7%~ JOURNAL OF BIOLOGICAL CHEMISTRY 0 1990 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 265, No. 6, Issue of February 25, PP. 3324-3331,199O Printed in U.S.A.

Bovine ,81+4=Galactosyltransferase: Two Sets of mRNA Transcripts Encode Two Forms of the Protein with Different Amino-terminal Domains 1N WTR0 TRANSLATION EXPERIMENTS DEMONSTRATE THAT BOTH THE SHORT AND THE LONG FORMS OF THE ENZYME ARE TYPE II MEMBRANE-BOUND GLYCOPROTEINS*

(Received for publication, September 21, 1989)

Ruth N. Russo$j~, Nancy L. Shaper+, and Joel H. Shaper$§]] From the $Cell Structure and Function Laboratory, The Oncology Center und the $Department of Pharmacology and Molecular Sciences, School of Medicine, The Joh.ns Hopkins University, Baltimore, Maryland 21205

We have used Sl and primer extension analysis to demonstrate that the gene for bovine @l-4-gala&o- syltransferase specifies two sets of mRNA transcripts of different lengths. The longer mRNA transcripts in- itiate upstream of two in-frame ATG codons and en- code a protein of 402 amino acids (long form). The shorter mRNA transcripts initiate between the two in- frame ATG codons and encode a protein of 389 amino acids (short form). These two related forms of @144- galactosyl&ansferase have an identical large (358 amino acids), potentially glycosylated, COOH-terminal catalytic domain, and an identical single transmem- brane domain. The only difference in primary strut- ture between the two forms is that the long form con- tains an NHZ-terminal extension of 13 amino acids, Thus, bovine @l-4-galactosyltransferase fits the pat- tern established for murine @1+4-galactosyltransfer- ase (Shaper, N. L., Hollis, G. L., Douglas, J. G., Kirsch, I. R., and Shaper, J. H. (1988) J. Viol. Chem. 263, 10420-10428). Inspection of the NHZ-terminal do- main suggests that the long form of the bovine enzyme, like its murine counterpart, has a functional cleavable signal sequence which would dictate that the two forms of the membrane-bound enzyme are oriented in oppo- site directions. We have tested this hypothesis by in vitro translation in the absence or presence of dog pancreas microsomes. In vitro translation of RNA transcripts for the long and short form of @l-4-gal- actosyltransferase in the absence of microsomes results in the synthesis of polypeptides with apparent iV& of 44,500 and 43,000, respectively. 1n uitro translation of each transcript in the presence of microsomes results in the synthesis of two glycosylated, endoglycosidase H-sensitive proteins with apparent Mr of 47,500 and 46,000. These experiments and additional protease protection experiments demonstrate t.hat t.he COOH- terminal domain of both the short and the long form of

*This work was supported in part by Grants GM38310 and CA45799 from the National Institutes of Health. The costs of publi- cation of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertise- merit” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in thispaper ho-s been submitted to the GenBankTM/EMBL Data Bank with accession number(s) JO521 7.

q Supported by the National Science Foundation graduate fellow- ship program.

11 To whom correspondence and reprint requests should be ad- dresse& The Johns Hopkins School of Medicine, Oncology Center, Room l-127, 600 N. Wolfe Street, Baltimore, MD 21205.

bovine @1+4-galactosyltransferase are translocated into the microsomal lumen. By extrapolation, both forms of the enzyme are oriented in vivo as Type II membrane-bound glycoproteins.

UDP-Bl+4-galactosyltransferase (UDP-galactose:N-ace- tylglucosamine galactosyltransferase, EC 2.4.1.38) is a Golgi marker membrane-bound enzyme that functions in the bio- synthesis of N-linked oligosaccharide chains by catalyzing the transfer of galactose, from UDP-Gal, to the acceptor sugar, N-acetylglucosamine, forming bl+4-lactosamine [ Galbl+ 4GlcNAc] (Hill et al., 1968). fll+4-Galactosyltransferase can also interact with the hormonally regulated protein a-la&al- bumin (Brodbeck et ul., 1967). This complex (lactose synthe- t,ase; EC 24.122) is responsible for the biosynthesis of the disaccharide lactose. /31+4-Galactosyltransferase has also been localized to the cell surface of many cells and tissues where it may function as a receptor molecule in intercellular recognition and/or adhesion (Roseman, 1970; Shaper et ul., 1985; Lopez et ul., 1985; Bayna et al,, 198& Penno et al., 1989).

fil+4-Galactosyltransferase is a member of a functional family of enzymes termed glycosyltransferases. It has been estimated that there are at least 100 different membrane- bound enzymes that participate in the coordinate biosynthesis of diverse carbohydrate side chains found on glycoproteins and glycolipids. Structural characterization and subsequent comparison of these enzymes have been hampered by their low cellular abundance. Consequently, it has been difficult to obtain sufficient quantities of highly purified glycosyltrans- ferases by standard biochemical procedures. Recently, a num- ber of investigators have taken advantage of molecular cloning techniques to circumvent this problem and obtain detailed structural information.

cDNA clones for a number of terminal glycosyltransferases, including rat a2+&sialyltransferase (Weinstein et al., 1987), bovine al+3-galactosyltransferase (Joziasse et al., 1989), hu- man fucosyltransferase (Rajan et uZ., 1989), and bovine (Shaper et uZ., 1986; Narimatsu et ul., 1986; D’Agostaro et ul., 1989; Masibay and Qasba, 1989), human (Masri et al., 1988), and murine @1+4-galactosyltransferase (Nakazawa et ul., 198% Shaper et cd,, 1988) have been reported.

