Building-up of the plastid transcriptional machinery · The plastid transcriptional machinery is very complex. Many different components of the plastid transcriptional apparatus are

1

Building-up of the plastid transcriptional machinery …

corresponding Author

Silva Lerbs-Mache

Laboratoire Plastes et Differenciation cellulaire, Université Joseph Fourier and Centre

National de la Recherche Scientifique, B.P. 53, F-38041 Grenoble, France

Tel.: (33) (0)4 76 63 57 44; Fax: (33) (0)4 76 63 55 86

E-mail: [email protected]

Research category: Development and Hormone Action

Plant Physiology Preview. Published on September 8, 2006, as DOI:10.1104/pp.106.085043

Copyright 2006 by the American Society of Plant Biologists

www.plantphysiol.orgon July 2, 2020 - Published by Downloaded from Copyright © 2006 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

2

Building-up of the plastid transcriptional machinery during germination

and early plant development

Emilie Demarsy, Florence Courtois, Jacinthe Azevedo, Laurence Buhot and Silva Lerbs-

Mache

Laboratoire Plastes et Differenciation cellulaire, Université Joseph Fourier and Centre

National de la Recherche Scientifique, B.P. 53, F-38041 Grenoble, France



3

Footnotes:

This work was financed by the French Ministry of Research (ACI Biologie du

Développement et Physiologie Intégrative)

present address of L. Buhot:

The Sainsbury Laboratory, John Innes Centre, Colney Lane, Norwich, Norfolk, NR4 7UH,

UK

corresponding Author:

Silva Lerbs-Mache

Tel.: (33) (0)4 76 63 57 44; Fax: (33) (0)4 76 63 55 86

E-mail: [email protected]



4

Abstract

The plastid genome is transcribed by three different RNA polymerases, one is called PEP

(plastid-encoded RNA polymerase) and two are called NEPs (nucleus-encoded RNA

polymerases). PEP transcribes preferentially photosynthesis-related genes in mature

chloroplasts while NEP transcribes preferentially housekeeping genes during early phases of

plant development, and it was generally thought that during plastid differentiation the

building-up of the NEP transcription system precedes the building-up of the PEP transcription

system. We have now analysed in detail the establishment of the two different transcription

systems, NEP and PEP, during germination and early seedling development on the mRNA

and protein level. Experiments have been performed with two different plant species,

Arabidopsis thaliana and Spinacia oleracea. Results show that the building-up of the two

different transcription systems is different in the two species. However, in both species NEP

as well as PEP is already present in seeds, and results using Tagetin as specific inhibitor of

PEP activity demonstrate that PEP is important for efficient germination, i. e. PEP is already

active in not yet photosynthetically active seed plastids.



5

Introduction

The plastid transcriptional machinery is very complex. Many different components of the

plastid transcriptional apparatus are already known. For some of them the function has been

elucidated. At least three enzymes, PEP (Plastid-Encoded RNA Polymerase) and two NEPs

(Nucleus-Encoded RNA Polymerases), are implicated in plastid gene expression (for recent

reviews see Toyoshima et al., 2005 and Shiina et al., 2005). PEP is a eubacterial-type multimeric

enzyme. Gene order and organization have bacterial traits, i. e. genes coding the β (rpoB) and

β'/β'' subunits (rpoC1 and rpoC2) are arranged as operon analogous to the rif operon of E. coli

while the gene coding for the α subunit (rpoA) is arranged in another operon together with genes

coding for ribosomal proteins (reviewed in Igloi and Kössel, 1992). The expected molecular

masses for the PEP subunits of A. thaliana are 38 kD (α), 121 kD (β), 79 kD (β') and 156 kD

(β''). NEP enzymes (RPOTm, RPOTp and RPOTmp, for nomenclature see Azevedo et al.,

2006) are phage-type monomeric enzymes of about 110 kD. All three genes are nucleus encoded

and two of the resulting NEP enzymes (RPOTp and RPOTmp) are imported into plastids

(Hedtke et al., 2000; Azevedo et al., 2006). RPOTmp is also imported into mitochondria and

organelle targeting might be species-specific and developmentally regulated (Hedtke et al., 2000;

Kabeya and Sato, 2005). In plastids, specificity of promoter recognition and transcriptional

enhancement is brought about by nucleus-encoded transcription factors ranging from six

prokaryotic-type sigma factors (reviewed by Allison, 2000) up to specific DNA-binding factors

like CDF1 (Lam et al., 1988), CDF2 (Iratni et al., 1994), AGF (Kim and Mullet, 1995) and PTF1

(Baba et al., 2001).

According to this multiplicity of transcriptional components, different types of

promoters are found on the plastid genome: PEP, consensus-type NEP (class I) and

exceptional promoters (Class II, reviewed in Weihe and Börner, 1999). PEP promoters are

characterized by the eubacterial-type consensus sequences -10 and -35. Consensus-type NEP

promoters are characterized by the short consensus YRTA that resembles to the consensus of

mitochondrial promoters. Exceptional promoters differ from the class I promoters in two

respects. They do not have the YRTA consensus sequence and they are differently utilised

during plant development. While consensus-type promoters are mainly active in non-

photosynthetic cells, PEP and exceptional promoters are active in green tissues (reviewed in

Liere and Maliga, 2001). Most of the plastid transcription units are under control of PEP as



6

well as NEP promoters. Only few genes are transcribed only from a NEP promoter (e. g.

rpoB, accD) or only from a PEP promoter (e. g. rbcL, psbA).

RNAs encoding housekeeping functions (transcription/translation) reach maximal

abundance earlier in chloroplast development than RNAs encoding photosynthetic functions

(Baumgartner et al., 1993) and it has been hypothesized that the building-up of the NEP

transcription system precedes the building-up of the PEP transcription system (Mullet et al.,

1993). This hypothesis had been reinforced by two supplementary observations. (1) The plastid

rpoB operon is under control of a NEP promoter (Silhavy and Maliga, 1998; Liere and Maliga,

1999). (2) It had been shown that, in general, the expression of nuclear genes encoding plastid

proteins precedes the expression of chloroplast genes during germination, i. e. during early

phases of chloroplast development (Harrak et al., 1995). Since NEP is nucleus-encoded it was

likely to assume that during germination at first NEP is made. NEP will then transcribe

housekeeping genes (e. g. PEP encoding genes) during early phases of plastid differentiation

and PEP takes over transcription during later stages. However, experimental proof for this

hypothesis, based on expression studies of NEP and PEP during plastid differentiation, is still

lacking. To close this gap we have prepared specific antibodies against a number of proteins of

the NEP and PEP transcription system and we have analysed the expression of these

components of the two transcription systems on the RNA and on the protein level during

germination and early plant development, i. e. during the transformation of proplasts that are

present in dry seeds into chloroplasts of photosynthetically active cotyledons. Analyses have

been made with two different plant species, Arabidopsis thaliana and Spinacia oleracea.

Results

RNAs encoding NEP and PEP are already present in dry seeds of Arabidopsis

Germination experiments of A. thaliana have been carried out as previously described

and young plantlets have been analysed up to the 6th day after germination (Privat et al., 2003).

