Case Report A Novel Nonsense Mutation of the AGL Gene in ...downloads.hindawi.com/journals/crig/2016/8154910.pdfCase Report A Novel Nonsense Mutation of the AGL Gene in a Romanian

Case ReportA Novel Nonsense Mutation of the AGL Gene in a RomanianPatient with Glycogen Storage Disease Type IIIa

Anca Zimmermann1 Heidi Rossmann2 Simona Bucerzan3 and Paula Grigorescu-Sido3

1Department of Endocrinology and Metabolic Diseases 1st Clinic of Internal Medicine University of MainzLangenbeckstrasse 1 55131 Mainz Germany2Institute for Clinical Chemistry and Laboratory Medicine University of Mainz Langenbeckstrasse 1 55131 Mainz Germany3Center of Genetic Diseases Emergency Childrenrsquos Hospital University of Medicine and PharmacyMotilor Street 68 400370 Cluj Romania

Correspondence should be addressed to Anca Zimmermann zimmeranuni-mainzde

Received 1 October 2015 Accepted 6 December 2015

Academic Editor Shoji Ichikawa

Copyright copy 2016 Anca Zimmermann et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Background Glycogen storage disease type III (GSDIII) is a rare metabolic disorder with autosomal recessive inheritance causedby deficiency of the glycogen debranching enzyme There is a high phenotypic variability due to different mutations in the AGLgene Methods and Results We describe a 23-year-old boy from a nonconsanguineous Romanian family who presented withsevere hepatomegaly with fibrosis mild muscle weakness cardiomyopathy ketotic fasting hypoglycemia increased transaminasescreatine phosphokinase and combined hyperlipoproteinemia GSD type IIIa was suspected Accordingly genomic DNA of theindex patient was analyzed by next generation sequencing of the AGL gene For confirmation of the two mutations found geneticanalysis of the parents and grandparents was also performed The patient was compound heterozygous for the novel mutationc3235CgtT pGln1079lowast (exon 24) and the known mutation c1589CgtG pSer530lowast (exon 12) c3235 gtT pGln1079lowast was inheritedfrom the father who inherited it from his mother c1589CgtG pSer530lowast was inherited from the mother who inherited it from herfather Conclusion We report the first genetically confirmed case of a Romanian patient with GSDIIIa We detected a compoundheterozygous genotype with a novel mutation in the context of a severe hepatopathy and an early onset of cardiomyopathy

1 Introduction

Glycogen storage disease type III (GSDIII) sometimesreferred to as Cori-Forbes disease (OMIM 232400) is ametabolic disorder with autosomal recessive inheritancecaused by glycogen debranching enzyme (GDE) deficiencywith accumulation of an intermediate glycogen form calledlimit-dextrin (LD) in affected tissues [1]

GDE contains two catalytic sites with two different func-tions 4-alpha-glucanotransferase (EC 24125) and amylo-16-glucosidase (EC 32133) [2ndash4]

AGL (amylo-alpha-1 6-glucosidase 4-alpha-glucano-transferase) the gene encoding GDE spans 85 kb of genomicDNA contains 35 exons [3] and is located on chromosome1p212 [5] Bao et al recognized the presence of six differentisoforms of GDE that differ in the 51015840 end [6] Transcript

variant 1 of the AGL gene (NM 0006422) which is mainlyexpressed in liver and kidney consists of 34 exons 33 ofwhich are coding Tissue-specific alternative splicing maycontribute to the wide range of enzymatic and clinicalvariability described for GSDIII mutations (Human GeneAGL (uc001dsi1) httpsgenomeucscedu) The glycogenbinding site is encoded by exons 31 and 32 and the active siteis encoded by exons 6 13 14 and 15 [7]

GDE deficiency leads to storage of LD in affected tissues(liver skeletal muscles and myocardium) with morpholog-ical and functional consequences There are four subtypesof GSDIII depending on the type of enzymatic deficiencyand its location The most frequent two subtypes are causedby the deficiency of both catalytical GDE functions withinvolvement of liver and muscle in GSDIIIa (85 of patients)or only of liver in GSDIIIb (15 of patients) [8]

Hindawi Publishing CorporationCase Reports in GeneticsVolume 2016 Article ID 8154910 5 pageshttpdxdoiorg10115520168154910

