 1 tr octyl acetate 4 3 25 8 8 1 5 1 3-octen-l-yl acetate Tr 2 tr 1 tr phenylmethyl acetate 24 10 44 33 10 9 7 4 2-phenylethyl acetate 3 2 7 15 2 I 2 I benzenepropyl acetate 2 tr 3 1 tr I tr tr total 723 286 1065 369 978 302 974 174

propanoates and methylpropanoates methyl propanoate 3 6 7 9 2 I I ethyl propanoate 20 tr 59 4 25 23 41 tr propyl propanoate Tr tr tr tr 2-methylpropyl propan. 1 1 2 tr tr tr butyl propanoate I 1 tr tr tr tr pentylpropanoate tr methyl 2-methylpropan. 1 1 4 7 16 I 1 ethyl 2-methylpropan. 4 1 36 I 30 7 25 tr total 30 10 108 24 74 31 68 3

butanoates and methylbutanoates methyl butanoate 5 8 26 19 11 3 5 ethyl butanoate 67 5 108 6 104 25 96 propyl butanoate 1 1 2 tr 1 tr 2-methylpropyl butanoate 1 I I I 1 tr butyl butanoate Tr tr tr I tr ethyl 2-methylbutanoate 14 1 41 I 28 6 39 tr total 89 15 177 27 145 35 142 2

other esters methyl pentanoate tr tr tr ethyl pentanoate I 3 tr I tr methyl hexanoate I tr 4 I 1 tr tr tr eth}::l hexanoate 4 tr 27 tr 12 2 23 tr

369

TABLE 2. Odour values of some of the esters identified in the headspace of melon plugs excised from non­transformed (nn and ACO antisense (AS) hybrids.

Hybrids

Ester Odour Threshold PLI- PLI- PL2- PL2- PL3- PLJ- PIA- PlA-in Water ~n~g2 nT AS nT AS nT AS nT AS

Ethyl acetate 5 37 8 64 8 92 38 13 8

Butyl acetate 66 1 <1 2 <1 1 <1 1 <1 Ethyl butanoate 1 67 5 108 6 104 25 96 <1

Hexyl acetate 2 20 13 42 16 34 6 22 5 Ethyl hexanoate 1 4 <1 27 <\ 12 2 23 <1

2-Methylpropyl acetate 65 2 1 3 2 2 <I 1 1 Ethyl 2-methyl propanoate 0.1 37 3 361 12 303 68 251 2

2-Methylbutyl acetate 11 12 6 9 3 10 2 6 3 Ethyl 2-methyl butanoate 0 . .3 47 2 136 2 93 21 131 <1

5. Conclusions

ACO antisense Cantaloupe melons are less aromatic than non-transformed melon. In non-transformed melons, branched-chain ethyl esters that are potent odorants are present at much lower levels than the corresponding acetates. In ACO antisense fruit, they were far more depleted than acetates. Thus, ethylene seems to enhance the synthesis of esters having a strong impact on the aroma.

6. Acknowledgements

We would like to thank Tezier for providing the melons. This work was funded by the European program FAIR CT96-1138.

7. References

1. Ayub, R., Guis, M., Ben Arnor, M, Gillot, L., Roustan, 1. P., Latche, A., Bouzayen, M., and Pech, 1. C. (1996) Expression of ACC oxidase antisense gene inhibits ripening of Cantaloupe melon fruits, Nature Biotech. 14, 862-866.

2. Guis, M., Botondi, R., Ben-Arnor, M., Ayub, R., Bouzayen, M., Pech, 1. C., and Latche, A. (1997) Ripening-associated biochemical traits of Cantaloupe Charentais melons expressing an antisense ACC oxidase transgene, J. Amer. Soc. Hart. Sci. 122,748-751.

3. Wang, Y., Wyllie, S. G., and Leach, D. N. (1996) Chemical changes during the development and ripening of the fruit ofCucumis melo (cv Makdimon), J. Agric. Food Chern. 44. 210-216.

4. Yabumoto, K., and Jennings, W. G. (1977) Volatile constituents of Cantaloupe, Cucumis melo, and their biogenesis, J. Food Sci. 42,32-37.

5. Wyllie, S. G., Leach, D. N., Nonhebel, H. N., and Lusunzi, I. (1996) Biochemical pathways for the formation of esters in ripening fruit, in A. 1. Taylor and D. S. Mottram (eds.), Flavour Science: Recent developments, Royal Society of Chemistry, Information Services, Cambridge, UK, pp. 52-57.

370

6. Bauchot A. D., Mottram, D. S., Dodson, A. T., and John, P. (1998) Effect of antisense ACC oxidase on formation of volatile esters in Cantaloupe Charentais melon (cv Vedrandais), J. Agric. Food Chem., 46, 4787-4792.

7. Yamaguchi, M., Hughes, D. L., Yabumoto, K., and Jennings, W. G. (1977) Quality of Cantaloupe muskmelon: variability and attributes, Sci. Hort. 6, 59-70.

8. Ueda, Y., Fujishita, N., Chachin, K. (1997) Presence of alcohol acetyl- transferase in melons (Cucumis melo L.), Postharv. BioI. Techno/lO, 121-126.

9. Teranishi, R., Buttery, R.G., Stern, D.1., and Takeoka, G. (1991) Use of odor thresholds in aroma research., Food Sci. Technol. 24, 1-5.

GENETIC ENGINEERING OF CANTALOUPE TO REDUCE ETHYLENE BIOSYNTHESIS AND CONTROL RIPENING

1. Abstract

S. K. CLENDENNENl, J. A. KELLOGG l, K. A. WOLFFl, W. MATSUMURAl, S. PETERS l, J. E. VANWINKLE\ B. COPES2, M. PIEPER2, AND M. G. KRAMERl 'Agritope, Inc., 16160 SW Upper Boones Ferry Rd., Portland, Oregon, 97224, USA; 1 Harris Moran Seed Company, 100 Breen Road, San Juan Bautista, California, 95045, USA.

Cantaloupes (Cucumis melD) comprise a large retail market in the US. Postharvest losses, which are largely attributable to the effects of ethylene, have been estimated to be near 30%. Ethylene biosynthesis has been manipulated to prolong ripening and extend the postharvest life of cantaloupe via genetic modification. The T3 bacteriophage gene product S-adenosylmethionine hydrolase (SAMase) catalyzes the degradation of SAM, a precursor to ethylene biosynthesis. Because both SAM and ethylene play a number of important roles in normal plant growth and development, a synthetic promoter has been designed to restrict SAMase expression to the ripening fruit of cantaloupe. The ripening phenotype of cantaloupe transformed with a fruit-specific SAMase expression construct was analyzed in greenhouse and field trials. Results indicate that the genetically modified cantaloupe expressing SAMase exhibit modified postharvest characteristics, including a dramatic reduction in ethylene synthesis.

2. Introduction

Practically speaking, all cultivated forms of cantaloupe belong to the highly polymorphic species Cucumis melD L. that is grown for its sweet edible fruit [I]. The term cantaloupe pertains to the American usage of the name to describe the netted melons, also commonly referred to as muskmelon [2]. As a crop, cantaloupes are grown commercially wherever environmental conditions permit the production of an economically viable yield. In the United States, the principal fresh market cantaloupe growing regions are California, Arizona and Texas which produce approximately 96,000 acres out of a total annual acreage of more than 113,000 acres (USDA, 1998). Cantaloupes comprise a $2.8 billion retail market in the US. It has been estimated that postharvest losses, which are largely attributable to the effects of ethylene, can reach 30% throughout the distribution chain.

Genetic engineering of plants to manipulate ethylene biosynthesis can lead to delayed ripening and extended postharvest life in climacteric fruit, which in turn

371

372

reduces post-harvest losses resulting from produce that is overripe and senescent. A gene derived from E. coli bacteriophage T3 encoding an enzyme capable of degrading S-adenosylmethionine (SAM) has been introduced into the Cucumis melo genome using standard Agrobacterium binary vectors. Production of this enzyme, S­adenosylmethionine hydrolase (SAMase) in fruit alters the ethylene biosynthetic pathway and causes a modified fruit ripening phenotype in cantaloupe.

3. Materials and Methods

3.1. INBRED AND TRANSGENIC CANTALOUPE LINES

Non-transformed cantaloupe lines A and B are proprietary inbred breeding lines developed by Harris Moran Seed Company, Inc, Modesto, California, USA. Both inbred lines produce fruit of the "Western Shipper" type; a round shape with a rough surface and minimal or no sutures. Fruits abscise, or "slip," when ripe, and the formation of the abscission zone is the primary harvest indicator. Transgenic line A is derived from a homozygous R 1 progeny selection from an original RO transformant A, obtained by transformation of the parental inbred line A with binary vector pAG 7162. Line B is derived from a homozygous RJ progeny selection from an original Ro transformant B, obtained by transformation of the parental inbred line B with binary vector pAG 7162. As determined by quantitative PCR and Southern blot analysis, transgenic line A contains two copies ofthe T-DNA insert, while line B contains one. In both lines the T-DNA insertions are at a single locus and have remained stable over three generations.

3.2. THE EXPRESSION CONSTRUCT pAG 7162

3.2.1. The Gene EncodingSAMase The SAMase gene is derived from an E. coli bacteriophage T3 gene that encodes a functional S-adenosylmethionine hydrolase, or SAMase, protein [3, 4]. The SAMase encoding trans gene is derived from a previously reported M13 clone [3] modified to contain a consensus eukaryotic translation initiation site by altering the nucleotide sequence surrounding the sam ATG start codon [5]. The resulting gene was named sam-k and was utilized in plasmid pAG 7162 (see Figure 1). The SAMase protein catalyzes the conversion of S-adenosylmethionine (SAM) to methylthioadenosine and homoserine, both of which are recycled in separate pathways. SAM is a ubiquitous nucleotide used in many activities in all cells [6, 7]. In the course of ethylene biosynthesis, l-aminocyclopropane-l-carboxylic acid (ACC), the immediate precursor to ethylene, is produced from SAM by the enzyme ACC synthase [8]. As the pool of SAM is depleted by the action of SAMase, neither ACC nor ethylene are produced.

3.2.2. The E8/E4 Chimeric Promoter There are many examples of fruit-specific and ripening-associated promoters from plants. Two well-characterized examples are the promoters associated with the fruit­specific and ethylene responsive genes E8 and E4 from tomato [9, 10, 11]. Ethylene

373

responsive elements have been identified in the tomato ES and E4 promoters, as wen as elements governing organ-specificity and association with ripening (see Figure IA). The promoter from the ripening-associated ES gene was used successfully to drive expression of SAMase in tomato, resulting in a decrease in ethylene production in the fruit [5, 12]. For the expression of SAMase in cantaloupe, a novel ethylene responsive promoter was synthesized from elements of the tomato ES and E4 promoters, as indicated in Figure lB. The sam-k sequence was fused to the ESlE4 chimeric promoter and a nos 3' termination sequence from Agrobacterium tumefaciens [13]. The SAMase expression construct also contains a selection cassette composed of the kan' gene under transcriptional control of a proprietary constitutive promoter and the gene 7 termination sequence [14, 15]. Plasmid pAG 7162 was used in the transformation of the A and B parental lines.

A (E)

(-2181) , ,.

(0) (R) []----WJ-----...... Tomato E8

URE DRE

~ Tomato E4

TATA

B (E8; -2181 to -1088) (E4; ·1150 to ATG)

(E) URE DRE

·~--.I ............. ~~·----~~ '" TATA ,/ ....... _,

........... ES/E4 promoter ,/"/

LB selection SAMase RB

Figure 1. Diagram of the components of the chimeric ethylene responsive promoter and the SAMase expression construct pAG 7162. A) Ethylene responsive elements in the tomato E8 and E4 promoters (E, URE, and DRE) are represented by gray boxes. In the E4 promoter, both an upstream responsive element (URE) and a downstream element (DRE) are necessary for ethylene­responsive expression. Other functional elements in the E8 promoter have been identified as being responsible for organ specificity (0) or association with ripening (R) [9, 10, II]. B) In pAG 7162, a translational fusion between the chimeric ethylene-responsive E81E4 promoter and the gene encoding SAMase as well as a selection cassette are contained between the left and right borders (LB, RB) of the T-DNA.

4. Results

4.1. EXPRESSION OF SAMASE IN TRANSFORMED PLANTS

Stable integration of the sam-k transgene into the cantaloupe genome results in the production of a functional SAMase protein. The ES/E4::sam-k translational fusion present in lines A and B expresses a functional SAMase protein in a fruit specific (not

374

shown) and ethylene responsive manner, as determined by western blot analysis of total protein from different tissues of field-grown cantaloupe (Fig. 2). Transgenic fruit of lines A and B initiate expression of the SAMase protein at varying levels in fruit that has begun to mature (full slip) and continue to express a functional protein in fruit that is fully mature (post slip).

kd 1 :2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25

423--:

31.6-:

[8-

7.6-

Figure 2. Western blot analysis of lines A and B demonstrating ethylene responsive regulation of sam-k gene expression. lOOg samples of protein extracted from pre-slip, slip and post slip fruit were resolved on an SDS-P AGE gel and blotted to a nylon membrane. The resulting blot was probed with a monoclonal antibody specific to the SAMase protein and visualized using chemiluminescence. Lane I: molecular weight standard. Lane 2 is blank. Lane 3: line B control immature, Lane 4: line B control full slip, Lane 5: line B control post slip, Lane 6: line B immature, Lane 7: line B full slip, Lane 8: line B post slip. Lanes 9 and 10 are blank. Lane 11: line A control immature, Lane 12: line A control full slip, Lane 13: line A control post slip. Lane 14: line A immature, Lane 15: line A full slip, Lane 16: line A post slip. Lanes 18-25 represent a standard curve containing 20,40,80, 160,320, and 640 pg of SAMase fusion protein respectively.

4.2. POST HARVEST FRUIT QUALITY EVALUATIONS

Harris Moran Seed Company and Agritope, Inc. have conducted horticultural and physiological evaluations on lines A and B during the 1997 and 1998 field seasons in California, Oregon, Arizona and Texas. The parameters evaluated included harvest maturity (timing from anthesis to full slip), fruit size and weight, fruit firmness, mold susceptibility, external and internal color, soluble solids, and ethylene production in harvested fruit. Data collected from these trials, as well as from laboratory analyses demonstrate that SAMase-expressing cantaloupe lines A and B, except for the intended impact of SAMase expression on ethylene biosynthesis and related processes, do not differ from the non-transgenic parental varieties.

4.2.1. Ethylene Biosynthesis During the 1998 Summer field trail season at the Hermiston Agricultural Research Center, a detailed analysis of the ethylene production rates in transgenic lines A and B and their respective controls was carried out. Ethylene data were collected from full slip fruit using formation of the abscission zone as a harvest indicator. The melons were acclimated overnight at room temperature (23 DC) after which ethylene measurements were performed daily for four consecutive days. Ethylene concentrations were

375

determined by gas chromatography and evolution rates were reported as ppmlcm31hr. Results are shown in Figure 3 and indicate that significant differences exist between control and transgenic fruit in their ability to produce ethylene. The reduction in ethylene biosynthesis is evident in the inbred transgenic lines as well as in hybrid crosses between the transgenic lines and the non-transformed controls.

..s:::: ;:;-. E 0 -E 0.., 0..,

0.08

0.07

0.06

0.05

0.04

0.03

0.02

0.01

o A control Line 8 B control Line ,§

(n=26) (n=7) (n=47) (n=34) AXB (n=24)

8XB (n=12)

8X,§ (n=34)

Figure 3. Mean peak rates of ethylene production in transgenic SAMase cantaloupe lines A and B and respective controls and hybrids, Ethylene production was measured as described in the text. The peak rate of ethylene synthesis over four days of measurement was selected for each fruit, and like samples were pooled and averaged (n=number of fruit in each pool), Controls are represented by labeled black bars, while transgenic lines are represented by labeled open bars. The transgenic parent of each hybrid (gray bars) is indicated by underscoring. The black lines represent the standard deviation of each sample mean.

4.2.2. Maturity In order to determine if maturity differences exist between transgenic cantaloupe lines A and B and the respective non-transgenic controls, SAMase positive plants as well as null plants from segregating populations of lines A and B respectively were flagged in the field during the 1997 growing season in Hermiston, OR. Open flowers on SAMase positive and null plants from these populations were then tagged. Several bee boxes provided the source of pollinators and a count of successful pollinations was made 5-7 days after each tagging. Heat unit accumulation from tagging (pollination) to full slip was recorded. Results are reported as the percentage of mature (full slip) fruit in each of the lines after accumulation of the given number of heat units until all tagged fruit had slipped. Heat units are derived by subtracting the daily minimum temperature from

376

the daily maximum temperature, dividing by two and subtracting a base temperature (in this case 45°F).

TABLE I. Timing, measured in heat units, from pollination until the formation of the fruit abscission zone (full slip) in control and transgenic cantaloupe

Heat Units: 1009 1074 1160 1227 Genotype

Line A control 16% 31% 49% 6% Line B control 11% 35% 46% 8%

LineA 8% 17% 67% 8% LineB 6% 19"10 70% 5%

The results in Table 1 demonstrate that while the onset of maturity is not significantly delayed in transgenic fruit compared to the respective controls, full maturity of the transgenic fruit is more concentrated in terms of the percentage of tagged fruit which reached full slip and that this happens at a greater number of heat units than the controls. Also, it should be noted that in terms of total heat units required for the total fruit load to reach maturity there is no difference. Instead, it would appear that the transgenic fruit matures more uniformly than the controls. Further testing may help determine if these differences are due to the effects of SAMase expression in the fruit.

4.2.3. Yield Characteristics As part of the ongoing horticultural evaluation and phenotype characterization carried out at the various field test locations, yield characteristics and fruit size distribution has been evaluated by quantitative harvest at full fruit maturity (i.e. full slip). In the Oregon, California, and Arizona trials during the spring and summer of 1998, fruit were harvested on an per plant basis and comparisons made between total number of fruit per plant, total fruit weight and fruit size distribution. While in some cases there were significant differences between transgenic and control entries for fruit size and/or yield, these differences were not consistent over locations and appear to simply be a genotype by environment interaction resulting at least in part from the process of reducing the original cantaloupe populations to single plants and the subsequent expansion of these populations to their current size. This type of result is not unusual in conventional breeding programs such as backcrossing programs where single plant selections are made in the process of introgressing new genetic material into standard inbred types (Copes, 1998, personal communication). There is no evidence to suggest that these differences are the direct result of SAMase expression.

4.2.4. Other Horticultural Evaluations As part ofthe post-harvest evaluation of the fruit, measurements of internal and external fruit firmness, parameters of fruit deterioration, and soluble solids were performed in three separate field trial locations. At the Davis field site, these post-harvest evaluations were made over several weeks of post-harvest storage. The following tables (2A through C) summarize these data. When evaluating external firmness, formation of soft spots, deterioration of the stem end, and growth of molds, a subjective scale from 1 to 9

377

is used, with 9 being a more desirable state and 5 being the lower limit of commercial marketability.

TABLE 2. Summary of fruit quality evaluations of cantaloupe Lines A and B and respective controls, evaluations completed during the 1998 summer field season.

A. Davis, California, summer 1998, Day 0

External Internal Soft Spot Stem End Molds Genotype Firmness Firmness (1-9) (1-9) (1-9) o Brix

(1-9) (lbs./sq.in.) Line A Control 8.21 5.50 8.39 8.32 9.00 12.38 Line A 8.07 6.10' 7.87 8.07 8.09 11.70 Line B Control 8.26 5.80 8.05 8.16 9.00 9.01 Line B 8.68 6.77' 8.76' 8.45* 8.95 9.71 •

B. Davis, California, summer 1998, Day 14 Line A Control 5.71 2.26 5.75' 4.87' 5.01 • 11.55 lineA 5.65 2.50 4.44 4.18 4.39 12.08 Line B Control 5.68 2.77 5.02 4.64 5.34 8.37 Line B 5.83 3.66' 5.24 5.06 5.02 9.38

C. Davis, California, summer 1998, Day 21 Line A Control 5.03 2.16 4.58' 4.16 4.19 11.35 Line A 4.87 1.97 3.91 3.85 398 11.65 Line B Control 5.39 3.29 4.\0 4.20 3.92 8.54 Line B 5.48 3.36 4.43 4.23 4.25 9.04'

•. Means of controls and respective transgenic lines are significantly different at p-O.OS.

5. Discussion

Cantaloupe was transformed with an E8!E4 hybrid promoter SAMase construct, and the resulting transformants were analyzed for SAMase expression and ripening phenotype both in greenhouse and field trials. The chimeric promoter in the SAMase expression construct drives expression of SAMase in a fruit specific and ethylene responsive manner. By expressing this enzyme in such a regulated manner, fruit of SAMase lines A and B produce substantially less ethylene than non-transgenic fruit resulting in a modified ripening and post-harvest phenotype.

SAMase melons show significant reductions in ethylene biosynthesis, both as inbreds homozygous for the introduced SAMase transgene and as hybrids. SAMase melons also show minimal delay in the time from pollination to maturity, and the fruit of the transgenic plants may be characterized as ripening more uniformly in the field. Other horticultural traits and yield are minimally impacted by SAMase expression, with the transgenic fruit most often showing no statistical differences from the non­transformed controls. It was frequently observed that the concentration of soluble sugars was significantly higher in the transgenic fruit compared with the controls. One possible explanation may be that fuII slip is achieved by the majority of transgenic fruit one to three days later than the average control fruit. The additional time on the vine may aIIow more sugar to accumulate in the fruit before it is harvested. These results are

378

consistent with observations of melons exhibiting dramatically reduced ethylene biosynthesis as a result of antisense expression of ACC oxidase (ACO) [16]. Ethylene production was reduced by >99% in the ACO-antisense melons, and flesh firmness was substantially increased in the transgenic ripe fruit. However, the accumulation of soluble solids was minimally affected in the transgenic fruit, confirming that sugar accumulation in melon is independent of ethylene [16].

Using a fruit-specific developmentally regulated SAM degradation strategy as a means to reduce ethylene biosynthesis in plants has a number of distinct advantages. The fruit-specific nature of gene expression targets only the SAM found in fruit and diverted to ACC for ethylene production. The fact that sam-k gene expression follows the normal pattern of expression of ethylene during the ripening process means that the SAMase protein is essentially transient and final concentrations in the ripe fruit are minimal. The use of an enzyme that degrades SAM may allow for the selection of a broad range of modified ripening phenotypes which can be predictably determined by the level of SAMase protein expressed. We believe that these benefits will help to reduce production and handling related losses and produce a higher quality in the crop as a whole with the concomitant savings in labor and distribution costs. There also exists the potential to benefit consumers with a longer-lasting, higher-quality product.

6. Acknowledgements

The authors wish to acknowledge the contributions of the Harris Moran breeding staff and the Agritope research staff, with special thanks to Brenda Lanini of HMSC, Davis, CA.

7. References

1. Purseglove, J. W. (1968) Tropical Crops. Dicotyledons I. John Wiley and Sons. New York. 2. Everett, T.H. (1981) The New York Botanical Garden Encyclopedia of Horticulture. Garland Press,

New York. pp. 3596 3. Hughes, J.A. et al. (1987) Nucleotide sequence analysis of the coliphage T3 S-adenosylmethionine

hydrolase gene and its surrounding ribonuclease III processing sites, Nuc. Acid Res. 15, 717. 4. Hughes, J.A. et al. (1987) Expression of the cloned coliphage T3 S-adenosylmethionine hydrolase

gene inhibits DNA methylation and polyamine biosynthesis in E. coli. J Bact. 169, 3625-3632. 5. Good, x., Kellogg, J.A., Wagoner, W., Langhoff. D., Matsumura, W. and Bestwick, RK. (1994)

Reduced ethylene synthesis by transgenic cantaloupes expressing S-adenosylmethionine hydrolase, Plant Mol. Bioi. 26, 781-790.

6. Salvatore, F. et al. (1977) The Biochemistry of Adenosylmethionine, Columbia University Press, New York.

7. Usdin, E. et al. (1979) Transmethylation. ElsevierlNorth Holland Publishing, New York. 8. Kende, H. (1993) Ethylene biosynthesis, Annu. Rev. Plant Physiol. Plant Mol. Bioi. 44,283-307. 9. Deikman, J., Xu, R, Kneissl, M.L., Ciardi, J.A., Kim, K-N. and Pelah, D. (1998) Separation of cis

elements responsive to ethylene, fruit development, and ripening in the 5'-flanking region of the ripening-related E8 gene, Plant Mol. Bioi. 37, 1001-1011.

10. Xu, R, Goldman, S., Coupe, S., and Deikman, J. (1996) Ethylene control ofE4 transcription during tomato fruitripening involves two cooperative cis elements, Plant Mol. Bioi. 31,1117-1127.

11. Deikman, J., Kline, R., Fischer, RL. (1992) Organization of ripening and ethylene regulatory regions in a fruit-specific promoter from tomato (Lycopersicon esculentum), Plant Physiol. 100, 2013-2017.

379

12. Kramer, M.G., Kellogg, J.A, Wagoner, W., Matsumura, W., Good, x., Peters, S., Clough, G, and Bestwick, R.K. (1997) Reduced ethylene synthesis and ripening control in tomatoes expressing S­adenosylmethionine hydrolase, in AK. Kanellis, et al. (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 307-319.

13. Depicker, A, Stachel, S., Dhaese, P., Zambryski, P. and Goodman, H.M. (1983) Nopaline synthase, transcript mapping and DNA sequence, J. Mol. Appl. Genet. 1,561-573.

14. Beck, E., Ludwig, G., Auerswald, E., Reiss, B., Schaller, H. (1982) Nucleotide sequence and exact location of the neomycin phosphotransferase gene from transposon Tn5, Gene 19, 327-336.

15. Velten, J., Shell, J. (1985) Selection-expression plasmid vectors for use in genetic transformation of higher plants, Nucleic Acids Res. 13, 6981-98.

16. Guis, M., Bouquin, T., Zegzouti, H., Ayub, R., Ben Amor, M., Lasserre, E., Botondi, R., Raynal, J., Latche, A, Bouzayen, M., Balgue, C., and Pech, J.C. (1997) Differential expression of ACC oxidase genes in melon and physiological characterization of fruit expressing an antisense ACC oxidase gene, in AK. Kanellis, et at. (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 327-337.