The developmental stages that have been used in the following experiments are shown in Figure

1A. RNA steady state levels corresponding to all RNA polymerase subunits and to all six sigma

factors have been analysed by semi-quantitative RT-PCR using cytoplasmic 18S rRNA as

control (Figure 1B and C). The absence of DNA in the RNA preparations has been verified by

direct PCR reaction without prior reverse transcription (Figure 1C, control-RT). RNAs coding



7

for all RNA polymerase subunits (RPOTmp, RPOTp, rpoA, rpoB, rpoC1, rpoC2) are already

present in dry seeds (Figure 1B, lane 1). Their quantity augments immediately during imbibition

(lane 2) and drops down progressively during later developmental stages. Messenger RNAs

coding for RPOTmp and RPOTp increase again at stage 6 when primary leaves start to emerge

(lane 8). The augmentation of all mRNA levels from stage 0 to 0+ indicates that nucleus-

encoded RPOT genes as well as plastid-encoded rpo genes are transcribed immediately after the

onset of imbibition. In contrast to this general raise of mRNAs encoding RNA polymerase

subunits (Figure 1B), sigma factor genes are differentially expressed during germination and

early seedling development (Figure 1C). SIG2 and SIG5 mRNAs are already present in dry

seeds (Figure 1C, lane 1) whereas mRNAs of all other sigma factors appear during imbibition, i.

e. at stage 0+ (lane 2). Messenger RNA levels corresponding to SIG1, SIG2 and SIG6 peak

between stages 2 and 4 and then drop down while the transcript levels coding for SIG3, SIG4

and SIG5 do not change significantly between stages 3 and 6.

Protein components of the NEP and PEP transcription systems are already present in dry

seeds of A. thaliana

In order to reveal components of NEP and PEP at the protein level we have prepared

specific peptide antibodies against the two different NEP enzymes, RPOTp and RPOTmp, from

Arabidopsis (see Material and Methods). Both antisera react with two different proteins in total

protein extracts. One of these proteins has the expected molecular mass of about 110 kD. The

second one has a molecular mass slightly below 100 kD (Figure 2A, lanes 2 and 6). Affinity

purification of these antisera on Affi-gel fixed peptides results in an enrichment of antibodies

reacting with the higher molecular weight polypeptide (Figure 2A, lanes 3 and 7). The pre-

immune sera do not react with proteins present in total plant protein extracts (Figure 2A, lanes 1

and 5). As expected, RPOTp is present in purified chloroplasts (Figure 2A, lane 4).

Immunological cross-reaction of the two different RPOT antisera has been excluded by cross-

testing the corresponding peptides (Figure 2B).

To analyse components of the eubacterial-type enzyme we have used antibodies

prepared against components of the E. coli RNA polymerase. It has been repeatedly shown that

the E. coli RNA polymerase and PEP have sufficient similarity to allow immunological cross-

reaction (Lerbs et al., 1985; Lerbs et al., 1988; Iratni et al., 1994). So we have used two

different antisera that have both been prepared against E. coli RNA polymerase (see Material



8

and Methods). Immunological cross-reaction of these antisera with proteins of A. thaliana is

shown in Figure 2C. The two antisera reveal different polypeptides in the Arabidopsis protein

extracts, indicating that antibody production has not been efficient against all polymerase

polypeptides or that some of the antibodies do not recognize their plastid orthologous with

sufficient strength in the same antiserum. The Α antibodies react with polypeptides of about

120, 80 and 38 kD corresponding well to the expected molecular masses of the β, β' and α

subunits of PEP (Figure 2C, lane 1). The B antibodies react with polypeptides of about 150 and

38 kD in the A. thaliana total protein extract (Figure 2C, lane 2). This corresponds well to the

molecular masses expected for the β'' and α subunits of PEP. Thus, although each antiserum

alone does not permit to analyse all polymerase subunits, the use of the two different antibodies

solves this problem. Plastid localization of the immunologically cross-reacting polypeptides

RPOB, RPOC1 and RPOC2 is shown in Figure 2C on the right hand side (lanes 3 and 4).

Next we have prepared protein extracts from Arabidopsis seeds and plantlets up to 6

days after germination. The protein pattern of these extracts after separation on denaturing SDS

polyacrylamide gel and blotting to a nitrocellulose membrane is shown in Figure 2D. Western

immuno-blotting of these extracts using the antibodies made against RPOTp and RPOTmp

shows that both RNA polymerases are already present in seeds (Figure 2E, upper two panels).

Equally, analysis of Western blots using the two E. coli RNA polymerases antibodies shows

that all PEP subunits are already present in dry seeds (Figure 2E, lower two panels). The

expression profiles of RPOB and RPOC1/C2 differ from that of RPOA. This difference might

be due to the fact that RPOA is encoded by another operon than RPOB/C1 and C2 and protein

expression of the two operons might be differently regulated.

Taken together with our previous studies showing that one of the PEP transcription

factors, SIG3, is also already present in dry seeds (Privat et al., 2003), these results indicate that

both types of plastid RNA polymerases, NEP and PEP, are present in dry seeds, i. e. not only

NEP but also PEP could be active immediately after seed imbibition.

RNAs encoding NEP and PEP are already present in dry seeds of Spinacia oleracea

The above-described results indicate the presence of both types of RNA polymerase,

NEP and PEP, already in dry seeds. This observation is unexpected, especially with regard to

the PEP transcription system that is thought to be primarily important for the expression of



9

photosynthesis related genes. Therefore, we wanted to know whether or not this result can be

generalized, and we performed similar experiments as described above for Arabidopsis also

with spinach. Spinach has been chosen for the following reasons: (1) The sequence of the

spinach genome is known (Schmitz-Linneweber et al., 2001), i. e. mRNA levels coding PEP

subunits could be easily analysed by RT-PCR. (2) The cDNAs coding the two NEP enzymes,

RPOTp and RPOTmp, have recently been sequenced and plastid localization of two NEP

enzymes has been shown (Azevedo et al., 2006). (3) Partial cDNAs of spinach coding for two

of the early sigma factors (SIG2 and SIG3, see Figure 1C and Privat et al., 2003) have recently

been cloned and sequenced by us (Acc. no. AJ427912; Mache et al., 2002). For the following

experiment the partial cDNA sequence coding the spinach SIG2 factor has been completed by

5'-race and the additional sequence has been deposited at EMBL (Acc. No. AJ427912).

Developmental stages of young spinach plantlets that have been used for the following

experiments are demonstrated in Figure 3A. Semi-quantitative RT-PCR analyses of RNAs

corresponding to all RNA polymerase subunits and two sigma factors (SIG2 and SIG3) are

shown in Figure 3B. The RT-PCR experiment shows that all analysed RNAs, including those

coding the two sigma factors, are already present in dry seeds. RNA levels do not change

considerably between stages 0 and 1, but augment strongly at stage 2 when hypocotyl/root

growth starts. With respect to the PEP enzyme, results resemble to those obtained with

Arabidopsis, i. e. PEP coding mRNAs are already present in dry seeds. However, the expression

patterns of the mRNAs are slightly different. While in Arabidopsis core PEP mRNA levels peak

between stages 0+ and 2 and then decrease, in spinach the raise in mRNA levels is retarded to

stage 2 and mRNA levels do not change considerably afterwards. The expression patterns of the

two sigma factors are also different between Arabidopsis and spinach. The augmentation of the

SIG2 and SIG3 mRNA levels are one day delayed in spinach compared to Arabidopsis and

SIG3 mRNA is already present in dry seeds of spinach but not in Arabidopsis.