2 Case Reports in Genetics

The clinical picture varies according to age In infantshepatomegaly keto-hypoglycemic episodes muscular hypo-tonia and growth retardation occur accompanied by highlyincreased transaminases combined hyperlipoproteinemiaand increased values of serum creatine kinase In adults withthe subtype IIIa the main findings are progressive myopathycardiomyopathy and sometimes altered hepatic tests [9 10]

The number of known mutations associated with GSDIIIhas increased over time with 130mutations by the end of 2014[11 12]

We report on a Romanian child with a GSDIIIa phe-notype harbouring a new nonsense mutation (c3235CgtTpGln1079lowast) in a compound heterozygote state with a pre-viously known mutation (c1589CgtG pSer530lowast) For correctsegregation molecular analysis has also been performed onthe parents and the two pairs of grandparents

2 Case Presentation

A 23-year-old boy was admitted to the Department ofGenetic Diseases of the Emergency Hospital for Children inCluj Romania for evaluation of hepatomegaly and elevatedtransaminases The patient was the parentsrsquo first child bornfrom the second gestation after an initial spontaneous abor-tion in the 8th gestational week from apparently healthynonconsanguineous and young parents (age at the childrsquosbirth mother 24 yrs father 27 yrs) The pregnancy was nor-mal with spontaneous vaginal delivery at termThe newbornappeared healthy with a length of 56 cm (97 percentile)and weight of 3500 g (50 percentile) [13] At the age of 1year hepatomegaly and highly increased transaminases wereobserved Ametabolic storage disorderwas suspected and thepatient was referred to our clinic for further investigation

At admission to our service the patient was in good gen-eral condition He presented with a body height of 900 cm(50 percentile) and a body weight of 165 kg (97 percentile)[13] severe hepatomegaly mild muscle weakness and mildsplenomegaly On sonographic volumetric evaluation thehepatomegalywas 43x the upper normal limit (UNL) and thesplenomegaly was 13x UNL Normal values were consideredto be 25 of the patientrsquos weight for the liver and 02 of thepatientrsquos weight for the spleen according to published criteria[14] Hepatic sonography showed additionally a slightlyincreased echogenic pattern

Laboratory tests showed the following abnormalitiesincreased transaminases (alanine transaminase (ALT) =760UIL and aspartate transaminase (AST) = 767UILnormal values 20ndash40UIL) and gamma-glutamyl transferase(120574GT) = 333UIL normal values lt 20UIL viral markersfor hepatitis B and hepatitis C were negative moderatelyincreased creatine phosphokinase (CPK) = 545UIL (normalvalues 30ndash200UIL) and lactic dehydrogenase (LDH) =780UIL (normal values 120ndash300UIL) confirming mus-cular involvement in accordance with the clinical pictureketotic fasting hypoglycemia (48mgdL) with metabolicacidosis (pH = 726 BE = minus126 HCO

3

minus = 128mmolL)and combined hyperlipoproteinemia with total cholesterol =282mgdL (normal values for age le 170mgdL) triglycerides= 300mgdL (normal values for age le 100mgdL)

Liver biopsy was performed before the patientrsquos refer-ral to our clinic The biopsy showed enlarged hepatocyteswith intracytoplasmic glycogen loading and stellate as wellas periportal bridging fibrosis with incomplete nodulartransformation Cardiac ultrasound showed a hypertrophicobstructive myocardiopathy with biventricular hypertrophyon electrocardiogram (EKG)

The clinical picture and the diagnostic findings suggest ahepatic glycogenosis (type IIIa)

21 Genetic Testing All of the genetic investigations per-formed on this patient and his family members were doneafter informed consent was obtained following local Institu-tional Review Board policies and procedures

The genomic DNA of the index patient isolatedfrom peripheral blood leucocytes was analyzed by a nextgeneration sequencing panel (Centogene AG RostockGermany) comprising the entire coding region and thehighly conserved exon-intron splice junctions of theAGL gene (amylo-alpha-16-glucosidase 4-alpha-glucano-transferase RefSeq NM 0006422 [variant 1] NM 0006452[variant 5] NM 0006462 [variant 6]) G6PC (glucose-6-phosphatase catalytic subunit RefSeq NM 0001513) GBE1(glucan (14-alpha) branching enzyme 1 NM 0001583) andSLC37A4 (solute carrier family 37 (glucose-6-phosphatetransporter member 4) RefSeq NM 0011642781) Librarypreparation was based on polymerase chain reaction (PCR)amplicons and the minimal coverage was 30x

