Computer-aided design
We have developed CAD tools to design DNA, RNA and protein
nanostructures and devices. The designed sequences are ordered and
produced in the lab.
Biomolecular Design for Synthetic Biology
Ebbe Sloth Andersenhttp://andersen-lab.dk
[email protected], 1592-320
Biomolecular design lab
Approach and method
Project examples
Read more ...
We use biomolecules as building blocks to design nanosca-le
devices for applications in basic science and technology. Our
research aims at understanding the fundamental prin-ciples of how
biomolecules fold into unique and functional shapes and at using
this insight to guide the design of novel nanoscale devices. The
designer molecules are used for re-programming cell properties to
function as e.g. biosensors, enzyme assembly lines or signaling
networks.
Postdoc project:RNA-protein scaffolds studied by cryo-electron
microscopy
In this project Ewan McRae design RNA scaffolds for proteins
with the aim of characterizing the atomic structure of RNA-protein
complexes that have not been possible to solve the structure of
because of flexibility and/or size limitati-ons.
Structural characterization
We use biophysical characterization tech-niques such as atomic
force microscopy (AFM) and cryo-electron microscopy (cryo-EM) to
verify molecular designs.
PhD project:Biosensors for selection of pro-duction strains in
nanodroplets
In this project Bente K. Hansen works with Novo Nordisk to
develop biosensors for GLP-1 that will be used for selection of
yeast production stains in a nanodrop-let setup.
Synthetic biology applications
Verified molecular designs are genetical-ly encoded and
expressed in bateria or eucaryotic cells and properties are tested
with e.g. fluorescence microscopy.
Master project:Control of enzyme activity by
switchable RNA scaffoldsIn this project Kalinka Hansen designs
RNA lattices that assemble when a ligand is present. The RNA
lattice will be used to attach an enzyme system that produces the
ligand and thus constitute an autore-gulatory system in cells.
A single-stranded architecture for cotranscriptional folding of
RNA nanostructures, Geary et al., Science 2014.Development of a
genetically encodable FRET system using fluorescent RNA aptamers,
Jepsen et al., Nature Communications 2018.An RNA origami octahedron
with intrinsic siRNAs for potent gene knockdown, Høiberg et al.,
Biotechnology Journal 2018.Genetically Encoded, Functional
Single-Strand RNA Origami: Anticoagulant, Krissanaprasit et al.,
Advanced Materials 2019.Branched Kissing Loops for the Construction
of Diverse RNA Homooligomeric Nanostructures, Liu et al.,Nature
Chemistry 2020.
CAGGUCGGAAGGGUGCCCGGACCCAAUGCGAGAGGGUCAUGUGACCCAAUGCGAGAGGGUCACAUUGACGGUCGACAUGAGGAUCACCCAUGUUGACUGUCACGUGUGCUUUUCGAAGUACAUGACGGGUUCGCCUGUCAGGCACUCUUCCCCUGACGGGUUCGCCUGUCAUGACGGUCGACAUGAGGAUCACCCAUGUUGACUGUCACCGGCAAGUAAGGAGCCGGGGAUAUCAAAUCGGGAGAUAUGACCUGCUGGGGCCAGGCCUUUGGCUCUGAAACCCGAUAUCAGAGGUGUUCGGAACCUUACACCGAACACCUGUCACCGACUGGCACAGAAGAUAUGGCUUCGUGCCGGUCGGUGACGGCCUAGGAUC
AFM TEM
http://andersen-lab.dkmailto:[email protected]://www.au.dk/om/organisation/find-au/bygningskort/?b=1592https://science.sciencemag.org/content/345/6198/799https://www.nature.com/articles/s41467-017-02435-xhttps://onlinelibrary.wiley.com/doi/full/10.1002/biot.201700634https://onlinelibrary.wiley.com/doi/full/10.1002/adma.201808262https://www.nature.com/articles/s41557-019-0406-7