Comparison of the primary structures of the limited subset of glycosyltransferases for which sequences have been pub- lished has revealed several interesting patterns. First, there is essentially no sequence similarity between the different en- zymes. This is especially surprising for the two galactosyl-

3324

by guest on October 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Membrane Orientation of fil+4-Galactosyltransferase 3325

transferases, al+%galactosyltransferase and /31+4-galacto- syltransferase, and suggests that each enzyme has evolved independently. Second, in spite of the lack of sequence simi- larity, these enzymes have an identical protein domain struc- ture. Each enzyme has a large, potentially glycosylated, COOH-terminal domain containing the catalytic center, one transmembrane domain, and a short NHz-terminal domain. This protein domain structure indicates that the enzymes are topologically oriented as Type II membrane-bound proteins (Zerial et al., 1986), with the COOH-terminal, catalytic do- main positioned in the lumen of the Golgi and the NHz- terminal domain located in the cytoplasm. This orientation for pl+4-galactosyltransferase and &-&-sialyltransferase has been confirmed by immunolocalization of the COOH- terminal domains within the Golgi lumen (Roth and Berger, 1982; Roth et al., 1985).

in Shaper et al. (1988). The vector pGEM3 and all reagents for the in &ro transcription and translation experiments were purchased from Promega Biotec, Inc. RNase-free DNase, the Klenow fragment of DNA polymerase I, and RNA molecular size standards were from Bethesda Research Laboratories. [%]Methionine and [‘%]protein

In contrast to the genes for al+3-galactosyltransferase and a2-&-sialyltransferase which each specify a single gene prod- uct, the gene for murine @l-+4-galactosyltransferase is un- usual in that it specifies two closely related proteins which differ only in the length of their NHZ-terminal domains; the long form of bl-&galactosyltransferase has an NH*-terminal extension of 13 amino acids. Originally it was suggested that the NH*-terminal domain of the long form of murine pl+4- galactosyltransferase contains features of a functional cleav- able signal sequence (Shaper et al., 1988). A cleavable signal sequence would dictate that the long form of @1+4galacto- syltransferase is oriented as a Type I membrane-bound pro- tein, with its COOH-terminal catalytic domain positioned in the cytoplasm. This orientation is intriguing in light of the discovery of O-linked GlcNAc residues on several nuclear and cytoplasmic proteins (Holt et al., 1987, a and b). The addition of GlcNAc has been proposed to take place in the cytoplasm and consequently is spatially separated from the N- and O- linked glycosylation pathways of the endoplasmic reticulum and Golgi. It is not known if oligosaccharides containing O- linked GlcNAc are present. Nevertheless, we have speculated that there is a form of /3l-&galactosyltransferase, with its catalytic domain cytoplasmically oriented, which participates in the assembly of oligosaccharide side chains containing O- linked GlcNAc (Shaper et al., 1988).

In this report we show that the gene for bovine pl-+4- galactosyltransferase specifies two structurally related forms of the enzyme. The amino acid sequence of the NH*-terminal domain of the long form is highly conserved in comparison with its murine counterpart, and, consequently, it potentially contains a cleavable signal sequence. We have directly tested if this domain contains a functional cleavable signal sequence by in uitro translation of transcripts for each form of bovine @1+4-galactosyltransferase in the presence and absence of dog pancreas microsomes. Because the COOH-terminal do- main of the enzyme contains two potential N-linked glyco- sylation sites (amino acid residues 90 and 117, Fig. 1), an increase in apparent molecular size upon in u&o translation in the presence of microsomes is diagnostic for translocation of the COOH-terminal domain into the microsomal lumen. This feature has allowed us to demonstrate that the COOH- terminal domain of both the long and the short form of bovine @l-+&galactosyltransferase is translocated into the microso- ma1 lumen. By extrapolation, both forms of the enzyme are oriented as Type II membrane-bound glycoproteins. The po- tential biological significance of the two forms of fil-& galactosyltransferase will be discussed.

EXPERIMENTAL PROCEDURES

Material3

Reagents used in construction of the primer extension cDNA library and the Sl and primer extension analyses were as described

molecular size standards were purchased from Amersham Corp. En- doglvcosidase H was from Genzvme Corn., Trasvlol was from Mobay Ch&ical Corp., and proteinas; K was from Boihringer Mannhe& GammaBind G-Agarose was from Genex Corp., and fluorographic enhancer was from Amersham Corp. or EM Corp.

Construction and Screening of a Primer Extension Bovine cDNA Library

Poly(A)+ RNA was prepared from MDBK’ cells (ATCC No. CCL 22) as previously described (Shaper et al., 1986). Two single-stranded oligomers, 5’-CCTCAGGGCATGCGGTCAGCGAGCG-3’ and 5’- GCTCCACAAGCTTCAGGTCCACAGG-3’. comulementarv to nu- cleotides at positions 409-385 and 478-454, rkspeciively (Fig: 11, were annealed to MDBK poly(A)+ RNA and extended by reverse transcrip- tion. Double-stranded cDNA was synthesized, ligated into the unique EcoRI site of ,QtlO, and packaged as previously described (Shaper et al., 1988). An EcoRI-SmaI fragment from the 5’-end of clone 7A (nucleotide positions l-131, Fig. 3, Shaper et al., 1986) was used to screen approximately 4 x 10’ independent recombinants. Twenty hybridization-positive clones were identified, and those with inserts >200 bp were sequenced.

Sl N&ease Protection and Primer Extension

Sl nuclease protection was performed as previously described (Shaper et QZ., 1988). A 529-bp radiolabeled probe complementary to the transcribed sequence was prepared by subcloning into Ml3. The probe contained 251 bp of bovine ,!?l+&galactosyltransferase se- quence complementary to nucleotides -23 to 228 (Fig. 1), in addition to 26 bp of Ml3 sequence at its 5’-end and 252 bp of QtlO sequence at its 3’-end. Primer extension analysis was carried out essentially as described (Shaper et al., 1988), using a 200-bp radiolabeled primer complementary to nucleotides 231 to 407 of bovine fll-&galactosyl- transferase (Fig. 1) that included 24 bp of Ml3 sequence.

Vectors /or in Vitro Transcription

pTGT-A modified form of cDNA clone 7A, in which a BamHI- S&I linker. 5’-GATCCAAAATAATGGGAGCT-3’. was lieated to the SstI siie at the 5’-end of clone 7A (nucleotide p&ition 526, Fig. l), was kindly provided by Dr. Eliot Rosen (Am&ican Biogenetic S&ems. South Bend, IN). This modification chanced the Ser residue ai amin; acid positioh 6.of clone 7A to a Met (Siaper et al,, 1986). The resulting 1014-bp fragment was excised from pBR322 with BamHI and BclI and then ligated into the BamHI site of pGEM3, yielding pTGT, which encodes a truncated form of ,%+4-galactosyl- transferase (Fig. 4A). Orientation of the insert was determined by restriction mapping. Plasmids containing inserts in the sense and antisense orientation with respect to the SP6 promoter were linear- ized with PuuII prior to transcription.

pSGT-Bovine fll-&galactosyltransferase cDNA clone 44, cor- responding to nucleotide position 23 to 477 (Fig. l), contains an in- frame ATG at nucleotide position 40. Clone 44 and clone 7A were ligated at the unique S&I &te (nucleotide position 226, Fig. l), and the resulting 1544-bp fragment was ligated into the EcoRI site of pGEM3, yielding pSGT which encodes the short form of pl+4- galactosyltransferase (Fig. 4A). Plasmids containing the insert in the sense and antisense orientation with respect to the SP6 promoter were linearized with BgZI and treated, just prior to transcription, with the Klenow fragment of DNA polymerase I in order to convert the 3’-overhang to a blunt end.