A previously unreported heterozygous variant in exon24 of the AGL gene was identified c3235CgtT (pGln1079lowast)see Figure 1(a) This variant causes the reading frame to beinterrupted by a premature stop codon and is classifiedaccording to the American College of Medical Geneticsand Genomics (ACMG) recommendations as class 2 asequence variation previously unreported and of the typethat is expected to cause the disorder [15] Furthermore themutation c1589CgtG (pSerlowast) in exon 12 of the AGL gene hasalso been detected in a heterozygous state (Figure 1(b)) Thismutation has been previously described as disease-causing

No disease-causing mutation was detected in the G6PCGBE1 or SLC37A4 genes

The results were confirmed in a second independentsample at the Institute for Clinical Chemistry and LaboratoryMedicine (Mainz Germany) by conventional sequencing ofexons 12 and 24 (PCR primers ACCAGTGTTTCCTTG-AAGTAATTG and AAATCAATGCTTGTGTCCAACTAGfor amplification of exon 12 and TTGAAGGAAAGAAAC-CAAGTAAA and CTTGAGTAGCATTACAAGCTTTT forexon 24) For sequencing (Dye Terminator Cycle SequencingQuick Start Kit CEQ 8000 Genetic Analysis System Beck-man Coulter Krefeld Germany) M13M13R tags were addedto the PCR primers

Given the autosomal recessive mode of inheritance ofglycogen storage disease type III we performed parentalcarrier testing to confirm the mutation phase (cis or trans)We tested the grandparents too The mutation analysis offamily members has also been performed in the Institutefor Clinical Chemistry and Laboratory Medicine (MainzGermany)

Case Reports in Genetics 3

Index patient

Mother

Father

A G A A A A G G A G Y A A T G T T G T GA


A G A A A A G G A G C A A T G T T G T GA

c3235CgtTpGln1079lowast

(a)

Index patient

Mother

Father

c1589CgtGpSer530lowast

A A C T G C C A C T C A A C A C C T C T T

A A C T G C C A C T S A A C A C C T C T T


(b)

Figure 1 Sequence analysis of the index patient showing the novel mutation c3235CgtT pGln1079lowast in exon 24 (a) and the known mutationc1589CgtG pSer530lowast in exon 12 (b)

Further family members not genotyped

pGln1079lowast

pSer530lowast

Figure 2 Diagnostic sequence analysis of the AGL gene (exons 12 and 24) shows compound heterozygosity for c1589CgtG pSer530lowast andc3235CgtT pGln1079lowast in the index patient and heterozygosity for either c1589CgtG pSer530lowast or c3235CgtT pGln1079lowast in his parents andgrandparents

The results demonstrated the inheritance of the twomutations in trans phase The novel mutation c3235CgtT(pGln1079lowast) was inherited from the father who inheritedit from his mother while the known mutation c1589CgtG(pSer530lowast) was inherited from the mother who inherited itfrom her father (Figure 2) Therefore the index patient hasa compound heterozygous genotype with the novel mutationc3235CgtT (pGln1079lowast) in exon 24 and the known mutationc1589CgtG (pSer530lowast) in exon 12 (Figures 1(a) and 1(b))

22 Follow-Up The therapy was according to present rec-ommendations with a specific diet including frequent mealshigh in carbohydrates supplementation of maltodextrin

(1 gkg4 hrs) during the night to prevent hypoglycemiaprotein enrichment during the day (up to 3 gkg)

Six months after the start of treatment we registeredno more hypoglycemia improvement of dyslipidemia (totalcholesterol from 282 to 164mgdL and triglycerides from 300to 184mgdL) and decrease of transaminases (ALT from 760to 529UL AST from 767 to 472UL) with constant values ofgamma-GT

3 Discussion

The majority of the mutations reported in the AGL geneto date are nonsense or missense mutations small orlarge deletions or insertions Very few mutations are


specific for a geographical region most of them areprivate mutations [11 12] Three mutations (pArg864lowastpArg1228lowast and pTrp680lowast) account for approximately 28of the known mutations in individuals of European origin[11]