Protein components of the PEP transcription system are differently expressed during seed

germination of S. oleracea when compared to A. thaliana

To analyse components of the PEP transcription system from spinach we prepared

specific peptide antibodies against its α-subunit (SoRPOA) and against sigma 2 (SoSIG2). Both

antisera have been made by using two different peptides at once for immunisation (Double X

Program, Eurogentec). The two cDNAs have been cloned into pET-32a and pBAD/ThioTOPO



10

expression vectors and the antibodies have been tested on E. coli extracts without and after

induction of expression by arabinose or isopropylthio-β-galactoside (IPTG), respectively

(Figure 4A and C, lanes 2 and 3 and lanes 3 and 4, respectively). Antibody signals have been

verified by anti-thioredoxin antibodies (Figure 4A, lanes 4 and 5) or by anti-His antibodies

(Figure 4C, lanes 5 and 6). The specificity of the SoSIG2 antibody has been further

characterized by affinity purification of the antisera on one (P1) or the other (P2) of the two

peptides that had been used for immunisation (Figure 4B, lanes 1 and 2). Both different IgG

fractions react with a polypeptide of the expected size in spinach protein extracts thus

confirming the immuno-reactivity of both peptides and the specificity of the SoSIG2 antibody.

Control reactions that have been performed using the pre-immune sera do not reveal any

polypeptides (Figure 4B, lane 3 and Figure 4C, lanes 1 and 2). The SoRPOA antibodies have

been further characterized by showing plastid localization (Figure 4C, lanes 7 and 8). The two

spinach RPOTp and RPOTmp antisera have been characterized previously (Azevedo et al.

2006).

In the following, spinach protein extracts prepared from dry seeds (0), seeds after

imbibition (0+) and seedlings up to six days after germination (1-6) have been analysed by

Western immuno-blotting (Figure 4D). Immuno-reactions corresponding to the α and β''

subunits of PEP as representatives for the two different plastid rpo gene coding operons, are

shown. Both proteins are detectable from stage 0+ until stage 5 and drop down at stage 6. The

phage-type RPOTp enzyme and sigma factor 2 are already present in dry seeds. RPOTmp is not

shown because the antibody is not strong enough to reveal the protein in total protein extracts of

entire plantlets during germination. The presence of the α-subunit as well as the β"-subunit of

PEP at stage 0+ suggests that the PEP core enzyme is built-up immediately at the onset of

imbibition. The presence of at least one sigma factor indicates that PEP could be already

functional during germination and root outgrowth.

The PEP transcription system is already active during germination

The experiments demonstrated above show the presence of PEP already in seeds thus

raising the question of whether some PEP is just stored to facilitate early seedling growth or

whether PEP is already functional in seeds during germination. To answer this question we

decided to analyse germination in the presence and in the absence of Tagetin, a specific



11

inhibitor of eubacterial RNA polymerase and PEP (Mathews and Durbin, 1990 and 1994) and

of nuclear RNA polymerase III (PolIII; Steinberg et al., 1990). We started our experiments by

determining the optimal concentration of Tagetin that inhibits PEP but not PolIII activity. For

this purpose, Arabidopsis seedlings have been grown in the presence of either water or different

concentration of Tagetin for four days (Figure 5A and B). Inhibition of transcription of

photosynthesis-related genes by PEP due to the presence of Tagetin results in bleaching of

leaves (Kapoor et al., 1997). Figure 5A shows that growth of Arabidopsis seedlings in the

presence of a concentration of 100 µM Tagetin leads to complete bleaching of cotyledons. To

assure that this concentration does not interfere with PolIII activity we verified the quantity of

nuclear 5S RNA by in vitro capping of total RNA obtained from seedlings that had been grown

either on water or on different concentrations of Tagetin (Figure 5B; Iratni et al., 1997). Since

the quantity of 5S RNA is not diminished at 100 µM Tagetin, this concentration has been used

in the following experiments to analyse the percentage of germination of Arabidopsis seeds on

water or on Tagetin (Figure 5C and D). We used a transparent testa mutant (tt2-1; Koornneef,

1990; Debeaujon et al., 2000) whose seed coat is highly permeable to insure that the

exogenously applied Tagetin reaches the embryo easily during seed imbibition. This mutant has

already been successfully used to analyse the effect of α-Amanitin on seed germination (Rajjou

et al., 2004). Each time 50 seeds have been observed over a period of 3 days and the percentage

of radicle protrusion has been calculated at various time points as a measure for germination

(Figure 5D). Figure 5C shows tt2-1 seeds germinated on water or on Tagetin, 60 hours after

imbibition (i. e. 24 hours cold treatment followed by 36 hours at room temperature). In general,

we observed that the tt2-1 seeds needed more time to accomplish germination than wild type

seeds. Most of the seeds are germinated 48 hours after release from cold treatment, but the delay

of germination due to Tagetin treatment is obvious from differences in root length between the

water and Tagetin treated samples (not shown). The experiment has been performed three times

and Figure 5D summarizes the results. Tagetin treatment results in a slight but significant delay

of germination thus indicating an activity of PEP immediately after imbibition.

This early PEP activity has been confirmed by RT-PCR analysis of rbcL mRNA at stage

0+ and 42h after cold release (Figure 5E, upper part, lanes 1-4). RbcL is one of the few plastid

genes that are transcribed exclusively from a PEP promoter. At stage 0+, water and Tagetin

treated seeds contain about the same amounts of mRNA. This might be explained in that PEP is

not active at 4°C. However, RT-PCR analysis of RNA isolated 42h after cold release shows a

strong diminution of rbcL mRNA after Tagetin treatment. As controls, we have analysed by

RT-PCR the RNA levels of two different genes that are not transcribed by Tagetin-sensitive



12

RNA polymerases, i. e. the cytoplasmic 18S rRNA and the plastid rpoA mRNA. As expected,

both mRNA levels do not change after Tagetin treatment. Finally, the presence of PEP subunits

RPOA and RPOC2 in tt2-1 seeds at stage 0+ and 42h after release from cold treatment confirms

the presence of PEP at early developmental stages in the mutant (Figure 5E, lower part).

Discussion

In the present paper we have analysed the building-up of the two different plastid

transcription systems, PEP and NEP, during germination and early seedling outgrowth in

Arabidopsis and in spinach on the mRNA and protein levels.

Analyses of rpo mRNAs. Although the kinetics of mRNA accumulation is different in

both plant species, all RNAs corresponding to the PEP and NEP core enzymes are already

present in dry seeds (Figures 1B and 3B). In Arabidopsis, de novo synthesis of rpo mRNAs

starts immediately with imbibition as suggested by the strong accumulation of all rpo mRNAs

at stage 0+ compared to dry seeds (stage 0; Figure 1B). In spinach, rpo mRNA accumulation

occurs later, on the second day after germination, when roots have started to elongate (Figure 3).

The accumulation of mRNAs coding sigma factors is different for each of the 6 sigma factors of

Arabidopsis (Figure 1C). Only two sigma mRNAs, SIG2 and SIG5, are already present in dry

seeds, consistent with a proposed early expression of sigma 2 (Kanamaru et al., 1999; Privat et

al., 2003) and a specific function of sigma 5 in embryo development (Yao et al., 2003). In

spinach, the accumulation of the two mRNAs coding for SIG2 and SIG3, resembles that of the

mRNAs encoding the PEP core enzymes (Figure 3B). Apart of these differences in mRNA

accumulation between Arabidopsis and spinach, the essential information obtained from these

experiments is that PEP as well as NEP coding mRNAs are already present in dry seeds. This

means that both different transcription systems coexist in different plastid types, like

chloroplasts, proplastids and amyloplasts.