pLGT-Bovine @l-&galactosyltransferase cDNA clone 118, cor- responding to nucleotide position -23 to 407 (Fig. 1), contains two in-frame ATG codons at nucleotide positions 1 and 40. Clone 118 and clone 7A were ligated at the unique SstI site and then subcloned into the EcoRI site of pGEM3, yielding pLGT which encodes the long form of bid-galactosyltransferase (Fig. 4A). Plasmids containing the insert in the sense and antisense orientation with respect to the

* The abbreviations used are: MDBK, Madin-Darby bovine kidney; bp- base pair(s); Hepes, 4-(2-hydroxyethyl)-l-piperazineethanesul- fonic acid.

by guest on October 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

3326 Membrane Orientation of /3l-&Galactosyltransferase

SP6 promoter were linearized with BglI and treated with Klenow fragment as described above.

Transcription

Synthesis of the transcripts was carried out according to manufac- turer’s instructions. Two pg of linearized plasmid in 50 ~1 of reaction mix was used as the template for SP6 RNA polymerase. The ‘mGpppG cap analog was not included since preliminary experiments showed no difference in translation efficiency between capped and uncapped RNA (data not shown). Aliquots of each reaction were electrophoresed on formaldehyde-agarose gels with RNA molecular size standards in order to determine the size and concentration of the transcript synthesized. Yields of 5-10 pg of RNA were obtained per reaction. Aliquots containing 0.25-0.5 @g/PI RNA were stored at -7OOC.

HCl, pH 7.4,lOO mM NaCl, 0.25 M sucrose) or 10 ~1 of protease buffer containing 1% Triton X-100. Two ~1 of proteinase K (100 pg/ml in protease buffer) was added, and each sample was incubated on ice for I h. Five ~1 of phenylmethanesulfonyl fluoride (100 mM in anhydrous isopropyl alcohol) was added to stop the reaction prior to immuno- precipitation.

Translation

Wheat germ extracts or rabbit reticulocyte lysates, in the presence or absence of canine pancreas microsomes, were used for translation. Reactions were carried out according to manufacturer’s instructions in a volume of 25 ~1 containing 1 ~1 of RNA. [35S]Methionine (15 mCi/ml) was used to radiolabel the product, and, after a 60-min incubation at 30 ‘C, the reaction was terminated by placing the tubes on ice.

Immunoprecipitation of the in uitro translated polypeptides was performed as described by Anderson and Blobel(l983). A rabbit anti- bovine @l-+&galactosyltransferase IgG fraction (Shaper et al., 1985), which had been purified on a Protein A-Sepharose column and diluted to a final concentration of 360 pg/ml in a buffer containing 10 mM Hepes, pH 7.1, 150 rnM NaCl, 10 mg/ml bovine serum albumin, was used as the primary antibody. Immune complexes were precipitated by the addition of GammaBind GAgarose. The washed resin was heated for 30 min at 65 ‘C in 4 volumes of Laemmli sample buffer (Laemmli, 1970) containing 5% sodium dodecyl sulfate and 1.25% @- mercaptoethanol. Aliquots were resolved on a 12% sodium dodecyl sulfate-polyacrylamide gel with 5% stacking gel. After electrophoresis, gels were fixed in 50% methanol, 16% acetic acid, treated with fluorographic enhancer, dried, and placed under film at -70 -C.

RESULTS

Endoglycosidase H treatment was performed essentially as de- scribed by Schmid and Spiess (1988). A 12.5-~1 aliquot of the trans- lation mixture was added to 37.5 ~1 of solubilization buffer (50 mM sodium citrate, pH 6, 1% sodium dodecyl sulfate) and heated for 30 min at 65 OC. Samples were diluted by the addition of 150 ~1 of 50 mM sodium citrate, pH 6. Two hundred kallikrein inactivator units of Trasylol, 4 ~1 of endoglycosidase H (2 milliunits/pl in 50 mM sodium phosphate, pH 6), and 2 ~1 of phenylmethanesulfonyl fluoride (100 mM in anhydrous isopropyl alcohol) were added sequentially. Tubes were incubated at 37 ‘C for 30 min and placed on ice prior to immunoprecipitation.

Protease protection experiments were performed essentially as described by Rottier et al. (1987). A 20+1 aliquot of the translation mixture was treated with either 10 /.d of protease buffer (50 rnM Tris-

Isolation of cDNA Sequence Encoding the Transmembrane and Amino-terminal Domains of Bovine ,M-+Galactosyl- transferase-A 131-bp probe, derived from a region near the 5’-end of cDNA clone 7A, was used to isolate 20 cDNA clones from a primer extension bovine cDNA library. One of the clones isolated, clone 44, corresponds to nucleotide position 2 to 477 (Fig. 1) and contains one in-frame ATG codon at nucleotide 40. Because the sequence of this clone was shorter than both the full length murine (Shaper et al., 1988) and human (Masri et al., 1988) cDNA clones reported, additional clones were examined. Clone 118 was identified which corre- sponds to nucleotide position -23 to 407 (Fig. 1) and contains two in-frame ATG codons at nucleotide positions 1 and 40. Ligation of clone 118 to clone 7A at the unique St1 site

-23 I 30 I I I

CCCTC~~GCGGCGGCCGMGAT~G~CGGGAGCCGCTCCTGGGCGGCAGTGCCGCGATGCCG !,ETLysPheArgGluProL.d.euGlyGlySerAl~l.dETPro b

*ra GlnPhe q

60 90 12ll I I I

GC~GCCTCCCTGCAGCGGGCCTGCCGCCTCCTCGTGGCTGTCTGCGCCCTGCATC~GGCGTCACC~TCGTCTATTACCTGGCCGGCCGA ClyAlaSerL~~Gl~r~l~Cy~A~~~~L~~V~lAl~V~lCy~AI~L~~~~L~~GlyV~~ThrLe~V~lTy~Ty~LeuAlaGlyA~g b

Thr ser m

150 100 210 I I + I

GACCT*GACGCCTGCCTCAGCTGGTCGGAGTCCACCCACCGC~CAGGG~GCTCTCACGGCGCCGCCGCTATCGGGCAGCCCTCCGGG ~~p~~~~~~g~"P~~Gl~~~V~lGlyV~lH~~P~~P~~~~Gl"GlyS~~S~~Hi~GlyAl~l~lall~GlyGlnP~oSerGly b