Mutations with a certain regional pattern are homozy-gous in affected individuals and have been described in Inuitchildren from the Eastern region of the Hudson bay andin Jews of North-African origin (c4555delT) [12 16] ininhabitants of the Faroe islands (c1222CgtT pR408lowast) [17]and inTunisian patients c3216 3217delGA [18] andpW1327lowast[19]These findings are explained by a ldquofounder effectrdquo and areresponsible for a high prevalence of the disease in these areas15420 in North-African Jews 13600 in the inhabitants ofthe Faroe islands and 12500 in Inuits versus 1100000 inNorth-America [17 18] A higher prevalence with clusteringof some mutations has been reported from Japan [20] andKorea [21]

The genetic heterogeneity due to a high number of privatemutations precludes a diagnostic strategy based on screeningfor the most common ones Furthermore the heterogeneityof the clinical picture with high phenotypic variability inpatients with the same genotype makes genotype-phenotypecorrelations extremely difficult [10 11] Heterogeneity evenwithin a given family has been noted [9] The only observedcorrelation is the association between mutations in exon 3with GSD type IIIb [22]

The index patient reported here has a GSD type IIIphenotype with a pronounced hepatic involvement (severehepatomegaly altered liver tests and liver fibrosis) anda hypertrophic obstructive cardiomyopathy The associa-tion of a mild muscular involvement suggests GSD typeIIIa The absence of a mutation in exon 3 associatedwith GSD type IIIb supports the diagnosis As shownour patient displayed a compound heterozygous genotypec3235CgtT (pGln1079lowast)c1589CgtG (pSer530lowast) c3235CgtT(pGln1079lowast) is a novel mutation leading to a stop codonyielding a truncated protein lacking the 31015840 454 amino acidsThe protein lacks exon 31 which is one glycogen bindingareaThe secondmutation c1589CgtG (pSer530lowast) also leadsto a premature stop codon and has been described previ-ously in a patient of Mediterranean origin who was com-pound heterozygous and presented with a severe phenotype[23]

Some studies describe severe hepatopathy at olderages in patients with GSD III such as in the seconddecade of life in an 18-year-old patient with the genotypec2607 2610delATCCc1672dupA [24] or in the third decadein 16 of the patients reported [9] The cardiomyopathyis also reported later in adult life [25] The phenotype inour patient with early hepatic and cardiac damage may beexplained by the fact that both mutations generate prematurestop codons with the theoretical risk of null alleles for thedevelopment of amore severe clinical picture [9] It is possiblethat further improvement will occur in time so the severityof the phenotype will be shown in future Nevertheless thesevere histologic damage of the liver remains a key elementof concern

4 Conclusions

We report on a new nonsense mutation (c3235CgtTpGln1079lowast in exon 24 of the AGL gene) in a compoundheterozygote state with the known mutation c1589CgtG(pSer530lowast) in the first genetically confirmed Romanianpatient with GSDIIIa Our observation adds to many otherprevious reports pointing out to the heterogenous geneticbackground of the disease and the need for complete AGLgene sequencing in the setting of a suggestive clinical picturein order to confirm the diagnosis to screen further siblingsand to offer correct genetic counselling in young families

Consent

Written informed consent has been obtained

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

References

[1] P S Kishnani S L Austin P Arn et al ldquoGlycogen storagedisease type III diagnosis andmanagement guidelinesrdquoGeneticsin Medicine vol 12 no 7 pp 446ndash463 2010

[2] W Liu N B Madsen C Braun and S G Withers ldquoReassess-ment of the catalytic mechanism of glycogen debranchingenzymerdquo Biochemistry vol 30 no 5 pp 1419ndash1424 1991

[3] Y Bao T L Dawson Jr and Y-T Chen ldquoHuman glycogendebranching enzyme gene (AGL) complete structural organi-zation and characterization of the 51015840 flanking regionrdquoGenomicsvol 38 no 2 pp 155ndash165 1996

[4] C B Newgard P K Hwang and R J Fletterick ldquoThe familyof glycogen phosphorylases structure and functionrdquo CriticalReviews in Biochemistry and Molecular Biology vol 24 no 1pp 69ndash99 1989

