51)11

CHARACTERIZATION OF GENES INVOL YED IN HETEROCYST DIFFERENTIATION AND PATTERN FORMATION IN THE

CYANOBACTERIUM ANABAENA SP. STRAIN PCC 7120

A DISSERTATION SUBMITIED TO THE GRADUATE DMSION OF THE UNIVERSITY OF HAW AI'I IN PARTIAL FULFll..MENT OF THE

REQUIREMENTS FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY

IN

MICROBIOLOGY

MAY 2008

By

Pritty B. Borthakur

Dissertation Committee:

Sean M. Callahan, Chairperson

David T. Webb

Paul Q. Patek

Maqsudul Alam

Sandra P. Chang

We certify that we have read this dissertation and that, in our opinion, it is satisfactory in scope and quality as a dissertation for the degree of Doctor of Philosophy in Microbiology.

Dissertation Committee

-

ID,ll)j( ik~

Acknowledgments

I am grateful to Dr. Sean Callahan, my advisor, for giving me an opportunity to come back to research on Anabaena, the cyanobacterium that I worked on previously in the labomtory of Dr. Robert Haselkom at the University of Chicago. I thank Dr. Callahan for his discussion and advice throughout this research. I would like to acknowledge my committee members, Dr. David Webb, Dr. Paul Patek, Dr. Maqs Alam, and Dr. Sandre Chang for their time, comments, and suggestious.

I would also like to thank our lab members, Christine Orozco, Shirley Y oung­Robbins, Hiroshi Yamaura, Ramya RajagopaIan, Doug Risser, Asha Nayar, Scott Harada, Deborah Lee, Sasa Tom, and Kelly Higa for their help in everyday laboratory situation, companionship, and friendship. I acknowledge Chirstine for her help at the beginning of my research, Shirley for her work on acetylene reduction. Hiroshi for his constant support, and Doug for his scientific discussion.

I gratefully acknowledge Mr. Peter Whiticar, Chief, SID/AIDS Prevention Branch, Department of Health, for allowing me to carry on this research.

I thank my parents for their support and encoumgements for higher education. I also thank my mother-in-law for her patience during her visit to Hawaii. She understood that it was quite a challenge to carry on my research with a full-time job. It would not have been possible without the everlasting support of my husband, Dr. DulaI Borthakur. I thank him for his endurance during my long hours of research during evenings, weekends, and holidays, for the past five years. Finally, I would like to thank our two wonderful daughters, Dr. Rajsree Borthakur and to-be-Dr. Gitasree Borthakur for their affection and inspiration, which are the sources of my strength for completing this research.

Abstract

The goal of this research was to understand regulation of heterocyst

differentiation in Anabaena sp. strain PCC 7120 (hereafter Anabaena PCC 7120) by

characterizing regulatory genes for heterocyst fonnation and their mutants. Anabaena is

a filamentous cyanobacterium that forms specialized cells for nitrogen fixation. called

heterocysts, which differentiate from vegetative cells at intervals of 10 - 12 cells. Two

genes, patS and hetN. are known to suppress the differentiation of vegetative cells into

heterocysts for establishing and maintaining a pattern of heterocysts along the filament

This study has established that PatS and HetN work independently to suppress

differentiation. Using a patS-deletion strain with conditional expression of hetN, it was

shown in this study that PatS and HetN are members of separate heterocyst suppression

pathways. Inactivation of either of these negative regulators enhances heterocyst

frequencies to >20%, compared to 9% in the wild type. However, inactivation of both

patS and hetN increases heterocyst differentiation to nearly 100%.

A mutant, UHM I 00, was created to study the function of both genes by deleting

patS and making expression of hetN conditional. In the absence of nitrogen in liquid

medium, almost all vegetative cells of UHM 1 00 differentiated to heterocysts, giving rise

to a phenotype called 'multiple contiguous heterocysts' (Mch). Interestingly, UHMlOO

has an Mch phenotype even in the presence of combined nitrogen, which usually

suppresses heterocyst differentiation. UHMIOO was used to study the time course of

heterocyst differentiation. The percentage of cells that differentiated into heterocysts

correlated with the time since induction and was independent of cell density in liquid

ii

medium lacking a fixed nitrogen source. It was expected that in the patS and hetN double