Analyses of rpo proteins. To confirm this conclusion on the protein level we had at first

to produce several antibodies, specific for some of the RNA polymerase polypeptides. Two-

peptide antibodies have been prepared against Arabidopsis RPOTm and RPOTmp and against

spinach sigma factor 2 and the α subunit of PEP. RPOT and sigma peptides have been chosen in

the variable N-terminal parts of the proteins to avoid the risk of cross-reaction between either

the two NEP enzymes or between different sigma factors. In addition, all antibodies have been



13

purified on the corresponding peptides and specific IgG fractions have been used for protein

analyses. Non-purified RPOTp and RPOTmp antisera react both with two different polypeptides

of about 100 and 110 kDa. After purification both antibodies react preferentially with the larger

polypeptide (Figure 2A). This indicates that only the 110-kDa polypeptides correspond to

RPOTp and RPOTmp. However, at present we cannot exclude that the smaller polypeptides

result from development-dependent alternative splicing (Young et al., 1998) or alternative

translation initiation of the rpo mRNA precursor molecules (Kobayashi et al., 2001; Richter et

al., 2002,) or from alternative cleavage of the proteins.

The spinach RPOA and SIG2 antibodies reveal only one protein of the expected

molecular weights, i. e. 38 and 60 respectively, independent of whether the antibodies are

purified or not (not shown). Finally, we have also prepared peptide antibodies against other

spinach PEP core subunits but they are not strong enough to reveal the corresponding

polypeptides in crude protein extracts (not shown). Therefore, in order to analyse the subunits of

the PEP core enzyme in Arabidopsis and spinach we have used antibodies that had been

prepared against two different preparations of E. coli RNA polymerase. Although the titer of

individual antibodies recognizing the RPOA, RPOB, RPOC1 and RPOC2 subunits of the

plastid PEP enzyme is very different in the two E. coli antisera it is possible to reveal all PEP

subunits by using the two different antisera (Figure 2C). Figure 2E shows the analysis of all

PEP subunits during Arabidopsis germination and early seedling development. The polypeptide

pattern of the extracts is shown in Figure 2D. The result shows that not only PEP and NEP

mRNAs but also the corresponding protein products are already present in dry seeds of

Arabidopsis. RPOTp and RPOTmp protein levels are highest on day two after germination,

subsequently decrease up to day five and increase again on day six. The increase on day six

might correspond to the appearance of the primary leaves at that stage (see Privat et al., 2003;

Figure 6A). These results are in good agreement with recently published results obtained by

expression of RpoTp::GUS and RPOTmp::GUS fusion constructs in Arabidopsis (Emanuel et

al., 2005). This paper shows overall expression of β-glucuronidase (GUS) on day two from the

two constructs with a specific accumulation in root tips from the RpoTmp::GUS construct. On

day four GUS expression is strongly diminished in the whole plantlets remaining only

detectable in root tips again for the RpoTmp::GUS construct. On day seven, GUS expression

reappears but now in a very limited tissue-specific manner with strongest expression in the

emerging primary leaves.

At present, it is not known whether RPOTmp and SIG2 proteins are present in

chloroplasts or in mitochondria or in both organelles in early developmental stages, i. e. during



14

the first six days after germination. It is technically not feasible to isolate pure mitochondria and

chloroplasts from different organs of very young Arabidopsis plantlets. RPOTmp is localized

exclusively in chloroplasts in mature spinach plants (Azevedo et al. 2006). In cotyledons and

leaves of Arabidopsis, RPOTmp might be exclusively localized in mitochondria (Kabeya and

Sato, 2005). On the other hand, rpoTmp T-DNA insertion mutants have altered plastid gene

expression while no differences have been found for mitochondrial gene transcripts (Baba et al.,

2004). It is therefore likely that the targeting of RPOTmp to either mitochondria or chloroplasts

is developmentally regulated and might differ in different plant species. Double targeting to

mitochondria and plastids has also been described for SIG2 in maize (Beardslee et al. 2002). In

both cases, i. e. RPOTmp and SIG2, it is not yet clear whether the polypeptides are functional in

mitochondria or whether mitochondrial localization is the result of erroneous targeting.

Since cross-reaction of RPOA antibodies are very weak in Arabidopsis we decided in

the following to prepare specific peptide antibodies against the α subunit of spinach PEP

(Figure 4C). Contrary to Arabidopsis, in spinach the PEP core enzyme is not present in dry

seeds as demonstrated for the α (SoRPOA) and β’’ (SoRPOC2) subunits (Figure 4D). However,

both subunits can be clearly revealed at stage 0+ indicating that PEP is built-up immediately

after imbibition and is present in seeds already during germination before the radicle protrudes

the seed coat. RPOTp and SIG2 are already present in dry seeds, i. e. both enzymes, PEP and

NEP coexist already in seeds and the building-up of the two transcriptional systems during

germination seems to proceed either sequential (spinach) or in parallel (Arabidopsis).

From the results we can further conclude that PEP activity is not only important in

photosynthetically active chloroplasts but also in non-photosynthetic plastids. In agreement with

this conclusion are recent studies analysing PEP promoter driven transient expression of gfp

(green fluorescent protein) in various plastid types that have shown GFP in chromoplasts and

roots (Hibbert et al., 1998). Furthermore, early transcription in chloroplast development of

plastid rpo genes has been already reported (Baumgartner et al., 1993; Inada et al., 1996), but in

these studies rpo gene transcription has not been linked to PEP activity. Finally, early

transcription of several SIG2 dependent tRNAs indicates that PEP might be necessary for

efficient tRNA synthesis in non-photosynthetic plastids (Kanamaru et al., 2001).

In the present paper, we have analysed early PEP activity during imbibition and

germination by treating Arabidopsis seeds with Tagetin, a specific inhibitor of PEP activity

(Mathews and Durbin, 1990 and 1994). A clear retard in germination is observed in the

presence of the inhibitor (Figure 5C and D), which should be due to the inhibition of PEP

activity during germination as shown by specific inhibition of rbcL transcription (Figure 5E).



15

The lack or diminution of PEP activity is not vital for germination since all seeds germinate

finally, but PEP activity is certainly important in non-photosynthetic seed plastids for efficient

germination.

Conclusion

Results show that both plastid transcription systems, NEP and PEP, are built-up in parallel

during germination and early plant development. The presence of PEP in dry seeds of

Arabidopsis and in seeds of spinach immediately after imbibition indicates that PEP could be

active already before germination and development of photosynthetically active tissues/organs.

Delay of germination in the presence of Tagetin, a specific inhibitor of PEP activity, confirms

that PEP is active and required for efficient germination. Experiments are in progress to define

the role of PEP for optimal germination in more detail.

Materials and Methods

Plant material and growth conditions

If not otherwise indicated, surface-sterilised Arabidopsis seeds (Arabidopsis thaliana, ecotype

WS) were spread on MS Agar plates containing 1% sucrose, kept for 72 hr at 4°C in darkness

(stage 0+) and then transferred into a growth chamber and grown for 6 days at 23°C under 16/8

hr light/dark cycle at 110 µmol m-2 s-1. For mRNA and protein analyses seeds and/or plantlets

were harvested in 24 hr intervals.

Spinach seeds (Spinacia oleracea) were agitated in distilled water for 24 hr (0+) and

were then germinated at 23°C on three layers of moistened filter paper (Whatman 3MM,

Dominique Dutscher, Brumath cedex, France) in a growth chamber under 10/14 hr light/dark

cycle. For mRNA and protein analyses seeds and/or plantlets were harvested according to the

developmental stages described in Figure 3A (see also Harrak et al., 1995).