[5] T L Yang-Feng K Zheng J Yu B-Z Yang Y-T Chen and F-T Kao ldquoAssignment of the human glycogen debrancher gene tochromosome 1p21rdquo Genomics vol 13 no 4 pp 931ndash934 1992

[6] Y Bao B-Z Yang T L Dawson Jr and Y-T Chen ldquoIsolationand nucleotide sequence of human liver glycogen debranchingenzyme mRNA identification of multiple tissue-specific iso-formsrdquo Gene vol 197 no 1-2 pp 389ndash398 1997

[7] O N Elpeleg ldquoThe molecular background of glycogenmetabolism disordersrdquo Journal of Pediatric Endocrinology andMetabolism vol 12 no 3 pp 363ndash379 1999

[8] J-H Ding T de Barsy B I Brown R A Coleman and Y-TChen ldquoImmunoblot analyses of glycogen debranching enzymein different subtypes of glycogen storage disease type IIIrdquo TheJournal of Pediatrics vol 116 no 1 pp 95ndash100 1990

[9] S Lucchiari D Santoro S Pagliarani and G P Comi ldquoClinicalbiochemical and genetic features of glycogen debranchingenzyme deficiencyrdquo Acta Myologica vol 26 no 1 pp 72ndash742007

[10] C P Sentner Y J Vos K N Niezen-Koning B Mol andG P Smit ldquoMutation analysis in glycogen storage diseasetype III patients in the Netherlands novel genotype-phenotyperelationships and five novel mutations in the AGL generdquo JIMDReports vol 7 pp 19ndash26 2013


[11] J L Goldstein S L Austin K Boyette et al ldquoMolecular analysisof the AGL gene identification of 25 novel mutations andevidence of genetic heterogeneity in patients with GlycogenStorage Disease Type IIIrdquo Genetics in Medicine vol 12 no 7pp 424ndash430 2010

[12] I Rousseau-NeptonM Okubo R Grabs et al ldquoA founder AGLmutation causing glycogen storage disease type IIIa in Inuitidentified through whole-exome sequencing a case seriesrdquoCanadian Medical Association Journal vol 187 no 2 pp E68ndashE73 2015

[13] AACarillo andB F Recker ldquoLength for age andweight for ageboys birth to 36monthsrdquo in Pediatric Endocrinology F LifshitzEd p 987 Marcel Dekker New York NY USA 4th edition2003

[14] N Weinreb J Taylor T Cox J Yee and S Vom Dahl ldquoAbenchmark analysis of the achievement of therapeutic goalsfor type 1 Gaucher disease patients treated with imigluceraserdquoAmerican Journal of Hematology vol 83 no 12 pp 890ndash8952008

[15] C S Richards S Bale D B Billissimo et al ldquoACMG recom-mendations for standards for interpretation and reporting ofsequence variations revisions 2007rdquo Genetics in Medicine vol10 no 4 pp 294ndash300 2008

[16] R Parvari S Moses J Shen E Hershkovitz A Lerner andY-T Chen ldquoA single-base deletion in the 31015840-coding region ofglycogen-debranching enzyme is prevalent in glycogen storagedisease type IIIA in a population of North African Jewishpatientsrdquo European Journal of Human Genetics vol 5 no 5 pp266ndash270 1997

[17] R Santer M Kinner U Steuerwald et al ldquoMolecular geneticbasis and prevalence of glycogen storage disease type IIIA inthe Faroe Islandsrdquo European Journal of Human Genetics vol 9no 5 pp 388ndash391 2001

[18] A Mili I Ben Charfeddine A Amara et al ldquoAc3216 3217delGA mutation in AGL gene in Tunisian patientswith a glycogen storage disease type III evidence of a foundereffectrdquo Clinical Genetics vol 82 no 6 pp 534ndash539 2012

[19] W Cherif F Ben Rhouma H Messai et al ldquoHigh frequency ofW1327X mutation in glycogen storage disease type III patientsfrom central Tunisiardquo Annales de Biologie Clinique vol 70 no6 pp 648ndash650 2012

[20] W-L Shaiu P S Kishnani J Shen H-M Liu and Y-T ChenldquoGenotype-phenotype correlation in two frequent mutationsand mutation update in type III glycogen storage diseaserdquoMolecular Genetics and Metabolism vol 69 no 1 pp 16ndash232000