mutant UHMIOO, hetR will be overexpressed in all cells. However, when UHM100

containing hetR-gfp was grown in nitrogen-free medium, the pattern of fluorescence

observed at 48 h after induction showed that hetR was expressed in -55% cells,

suggesting that nitrogen-deprivation did not immediately induce hetR in all cells. Thus,

hetR expression in the absence of patS and hetN was asynchronous. The patS and hetN

double mutant was also used to determine if the position ofheterocysts along the filament

was random or not When the positions of heterocysts relative to other vegetative cells

was examined using statistical analyses for randomness, the distribution of heterocysts

was found to be nonrandom. Time course studies using UHM100 further showed that

heterocyst differentiation occurred in clusters of 2-5 cells at 48 h and the size of the

clusters increased with time. Heterocyst frequency reached -98% after 144 h in the

absence of fixed nitrogen. Clustering ofheterocysts in the filaments ofUHMIOO suggests

that besides PatS and HetN, there are other factors that influence pattern formation in

Anabaena PCC 7120.

A heterocyst-deficient (Her) spontaneous mutant, NSM6, was isolated from

UHMIOO. Complementation of NSM6 by a cosmid clone, pPB6-1, from an Anabaena

PCC 7120 genomic library restored the Mch phenotype of this mutant. By sequencing,

sub-cloning, and further complementation analyses, a novel gene, alr9018, was identified

in a 4.l-kb fragment of pPB6-1. The alr9018 gene is located in the Epsilon plasmid of

Anabaena, and it encodes a 148.7 -kDa protein. The Alr9018 protein contains an NTPase

domain, which is a characteristic of proteins involved in signal transduction. alr9018 is

expressed in both vegetative cells and heterocysts. Similar to alr9018, hetR can also

iii

restore the Mch phenotype in NSM6, suggesting that the NSM6 mutant can be

functionally complemented by mUltiple copies of either a/r9018 or hetR. When palr9018

was transferred to Anabaena PCC 7120, the transconjugants formed -15% heterocysts

compared to -10% heterocysts fonned by Anabaena PCC 7120. The transconjugants

also reduced at least 50% more acetylene than PCC 7120, suggesting that multiple copies

of alr9018 enhance heterocyst development. This is the first report showing that the

Epsilon plasmid of Anabaena PCC 7120 contains genes involved in heterocyst

differentiation. The identification and characterization of alr9018 in the present study

further show that the regulation of heterocyst differentiation in Anabaena is complex.

Further studies will be required to fully understand the complex interactions between

alr9018 and hetR and the role of alr9018 in cell differentiation and pattern formation in

Anabaena PCC 7120.

iv

Contents

Acknowledgements

Abstract

List of Contents

List of Figures

List of Tables

Abbreviations

TABLE OF CONTENTS

CHAPTER I. Heterocyst Differentiation in Anabaena sp. PCC 7120 .......... .

Introduction ....................................................•...•.................. Ultrastructure of a Heterocyst ......................................................... . Physiology of heterocyst. .............................................................. ... Biochemistry and genetics of heterocyst differentiation .................. . Additional genes for regulation of heterocyst development ...........•..... Models of heterocyst differentiation ....................•.............................. Similarities and differences between heterocyst differentiation and other bacterial cell differentiation .........................•...•..........••.................• Specific Objectives ........................................................................ ..

CHAPTER 2. Inactivation of patS and hetN Causes Lethal Levels of Heterocyst Differentiation In The Filamentous Cyanobacterium

Page

i

ii

v

vii

viii

ix

I I 4 5 6 10 11

13 15

Anabaena sp. PCC 7120 18 Introduction. ......... ..... ... ............ .... .... ..... .... ..•. ..•. ...... ............. 18 Result 20 PatS and HetN work independently to suppress differentiation.. ....... ..•.. ..•.. .. .. ...... .. ... .... ..... ..... .. .. .. ..................•... 20 Controlled expression of hetN in a patS-null background. .... ..... .. ... .. ... .. .. .. ... . .. .. .. ........................... ....................... 22 Limiting factors for complete differentiation .................................. . Inactivation of patS and hetN causes complete differentiation of filaments.. .... ......... ..... ..... ........... .......... ....... ..... ... ..... .......•.... 25 Limiting factors for complete differentiation.............. ......................... 30 Induction of hetR and pattern formation in the absence of patS and hetN expression........................................................... .................... 32 Discussion. . ... ...... ... .. ....... .. ... ... ... . ... .. .. ..... .•... .... .. .. ................... 37

v

I "

.·1

I I

1 ., !