PHYSIOLOGICAL ANALYSIS OF FLOWER AND LEAF ABSCISSION IN ANTISENSE-ACC OXIDASE TOMATO PLANTS

L. ZACARIAS\ C. WITHELAW2, D. GRIERSON2 AND J.A. ROBERTS2

/ lnstitUlo de Agroquimica y Tecnologia de Alimentos (CSlC), 46100 Burjassot, Valencia, Spain, 2Plant Science Division, School of Biological Sciences, University of Nottingham, Sutton Bonington Campus, Loughborough, LEI2 5RD, UK

1. Introduction

The process of abscission is a common feature during plant development by which flowers, flower parts, leaves, fruits and other organs are shed. Cell separation occurs at a predeterminated site known as the abscission zone and the process is triggered by developmental and environmental signals that bring about cell wall dissolution and the shedding of the organ [5]. The regulatory mechanisms governing abscission are not completely understood and may vary at different abscission sites and stages in the plant's life [16]. However it is clear that different hormonal stimuli act in a co­ordinated manner to determine the timing of abscission and based on their response to ethylene and indole-3-acetic acid (lAA) abscission-zone cells have been classified as a particular type of target cell [12]. Ethylene has been recognised as an important abscission-promoting signal and in different plant species genes whose expression is regulated by this gaseous plant hormone have been isolated and characterised [4, 8]. However the precise role by which ethylene regulates the abscission process and whether it acts as an inducer or an accelerator of cell separation remains unresolved. Analysis of the abscission process in mutants that exhibit an attenuated capacity to perceive or synthesise ethylene provides a unique strategy to clarify the role of the hormone in abscission. In the ethylene insensitive mutant of Arabidopsis thaliana, etrl-I, shedding of the petals and expression of the I)-glucuronidase reporter gene driven by the chitinase promoter both took place at the base of the flower abscission-zone but were delayed with respect to the wild type plant. Similar results were reported in the ein2 mutant, which carries a mutation conferring near complete ethylene-insensitivity [2]. In the Never ripe mutant of tomato, ethylene perception is blocked by a lesion in an ethylene receptor gene that is homologous to the ERS gene of Arabidopsis. This gene is similar to ETRI but lacks the response domain [\8]. The time course of both 'natural' and ethylene-promoted flower senescence and abscission was substantially delayed in Nr plants [\ 0, 17] indicating that ethylene plays a role in regulating these processes in tomato. These observations suggest that there is not an absolute requirement for ethylene in order for abscission to take place in Arabidopsis or tomato but further work is necessary to determine whether

381

382

this is a general feature of different species and sites of shedding. Moreover, by examining mutants where different components of the ethylene perception and signal transduction pathway are blocked it will be possible to determine whether the abscission process is always co-ordinated in the same way.

Tomato plants producing reduced levels of ethylene have been generated by expressing an antisense ACC oxidase (ACO) transgene [6] and the rates of fruit ripening and leaf senescence have been shown to be retarded in transgenic (ACOI AS)

plants [7, 14]. These ACO 1 AS plants provide a useful experimental system to elucidate the involvement of ethylene in different developmental processes. In this article we report a physiological analysis of flower and leaf abscission in ACOI As tomato plants. Our results indicate that reduced ethylene production is accompanied by a reduction in sensitivity to the gaseous plant hormone.

2. Flower Senescence

To examine the effect of reduced ethylene production on flower senescence, flowers at the closed bud stage (when the petals start to emerge - described by Barry et aZ. [1] as Stage 2) or flowers at anthesis (Stage 3) were tagged from both wild-type (WT, cv. Ailsa Craig) and ACOI As plants. Plants were grown in a growth chamber under fluorescent light for 16 h at 28°C and 8 h dark at 25°C. Under these conditions, flowers of WT plants began to sene see by drying and wilting at the tip of the petals and as the wilting progressed the corolla became closed and by about five days after anthesis it had faded. A large proportion of intact WT flowers showed initiation of cell separation and progressive yellowing of the proximal pedicel and sepals, culminating in flower abscission. Flowers from the ACOI As plants displayed a significant delay in senescence and did not wilt in the same manner as WT. The tip of the petals started to fade by about the fourth day after anthesis and this progressed slowly to the base of the petals, which remained expanded, turgid and attached more than 7 days later. Two weeks after anthesis most of the ACOI As flowers had desiccated but were still firmly attached to the base of the calyx. Only a small proportion of the ACOI As inflorescences eventually abscised.

3. Abscission of Flower Explants

Separation at the flower abscission zone was examined in explants that either had the flower removed or still attached to the pedicel. In WT explants in which the flower had been excised, abscission started after 6 h and 100% separation was achieved within 18 h. In the ACOI AS material abscission progressed at a slower rate and by 72 h only 80% of the air-treated explants had undergone separation. This delay in abscission was associated with a 90% reduction in ethylene production by the ACOI As explant tissue compared to the WT material. Application of ethylene (l01l1 rl) accelerated the rate of separation in both WT and transgenic phenotypes but the time required to complete abscission was almost doubled in the ACOIAS plants (Table I).

TABLE I. Time required (h) to induce 50% and 100% abscission by ethylene (I01l1 rl) in abscission-zone explants, with (+) or without (-) the terminal flower, from wild-type (WT, CV. Ailsa Craig) and ACO I AS tomato plants.

Abscission WT ACOI As

- flower 50% 3.5 4.7

100% 6.0 11.0

+flower 50% 6.0 11.0

100% 11.0 72.0

383

If the flower was left attached to the pedicel explant abscission was delayed for up to 24 h in WT plants while in the ACOI As plants the process was suppressed completely. Ethylene production by the transgenic explants was only 10% of that observed in WT material. Ethylene accelerated the rate of abscission in flower explants from WT and ACOI As plants but the transgenic material exhibited a greatly reduced sensitivity to the hormone (Table 1).

4. Abscission of Leaf Explants

Ethylene production by leaf explants from the WT increased with the onset of abscission and reached a peak after 3 days. No comparable rise in ethylene synthesis was observed in explants from ACOI As plants and the level of ethylene production was only 7% of that seen in WT. The reduced production of ethylene by the transgenic tissue was accompanied by a suppression of abscission and after 7 days less that 10% of the explants had abscinded compared with 100% abscission in WT explants by day 5. Sensitivity to ethylene was also attenuated in leaf explants from the ACOI As plants. After 2 days of exposure to 1 or 10 J.ll.rl ethylene abscission was 3 and 2.4-times lower, respectively that in WT explants (Table 2).

5. Conclusion

Transgenic tomato plants expressing an antisense ACO-I gene produce reduced levels of ethylene during flower senescence and abscission of flowers and leaves. Flower senescence was considerably delayed in the ACOI As line and proceeded in a different manner compared with WT plants. Pedicel abscission was delayed or suppressed, in either the presence or absence of the terminal flower, and abscission of leaf explants was also retarded. These results clearly indicate that ethylene is the major regulatory

384

signal controlling flower wilting and abscission in tomato and corroborate previous observations [3].

TABLE 2. Effect of ethylene on abscission of leaf explants from wild type (WT, cv. Ailsa Craig) or ACOI As tomato plants. Abscission was determined after 48 h of exposure to different concentrations of the gas.

Ethylene (~11·1) WT

o 20,0

36,0

10 67,5

Abscission (%)

0,0

12,0

27,5

During senescence of tomato flowers an increase in the expression of ACC oxidase genes ACO-I and ACO-3 as well as in ACC oxidase activity has been reported [I] indicating a spatial and temporal regulation of ACC oxidase during flower senescence. The delay in the onset of flower senescence observed in the ACOI AS plants reinforces the key role of ethylene in coordinating the different morphological and physiological events accompanying flower senescence. This hypothesis is also supported by the fact that the phenotype exhibited for flower senescence in ACOI AS plants closely resembles that described for flowers from Nr plants in which ethylene perception is blocked [10, 191-

Separation of the flower abscission-zone explants was influenced by the presence of the flower. Whereas in the WT explants the process was delayed, in ACOI AS explants the presence of the terminal flower almost completely suppressed abscission. Abscission inhibitors such as auxins, present in the flower, have been previously suggested to regulate the timing of abscission [15]. The interaction between ethylene and auxin appears to be crucial, since ethylene can increase auxin metabolism and reduce basipetal auxin transport [3]. In explants from ACOI AS plants ethylene production was greatly reduced and it is likely that in the presence of the terminal flower the auxin flux through the abscission zone would be maintained and be responsible for the observed suppression of abscission. This is consistent with a model in which, in the absence of the source of inhibitor from the flower, the auxin gradient would progressively decline and the explants would exhibit an elevated sensitivity to the low levels of ethylene evolved and abscission would progress at a slow rate.

Interestingly, in the three abscission systems examined (pedicel, flower and leaf explants) antisense ACOI AS plants displayed a reduced sensitivity to ethylene-induced separation, although they finally did abscind. The mechanism by which ethylene is perceived and transduced is not completely understood but genes encoding putative ethylene receptors have been isolated from Arabidopsis and tomato [11, 13, 18, 20]. Zhou et al. [20] reported that the ETRI gene was constitutively expressed during leaf abscission and was unaffected by ethylene, silver thiosulfate (an inhibitor of ethylene action) or IAA. They concluded that the regulation of abscission by ethylene is not

385

related to changes in the expression of the ETRI gene. However the level of the mRNA encoding the NR gene was higher in the flower-abscission zone than in the distal or proximal pedicel region and increased specifically during shedding [13]. The expression of the NR mRNA was developmentally regulated and induced by ethylene and therefore was proposed to playa role in the autocatalytic mechanism of ethylene biosynthesis and perception [9, 13]. This model could help to explain the reduced sensitivity of the ACOl As abscission-zones to ethylene. If the expression of the ethylene receptor is regulated by ethylene itself it would be predicted that plants producing very low levels of the gas during the life cycle would exhibit reduced receptor levels and consequently have a diminish competence to respond to the hormone. Although a more complex mechanism may dictate the ability of the abscission-zone cells to perceive and transduce the ethylene signal, the results reported here indicated that this programme of events is, in part, linked to ethylene biosynthesis.

6. Acknowledgements

The financial support of the Conselleria d'Educaci6 i Cultura (Generalidad Valenciana, Spain) and the Royal Society (UK) is gratefully acknowledged.

7. References

I. Barry, C.S., Blume, B., Bouzayen, M., Cooper, W., Hamilton A.J. and Grierson, D. (1996) Differential expression of the I-aminocyclopropane-I-carboxylate oxidase gene family in tomato, Plant J. 9, 525-535.

2. Bleecker, AB. and Patterson, S.E. (1997) Last exit: senescence, abscission, and meristem arrest in Arabidopsis, Plant Cell 9, 1169-1179.

3. Brown, K.M. (1997) Ethylene and abscission, Physiol. Plant. 100,567-576. 4. Coupe, S.A, Taylor, J.E. and Roberts, J.A (1997) Temporal and spatial expression of mRNAs

encoding pathogenesis-related proteins during ethylene-promoted leaflet abscission in Sambucus nigra, Plant Cell and Environ. 20, 1516-1524.

5. Gonzalez-Carranza, Z.H., Lozoya-Gloria, E. and Roberts, J.A. (1998) Recent development in abscission: shedding light on the shedding process, Trends in Plant Science 3, 10-14.

6. Hamilton, AJ., Lycett, G. W. and Grierson, D. (1990) Antisense gene that inhibits synthesis of the hormone ethylene in transgenic plants, Nature 346,284-287.

7. John, 1., Drake, R., Farrell, A, Cooper, W., Lee, P., Horton, P. and Grierson, D. (1995) Delayed leaf senescence in ethylene- deficient ACC-oxidase antisense tomato plants: molecular and physiological analysis, Plant J. 7,483-490.

8. Kalaitzis, P., Solomos, T. and Tucker, M.L. (1997) Three different polygalacturonases are expressed in tomato leaf and flower abscission, each with a different temporal expression pattern. Plant Physiol. 113, 1303-1308.

9. Klee, H.J. and Tieman D. (1997) Potential applications of controlling ethylene synthesis and perception in transgenic plants, in AK. Kanellis, C. Chang, H. Kende and D. Grierson (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publisher, Dordrech, pp. 289-297.

10. Lanahan, M.B., Yen, H-C., Giovannoni, J.J. and Klee, H.J. (1994) The Never Ripe mutation blocks ethylene perception in tomato, Plant Cell 6,521-530.

11. Lashbrook, C.c., Tieman, D.M. and Klee, H.J. (1998) Differential regulation of the tomato ErR gene family throughout plant development, Plant J. 15, 243-252.

12. Osborne, D.J. (1989) Abscission, Curro Rev. Planl Sci. 8,103·129. 13. Payton, S., Fray, R.G., Brown, S., and Grierson, D. (1996) Ethylene receptor expression is regulated

during fruit ripening, flower senescence and abscision, Plant Molec. BioI. 31, 1227-1231.

386

14. Picton, S., Barton, S.L., Bouzayen, M., Hamilton, AH. and Grierson, D. (1993) Altered fruit ripening and leaf senescence in tomatoes expressing an antisense ethylene-forming enzyme transgene, Plant J. 3,469-481.

15. Roberts, J.A, Schindler. C.B. and Tucker, G.A (1984) Ethylene-promoted tomato flower abscission and the possible involvement of an inhibitor, Planta 160,159-163.

16. Sexton, R. and Roberts, J. A (1982) Cell biology of abscission, Ann. Rev. Plant Physiol. 33, 133-162 17. Tucker, G.A, Schindler. C.B., and Roberts, J.A (1983) Flower abscission in mutant tomato plants,

Planta 160, 164-167. 18. Wilkinson, J.Q., Lanahan, M.B., Yen, H-C., Giovannoni, J.J. and Klee, H.J. (1995) An ethylene­

inducible component of signal transduction encoded by Never-ripe, Science 270,1807-1809. 19. Wilkinson, J.Q., Lanahan, M.B., Clark, D.J., Bleecker, AB., Chang, C., Meyerowitz, E.M. and Klee,

H.J. (1997) A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in heterologous plants, Nature Biotech. 15,444-447.

20. Zhou, D., Kalaitzis, P., Mattoo, A.K., and Tucker, M.L. (1996) The mRNA for the ETRI homologue in tomato is constitutively expressed in vegetative and reproductive tissues, Plant Molec. Bioi. 30, 1331-1338.

ETHYLENE IN HIGHER PLANTS: BIOSYNTHETIC INTERACTIONS WITH POLYAMINES AND HIGH-TEMPERATURE-MEDIATED DIFFERENTIAL INDUCTION OF NRVERSUS TAEl ETHYLENE RECEPTOR

1. Abstract

R. A. MEHTA·, D. ZHOU" M. TUCKER·, A. HANDA2, T. SOLOMOS3, A. K. MATTOO·,4 JUSDA, Plant Sciences Institute, Building OlOA, Agricultural Research Center-w, Beltsville, MD 20705, USA, 2Department of Horticulture, Purdue University, W Lafayette, IN 47907, USA, and 3 Department of Horticulture, University of Maryland at College Park, MD 20742, USA. 4Address correspondence to this author

We are interested in factors that predispose a fruit or leaf to senesce, and the means by which these factors could be neutralized in a timely manner. Polyamines - putrescine, spermidine, spermine - accumulate and function during cell division and growth of the plant, and act as anti-senescence growth factors. On the other hand, ethylene production in the fruit is induced after growth and cell expansion are completed, which results in the promotion of the senescence process. Our experiments were designed to interfere with the ripening process by increasing the production of polyamines by introducing a key polyamine gene, S-adenosylmethionine decarboxylase, during the senescence phase and test if the fruit can reverse a part or parts of the senescence process, maintain or overaccumulate desirable nutrients, and prolong its shelf-life. Ripening fruits from transgenic lines accumulate polyamines, whereas the red fruit from the wild-type line carried through tissue culture had little, if any, spermidine and spermine. Fruit from some of these transgenic lines accumulate several-fold higher lycopene, appear to store better, and show delayed ripening and senescence than the fruit from the wild-type plants. Northern blot analysis showed that the TAEI (ethylene receptor) class of mRNA is constitutively expressed at fairly constant levels in all examined tissues and organs. We used a tomato NR (mutated ethylene receptor) gene-probe to analyze mRNA accumulation for the NR gene. Accumulation of the NR gene transcript was considerably more variable. Most notable were changes in NR mRNA accumulation during fruit maturation, and heat stress at 37°C. Thus, NR mRNA is differentially expressed in tomato as compared to the generally

2. Introduction

Ethylene is a simple hydrocarbon, a gas at room temperature, produced by higher plants, fungi and bacteria (1, 2]. Plants use ethylene as a hormone for regulating diverse

387

388

metabolic processes during plant growth, development and senescence. Its production is regulated by transcriptional and post-transcriptional controls of two key ethylene­biosynthesis enzymes, I-aminocyclopropane-l-carboxylate (ACC) synthase and ACC oxidase [3]. Decreasing the expression oftheir transcripts in transgenic plants produced via anti-sense RNA technology inhibits ethylene production and fruit ripening [4, 5]. Ethylene action involves several loci in the ethylene transduction pathway, two of which are erRI [6] - a negative regulator in the ethylene pathway, which encodes a Raf-like protein kinase, and ErRI, which encodes for a putative transmembrane protein kinase resembling the prokaryotic two-component signal transducers [7]. Introduction of the mutant Arabidopsis etrl-l gene into tomato also enabled manipulation of ethylene responses in higher plants, viz., inhibition of fruit ripening [8]. Ethylene likely influences plant metabolism via interactions with other plant growth regulators [9], such as auxins, gibberellins, cytokinins, abscisic acid, brassinosteroids [10], methyljasmonate [II], polyamines [12], and salicylic acid [13]. Auxins, gibberellins, cytokinins, brassinosteroids, and polyamines are generally considered as promotors of growth and development while methyljasmonate, abscisic acid and ethylene promote senescence and cell death. Plant hormone action seems determined by not only the relative levels of these growth regulators, but also by the sensitivity of each cell to perceive different hormones, individually or in a certain combination.

3. Do Polyamines Impact the Ripening Process of Fruits?

A temporal relationship has been observed between polyamines and ethylene during plant development - this has led to suggestions that changes in the ratio of polyamines and ethylene levels influence specific physiological processes in plants [14]. Ethylene and polyamines share a common intermediate, S-adenosylmethionine (SAM), and a common byproduct, methylthioadenosine [3, 15, 16]. In vitro studies have shown that polyamines inhibit ethylene biosynthesis in a variety of fruit and vegetative tissues, while ethylene suppresses the accumulation of polyamines [17, 18]. Polyamines inhibit ethylene biosynthesis by suppressing the induction of ACe synthase, which catalyzes the formation of ACC from SAM, and ACe oxidase, which converts ACC into ethylene [19]. The inhibition of the ethylene biosynthetic pathway generates a feed back causing SAM to accumulate which is then channeled into polyamine biosynthesis [20, 21]. Polyamines are generated once the diamines, putrescine and cadaverine, are synthesized from arginine and lysine, respectively [12]. Then, the aminopropyl group from decarboxylated SAM, formed from SAM by SAM decarboxylase, is donated to putrescine to form spermidine, and, in turn, spermidine reacts with another aminopropyl group from decarboxylated SAM to form spermine. Ethylene-mediated suppression of polyamine biosynthesis is thought to occur by an inhibition of SAM decarboxylase, a key enzyme in polyamine biosynthesis. These results have led to the hypothesis that there is a cross-talk between ethylene biosynthesis and polyamines biosynthesis [22]. The nature of the interrelationships between ethylene and polyamines at both the physiological and biosynthetical levels still remain to be resolved. Although polyamines have been implicated in many physiological processes in plants, a definite

389

role for these metabolites in plant metabolism, growth and development has not yet been demonstrated.

Weare interested in factors that predispose a fruit or leaf to senesce, and the means by which these factors could be neutralized in a timely manner. Polyamines - putrescine, spermidine, spermine - accumulate and function during cell division and growth of the plant, and act as anti-senescence growth factors [12]. On the other hand, ethylene production in the fruit is induced after growth and cell expansion are completed, which results in the promotion of the senescence process. Our experiments were designed to interfere with the ripening process by increasing the production of polyamines during the senescence phase and test if the fruit can reverse a part or parts of the senescence process [23], maintain or overaccumulate desirable nutrients, and prolong its shelf-life.

Several approaches have been suggested [24] to elucidate the relationships between polyamines and ethylene: [1] to monitor the levels of polyamines and ethylene, the corresponding key enzyme activities, and the metabolic flux of radio labeled metabolites; [2] to develop and use appropriate genetic mutants that show delayed senescence or a wide variation in their levels of individual polyamines; and [3] to produce transgenic plants transformed with antisense gene constructs for the key genes involved, ACC synthase, spermidine synthase or SAM decarboxylase fused to regulatable promoters. Our approach of choice to address the role of polyamines in fruit ripening was to introduce and express a reconstructed polyamine-producing gene in the fruit following initiation of ripening so that polyamines accumulate at a stage when they are normally at very low levels [24].

4. Tomato Transformed with Yeast SAM Decarboxylase Accumulate Polyamines in the Fruit

We genetically transformed tomato plants with a construct of S-adenosylmethionine decarboxylase (SAMdc), the enzyme that catalyzes the first commited step in polyamine biosynthesis. SAMdc gene was fused to the developmentally (ripening) and ethylene regulated E-8 promoter [25] to enable accumulation of polyamines in the fruit only upon ripening. Analysis of such fruit should reveal if continued accumulation of polyamines interferes with the expression of ethylene biosynthesis genes and the ethylene receptor gene family, and thereby result in modulating the ripening process. Such transgenic fruit can also be used as a model to study the role of polyamines in the ripening/senescence process. For instance, accumulation of polyamines may change the redox of the cells due to their property of being anti-oxidative in nature [26] and by their ability to stabilize cellular membranes [27] polyamines may tilt the balance towards anabolic from catabolic metabolism [23].

Putative transformants were selected using kanamycin marker selection, and the tissue grown into seedlings. A number of Ro transformed lines showed growth aberrations and in some cases seeds did not germinate, when grown under greenhouse conditions. The number of seeds per fruit in some of the transformed lines varied from 2 to 78 as compared to an average of 89 in the non-transformed wild type. This has also been observed with genetic transformations using other gene constructs.

390

Fruit from the several transformed lines were analyzed for stable integration of the gene, polyamine content, soluble solids, color development, and shelf-life. Gene integration was checked by Southern blotting of polymerase chain reaction (PCR)­amplified tomato genomic DNA (Fig. 1). It is apparent that each transformant integrated one or more copies of the SAMdc gene. Final confirmation that the Ro lines, called SAMDCI, 2,6, 10 and 13, had integrated the heterologous SAM decarboxylase gene in a functional manner was tested by determining the levels of polyamines, putrescine (Put), spermidine (Spd) and spermine (Spm) in the fruit of these lines as well as in the SAMDC15 azygous line and non-transformed wild type. The data in Figure 2 indicate that indeed, in the red ripe fruit of some lines, polyamines did accumulate -lines 1 and 6 preferentially accumulated Put whereas line 2 predominantly accumulated Spd, Spm being almost undetectable in lines I, 6 and 10. It remains to be determined why some lines accumulate high putrescine and others spermidine or spermine since the individual transformants were created using the same gene.

Segregation analyses of self ed-progeny from three independent transgenic lines show that the chimeric gene is stably maintained and segregates in a normal Mendelian manner during the sexual propagation. Ripening fruits from transgenic lines accumulate polyamines, whereas the red fruit from the wild-type line carried through tissue culture had little, if any, spermidine and spermine. Fruit from some ofthese transgenic lines

kb c 1 2 6 o 13

1.2 •

Figure 1. Southern blotting of PeR-amplified DNA from the indicated lines. Line numbers represent untransformed control (C) and transgenic ~ lines 1,2,6, 10 and 13

accumulate several-fold higher lycopene, appear to store better, and show delayed ripening and senescence than the fruit from the wild-type plants. Surprisingly, along with the accumulation of polyamines, the transgenic tomato fruit consistently produced more ethylene than the control lines. We are presently testing if this phenotype is a consequence of silencing of the E8 gene. The trans gene acts as a dominant in one line and as a quantitative trait in another, both of which show similar phenotypes under greenhouse and field conditions. We are using these high polyamine- accumulating lines as models to elucidate the role of polyamines in regulating gene expression, metabolism, growth and development in plants.

run 300 -01 el 9' FW

200

100

o c 15 1 2 6

PLANT #

put

spd

• spm

10

391

13

Figure 2. Levels of polyamines, putrescine (put), spermidine (spm) and spermine (spm) in untransformed control (C), tissue culture generated WT plant (15), and transgenic Ro lines 1,2,6, 10 and 13.

5. Preferential Induction of NR versus TAE! during Ripening and High Temperature Stress

We have identified two tomato homologues, eTAEI [28] and TFE27 [29], of the Arabidopsis ETRI ethylene receptor gene. The primary sequence characteristics of eTAEI and TFE27 suggest that they belong in the same class of ethylene receptors as ETRI but different from the Arabidopsis ERS gene-product which does not have a receiver domain [6, 7]. The Never ripe (NR) gene-product from tomato also lacks a receiver domain and shares higher sequence identity with the ERS genes than with the ETRI class.

Northern blot analysis showed that the TABI class of mRNA is constitutively expressed at fairly constant levels in all examined tissues and organs (stems, leaves, flower pedicels and abscission zones) and under different developmental stages and environmental stimuli (fruit ripening, auxin and ethylene treatments, and heat and cold stress) [28; unpublished]. Where examined, mRNA accumulation for TFE27 was very similar to that for eTAEl. In addition to eTAEI and TFE27, we used a tomato NR gene-probe to analyze mRNA accumulation for the NR gene. Accumulation of the NR gene transcript was considerably more variable. Most notable were changes in NR mRNA accumulation during fruit maturation, and heat stress at 37°C (Fig. 3). Thus, NR mRNA is differentially expressed in tomato as compared to the generally constitutive eTAEl. Similar results have been obtained by Lashbrook et al. [30].

392

We have introduced into the tomato eTAEI cDNA the same mutation that confers dominant ethylene-insensitivity in the etrl-l mutant in Arabidopsis. Chimeric gene constructs have been prepared where the mutant eT AE I gene was fused to either a Camv 35S, ubiquitin, or a polygalacturonase abscission-specific promoter. These constructs were transformed into tomato and the transgenic plants are currently being examined for any alteration in the abscission process and/or fruit ripening.

6. Acknowledgments

We thank Drs. James D. Anderson and Robert Saftner for a critical review of the original manuscript.

7. References

Tomato Leaves o 5 15 25 37°C

TAE1 -I, ::=====::::;=:

NR-

Figure 3. Preferential induction of NR mRNA in response to heat stress. Two identical RNA blots were probed separately with cDNA inserts from TAE] andNR.