RNA extraction

RNA has been isolated as described by Suzuki et al. (2004). Briefly, after extensive

homogenisation in liquid nitrogen the powder is solubilized in 2 mL of buffer (100 mM

Tris/HCl, pH 9.5 ; 10 mM EDTA, pH 8 ; 2% LDS (w/v) ; 0.6 M NaCl ; 0.5 M Trisodium

Citrate ; 5% β-mercaptoethanol). Cell debris are removed by centrifugation at 16,000g for 5 min



16

and RNAs are extracted from the aqueous phase by three successive treatments. (1) Chloroform

treatment is followed by (2) treatment with phenol containing 3.5% (w/v) of guanidine

isothiocyanate (SIGMA, Saint Quentin Fallavier, France) and 0.2 M sodium acetate pH 4. After

a 3 min of incubation, half a volume of chloroform is added and (3) by an additional chloroform

treatment. The resulting supernatant is finally precipitated by addition of 0.6 volumes of

isopropanol. Remaining traces of DNA are removed by two successive DNase treatments and

the absence of DNA in the RNA preparation is verified by PCR.

Semi-quantitative RT-PCR

One µg of DNase I treated RNA was reverse transcribed using 200U of Superscript II

(Invitrogen SARL, Cergy Pontoise, France) according to the manufacturer’s protocol. The

reaction was performed in the presence of 1 µg random hexamers in a total volume of 60 µL at

42°C for 50 min. Aliquots of 1µL of this reaction were afterwards used as template for semi-

quantitative PCR in a 25 µL reaction mix containing 1U of BioTaq (Bioline, London, UK). In

order to assure that amplification is in the linear range, the optimal number of cycles (n) has

been determined for each couple of primers separately. PCR was carried out under the following

conditions: 5 min denaturation at 94°C, followed by n cycles of amplification (30’’ at 94°C, 30”

at 55°C, 1 min at 72°C), and a final 7 min termination step at 72°C. The Quantum 18S rRNA

Universal kit (Ambion, Cambridgeshire, UK) served as control. Primers are as follows.

Arabidopsis: 5'- TTGCTTCTACTGAGAGACCTGGC -3', 5'-

CCGAGATATCTTCAAGATACTGC -3' (AtSIG1); 5'- TTAACGGCCTTTCATCAATGG -3',

5'- ATCAACTTCCTGCGCAACAAGACG -3' (AtSIG2); 5'-

TTAGTGCGATCGAGTTTAACATCG-3', 5'-TAAGCACGACGTGATTGAGGAACC-3'

(AtSIG3); 5'-ACAATCTCTCCCTTACTCAGAACG-3', 5'-

AACAACCAACCTACGGTAACAACG-3' (AtSIG4); 5'- TTGATGCAACCTATGAAGGC -

3', 5'- TTTCGGCTTCAATGAATCGAG -3' (AtSIG5); 5'-

ACTAGCTCAGAAGGCTTTATCAGC-3', 5'-ATGGACTACCAGACGTAGGTTTGC-3'

(AtSIG6); 5'-TCTACTCGGACACTACAGTGGAAG-3', 5'-

CATCGCAATGCCTATTGTGTCGGC-3' (AtRPOA); 5'- TTTATCGGTTTATTGATCAGGG

-3', 5'- TTGTTTCCTACTCACCCGAG -3' (AtRPOB); 5'-ATCCTGGAAATACAGCATCC-3',

5'-ATCTTCCCATTCATTCCCC-3' (AtRPOC1); 5'-ATAGATCACTTCGGGATGGC-3', 5'-

ATATGGACTGGATTGAAGGG-3' (AtRPOC2); 5'- CAGATGACTGCTTTTGCACC -3', 5'-

TTGAGGTTAACCATCAACATTCC -3' (AtRPOTm); 5'-TTCATTGGAAGACCAATACC-3',

5'-TTTCAAAGTCTGATCAACC-3' (AtRPOTp); 5'-TGGTTATTGTTCTGGTTTAT-3', 5'-



17

AACAATTCATCTACCTCAGG-3' (AtRPOTmp); 5'-

GGTGAGTAACGCGTAAGAACCTGC-3', 5'-CCTCGGGCGGATTCCTCCTTTTGC-3'

(control-rrn);

Spinach: 5'-AGCACTTTGGGTTCTCCAG-3', 5'-TTGATTAAGCTCTTCACGCG-

3’(SoSIG2); 5'-TCCTTTCACCACCAATTCTTCC-3’, 5’-GGAAGGTTGGGAGCATTGCA-

3’ (SoSIG3); 5’-AATTCTTCACCCCGAACCTC-3’, 5’-TTGATTAAGCTCTTCACGCG-

3’(SoRPOTmp); 5’-AATTCTTCACCCCGAACCTC-3’, 5’-TTGATTAAGCTCTTCACGCG-

3’(SoRPOTp).

RNA capping

RNA was 5'-labelled by in vitro capping using guanylyltransferase according to the suppliers'

protocol (Ambion, Cambridgeshire, UK). One µg of ARN was incubated with 5 U of

guanylyltransferase in the presence of 37 U RNase inhibitor (Amersham Biosciences, Saclay,

France) and 15 pmol α32

P-GTP (3 000 Ci per mmol) in reaction buffer (50 mM Tris/HCl, pH 8;

6 mM KCl; 1.25 mM DTT; 1.25 mM MgCl2; 50 µg mL-1 BSA) for 1 hr at 37ºC. RNA was

precipitated by adding 2 volumes of ethanol and 0.3 M sodium acetate pH 5.6, washed with

70% ethanol, dried and separated by electrophoresis on a 6% denaturing polyacrylamide gel.

Antibody preparation, purification and characterization

Peptide antibodies have been prepared in rabbits according to the DoubleX program by

Eurogentec (Seraing, Belgium). The following peptides have been used for immunisation:

SoSIG2:H2N-DYSDPLRYLRGATNS- CONH2 , H2N-KLHDELKVRFGKSPSC-CONH2;

SoRPOA: H2N-WKCVESRTDSKCL-CONH2, H2N-HAEENVNLEDNQHKVC-CONH2;

AtRPOTp: H2N-CSFENQDSSYAGT-CONH2, H2N-DIDKRKFDSLRRRQC-CONH2;

AtRPOTmp: H2N-ITRREEFSKSERCL-CONH2, H2N-RSWRMKKQDQFGMGC-CONH2.

Specific IgG fractions have been obtained by coupling of the corresponding peptides to

Affi-Gel 10 or 15 and antibodies have been purified according to the suppliers' protocol (BIO-

RAD, Marnes-la-Coquette, France). Purified antibodies have been stored in aliquots at –80°C

until usage. The reactivity and specificity of the antibodies have been tested either by dot blot

analyses or on recombinant proteins. For dot blot analyses, 5, 50, 100, 250 and 500 ng of

peptides have been spotted in equal volumes to Nitrocellulose. For testing on recombinant

proteins the SoSIG2 and SoRPOA cDNAs have been cloned into pBAD-ThioTOPO (Invitrogen,

SARL, Cergy Pontoise, France) and pET32a (Novagen, tebu-bio SA, Le Perray-en-Yvelines,



18

France) respectively, and antibodies have been tested on the thioredoxin fusion proteins after

arabinose or IPTG induction, SDS-PAGE separation of proteins and transfer to Nitrocellulose.