I j

.1

!

Contents Page

CHAPTER 3. Identification and Characterization ofa Gene, alr9018, Which Enhances Frequencies of Heterocyst in the Filament of Anabaena sp. 43 PCC 7120 .......................................................................... .

Introduction............................. ......................................................... 43 Results..... .............. ... ...... ... ... ........................................................... 45 Isolation ofHef mutants ofUHM100........................................................ 45 Complementation ofNSM6 with an Anabaena genomic library...... ...... 45 Isolation and characterization ofa cosmid, pPB6-1, that restores an Mch phenotype to NSM6............................................................... 46 Cosmid pPB6-1 contains cloned DNA of the Epsilon plasmid of Anabaena PCC 7120........................................................................... 46 The cloned hetR restores Mch phenotype in NSM6 mutant....................... 50 NSM6 is not an alr9018 mutant......................................................... 56 NSM6 is not a hetR mutant................... ............................................... 56 NSM6 containing alr9018 makes functional heterocysts..................... 56 PCC 7120 containing alr9018 produced increased number ofheterocysts 58 PCC 7120 containing alr9018 fixed more nitrogen than PCC 7120........ 58 The expression of alr9018..................................................•..... 58 Possible functions of alr9018.................................................... 64 Discussion 65

CHAPTER 4. General Discussion...................................................... 67

CHAPTER 5. Materials And Methods................................................. 73 Culture conditions ......................................................................... ... Conjugation ............................................................................. . Selection of transconjugants Mutant selection ........................................................................ . Identifying the phenotype of the mutant ............................................ . NSM strain archival.. .................................................................. . Plasmid constructions ................................................................. . Construction of alr9018-gfp transcriptional fusion Plasmid DNA isolation and analyses ................................................ . Nucleotide sequencing ................................................................. . PCR amplification of DNA fragments ............................................ .. Colony PCR ............................................................................. . DNA sequence analyses .............................................................. . Strains Construction .................................................................... . Microscopy ............................................................................. . Heterocyst number, pattern and statistical analysis ................................ . Acetylene reduction assays ........................................................... .

73 74 75 75 76 79 79 81 81 82 82 83 85 85 87 87 88

CHAPTER 7. References................................................................ 89

vi

.. "

I !

I ·1 !

I i I

I I ,

)

I

I I

.: , :

LIST OF FIGURES i , !

I

Contents Page

Fig 1.1 A schematic representation of physiology of a heterocyst 16

Fig 2.1 PatS and HetN are members of separate heterocyst-suppression 23 pathways

Fig 2.2 In strain UHMI 00 expression of hetN determines the number of 27 cells that will differentiate into heterocysts.

Fig 2.3 Strain UHM \00 forms mature, functional heterocysts 28 I

Fig 2.4 With hetN inactivated, strain UHMIOO differentiates nearly all 29 heterocysts

I Fig 2.5 Extent of heterocyst differentiation as a function of time since 35

:; .1

induction and phase of growth

Fig 2.6 Asynchronous, non-random differentiation of heterocysts by strain 36 UHM I 00.

Fig 3.1 PpetE.hetN chromosomal fusion, strain 7120PN 43

Fig 3.2 Three Het-mutants ofUHMIOO in Cu.N.liquid medium. 47

Fig 3.3 NSM6 and its complemented derivatives NSM6-1 in CuN liquid 48 medium

Fig 3.4 Anabaena PCC 7120 (pPB6-I) showed Mch phenotype even in 52 BG-II N' solid medium.

Fig 3.5 The map of the cloned DNA in pPB6-1 53

Fig 3.6 NSM6 containing alr9018 ORF restored the Mch phenotype 54

Fig 3.7 NSM (phetRhetR) shows Mch phenotype in CuN medium 55 I

Fig 3.8 Strain NSM6 (p90 18) forms mature, functional heterocysts. 57 I .!