Se= serseuhr GlyThrAsn SerLys Pt.0 m

240 270 mo I I I

CACCTCCCCCTGCGAGGGGTCGCACCGCCGCCGCCTTTGCAG~CTCTTCC~GCCGCGCTCGCGGGCCCCCTCC~CCTAGACGCGTAC G~~~~~~~~~~~~G~~V~~A~~P~~P~~P~~P~~~~~G~~~~S~~S~~L~~P~~A~~S~~A~~~~P~~S~~A~~~~~~~A~~T~~ b

c1n Pm *hArg GlyVd PI-0 ..~.----.-.-.-.... serser m

330 360 390 I I I

TCTCACCCCGCCCCTCGCCCGCGCCCGGGGAGC~C~GAC~CGGCCCCAGTGCCCTCCAC~~CA~GCTCGCTGACCG~ S~~Hi~P~~ClyP~~ClyP~~GlyP~~GlyS~~A~"L~~~~S~~Al~P~~V~lP~~Se~~r~~~~AKgSe~~U~KAl~CySP~O b P~oclyAla.4laseK LeuLy* ser Leu Thr GlyLeu*** Pt% q

420 450 400 I I I

~ACTCCCCCCTCCTCGTCGGCCCCATGCTGATTGAG~T~CATACCTGTGGAC~CTTG~GAGCAGCAG~CCCG~GGTG Gl~Cl~S~~P~~~~~~~~V~lG~yP~~~~tL~~ll~Gl~Ph~A~~ll~P~~V~lAsp~uLys~uValGluGlnGl~~nP~oLy~V~l b

ASP Ah Glu Lelk4l~LysLys GluIle q

FIG. 1. The nucleotide sequence of the 5’-region of cDNA encoding hovine fll+4-galactosyltrans- ferase and the predicted amino acid sequence. The single open reading frame, beginning at the first ATG codon, is shown directly below the nucleotide sequence which is numbered in the 5’ to 3’ direction. Nucleotides are numbered above the sequence, and those 5’ of the first in-frame ATG codon are assigned negatiue numbers. The putative transmembrane domain is italicized. Amino acid differences between the bovine (b) and murine (m) sequences (Shaper et al., 1988) are indicated beneath the bovine amino acid sequence. The 5’-end of the partial bovine clone 7A (Shaper et al., 1986) is indicated by the arrow at nucleotide position 203. A deletion in the murine amino acid sequence is indicated by the dashed lirze, and the single insertion in the murine sequence is indicated by asterisks which are read as Leu-Ser. Underlined seqmnces at nucleotide positions 385-409 and 454-478 are complementary to the single-stranded primers used to construct the primer-extended library.

by guest on October 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Membrane Orientation of ~l-&Galactosyltransferase 3327

(nucleotide position 226, Fig. 1) yields a cDNA clone that mentary to nucleotides 231-407 in Fig, 1) was hybridized to contains the complete coding sequence of bovine /31+4-gal- 20 Kg of E. coli RNA (Fig. 3, lune 1) or 4 pg of MDBK poly(A)+ actosyltransferase. The nucleotide and predicted amino acid RNA (Fig. 3, lane 2). After extension with reverse transcrip- sequence of the 118/7A construct is shown in Fig. 1 (see Fig. tase, the products were analyzed by polyacrylamide gel elec- 3, Shaper et ul., 1986, for the translated primary sequence of trophoresis. Extension products of 420, 740, and 770 bp are the COOH-terminal domain of bovine fll+4-galactosyltrans- seen in lane 2 which are absent from the control. The 5’- ferase). The cDNA sequence reported here is virtually iden- boundary of the transcript represented by the shorter species tical with the sequences recently reported by D’Agostaro et maps approximately to nucleotide 10 in the region between al., 1989 and Masibay and Qasba, 1989. the first two in-frame ATG codons; the longer species repre-

Comparison of the bovine cDNA sequence to the murine sent transcripts extending to nucleotide -310 and -340. and human sequences shows that the two in-frame ATG Analysis of the Predicted Open Reading Frame-The Sl codons are conserved at nucleotide positions 1 and 40 in the and primer extension analyses show that there are two sets bovine and murine sequences (Fig. 1) and at nucleotide posi- of transcripts that encode bovine Bl-&galactosyltransferase. tions 1 and 37 in the human sequence (Masri et ul., 1988). The shorter set initiates between the first two in-frame ATG Furthermore, a comparison of the bovine, murine, and human codons (Fig. l), while the longer set initiates approximately coding sequences for the NH*-terminal and transmembrane 300 bp upstream of the first in-frame ATG codon. Both ATG domains reveals a greater than 80% similarity at the amino codons are preceded by a purine in the -3 position, the most acid level. crucial position in the eukaryotic consensus translation ini-

Two Different Sets of mRNA Transcripts Encode Bovine tiation sequence (Kozak, 1986a), suggesting that both are ~l-&Galactosyltransferue-Sl nuclease protection assays potential translation initiation sites. The open reading frame were performed in order to both confirm that mRNAs co- of the short message predicts a polypeptide of 389 amino linear with the primer-extended sequence exist in the MDBK acids, M* = 43,450 (SGT, Fig. 4B). The open reading frame mRNA population and to determine if different sized tran- of the long message predicts a polypeptide of 402 amino acids, scripts are present. A 529-bp probe was hybridized to 20 pg Mr = 44,810 (LGT, Fig. 4B). The only difference between the of yeast tRNA (Fig. 2, lune 1) or 4 pg of MDBK poly(A)+ two polypeptides is that the long form contains an NH*- RNA (Fig. 2, lane 2) and then digested with Sl nuclease and terminal extension of I3 amino acids. electrophoresed on a 7% polyacrylamide-urea gel. Two pro- In Vitro Transcription and Translation-In order to estab- tected fragments were observed. The 25I-bp species repre- lish that both of the first two in-frame AUG codons can act sents a full length protection of the probe; the 220-bp species as translation initiation sites and to verify that corresponding maps approximately to nucleotide 10 which corresponds to polypeptides of the predicted molecular size are synthesized, the region between the first two in-frame ATGs. When a longer probe (508 bp) was used, a protected species that maps A to the region between the first two in-frame ATGs was also seen in poly(A)+ RNA isolated from either MDBK cells or M 1 2

calf thymus (data not shown). Confirmation of the results from the Sl analysis was pro-

vided by primer extension analysis. A 200-bp primer (comple-

I 2

634- 520- P@ - -529

453 -

99a- .--..$ .=,. . . --- M//U -740

634 -

520 - 453 - ibr&d ~-420

296 -

220- +220 AUG AUG

B + 5’ w ! , , 3, -300 I 100 200 300 400

ATG ATG

5l 1 + +

I I 50

I 251

‘* Protected FIG. 3. Primer extension analysis. A 200-bp radiolabeled

mimer, comnlementary to nucleotides 231 to 407 (Fig. I) including t

Z?CI ,~ , Species 24 bp of Ml> polylinker DNA at its 5’.end, was used for the primer extension analysis. PuneL A: lane 1, 20 pg of E, co/i RNA; lune 2, 4 pg