[21] J S Ko J S Moon J K Seo H R Yang J Y Chang andS S Park ldquoA mutation analysis of the AGL gene in Koreanpatients with glycogen storage disease type IIIrdquo Journal ofHuman Genetics vol 59 no 1 pp 42ndash45 2014

[22] J Shen Y Bao H-M Liu P Lee J V Leonard and Y-T ChenldquoMutations in exon 3 of the glycogen debranching enzyme geneare associated with glycogen storage disease type III that isdifferentially expressed in liver and musclerdquo Journal of ClinicalInvestigation vol 98 no 2 pp 352ndash357 1996

[23] S Lucchiari I Fogh A Prelle et al ldquoClinical and geneticvariability of glycogen storage disease type IIIa seven novelAGL gene mutations in the Mediterranean areardquo AmericanJournal of Medical Genetics vol 109 no 3 pp 183ndash190 2002

[24] Y Kondo H Usui M Ishige-Wada T Murase M Owada andM Okubo ldquoLiver cirrhosis treated by living donor liver trans-plantation in a patientwithAGLmutation c2607-2610delATTCand c1672dupArdquoClinica Chimica Acta vol 424 pp 19ndash21 2013

[25] A Ogimoto M Okubo H Okayama et al ldquoA Japanese patientwith cardiomyopathy caused by a novel mutation R285X in theAGL generdquo Circulation Journal vol 71 no 10 pp 1653ndash16562007

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014


MEDIATORSINFLAMMATION

of


Behavioural Neurology

EndocrinologyInternational Journal of



Disease Markers


BioMed Research International

OncologyJournal of



Oxidative Medicine and Cellular Longevity


PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of



Computational and Mathematical Methods in Medicine

OphthalmologyJournal of


Diabetes ResearchJournal of



Research and TreatmentAIDS


Gastroenterology Research and Practice


Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom


The clinical picture varies according to age In infantshepatomegaly keto-hypoglycemic episodes muscular hypo-tonia and growth retardation occur accompanied by highlyincreased transaminases combined hyperlipoproteinemiaand increased values of serum creatine kinase In adults withthe subtype IIIa the main findings are progressive myopathycardiomyopathy and sometimes altered hepatic tests [9 10]

The number of known mutations associated with GSDIIIhas increased over time with 130mutations by the end of 2014[11 12]

We report on a Romanian child with a GSDIIIa phe-notype harbouring a new nonsense mutation (c3235CgtTpGln1079lowast) in a compound heterozygote state with a pre-viously known mutation (c1589CgtG pSer530lowast) For correctsegregation molecular analysis has also been performed onthe parents and the two pairs of grandparents

2 Case Presentation

A 23-year-old boy was admitted to the Department ofGenetic Diseases of the Emergency Hospital for Children inCluj Romania for evaluation of hepatomegaly and elevatedtransaminases The patient was the parentsrsquo first child bornfrom the second gestation after an initial spontaneous abor-tion in the 8th gestational week from apparently healthynonconsanguineous and young parents (age at the childrsquosbirth mother 24 yrs father 27 yrs) The pregnancy was nor-mal with spontaneous vaginal delivery at termThe newbornappeared healthy with a length of 56 cm (97 percentile)and weight of 3500 g (50 percentile) [13] At the age of 1year hepatomegaly and highly increased transaminases wereobserved Ametabolic storage disorderwas suspected and thepatient was referred to our clinic for further investigation

At admission to our service the patient was in good gen-eral condition He presented with a body height of 900 cm(50 percentile) and a body weight of 165 kg (97 percentile)[13] severe hepatomegaly mild muscle weakness and mildsplenomegaly On sonographic volumetric evaluation thehepatomegalywas 43x the upper normal limit (UNL) and thesplenomegaly was 13x UNL Normal values were consideredto be 25 of the patientrsquos weight for the liver and 02 of thepatientrsquos weight for the spleen according to published criteria[14] Hepatic sonography showed additionally a slightlyincreased echogenic pattern

Laboratory tests showed the following abnormalitiesincreased transaminases (alanine transaminase (ALT) =760UIL and aspartate transaminase (AST) = 767UILnormal values 20ndash40UIL) and gamma-glutamyl transferase(120574GT) = 333UIL normal values lt 20UIL viral markersfor hepatitis B and hepatitis C were negative moderatelyincreased creatine phosphokinase (CPK) = 545UIL (normalvalues 30ndash200UIL) and lactic dehydrogenase (LDH) =780UIL (normal values 120ndash300UIL) confirming mus-cular involvement in accordance with the clinical pictureketotic fasting hypoglycemia (48mgdL) with metabolicacidosis (pH = 726 BE = minus126 HCO