I

Fig 3.9 PCC 7120 (p90 18) differentiates 5% more heterocysts compared to 60 j

the wild type i ,j

vii

Contents Page ., ,

Fig 3.10 Acetylene reduction assay of PCC 7120 (p90 18) 61

Fig 3.11 alr9018-gfp expression at 15 h in different strains in N.liquid 62 medium

Fig 3.12 alr9018-gfp expression in the !!.heIR mutant grown in N+ medium 63 at 96 h

Fig 3.13 Hydropathy profile of the amino acid sequences of Alr9018. 64

.;

LIST OF TABLES

.1

viii

ABBREVIATIONS

Mch Multiple contiguous heterocysts

Nlf Nitrogen fixing genes

AhetR hetR is deleted

ApatS pats is deleted

P petE -hetN The normal promoter of hetN is replaced by the copper-inducible

promoter, petE

ix

, I I

I , 'I I I , i I

"

CHAPTER 1

Heterocyst Differentiation In Anabaena Sp. PCC 7120

Introduction

Cyanobacteria are a diverse group of organisms found in fresh or marine waters

and terrestrial habitats. Some cyanobacteria are also found in some extreme habitats

including hot springs, deserts, and polar regions (Whitton and Potts, 2000).

Cyanobacteria are O;r-evolving photosynthetic prokaryotes, and some species of

cyanobacteria are capable of fixing nitrogen under aerobic conditions. They emerged

approximately 3.5 billion years ago as the first photosynthetic prokayotes on the Earth.

Some cyanobacteria are unicellular while others are filamentous. Filamentous

cyanbacteria can have more than 100 cells connected to each other. In the filaments,

most cells can operate independently from each other and can be separated from the

filament to produce several filaments.

Anabaena sp. strain PCC 7120 (hereafter Anabaena PCC 7120) is a filamentous

cyanobacterium that is capable of both photosynthesis and dinitrogen fixation under

aerobic conditions. In the presence of combined nitrogen, such as nitrate or ammonia,

filaments of 100 or more cells grow as undifferentiated chains of vegetative cells. On the

other hand, in the absence of combined nitrogen, approximately 10% of the cells

differentiate into a specialized cell type, called a heterocyst, in a semi-regular pattern. As

the filament grows and the number of vegetative cells between two heterocysts increases,

a single vegetative cell midway between two heterocysts develops into a new heterocyst,

thus maintaining a pattern of one heterocyst in approximately ten vegetative cells.

1 ,.i

I i i

i i

i

I

Anabaena is a simple filamentous nitrogen-fixing cyanobacterium capable of

forming a one-dimensional pattern of single heterocysts separated by 10-12 vegetative

cells. It is a multicellular organism with prokaryotic cell structures that is easy to grow

and suitable for genetic manipulation. Development of heterocysts in the filaments of

Anabaena for nitrogen fixation provides a unique model system for studying cell

differentiation and the underlying genetic regulatory system.

The vegetative cells of Anabaena and other cyanobacteria have the characteristics

of a typical Gram-negative bacterial cell. They contain a cell envelope, which consists of

an inner plasma membrane, a peptidoglycan layer, and an outer membrane. In addition to

these membranes, cells of some Anabaena species are covered with a mucilaginous

sheath made of complex polysaccharides. Cells of Anabaena PCC 7120 do not contain

such a mucilaginous sheath. AF. in other Gram-negative bacteria, the cyanobacterial cell

wall acts as a mechanical and permeability barrier for larger molecules and contains

different transport systems for transfer of large molecules in and out of cells. The porins

in cyanobacterial cell walls are monomers of about 50 to 70 kOa. Between two adjacent

vegetative cells of a filament, there are microplasmodesmata pores for transport of

substrates (Fay 1992). During heterocyst differentiation, about 80% if the existing

micoplasmodesmata are destroyed as the poles of the cell become constricted into narrow

necks leaving smaller areas of contact with the adjacent vegetative cells (Thomas and

Staehlein 2004). Cyanobacteria have an internal system of thylakoid membranes where

the electron transfer reactions of photosynthesis using photosystem I and II and

respiration occur. These membranes contain chlorophyll a and several accessory

pigments. such as phycocyanin and phycoerythrin in the photosynthetic lamellae.

2

i ,I ,

I I , "

,i I

"

i

!

i

!

I !

i

1

I ,I i I 1

i I i

Phycobilisomes, which are water-soluble multiprotein complexes associated with the

thylakoid membranes, constitute about 50% of the total cellular proteins in cyanobacteria

(Grossman et al. 1993). The photosynthetic pigments in cyanobacteria can have different

colors: yellow, red, violet, green, deep blue and blue-green. Due to their blue green

pigmentation (phycocyanin and phycoerythrin) and photosynthetic activity they are often

known as 'blue-green algae'.