FIG. 2. Sl nuclease protection analysis. The probe used for of MDBK poly(A)+ RNA. Specific extension products are marked to analysis contained 251 bp of bovine fil+4galactosyltransferase se- quence complementary io nucleotides -2s to 228 (bold Laze), in

the rigfzt with arrou~s. Molecular size markers (M) are EcoRI/Hinff - digested pBR327 in base pairs. Pund S, a schematic representation

addition to 26 bn of IVIl3rnnll seauence at its 5’ end. and 252 bn of AgtlO sequence at its 3’- end. La& 1,20 pg of yeast tRN4 &e-2,4

of the 5’-end of the bovine fll+4-galactosyltransferase transcript. The bold Line indicates coding sequence, the thin line indicates 5’-

pg of MDBK poly(A)+ RNA. The position of specific Sl nuclease untranslated sequence. The numbers indicate nucleotide position, products are marked to the right with czrrou~.s, and the band repre- and the AU& at position 1 and 40 are shown. Panel C, the primer is senting undigested probe is marked with a line. The position of EcoRI/ indicated by the bold Line, and the extended products are indicated Hi&I-digested pBR327 molecular size markers are indicated with by the thin line. The vertical urrow denoted the termination point of --. lanes. Molecular sizes are given in base pairs. the 740.bp species.

29a- . . . “La.4

by guest on October 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Membrane orientation of $14~Galactos~ltransfera~se

B M TGT 329 A A I> y I

M SGT 389A.A I

MM LGT 4OZAA I'- ' '

FIG;. 4. I’c~rzc/ .,I, diagrammatic representation of vectors for in t’l(rYj transcription containing :jl ~~-~alactos~ltransferase cDNA ill- wrts ivhich differ at their 5’.ends. Pklsmids containing cDNA inserts enfodin~ t runcaied, short. and tong ,jlj~-~~ltactos~ttrallsferase are referred to as p’IY;T. p%T, and pLGT. respectively. Horizontd /inw represent noncoding sequences contributed by pCEM3 plasmid DNA C t/?ir? /irlw) and ,jl~~-~al~lctos~ttraIlsferase cDNA (heav.x /~nrsJ. The SI% RNA potymerase promoter is shown hy the dark ,squarv. The open rc,cff~rg/w represent sequences coding for ~~l~~-~atactos~ltraIls- ltirase (see “Kxperimentat Procedures” for plasmid construction). Restriction sites are indicated for /%/nHI (B), KcoRI (k). and .%!I (.Y). ATC;b mark possible iwframe translation initiation codons. /‘~nv/ B% diagrammatic representation of in Lshro translated 131-4 ~~lt~l~t(~s~ltr~~nsfer~tse polvpeptides which possess amino-terminal do- mains oi different lengtt& TC>T. XT. and LC;T refer to truncated. short. and tong ‘jl~~-~alactos~ltransferase polypeptides, respec- t ively: the predicted size of each protein in amino acid residues (A.A.) is indicated. The ~\~in hrimnkd /ine represents primary amino acid squence. and the predicted transmembrane domain is shown by the C/C/~/: wc/~n~/v. Consensus sites for )V-linked oligosaccharide ad&tion (Y) are shown. Methionines (A4) in the NH2-terminal domain are indicated.

appropriate plasmid constructs were utilized as templates for RNA transcription in vitro. The plasmid containing the “trun- cated @l-&galactosyltransferase” insert (pTGT) lacks the sequence that encodes bot,h the NHZ-terminal and transmem- brane domains. The plasmid cont,aining the “short Pl-+4- galactosyltransferase” insert (pSGT) lacks adenine at nucleo- tide position 1, and, consequently, translation can only initi- ate at the downstream in-frame AUG codon at nucleotide position 40. The plasmid containing the “long Bl-&galac- tosyltransferase” insert (pLGT) includes both in-frame AUG codons at nucleotide positions 1 and 40. The three plasmid constructs and the corresponding forms of the Pl+4-galac- tosyltransferase protein (TGT, SGT, and LGT) are diagram- matically represented in Fig. 4.

RNA transcripts that were synthesized from the three vectors described above were translated in vitro using wheat germ extracts in the presence of [‘%]methionine. After im- munoprecipitation, the proteins were resolved by sodium do- decyl sulfate-polyacrylamide gel electrophoresis and detected by fluorography. As seen in Fig. 5, the apparent iMr of the in vitro translated proteins are 36,500 (lczne l), 43,000 (lane 21, and 44,500 (/czne 3). These sizes agree with the predicted molecular weights of 37,200, 43,500, and 44,800 for TGT, SGT, and LGT, respectively. In addition, a band at a position corresponding to 43,500 is not seen in lane 3, indicating that translation only initiates at the first in-frame AUG of the LGT transcript. Furthermore, when each of the three /jl+4- galactosyltransferase transcripts were translated using rabbit reticulocyte lysates, which reportedly are more likely to ini-

I23 69 -

46 -

36.5+ m

30 - FIG. 5. In LGPO translation of truncated, short, and long

bl+4-galactosyltransferase. RNAs transcribed from the vectors shown in Fig. -iA were translated in wheat germ extracts in the presence of /“S]methionine. The in ~iltv translation products \vere resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and detected by fluorography. ~wze,s 1, 2, and 3 show TC;T, SGT, and LGT, respectively. The positions of protein markers are indicated to the /e/t. The position of in uitro translated proteins are indicated by orrows. Protein molecular sizes are given in kDa.

