Chapter 13: Genetic Engineering

How could you get a desired trait without directly manipulating the organisms’ DNA?

• Selective Breeding

- choosing organisms with desired traits to produce the next generation

• Breeding the winners of a horse race (Smarty Jones)

• Selecting a person with a certain eye color or features

• Taking the seeds from the Great Pumpkin

Hybridization

• Crossing organisms of different traits to produce a hardier product

Ex. A mule is a cross of a horse and a donkey – Sturdy and surefooted

Hybrid corn – tastes good and is more resistant to disease.

Inbreeding

• Maintaining the present genes by breeding only within the population

• Ex. Pedigree animals

• Risk with dipping into the same gene pool and recessive traits showing

up that may be lethal or harmful.

Inducing mutations

By using known mutagens, attempt to force mutations to occur

• Radiation & Chemicals

• Not a sure bet nor do you know what you are going to get

• Polyploidy (3N or 4N) plants have resulted from this – larger & hardier

Glofish: the first genetically modified

animal to be sold as a pet

Now let’s manipulate the genes by altering the organism’s DNA

• DNA Technology – science involved in the ability to manipulate genes/DNA

• Purpose:– Treat disease (Cystic Fibrosis)– Treat genetic disorders (Hemophilia, diabetes)– Improve food crops (better tasting, longer

shelf life, fungus resistance…)– Improve human life in general– Forensic purposes

The Tools:• DNA Extraction – Chemical procedure (we did

this) to isolate DNA• Restriction enzymes – molecular scissors that

cut DNA at specific nucleotide sequences• Gel Electrophoresis – method to analyze

fragments of DNA cut by restriction enzymes through a gel made of agarose (molecular sieve)

• DNA Ligase – molecular glue that puts pieces of DNA together

• Polymerase Chain Reaction (PCR)- molecular copy machine. Makes millions of copies of DNA/hr

Let’s suppose that you are a diabetic and can not make your own insulin. What are

you to do?• Inject insulin of course but from what

source?

• Old method was to use sheep insulin. Costly and labor intensive also tough on the sheep

• New method: Let bacteria with a human insulin producing gene make it for you

The New Method:

• Transformation of a bacterium to produce human insulin

1. Extract the insulin producing gene from a healthy human

2. Using a restriction enzyme, cut the insulin producing gene out of a the DNA

What are restriction enzymes? • Bacterial enzymes – used to cut bacteriophage

DNA (viruses that invade bacteria).• Different bacterial strains express different

restriction enzymes• Restriction enzymes recognize a specific short

nucleotide sequence – Recognition site• For example, Eco RI recognizes the sequence:

• 5’ - G A A T T C - 3’• 3’ - C T T A A G - 5’ • Palindrones same base pairing forward and

backwards

Let’s try some cutting:

• Using this piece of DNA, cut it with Eco RI

G/AATTC

5` GACCGAATTCAGTTAATTCGAATTC

3` CTGGCTTAAGTCAATTAAGCTTAAG

5` GACCG/AATTCAGTTAATTCG/AATTC

3` CTGGCTTAA/GTCAATTAAGCTTAA/G

What results is:

• GACCG AATTCAGTTAATTCG AATTC

• CTGGCTTAA GTCAATTAAGCTTAA G

Sticky end Sticky end - tails of DNA – easily bind to other DNA strands

Blunt & Sticky ends

• Sticky ends – Creates an overhang. Bam HI

• Blunts- Enzymes that cut at precisely opposite sites without overhangs. SmaI is an example of an enzyme that generates blunt ends

3. Cut cloning vector:Carry the desired gene

• Use bacterial plasmids

– Plasmids will be cut with the same restriction enzyme used to cut the desired gene

• 4. Ligation - Donor gene (desired gene) is then spliced or annealed into the plasmid

using DNA ligase as the glue.

Recombinant DNARecombinant DNA - DNA with new piece of genetic information on it

• 5. Plasmid is then returned to bacterium and reproduces with donor gene in it.

Transgenic organism – organism with foreign DNA incorporated in its

genome (genes)• 6. Bacterium reproduces and starts producing

human insulin gene which we harvest from them.