Vegetative cells of cyanobacteria are photosynthetic cells that divide and grow

under favorable conditions. In some filamentous cyanobacteria they can differentiate into

three different cell types: (i) Akinetes are spores that can withstand adverse

environmental conditions and remain viable in sediments for many years under harsh

conditions such as cold, darkness and desiccation (Adam and Carr 1981). When suitable

conditions for vegetative growth are restored, the akinete germinates into new vegetative

cells. Thus the akinete appears to be a "resting" stage (Meek et aI. 2002) similar in

function to a spore. (ii) Hormogonia are small motile filaments that are capable of

gliding, and are formed during symbiotic associations with bryophytes. Their production

is inducted by an uncharacterized hormogonia-inducing factor (HIP) secreted by the host

Once the motile hormonogia reach the bryophyte host cavity, they revert back to

vegetative cells and nitrogen fixing heterocysts (Herroro et al. 2004). In the host cavity,

hormogonia differentiation is repressed by a hormogonia-repressing factor (HRF)

produced by the host (Adams 2002). (iii) Heterocysts are specialized nitrogen fixing

cells of filamentous cyanobacteria.

3

, 1 1

I '1 I

I , , ,

! , .1

Heterocysts contain a thick layer of glycoplipid to prevent oxygen getting into the

cell, thus providing a microaerofilic condition for nitrogen fixation (Winkenbach et ai.,

1972). During heterocyst differentiation, PSI! and phycobiliproteins are degraded (Wood

and Haselkorn, 1979, 1980; Wolk et al. 1994) and nitrogenase enzymes are synthesized.

A TP for nitrogen fixation is derived from PSI, and carbon sources, which are required for

generation of NADPH are provided by neighboring vegetative cells (Wolk et al. 1988,

Mum-Pastor and Florencio. 1994). Almost half of the NADPH is used for respiration

and nitrogen fixation in heterocysts (Murray and Wolk, 1989). Atmospheric nitrogen

enters a heterocyst through diffusion, where it is then converted to NH3 by nitrogenase

(Fuchs, G. 1999).

Nz+ 8It" + 8e"+ 16 ATP __ N_iII'_ose_, ..... __ ... 2NH3+ Hz+ 16ADP + 16 PI

Heterocysts transport fixed nitrogen in the fonn of glutamine or arginine to the vegetative

cells (Fay 1992). A review of the literature on the biochemistry and genetics of

heterocyst differentiation is the main objective of this chapter.

Ultrastructure of a heterocyst

Heterocysts are physically distinct from vegetative cells. They have a larger size,

thicker cell wall, and a less granular cytoplasm. The heterocyst cell envelope contains

two specialized layers composed of glycoplipid and polysaccharide that provide physical

protection and prevent oxygen from diffusing in (Fig 1.1). . At the polar ends of

heterocysts, where vegetative celis are attached, the cell wall thickens to fonn two

4

, ,

J i

.I

i i I

"

I

.,

refractile bodies. In terminal heterocysts, there is only one refractile body. Refractile

bodies are made up of cell wall with accumulated nitrogen compound. A heterocyst is

connected to the neighboring cells by a septum containing a plasma bridge called

microplasmodesmata. The microplasmodesmata between a heterocyst and a vegetative

cell is much smaller in pore size than between two vegetative cells (Wolk et aI. 1994).

Recently, it has been shown that there is a functionally continuous periplasm that allows

movement of proteins along the filament inside of a common outer membrane (Vicente et

aI., 2007). During nitrogen fixation, heterocysts and vegetative cells are functionally

independent. The vegetative cells supply fixed carbon, reduced sulphur, and glutamate to

heterocysts. In the heterocyst, fixed nitrogen (NH3) is converted by glutamine synthetase

into glutamine, which is transported to vegetative cells.