3

minus = 128mmolL)and combined hyperlipoproteinemia with total cholesterol =282mgdL (normal values for age le 170mgdL) triglycerides= 300mgdL (normal values for age le 100mgdL)

Liver biopsy was performed before the patientrsquos refer-ral to our clinic The biopsy showed enlarged hepatocyteswith intracytoplasmic glycogen loading and stellate as wellas periportal bridging fibrosis with incomplete nodulartransformation Cardiac ultrasound showed a hypertrophicobstructive myocardiopathy with biventricular hypertrophyon electrocardiogram (EKG)

The clinical picture and the diagnostic findings suggest ahepatic glycogenosis (type IIIa)

21 Genetic Testing All of the genetic investigations per-formed on this patient and his family members were doneafter informed consent was obtained following local Institu-tional Review Board policies and procedures

The genomic DNA of the index patient isolatedfrom peripheral blood leucocytes was analyzed by a nextgeneration sequencing panel (Centogene AG RostockGermany) comprising the entire coding region and thehighly conserved exon-intron splice junctions of theAGL gene (amylo-alpha-16-glucosidase 4-alpha-glucano-transferase RefSeq NM 0006422 [variant 1] NM 0006452[variant 5] NM 0006462 [variant 6]) G6PC (glucose-6-phosphatase catalytic subunit RefSeq NM 0001513) GBE1(glucan (14-alpha) branching enzyme 1 NM 0001583) andSLC37A4 (solute carrier family 37 (glucose-6-phosphatetransporter member 4) RefSeq NM 0011642781) Librarypreparation was based on polymerase chain reaction (PCR)amplicons and the minimal coverage was 30x

A previously unreported heterozygous variant in exon24 of the AGL gene was identified c3235CgtT (pGln1079lowast)see Figure 1(a) This variant causes the reading frame to beinterrupted by a premature stop codon and is classifiedaccording to the American College of Medical Geneticsand Genomics (ACMG) recommendations as class 2 asequence variation previously unreported and of the typethat is expected to cause the disorder [15] Furthermore themutation c1589CgtG (pSerlowast) in exon 12 of the AGL gene hasalso been detected in a heterozygous state (Figure 1(b)) Thismutation has been previously described as disease-causing

No disease-causing mutation was detected in the G6PCGBE1 or SLC37A4 genes

The results were confirmed in a second independentsample at the Institute for Clinical Chemistry and LaboratoryMedicine (Mainz Germany) by conventional sequencing ofexons 12 and 24 (PCR primers ACCAGTGTTTCCTTG-AAGTAATTG and AAATCAATGCTTGTGTCCAACTAGfor amplification of exon 12 and TTGAAGGAAAGAAAC-CAAGTAAA and CTTGAGTAGCATTACAAGCTTTT forexon 24) For sequencing (Dye Terminator Cycle SequencingQuick Start Kit CEQ 8000 Genetic Analysis System Beck-man Coulter Krefeld Germany) M13M13R tags were addedto the PCR primers

Given the autosomal recessive mode of inheritance ofglycogen storage disease type III we performed parentalcarrier testing to confirm the mutation phase (cis or trans)We tested the grandparents too The mutation analysis offamily members has also been performed in the Institutefor Clinical Chemistry and Laboratory Medicine (MainzGermany)


Index patient

Mother

Father





(a)

Index patient

Mother

Father





(b)



pGln1079lowast

pSer530lowast






3 Discussion








4 Conclusions


Consent




References
































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of

















Index patient

Mother

Father





(a)

Index patient

Mother

Father





(b)



pGln1079lowast

pSer530lowast






3 Discussion








4 Conclusions


Consent




References
































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of






















4 Conclusions


Consent




References
































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of





































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of





















of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















Documents

Case Report A Novel Nonsense Mutation of the AGL Gene in ...downloads.hindawi.com/journals/crig/2016/8154910.pdfCase Report A Novel Nonsense Mutation of the AGL Gene in a Romanian