Antibody reactions have been revealed by the ECL western blotting detection system

(Amersham Biosciences, Saclay, France)

One of the two different antibodies against E. coli RNA polymerase (E.c.-A) had been

kindly provided by Prof. Dubert. The second one (E.c.-B) has been prepared by Eurogentec

(Seraing, Belgium) using commercially available E. coli RNA polymerase

Chloroplast isolation

Arabidopsis thaliana chloroplasts were prepared using a slightly modified protocol of Kunst

(1998). Briefly, 7 days-old Arabidopsis leaves were homogenised in buffer containing

Sorbitol (0.45 M), Tricine (20 mM, pH 8.4), EDTA (10 mM) and NaHCO3 (10 mM). A crude

plastid pellet was obtained by centrifugation at 5,000g for 3 min. Plastid were suspended in

RB buffer (Sorbitol 0.3M; Tricine 20 mM, pH 7.6; MgCl2 5mM; ETDA 2.5 mM) and further

purified by centrifugation through a 40% Percoll cushion at 5,000g for 10 min. Intact

chloroplasts were recovered as a pellet, washed twice with RB buffer and chlorophyll was

removed by treatment with 80% acetone. For further analyses the chlorophyll-free protein

pellet was suspended in buffer containing Tris/HCl (30 mM, pH 6.8), glycerol (12.5%), SDS

(1%). Preparations were routinely analysed by Western immuno-blotting using an antibody

directed against the mitochondrial polynucleotide phosphorylase (Perrin et al., 2004) and

were found to be devoid of mitochondrial cross-contamination

Protein purification and analyses

Proteins have been isolated and analysed by western immuno-blotting as described previously

(Privat et al., 2003). Briefly, protein extracts were prepared according to Hurkman and Tanaka

(1986). Protein concentrations were determined by using the BioRad DC protein assay and BSA

as standard (BIO-RAD, Marnes-la-Coquette, France). After separation of equal amounts of

protein by SDS–PAGE and subsequent transfer to nitrocellulose membranes (Schleicher &

Schuell, BioScience, Dassel, Germany) proteins were either stained by Ponceau S or analysed

by antibody reaction using the ECL western blotting detection system (Amersham Biosciences,

Saclay, France).

Germination test



19

Germination assays have been performed using the transparent testa mutant tt2-1 (Debeaujon et

al., 2000). The analyses of the kinetic of germination were carried out on three independent

experiments. Seeds were imbibed in 200 µL of distilled water in presence or absence of 100 µM

Tagetin (Epicentre, tebu-bio SA, Le Perray-en-Yvelines, France) on three layers of filter paper

(Whatman No.1, Dominique Dutscher, Brumath, France) or on one layer of Whatmann No.1

covered by a black membrane filter with a white grid (ME 25/31, Schleicher & Schuell,

BioScience, Dassel, Germany) in small Petri dishes. After vernalisation in darkness at 4°C for

24 h, samples were kept at 23°C under continuous light. Protrusion of the radicle trough the

seed coat was counted at different intervals over a period of 50 hours and values were expressed

as percentage of germinated seeds.

Acknowledgements

We thank Isabelle Debeaujon for kindly providing tt2-1 seeds and Dominique Job for many

stimulating discussions.

References

Allison LA (2000) The role of sigma factors in plastid transcription. Biochimie 82: 537-548

Azevedo J, Courtois F, Lerbs-Mache S (2006) Sub-plastidial localization of two different

phage-type RNA polymerases in spinach chloroplasts. Nucleic Acids Res. 34: 436-444

Baba K, Nakano T, Yamagishi K, Yoshida S (2001) Involvement of a Nuclear-Encoded

Basic Helix-Loop-Helix Protein in Transcription of the Light-responsive Promoter of

psbD. Plant Physiol. 125: 595-603

Baba K, Schmidt J, Espinosa-Ruiz A, Villarejo A, Shiina T, Gardeström, P, Sane AP,

Bhalero RP (2004) Organellar gene transcription and early seedling development are

affected in the rpoT;2 mutant of Arabidopsis. Plant J. 38: 38-48

Baumgartner BJ, Rapp JC, Mullet JE (1993) Plastid Genes Encoding the

Transcription/Translation Apparatus Are Differentially Transcribed Early in Barley

(Hordeum vulgare) Chloroplast development. Plant Physiol. 101: 781-791

Beardslee TA, Roy-Chowdhury S, Jaiswal P, Buhot L, Lerbs-Mache S, Stern DB, Allison

L (2002) A nucleus-encoded maize protein with sigma factor activity accumulates in

mitochondria and chloroplasts. Plant J. 31: 199-209



20

Debeaujon I, Léon-Kloosterziel KM, Koornneef M (2000) Influence of the testa on seed

dormancy, germination, and longevity in Arabidopsis. Plant Physiol. 122: 403-413

Emanuel C, von Groll U, Müller M, Börner T, Weihe A (2006) Development- and tissue-

specific expression of the RpoT gene family of Arabidopsis encoding mitochondrial

and plastid RNA polymerase. Planta 223: 998-1009

Harrak H, Lagrange T, Bisanz-Seyer C, Lerbs-Mache S, Mache R (1995) The Expression

of Nuclear Genes Encoding Plastid Ribosomal Proteins Precedes the Expression of

Chloroplast Genes during Early Phases of Chloroplast development. Plant Physiol.

108: 685-692

Hedtke B, Börner T, Weihe A (2000) One RNA polymerase serving two genomes. EMBO

Rep. 5: 435-440

Hibberd JM, Linley PJ, Khan MS, Gray JC (1998) Transient expression of green fluorescent

protein in various plastid types following microprojectile bombardment. Plant J. 16:

627-632

Igloi GL, Kössel H (1992) The Transcriptional Apparatus of Chloroplasts. Crit. Rev. Plant Sci.

10: 525-558

Inada H, Kusumi K, Nishimura M, Iba K (1996) Specific Expression of the Chloroplast

Gene for RNA Polymerase (rpoB) at an Early Stage of Leaf Development in Rice.

Plant Cell Physiol. 37: 229-232

Iratni R, Baeza L, Andreeva A, Mache R, Lerbs-Mache S (1994) Regulation of rDNA

transcription in chloroplasts: promoter exclusion by constitutive repression. Genes &

Dev. 8: 2928-2938

Iratni R, Diederich L, Harrak H, Bligny M, Lerbs-Mache S (1997) Organ-specific

transcription of the rrn operon in spinach plastids. J. Biol. Chem. 21: 13676-13682

Kabeya, Y, Sato, N (2005) Unique Translation Initiation at the Second AUG Codon

Determines Mitochondrial Localization of the Phage-Type RNA Polymerases in the

Moss Physcomitrella patens. Plant Physiol. 138: 369-382

Kanamaru K, Nagashima A, Fujiwara M, Shimada H, Shirano Y et al. (2001) An

Arabidopsis Sigma Factor (SIG2)-Dependent Expression of Plastid-Encoded tRNAs in

Chloroplasts. Plant Cell Physiol. 42: 1034-1043

Kapoor S, Suzuki JY, Sugiura M (1997) Identification and functional significance of a new

class of non-consensus-type plastid promoters. Plant J. 11: 327-337



21

Kim M, Mullet JE (1995) Identification of a Sequence-Specific DNA Binding Factor required

for Transcription of the Barley Chloroplast Blue Light-responsive psbD-psbC

Promoter. Plant Cell 7: 1445-1457

Kobayashi Y, Dokiya Y, Sugita M (2001) Dual Targeting of Phage-Type RNA Polymerase to

both Mitochondria and Plastid Is Due to Alternative Translation Initiation in Single

Transcripts. Biochim. Biophys. Res. Commun. 289: 1106-1113

Koornneef M (1990) Mutations affecting the testa colour in Arabidopsis. Arabidopsis Inf. Serv.