Physiology of heterocysts

Heterocyst physiology is different from that of vegetative cells due to its

specialized structure and function. Heterocysts provide a microaerophilic environment to

protect oxygen-labile nitrogenase from oxygen damage by having two additional layers:

a thick glycolipid layer and a thin polysaccaharide layer. The nitrogenase enzyme

requires an oxygen-free environment to function because this enzyme is irreversibly

damaged by oxygen. The small amount of oxygen initially present in heterocysts is used

in respiration and thus the cell achieves an anaerobic condition for the nitrogenase

enzyme to function. Heterocysts lack ribulose-bisphosphate-carboxylase (no Calvin

cycle), PSll, and phycobiliproteins; they do not fix carbon dioxide. Heterocysts receive

carbon supply from adjacent vegetative cells. pssibly through microplasmadesmata

5

I

.j

I

!

i I I

I

I

i ·i " ,

, J

(Fay (992) or the contiguous periplasm (Vicente et aI., 2007). Maltose and sucrose are

believed to be transported from the vegetative cells (Wolk et al. (988). Heterocysts

oxidize sugar via the oxidative pentose phosphate pathway to reduce NADP to NADPH.

The NADPH is then used to provide reductant to nitrogenase reductases or component n

of nitrogenase. The energy for nitrogen fixation comes as A TP from photosystem I.

Atmospheric nitrogen enters heterocysts by diffusion through the cell envelop as well as

from the neighboring cells. Nitrogenase converts nitrogen into ammonia, which is then

assimilated to produce glutamine by the enzyme glutamine synthetase and transported to

vegetative cells.

Biochemistry and genetics of heterocyst differentiation

Heterocyst differentiation takes place in the absence of fixed nitrogen within 24 h.

Some of the events that take place during heterocyst differentiation are described below:

Initiation of heterocyst differentiation: Immediately after nitrogen deprivation, the level

of 2-oxogluratate (2-00) increases in all cells and gives a signal for the absence of

nitrogen in the environment. 2-00 serves as the carbon skeleton for ammonium

assimilation through the glutamine synthetase-glutamate synthase (OS-GOOA T) cycle

(Vazquez-Bermudez et aI., 2000). Within the first hour of nitrogen starvation, the

concentration of 2-00 reaches to its highest level (Zhang et al. 2006) and activates NtcA

NtcA is a transcription factor belonging to the cyclic AMP receptor protein family

that induces transcription of a series of genes involved in nitrogen and carbon metabolism

(Herrero et al. 2004). NtcA activates transcription of hetR within 3 h of nitrogen step

down, a gene necessary for heterocyst differentiation (Buikema and Haselkorn, (991).

6

"

, :

:,1

I

I 1 I I

,I i

,

I I I I I I

,1 I

i ! ,I

,I

I I I I I i I I , :

J

HetR is the master regulator of heterocyst differentiation in Anabaena PCC 7 I 20

(Buikema and Haselkorn 200 I). HetR is a DNA binding protein and its

homodimerization is required for DNA binding (Huang et al 2004). HetR binds the

promoter regions of hetR. hepA. and patS (Black et al 1993, Leganes 1994). Besides

regulating other genes for heterocyst differentiation, heIR also regulates its own

expression (Cai and Wolk 1997). When the Cys-48 residue of hetR was replaced with Ala

residue in Anabaena PCC 7 I 20, the resulting mutant could not dimerize, indicating that

HetR dimerizatin occurs through disulphide bonds (Huang et al 2004). Similarly, a

substitution of Asp- I 7 residue to Glu has been shown to alter DNA binding ability of

HetR, as a result of which the mutant has lost the abilities to promote differentiation

Disser and Callahan 2007). HetR has also been shown to contain auto degradation

protease activity, and the serine residue at position 152 has been reported to be the active

site of protease activity (Dong 2000). However, Risser and Callahan (2007) recently

showed that a Ser to Ala substitution at position 152 did not have any effect on heterocyst

differentiation or patterning in Anabaena PCC 7 I 20. Thus HetR may not have

autodegradative protease activity as previously described (Black et al 1993, Zhang et al

2007).