123456789 MS + + + + + + Endo H + + +

69-

46-

30-

FIG;. 6. Endoglycosidase H treatment of in &ro translated polypeptides. RNA transcribed from pT(2T (~arzes J-J), p%T (/anes 4-E), or pLC;T (~arws 7-9) was translated in rabbit reticulocyte lysates in the presence of [“%]methionine, and in the absence or presence of dog pancreas microsomes (ML?). Aliquots of the latter were treated with endoglycosidase H (Endo H). Proteins were re- solved by sodium dodecyt sulfate-polyacrylamide gel electrophoresis and detected by fluorography. The positions of protein markers are indicated to the /e/f. Protein molecular sizes are given in kDa.

tiate translation at internal AUGs (Kozak, 1986b), polypep- tides identical in size with those shown in Fig. 5 were also obtained (see lcznes 1, 4, and 7 in Fig. 6). These data indicate that translation of the longer size set of mRNA transcripts detected by the Sl and primer extension analyses does not produce the two sizes of @l-4-galactosyltransferase polypep- tide as a consequence of leaky scanning (Kozak, 1986b).

Analysis of the Orientation of SGT and L(iT-As pointed out above, the NHJ-terminal domain of the long form of both bovine (1,GT) and murine /jl+4-galactosyltransferase con- tains structural features of a cleavable signal sequence. These features include a short, basic NHj-terminal region, a central hydrophobic region, and a COOH-terminal region which be-

by guest on October 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Membrane Orientation of bl+4-Galactosyltransferase

gins with a helix-breaking residue. If, as proposed, bovine LGT contains a cleavable signal sequence, then this form of the enzyme would be oriented as a Type I membrane-bound protein with the COOH-terminal domain positioned in the cytoplasm of the cell. In contrast, SGT, which lacks the putative cleavable signal peptide, would be oriented as a Type II membrane-bound glycoprotein with its COOH-terminal domain located inside the lumen of the Golgi compartment (see Zerial et ul., 1986 for a discussion of Type I and II transmembrane proteins).

In order to determine if the NHt-terminal domain of LGT functions as a cleavable signal sequence, each of the fll+4- galactosyltransferase transcripts described above was trans- lated using rabbit reticulocyte lysates in the absence or pres- ence of dog pancreas microsomes. The translated proteins were immunoprecipitated, and their size was estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Because the COOH-terminal domain of the enzyme contains two potential N-linked glycosylation sites (amino acid resi- dues 90 and 117, Fig. l), an increase in apparent molecular size upon in uitro translation in the presence of microsomes is diagnostic for translocation of the COOH-terminal domain into the microsomal lumen. As seen in Fig. 6, the resulting TGT polypeptide is 36.5 kDa in size in the absence of micro- somes (brie l), in the presence of microsomes (lune 2), or after endoglycosidase H treatment (lune 3), consistent with the prediction that TGT is a soluble protein excluded from the microsomal compartment. In contrast, the apparent Mr of both SGT and LGT increases by -3000 after translation in the presence of microsomal membranes (Fig. 6, lunes 4, 5 and 7, 8). Subsequent endoglycosidase H treatment removes -2.5 kDa from both SGT and LGT (Fig. 6, lunes 6 and 9). This suggests that at least one and possibly both potential sites for N-linked glycosylation are modified. The glycosyla- tion of SGT and LGT demonstrates that each Bl+4-galac- tosyltransferase isoform is oriented with its COOH-terminal domain, containing the catalytic site, within the microsomal lumen. Therefore, LGT does not contain a cleavable signal sequence.

These results were further supported by experiments in

I23 4 MS ++ + Prot K + + Triton +

69-

46-

mm

30-

5 6 7 8 9 IO ii I2 +++ +++

+ + + + + +

-m -m ” m --

FIG. 7. Proteinase K treatment of in vitro translated poly- peptides. RNA transcribed from pTGT (lanes l-4), pSGT (lanes 5- 8), or pLGT (lanes 9-12) was translated in rabbit reticulocyte lysates in the presence of [%]methionine and in the absence or presence of dog pancreas microsomes (MS). Aliquots of the latter were treated with proteinase K (Prot K) in the absence or presence of Triton X- 100 (?Motz). Proteins were resolved bv sodium dodecvl sulfate- polyacrylamide gel electrophoresis and deiected by fluorography. The positions of protein markers are indicated to the lejt. Protein molec- ular sizes are given in kDa.

which the polypeptides were synthesized in the presence of intact microsomes and then subjected to proteolysis. TGT is completely digested after the addition of proteinase K, in the presence or absence of Triton X-100, consistent with the prediction that TGT is excluded from the microsomal com- partment (Fig. 7, lunes 3 and 4). In contrast, both SGT and LGT are resistent to protease digestion in the presence of intact microsomes (Fig. 7, lunes 7 and 11). However, after addition of Triton X-100, both polypeptides are susceptible to protease digestion (Fig. 7, lanes 8 and 12).

DISCUSSION

The Gene for Bovine /31-+4Guluctosyltransferuse Specifies Two Sets of mRNA Transcripts Thut Contuin Different Truns- lution Znitiution Sites-We have isolated and characterized a cDNA clone that completes the full length coding sequence for bovine pl+4-galactosyltransferase. Sl nuclease protec- tion and primer extension analyses show that two size sets of mRNA transcripts are present, one of which initiates in the region between the first two in-frame ATG codons and one of which initiates upstream of the first in-frame ATG codon. The presence of two size sets of transcripts encoding two structurally related forms of pl+4-galactosyltransferase has also been observed with murine @l--+4-galactosyltransferase (Shaper et al., 1988).

Zn vitro translation of the transcript which initiates either upstream or between the first two in-frame ATG codons produces two forms of bovine fll+&galactosyltransferase polypeptide which differ in size by -1.5 kDa. The data show that each of the mRNAs specified by the @1+4-galactosyl- transferase gene can function in translation. Furthermore, since in uitro transcription and translation of pLGT does not result in two size forms of Bl+4-galactosyltransferase, SGT is not generated by “leaky scanning.” Translation of bovine @1+4-galactosyltransferase, therefore, initiates only at the first in-frame AUG codon of each mRNA transcript, consist- ent with the scanning model for translation (Kozak, 1989).

Two forms of human /3l-&galactosyltransferase have been identified in HeLa cells. Pulse metabolic labeling with [‘5S] methionine in the presence of tunicamycin, followed by im- munoprecipitation, resulted in the detection of two molecular weight forms of 42,000 and 44,000 (Strous et ul., 1983). Similar results have been obtained from immunoprecipitation of hu- man ~l-&galactosyltransferase, following in uitro transla- tion of total RNA from HeLa cells in wheat germ extracts (Strous et ul., 1988). Based on these results and the recently reported sequence for human pl+4-galactosyltransferase (Masri et al., 1988) in which there are also two in-frame methionines separated by 12 amino acids, we predict that the human gene also specifies two size sets of mRNAs. Transla- tion of these two sets would result in two forms of human fll-+4-galactosyltransferase as a consequence of initiation at the first in-frame methionine of each transcript.