27: 1-4

Kunst L (1998) Arabidopsis protocols. In J M Martinez-Zapater and J Salinas eds. Preparation

of Physiologically Active Chloroplasts from Arabidopsis, Humana Press, Totowa,

New Jersey, pp. 43-48

Lam E, Hanley-Bowdoin L, Chua NH (1988) Characterization of a Chloroplast Sequence-

specific DNA Binding Factor. J. Biol. Chem. 263: 8288-8293

Lerbs S, Bräutigam E, Partier B (1985) Polypeptides of DNA-dependent RNA polymerase of

spinach chloroplasts: characterization by antibody-linked polymerase assay and

determination of sites of synthesis. EMBO J. 4: 1661-1666

Lerbs S, Bräutigam E, Mache R (1988) DNA-dependent RNA polymerase of spinach

chloroplasts: Characterization of α-like and σ-like polypeptides. Mol. Gen. Genet. 211:

459-464

Liere K, Maliga P (1999) In vitro characterization of the tobacco rpoB promoter reveals a core

sequence motif conserved between phage-type and plant mitochondrial promoters.

EMBO J. 18: 249-257

Liere K, Maliga P (2001) Plastid RNA Polymerase in Higher Plants. In E-M Aro and B

Andersson, eds, Regulation of photosynthesis, Kluver Academic Publishers,

Netherlands, pp. 29-49

Mache R, Cottet A, Imberty A, Hakimi M-A, Lerbs-Mache S (2002) The Plant Sigma

Factors: Structure and Phylogenetic origin. Genome Lett. 1: 1-6

Mathews DE, Durbin RD (1990) Tagetitoxin Inhibits RNA Synthesis Directed by RNA

Polymerases from Chloroplasts and Escherichia coli. J. Biol. Chem. 265: 493-498

Mathews DE, Durbin RD (1994) Mechanistic Aspects of Tagetitoxin Inhibition of RNA

Polymerase from Escherichia coli. Biochemistry 33: 11987-11992

Mullet JE (1993) Dynamic Regulation of Chloroplast Transcription. Plant Physiol. 103: 309-

313



22

Perrin R, Meyer EH, Zaepfel M, Kim Y-J, Mache R, Grienenberger J-M, Gualberto J

M, Gagliardi D (2004) Two Exoribonucleases Act Sequentially to Process Mature

3'-Ends of atp9 mRNAs in Arabidopsis Mitochondria. J. Biol. Chem. 279: 25440-

25446

Privat I, Hakimi M-A, Buhot L, Favory J-J, Lerbs-Mache S (2003) Characterization of

Arabidopsis plastid sigma-like transcription factors SIG1, SIG2 and SIG3. Plant Mol.

Biol. 55: 385-399

Rajjou L, Gallardo K, Debeaujon I, Vandekerckhove J, Job C, Job D (2004) The Effect

of α-Amanitin on the Arabidopsis Seed Proteome Highlights the Distinct Roles of

Stored and Neosynthesized mRNAs during Germination. Plant Physiol. 134: 1598-

1613

Richter U, Kiessling J, Hedtke B, Reski R, Börner T, Weihe A (2002) Two RPOT genes

of Physcomitrella patens encode phage-type RNA polymerases with dual targeting to

mitochondria and plastids. Gene 290: 95-105

Schmitz-Linneweber C, Maier RM, Alcaraz J-P, Cottet A, Herrmann RG, Mache R

(2001) The plastid chromosome of spinach (Spinacia oleracea): complete nucleotide

sequence and gene organization. Plant Mol. Biol. 45: 307-315

Shiina T, Tsunoyama Y, Nakahira Y, Khan MS (2005) Plastid RNA Polymerases,

Promoters, and Transcription Regulators in Higher Plants. Int. Rev. Cytol. 244: 1-68

Shirano Y, Shimada H, Kanamaru K, Fujiwara M, Tanaka K, Takahashi H, Unno K,

Sato S, Tabata S, Hayashi H, Miyake C, Yokota A, Shibata D (2000) Chloroplast

development in Arabidopsis thaliana requires the nuclear-encoded transcription factor

Sigma B. FEBS Lett. 24318: 1-5

Silhavy D, Maliga P (1998) Mapping of promoters for the nucleus-encoded plastid RNA

polymerase (NEP) in the iojap maize mutant. Curr. Genet. 33: 340-344

Steinberg TH, Mathews DE, Durbin RD, Burgess RR (1990) Tagetitoxin: A New Inhibitor

of Eukaryotic Transcription by RNA Polymerase III. J. Biol. Chem. 265: 499-505

Toyoshima Y, Onda Y, Shiina T, Nakahira Y (2005) Plastid Transcription in Higher Plants.

Crit. Rev. Plant Sci. 24: 59-81

Weihe A, Börner T (1999) Transcription and the architecture of promoters in chloroplasts.

Trend Plant Sci. 4: 169-170

Yao J, Roy-Chowdhury S, Allison LA (2003) AtSig5 Is an Essential Nucleus-Encoded

Arabidopsis σ-like Factor. Plant Physiol. 132: 739-747



23

Young DA, Allen RL, Harvey AJ, Lonsdale DM (1998) Characterization of a gene encoding

a single-subunit bacteriophage-type RNA polymerase from maize which is

alternatively spliced. Mol. Gen. Genet. 260: 30-37

Figure Legends

Figure 1. Analysis of mRNA levels of NEP and PEP components during germination and early

Arabidopsis seedling development. A, Developmental stages of Arabidopsis that have been

used in (B) and (C). B. mRNA levels coding for NEP and PEP core subunits and C, PEP

transcription factors of the sigma type have been analysed by semi-quantitative RT-PCR. The

principal developmental stages that have been analysed are as follows: dry seeds (0, lane 1),

seeds after imbibition and vernalisation (0+, lane 2) and 1 to 6 days after germination (lanes 3-

8). 18S RNA in (A) was analysed as internal constitutive control standard and RNA

preparations have been routinely tested for the absence of DNA by performing PCR directly

without prior reverse transcription (shown as example for rpoA in C, Control –RT).

Figure 2. Analysis of protein levels of NEP and PEP components during germination and early

Arabidopsis seedling development. A, Characterization of specific RPOTp and RPOTmp

peptide antibodies. 30 µg aliquots of either total leaf proteins (lanes 1-3 and 5-7) or chloroplast

proteins (lane 4) have been separated on 12% polyacrylamide gels and Nitrocellulose blots have

been probed with either pre-immune serum (PI, lanes 1 and 5) or RPOTp and RPOTmp antisera

before (lanes 2 and 6) and after (lanes 3, 4 and 7) affinity purification of specific IgG fractions.

B, Exclusion of antibody cross-reaction between RPOTmp and RPOTp. Different

concentrations (as indicated in ng on the right side of the Figure) of peptides AtRPOTmp-a

(lanes 1 and 5), AtRPOTmp-b (lanes 2 and 6), AtRPOTp-a (lanes 3 and 7) and AtRPOTp-b

(lanes 4 and 8) have been spotted in equal volumes to Nitrocellulose filters and probed either

with RPOTp (left hand side) or RPOTmp (right hand side) antibodies. C, Immunological cross-

reaction of two different antibodies prepared against E. coli RNA polymerase with PEP subunits

in Arabidopsis protein extracts. 30 µg aliquots of total leaf proteins (lanes 1-3) or chloroplast

proteins (lane 4) have been separated on 12% SDS-polyacrylamide gels and Nitrocellulose blots

have been probed with the A antibodies (lane 1 and lower part of lanes 3 and 4) and the B

antibodies (lane 2 and upper part of lanes 3 and 4). D, Protein patterns of the protein extracts



24

prepared from dry seeds (0), seeds after vernalisation (0+) and from seedlings 1 to 6 days after

germination (1-6) as revealed by Ponceau staining of Nitrocellulose membranes after SDS gel

separation on 10% acrylamide gels and blotting. E, Immunoblot analysis of Nitrocellulose blots

as described in (D) by the different antibodies that are characterized in (A), (B) and (C).