1. Mattoo, AK. and Suttle, J. (1991) The Plant Hormone Ethylene, CRC Press, Boca Raton, pp. 337. 2. Abeles, F. 8., Morgan, P.W. and Saltveit, M. E. Jr (1992) Ethylene in Plant Biology, Academic

Press, San Diego, pp.414. 3. Fluhr, R. and Mattoo, AK. (1996) Ethylene: biosynthesis and perception, Crit. Rev. Plant Sci.,

B.V. Conger (ed.), CRC Press, Inc., Boca Raton, pp. 479-523. 4. Oeller, P.W., Wong, L.M., Taylor, L.P., Pike, D.A. and Theologis, A (1992) Reversible inhibition

of tomato fruit senescence by antisense l-aminocyclopropane-l-carboxylate synthase, Science 254, 437-439.

5. Picton, S., Barton, S., Bouzayen, M., Hamilton, A and Grierson, D. (1993) Altered fruit ripening and leaf senescence in tomatoes expressing an antisense ethylene-forming enzyme transgene, Plant J. 3,469-481.

6. Ecker, J.R. (1995) The ethylene signal transduction pathway in plants, Science 268, 667-675. 7. Chang, C., Kwok, S.F., Bleecker, A8. and Meyerowitz E.M. (1993) Arabidopsis ethylene­

response gene ETR]: Similarity of product to two-component regulators, Science 262, 539-545. 8. Wilkinson, J.Q., Lanahan, M.B., Clark, D.G., Bleecker, AB., Chang, C., Meyerowitz, E.M. and

Klee, H.1. (1997) A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in heterologous plants, Nature Biotechnol. 15,444-447.

9. Suttle, J.e. (1991) Ethylene interactions with other endogenous growth substances, in AK. Mattoo

393

and J.C. Suttle (eds.), The Plant Hormone Ethylene, CRC Press, Inc., Boca Raton, pp. 115-131. 10. Clouse, S.D. and Sasse, J.M. (1998) Brassinosteroids: Essential regulators of plant growth and

development, Annu. Rev. Plant Physiol. Plant Mol. Bioi. 49,427-451. 11. Creelman, RA, Tierney, M.L. and Mullet, J.E. (1992) Jasmonic acid/methyl jasmonate

accumulate in wounded soybean hypocotyls and modulate wound gene expression, Proc. Natl. Acad. Sci. USA 89, 4938-4941.

12. Slocum, RD. and Flores, H.E. (1991) (eds), Biochemistry and Physiology of Polyamines, CRC Press, Boca Raton, pp. 264.

13. Leslie, C.A. and Romani, R.l (1986) Salicylic acid: A new inhibitor of ethylene biosynthesis, Plant Cell Reports 5, 144-146.

14. Imaseki, H. (1991) The biochemistry of ethylene biosynthesis, in AK. Mattoo and lC. Suttle (eds.), The Plant Hormone Ethylene, CRC Press, Inc., Boca Raton, pp. 1-20.

15. Mattoo, AK. and White, B. (991) Regulation of ethylene biosynthesis, in AK. Mattoo and J.C. Suttle, (eds.), The Plant Hormone Ethylene, CRC Press, Inc, Boca Raton, pp. 21-42.

16. Kende, H. (1993) Ethylene biosynthesis, Annu. Rev. Plant Physiol. Plant Mol. Bioi. 44,283-307. 17. Apelbaum, A, Burgoon, AC., Anderson, J.D., Lieberman, M., Ben-Arie, R. and Mattoo, AK.

(1981) Polyamines inhibit biosynthesis of ethylene in higher plant tissue and protoplasts, Plant Physiol. 68, 453-456.

18. Suttle, J.C. (1981) Effect ofpolyamines on ethylene production, Phytochemistry 20,1477-1480. 19. Li, N., Parsons, B., Liu, D. and Mattoo, AK. (1992) Accumulation of wound-inducible ACC

synthase transcript in tomato fruit is inhibited by salicylic acid and polyamines, Plant Mol. Bioi. 18,477-87.

20. Even-Chen, Z., Mattoo, AK. and Goren, R (1982) Inhibition of ethylene biosynthesis by aminoethoxyvinylglycine and by polyamines shunts label from 3,4-e4C)methionine into spermidine in aged orange peel discs, Plant Physiol. 69,385-388.

21. Roberts, D.R., Walker, M.A., Thompson, lE. and Dumbroff, E.B. (1984) The effects of inhibitors of polyamine and ethylene biosynthesis on senescence, ethylene production and polyamine levels in cut carnation flowers, Plant Cell Physiol. 25, 315-322.

22. Mehta, RA, Handa, A and Mattoo, AK. (1997) Interactions of ethylene and polyarnines in regulating fruit ripening, in AK. KanelIis et al. (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 321-326.

23. Mehta, RA and AK. Mattoo (1995) Gene expression and protein dynamics during tomato fruit ripening, in A Ait-Oubahou and M. EI-Otmani (eds.), Postharvest Physiology. Pathology and Technologies for Horticultural Commodities: Recent Advances, Institut Agronomique et Veterinaire Hassan II, Agadir, pp. 343-352.

24. Kushad, M.M. and Dumbroff, E.B. (1991) Metabolic and physiological relationships between the polyamine and ethylene biosynthetic pathways, in RD. Slocum and H.E. Flores (eds.) Biochemistry and Physiology of Polyamines, CRC Press, Boca Raton, pp. 77-92.

25. Deikman, l, Kline, R and Fischer, R.L. (1992) Organization of ripening and ethylene regulatory regions in a fruit-specific promoter from tomato (Lycopersicon esculentum), Plant Physiol. 100, 2013-2017.

26. Drolet, G., Dumbroff, E.B., Legge, RL. and Thompson, lE. (1986) Radical scavenging properties of polyarnines, Phytochemistry 25, 367-371.

27. Ben-Arie, R, Lurie, S. and Mattoo, AK. (1982) Temperature-dependent inhibitory effects of calcium and spermine on ethylene biosynthesis in apple discs correlate with changes in microsomal membrane microviscosity, Plant Science Lett. 24,239-247.

28. Zhou, D., Kalaitzis, P., Mattoo, AK. and Tucker, M.L. (1996) The mRNA for an ETR1 homologue in tomato is constitutively expressed in vegetative and reproductive tissues, Plant Mol. Bioi. 30, 1331-1338.

29. Zhou, D., Mattoo, AK. and Tucker, M.L. (I996) Molecular cloning of a tomato cDNA (Accession n. U4279) encoding an ethylene receptor, Plant Physiol. 110, 1435.

30. Lashbrook, C.C., Tieman, D.M. and Klee, H.J. (1998) Differential regulation of the tomato ETR gene family throughout plant development, Plant J. 15, 243-252.

UNDERSTANDING THE ROLE OF ETHYLENE IN FRUIT SOFTENING USING ANTISENSE ACC OXIDASE MELONS

M. GUIS, A. LATCHE, M. BOUZA YEN AND J.C. PECH ENSA T, Avenue de I'Agrobiopole BP 107, Auzeville Tolosan, 31326 Castanet Tolosan Cedex, France lK.C. ROSE, K.A. HADFIELD AND A.B. BENNETT Mann Laboratory, Department of Vegetable Crops, University of California, Davis, CA 95616, USA

1. Introduction

The softening that occurs during the ripening of many fruits is generally attributed to the degradation of cell wall components, in particular the pectin and the hemicellusose polymer matrices. Ethylene is assumed to be involved in regulating the softening process in climacteric fruit, but its precise role remains unclear. Cantaloupe charentais melons, exhibit remarkably rapid softening, correlating with substantial cell wall disintegration and a sharp increase in ethylene production [1]. Transgenic ACC oxidase antisense fruits synthesizing less than 1 % of wild type levels of ethylene undergo minimal softening [2], however a dramatic loss of flesh firmness can be induced by application of ethylene [3]. The process of cell wall degradation and the expression of genes encoding cell wall degrading enzymes have been examined and we describe here the process of cell wall disassembly in these two types of fruits with particular emphasis on the pectin matrix.

2. Results

In pectin-enriched cell wall fractions obtained as described in Rose et at. [1], the apparent molecular size of the polymers declined during ripening of wild type fruits. Mature antisense ACC oxidase fruits exhibited a profile comparable to that of the pre­climacteric wild type suggesting that substantial pectin depolymerization did not occur in these fruits. However treatment of transgenic fruits with 50 ppm ethylene for four days resulted in a reduction in the average Mw of the pectins that was similar to that observed in the ripe wild type fruit. Pectin disassembly may be mediated in part by polygalacturonase (PG). Three melon cDNA clones with significant homology to other PGs were found to be expressed at high levels during fruit ripening [4]. In the wild type melon fruits, CmPG 1 and CmPG3 were abundantly transcribed at the peak of ethylene production and at a later ripening stage, but their mRNA levels were low during the ripening of the antisense ACC

395

396

oxidase fruits. Interestingly CmPG2 expression was detected at an early stage of ripening, well before the onset of ethylene production and its expression was not affected by ethylene suppression in the transgenic fruits. Application of ethylene resulted in an increase in mRNA abundance of all three PG genes.

Wild Type Antisense ACC Oxidase

+ C2H4

DAP 363840 4346 36 38 40434648 1d 4d

CmPG1

CmPG2

CmPG3

3. Conclusion

Figure 1. RNA expression pattern for three PG cDNAs during ripening of wild type and antisense ACC oxidase melons fruits. RNA extraction was performed according to Rose et a1. [I]. Total RNA (l51-1g per lane) isolated from fruit mesocarps were subjected to a Northern blot analysis using pMPG I, pMPG2 and pMPG3 as probes as described in Hadfield et al. [4]. DAP stands for Days After Pollination.

As with many fleshy fruits, Charentais melons undergo rapid softening during ripening however genetically engineered fruits producing extremely low levels of ethylene exhibited minimal softening during ripening on the vine. Transgenic fruits do not show the substantial changes in pectin molecular mass observed in the wild type. Application of ethylene to these transgenic fruits induced both the loss of firmness and a downshift in the size of cell wall polymers. These data and analysis of the expression pattern of PG genes suggest that ethylene plays an important role in regulating cell wall disassembly in melon. However, the complex regulation of PG gene expression underlines the participation of other developmental or environmental signals.

4. References

I. Rose, 1.K.C., Hadfield, K.A, Labavitch, J.M., and Bennett, AB. (1998) Temporal sequence of cell wall disassembly in rapid ripening melon fruit, Plant Physio1. 117,345-361.

2. Ayub, R, Guis, M., Ben Amor, M., Gillot, L., Roustan, J.P., Latch<!, A, Bouzayen, M., and Pech, J.C. (1996) Expression of an ACC oxidase antisense gene inhibits ripening of cantaloupe melons fruits, Nature Biotechn. 14, 862-864.

3. Guis, M., Botondi, R, Ben Amor, M., Ayub, R, Bouzayen, M., Pech; J.e., and Latche, A (1997) Ripening-associated biochemical traits of Cantaloupe Charentais melons expressing an antisense ACC oxidase transgene, J. Am. Soc. Hortic. Sci. 122, 748-751.

4. Hadfield, K.A., Rose, J.K.C., Yaver, D.S., Berka, RM., and Bennett, AB. (1998) Polygalacturonase gene expression in ripe melon fruit supports a role for polygalacturonase in ripening-associated pectin disassembly, Plant Physiol. 117,363-373.

ETHYLENE BIOSYNTHESIS IN TRANSGENIC AUXIN-OVERPRODUCING TOMATO PLANTS

J.M. CASTELLANO\ J. CHAMARR02 AND B. VIOQUE I

IInst. de La Grasa, CSIC, PO Box, J 078 £-4 J 0 J 2 Seville, Spain. 21nst. de Bioi. Mol. y Cel. de Plantas (UPV-CSIC), Valencia, Spain

1. Introduction

Indole-3-acetic acid (IAA) stimulates ethylene production in a wide variety of plant tissues and many of the effects of auxin are now attributed to its ability to induce ethylene production [1]. Evidence indicates that the enzymes involved in ethylene biosynthesis are sequentially induced in response to auxin treatment [2,3]. Classical approaches to understand auxin/ethylene interactions rely on exogenous applications of the hormone. We have initiated studies using transgenic tomato plants (Lycopersicum escuLentum Mill, cv. Ailsa craig) engineered with the iaaM gene from Agrobacterium tumefaciens under the control ofthe nonspecific 35S promoter from CaMV, in order to study the effects ofIAA overproduction on the ethylene biosynthesis pathway.

2. Results and Discussion

1.0 400

During fruit growth and development, ethylene production, ACC and MACC contents and ACC oxidase activity are :c similar in transgenic and wild type fruits, ~ 0.8

despite the higher levels of IAA in transgenic I 0.6

:<)' 300 +

5 0.4

~

~o 200 § 100 j o 3

o

fruits (data not shown). However, the increase in ethylene production during the first stages of ripening is 2-3 times higher in transformed fruits (Fig. 1). At difference with ethylene, the increase in IAA level does

0.2 -100 8

not advance the autocatalytic ethylene rise associated with climacteric. As already found in other climacteric fruits, the burst in ethylene production of control and transformed fruits is coupled with a rise in ACC and MACC contents and in ACC

0.0 'T--,.----.-,---,--.,-.L... -200

o 50 100 150 200 250 Time since colour turning (h)

Figure I. Ethylene production during fruit ripening.

oxidase activity. In transgenic fruits, the levels of ACC and MACC are higher than in wild type fruits at all stages of ripening (Fig. 2). The ACC oxidase activity reaches

397

398

similar values in both types of fruits, however in transgenic fruits the activity remains at a high level even at later stages of ripening (Fig. 3). The overproduction of auxin in

15 :;;­~

o Control • Transformed

'Oil

1 tIlM 3 "0 e

10

~ 5

0

150

-; 2 .s: .-5 " o u u «

MG B p R RR

'Oil

1 Figure 3. In vivo ACO activity in tomato fruits during ripening. Ripening stages are designed as in figure 2. 100

~ 50

0

MG B P R RR

Figure 2. ACC and MACC contents in tomato fruits during ripening. Ripening stages are designed as MG: mature green; B: breaker; P: pink; R: red; RR: red ripe.

transgenic tomato plants, a s in tobacco and Arabidopsis [4], also results in the overproduction of ethylene. The data presented are in agreement with evidence indicating that auxin-induced ethylene production is associated with an increase in ACC synthase and ACC oxidase activities [2, 5, 6], and also with a stimulation of ACC N­maloniltransferase activity by ethylene [7].

3. References

1. Abeles, F.B., Morgan, P.w. and Salveit, M.E. (1992) Ethylene in Plant Biology, Academic Press, New York.

2. Peck, S.c. and Kende, H. (1995) Sequential induction of the enzymes of ethylene biosynthesis by indole-3-acetic acid in etiolated peas, Plant Mol. Bioi. 28,293-301.

3. Peck, S.C. and Kende, H. (1997) Regulation of auxin-induced ethylene biosynthesis in etiolated pea stems, in A.K. Kanellis, C. Chang, H. Kende and D. Grierson (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 31-38.

4. Romano, C.P., Cooper, M.L. and Klee, H.J. (1993) Uncoupling auxin and ethylene effects in transgenic tobacco and Arabidopsis plants, Plant Cell 5,181-189.

5. Kim, W.T., Silverstone, A., Yip, W.P., Dong, J.G. and Yang, S.F. (1992) Induction of 1-aminocyc1opropane-I-carboxylate synthase mRNA by auxin in mung bean hypocotyls and cultured apple shoots, Plant Physiol. 98,465-471.

6. Kim, W.T. and Yang, S.F. {I 994) Structure and expression of cDNAs encoding 1-aminocyc1opropane-I-carboxylate oxidase homologs isolated from excised mung bean hypocotyls, Planta 194,223-229.

7. Liu, Y., Su, L.Y. and Yang, S.F. (1985) Ethylene promotes the capability to malonylate 1-aminocyclopropane-I-carboxylic acid and D-aminoacids in prec1imacterics tomato fruits, Plant Physiol. 77,891-895.

UNPREDICTABLE PHENOTYPE CHANGE CONNECTED WITH AGROBACTERIUM TUMEFACIENS MEDIATED TRANSFORMATION OF NON-RIPENING TOMATO MUTANT

G. BARTOSZEWSKI 1, O. FEDOROWICZI, S. MALEPSZy l, A. SMIGOCKf, AND K. NIEMIROWICZ-SZCZYTT 1

IDepartment of Plant Genetics, Breeding and Biotechnology, Warsaw Agricultural University, Poland; 2 Molecular Plant Pathology USDA, ARS, Beltsville, MD 20705-2350, USA

1. Introduction

The most characteristic feature of the non-ripening (nor) tomato mutant is the yellow colour of fruits at the stage of full maturity. These fruits do not synthesise climacteric ethylene or accumulate Iycopene. The nor gene has been subject to intensive studies due to its impact on ethylene production. The experiments consisted of the transformation of the nor mutant in order to improve fruit taste and plant resistance.

2. Materials and Methods

Plant material: non-ripening (nor) tomato mutant (seeds were kindly provided to our department by prof. RW Robinson in 1983 and multiplied in plastic greenhouse). Binary plasmids: pBIl21 with 35SCaMVlbeta-glucuronidase [I]; pRUR528 constructed on the basis ofpBI121, containing thaumatin II cDNA instead of gus gene [3], (kindly provided by M.Szwacka); pHSCKn318 carries isopentenyl transferase gene under heat shock promoter hsp70, constructed on the basis ofpKLYX7 [2], (kindly provided by A. Smigocki). AlI plasm ids had the same selective marker gene nptIl.

Ploidy level: was estimated by the flow cytometry method. Seedling segregation: seeds were tested in vitro on agar medium with 75 mg/I

kanamycin.

3. Results

In the experiments carried out recently the nor mutant was transformed with three Agrobacterium tumefaciens strains which contained different binary plasmids (pBI121, pRUR528 and pHSCKn312). In total, 18 transgenic plants were generated (5 for pBIl21,5 for pRUR528 and 8 for pHSCKn312), three of which produced normally ripening red fruits. All the other transgenic plants (15 individuals) as well as the plants

399

400

regenerated in vitro as a control had green-yellow fruits, typical of the nor mutant. Each of the transgenic plants with red fruits was obtained as a separate transgenic event, incorporating different plasmids. Plants with normally ripening red fruits showed some other morphological changes. Out of three normally ripening plants one was characterised by changed ploidy level (4x), which had an effect on leaf morphology, another one was a typical nor mutant and the third was a chimeric plant. Some sectors of different organs: leaves, stems and flowers of this chimeric plant were hairless. It was confIrmed by PCR or Southern-blot that transgene integration took place in the three normally ripening plants.

The segregation of the progeny of two plants was not corresponding to any mendelian ratio. In the third case however the ratio was 15: 1 (Chi-Square=O.O 1). Sensitivity of fruits to ethylene and colour of mature fruit as well as transgene expression will be the object of further study.

4. Conclusions

These results of the experiments are diffIcult to interpret. There are different possible reasons for phenotype reversion. It suggests the influence of transformation events on phenotype reversion of the nor mutant, but other reasons can not be excluded. Further research is needed to check the stability of nor gene and to identify the reasons of reversion.

5. Acknowledgements

This work was supported by the Polish State Committee for ScientifIc Research Grant No. 5P06A025 I 1. Grzegorz Bartoszewski was supported by Fellowship of Foundation for Polish Science.

6. References

I. Jefferson, R.A. Kavanagh, T.A. and Bevan, M.w. (1987) GUS fusions: f3-glucuronidase as sensitive and versatile gene fusion marker in higher plants, EMBOJ. 6,3901-3907.

2. Smigocki, AC. (1991) Cytokinin content and tissue distribution in plants transformed by a reconstructed isopentenyl transferase gene, Plant Mol. BioI. 16, 105-115.

3. Szwacka, M., Burza, W., Palucha, A and Malepszy, S. (1997) Transformacja u ogorka Cucumis sativus L., Biotechnologia 39, 20-26.

ON CHLOROPLAST INVOLVEMENT AND ETHYLENEINITRIC OXIDE (NOe) STOICHIOMETRY IN FRUIT MATURATION

1. Abstract

Y.Y. LESHEMl, R.B.H. WILLS2 AND V.V. KU2

J Department of Life Sciences. Bar-Ilan University. Ramat Gan 52900. Israel. 2Department of Food Technology. University of Newcastle. Ourimbah, NSW 2258, Australia

In ripening Citrus species fruits - oranges, grapefruit and Pomelit - it was found that endogenous NO· emission is intricately linked to skin-contained chloroplasts. This surmise is supported by the observation that illumination of immature green as opposed to yellow fruit markedly enhanced NO· emission. In this respect, the most active tissue was the flavedo which produced 1.5-3.0 x more NO· than the colorless albedo. Mode of interaction with C2H4 and relative contribution of flavedo-derived NO· to the overall fruit ripening process are discussed.

2. Introduction

The endogenous synthesis of the free radical gas NO· and its putative role in control of fruit maturation, leaf senescence and environmental stress have been documented earlier [3, 4]. These reports have provided evidence that mode of NO· action in the above processes is mainly by control of C2H4 emission and that under physiological conditions and exposure to short term stress, a clear ethylenefNO· stoichiometry exists. Moreover, Leshem, Wills and Ku [5] have shown that a single short term NO· fumigation of various fruits significantly enhanced shelf life of both climacteric and non-climacteric types in which maturation is ordinarily associated with C2H4 upsurge. The present research endeavored to shed more light on this mechanism, and in particular, to identify the sub-cellular location of NO· synthesis. In view of applied aspects of the problem, emphasis was laid on fruit maturation with special attention to Citrus spp.

3. Material and Methods

Mode ofC2H4 and NO· determination in ripening fruits have been detailed elsewhere [2, 4]. Modification of the NO· probing procedure was insertion of the probe tip into citrus flavedo which avoided disruption of the aromatic oil glands. In the experiments whose

401

402

results are presented in Figure 1, illumination source at a 150 /lmol s·J m2 (PAR) light intensity was from a mixed incandescent and fluorescent source.

3.1. PLANT MATERIAL

Citrus fruit possessing a thick rind with clearly demarcated flavedo and albedo were considered ideal for the study of locale of NO· synthesis. Although Citrus as a group is not a high ethylene producer, it nevertheless does respond to ethylene regulating treatment [1]. In order to test an experimental surmise that rind-contained chloroplasts or chromoplasts may playa key role in NO· turnover, it was of interest to compare essentially glaucous citrus fruits to a species that has green pulp and rind but whose epidermis is protected from light by a dense mat oftrichomes viz. the litchi.

4. Results and Discussion

Figure 1 indicates that, as expected in both the sour orange and kiwi, immature fruits emit more NO· than ripe ones. However, the effect of illumination markedly differs in the two fruit types. On the one hand, in the green 'bald' immature citrus fruit, illumination significantly raises rate of NO' emission, while in the ripe yellow/orange colored fruits where the chloroplasts presumably have converted to chromoplasts, this increase is not observed: with progress of time this even decreases. On the other hand, in the kiwi, densely covered with light-obstructing trichomes, besides a slight spike immediately following illumination, rate of NO synthesis remains constant. These results strongly suggest involvement of chloroplasts in endogenous NO' evolution.

This contention may be borne out by results presented in Table 1 where it is clearly seen that the colored chlorophyll-containing flavedo tissue emits 1.5-3.0 x more NO· than the white chlorophyll-lacking tissue. Further support to the experimental hypothesis that chloroplasts may inherently be linked to NO· turnover, is the report that in Pisum sativum foliage, NO· application at deleteriously high concentrations, induces a marked increase of red fluorescence of chlorophyll, this indicating PSII impairment [3]. Separate experimentation indicated that in fully mature maximally colored fruits, the difference between albedo and flavedo NO· emission markedly diminishes. Moreover, we also observed that mature fruit pulp emits NO· at levels being approximately those of the albedo.

5. Conclusions

In ripening Citrus fruit skin, a major but not a sole site of NO· production is the chloroplast. However, since the chlorophyll-lacking albedo and also the fruit's interior do manifest a certain amount of NO· emission, and considering their relative percentage of the volume of the whole fruit, their overall contribution to the total NO· pool may be as great, if not greater, than of flavedo tissue. An alternative site of NO· production in the still green immature fruit may be the green tissue contained in the vesicles of the

403

pulp segments. Preliminary experiments have shown that this tissue is an active NO· producer, rate of production decreasing with degree of ripeness.

Be this as it may, NO· participation in the peel de-greening process may have its commercially positive or negative aspects and, by exogenous application, provide a means for its regulation.

% , ;;:..::;; immature fruit ,,' = rip. fruit '" 250

, '" ,

" '" , --- '" I semi-shade I " [ illuminated I U u , > ... .... '" ... , ~ U

, - u 'v' ::s '" e .... ,," ... 200 ,," ::s ::s .;' ,..

CJ ,; '-" ... =

.; "

0 .::: " .... "-I

"'9 "-I .... e u

I

U u .:: 150

" .3 z u ...

min

Figure 1. Fruit rind color and NO·. Effect ofiIlumination on NO· emission in ripening sour orange (c. auranthium) and kiwi (Actinidia chinesis) fruit. Five replicate means. standard deviations were <12% of given values. Arrows indicate commencement of illumination.

TABLE 1. Comparison of NO· emission (x20 I1M.min.gr fresh wt tissue) in flavedo and albedo in peel of various Citrus species. Five replicate means. Comparative values ..

Tested species

Grapefruit (C. paradisi cv Ruby)

Pomelit (C. paradisi x C. maxima cv Goliath)

Orange (c. sinensis - cv Valencia)

Standard deviations did not exceed 15% of presented values.

Type of skin tissue

Flavedo

211

160

280

Albedo

100

100

100

404

6. References

1. Goldschmidt, E.E., Goren, R, and Huberman, M. (1993) Probing the role of endogenous ethylene in the degreening of citrus fruit with ethylene antagonists, Plant Growth Regul. 12,35-39.

2. Leshem, Y.Y. and Haramaty, E. (1996) The characterisation and contrasting effects of the nitric oxide free radical in vegetable stress and senescence of Pisum sativum Linn. foliage, 1. Plant Physiol. 148,258-263.

3. Leshem, Y.Y., Hararnaty, E., I1uz, D., Malik, Z., Sofer, Y., Roitrnan, Z., and Leshem, Y. (1997) Effect of stress nitric oxide (NO): Interaction between chlorophyll fluorescence, galactolipid fluidity and Jipoxygenase activity, Plant Physiol. Biochem. 35,573-579.