The NHz-terminul Domain of the Long Form of b1-d Gulactosyltrunsferuse Does Not Contuin u Cleuvuble Signul Sequence-We have suggested that the NH*-terminal domain of the long form of bovine pl+4-galactosyltransferase con- tains a cleavable signal sequence and consequently would be oriented with its COOH-terminal domain within the cyto- plasm of the cell. Correspondingly, in an in vitro translation system, the molecular size of LGT should not increase in the presence of dog pancreas microsomes, for the oligosaccharide attachment sites would be excluded from the microsomal compartment. However, since both SGT and LGT increase in apparent molecular size when synthesized in the presence of microsomes and are sensitive to endoglycosidase H, each

by guest on October 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

3330 Membrane Orientation of pl4-Galactosyltransferase

form is in fact oriented with its COOH-terminal domain, containing the oligosaccharide attachment sites and the cat- alytic center, sequestered in the microsomal lumen, This result has been confirmed by the protease protection experi- ments which show that both SGT and LGT are protected from protease digestion by the microsomal membrane. By extrapolation, SGT and LGT exist as Type II membrane- bound glycoproteins in the cell, with their NH*-terminal domains positioned in the cytoplasm and their COOH-ter- minal domains located within the Golgi lumen. This finding is consistent with earlier experiments which demonstrated that protease treatment of intact rat liver or HeLa cell micro- somes does not digest fil+4-galactosyltransferase (Fleischer, 1981; Strous et ul., 1983), and that the enzyme active site is inaccessible to exogenous large protein substrates in intact rat liver microsomes (Fleischer, 1981).

Functional Significance of the Two ~1+4Galactosyltrans- ferase Isoforms-We have demonstrated that in vitro, SGT and LGT are both oriented with the COOH-terminal domain sequestered within the microsomal compartment and the NH*-terminal domain excluded. 1n uivo, the difference in length between the cytoplasmic, NHZ-terminal domains of the two /31+4galactosyltransferase isoforms (11 amino acids for SGT and 24 amino acids for LGT) may be of functional significance. In several examples in which two protein iso- forms have been synthesized as a consequence of alternative translation initiation (Kozak, 1988), each form of the protein targets to a different cellular compartment. As pointed out in the introduction to the text, @l-&galactosyltransferase has been localized to two different membrane compartments, the trans-Golgi and the cell surface. Cell surface @l-4-galacto- syltransferase has been visualized directly over actin-contain- ing filaments after antibody-induced clustering in living MDBK cells (Shaper et al., 1985). It is tempting to speculate that the cytoplasmic NH2 terminus of either SGT or LGT interacts with cytoskeletal elements which preferentially di- rect one form to the plasma membrane (see also “Discussion,” Shaper et al., 1989). Alternatively, a protein analogous to yeast SEC7p, which has been postulated to interact with proteins on the cytoplasmic surface of the Golgi apparatus (Achstetter et al., 1988), may selectively interact with the NHZ-terminal domain of either SGT or LGT in order to selectively retain one form in the trun+Golgi. An example of such a signal is provided by the adenovirus E3/19K glycopro- tein, in which the last 6 amino acid residues of the cytoplasmic tail suffice to retain the transmembrane protein in the endo- plasmic reticulum (Nilsson et ul., 1989).

Effect of the Cytoplasmic Domain on Transit Time to the Cell Surfuce-The above considerations assume that each form of Bl+4-galactosyltransferase is selectively retained in a different membrane compartment. An alternative possibility is that both forms are found in both subcellular compart- ments. This result might not be totally unexpected since all integral membrane proteins transit through the Golgi en route to the cell surface. In this context, a role of the cytoplasmic domain in the surface expression of transmembrane proteins may be to modulate transit time through the endoplasmic reticulum and the Golgi. For example, a mutation which deleted the 12 amino acids from the cytoplasmic tail of the murine Ia antigen (Griffith et cd., 1988) increased the intra- cellular transit time about g-fold (half-life of >18 h uersus 2 h). Additionally, substitution of the cytoplasmic domain of vesicular stomatitis virus G protein (29 amino acids) with the cytoplasmic domain of the immunoglobulin pm heavy chain (3 amino acids) resulted in a 6-fold slower rate of transport of the chimeric molecule to the cell surface relative to the

wild-type vesicular stomatitis virus G protein (Puddington et ul., 1986).

By analogy, one can speculate about the cell’s requirement for two forms of fll+4-galactosyltransferase. To function as a resident tram-Golgi protein, a long transit time through this organelle would be required. Perhaps the short cyto- plasmic domain of /31+4-galactosyltransferase confers this property to the enzyme. For a biological function which re- quires the cell surface form of the enzyme, the long NH*- terminal domain could function to minimize transit time through the intracellular membrane compartments. In this context, our observation that murine germ cells, which appar- ently require the surface @l+&galactosyltransferase as a recognition/adhesion molecule, express only the long form of pl+4-galactosyltransferase is interesting (Shaper et ul., 1990).

Comparison of Three Glycosyltransferases-In an attempt to identify a common primary amino acid sequence motif, pl+4-galactosyltransferase was compared to two other truns- Golgi glycosyltransferases, al+3-galactosyltransferase and a2+6+ialyltransferase. The latter enzyme has also been lo- calized to the plasma membrane of different cell types (Taatjes et ul., 1988).

The protein domain structures of bl+4-galactosyltransfer- ase, al+3-galactosyltransferase, and &2+6-sialyltransferase are remarkably similar. Each enzyme has a large COOH- terminal domain containing the catalytic site oriented within the Golgi lumen, one transmembrane domain, and a short NH*-terminal cytoplasmic domain. The organization of the transcripts is also similar. Each has a long 5’-untranslated region (>150 bp) and an unusually long 3’-untranslated region (>2500 bp) that flank a coding region of about 1200 bp (Shaper et al., 1988, Weinstein et al., 1987, and Joziasse et al., 1989). However, the coding sequence of a2+6-sialyltransfer- ase does not contain a second in-frame ATG codon in the region specifying the NHZ-terminal domain; thus, only one form of this protein is translated. Interestingly, two sets of transcripts encoding al+3-galactosyltransferase were iden- tified which differ in size by about 350 bp. However, the 5’- ends of all of the transcripts originate upstream of the first in-frame ATG codon, indicating that this transferase is trans- lated as a single polypeptide (Joziasse et ul., 1989). These data suggest that the synthesis of two polypeptides, as a conse- quence of alternative translation initiation at one of two in- frame AUG codons, is not a characteristic feature of all glycosyltransferases, but may be unique for /?l-&galactosyl- transferase.