Heterocyst differentiation: At about 12 h after induction, some vegetative celIs commit

to heterocyst differentiation (Yoon and Golden, 200 I). The biochemical changes in

differentiating cells starts with degradation of light harvesting proteins, phycobilisomes,

(Wood and Haselkorn 1980). Degradation of phycobilisomes is thought to provide

substrates for protein synthesis. In addition, degradation of phycobilisomes minimizes

the absorption of excess excitation energy under the stress situation. This process is

7

1

i i I 'I I

I I I

i ,I

I

"

"

I

i

I

I i

i , i

known as proteolysis and is visible by a color change from blue-green to yellow-green,

which is similar to chlorosis or bleaching (Allan and Smith 1969). NbIA, a small protein

encoded by the gene nblA plays a central role in degradation of phycobilisomes in

Anabaena PCC 7120 (Baier et al. 2004, Bienert et at. 2006). Within 3 h, the expression

of hetR increases in all cells. Expression of nrrA (NrrA is a nitrogen-responsive response

regulator with a DNA-binding domain) starts in the early stage of heterocyst

differentiation (Ehira and Ohmori 2006). The level of Ca2+ ions increases after one to

two hours of HetR expression, which suggests that HetR protease activity degrades the

ea2+ -binding protein CcbP, and releases free Ca2+ (Zhao et al. 2005). HetR is believed

to be a Ca2+ dependent protease and increased levels of ea2+ may be necessary for HetR

fimction to up-regulate other het genes in differentiating cells (Zhao et al. 2005, Shi et al.

2006). During this time, early heterocyst differentiation genes, hepA and devA for

heterocyst envelope synthesis (Y oon and Golden, 200 I); hetC and hetM for glycolipid

layer formation (Khudyakov and Wolk, 1997, Wolk 1996) are also expressed. At 12 h,

vegetative cells that are in the process of differentiation become pro-heterocysts, which

have not yet developed an additional glycoplipid layer on the cell surface (Adam 2000).

The filament grows by increasing the number of vegetative cells between heterocysts,

and when the filament reaches 20 or more vegetative cells between heterocysts, a cell,

which is midway between two heterocysts differentiate to become heterocyst

Pattern formation and pattern maintenance: Heterocyst pattern formation and

maintenance is controlled by genes that have positive effects, such as hetR and patA, and

by genes that have negative effects, such as patS and hetN. Recently, one additional

positive regulatory gene. hetZ (Zhang et al. 2007) and two negative regulatory genes,

8

I

I

I I I

1

I I j I

!

asr1734 (Wu et al. 2007) and patU3 (Zhang et al. 2007) involved in heterocyst

differentiation and pattern fonnation have been reported. The patS gene is involved in

negative regulation of heterocyst differentiation. PatS regulates de novo pattern

fonnation when filaments are induced to differentiate. patS encodes a 17- or 13-amino

acid peptide that prevents binding of HetR to the hetR promoter region (Huang et al.

2004). patS is expressed in developing heterocysts, and overexpression of patS

completely blocks heterocyst development (Yoon and Golden, 2001). The PatS peptide,

which is produced in heterocysts, diffuses to the adjacent vegetative cells and prevents

them from differentiating into heterocysts (Y oon and Golden 200 I). Expression of patS

is induced soon after nitrogen deprivation, and the mUltiple contiguous heterocyst (Mch)

phenotype of a patS mutant is observed at 24 h after nitrogen step down, but thereafter,

the expression of patS returns to preinduction levels, suggesting that PatS controls de

novo pattern fonnation, but may not be the sole factor in controlling the pattern formation

and maintenance (Y oon and Golden 1998). Pattern formation in a patS-deletion strain

shifts from a Mch to a more wild type pattern after 72 hours (Y oon and Golden 200 I).

These observations suggest that there are other factor(s) independent of PatS involved in

pattern maintenance.

Another regulatory gene involved in negative regulation of heterocyst

differentiation is hetN. The hetN gene is predicted to encode a ketoacyl reductase that

serves as a negative factor for heterocyst pattern maintenance (Black and Wolk 1994,

Callahan and Buikema 200 I, and Li et al 20002). When hetN is present on a multicopy

plasmid in Anabaena PCC 7120, it partially prevents heterocyst differentiation (Black

and Wolk 1994). This is different from the multicopy expression of patS, which

9

I , I I I

"I I

I I I

I

I i I I

completely suppresses heterocyst differentiation. Prevention of hetN expression in

Anabaena pee 7120 does not appear to have any visible effects on heterocyst frequency

in 24 h, but it causes a delayed Mch phenotype at 48 h, suggesting that HetN is involved

in maintenance of spacing after the initial heterocyst pattern has been established

(Callahan and Buikema 200 I).

During heterocyst differentiation, patA is involved in the regulation of HetR

activity (Buikema and Haselkom 200 I). The PatA protein sequence indicates that it is a

response regulator of a two-component environmental sensing system. In a patA mutant

and heterocysts are formed primarily at the ends of the filaments (Liang et aI., 1992).