4. Leshem, Y.Y. and Wills, RB.H. (1998) Harnessing senescence delaying gases nitric oxide and nitrous oxide: a novel approach to postharvest control of fresh horticultural produce, BioI. Plant. 41,1-10.

5. Leshem, Y.Y., Wills, RB.H., and Ku, V.V. (1998) Evidence for the function of the free radical gas - nitric oxide (NO· ) - as an endogenous maturation and senescence regulating factor in higher plants, Plant Physiol. Biochem. (in press).

ETHYLENE DELAYS ONSET OF WOOLLY BREAKDOWN IN COLD­STORED PEACHES

1. Abstract

L. SONEGO, A. LERS, A. KHALCHITSKI, Y. ZUTKHI, H. ZHOU, S. LURIE AND R. BEN-ARIE Department of Postharvest Science, ARO - The Volcani Center, Bet­Dagan, 50250, Israel

'Hermosa' peaches were stored at O°C in a flow through system, which supplied ethylene in air at concentrations of 0, I, 10 or 100 /ll.rl. Fruit were examined during 6 weeks' storage upon removal from O°C and after 5 days at 20°e. The onset of woolly breakdown (WB) was delayed and its severity reduced with exposure to IoriO /l1.1- 1

ethylene. Fruit softening was not significantly affected by ethylene treatment. Polygalacturonase (PG) activity, which was undetectable in control fruit during storage at O°C, was induced by ethylene at DoC and enhanced 5-10 fold after transfer to 20°C. However, PG protein content was unaffected by ethylene treatment. Pectin-methyl­esterase (PME) content and activity, which increased during cold storage, were not affected by ethylene treatment. The RNA messages for both pectic enzymes were detected at all stages of storage and ripening, but were unaffected by ethylene treatment, as were the messages for ACC synthase and ACC oxidase.

2. Introduction

Woolly breakdown (WB) of peaches and nectarines is a chilling disorder, which generally develops in susceptible cultivars during shelf-life following 2-3 weeks in cold storage [8]. Development of the disorder has been attributed to the abnormal solubilization of cell wall pectins [5], resulting from an imbalance in the activities of PG and PME which is caused by prolonged exposure to low temperatures [I]. Storage techniques that have been shown to delay the onset of WB are delayed storage, intermittent warming and controlled atmosphere with relatively high CO2 levels [8]. The effectiveness of these techniques appears to be related to their ability to correct the imbalance in enzyme activity: the first two enable enhanced PG activity during storage [2] and the third causes inhibition of PME activity [3].

PG mRNA, PG protein and PG activity were all undetectable in nectarines harvested at the commercial stage of maturity appropriate for cold storage, but were expressed as the fruit ripened at 20°C following harvest (Lurie, unpublished data). In transgenic tomatoes that are incapable of ethylene synthesis, PG was produced following exposure

405

406

to exogenous ethylene [12]. The production of ethylene by pre climacteric peaches is extremely low [13]. We have therefore examined the possibility of increasing PG activity in cold-stored peaches by applying exogenous ethylene, with the intent of increasing pectin solubility and inhibiting the development of WB. We show that although ethylene does indeed induce and enhance PG activity, the control of WB is limited.

3. Materials and Methods

3.1. FRUIT SAMPLING AND STORAGE TREATMENTS

Peaches (Prunus persica L. cv. Hermosa) were harvested from a commercial orchard, at a preclimacteric stage of maturity, and divided into 5 batches - 4 for storage treatments and one for assessments at harvest and after 5 days ripening at 20°C. The fruit was stored at O°C in air tight barrels through which humidified air streams containing 0, I, 10 or 100 IlLrI ethylene passed at a flow rate of 100 ml.min-I. Samples of 20 fruit were taken from each barrel after 21, 29 and 41 days' storage. Ten fruit were assessed immediately and 10 were transferred to 200 C for 5 days and then assessed.

3.2. FRUIT ASSESSMENTS AND ENZYME ANALYSIS

Fruit firmness was determined on the opposite pared cheeks of each fruit with a Hunter­Spring firmness tester, using an 11 mm tip. The development of WB was evaluated visually on halved fruit as follows: 0 - none, 1- < 25%, 2- 25-50%,3 - 50-75%, 4 > 75% of the cut surface. Three representative fruits from each sample were chosen for enzyme analysis. Peeled flesh (40g) from each of these fruits was frozen ,extracted for PG and PME and assayed as previously described (1). Boiled samples were assayed as blanks for each determination of enzyme activity. Protein content was determined according to [4]. A unit of PME activity was defined as a milliequivalent of carboxyl groups released, per mg protein during one hour. A unit of PG activity was defined as 1 nmol of galacturonic acid released per mg protein during 1 hour.

3.3. RNA EXTRACTION AND NORTHERN BLOT ANALYSES

Total RNA was extracted from one g of freeze-dried peach tissue as described [9]. RNA blots were prepared and hybridized [II] and washed in 0.5 X SSC, 0.1% SDS at 60°C. Probes included peach cDNAs of polygalacturonase (PG) [7], pectin esterase (PE) and ACC synthase (ACS), and the tomato ACC oxidase (ACO) cDNA - generous gifts of Drs. D. R. Lester, J. Speirs, P. Tonutti, and D. Grierson, respectively.

3.4. PROTEIN EXTRACTION AND WESTERN BLOTTING

Protein was extracted from freeze dried tissue (0.5 g) by grinding in liquid N2,

extracting with Tris-buffered phenol and precipitating with ammonium acetate in methanol (6). The final pellet was suspended in Laemmli sample buffer and the protein

407

content was determined by the Bio-Rad microassay procedure. For Western blotting, equal amounts (15)lg) of protein were separated on a 12% SDS/acrylamide gel, transferred to a nitrocellulose filter and incubated with the primary antibody. Visualization of the antibody was by the alkaline phosphatase reaction. The antibodies for PG and PME were kindly supplied by Dr. J. Spiers (CSIRO, Adelaide, Australia).

4. Results

4.1. FRUIT QUALITY

Ethylene application to 'Hermosa' peaches during cold storage, at concentrations up to 100 )lu-1, did not induce any significant fruit softening during 6 weeks' storage (data not shown). The fruit from all treatments softened to eating ripeness after cold storage, within 5 days at 20°C, with the exception of untreated control fruit after 6 weeks' storage, which softened only to 50% of its initial value. This inhibition of softening indicated the woolly texture of the fruit flesh (2) and did not occur in any of the ethylene treated fruits. The onset of WB after storage was delayed by exposure to ethylene during storage (Table 1), but after 6 weeks' storage there were no significant differences in the visible incidence ofWB.

TABLE 1. The effect of ethylene during storage on the development of woolly breakdown (WB) during subsequent shelf-life at 20De.

Days in storage

29 41

o 1.60 b 3.60 a

Ethylene concentration (Ill.l-I) I 10

. 0.67 c 0.67 c 3.48 a 3.13 a

a-c numbers with different letters differ significantly at p~0.05

4.2. ENZYME ACTIVITY

100 0.90bc 3.39 a

PME activity in fruits from all treatments increased during cold storage, as previously shown [1], but decreased during shelf life (data not shown), except after the last removal from storage, without any significant differences between the treatments until the last shelf-life period (Table 2). At this time, PME activity continued to increase in the control fruit, whereas it remained at the same level as upon removal from storage, in fruit that had been exposed to ethylene.

There was very little PG activity in the fruit at harvest but it increased considerably during 5 days' shelf-life (Table 3). Even higher values of activity were attained during shelf-life after 21 days' storage at OCC, although there had been no measurable activity upon removal from storage. The first significant effect of ethylene on PG activity was observed after 29 days' cold storage. Upon removal from storage there was still no activity in control fruit, whereas it increased significantly in treated fruit with each increment in ethylene concentration. A low activity developed in control fruit during shelf-life, but in the ethylene-treated fruit it was 5 fold higher, reaching a level similar to that measured after harvest, irrespective of the level of ethylene applied during cold

408

storage. After 2 additional weeks in storage, PG activity upon removal from storage was undetectable for all treatments, except 100 Ill.l-l, but during shelf-life activity increased and, although levels were low, the enzyme was about 10 times more active in the ethylene-treated fruit than in the untreated control.

TABLE 2. The effect of ethylene application to Hermosa peaches during storage on the activity of pectin methylesterase (units x 10.3)

after 6 weeks at O·C and 5 days at 20·C.

Storage Shelf-life

o 0.67b 0.96 a

Ethylene concentration (~Jl.I.J) I 10

0.64 b 0.69 b 0.70 b 0.61 b

100 0.62b 0.81 ab

a-b numbers with different letters differ significantly at p:S0.05

4.3. EN.lYME CONTENT

The amount of PME protein did not appear to change significantly after harvest, whatever the storage temperature or ethylene content of the storage atmosphere (Fig. 1). PG protein, which was undetectable at harvest, accumulated during shelf-life and storage, but was also unaffected by ethylene treatments.

TABLE 3. The effect of applied ethylene during cold storage on PG activity (units per mg protein) in Hermosa peaches upon removal from O·C and following 5 days at 20·C.

41 5 26 34 o 0.12 0.00 0.00 d 1 0.00 0.13 c 10 0.00 0.18 b

100 O.oI 0.25 a N.S.

0.00 0.00 0.00 0.20 N.S.

5.39 8.09 6.95 7.79 7.18 N.S.

a-d numbers with different letters within a column differ significantly at p:S0.05. N.S no significant differences at. p:S0.05.

4.4. MESSENGER RNA

0.94 b 5.22 a 5.92 a 5.87 a

46 0.16 b 1.36 a 1.81 a 1.62 a

The mRNAs of the pectic enzymes behaved similarly in all treatments, but were differentially affected by storage and shelf-life (Fig. 2). The PME message tended to decrease as storage progressed, but accumulated somewhat during shelf-life relative to the storage level. The PG message was detected at harvest and throughout storage, but was always much stronger during shelf-life. Similarly, messages of both the genes involved in ethylene synthesis, ACC synthase and ACC oxidase, were unaffected by ethylene treatment, but were greatly enhanced during shelf-life.

409

Ethylene -++-

Ethylene + + + + 02 29d

Ii 41d

202 -5d - - 5d 5d - - 5d 5d

Figure 1. Western blots of PO and PME protein extracted from control fruits and from fruit treated with I f.l1.l-1 ethylene during storage at O°C and following subsequent shelf-life at 20°e.

5. Discussion

02

PG

PE

ACS

ACO

Figure 2. Changes in mRNA level of genes involved in cell wall degradation and ethylene biosynthesis following ethylene treatment during storage.

Although the peach is a climacteric fruit, it is considered relatively insensitive to exogenous ethylene application, in that even concentrations of 100-500 J..lLrl do not always accelerate the rate of ripening at 20°C [8]. Our data support this view with regard to fruit softening. Nonetheless, applied ethylene enhanced PG activity in fruit stored at ooe at a level as low as 1 J..lLrl. The fact that fruit softening during storage was unaffected by ethylene treatment, even though PG activity was enhanced, is in agreement with the suggestion that PG is not the sole enzyme involved in fruit softening [10]. The connection between PG activity and development of WB [1-3] is more difficult to support from these data. After 4 weeks' storage, WB development during shelf-life was significantly reduced by ethylene application at 1 and 10 J..lLrl, but not so at 100 J..ll.r1, where the enhancement of PG activity was greatest during storage. Moreover, after 6 weeks at oDe, when WB incidence was very high, no control was achieved due to ethylene treatment, even though PG activity in the treated fruit was still significantly higher than in the control. The negative results after 6 weeks' storage may be explained on the basis of the balance between PG and PME activities. Although PG activity was enhanced by ethylene treatment, it did not reach the postharvest levels measured in normally ripened fruit after harvest, whereas PME activity was significantly higher upon removal from storage than at harvest, and even increased during shelf-life. However, even if this explanation may appear to be in accordance with our equilibrium theory [2], it does not adequately support the data obtained for exposure to 100 J..ll.r1 ethylene after 4 weeks storage. It should be possible to clarify this point by applying ethylene to fruit stored in a controlled atmosphere with high CO2,

which has been shown to inhibit PME activity [3].

410

The increase in PG activity, induced by exposure to ethylene, was not a result of induced message or enhanced protein abundance. Moreover, the PG message, which was present in harvested fruit was not expressed at this time or during subsequent cold storage. These findings are possible indications of a preharvest inhibitory effect or suppression of the translation of the message, which is overcome during the ripening process and can be relieved by applying ethylene, even at oDe. The enhancing effect of ethylene on PG activity without concurrently affecting PME activity, supports the suggestion that ethylene may alleviate WB, without completely controlling it.

6. References

I. Ben-Arie, R and Sonego, L. (1980) Pectolytic enzyme activity involved in woolly breakdown of stored peaches, Phytochemistry 19, 2553-2555.

2. Ben-Arie, R, Sonego, L., Zeidman, M. and Lurie S. (1989) Cell wall changes in ripening peaches, in D.J. Osborne and M.B. Jackson (eds.), Cell Separation in Plants, NATO AS) series, vol H35, Springier-Verlag Berlin, pp. 253-262.

3. Ben-Arie, R., Sonego, L., Levin, A. and Lurie, S. (1993) Pectin metabolism in CA-stored nectarines, Proceedingsfrom the Sixth International Controlled Atmosphere Research Coriference, Cornell University, Ithaca New York, voL): II (Abstr.)

4. Bradford, M. (1976) A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72,248-254.

5. Dawson D.M., Melton L.D. and Watkins C.B. (1992) Cell wall changes in nectarines (Prunus persica): solubilization and depolymerization of pectic and neutral polymers during ripening and in mealy fruits, Plant Physiol. 100, 1203-1210.

6. Hurkrnan, W. J. and Tanaka, C. K. (1986) - Solubilization of plant membrane proteins for analysis by two-dimensional gel electrophoresis, Plant Physiol. 81, 802-806.

7. Lester D.R, Speirs J., Glenda O. and Brady, C.J. (1994) Peach (Prunus persica) endopolygalacturonase cDNA isolation and mRNA analysis in melting and non-melting peach cultivars, Plant Physiol. 105,225-231.

8. Lill RE., O'Donoghue E.M. and King lA. (1989) Postharvest physiology of peaches and nectarines, Hort. Review 11,413-452.

9. Lopez-Gomez R and Gomez-Lim M.A (1992) A method for extracting intact RNA from fruits rich in polysaccharides using ripe mango mesocarp, HortScience 27, 440-442.

10. Oeller P.W., Wong L.M., Taylor L.P., Pike D. and Theologis A. (1991) Reversible inhibition of tomato fruit senescence by antisense I-aminocyclopropane I-carboxylate synthase, Science 254, 437-439.

II. Sambrook J., Fritsch E.F. and Maniatis T. (1989) Molecular Cloning, Cold Spring Harbor Laboratory Press, CSH.

12. Theologis A., Oeller P.W., Wong L.M., Rottman W.H. and Gantz D.M. (1993) Use of a tomato mutant constructed with reverse genetics to study fruit ripening, a complex development process, Dev. Gen. 14,282-295.

13. Tonutti P., Bonghi C. and Ramina A. (1996) Fruit firmness and ethylene biosynthesis in three cultivars of peach (Prunuspersica L. Batsch), J Hor Sci. 71, 141-147.

ETHYLENE REMOVAL BY PEAT-SOIL AND BACTERIA: ASPECTS FOR APPLICATION IN HORTICULTURE

1. Abstract

L. ELSGAARD Department of Crop Physiology and Soil Science, Danish Institute of Agricultural Sciences, Foulum, DK-8830 Tjele, Denmark

The plant hormone ethylene (C2H4) may cause an undesirable ripening and senescence of horticultural produce when it accumulates in transport or storage facilities. Therefore, the use of biological catalysts for ethylene removal has recently been tested. It has been found that growing media for potted plants (peat-soil) may consume ethylene, but only after an initial adaptation period. The present data show that the soil water content (2.4 to 4.7 mL g.l dry wt soil) only plays a minor role for this characteristic. Ethylene consumption in peat-soil can be enhanced, however, by plant growth or the addition of ethylene-oxidizing bacteria. In experiments with Begonia elatior 'Nielson' the effect of such ethylene consumption has been tested during conditions of transport simulation (i.e., ethylene exposure in darkness). Although an enhanced ethylene removal was demonstrated, no effects on the plant quality occurred. Thus, the ethylene consumption was insufficient to reduce the ethylene concentration (1 ppm) to levels near the threshold limit for the action of ethylene as a plant hormone (ca. 0.01 ppm). While the consumption of ethylene may be insufficient when a passive scrubber system is applied, the removal of ethylene to extremely low levels is possible by application of a biofilter with ethylene-oxidizing bacteria. By use of a peat-soil biofilter with the bacterial strain RD-4, it was possible to remove ethylene from 2 and 117 ppm to levels as low as 0.017 ppm. These results, as well as results from other biofilters, demonstrate the potential for biological removal of ethylene during storage and transport of horticultural produce.

2. Introduction

Accumulation of the plant hOimone ethylene may occur during storage of fruits, vegetables and flowers in closed facilities due to endogenous production by the plant material [1,22]. To prevent the physiological effect of such ethylene on horticultural produce (e.g., ripening, abscission and senescence), various procedures have been applied, for example spraying with silver thiosulfate [5, 6], or use of gaseous ethylene antagonists, such as 1-methylcyclopropene [28], nitrous oxide [18], or carbon dioxide [30]. Also, it is common practice in many storage facilities and transport containers to

411

412

reduce the ethylene concentrations by use of ventilation systems [23, 26]. The use of ventilation may be unsuitable, however, if the temperature or chemical composition of the open air is different from the atmosphere required for the storage purpose. Concequently, chemical ethylene scrubbers (ethylene removing devices) are widely used in storage facilities for horticultural produce [23, 26, 29]. A drawback of such scrubbers are the cost of operation and the need for replenishment of the ethylene removing agents [1, 11, 29]. Therefore, the use of biological catalysts for ethylene removal is an interesting alternative [20,29].

Peat-soil, which is an important medium for plant growth in horticulture [27], has previously been shown to have a potential for microbial consumption of ethylene - at least after an adaptation period of several days [12]. Given the sufficiently high ethylene consumption in the soil of potted plants, this process itself could have the potential to reduce the ethylene concentration during storage and transport of potted plants. Notably, for plant-damaging ethylene produced in the soil environment [2, 16], a beneficial effect of stimulated ethylene consumption in the plant soil could be envisaged. However, as a more direct approach of ethylene removal, a biofilter based on ethylene-consuming peat-soil could be applied in horticultural storage facilities provided that the efficiency of ethylene removal was adequate and stable. The use of ethylene-oxidizing bacteria (e.g., Mycobacterium E3) in biofilters has been reported [7, 8, 9, 13, 32, 33], but only a few studies have demonstrated a removal of ethylene to levels near the threshold limit for the plant hormonal response.

In order to improve the ethylene consumption in horticultural peat-soil, an ethylene­oxidizing bacterium (strain RD-4) was recently isolated and applied to the soil as a concentrated bacterial suspension [13, IS]. This bioaugmentation was performed for the pot-soil of Begonia and a peat-soil biofilter. The Begonia were subjected to transport simulation in the presence of ethylene, while the biofilter was operated as an ethylene waste gas purification system. Here the results of these recent studies [13, IS] are surveyed and discussed with respect to their relevance for horticulture. In addition, new data are presented, which demonstrate the characteristics of microbial ethylene consumption in peat-soil under different soil water conditions that may occur during the cultivation of potted plants.

3. Ethylene Removal in Peat-soil

Fresh horticultural peat-soil that is incubated with ethylene has been shown to develop a microbial capacity for ethylene removal [12]. In samples of peat-soil from potted plants, this ethylene consumption was even more pronounced [14], probably as a result of microbial stimulation during plant cultivation (cf. [25]). Also, microbial ethy lene consumption has been observed in other growing media [31].

One of the factors that affects microbial activity, and which may vary during the cultivation of potted plants, is the soil water content [19, 24]. To assess the importance of this factor on the microbial ethylene consumption, a time course experiment was made with horticultural peat-soil (Sphagnum Blend 2, Pindstrup, Denmark). Peat-soil (16 g fresh wt; ca. 7 g dry wt), representing a volume of ca. 60 mL, was mixed with distilled water (8, 16 and 24 mL) and incubated at 200 e in 120-mL bottles closed by

413

butyl rubber stoppers. Ethylene was added to headspace concentrations of ca. 70 ppm, and ethylene depletion in triplicate incubations was followed by GC analysis [15] of withdrawn gas samples (0.6 mL).

80

E 60 c.. S Q) 40 c Q)

>. .s:: ill 20

0'--"'--_...J.-_--'-...... --'--4111-'

o 6 12 18 24 30

Time (days)

Figure 1. Time course of ethylene removal in fresh peat-soil with water contents of (II) 2.4, ( .... ) 3.6 or (e) 4.7 mL per g dry wtsoil.

TABLE 1. Adaptation period and ethylene consumption rate in peat-soil with different water contents. Data are mean ± standard deviation of three time course experiments. Means followed by different letters (in parentheses) are significantly different at p=O.OS (Tukey test [3S]).

Water content Adaptation period Consumption rate (mL.gol dry wt soil) (days) (ppm dayOI)

2.4 18.3 ± 0.4 (a) 8.S ± 0.9 (b)

3.6 14.2 ± 0.6 (b) 11.1 ± 1.1 (a)

4.7 19.0 ± 1.1 (a) 9.8 ± 0.3 (a,b)

"Defined as the time when 10% of the added ethylene was consumed. ~stimated by linear regression of data following the adaptation period.

Consumption of ethylene commenced after an adaptation period of more than 14 days (Fig. 1). It was found that the intermediate water content of3.6 mL.go! dry wt soil (equivalent to ca. 40% of the total soil volume) resulted in a shorter adaptation period and a higher resulting rate of ethylene consumption than the water contents of 2.4 and 4.7 mL.go! dry wt soil (Table 1). However, although the effects of different water contents were statistically significant, the results deviated by no more than a factor of

414

1.3. It was concluded, therefore, that the water contents usually recommended for potted plants [24] proved to be suitable for microbial ethylene consumption.

The present data illustrate the long adaptation periods that are generally found for ethylene consumption in fresh peat-soil [12]. In contrast, ethylene consumption in peat­soil from potted Begonia [14, IS] and Hibiscus (unpublished data), occurs after a short (less than 2 days) adaptation period. Hence, the precedent plant growth may result in a stimulation of the ethylene-consuming soil microorganisms, which largely exceeds the effects of different soil water conditions in the peat-soil. It is likely that the plant soil has a higher activity of ethylene-oxidizing microorganisms in response to previous exposure to ethylene liberated by plant roots or by heterotrophic microorganisms stimulated by the rhizosphere environment [3, 4]. Yet, although stimulation of ethylene consumption may occur during plant cultivation, it has been found that bioaugmentation with ethylene-oxidizing bacteria may further stimulate and improve the ethylene removal in peat-soil from potted plants [14, 15].

4. Ethylene Removal during Transport Simulation

Transport simulation of potted plants is used to assess the ethylene sensitivity of various plant species [21, 34]. However, with a sufficient (stimulated) capacity of ethylene consumption, the plant soil of the tested plants could contribute to a reduction in the applied ethylene level during transport simulation. This hypothesis was tested by Elsgaard and Andersen [15]. Briefly, the pot soil of 12 Begonia (from a commercial grower) were watered (inoculated) with a 25-mL suspension of ethylene-oxidizing bacteria (strain RD-4) while 12 other plants were watered with 25 mL of tap water (uninoculated plants). Transport simulation (4 days) actuated for 4 boxes (410 L) with either 6 inoculated or 6 uninoculated Begonia. The boxes were exposed to airflow with I ppm ethylene (ca. 164 L.h-') and gas samples (1 mL) for ethylene analysis were collected at the inlet and the outlet of each box. After 4 days of transport simulation, significant ethylene consumption (8 to 11%) occurred in the boxes with inoculated plants, but also in one box with uninoculated plants (9%). In the other box with uninoculated plants the ethylene consumption was not significant (3%). The average ethylene consumption in boxes with inoculated plants was ca. 16.4 ilL C2f4.h-' while it was ca. 9.8 ilL C2f4.h-' in boxes with uninoculated plants. Thus, the overall tendency was that the bacterial inoculation gave the plant soil a higher capacity of ethylene removal as would indeed be expected. However, the keeping quality of the Begonia was generally not affected by the enhanced capacity of ethylene removal [IS]. In comparison, it has been reported that Begonia are sensitive to ethylene exposure with quality loss occurring after treatment with only 0.05 ppm ethylene for 3 days [21]. One reason for the insufficiency of the ethylene removal was the constantly high flow rate (164 L.h-'), which prevented an accumulative effect of the microbial ethylene consumption. Thus, if the transport simulation had been performed under conditions with a non-renewed ethylene atmosphere [17, 34], the ethylene consumption might have resulted in a significantly lower ethylene concentration with possible impact on the plant quality.

415

S. Ethylene Removal by Biofilters

Gas removal by biological filters has been reported for several air pollutants including ethylene [7, 8, 9, 10, 13, 17, 32, 33]. The data in Table 2 illustrate the various outlet concentrations of ethylene that have been reported for a given inlet concentration in different filters. It should be stressed, however, that a direct comparison of the performance of different filters is difficult, or even impossible, unless they have been operated under exactly the same conditions (i.e., inlet concentration and volume-to-flow ratio).

TABLE 2. Characteristics of different filters for biological ethylene removal.