As discussed above, the three glycosyltransferases share no major primary sequence similarities. Based on this limited analysis, it is likely that a targeting address for trun.s-Golgi resident proteins may not be encoded by a non-degenerate and easily recognized linear amino acid sequence. Experi- ments are in progress to determine if, in fact, the cytoplasmic domains for the long and short form of /31+4-galactosyltrans- ferase specify retention time within the trun.s-Golgi compart- ment or transit time to the cell surface.

REFERENCES Achstetter, T., Franzusoff, A., Field, C., and Schekman, R. (1988) J.

Bid. Chm. 263,11711-11717 Anderson, D. J., and Blobel, G. (1983) Methock Enzymol. 96, lll-

120 Bayna, E. M., Shaper, J. H., and Shur, B. D. (1988) Cell 53,145-157 Brodbeck, U., Denton, W. L., Tanahashi N., and Ebner, K. E. (1967)

J. Biol. &em. 242, 1391-1397 D’Agostaro, G., Bendiak, B., and Tropak, M. (1989) Eur. J. Biochem.

183,211-217 Fleischer, B. (1981) J. Cell Biol. 89, 246-255

by guest on October 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Membrane Orientation of /31+4Galactosyltransferase 3331

Griffith, I. J., Ghogawala, Z., Nabavi, N., Golan, D. E., Myer, A., McKean, D. J., and Glimcher, L. H. (1988) Proc. N&l. Acad. Sci. U. S. A. 85,4847-4851

Hill, R. L., Brew, K., Vanaman, T. C., Trayer, I. P., and Mattock, P. (1968) Brookhauen Symp. Biol. 21, 139-154

Holt, G. D., Haltiwanger, R. S., Torres, C.-R., and Hart, G. W. (1987a) J. Biol. Chem. 262, 14847-14850

Holt, G. D., Snow, C. M., Senior, A., Haltiwanger, R. S., Gerace, L., and Hart, G. W. (1987b) J. Cell Biol. 104,1157-1164

Joziasse, D. H., Shaper, J. H., Van den Eijnden, D. H., Van Tunen, A. J., and Shaper, N. L. (1989) J. Biol. Chem. 264,14290-14297

Kozak, M. (1986a) Cell 44, 283-292 Kozak, M. (1986b) Cell 47, 481-483 Kozak, M. (1988) J. Cell Biol. 107, l-7 Kozak, M. (1989) J. CelZ Biol. 108,229-241 Laemmli, U. J. (1970) Nature 227,680-685 Lopez, L. C., Bayna, E. M., Litoff, D., Shaper, N. L., Shaper, J. H.,

and Shur, B. D. (1985) J. Cell Biol. 101,1501-1510 Masibay, A. S., and Qasba, P. K. (1989) Proc. N&l. Acad. Sci. U. S.

A. 86,5733-5737 Masri, K. A., Appert, H. E., and Fukuda, M. N. (1988) Biochem.

Biophys. Res. Common. 157,657-663 Nakazawa, K., Ando, T., Kimura, T., and Narimatsu, H. (1988) J.

Biochem. (Tokyo) 104,165-168 Narimatsu, H., Sinha, S., Brew, K., Okayama, H., and Qasba, P. K.

(1986) Proc. Natl. Acad. Sci. U. S. A. 63, 4720-4724 Nilsson, T., Jackson, M., and Peterson, P. A. (1989) Cell 58, 707-

718 Penno, M. B., Passaniti, A., Fridman, R., Hart, G. W., Jordan, C.,

Kumar, S., and Scott, A. F. (1989) Proc. N&l. Acud. Sci. U. S. A. 86,6057-6061

Puddington, L., Machamer, C. E., and Rose, J. K. (1986) J. Cell Biol, 102,2147-2157

Rajan, V. P., Larsen, R. D., Ajmera, S., Ernst, L. K., and Lowe, J. B. (1989) J. Biol. Chem. 264, 11158-11167

Roseman, S. (1970) C/rem Phys. Lipids 5, 270-297 Roth, J., and Berger, E. G. (1982) J. Cell Biol. 93, 223-229 Roth, J., Taatjes, D. J., Lucocq, J. M., Weinstein, J., and Paulson, J.

C. (1985) Cell 43, 287-295 Rottier, P. J. M., Florkiewicz, R. Z., Shaw, A. S., and Rose, J. K.

(1987) J. Biol. Chem. 262,8889-8895 Schmid, S. R., and Spiess, M. (1988) J. Biol. Chem. 263, 16886-

16891 Shaper, N. L., Mann, P. L., and Shaper, J. H. (1985) J. Cell. Biochem.

28,229-239 Shaper, N. L., Shaper, J. H., Meuth, J. L., Fox, J. L., Chang, H.,

Kirsch, I., and Hollis, G. (1986) Proc. N&l. Acud. Sci. U. S. A. 83, 1573-1577

Shaper, N. L., Hollis, G. F., Douglas, J. G., Kirsch, I. R., and Shaper, J. H. (1988) J. Biol. Chem. 263.10420-10428

Shaper, .N. LI, Wright, W. W., and Shaper, J. H. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 791-795

Strous, G. J., Van Kerkhof, P., Willemsen, R., Geuze, H. J., and Berger, E. G. (1983) J. Cell Biol. 97, 723-727

Strous, G. J., Van Kerkhof, P. V., and Berger E. G. (1988) Biochem. Biophys. Res. Commun. 151,314-319

Taatjes, D. J., Roth, J., Weinstein, J., and Paulson, J. C. (1988) J. Biol. Chem. 263, 6302-6309

Weinstein, J., Lee, E. U., McEntee, K., Lai, P.-H., and Paulson, J. C. (1987) J. Biol. Chem. 262, 17735-17743

Zerial, M., Melancon, P., Schneider, C., and Garoff, H. (1986) EMBO J. 5, 1543-1550

by guest on October 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from

R N Russo, N L Shaper and J H Shapertype II membrane-bound glycoproteins.

experiments demonstrate that both the short and the long forms of the enzyme areforms of the protein with different amino-terminal domains. In vitro translation

Bovine beta 1----4-galactosyltransferase: two sets of mRNA transcripts encode two

1990, 265:3324-3331.J. Biol. Chem. 

  http://www.jbc.org/content/265/6/3324Access the most updated version of this article at

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/265/6/3324.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at

by guest on October 17, 2018

http://ww

w.jbc.org/

Dow

nloaded from