Recombinant DNA Donor Gene

Practical Use of DNA technology

1. Pharmaceutical products – insulin, HBCF (human blood clotting factor), Human Growth Hormone

2. Genetically engineered vaccines – to combat viral infections (pathogenic – disease causing) – your body recognizes foreign proteins, produces antibodies. Introduced viral proteins will trigger an immune response and the production of antibodies

• 3. Increasing agricultural yields –– New strains of plants – GMO – Genetically

modified organism– Insect resistant plants – Insert gene that digests

larvae when larvae try to eat the plant – Not always specific to harmful species!! – Monarch problem

– Disease resistance – Fungal resistance in tomatoes, corn, soybean

– Herbicide resistance - *Round Up won’t harm the good plants, only the bad plants (weeds) – cheaper and less labor extensive than weeding

– Getting genes from Nitrogen fixing bacteria inserted into plants – fix their own nitrogen (a must for plants) in N poor soils

– Salt tolerant plants – can grow plants where high concentrations of salt in the air or soil

• Improve quality of produce

- Slow down the ripening process – ship when un-ripened, to market when ripe – Flava Sava gene

- Enhance color of produce

- Reduce hairs or fuzz on produce

- Increase flavor

- Frost resistance

Drought resistance

The negatives

• Problem with transgenic foods is that an introduced gene may produce a protein that someone may be sensitive to.

• FDA does not require that on a label (here in the US)

• If a label starts with a “(8), then it’s a GMO product – 84011 = GMO banana

• Also, may create “superweeds” that cross pollinate with others & may take over environment

Cloning

• Growing a population of genetically identical cells from a single cell.

• 1997 - Ian Wilmut with Dolly, the cloned sheep

1. Remove nucleus from egg cell

2. Fuse de-nucleated cell with a body cell from another adult

3. Cells fuse to become 2N and then divides

4. Implant embryo in reproductive system of foster mother

Hello Dolly!

DNA Fingerprinting

• Using cut DNA at specific sites to determine the source of the DNA.

• Analyzes sections of DNA that have little to no function but vary greatly from one person to the next (called repeats)

• RFLP analysis – We’ll do this in lab

Restriction Fragment Length Polymorphism

How is it done?

• RFLP analysis – Restriction fragment length polymorphism. We each have non-coding segments on our DNA. (Old genes)

1. Extract DNA sample from blood or tissues2. Cut DNA using restriction enzymes. Fragment lengths

varies with each person3. Separate fragments by gel electrophoresis – separates

DNA fragments by the # of base pairs (length of the fragment) and charge

4. Place DNA sample into wells in the agarose gel – molecular sieve

5. Run a current through the gel. The DNA (negatively charged) will migrate from (-) to (+)

6. The larger fragments will not migrate that far. The small fragments will go the furthest.

7. Stain gel and bands in a dye or use a radioactive probe to analyze the banding

• Electrophoresis “electro” = electricity “phoros” = to carry across

• Makes it possible to determine the genetic differences and the evolutionary relationship among species of organisms

• Method that separates macromolecules (Nucleic acids or proteins) on the basis of size, electric charge and other physical properties

Who did it? Suspect #1 or #2• #1’s fingerprint matches the

evidence left. • Neither Suspect #2 nor the

Victim matches #1.

• Therefore, #1 did it!!

• Your repeats are inherited from your parentsShown below are the repeat patterns for the Mom [blue], &

the Dad [yellow]

• Their four children:– D1 (the Mom and Dad’s biological daughter)– D2 (the Dad’s step-daughter, child of the Mom and her

former husband [red])– S1 (their biological son)– S2 (their' adopted son, not biologically related [his

parents are light and dark green]).

Gene Therapy

• Treatment of a genetic disorder (like cystic fibrous) by correcting a defective gene that causes a deficiency of an enzyme.

• Nasal spray that carries normal enzyme gene. Body makes enzyme and patient breathes normally. Regular treatments necessary

• Has not been proven to be successful in the long term

1. The healthy gene is inserted into a virus (retrovirus).

2. The (retro)virus is inserted into the patient (by injection or inhalation).

3. The (retro)virus enters the unhealthy cells and transfers the healthy gene into the unhealthy cells' DNA.

4. Now when the cells divide, the new cells will contain the healthy gene.

                                                                                                                                                          

.