Ref. Carrier Bacteria InletC,H, Outlet C,H, Stability" (ppm) (ppm)

[33] Lava Mycobact. E3 3.2 0.06b Not stable

[33] Perlite Mycobact. E3 3.2 0.27b Not stable

[32] Compost Mycobact. E3 2 0.27c Stable

[8] PUP! Mycobact. E3 122 91.5" No data

[7] GACf Mycobact. E3 127 19.2& Stable

[13] Peat-soil Strain RD-4 2.05 0.02 Stable

[13] Peat·soil Strain RD-4 117 <0.04 Stable

"Defined as a stable outlet concentration for more than ca. 5 days bRead from Fig. 3 in [33] cRead from Fig. 2 in [32] dPolyurethane foam cCalculated from the cited removal efficiency of25% [8] fGranular activated carbon &Calculated from the cited removal efficiency of 84.9% [7]

As shown in Table 2, the lowest stable outlet concentrations [13,33] are close to the threshold limit for the action of ethylene as a plant hormone (ca. 0.01 ppm). In the study of Elsgaard [13], a biofilter was packed (687 cm3) with inoculated peat-soil, prepared by mixing 300 g of peat-soil with 200 mL of distilled water and 100 mL of bacterial cell suspension (strain RD-4). Ethylene (2.05 ppm) in humid air was applied to the biofilter at a rate of 73 mL min-I. After operating for 1 h, the biofilter outlet concentration was 0.23 ppm. This corresponded to a removal efficiency of 89%. During 16 days of operation (21°C), the capacity of ethylene removal gradually improved and increased to 99% of the incoming concentration. Thus, at the end of the experiment the biofilter had a stable performance with an outlet concentration of only 0.017 to 0.020 ppm ethylene. When the inlet ethylene level was increased to 117 ppm, the ethylene concentration at the outlet of the biofilter was below 0.04 ppm after 4 days of operation. Thus, more than 99.9% of the incoming ethylene was removed by the biofilter and this performance was stable during operation for more than 75 days. When the biofilter (operated with 117 ppm ethylene) was transferred from 21 to lOoC, the

416

outlet ethylene concentration increased from <0.04 ppm to 46.6 ppm. However, after 2 days of operation at 10°C, the outlet concentration started to decrease and after 18 days the outlet concentration was 1.6 ppm ethylene, which was equivalent to a removal efficiency of 98.6% [13]. This indicated that a proliferation of the ethylene-oxidizing bacteria still occurred at 10°C. This observation was encouraging for the practical use of the isolated bacteria as ethylene scrubbers during storage of horticultural produce, which is often kept at temperatures below 10°C. However, a more detailed study of the temperature response of the strain RD-4 should be performed before this suitability can be properly evaluated.

No experiments have been reported, so far, where the performance of ethylene removing biofilters has been tested under in situ conditions during storage and transport of horticultural produce. However, given the potential and qualified performance of various biofilters (Table 2) such experiments should be encouraged.

6. Conclusions

Ethylene can be consumed by peat-soil for horticultural practice. Plant growth in the peat-soil, or the addition of ethylene-oxidizing bacteria, may enhance this capacity. Yet, it is not clear whether such ethylene removal may have a beneficial effect on potted plants in terms of maintaining low ethylene levels in the atmosphere or soil-air. By use of biofilters with ethylene-oxidizing bacteria, ethylene can be removed to very low levels (near 0.01 ppm). Experiments designed to test the use of such biofilters ill

storage facilities for horticultural produce are lacking, and should be encouraged.

7. References

I. Abeles, F.B., Morgan, P.W. and Saltweit, M.E. (1992) Ethylene in Plant Biology, 2nd ed., Academic Press, San Diego.

2. Arshad, M. and Frankenberger, W.T. (1988) Influence of ethylene produced by soil microorganisms on etiolated pea seedlings, Appl. Environ. Microbial. 54, 2728-2732.

3. Arshad, M. and Frankenberger, W.T. (1991) Microbial production of plant hormones, Plant Soil 133, 1-8.

4. Arshad, M. and Frankenberger, W. T. (1998) Plant growth-regulating substances in the rhizosphere: microbial production and functions, Adv. Agron. 62, 45-151.

5. Cameron, AC. and Reid, M.S. (1981) The use of silver thiosulfate anionic complex as a foliar spray to prevent flower abscission ofzygocactus, HortScience 16, 761-762.

6. Cameron, AC. and Reid, M.S. (1983) Use of silver thiosulfate to prevent flower abscission from potted plants, Scientia Hortic. 19,373-378.

7. De Heyder, B., Overmeire, A, Van Langenhove, H. and Verstraete, W. (1994) Ethene removal from a synthetic waste gas using a dry biobed, Biotechn. Bioengin. 44, 642-648.

8. De Heyder, B., Smet, E., Verstraete, W. and Van Langenhove, H. (1992) Biotechnological removal of ethene from waste gases, in AJ. Dragt and 1. Van Ham (eds.), Biotechniques for Air Pollution Abatement and Odour Control PoliCies, Elsevier, Amsterdam, pp. 309-313.

9. De Heyder, B., Van Elst, T., Van Langenhove, H. and Verstraete, W. (1997) Enhancement of ethene removal from waste gas by stimulating nitrification, Biodegradation 8, 21-30.

10. Dragt, A J. and Van Ham, J., (eds.) (1992) Biotechniquesfor Air Pollution Abatement and Odour Control Policies, Elsevier, Amsterdam.

11. EI Blindi, A, Rigal, L., Malmary, G., Molinier, J. and Torres, L. (1993) Ethylene removal for long term conservation of fruits and vegetables, Food Quality and Preference 4, 119-126.

417

12. E1sgaard, L. (1996) Ethylene degradation in peat-soil for horticultural practice, Abstracts of the NATO Advanced Research Workshop on Biology and Biotechnology of the Plant Hormone Ethylene, Chania, Greece, p. 97.

13. Elsgaard, L. (1998) Ethylene removal by a biofilter with immobilized bacteria, Appl. Environ. Microbiol. (in press).

14. Elsgaard, L. and Andersen, L. (1997) Microbial ethylene removal in peat-based growing media and its relevance for horticultural practice, in G. Schmilewski (ed.), Peat in Horticulture -Its Use and Sustainability, International Peat Society, Jyska, Finland, pp. 36-38.

15. Elsgaard, L. and Andersen, L. (1998) Microbial ethylene consumption in peat-soil during ethylene exposure of Begonia elatior, Plant and Soil (in press).

16. Frankenberger, W.T. and Arshad, M. (1995) Phytohormones in Soils - Microbial Production and Function, Marcel Dekker, New York.

17. Frye, R.F., Welsh, D., Berry, T.M., Stevenson, B.A. and McCallum, T. (1992) Removal of contaminant organic gases from air in closed systems by soil, Soil BioI. Biochem. 24,607-612.

18. Gouble, B., Fath, D. and Soudain, P. (1995) Nitrous oxide inhibition of ethylene production in ripening and senescing climacteric fruits, Postharvest Bioi. Technol. 5,311-321.

19. Griffin, D.M. (1981) Water and microbial stress, Adv. Microb. Ecol. 5,91-136. 20. Harttnans, S., de Bont, JAM. and Harder, W. (1989) Microbial metabolism of short-chain

unsaturated hydrocarbons, FEMS Microbiol. Rev. 63, 235-264. 21. Heyer, L. (1985) Bud and flower drop in Begonia elatior 'sirene' caused by ethylene and darkness,

Acta Hortic. 167,387-391. 22. Heyer, L. (1995) Investigations of the ethylene build-up during transport of pot plants in controlled

temperature trucks, Postharvest BioI. Technol. 5, 101-108. 23. Knee, M., Proctor, FJ. and Dover, CJ. (1985) The technology of ethylene control: use and removal

in post-harvest handling of horticultural commodities, Ann. Appl. BioI. 107,581-595. 24. Maller, L. (1993) Sphagnum som dyrkningsmedium, Gartner Tidende 3, 62-64 (in Danish). 25. Otani, T. and Ae, N. (1993) Ethylene and carbon dioxide concentrations of soils as influenced by

rhizosphere of crops under field and pot conditions, Plant and Soil 150, 255-262. 26. Rudolphij, lW. and Boerrigter, H.A.M. (1981) Scrubbers voor ethyleen, Bedrijfsontwikkeling 12,

307-312 (in Dutch). 27. Schmilewski, G.K. (1996) Horticultural use of peat, in E. Lappalainen (ed.), Global Peat Resources,

International Peat Society, Jyska, Finland, pp. 327-334. 28. Serek, M., Sisler, E.C. and Reid, M.S. (1994) Novel gaseous ethylene binding inhibitor prevents

ethylene effects in potted flowering plants, J. Amer. Soc. Hort. Sci. 119,1230-1233. 29. Sherman, M. (1985) Control of ethylene in the postharvest environment, HortScience 20, 57-60. 30. Sisler, E.C. and Wood, C. (1988) Interaction of ethylene and CO2, Physiol. Plant. 73,440-444. 31. Turner, M.A., Reed, D.W. and Morgan, D.L. (1988) Ethylene-induced defoliation in Ficus species

and ethylene depletion by soil bacteria in peat-amended media and in vitro, J. Amer. Soc. Hort. Sci. 113, 794-796.

32. Van Ginkel, C.G., Welten, H.GJ. and de Bont, J.A.M. (1987) Growth and stability of ethene­utilizing bacteria on compost at very low substrate concentrations, FEMS Microbiol. Ecol. 45, 65-69.

33. Van Ginkel, C.G., Welten, H.GJ., de Bont, lA.M. and Boerrigter, H.A.M. (1986) Removal of ethene to very low concentrations by immobilized Mycobacterium E3, J. Chem. Tech. Biotechnol. 36, 593-598.

34. Woltering, EJ. (1987) Effects of ethylene on ornamental pot plants: a classification, Scientia Hortic. 31,283-294.

35. Zar, J.H. (1996) Biostatistical Analysis, 3rd edn., Prentice-Hall, Upper Saddle River, New Jersey.

ETHYLENE DEVELOPMENT IN DIFFERENT CLONES OF 'ANNURCA' APPLE AND ITS INFLUENCE ON THE BIOSYNTHESIS OF AROMA ESTERS AND ALCOHOLS

R. LO SCALZO AND A. TESTON I /. V. TP.A. via G. Venezian, 26-20133 Milano, Italy

1. Abstract

'Annurca' (Malus domestica Borkh) is an apple cv commonly cultivated in Southern Italy. Its aroma composition is characteristic and completely different from other apple's cv. The I.S.F. (Experimental Institute of Fruit Growing) in Rome, Italy, has selected several clones of this cv, in order to attenuate the agronomical 'Annurca' defects. We studied the headspace composition (ethylene, esters and alcohols) of intact, unreddened fruits just after harvest and after storage in air or in controlled atmosphere. Relationships between ethylene amount in the headspace and esters or alcohols production were evaluated in order to determine the optimum of storability for every clone and the best aroma retention.

2. Introduction

In the cultivars panorama of Southern Italy the cv 'ANNURCA' apple represents a very important part, known since ancient Romans times. Today it is the most commonly grown cultivar in Campania region. It accounts for 95% of Southern Italy and 3-4% of the national apple production [I].

Just after harvest, the fruits are treated with a special system to obtain their reddening. The apples are placed on the soil protected only by straw and are daily wet. This means that the fruits mantain a high quality if they are kept at room temperature after harvest.

Given the cultivar's importance to Campania's economy, the 'Experimental Institute of Fruit Growing' at Ciampino, Rome initiated in 1970 a research programme aimed at attenuating ANNURCA's defects. These efforts have included studies of various aspects of its biology, breeding and storage [2,3,4].

This cultivar has also been proposed to the European Council for the "Protected Geographical Indication" (PGI), an European project related to the preservation of local and characteristic agriculture commodities [5].

Nowadays, great importance is given to the study on aroma composition of fruits and vegetables for determining the relationship to the ripening, frequently associated

419

420

with the increase in ethylene and other physiological factors (e.g. CO2 production) [6, 7].

The present study reports the results of a research on the volatile compounds emitted by 3 different clones of this fruit, before the reddening treatment, during its ripening period of 26 days at 20°C after harvest and 9 days after storage in air (NA) or in controlled atmosphere (CA). These studies were based on static headspace sampling of intact fruits for ethylene and dynamic headspace sampling of the same apples for other volatiles [8].

3. Experimental

3.1. PREPARATION OF HEADSPACE SAMPLES

'ANNURCA' apple fruit were harvested at commercial maturity (Table 1) from trees in a research orchard (Experimental Institute of Fruit Growing) in Rome, Italy on 15 October 1996. Nine different clones of this cv were studied, here 3 clones have been considered: one commonly cultivated called 'Standard', the second called 'Bella del Sud' [4], and the third called 'Clone 7'. Fruits were transported to the laboratory, conditioned 24 hr at 20°C and the collection of headspace samples was started the following day, and continued at 5, 7, 9, 12, 15, 19, 22 and 26 days at 20°C. Two aliquots of apples were stored respectively in air at 1°C (NA) for 6 months and in controlled atmosphere at 1°C (2.0% O2, 1.2% CO2) (CA) for 7 months. After the storage the fruits were conditioned at 20°C 24 hr immediately followed by the collection of heads pace samples, continued at 5, 7 and 9 days at 20°C.

TABLE 1. Soluble solids, fruit colour, titratable acidity and firmness of "Annurca" apples harvested 10 October 1996*

Standard Bella del Sud Clone 7 Soluble solids (%) 12.41 ± 0.88 12.41 ± 1.04 14.36 ± 1.32 Colour (CrE) L 73.54± 2.23 72.25 ± 2.95 71.38 ± 3.59

a* -11.05 ± 4.l1 -7.85 ± 5.24 -4.51 ± 5.86 b* +36.04 ± 1.88 +35.26±3.12 +38.53 ±3.11

Titratable acidity (meq/100g) 13.88 ± 1.14 14.35 ± 1.76 14.59 ± 1.74 Firmness (Newton) 96.30 ± 9.02 93.46 ± 9.02 100.71 ± 10.00 * Values represent averages of 20 individual fruits

Glass jars (5 1) were used for sample collection (about 1 kg ea), the jars were fitted with teflon lids having 2 gas ports.

For the ethylene analysis, a 5 ml sample of headspace was drawn with a gas-tight syringe directly from the glass jar kept close for 1 hr and then assayed by GC-FID (see GC-FID for ethylene).

Each dynamic headspace sampling was conducted for a time of 1 hr at a flow of purified air of 600 ml min-I. Volatile compounds were collected onto 150 mg of 20-40 mesh activated coconut charcoal cartridges packed in a glass tube (0.6 cm i.d. X 7 cm) attached at the outlet port on the jar lid. Headspace components were subsequently desorbed from a trap using 500 f..ll of CH2Cl2 in 3 ml vials teflon-fitted, shaken for 40

421

min at room temperature, and then decanted at O°e. For the aroma developing each CH2CIz extract was directly introduced in a GC-FID system (see GC-FID for volatiles).

3.2. GC-FID FOR ETHYLENE

The gas samples from the headspace of the fruits were assayed by a gas chromatograph (DANI, model 3800) equipped with a 1.5 ml loop injection valve, a 2 m stainless steel Alumina FI (80-100 mesh) column held at 100°C,and a FID detector at 250°C. Data were expressed as ppm kg-Ihr-I, normalized per unit time due to collection of the static headspace.

3.3. GC-FID FOR VOLATILES

Headspace components were separated using a 30 m X 0.53 mm Carbowax 20M (1.00 11m film thickness) wide-bore column and temp. programmed as follows: 500 for 5 min, increased to 2000 at 30 min-I and then at 2000 for 5 min; the injection port was equipped with a PTV apparatus, programmed at 50° for 0.5 min, increased at 240° at 2700 min-1

and then kept at 240° for 15 min; the FID was at 250°; carrier gas was He at 3 ml min· l. The injection vol. was 4 III at a split ratio 1: 15. The identification of compounds was based both on the comparison of relative retention times with those of authentic standards and with data from GC-MS analyses, not reported here. The estimates of concentrations of the headspace compounds were made using response factors determined from authentic standards combined with fruit weight and air flow rate through the sampling jars. Concentrations are, therefore, expressed as amount per unit weight per unit time, i.e. ng kg-lh(l.

3.4. FRUIT COLOUR, SOLUBLE SOLIDS, ACIDITY, FIRMNESS MEASUREMENTS

'ANNURCA' skin colour and soluble solids was measured using a Minolta CR300 Chroma Meter with CIE L a* b* system. Soluble solids were evaluated with a BS RFM81 refractometer. Acidity was evaluated with a Metrohm 682 titroprocessor. Firmness was measured by an Universal Instron Testing Machine, probe 11 mm diameter, crosshead speed 200 mm min-I, and it was expressed as Newton.

4. Results

Apples were harvested at an acceptable maturity for commercial use (Table I). All the clones present high firmness, more marked in 'Clone 7', probably due to a lower ethylene biosynthesis. 'Bella del Sud' shows a better percentage of red surface at harvest, confirmed by an higher ethylene production and a lower firmness.

At harvest, the three clones present strong differences in ethylene and total aroma production (Fig. 1). 'Bella del Sud' has a higher ethylene production with a maximum after 9 days, followed by a decrease. 'Standard' clone produces less ethylene during all the ripening, with the maximum at the same time and reaching the value of 'Bella del

422

Sud' only at 26 days. 'Clone 7' ethylene biosynthesis has exactly the same changes, with a general diminution. The qualitative composition of aroma volatiles (Table 2) was similar to that found in other studies, except for 8-octalactone, never found in apples [9, IOl.

In Table 2 the volatile production of 'ANNURCA' apple is shown: 16 compounds were identified and quantified.

TABLE 2. Volatiles from 'Annurca' headspace

Ret. time 5,148 7,000 8,512 9,148 11,935 12,633 14,458 16,458 17,562 18,578 21,033 21,847 23,310 29,552 31,102 38,058

Compound Ethyl butanoate

Ethyl 2-methylbutanoate Butyl propionate

Butanol* Pentanol*

Ethyl hexanoate Hexyl acetate

Pentyl butanoate Hexyl propionate

Hexanol* Hexyl butanoate* Ethyl octanoate

Hexyl isovalerate Hexyl hexanoate* Octyl butanoate B-Octalactone

* Compounds present in relevant quantity

The compounds were mainly alcohols and esters. Among the esters, the butanoates, characteristic of red-skinned apples [II], the acetates and the ethyl esters have been considered for the study of change during ripening in relation to ethylene production.

-------------.-------------- -'I CHz·~ amount In headlpllC8 after harvest I 1000 Total aromas In headspaoe after harvest

80 /_ -+-standa,d::J _~ ~ . ~--~ :::~:e~SUd\ 800

;#=50 . -.c600 ~40 -:r 400 !: r 200

w 1

1_ ._O_-I-~-.~~_-.-._~10-_~-ys-_~~:3l"-._-C~.~-.-.-_~22_-_~26_ L _ ~_~ _____ ~O~~~~~B._: __ ~.J Figure 1. Ethylene and total aroma production at harvest.

Changes found in total aroma production of fruit from the different clones followed a pattern similar to that of ethylene production;, 'Bella del Sud' gives an earlier total aroma peak at 7 days respect to that of ethylene. 'Clone 7' presents an higher quantity of volatiles than we expected by the ethylene production, very high at 2 days, reaching the maximum at 9 days of ripening, with volatile amounts close to 'Bella del Sud', higher than 'Standard'. The difference in total aroma between 'Standard' and 'Bella del Sud' reflects the different ethylene production (Fig. 2).

423

After storage, the production of ethylene and volatiles has been considered only for 9 days of ripening at 20°C. For NA, the ethylene production shows the peaks for 'Standard' and 'Bella del Sud' at 7 days. In CA the peaks are at 5 days for all the clones (Fig. 2).

80 CHz=CH2 development after NA 80

80 80

1. 40 • ~ 20

i. , 40 II

i 201=----...---...--

o~ __ ~~~ __ ~~ __ -, 5 8

dlplt20'C 2 5 •

day •• t20·C

Figure 2. Ethylene production at harvest, NA an CA.

The 3 clones present an higher aroma amount in NA than at harvest, while in CA the aroma production is very depressed. In NA, for 'Clone 7' a marked decrease is noted (Fig. 3).

Total aromas In heads pace at harvest Total aromas In heads pace after ~ Total aromas In heads pace after CA 1800 -+-standard d] 1800~ 1800 , 1440 -r:J- BeY. del Sud , 1440 , 1440 1 -+-standerd 1 -lfr-Cone7 --0- 8aUa del Sud

t 1080 ~ 1080 .-.. ~ 1080 ......r-Oone7 ,0.. ..... :i 720 r-- 720 ,I:*"" standard dl -<I no

i!' 360 ~, i!' 360 -0- Bela del Sud i!' 360 .--=-.-... -~., ..• -6-00ne7

0 0 0

2 3 4 5 6 7 8 9 2 3 4 5 6 7 6 9 2 3 4 5 6 7 8 9

days at we days at2O"C days at we

Figure 3. Total aroma production at harvest, after NA and CA.

Alcohols, total esters and butanoates present changes close to total aroma. The acetates and ethyl esters are characterized by an increase in CA respect to harvest: this fact is probably due to the accumulation of their precursors during storage, Acetyl-CoA for acetates and ethanol for ethyl esters [12].

The acetates development present a peak at 7 days for 'Standard' and 'Bella del Sud' at harvest; 'Clone 7' has the lower production, reflecting the difference in ethylene biosynthesis. After NA and CA a general decrease is noted for 'Clone 7'. 'Bella del Sud' shows a maximum at 7 days in NA and CA (Fig. 4).

Acetates at harvest

~ 30 1 __ Standard II .c 24 -{}- Bella del Sud ~ 18 --<>- COna 7 !:12 ~

go ~ -- ~ 23456789

days at2O'C

Acetates after NA I--+- standard j 1 -{}- Bella del Sud -I!r-Cone 7

~~ ~ - ---------., #' 18 ,.....:::.::-:::::::~~=60=_~ ~ 12 ,.---- ~ .. 6 C O~T-T-T-______ ~

234567 8 9

days at 20'C

Figure 4. Acetates at harvest, NA and CA.

Acetates after CA I--+- standard i I -0-- Bela del Sud I

~~ ~ b --<>-COne 7 f 18

~ 1~ = :cP---n 0, ,== 23456789

days at 20'C

424

The ethyl esters quantities present a general increase, except for 'Clone 7' in NA, which shows a constant rate of production. In CA there is a minimum at 5 days for all the clones, corresponding to ethylene maximum, with a peak for 'Bella del Sud' at 7 days (Fig. 5).

Ethyl esters at harvest Ethyl e ste rs a fte r CA 120 120

96 1-96

-~ 1-.c 72

.c 72 .c 72 b. b. jt .. 48 48 .. 48 .. .. go c c

24 -0 24 24

0

2 3 4 5 6 7 8 9 2 3 4 5 6 7 8 9 2 3 4 5 6 7 8 9 days at 20G C days at 20'C days at 20·C

Figure 5. Ethyl esters after harvest, NA and CA.

5. Discussion and Conclusions

'ANNURCA' apple products a mixture of volatiles, responsible for its typical aroma, different from other apples' cv. Among the identified compounds, the o-octalactone, unusual for apple, has been found.

'Bella del Sud' presents an higher production of ethylene than 'Standard, while in 'Clone 7' it is lower. The CA makes the peak of ethylene production earlier than NA, mantaining the quantitative differences among the clones. The lower ethyl esters production after CA corresponds to the ethylene peak.

Comparing all the clones, in 'Clone 7' different ethylene levels don't seem to affect the volatiles biosynthesis, except for the acetates at harvest. This clone is noted also for its strong decrease in total aroma after NA. The 'Clone 7', for its features of good storability and aroma production, has to be considered.

CA storage prolonges the fruits mantainment but, also in 'ANNURCA' clones, decreases the total aroma amount. Only acetates and ethyl esters are increased by CA storage respect to harvest. This fact is especially noted for 'Bella del Sud'.

6. References

1. Floris, M. (l997) Melo e Pero nella Frutticoltura Italiana ed Europea, Federchimica Agrofarma, Milano, p. 17.

2. Fideghelli, C., Monastra, F., Della Strada, G., Quarta, R. and Donini, B. (1977) Mutazioni indotte nelle varieta di melo Annurca, Riv. Ortoflorofrutticoltura Italiana 61 (6),360-367.

3. Lintas, C., Paoletti, F., Cappelloni, M., Gambelli, L., Monastra, F. and Ponziani, G. (1993) Agronomic, nutritional and texture evaluation of 'Annurca' apple clones, Adv. Hort. Sci. 7, 165-168.

4. Limongelli, F. and Testoni, A. (1984) Annurca Bella del Sud e Annurca Rossa del Sud, Atti IVTPA 7,139-149.

5. CEE rule nr. 2081/92, Europe Council of 14/0711992 - related to the Protected Geographical Indication (PGn and Protected Designation of Origin (PDO) of Agricultural Products (Gazzetta Ufficiale lialiana L208 24/0711992).

425

6. Mattheis, J.P., Fellman, J.K., Chen, P.M. and Patterson, M.E. (1991) Changes in headspace volatiles during physiological development of Bisbee Delicious apple fruit, 1. Agric. Food Chem. 39,1902-1906.

7. Song, J. and Bangertb, F. (1996) The effect of harvest date on aroma compound production from 'Golden Delicious' apple fruit and relationship to respiration and ethylene production, Postharv. Bioi. and Technol. 8, 259-269.

8. Mattheis, J.P., Buchanan, D.A., and Fellman, J.K. (1992) Identification of headspace volatile compounds from 'Bing' sweet cherry fruit, Phytochemistry 31,775-777.

9. Dimick, P.S. and Hoskin, J.C. (1983) Review of apple flavour - State of the art, CRC Crit. Rev. Food Sci. Nutr. 18,387-409.

10. Paillard, N.M.M. (1990) The flavour of apples, pears and quinces, in J.D. Morton and A.J. McCleod (eds.), Food Flavours. Part C: The Flavour of Fruits, Elsevier Science Publishers, Amsterdam, pp. 1-42.

11. Paillard, N.M. (1979) Biosynthese des produits volatiles de la pomme: formation des alcools et des esters a partir des acides gras, Phytochemistry 18, 1165-1171.

12. Forss, D.A. (1972) Odor and flavor compounds from lipids, in R.T. Holman (ed.), Progress in the Chemistry of Fats and other Lipids, vol. 13, Pergamon Press, New York, p. 181.

DOES INHmITION OF ACO ACTIVITY IN JAPANESE-TYPE PLUMS ACCOUNT FOR THE SUPPRESSION OF ETHYLENE PRODUCTION IN ATTACHED FRUIT BY THE TREE FACTOR AND THE SUPPRESSED CLIMACTERIC?

The Role of Ethylene in the Tree Factor and Suppressed Climacteric in Japanese-type Plums

W.B. McGLASSON, N. ABDI AND P. HOLFORD Centre for Horticulture and Plant Science, University of Western Sydney Hawkesbury, Locked Bag 1, Richmond NSW, Australia 2753

1. Introduction

Abdi et al. [1] reported that the ripening of attached fruit of some cultivars of Japanese­type plums is delayed compared to harvested fruit. This phenomenon has been reported in other species, notably apples, and is ascribed to the presence of an unknown 'tree factor'. Abdi et al. [1] also described two classes of plums: one class, represented by the cvv Gulfruby and Beauty, expresses a typical climacteric pattern of respiration and ethylene production, while the second class, represented by cvv Shiro and Rubyred, has a suppressed-climacteric phenotype. In this latter phenotype, levels of ethylene production are low compared to normal, climcateric types. To further elucidate the physiology of the tree factor and the suppressed-climacteric behaviour we treated fruit of defined maturity stages with I-methylcyclopropene (I-MCP), an inhibitor of ethylene action, and propylene [2]. Measurements of ethylene production and respiration were made within 24 h of harvest and on the 5 subsequent days storage at 20°C.