Figure 3. Analysis of mRNA levels of NEP and PEP components during germination and early

seedling development of spinach. A, Stages of spinach development that have been used for

analysing the mRNA and protein levels. B, mRNA levels of stages presented in (A) have been

analysed by semi-quantitative RT-PCR as described in Materials and Methods. 18S RNA has

been analysed as internal constitutive control standard.

Figure 4. Analysis of protein levels of NEP and PEP components during germination and early

spinach seedling development. A, Characterization of the spinach SIG2 antibodies on

recombinant SoSIG2 protein . The cDNA of SoSIG2 has been cloned into pBAD-ThioTOPO

and the thioredoxin fusion protein has been analysed in total E. coli protein extracts before

(lanes 2 and 4) and after (lanes 3 and 5) induction of protein expression by Arabinose using the

SoSIG2 antibodies (lanes 2 and 3) and the anti-thioredoxin antibodies (lanes 4 and 5). B,

Characterization of affinity purified SoSIG2 antibodies on spinach total protein extracts.

SoSIG2 antibodies have been affinity-purified on either the SoSIG2-a peptide (P1, lane 1) or the

SoSIG2-b peptide (P2, lane 2) and probed on 50 µg aliquots of total spinach proteins. Lane 3

shows a control reaction with pre-immune serum. C, Characterization of SoRPOA antibodies on

recombinant RPOA protein and on spinach protein extracts. The cDNA of SoRPOA has been

cloned into pET32a and the His-fusion protein has been analysed in total E. coli protein extracts

before (lanes 1, 3 and 5) and after (lanes 2, 4 and 6) induction of protein expression by IPTG

using pre-immune serum (lanes 1 and 2), the SoRPOA antibodies (lanes 3 and 4), and the anti-

His antibodies (lanes 5 and 6). 30 µg aliquots of total leaf proteins (lane 7) and chloroplast

proteins (lane 8) have been separated on a 12% SDS-polyacrylamide gel and analysed by anti-

SoRPOA antibodies after transfer to nitrocellulose. D, Analysis of NEP and PEP protein levels

during germination and early seedling development. Nitrocellulose blots of proteins from

developmental stages shown in Figure 3 (A) have been probed by the different antibodies that

are characterized in Figure 4 (A), (B) and (C). The RPOTp antibody has been characterized

previously (Azevedo et al., 2006).



25

Figure 5. Delay of germination by Tagetin. A, Arabidopsis seeds of the tt2-1 mutant have been

germinated on moistened filter paper in the absence (lane 1) and in the presence of 1 µM (lane

2), 10 µM (lane 3) and 100 µM (lane 4) of Tagetin. B, Tagetin has no influence on 5S RNA

levels. 5S RNA has been analysed from Arabidopsis plantlets shown in (A) by in vitro capping

of isolated total RNA, separation on 6% denaturing polyacrylamide gels and autoradiography.

C, Arabidopsis seeds were photographed after 24 hr vernalisation and 36 hr incubation at 23°C

under continuous light in the absence (H2O) and presence (Tagetin) of 100 µM Tagetin. D,

Analysis of the effect of Tagetin on the time course of seed germination. Seeds were germinated

as described in Materials and Methods in the absence (◆) and in the presence (�) of 100 µM

Tagetin. Germination is expressed as percentage of seeds showing radicle protrusion at the

indicated time points. The time scale does not include the first 24 hr after the vernalisation

period. E, RNA and protein have been isolated from water (lanes 2 and 4) and Tagetin (lanes 1

and 3) treated seeds at the end of the imbibition period (0+) and 42h after cold release. RNA

levels have been analysed by semi-quantitative RT-PCR for 18S rRNA, rbcL and rpoA mRNAs

and protein levels have been analysed by immuno-blotting for RPOA and RPOC2 using anti-E.

c. B antibodies.



Figure 1

18S

RPOTmp

RPOTp

0 0+ 1 2 3 4 5 6

NEP

B

Control

rpoA

rpoB

rpoC1

rpoC2

PEP

1 2 3 4 5 6 7 8

0 0+ 1 2 3 4 5 6

SIG1

SIG2

SIG3

SIG4

SIG5

Sigma

factors

C

SIG6

1 2 3 4 5 6 7 8

A

0 0+ 1 2 3 4 5 6

Control (-RT)

w

ww

.plantphysiol.orgon July 2, 2020 - P

ublished by D

ownloaded from

C

opyright © 2006 A

merican S

ociety of Plant B

iologists. All rights reserved.


Figure 2

1 2 3 4 5 6 7 8

5

50

100

250

500

RPOTp RPOTmp

B

E

RPOTp

RPOTmp

0 0+ 1 2 3 4 5 6

RPOC2

RPOB

1 2 3 4 5 6 7 8

NEP

PEPRPOC1

RPOA

A

150100755037

25

PI Ab

RPOTp

IgG

1 2 3 4

PI Ab

RPOTmp

5 6 7

IgGIgG

C E.coli

25015010075

50

37

1 2

RPOC2RPOB

RPOA

RPOC1

A B T P

E. c. A

E. c. B

T P

3 4

D0 0+ 1 2 3 4 5 6M

1 2 3 4 5 6 7 8 9

25015010075

5037

25

RBCL

w

ww


ublished by D

ownloaded from

C

opyright © 2006 A

merican S

ociety of Plant B



Figure 3

0 0+

1 23

45

6

A

0 0+ 1 2 3 4 5 6

18S

rpoA

rpoB

rpoC2

SIG2

SIG3

B

RPOTmp

RPOTp

Control

PEP

NEP

Sigmafactors

1 2 3 4 5 6 7 8

w

ww


ublished by D

ownloaded from

C

opyright © 2006 A

merican S

ociety of Plant B



Figure 4

0 0+ 1 2 3 4 5 6

SoRPOA

SoSIG2

1 2 3 4 5 6 7 8

RPOTp

SoRPOC2

C

Thio-SoRPOA

IPTG - + - + - +

1 2 3 4 5 6

Pre-IS SoRPOA anti-His

T P

7 8

SoRPOA

75

50

100150250

371 2 3

BP1 P2 Pre-IS

SoSIG2

Arabinose - + - +

75

50

37

100150250

1 2 3 4 5

ASoSIG2 anti-Thio

Thio-SoSIG2

D

w

ww


ublished by D

ownloaded from

C

opyright © 2006 A

merican S

ociety of Plant B



Figure 5

0 Tagetin 0 1 10 100 µM

1 2 3 4

A

CH2O Tagetin (100 µM)

D

0

50

100

24 30 36 42 48 hours

H20

Tagetingerm

inat

ed s

eeds

(%

)

(stage 1)

1 2 3 4

5S

B

0+Tagetin + - + -

18 S

rbcL

rpoA

RPOA

RPOC2

1 2 3 4

42hE

w

ww


ublished by D

ownloaded from

C

opyright © 2006 A

merican S

ociety of Plant B



Documents

Building-up of the plastid transcriptional machinery · The plastid transcriptional machinery is very complex. Many different components of the plastid transcriptional apparatus are