2. Results and Discussion

The strength of the tree factor in the cv Beauty is illustrated in Figure 1. The data show that fruit harvested at weekly intervals and ventilated with ethylene-free air had very low rates of ethylene production one day (Fig. tA) after harvest but production gradually increased during the next 5 days depending on the age of the fruit at harvest (Figs 1 B, C ,D). Fruit harvested 28 days after pit hardening (DAPH) did not produce detectable amounts of ethylene during the first 6 days after harvest. Fruit harvested 35 DAPH produced significant amounts of ethylene by day 6 and the rates were clearly higher than for fruit harvested 42 DAPH plus one day at 20°C. In turn, fruit harvested 42 DAPH produced considerably more ethylene by day 6 than fruit harvested 48 DAPH plus one day at 20°C. A comparison of ethylene levels between Figure lA and Figures

427

428

IB, C, D clearly demonstrates the release of the fruit from the influence of the tree factor. The tree factor is also strongly expressed in Rubyred, a cultivar that exhibits the suppressed climacteric phenotype [1].

I 28

H •

I 3S

"F 42

,. 49

80

1 2 10_

~ ~1~--dr9-r~~0~~3rI1~~~2--r-3T~-'--3r~~ ;: 70 C

" 60 U 50

40 30 20

Ig+-TI~-'I~-rI~~"F~~T~~T~ 36 37 38 39 40 41

80 70 60 D 50 40 30 20 10 O~~Lr~~~~~

43 44 4S 46 47 Days after Pit Hardening

48

Figure 1. Ethylene production by cv Beauty showing the "tree factor". A shows rates of ethylene production at 20°C one day after harvest for fruit harvested at 28, 35, 42 and 49 DAPH B, C and D show ethylene production from fruit harvested at 28, 35, 42 and 49 DAPH and ripened at 20°C on days 2-6 after harvest. The bars represent S.E. of the means (n=12). Adapted from Abdi et al. [I] with permission from Elsevier Science."

Abdi et al. [1, 2] showed that a continuous application of propylene advances the onset of the climacterics in ethylene production and respiration, and hastens skin colour changes in both Beauty and Rubyred, as expected of climacteric fruit. It is noteworthy that the peak rates of ethylene production in Rubyred were stimulated by propylene to rates similar to those seen in normal climacteric types. The application of I-MCP further highlighted differences in the physiology of the two classes of plums. In

429

Beauty, I-MCP delayed the climacterics and slowed skin colour changes: continuous application of propylene partly overcame this inhibition. In contrast, I-MCP eliminated the ethylene and respiratory climacterics in Rubyred and delayed colouring, while the addition of propylene restored these events and induced the fruit to ripen at about the same time as fruit ventilated in air. Ethylene production appears to be naturally low in suppressed-climacteric fruit and in I-MCP-treated fruit there may be too little endogenous ethylene production to initiate the climacteric. Another action of I-MCP that was observed in both classes of fruit was the elimination of the initial increase in respiration typically seen when propylene is applied to preclimacteric fruit. It is evident, therefore, that an ethylene receptor(s) is required for this response.

It is clear that the ability to produce ethylene is very low in plums with the suppressed-climacteric phenotype and that this affect continues even as the fruit enter the autocatalytic phase of ethylene production associated with ripening. However, ACC accumulated to similar concentrations in fruit of both Beauty and Rubyred [2] whilst on the tree. Therefore, we propose that inhibition of the conversion of ACC to ethylene is principally responsible for both the tree factor and the suppressed climacteric phenotype.

3. References

1. 1.Abdi, N., Holford, P., McGlasson, W.B. and Mizrahi, Y. (1997) Ripening behaviour and responses to propylene in four cultivars of Japanese type plums, Postharvest Bioi. Technol. 12,21-34.

2. Abdi, N., McGlasson, W.B., Holford, P., Williams, M. and Mizrahi, Y. (1998) Responses of climacteric and suppressed-climacteric plums to treatment with propylene and 1-methylcyclopropene, Postharvest Bioi. Technol. 14,29-39.

SOFTENING IN APPLES AND PEARS: A COMPARATIVE STUDY OF THE ROLE OF ETHYLENE AND SEVERAL CELL WALL DEGRADING ENZYMES

M.A. MOYA1, C. MOGGIA2, J. EYZAGUIRRE3 AND P. JOHN4

ILab. Fisiologia Vegetal, lnstituto de Biologia Vegetal y Biotecnologia, Universidadde Talca, Casilla 747, Talca, Chile, 2Lab. PostCosecha, Centro de Pomaceas, Facultad de Ciencias Agrarias, Universidad de Talca, Casilla 747, Talca, Chile, 3Lab. Bioquimica, Dpto. Ciencias Biologicas, Pontificia Univ. Cat61ica de Chile, Santiago, Chile, 4 Department of Agricultural Botany, School of Plant Sciences, The University of Reading, Reading RG6 6AS, UK

Apples and pears are climacteric fruit, which show a dramatic rise in ethylene production and respiration at the onset of ripening. Ethylene induces and coordinates many changes during the ripening of the fruit, including the development of colour and aroma, and improvements in flavour and texture [1].

Softening and textural changes are the most important factors that limit storage life of fruits. These changes could be partly explained by loss of turgor and degradation of starch, although many authors agree that modifications on the fruit cell wall are the major causes of softening [2]. Pears and apples soften at different rates and to varying extents: in general apples soften slowly while pears soften rapidly and with great intensity. This difference probably reflects the fact that several mechanisms operate during softening. In order to study the biochemical mechanism involved in the softening of these fruits, the activity of several cell wall degrading enzymes was followed during the softening of apples and pears.

Apples (cv. Braeburn, Royal Gala and Fuji) and pears (cv. Beurre Bosc and Packham's Triumph) were harvested from local orchards. Samples were collected weekly until harvest day, maturity indexes were measured (fruit firmness and ethylene production rate), and pulp tissue was frozen in liquid nitrogen and stored at -20°C. After one month of storage (O°C, 95% humidity), fruit was removed to room temperature (15/5 days for applesl pears), and sampled every 2 days.

Cell wall degrading enzymes were extracted by homogenizing frozen pulp tissue (10 g) in 20 ml of extraction buffer (0.1 M sodium citrate pH 4.6, 1M NaCl, 5 mM DTT, 13 mM EDTA and 1% (P/v) insoluble PVP) [3]. The homogenate was centrifuged at 25,000 g for 20 min. For PG assay, crude extract was previously desalted.

The activity of glycosidases (nmol pNPIh.ml) was measured using the respective p­nitrophenyl derivates (Sigma) prepared in 50 mM acetate buffer (pH 5). After incubation (30 min at 37°C) the p-nitrophenol liberated was measured at 405 nm. Polygalacturonase activity (flmol/h.ml) was assayed using polygalacturonic acid (Sigma) as a substrate (0.05%), and after incubation (30 min, 37°C, pH 5) the reduction power generated was estimated by using the dinitrosalicylic acid method [4].

Pears showed a dramatic reduction in fruit firmness during the postharvest period while climacteric ethylene is being produced. In cv. Packham's Triumph a clear increase in the activities of polygalacturonase, a and ~-galactosidase and a­mannosidase was observed while softening was taking place. In cv. Beurre Bosc the

431

432

activities of a- and J3-galactosidase, a-mannosidase and J3-glucosidase showed a general increase during softening. No activity was found for cellulase, xylanase, J3-mannosidase and a-glucosidase enzymes in apple or pear extracts.

The apple cultivars used in this study showed different levels of climacteric ethylene. Apple fruits showed a smaller reduction in fruit firmness than pears, and Royal Gala cuitivar, the one with the highest climacteric ethylene level, showed the most intensive reduction in fruit firmness. In Royal Gala apples an evident increase was found in J3-glucosidase and polygalacturonase activity during softening, while in Braeburn and Fuji no clear evidence for the participation of any cell wall degrading enzyme was observed. No activity for a-mannosidase was found in Royal Gala and Braeburn apples.

The results shown here indicate that different cell wall degrading enzymes are active during the softening of apples and pears, suggesting that different mechanisms are operating, and that ethylene is clearly inducing the softening of these fruits.

This work was supported by Fondecyt 1970586, and a travel fellowship from Fundaci6n Andes (M.A.Moya).

References 1. Abeles, F.B., Morgan, P.W. and Salveit, M.E. (1992) Ethylene in Plant Biology, Second Edition.

Academic Press, London, pp 414. 2. Tucker, G.A. and Grierson, D. (1987) Fruit Ripening, in The Biochemistry of Plants, Vol 12, Chapter

8, Academic Press, pp 265-318. 3. Lazan, H., Mohd, Z., Liang, K.S. and Lee, K.L. (1989) Polygalacturonase activity and variation in

ripening of papaya fruit with tissue depth and heat treatment, Physiol. Plant. 77,93-98. 4. Muran, S., Sakamoto, R. and Arai, M. (1988) Cellulases of Aspergillus niger, Methods in Enzymology,

160, 274-299.

PACKHAM'S TRIUMPH IOOT'----------r"100

3000

'0 2000

'000

,..-----------r "0

"l'OC 600

2no

DAYS

• 100

g ~ 75

Z

~ so Ii:

~ !!:

'l 0"

ROYAL GALA

,----------., 30000

l 10000

10000

r-----------r·OO

300

..-:>r------A 200

-----..'"

200

L--~~~ ___ _Jc

9

DAYS

DIFFERENTIAL EFFECTS OF LOW TEMPERATURE INHIBITION ON KIWIFRUIT RIPENING AND ETHYLENE PRODUCTION

1. Abstract

M.D.C. ANTUNES 1•5, I. PATERAKf, P. VERVERIDIS3, A.K. KANELLIS,2,4 AND E. SFAKIOTAKIS5

1 Universidade do Algarve, u.c. TA., Campus de Gambelas, 8000 FARO­PORTUGAL; 2Institute of Viticulture and Vegetable Crops, National Agriculture Research Foundation, PO Box 1841, GR-711 10 Heraklion, Crete, Greece; 3Technological Education Institute, School of Agricultural Technology, Dept. of Plant Sciences, PO Box 140, GR-711 10 Heraklion, Crete, Greece; 4Dept. of Pharmaceutical Sciences, Aristotle University of Thessaloniki, GR-540 06 Thessaloniki, Greece; 5 Laboratory of Pomology, School of Agriculture, Aristotle University of Thessaloniki, GR 540 06 Thessaloniki, Greece

Our previous studies [7] have shown that there is an inhibition of propylene-induced ethylene production in kiwifruit below a critical temperature range of 11-14.8°C. The aim of this research was to identify the biochemical basis of inhibition of the propylene­induced ethylene production in kiwifruit, below the above mentioned critical temperature range. "Hayward" kiwifruit were treated with l301-tl/l propylene or air free of propylene and ethylene at lOoC and 20°C. Ethylene production as well as ACC synthase and ACC oxidase activities were measured during a period of 312 hours. Changes in soluble solid content (SSC) and flesh firmness were also monitored during the same time-course period. RNA blot hybridisations using specific probes for ACC synthase and ACC oxidase were performed with total RNA from untreated fruit as well as from those that had received 192 hours of propylene treatment, at 10°C and 20°C. We propose that the main reasons for the inhibition of the propylene-induced (autocatalytic) ethylene production in kiwifruit at low temperature «11°C) are: a) primarily the inhibition of the expression of the propylene-induced ACC synthase gene and b) the possible post-transcriptional modification(s) of ACC oxidase, since expression of the propylene-induced ACC oxidase gene existed at the low temperature storage.

2. Introduction

Most of the factors influencing ethylene production, act primarily by enhancing endogenous levels of ACC via de novo synthesis of ACC synthase [I]. In kiwifruit, low temperature « 11 ° -I4.8°C) blocks initiation of autocatalytic ethylene production

433

434

(induced by propylene) but not ripening [8]. The rate limiting factor was found to be ACC production rather than ACC oxidase activity.

The aim of this research was to identify the biochemical basis of inhibition of the propylene-induced ethylene production in kiwifruit, below the above mentioned critical temperature range.

3. Material and Methods

Kiwifruit (cv. Hayward) were placed at 10° and 20°C in 5-litre jars into which a continuous humidified air stream with or without 130!!1/1 propylene was passed at a rate of 100mllmin. At periodical intervals, fruits of each treatment were removed from storage and used for analysis.

ACC synthase was extracted and assayed as described previously [2]. One unit of ACC synthase activity is defmed as the formation of 1 nmol of ACC/2hrs at 30°C. ACC oxidase was measured in vivo by infiltrating flesh disks with ImM ACC under vacuum as described elsewhere [5].

Total RNA was isolated from flesh tissue without seeds based on the method of Slater et al. [6]. RNAs were transferred to nylon membrane and hybridised with radiolabelled specific probes cDNA MELl [3] for ACC Oxidase and KWACCI [4] for ACC Synthase. Total RNA extraction and Northern blotting were performed 192 hours after the commencement of the experiment.

4. Results and Discussion

Kiwifruit treated at 20°C with propylene, resulted in induced ripening (Fig. lA, B) and ethylene production (Fig. 1 C). Ripening progressed immediately after propylene treatment, while autocatalysis of ethylene production had a lag period of 72 hours. The latter event was attributed to the delay found in the induction of ACC synthase activity (Fig. ID). In contrast, propylene treatment induced ACC oxidase activity with no lag period (Fig. IE). Moreover, accumulation of ACC synthase and ACC oxidase transcripts was only evident (Fig. IF) in ethylene-producing kiwifruit at 20°C (Fig. lC).

In contrast, kiwifruit treated at 10°C with propylene, resulted in a strong inhibition of ethylene production (Fig. 1 C), which was attributed to the low found activities of both ACC synthase and ACC oxidase (Fig. ID, E). Interestingly, propylene at 10°C induced the appearance ofmRNA of ACC oxidase but not of ACC synthase (Fig. IF). However, propylene induced ripening of that fruit with almost the same rate found for the propylene-treated fruit at 20°C (Fig. lA, B). It should be noted that during the whole experimental period (312 hours) the control fruit (treated with air free of propylene) showed no ripening, ACC synthase or ACC oxidase activities or ethylene production at either 10 or 20°C (Fig. lA, B, C, D, E).

Although decreased temperature (10°C) reduces ACC oxidase activity, the fact that at low temperature mRNA of the propylene-induced ACC oxidase gene is still present, led us to propose that the main reasons for the inhibition of the propylene-induced (autocatalytic) ethylene production in kiwifruit at low temperature «11°C) are: a)

435

primarily the inhibition of the expression of the propylene-induced ACC synthase gene and b) the possible post-transcriptional and/or post-translational modification(s) of ACC oxidase.

12 A

~10 .:: ............................... ~~~ ....... .

Ul B

17

15

2O"C+13Q1nA'cp

~ 6 • ...••... 'If!.~+.fi! .. ....•.............• IE ~ 4

u. 2

~~::=:::~~~ ........................ .:::.~~+~:.:.::.:

40 80 120 1eo 200 240 280 320 HOURS

40 80 120 160 200 240 280 320 HC:U<S

60 3'"

C t50 E"OO

~250 ~ § 40

" i 30 ~200

~150 LSD I ~ 20 '" "'100

~ 10 50

LSol

o

2trC+~

0 0 40 80 120 180 200 240 280 32.

HOl.AS ~o 80 120 160 200 240 280 320

HOURS

II III IV V F .' Ace syn thase

Figure I. The effect of temperature (10 and 20·C) and propylene (130,.11/1) on firmness (A), SSC (B), ethylene production (C), ACC synthase (D) and ACC oxidase (E) activities and on the steady state levels of ACC synthase and ACC oxidase transcripts of harvested 'Hayward' kiwifruit kept in a continuous, humidified, air stream. F: RNA blot analysis of ACC synthase and ACe oxidase after 192 hours at 10·C+air (I), I O·C+ 130!li1 propylene (II), 20·C+air (Ill), 20·C+ 130!li1 propylene (IV) and after harvest (V), I unit/mg = Ipmol ACC/mg proteinl2hours. LSD at u=0.05.

5. References

\. Acaster, M. A. and Kende, H. (1983) Properties and partial purification of l·aminocyc1opropane-l­carboxylate synthase, Plant Physiol. 72, 139-145.

2. Antunes, M. D. C. and Sfakiotakis, E. M. (1996) Biochemical bases of thermoregulation of ethylene production and ripening of 'Hayward' kiwifruit, Acta Hart. 444, 541-546.

436

3. Balague, C., Watson, C. F., Turner, A. J., Rouge, P., Picton, S. Pech, J. C. and Grierson, D. (1993) Isolation of a ripening and wound induced cDNA from cucumis melo L., with homology to the ethylene-forming enzyme, Eur. J. Biochem. 212, 27-34.

4. Ikoma, Y., Yano, M. and Ogawa, K. (1995) Cloning and expression of genes encoding ACC synthase in kiwifruit, Acta Hort. 398, 179-186.

5. Metzidakis, J. and Sfakiotakis, E. M. (1993) in J. C. Pech, A. Latche and C. Balague (eds.), Cellular and Molecular Aspects o/the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 142-143.

6. Slater, A., Maunders, M. J., Edwards, K., Schuch, W. and Grierson, D. (1985) Isolation and characterization of cDNA clones for tomato polygalacturonase and other ripening-related proteins, Plant Mol. BioI. 5, 137-147.

7. Sfakiotakis, E. M., Antunes, M. D. C., Stavroulakis, G., Niklis, N., Ververidis, P. and Gerasopoulos, D. (1997) Ethylene biosynthesis and its regulation in ripening 'Hayward' kiwifruit, in A. K. Kanellis, C. Chang, H. Kende and D. Grierson (eds.), Biology and Biotechnology of the Plant Hormone Ethylene, Kluver Academic Publishers, Dordrecht, pp. 47-56

8. Stavroulakis, G. and Sfakiotakis, E. M. (1993) Regulation by temperature of the propylene induced ethylene biosynthesis and ripening in 'Hayward' kiwifruit, in J. C. Pech. A. Latche and C. Balague (eds.), Molecular Aspects a/the Plant Hormone Ethylene, Kluwer Academic Publishers, Dordrecht, pp. 142-143.

DIFFERENCES IN COLOUR DEVELOPMENT AND EARLINESS AMONG PEPINO CLONES SPRAYED WITH ETHEPHON

M. LEIVA-BRONDO, J. PROHENS AND F. NUEZ Departamento de Biotecnologia. Universidad Politecnica de Valencia, Camino de Vera 14,46022 Valencia, Spain

1. Introduction

Most pepino (Solanum muricatum Aiton) clones have a long fruit ripening period. This hampers the introduction of this crop in intensive crop rotations [2]. Time elapsed between the fruit has reached its full size and ripeness can be extremely long, up to several months. Prohens et al. [3] have found that sprayings of 2-chloroethyl phosphonic acid (ethephon) can advance ripening ofcv 'Sweet Round' between 1 and 3 weeks. However, several evidences suggest that there are differences amog different clones in the response to ethephon [4]. Here we study, in several clones, the differences induced by ethephon applications on fruit colour, which is the most common used maturity index for the pepino [1].

2. Materials and methods

We used three clones of pepino ('0902', '2019', '6010) selected for its long ripening period. Cultivation was performed in an Autumn-Winter cycle [4]. Treatments were: no ethephon spraying (TO), one single application at 1000 mg/l at 60 (TI), 74 (T2), 88 (T3) days after fruit set, or a threefold application at 60, 74 and 88 days after fruit set (T4).Ethephon applications were performed with a manual sprayer ensuring that an uniform layer covered the whole fruit. Colour was measured with a colourmeter (Minolta RC300). The parameters L*, a*, b* and the hue angle (arctg (b*/a*» were determined.

3. Results and Discussion

As a result of ripening in the three clones studied, the hue angle decreased and the colour changed from green to yellow tones characteristic of the ripe stage (Fig. 1). In '0902' y '2019' the treatments with ethephon accelerated the change in colour. In these

437

438

QI 'EI c

'" QI :::I :I:

.. ;;, c

'" QI :::I ::c

125 .---------------------------------------------~ 120 115 110 105 100

95 90

Clone '0902'

85 ~--------------------------------------------~

125 I~~IS~~i;~li~;::=::::~--~~~~~~;:--·l 120 115 110 105 100

95 90 85 ~--------------------------------------------~

l~g l··~·~·~·~·~i;;;;~==----------~~~~:;~~~l 110 105 100

~~ . 85 +-~ ______ ~~~ __ ~~~_r_r~~~~~ ____ ~~

60 74 88 102 116 130 144 158 172 186 200 214 I _TO _T1 -.-T2 _T3 ---e-T41

Figure 1. Variation in fruit colour (hue angle) depending on the clone and treatment.

clones the treatment T4 was the most effective in hastening ripening. This allowed an advance in harvesting of more than 40 days. Regarding the treatments involving a single ethephon spraying, the most effective treatment for clone'0902' was Tl. For clone '2019' we did not found differences between the tratments Tl, T2 and T3. We found no effects as a result of the application of ethephon on the clone '6010'. These results suggest that there are differences in th physiology of fruit ripening in pepino. This could be used to select clones with a higher earliness in response to ethephon applications.

4. References

I. Heyes, J. A., BJaikie, F. H., Downs, C. G. and Sealey, D. F. (1994) Textural and physiological changes during pepino (Solanum muricatum Ait.) ripening, Scientia Hart. 58, 1-15.

2. Nuez, F. and Ruiz, 1. J. (1996) EI pepino dulce y su cultivo. FAO. Roma Italia. 3. Prohens, J., Ruiz, J. J., Valcarcel, 1. J. V. and Nuez, F. (1997) Hidroxi-MCPA and ethephon can

improve the production of 'Sweet Round'pepino grown in an Autumn-Winter growing cycle, Acta Hort.463:, 295-300.

4. Prohens, 1., Ruiz, J. 1. and Nuez, F. (1999) Yields, earliness and fruit quality ofpepino clones and their hybrids in the Autumn-Winter growing cycle, J. Sci. Food Agric. (in press).

S-METHYL-CYSTEINE SULFOXIDE INCREASES DURING POSTHARVEST STORAGE OF BROCCOLI

Accumulation of alkyl-cysteine derivatives in Crucifers

R. MASUDA, K. KANEKO AND M. SAITO National Food Research Institute, MAFF Kannondai 1-2-1, Tsukuba, Japan 305-8642

1. Introduction

Crucifer and Allium plants contained alkyl-cysteine-sulfoxides (ACSO) in their leaves, flowers and roots. Crucifer vegetables, such as cabbage, radish and cauliflower accumulate S-methyl-cysteine sulfoxide (MCSO) at high levels, in broccoli floral at more than 0.5 mg I gfw at harvest. This compound and related metabolites have been known to decrease cancer incidence in human. Under certain conditions of broccoli storage at oxygen levels ca. < 0.5%, strong off-odors and off-flavors developed. Their volatiles included various sulfur-containing compounds [I], formed from MCSO by cystine lyase at first decomposition step [2]. However, synthetic pathways of MCSO and other ACSO have not been clarified [3].

We are interested in the genetic control of MCSO contents in crucifers and other vegetables. We present the changes ofMCSO and this derivative contents during post­harvest storage of broccoli flowers and radish germination.

2. Results

2.1. BROCCOLI FLOWER

MCSO content during storage for 76 hr at 20 C was decreased to one third of the initial level under low gas-permeable film wrapped bags (Fig. I). Slightly decrease of MCSO in the bag with a higher permeable film was observed. Whereas MCSO increased under non-wrapped conditions at O°C and 20°C during storage of 126 hr. Separate experiments showed that MCSO levels were higher in developing leaves than in mature ones. S-methyl -cysteine (MC) (1.3 mole I gfw ) detected in florets after the long storage under low oxygen. Cystine lyase activities were not significantly changed during storage under the conditions tested. Sulfoxidation activities of MC decreased to zero under low oxygen while unchanged under non-wrapped ( 3 nmole Ihr /gfw).

2.2. RADISH GERMINA nON

439

440

Winter radish (Raphanus sativus Kaiware) seeds rapidly accumulated Meso during gemination, hypocotyls; 4.0 mole / gfw at 110 hr after sowing at light. Germinating plants at four days after sowing were transplanted from water to medium including S­methyl-glutathione (M-GS) or methanol. M-GS (lmM) treated hypocotyls and leaves accumulated much more Me and slightly Meso than those in water. One % methanol reduced free amino acids and Meso in all organs.

8.----------------------.

~\ I " Non wrapped __ -

"~---- ---'-1--'-'---1-._--. ___ . ___ ._ ·· .. 0. Oxygen permeated

Low Oxyge~-'Q"-O

50 100 Storage (Hr)

Figure 1. MCSO changes under various conditions (0 and 20°C) during storage of broccoli flowers of four determinations

3. Conclusions

Table 1 Effects ofS··methyl-glutathione (M-GS) or

Methanol addition to germination medium (water) on S­

methyl-cysteine derivatives accumulation.

IffiDle I g fw

M:xIium Root fiwoootyI Leaf

Water M::SO 1.8OiQ.24 (100) 3.22±{).IS (100) 3.5(}f!).07 (100)

M: O.17±O.01 (100) O.O3±O.02(100) O.I&W.03(100)

Metharol M::SO O.66±OJJ9 (37) 2.42±0.28 (75) 285±O.1O (81)

M: O.l1±O.OI (65) O.(1)±().02(300) O.I&W.OI (100)

MGS M:SO o.28±O.07( 16) 3.65±O.20 (I 13) 3.76±O.l7(107)

M: O.3I±O.06(1&2) 1.07±O.14(J5700) 1.16±O.1l (644)

MGS 0 O.3O±O.04 0

Values are means±SE of three determinations.

These results indicate that MeSO accumulation is related to rapid growth of organs. M­GS may be a possible precursor of MeSO, but the relationship between methanol application and MeSO formation was not clear. Germinating Kaiware radish is a good material for understanding synthetic pathways of S-alkyl-cysteine-sulfoxides.

4. References

l. Hansen, M., Buttery, R. G., Stem, D. J., Cantwell M. I. and Ling L.C.(1992) Broccoli storage under low-oxygen atmosphere: identification of higher boiling volatiles, J. Agric. Food Chern. 40, 850-852.

2. Marks, H. S., Hilson, 1. A., Leichtweis, H. C. and Stoewsand, G. S. (1992) S-methylcysteine sulfoxide in Brassica vegetables and formation of methyl methane-thiosulfinate form Brussels sprouts, J. Agric. Food Chern. 40, 2098-210 1.

3. Lancaster, 1. E. and Shaw, M. L. (1989) Glutamyl peptides in the biosynthesis of S-alk(en)yl-L­cysteine sulphoxides (flavour precursors) in Allium, Phytochemistry 28, 455-460.

ACTION OF 1,1-DIMETHYL-4-(PHENYLSULFONYL) SEMICARBAZIDE (DPSS), A NEW ANTISENESCENCE PRESERVATIVE FOR CUT CARNATION FLOWERS

S. SATOH, M. MIKAMI, S. KIRYU, T. YOSHIOKA AND N. MIDOH* Laboratory of Bio-adaptation. Graduate School of Agricultural Science. Tohoku University. Tsutsumidori-amamiyamachi I-I. Aoba-ku. Sendai 981-8555. and *Meiji Seika Kaisha Ltd. Yokohama. Japan

1. Introduction

Increasing flower's longevity by blockage of the onset of senescence has economical importance. Currently, STS (silver thiosulfate complex anion), is being used as an anti­senescence preservative in the cut-flower industry. But, STS contains a heavy metal ion (Ag +) and has a potential environmental hazard. Therefore, it is desired to have alternatives to STS, which are safe for organisms and have a less risk for environmental pollution. DPSS is a novel preservative for cut carnation flowers, which were developed recently [1] and has just come to the market in Japan. Its activity to retard carnation flower senescence is compatible to or more than that of STS. DPSS is safe for organisms including mammals, because its oral and dermal administration causes no acute toxicity in mice and exerts no mutagenic effects by Ames test.

Previous investigations showed that the inhibition of ethylene production is responsible for DPSS's antisenescent action in cut carnation flowers [I], and DPSS did not inhibit the in vitro activities of both ACC synthase and ACC oxidase obtained from senescing carnation petals [2]. Also, DPSS did not affect the ethylene-induced senescence in carnation flowers, suggesting no inhibition to the action of ethylene [1].

In the present study, we examined details of the inhibition by DPSS of ethylene production in carnation flowers.

2. Effects of DPSS on Changes in Ethylene Production, ACC Content and ACC Synthase Activity

Figure 1 shows changes in ethylene production, ACC content and ACC synthase in cut carnation (cv. Nora) flowers treated continuously with or without 0.08 mM DPSS at 23-25°C during I-week after the start of the treatment of fully opened flowers. At given times, ethylene production was measured with whole flowers, and then their petals were subjected to the assay of ACC content and in vitro ACC synthase activity.

In control flowers, ACC synthase activity and ethylene production showed simultaneous transient increases, although the former started to increase earlier than the latter, with their maximum at day 5 when petals began to wilt. ACC content began to increase gradually from day 5. These changes were similar to those reported previously [3]. On the other hand, in the DPSS-treated carnation flowers, there was no significant

441

442

increase in the activity of ACC synthase and the amount of ACC, which were most probably responsible for no induction of ethylene synthesis. The DPSS-treated flowers remained fresh for more than 2 weeks, but finally lost its freshness by drying-up oftheir petals. Combined the present findings and foregoing ones, it seems that DPSS exerted its inhibitory action on ethylene production through the inhibition of the synthesis of ACC synthase protein.

2.50 r--~-------=------'

2.00 -;:;-

,,'" jj { 1.50 .g=a III E 1.00

.=. 0.50

--+-Control ..... ·O.OSmM DPSS

0.00 ~ __ --; __ ':::::::'-ii>--___ -_

o 2 3 4 5 6 7

Days

.,.,. 0.8

~ 0.6

1 0.4

~ 0.2

0 ............................•......•......

0 2 3 4 5 6

Days

0.04 i----------------,

2 3 4 5 6 7

Days

Figure 1. Changes in ethylene production (top), ACC content (middle) and ACC synthase activity (bottom) in cut carnation flowers treated continuously with or without 0.08 mM DPSS

3. References

1. Midoh, N., Saijou, Y., Matsumoto, K. and Iwata, M. (1996) Effects of 1,I-dimethyl-4-(phenyl­sulfonyl)semicarbazide (DPSS) on carnation flower longevity, Plant Growth Regul. 20, 195-199.

2. Satoh, S., Oyamada, N., Yoshioka, T. and Midoh, N. (1997) 1,I-Dimethyl-4-(phenylsulfonyl) semi­carbazide (DPSS) does not inhibit the in vitro activities of l-aminocyclopropane-l-carboxylate (ACC) oxidase and ACC synthase obtained from senescing carnation (Dianthus caryophyllus L.) petals, Plant Growth Regul. 23,191-193.

3. Bufler, G., Mor, Y., Reid, M.S. and Yang, S.F. (1980) Changes in I-aminocyclopropane-l­carboxylic-acid content of cut carnation flowers in relation to their senescence, Planta 150, 439-442.

DIFFERENCES IN POSTHARVEST CHARACTERISTICS OF MINIATURE POTTED ROSES (ROSA HYBRIDA)

R. MULLER!, A.S. ANDERSEN!, B.M. STUMMANN2 and M. SEREK! J Department of Agricultural Sciences, Horticulture, The Royal Veterinary and Agricultural University, Thorvaldsensvej 57, DK-1871 Frederiksberg C, Denmark, 2 Department of Ecology and Molecular Biology, Genetics and Microbiology, The Royal Veterinary and Agricultural University, Thorvaldsensvej 40, DK-1871 Frederiksberg C, Denmark.

1. Introduction

Miniature potted roses (Rosa hybrida L.) are an important horticultural crop in Denmark. Leaf yellowing, flower, bud and leaf abscission can be important quality problems in miniature roses during marketing [2]. Selected cultivars were characterized with respect to natural ethylene production, endogenous ethylene in response to postharvest stress, ethylene sensitivity and/or ethylene binding in petal tissue.

2. Longevity Test

In a longevity test miniature rose cultivars held in ethylene-free air varied dramatically in their postharvest characteristics. The percentage of good flowers on day 10 and 20 showed significant differences among 9 cultivars of Parade roses (Poulsen Roser, Fredensborg, Denmark) and among 6 cultivars of Kordana roses (Rosen Kordes, Sparrieshoop, Germany). In some short-lived cultivars such as 'Bronze', 100% of the flowers had faded after 12 days. In long-lived cultivars like 'Vanilla' or 'Charming', less than 10% loss in display quality took place after the same period [I].

3. Ethylene Sensitivity and Ethylene Production

Exposure to exogenous ethylene resulted in distinctly reduced percentage of healthy open flowers in Parade and in Kordana roses. A concentration of 0.5 J.lL.L-! ethylene for 6 days resulted in more than 50% faded flowers in 'Bronze' and 'Charming', while 'Pink Marina' only exhibited 30% and 'Vanilla' less than 25% loss. Leaf, bud abscission and flower senescence was accelerated when plants were exposed to exogenous ethylene, and there were marked differences in sensitivity and response to ethylene among cultivars.

443

444

flower stage

Figure 1. Ethylene production in senescing flowers of Rosa hybrida cultivars expressed on fresh weight basis. Error bars represent SE.

10,---------------,

vanilla Pink Marina Charming Bronze

Figure 2. Ethylene production in open flowers of R .hydrida after 4 days transport simulation. Error bars represent SE.

Ethylene production of excised flowers was measured at 6 stages of development. In some cultivars flower senescence was accompanied by a clear climacteric rise in endogenous ethylene (,Bronze, Vanilla'), and in others there was only a moderate or very low ethylene production (Fig. 1). Simulated transport stress (darkness and shaking) resulted in significant ethylene production in 'Bronze', but did not distinctly affect endogenous ethylene in three other cuItivars Ethylene binding in petal tissue, measured as described in [3], was approximately identical (k.! = 0.14 nL.L- I ) for cultivars with different postharvest characteristics.

The abundance of ACC oxidase transcripts, detected by a Pelargonium cDNA sequence, increased concomitantly with the ethylene climacteric in senescing rose petals. The ACC oxidase transcripts peaked at an earlier flower stage in a short-lived cuItivar ('Bronze') than in a cultivar with long postharvest life (,Vanilla').

4. Discussion

The results suggest that ethylene is an important natural regulator of rose flower senescence at least in some cultivars; variation in postharvest life is due to differences in endogenous ethylene, and in sensitivity to exogenous ethylene. Natural longevity was not correlated with low sensitivity to ethylene, apparently flower life in the absence of ethylene was related to timing of the onset of ethylene production. The cultivar 'Vanilla' with excellent longevity in air was also almost insensitive to exogenous ethylene and may be useful for improving display life and ethylene resistance of miniature potted roses.

5. References

I. MOiler, R., Andersen, AS. and Serek, M. (1998) Differences in display life of miniature potted roses (Rosa hybrida. L.), Scient. Hart. 76, 59-71.

2. Serek, M., Sisler, E.C. and Reid, M. (1996) Ethylene and the postharvest performance of miniature roses, Acta Hart. 424, 145-149.

3. Sisler, E.C. (1979) Measurement of ethylene binding in plant tissue, Plant Physiol. 64, 538-542.

DRY WEIGHT VARIATIONS AS INFLUENCED BY ETHYLENE INSIDE TISSUE CULTURE VESSELS

R. JONA AND D.TRAVAGLIO Dipart. di Colture Arboree, & CVT CNR, Universita di Torino. Via Leonardo da Vinci 44, 10095 GRUGLIASCO TO, Italy

In previous papers the effect of ethylene developing inside the culture vessel was reported to produce negative effects on the growth of plant lets [1,2,3,4,5]. In order to gain more precise information, ethylene was added in controlled quantity by injection in the culture vessel [6]. It has been observed that the reaction of the various species was not equally intense. Consequently it appeared interesting to analyse the variations of the weight of dry matter in species with opposite sensitivity. 46 plantlets grown in vitro have been used of Malus communis Mill. and of Vitis vinifera L. The plants were multiplied and grown as usual according to their individual protocols.and singularly plugged into small cellulose pads (Sorbarod) soaked with the respective basal media, with the gelling agents omitted. into special 100 ml Erlenmayers with a screw hollow crown cap with a rubber membrane sealing the hole. From day 0 to day 18, every 3 days, the ethylene produced by each plant, as reaction to the initial addition of 30 III of ethylene, was measured. From the reported data it clearly appears that ethylene added at the inception of the experiment, does not affect nor produces reaction in the grapevine plantlets. Ethylene does not increase into the sealed bottles into which ethylene has been added preliminarily. Also the dry weight of plantlets along the two weeks of the experiment do not show any significant variation both in the untreated and the treated plantlets. Conversely the apple plantlets react sharply to the introduction of ethylene into the vessel. Synthesis of ethylene is elicited by the aliquot introduced initially and its quantity increases sharply with the ongoing days. Conversely the dry weight of the plantlets decreases swiftly on the early days of the treatment and it remains significantly lower than the initial level along the whole length of the treatment. The percent of decrease is not constant, though it is always important. From such a behaviour we may speculate that the loss of dry weight is rather precocious and rapid and that there are rather important individual variations and no specific trend can be identified. This may mean that once a platform is reached, no matter how harmed is the plant, there is no further loss of dry weight. It is conceivable to suppose that, once the plant is intoxicated by the increase of ethylene, not only the photosynthetic functions are harmed and inhibited as demonstrated by the decrease of chlorophyll [6], but also the mechanism of demolition and exploitation of the existing polysaccharides, in order to balance the lack of newly synthetized sugars, appears to be inhibited. When the threshold is bypassed the metabolism of the plantlet is so altered that it cannot even lose (i.e. exploit) the existing dry matter. This experiment was not drawn to verify the level

445

446

of this threshold, but its existence appears rather conceivable. Conversely it is rather interesting to observe that in the untreated plantlets

NO ETHYLENE ADDED; OPEN CAPS

8 7

E- "'-16

6 ~5 ~ 54 >- ~3

iJ:>..IJ...~' -~

'#.2 Ci

0 <'"l .,., t- o ~ >- >- >-« « « >- >-Ci Ci Ci « «

Ci Ci

DApple • Grapevine

.. :! >-« Ci

,----_._-_. __ ._-----------_ ..

ETHYLENE ADDED

50 T 40 1·

I 30 -;

i 20 .;.

°irir-i--n+-ii:-THri 10

11

-10 - U L.J U U U: -20 :

Days 3 6 9 12 15 18

_____ Apple ••••• • Grapevine

the behaviour is rather specular. The grapevine do not significantly increase their dry weight even if the exchanges of gas with the external atmosphere are assured. While the apple plantlets increase intensely their dry weight just during the short lag of time of the experiment.

This means that the growth metabolism is more rapid in the apple than in the grapevine, but it appears also different in its behaviour. On the other hand, it may be appropriate to remind that not only the growth habit, but also the final results are different in the two plants.

References

L Jona, R_, Gribaudo, I. and Vigliocco, R. (1984) Effects of naturally produced ethylene in tissue culture jars, in Y. Fuchs and E. Chalutz (eds.) Ethylene: PhYSiological and Applied Aspects, Kluwer Academic Publishers, Dordrecht, pp. 161-162.

2. Jona, R., Gribaudo, I. and Vigliocco, R. (1987) Natural development of ethylene in air tight vessels of GF 677, Plant Micropropagation in Horticultural Industries, Symp. Florizel87 Arion, Belgium

3. Jona, R. and Gribaudo, I. (1990) Ethylene production in tissue culture of peach x almond hybrid, tomato, sweet cherry and grape, Acta Hort. 280:445-9.

4. Jona, R., Fronda, A., Gallo, A. and Cattro, A (1993) Ethylene accumulation inside the tissue culture vessel, Acta Hort. 329: 206-8.

5. Jona, R., Fronda, A., Cattro, A. and Gallo, A. (1993) Ethylene synthesis by fruit plants cultured in vitro, in J. C. Pech at al. (eds.), Cellular and Molecular Aspects of the Plant Hormone Ethylene, Kluwcr Academic Publishers, Dordrecht, pp. 375-376

6. Jona, R., Callro, A, and Travaglio, D. (1997) Chlorophyll content as index of ethylene inside culture vessels, Acta Hort. 447, 229-30

Index of Authors

A Abdi, N., 427 Alderson, P.G., 255 Alferez, F. ,183 AI-Khalifah, N.S., 255 Alonso, J.M., 137 Andersen, A.S., 443 Antunes, M.D.C, 433 Ayub, R., 105

B Barrett, J.E., 357 Bartoszewski, G., 399 Bauchot, A.D., 1,305 Ben-Arie, R., 405 Bennett, A.B., 395 Benvenuto, E., 157 Berkovitz-Simantov, R., 151 Bernadac, A., 111 Bertran, A., 71 Bidonde, S., 35 Bihun, M., 197 Binder, B., 51 Black, C.R., 187 Bleecker, A. B., 51 Bonghi, c., 31, 249, 267 Botella, J.R., 29 Botondi, R. 105 Bouzayen, M., 105, Ill, 181, 395 Brown, K.M., 271

C Cantliffe, D.J., 191 Casadoro, G., 243, 269 Castellano, J.M., 397 Cavallaro, A.S., 29 Cazzonelli, c.1., 29 Chamarro, J., 397 Chang, S.c., 65, 221 Chatzopoulos, P., 321 Chaudhry, Z., 285 Clark, D.G., 357 Clendennen, S., 371

447

Cobb, B.G., 103 Coonfield, M.L., 59 Copes, B., 371 Cubells-Martinez, X., 137

D De Jong, A. J., 209 De Martinis, D., 157 De Paepe, A., 71 De Pauw, I., 71 Dilley, D.R., 7 Ding, W., 65 Dodson, A.T., 365 Dourtoglou, Y., I3 Drew, M.C., 145,339

E Ehara, Y., 285 EI Yahyaoui, F., 105 Elsgaard, L., 41 1 Elstner, E.F., 345 Esch, J. J., 51 Escribano, M.I., 327 Eyzaguirre, J., 431

F Faragher, J.D., 273 Fedorowicz, 0., 399 Finkelstein, D. B., 339 Finlayson, S.A., 145,339 Fox, E., 119 Frasse, P., 181 Friedman, H., 151 Fujimoto, S., 285

G Gallie, D.R., 221 Gamble, R.L., 59 Gherraby, W .. 321 Giovannoni, J.J., 119,249 Glick, B. R., 293 Gong, D., 165

448

Goren, R., 261 Granell, A., 137 Grierson, D., 381 Guis, M., 105, 395

H Hadfield, K.A., 395 Haegman, M .. , 71 Haenen, I., 157 Halevy, A. H., 151,203 Hall, E., 51 Hall, M.A., 77 Handa, A., 387 Hase, S., 285 He, CJ., 103, 145 Henderson, J., Hilioti, Z., 271 Hoeberichts, F.A., 217 Hofinan, P.J., 189 Holford, P., 427 Honma, M., 33 Huber, DJ., 191 Hunter, D.A., 165 Hussain, A., 187

I Imaseki, H., 21

J Jia, YJ., 33 John, P., 1,365,431 Jona, R., 445 Jones, B., Ill, 181 Jones, M.L., 195 Jordan, W. R., 103,339 Joyce, D.e., 189,273

K Kadyrzhanova, D., 7 Kakuta, Y, 33 Kaneko, K., 439 Kanellis, A.K., 321,433 Kang, B.G., 21 Kangasjarvi, J., 299, 345 Kannan, P., 119 Kellogg, K. J. A., 371

K~pczyilski, J., 193 Kettunen, R., 299 Khalchitski, A., 405 Kieber, J. J., 37 Kiryu, S., 441 Klee, H.J., 227, 351, 357 Koussissi, E., 13 Kramer, M.G., 371 Ku, V.V., 401

L Langebarte1s, e., 345 Lara, I., 185 Larsen, P.B., 65 Lashbrook, C.C., 227, 351 Latche, A., 35, 105,395 Leclercq, J., 111 Lee, I-J., 145 Lee, S., 119 Leikin-Frenkel, A., 277 Leiva-Brondo, M., 437 Lelievre, J.M., 105 Lers, A., 405 Leshem, Y.Y., 401 Li, J., 293 Linden, J.e., 85 Lind-Iversen, S., 271 Lindstrom, J.T., 195 Lo Scalzo, R., 419 Lurie, S., 405

M Macnish, A.J., 189,273 Madi, L., 277 Makris, A., 321 Malepszy, S., 399 Malorgio, F., 275 Mariani, e., 157,307,343 Masuda, R., 439 Matsui, H., 33 Matsumura, W., 371 Matloo, A. K., 387 McCully, T.J., 7 McGlasson, W.B., 427 McManus, M.T., 165 Mehta, R. A., 387

Meir, S., 151,235 Merodio, C., 327 Mertens, J., 333 Michaeli, R., 235 Midoh, N., 441 Mikami, M., 441 Miyamoto, K., 173 MOder, W., 345 Moffatt, B. A., 293 Moggia, c., 431 Morgan, P. W., 103, 145,339 Mori, H., 21,347 Moshkov, I.E., 77 Mottram, D.S., 365 Moya, M.A., 431 Muller, R., 443 Mullet, J.E., 145 Munoz, M.T., 327

N Nascimento, W.M., 191 Nell, T.A. ,357 Niemirowicz-Szczytt, K., 399 Novikova, G.V., 77 Nuez, F., 437

o Osborne, D. J., 129 Overmyer, K., 299

p Padmanabhan, V., 119 Pan, Z., 65 Park, D.H., 21 Pateraki, I., 321,433 Pech, J.C., 35, 105, 395 Penrose, D. M., 293 Peters, S., 371 Peterson, P. A., 95 Petritis, K., 13 Pezzarossa, B., 275 Pezzotti, M., 157 Philosoph-Hadas, S., 151,235 Phisalaphong, M., 85 Pieper, M., 371 Prescottand, A.G., 1

Prohens, J., 437 Pmsky, D., 277

R Ramassamy, S., 35 Ramina, A., 31, 249, 267 Randlett, M.D., 59 Rasori, A., 31 Reid, M.S., 189,273 Reynolds, E.A., 1 Richards, C., 271 Riov, J., 235, 261 Roberts, J.A., 187,381 Rodriguez, F. I., 51 Rose, J .K.C., 395 Rosenberger, I., 151 Ruperti, 8., 31,249,267

S Saito, M., 439 Sanchez-Ballesta, M.T., 137 Sandermann, Jr. H., 345 Saniewski, M., 73 Sanmartin, M., 321 Satoh, S., 285, 441 Scapin, A., 267 Schaller, G.E., 59 Serek, M., 45, 443 Sfakiotakis, E., 433 Shah, S., 293 Shockey, J.A., 65 Simons, D.H., 189 Sisler, E.C., 45 Smalle, 1., 71 Smigocki, A., 399 Smith, A.R., 77 Soiomos, T., 313, 387 Sonego, L., 405 Stella, L., 35 Stummann, 8.M., 443

T Tatsuki, M., 347 Taylor, LB., 187 Testoni, A., 419 Tieman, D., 351

449

450

Tomasin, C.A., 243,269 Tonnuti, P., 31, 249, 267, 275 Tournier, B., 111 Trainotti, L., 243, 269 Travaglio, D., 445 Tucker, M., 387

U Ueda, J., 173

V Van Caeneghem, W., 71 Van der Plas, L.H.W., 217 Van Der Straeten, D., 71, 333 Van Montagu, M., 71 Van Poucke, M., 333 Vandenbussche, F., 71 Vangronsveld, J., 333 Vanwinkle, J. E., 371 Vendrell, M., 185 Ververidis, P., 433 Vioque, B., 397 Vlachonasios, K., 7 Voesenek, L.ACJ., 307, 343 Vrebalov, J., 119 Vriezen, W.H., 307, 343

W Wang,Z.,7 Warner, T., 7 Wen, C.K., 65 Whitehead, C. S., 203 Whitelaw, C., 381 Wills, R.B.H., 401 Winer, L., 261 Wing, R. A, 339 Woeste, K.E., 37 Wolff, K. A, 371 Woltering, EJ., 151,209,217 Woodson, W.R., 195

y Yakimova, E. T., 209 Yoo, S.D., 165 Yoon, I. S., 21

Yoshioka, T., 285, 441

Z Zacarias, L., 183,381 Zegzouti, H .. , 111, 181 Zhou, D., 387 Zhou, H., 405 Zutkhi, Y., 405

Index of Keywords

A Abscisic Acid (ABA), 21-25, 184-187,

204 -deficient mutant (notabilis), 187 -ethylene relationship, 187 -responsive element, 26

Abscission, 132, 173, 175, 228, 236, 246,252-259,273-274,381-384 competence, 227 in tomato, 384 floral organs, 271 flower explants, 382 leaves and flowers, 269 pedicel, 123,383 petal, 272 -related-p-l,4-glucanases, 243 signal, 135 zone, 129, 133-134,229,235,239, 243,249,268,270-271,381,384, 391 zone ACC synthases, 229 zone receptors, 229 zones of pepper, 270

Acetates, 422-423 Actinidia chinensis (kiwifruit), 46, 402-403,433 Activated oxygen species (AOS), 299,

304 ADC activity, 328-329 Adventitious root, 357, 361 Aerenchyma, 103, 145, 148-149,339 Alcohol dexydrogenase (ADH) 317-

318 Agrobacterium tumefaciens, 22, 159,

182,372-373,399 ain2,72 D-alanine, II Albedo, 403 Alcohol acetyltransferase, 367 Alcohols, 419, 422 Alkyl-cysteine-sulfoxides, 439 Allium, 439 Alloxylon pinnatum 273-274

451

Alpha-aminoisobutyrate, II D-alpha-aminobutyrate, II Amaranthus caudatus, 193 I-aminocyclopropane-I-carboxylic

acid (ACC) deaminase, 33-34, 293-297 activity, 294 gene, 296

I-aminocyclopropane-I- carboxylate (ACC), 4, 8, 19-20, 31, 33, 72, 74, 108,131,185,192,199,214,227, 235,240,285,295-297,303,336, 345,372,388,397,429 apoplastic, 345 binding Site, I 1 carboxyl group, 7 content, 148, 174, 185-186, 287, 290,294,301,345,441 -enhanced leaf abscission, 240 extracellular, 33 -insensitive mutants, 72 intracellular, 33 oxidation, 16 production, 288 turnover, 290

(l-aminocyclopropane-1- carboxylate (ACC) oxidase, 1-4, 8-13, 30, 33, 35,131,157,185,285,290,297, 304,313,316,331,345,365,381, 388,395,405,408 activity, 2, 4, 7, 15,32, 145, 147, 159,167,169,174,193,229,288, 327-330,344,384,397,427,433 antisense, 5, 109, 365-369, 383-384, 395-396 apex-specific, 169 cDNAs, 343 down-regulation, 160 genes, 32,158,165-170,301,343, 366,384 gene expression, 31, 158-159, 162, 165,167,230

452

gene silencing in transgenic tobacco, 159 inhibitors, 13 mRNA, 145-149, 160,204,230,344 promoter, 302 protein, 185 recombinant, 35 recombinant apple, 14 site-directed mutagenesis, 7, 8 transcripts, 314, 444

1-aminocyclopropane-1- carboxylate (ACC) synthase, 2, 13,21,29,33, 37-39,131,174,185,196,204,285, 290,297,304,315,330,331,343, 345,347,372,388,405,408,433, 441 activity, 105, 109-108, 153, 186, 196,229,287,303,333,336,345, 434, 441-442 genes, 21, 105, 108, 151-154, 340, 343,347 LE-ACSIB, 347, 348 LE-ACS2,348 LE-ACS2, 3-4, 347 LE-ACS6 mRNA, 347 LE-ACS6 mRNAs, 348 transcripts, 196, 3 14 Vr-ACS/,22-23 Vr-ACS6, 22-23, 26 Vr-ACS6 of mung bean, 26 Vr-ACS6 promoter activity, 24 Vr-ACS6 promoter-GUS chimeric gene, 22

a-Aminobutyric acid, 297 y-aminobutyric acid (GABA), 328, 330 Aminoethoxyvinylglycine (AVG), 151,

191-192,235,240-241,293,336 Aminooxyacetic acid (AOA), 204, 288 Aminotransferases,30 Annona cherimola, 328 Annurca, 419 Anoxia, 337

enzymes, 3 16 proteins, 3 13

Anther, 158, 270 Anthracnose, 95

Antifungal compounds, 278 l-acetoxy-2-hydroxy-4-oxo­heneicosa-12, 15-diene (diene), 277 compound gossypol, 280 antifungal diene, 278, 281

Antirrhinum majus, 151-152 Anti senescence preservative, 441 Antisense plants, 105-109, 121, 125,

158-160,321-324,365-369,378, 381-385, 389-396 ACC oxidase, 396 ACC oxidase melons, 109, 395-396 antisense ACO-l gene, 383 antisense ACO / AS plants, 384 antisense fruit, 365, 366 antisense HAP5c, 321

Apoplast,2 Apoplastic washing fluid (A WF), 345 Apoptosis, 209, 211, 213 Apple, 14,424,432

fruits, 13 Arabidopsis Ihaliana, 38, 52, 65, 68,

69, 71- 74, 79-82, 243-246, 270, 300,302,321,333,337,352-353 ERS gene, 391 ETRI,391

a-Arabinosidasse, 105, 106 Arginine decarboxylase (ADC), 328 Aroma, 367, 419, 421

biosynthesis 419 extraction, 366

Aromatic oil glands, 40 I Ascorbic acid, I, 2, 18 Autophosphorylation, 59, 61 Auxin, 21-22, 182, 198,204,228,236,

240,255-259,361,384,391,398, -response factor, 182 -induced ethylene production, 21, 152 -inducible gene, 25 -responsive element, 25 -specific isogene, 22

Avocado fruits, 277-278 Azospirillum, 295

B ba4 mutant, 95, 97 BAC library, 120 Baccatin III, 85 Bacterial ACC deaminase, 294 Banana,46,48,315

fruit, 189,206 fruit ripening, 190 -treated with propylene, 190

Barren mutant, 96 BcI-2,211 Begonia etatior, 41 1- 414 Benzyladenine (BAP), 79 Benzylaminopurine (BA), 22 BHA, 240, 24 I Botrytis, 359 Broccoli,439 Butanoates, 422 Butylated hydroxyanisole (BHA), 235

C Ca2+, \03

antagonists, 15 I, 155 Cadaverine, 388 Campanula, 48 Camptothecin, 213, 218

-induced programmed cell death, 217

Canola, 293-294 root elongation, 293 roots, 296

Cantaloupe, 369, 371, 377 Capsicum annuum, 244 Carbamylation, 8 Carnation, 46-48, 195, 198, 3 I 4, 3 I 7

flowers, 206, 442 Carotene, 13 I Carotenoid biosynthesis, 139 Caspases, 209, 2 I I Castor bean, 283 CCAAT-binding factor, 321 Cell death, 214 Cell wall, 395

degrading enzymes, 105-106, 43 I hydro lases, 129, 132,228,23 I, 143, 249-250,271,372

Cellulase, 129- I 35, 271, 272, 432 activity, 131-134,339 gene expression, 134, 27 I

Charentais melons, 366 Cherimoya, 328-33 I

fruit ripening, 327 Chilling, 235, 327, 329

disorder, 405 injury, 330 stress, 239, 24 I temperatures, 238

453

-induced leaf abscission, 235-236, 238,240

Chimeric promoter, 377 2-chloroethyl phosphonic acid

(ethephon), 161, 188,295,437,438 chlorophyll, 166, 402

alb binding transcripts, 138 degradation, 138 polypeptides, 138

Chrysanthemyl alcohol, 18 Cin (cytokinin-insensitive) mutant, 37 Circadian ethylene rhythms, 149 Citrus deliciosa, 28 I Citrus, 141,261,281,401

degreening, 184 flavedo, 183 fruit, I 37, 402 fruit maturation, 183 fruits, 183 species, 403

Citrus sinensis, 183,261- 262 CMV-Y, 289

-infected leaves, 286-290 Carbon dioxide (C02), I, 7-8, 327-328

high, 328, 330 activation,7-8, I I activation of ACC oxidase, 8 output, 316 short-term high treatment, 327

Cocklebur, 177 CoClz, 318 Cold storage, 405, 407 Colletotrichum gtoeosporioides, 277 Colletotrichum lindemuthianum, 346 Competence to ripen, 181

454

Controlled atmosphere (CA) storage, 313

Copper, 333-337 Cotton, 227-228

abscission, 231 ACC oxidase gene, 227 leaves, 230

Crucifer, 439 CTR

ctr, 77 ctr mutant, 82 Ctr mutations, 37 CTR,82 CTRl, 51, 54, 60, 62, 65-68, 71, 124,304 CTRI kinase domain, 67 ctr 1 mutations, 71 CTRI protein, 37, 51, 63 CTR2,37

cucumber mosaic virus yellow strain (CMV-Y),285

Cucumis me/o, 365-366, 371 Cut flowers, 151 Cuttings, 361 Cyclamen, 196 Cycloheximide, 23 Cyclopropane 1,1 dicarboxylic acid,

13, 16 Cyclopropane-I-carboxylic acid, 11 Cyclopropene (CP), 48 Cymbidium, 196 Cystenyl aspartate-specific proteases,

210 Cystine lyase activities, 439 Cyt-b mediated electron transport, 2 Cytochrome oxidase, 316 Cytokinin, 21-22, 25, 37, 79

antagonises, 77 0'1:okinin-insensitive mutants, Cin, 38

Cytoplasmic pH, 327

D DADl homolog (defender against

apoptotic death), 211, 340-341 dadl gene, 217

Dark-induced senescence, 221 Dehydroascorbate, 2 Developmentally-regulated (DR)

clones, 181 Dianthus caryophyllus, 46-47, 200 Diazocyclopentadiene (DACP), 46 Diene,278,282 Differential display, 111,249,339 Digitalis, 196 1, I-Dimetyl-4-(phenylsulfonyl) semic

arbazide (DPSS), 441 3,3-Dimethylcyclopropene (3,3-

DMCP),48 Diospyros virginiana, 46 Diphenylene iodonium, 301 DNA laddering, 209 Double-mutant analysis, 71 Dry weight, 445 Dynamic headspace, 420

E E. cloacae, 296 E. coli,35

bacteriophage T3 gene, 372 E-8 promoter, 389 E8/E4 hybrid promoter, 377 Ear initiation, 96 EFC, 186 ElN

ein2,74 ElN2,51,55,304 EIN2 protein, 51 ein2-1,302 ein2-l mutant plants, 303 ElN3,51,55 EIN3 protein, 51 EIN4, 54,65,66, 71,352

elicitors, 346 Endo-p-mannanase, 191-192 Enterobacter cloacae, 295 Epi (Epinastic), 119-120

Epi mutant, 120-122 EpilEpi, 123 Epi/Epi; Nr/Nr double-mutant, 119

Epicatechin, 278, 283 Epinasty, 120, 122-123,229

ER24,113 ER43,115 ERS,122,289,309

ERSI, 54, 65-71, 352 ERS 1 and ERS2 proteins, 353 ERS2, 54, 65-66, 71, 352

Esters, 365,419,422 Ethyl 2-methylbutanoate, 365, 367 Ethyl acetate, 366 Ethyl butanoate, 367 Ethyl esters, 367,422 Ethyl esters after harvest, 424 Ethylene

action, 45, 149, 151 GA3,193 agonists, 49 allosteric regulation of ethylene analysis, 420 bending response, 154 binding, 55, 85, 92, 443, 444 binding assay, 46 binding proteins, 113 biological removal, 411 biosynthesis, 151, 228, 336, 339, 343,374,388 consumption, 411, 414 -dependent, 106, 109 -dependent cell death, 104 -dependent and independent pathways in the melon, 109 down-regulated, 112 evolution, 188,276 flower development in tobacco plants, 157 -fonning capacity, 185 gasing, 189 j asmonates, 91, 173 -independent, 106, 109 -induced IAA decarboxilation, 264 inhibition, 13 inhibitors, 154 insensitivity, 48, 73 insensitive CaMV35S-etr1-1 petunias, 362 insensitive petunia flowers, 357, 359

modulator of programmed cell death,303 mutants, 71 -overproducers, Eta, 37, 38 ovule development, 162

455

perception in tomato, 351 production, 131-132, 145, 151-153, 166,170,186,191-193,203,214, 238,286-287,290,330,333-337, 347,375,383,397,423,427,429, 431-434, 441-444 non-enzymatic production, 336 postranscriptional regulation of receptor(s), 45, 59, 63, 67, 65, 104, 124,178,229,267,285,352,381 receptor gene, 288 receptor protein, ETR I, 85 removal, 411-414 removal by biofilters, 415 -oxidizing bacteria, 412-416 -regulated (ER) clones, 116 -regulated cDNA fragments, 112 -responsive (ER) genes, 111 -responsive E8/E4 promoter, 373 -responsive elements, 32, 246 -responsive genes (ER clones), 113 rhythmic production, 147, 148 role in gravitropism, 155 role plant apoptosis, 213 seed gennination, 193 sensitivity, 141, 148-149,203,229, 235,384,443,444 sensitivity factor, 92 signal transduction, 51, 54, 59, 77, 81, 103, 121, 125,307 stress, 333 synthesis inhibitor, 155 transfonned plants, 161 treated transgenic flowers, 358 treatments, 391 eti5, 77, 79

Eta mutants, 38 eta2,41 eta2 (ethylene overproducer), 37 eta3, 38,40

ETR

456

ETR receptors, 51 etr, 77, 79 family, 53, 56 etrl,74 ETRl, 51, 59-61, 65, 66, 69, 71, 90, 122,267-289,309,352,388 ETRI gene, 59,289 etrl-l, 352, 358, 392 etrl-l gene, 388 etrl-l petunia flowers, 358 ETR2, 54, 65-69, 71, 352 ETR2, EIN4 and ERS2 receptors, 68 Le-ETRI,353 Le-ETR2, 353 Le-ETR3,353 LeETR4,353 LeETR5,353

Extended flower life, 357

F Fe (H)-dependent dioxygenase, I Fe Binding site, 9 Female

sporogenesis, 157 sterility, 162 -sterile transgenic plants, 160

Fertilisation, 157, 158,200, 203 Ficus benjamina, 255

in vitro cultures 257,260 Flavedo

flavedo, 137-138,403 maturation, 138 specific genes, 141

Flavonone-3-hydroxylase, 278 Flooding, 103,307,343

stress, 309 Flower(s), 196,443

abscission, 273-274 abscission zone, 227, 270, 382 and leaf abscission, 382 development, 158 senescence, 157,362,357-358,382, 383,443 wilting, 196, 199,273,358,382

Flowering, 203-204 Fruit

abscission, 129 abscission zone, 129 colour, 420 expression, 140 firmness, 376, 395, 406, 420, 431-433 quality 327-328, 365, 374, 377 pedicel abscission zone, 132 ripening, 115, 123,137,174,181, 276,357,361,372,382,391-392, 437 ripening control, 125 ripening in pepino, 438 set, 362 shedding, 132 softening, 405, 409

Fruitlet abscission, 249, 268 abscission zones, 32 abscission-related genes, 249

Funiculus, 159 Furanocoumarins from parsley, 280

G Galactanase, 105-106 a and I3-Galactosidase, 431 I3-Galactosidase, 68, 105, 106, 109,

132 Gibberellins

GA3,193 GA3 (gibberellin A3), 360 signaling pathway, 69

Gene-silencing approaches, 162 Genetic engineering, 29, 371 Genetically engineering of cantaloupe,

371 Geranium flowers, 271 Germination oflettuce seed, 191 Glucanases

abscission-related endo-I3-1 ,4-glucanases 243 endo-I3-I,4-g1ucanase, 244, 269 pepper endo-/3-1 ,4-glucanase, 269 13-1,3 gl ucanases, 253 13 1 ,3-glucanase genes, 249 13-1,3-glucanhydrolase,132

13-1,4-glucanhydrolase, 129 Glycosidases, 431

l3-glucosidase, 432 Glutathione peroxidases, 264 Glutathione reductase, 263

activity,264 G-proteins, 103 Gramineae, 96 Granny Smith, 185 Grapefruit, 403 Grapevine, 445 Gravistimulation, 151-153 Gravitropic process, 154

response, 151-152 gravity-induced ethylene and IAA, 153 gravity-induced ethylene asymmetry,154

GTP binding, 77, 79 GTP-binding protein, 81, 111, 115 GTP-binding proteins,

Gum induction, 173 GUS, 270

H

activity, 21-24, 245 expression, 244, 246 gene, 21 reporter gene, 244

H20 2, 261, 264 Hansenula saturnus, 34 Headspace, 419-420 Heat shock, 222 Heme

biosynthesis, 321 -activated protein (HAP), 321 -containing protein, 313 HAP2/3/4/5 complex, 322 HAP5c suppression, 325 HAP5c overexpression, 324

Hemicellusose, 395 Hexosephosphate isomerase, 346 Hibiscus, 414 Temperature

high, 191-192 high temperature stress, 391

457

high temperature-mediated differential induction of NR versus TAEI ethylene receptor 387

Histidine kinase, 54, 59-60, 67, 354 activity, 59,62-63, 66, 352 histidine kinase domain of ETR 1, 59

Hormonal interaction, 22 Hydrogen peroxide (H20 2), 19,263,

299 Hydroxyl radical, 299 Hypersensitive response, 299 Hypoxia 103-104,148-149,313-314,

I

316,340 hypoxic stress, 313 hypoxic treatment, 145

Indole-3-acetic acid (lAA), 22-23, 96, 151-153,242,256-257,261,263, 255,295-297,381,397 IAA catabolism, 242, 261 IAA decarboxylation, 261-263,265 IAA levels, 152 IAA oxidase, 261-264 IAA-induced GUS activity, 23 IAA-induced GUS expression, 21

Indole butyric acid (IBA), 255-257, 361

Indole-3-aldehyde (lAId), 262-263 Indole-3-carboxylic acid (lCA), 261-

263 Indole-3-methanol, 262 Idioblast, 278, 280 1M oxidase, 263 Inflorescences, 273, 382 Integument primordia, 159 Interaction ofETRl with CTRl, 62 Inter-tissue signalling, 129 inter-tissue signalling control of

ripening and abscission, 135 Iris, 203-204 Iron, 19 Isoelectric focusing, 35, 226

IEF and acidic activity gels, 133 Isoleucine, 365 Isopenicillin N synthase, 10

458

Isopentenyl transferase gene, 399 lxora coccinea, 235-236

J Jasmonic acid, 173, 176-178,204

K Kalanchoe blossfeldiana, 176 Kinases

MAP kinase phosphorylated, 81 MAP kinase, 51, 54, 60, 81-82 activity, 77,80 MAPKK kinase, 60, 79, 82

Kinetin, 23 Kiwifruit (Actinidia chinesis), 46, 402-403, 433

L Latex protein, 249, 252 Leaf

abscission, 227, 237-238, 240, 255 bud abscission, 443 development, 166 expansion, 187-188 lamina, 256 ontogeny, 166 senescence,237,239,382

Lettuce, seed embryo, 191 seed germination, 191 seed germination, 192

Lipase activity, 131 Lipoxygenase activity, 283 Lithospermum erythrorhizon, 86 Longevity test, 443 Low oxygen (02), 307- 313, 316, 330,

439 Low temperature, 274 Lycopene,390 Lycopersicon esculentum, 46, 47, 218,

300,397

M Maize, 95, 96,340

roots, 103

Male sterility, 160, 324 Malus communis, 445 Malus domestica, 419 a-Mannosidase, 431-432 mar 1 mutation, 72 MCSO,440 Mechanical impedance, 339-340 Megasporocyte, 158 Megasporogenesis, 157, 160, 162 Melon, 365, 374, 395

transformed melons, 365 Metals, 333, 335 2-Methylbutyl, 365 2-Methylbutyl acetate, 367 I-MethylcycIopropene (I-MCP), 45,

47-48, 113, 151, 189-190,235,273, 274,427,429

2-MethylcycIopropanecarboxylic acid, 18

3-Methyleneoxindole, 262 2-Methylpropyl, 365 2-Methylpropyl acetate, 367 Methyljasmonate, 85, 86, 87, 92,174 Methy1cycIopropene, 79 Methylthioadenosine, 388 Microbial ethylene consumption, 412 Monodehydroascorbate, 3 Mosaic Symptom Formation, 288 mRNA differential display, 181,249 mRNA stability, 222 Multiprotein bridging factor 1, 113 Mung bean, 21, 24, 46 Musa sapientum, 46-48 Musa sp, 189 Muskmelon, 106,371 Mycobacterium, 412 Myelin basic protein, 80

N Naphthalene acetic acid (NAA), 241,

255-257 NADPH oxidase, 301 Never ripe (Nr),352

Never-ripe (NR) gene, 121,391 Never-ripe ethylene receptor, 119

NiC12o,318

Nicotiana tabacum, 23, 46, 285-286, 345

Nitrosoguanidine, 294 NMR,283 NO·, 401,402,403 Non-climacteric,29, 137 non-ripening (nor), 120-124,399

genes, 119 (nor) tomato mutant, 399

2, 5-norbomadiene (NBD), 46, 48, 151, 184,196,262,264,303-304,309

NR Nr, 120, 124,353-354,381,391 Nr gene, 115 NRmRNA,387 NrlNr, 123

Nucellus, 158-159

o O2- production, 301 o-Octalactone, 424 Octanoic acid, 204-205 Odour, 365-369 Oil cells, 281 Oil palm, 129, 135

fruit abscission, 134 Oil synthesis, 281 Oligosaccharide fragment, 135 Orange, 183,402-403 Ovary, 158, 160, 195,213,271,358 Ovule development, 159 Oxidative stress, 236 Oxygen, 317 Ozone (03), 299-304, 345

P

0 3 induced ethylene emissions, 30 I 0 3 sensitive Arabidopsis mutant, 301

Pseudomonas jluorescens, 296 Pseudomonas put ida, 296 Paclitaxel, 85-88 Palm, 129 parB and GH3 auxin-responsive

elements, 26 Parenchymatous cells, 240

459

Pea,46,48 Peach, 31,249-250, 267-268, 405-406,

409 ETRI,267 fruitIet abscission, 253 abscission EGases genes, 243

Pear, 43 I, 432 Peat-soil biofilter, 411 Pectic enzymes, 405 Pectin, 395 Pectin-methyl-esterase (PM E) 105,

405-409 message, 408 protein, 408

Peiargonium, 196, 444 Peiargonium xhortorum, 271 Penicillium citrinum, 33 Pepino, 437 Pepper abscission (caEG2) genes, 243 Peroxidase, 263, 346 Persimmon, 46 Peat-soil, 412 Petiole elongation, 307 Petunia, (Petunia hybrida) 195, 198,

200,204,357,361 flowers, 358, 360 transformed 'V26', 358

Petunia injlata, 159 PGPR,294-297 Phaiaenopsis, 197-198,203,204 I, 10-phenanthroline (Ph), 288 Phenolic compounds, 346 3-Phenylisoserine,85 Phosphoinositides, 103 Phosphol ipases

C (PLC), 103 D (PLD), 103

Phosphorylation, 67 phyB mutant, 145 phyB-l mutant, 147, 149 Phytochrome A, 146 Phytochrome B, 145-146 Phytochrome B deficient mutant, 149 Phytophthora injestans, 346 Phytophthora megasperma, 346 Pineapple, 29

460

Pistil, 158 Pisum sativum, 46, 47 PLC, 104 PLD,104 Plums, 427 Pollen, 95,158,161, 195, 197,360 Pollination, 108, 157, 162, 195,203,

357,375,377 -induced senescence, 203 -induced, and normal senescence, 362

Polyacetylenic compound faIcarindiol, 280

Polyamine(s), 327, 330, 346, 388, 390 biosynthesis, 327--328, 389 putrescine, 327-329, 387-390 spermidine (Spd), 329-330, 327, 387,388,390 spermine, (Spm) 327, 329-330, 387, 390

Polygalacturonase (PG) activity, 105-106, 133-134, 405-410,431 -abscission-specific promoter, 392 exo-polygalacturonase, 105 exo- and endo-polygalacturonases, 129 gene expression, 134 isoenzymes, 133 message, 408, 410 protein, 405, 408

Pomelit, 403 Poncirus trifoliata, 281 Postharvest life, 444 Postharvest storage, 366 Post-translational control, 221 Potent odorants, 365 Pre-ripening development, 181 Programmed cell death (PCD), 103,

209,217,339 Promoter

analysis, 243 region of Vr-ACS6, 25

Propylene, 249, 250 treatment, 32, 434 -induced clones, 253

Proteaceae, 273 14-3-3 Protein family, 69 Protein

association assays, 65, 67 protein interactions, 65 protein phosphorylation, 77, 79-80, 103

Prunus persica, 244, 267, 406 Pseudomonas putida, 294 Putrescine, 327, 329,387-390 Pyruvate decarboxylase, 317

R Rafkinase, 54, 69, 82, III Raphanus sativus, 440 Rehydration, 230 Retarded growth, 324 Rhizobacteria (PGPR), 293 Rhizobia, 293 Ribonuclease protection assay, 272 rin, 120, 124 Ripening, 29-30, 105-106, 132, 173,

181,328,352,373,387,390,395, 420,429,434 apple fruit, 185 attached fruit, 427 delayed fruit ripening, 362, 371 -inhibitor (rin), 119, 121 -related ACC oxidase, 8 -related genes, 121

RNase, 221, 224, 226 activities, 221, 222

Rootorshootgrowth,293 Rooting, 361 Root-sourced ABA, 188 Rosa hybrida, 46, 443 Rose

flower, 444 miniature, 46, 443 petals and leaves, 46

RP-ERSl, 307, 309 RP-ERSI gene expression, 309 RP-ERSI GENE EXPRESSION, 310 RubisCO, 138 Rumex palustris, 307-311, 343, 344

s S. cerevisiae, 35 S-adenosylmethionine (SAM), 3, 304,

327,372,388 S-adenosylmethionine decarboxylase,

(SAMdc), 331, 387-389 S-adenosylmethionine hydrolase

(SAMase),371-375 expression, 374, 376 gene, 372 melons, 377

SAM synthetase, 345 Salicylic acid, 388 S-alkyl-cysteine-sulfoxides, 440 Secondary dormant (thermo dormant),

193 Seed germination, 74,176, 191, 193,

358,360 imbibition, 293

Selenium, 275 Senescence, 170, 173, 175, 197,203,

221,226,239,270,275,359,383, 389 corolla, 358 leaf tissue, 170 petal, 123 process, 387 -related genes, 140 rose petals, 444

Shade avoidance, 145 Shelflife, 189,401,407 Short-chain fatty acids, 203, 204 Short-term high CO2 treatment, 327 Signal transduction, 79, 115 Silver thiosulfate (STS), 187,257,259,

441 Site-directed mutagenesis, 7-8, 59, 67 Situ hybridisation, 159 slo mutant, 74 S-methyl-cysteine sulfoxide (MCSO),

439 S-methyl-glutathione, 440 Snapdragon, 151-154 Softening, 106,395,431 Soil,187,294,339,411 Solanum muricatum, 437

461

Soluble solid content (SSC), 376, 420, 433

Sorghum, 145 Soybean GH3 promoter, 25 Spermidine (Spd), 329, 330, 327, 387,

388,390 Spermine, (Spm) 327-330, 387, 390 Stearoyl-ACP-desaturase, 283 Stearoyl-acyl carrier protein (ACP)

desaturase gene, 277 Stem bending, 152 Stigma, 158 Stolon, 166 Stomatal conductance, 187 Storage, 423 Style, 158 Submergence, 340, 343 Sucrose synthase, 317 Superoxide anion (02), 299, 304

production, 301 Sweet potato roots, 316 Systemic infection, 286

T TAEl,391 TATA box, 246 TAT A box-binding protein, 113 Taxane

production, 85 taxane production in plant cell culture, 92

Taxol,85 Taxus canadensis, 85-86, 92 Taxus cuspidata, 87 Telopea speciosissima, 273 Terpene-producing trichomes, 281 Thaumatin II cDNA, 399 thi mRNA, 139 Thigmomorphogenesis,347 Titratable acidity, 420 Tobacco, 22-26, 79,157-162,169,212

243-244, 146,252,260,285-290, 321,324,346,357,362,398 transgenic, 21-26, 157, 159-160, 212,244,246,270,288,324 pistil cDNA library, 162

462

protoplasts, 25 transformed, 22, 324 transgenic, 324

Tomato, 46, 119, 125, 181,217,275, 276,300,347,361,384,381,399 transgenic plants, 29, 115, 122, 124, 302,383,390,397,405 CTRi-like gene: TCTRi, 123 ethylene receptor, 353 fruit, 111, 351 fruit ripening, 217 mutant, 399 transformed with yeast SAM decarboxylase, 389 suspension-cultured tomato cells, 218 transformed plants, 389

Touch stimuli, 347 Trans -phenyl cyclopropane carboxylic

acid, 13 Trans-2-pheny 1cyclopropane -1-

carboxylic acid, 18 Transcription factor, 113 Transcriptional activator, 321 Transformation events, 400 Transgenic plants, 21-26, 59,105-109,

115-116, 120-125, 157-160, 195, 199-200,212,243-246,270,288, 321-325,354,357-360,372-38878, 382-383,387-392,395-400,405 ACC oxidase antisense fruits, 395 antisense ACC oxidase melons, 105 antisense ACC synthase tomatoes, 106 Arabidopsis thaliana and tobacco plants, 321 auxin-overproducing tomato plants, 397 CaMV35S-etrl-1 petunias, 357 cantaloupe, 375 explants, 383 flowers, 157,358 fruit, 105, 108,375,377,396,397, 398 SAMase cantaloupe, 375 transgenic pollen, 160

transgenic and mutant tomato, 121 tobacco, 21-26, 157, 159-160,212, 244,246,270,288,324 tomato, 29, 115, 122, 124,302,383, 390,397,405

Transposon, 96 Tree factor, 428 Triacylglycerol, 131 Trifolium repens, 165 Triple response, 38, 71 Tunicamycin, 340 Two-component phosphore lay system,

67 Two-component signal transduction

systems, 59 Two-component system, 62 Two-D gel electrophoresis, 223 Two-hybrid assay, 67

V Valine, 365 Vase life, 273 Vida/aba, 345, 346 Vigna radiata, 23, 46-47 Virus, 285 Vilis vinifera, 445 Volatiles, 365-367, 421-424 Water stress, 230 Wheat, 222, 224 White clover, 165 Winter radish, 440 Woolly breakdown (WB), 405, 407 Wounding, 340

X Xanthine, 301 Xanthine Ixanthine oxidase, 304, 310 Xanthium pennsylvanicum, 177 Xylanase, 214, 432 7-xylosyl-l0-deacetyItaxol, 85

y Yeast two-hybrid assay, 65

Z Zinc, 333-337