Besides attenuating the negative effects of PatS and HetN on differentiation, PatA

promotes differentiation in a manner that is independent of the antagonistic effects of

PatS and HetN (Orozco et al. 2006). PatA may be required for either hetR transcription

or for posttranslational modification ofHetR (Buikema and Haselkom 2001). A patA

patS double mutant, but not a patA hetN double mutant, produces intercalary heterocysts

with an Mch phenotype (Orozco et al. 2006).

Additional genes for regulation of heterocyst development

Besides hetR. patA. hetN. and patS, there are other genes involved in fine-tuning

of heterocyst differentiation. Recently, Zhang et al. (2007) identified a gene cluster that

regulates both heterocyst differentiation and pattern formation in Anabaena pee 7120.

Among 10 genes in this cluster, two genes designated alr0099. or hetZ. and alrOlOl. or

patU3, have been shown to be directly involved in heterocyst differentiation and pattern

formation. There is a small ORF, patU5, in between hetZ and patU3. The patU5 ORF

overlaps hetZ by eight base pairs. patU5 mutants have not been isolated and the function

10

of this ORF is not known. Mutants of hetZ showed delayed or no heterocyst

differentiation in nitrogen step-down experiments. In contrast, a patU3 mutation

produced a Mch phenotype. Genes hetZ. patU5, and patU3 are inducible upon nitrogen

step-down. The up-regulation of hetZ and patU3 in differentiating cells depends on hetR.

patU3 is required for strong expression of hetZ, whereas functional hetZ reduces its own

expression (Zhang et al 2007). HetZ may bind to DNA and may regulate certain

heterocyst development genes, including its own by binding directly to their regulatory

sequences. Thus, HetZ has some function similarities with HetR.

Recently, Wu et al. (2007) identified another negative regulatory gene for

heterocyst patter formation. The asr 1734 gene inhibited heterocyst development when

present in extra copies in Anabaena PCC 7120. A asr1734 mutant produced 15%

heterocysts, compared to -10% heterocyst in the wild type Anabaena PCC 7120.

Models for heterocyst differentiation

Under nitrogen step down condition, some cells of the Anabaena PCC7120

filament undergo differentiation to become heterocysts. Although every vegetative cell in

the filament has -0.1 probability to differentiate into a heterocyst, the terminal cells have

higher probabilities for differentiation. This implies that there is an interaction between

stimulating and inhibiting factors within each cell for heterocyst differentiation. While

the stimulatory factors stimulate a vegetative cell to differentiate, the inhibitory factor

prevents it from undergoing differentiation. Thus a cell needs essential supports from the

adjacent cells to balance the opposing factors for differentiation. Deprivation of nitrogen

must trigger the cascade of stimulatory effects. It is known that under nitrogen step-

11

down condition, increased levels of 2-00 up-regulates the expression of ntcA, leading to

a high level expression of hetR. The initial stimulatory effects of nitrogen deprivation,

which are characterized by expression of hetR may occur in all vegetative cells.

Therefore. the determination that certain cells will become heterocysts is influenced by

the inhibitory effects exerted by the adjacent neighboring cells. Wilcox and Smith (1973)

demonstrated that proheterocysts at early stages could be made to regress by preventing

inhibition by neighboring cells through filament fragmentation. In comparison to

intercalary cells, the terminal cells receive only half the inhibitory effects from

neighboring cells. This explains why the terminal cells differentiate at higher

frequencies.

Wolk and Quine (1975) also supported the inhibition model, described above, and

proposed a 'one-stage model' to explain the probability of a vegetative cell to become

heterocyst. According to this model, every cell has equal probability to become a

heterocyst under nitrogen depriving conditions. They also postulated the existence of a

diffusible inhibitor made by proheterocysts that pass from cell to cell and is consumed by

neighboring cells. The cells that receive or accumulate less amount of the inhibitory

factor become committed to differentiate into heterocysts.

Meeks and Elhai (2002) expanded the above idea and proposed a 'two-stage'

model to explain the probability of a cell to become heterocyst. According to this idea,

although all vegetative cells in a filament should have equal probability to differentiate

under nitrogen deprivation, only those cells that are in a critical physiological stage of the

cell cycle can express hetR at a high level under the influence of NtcA. In a filament,

cells are at different stages of division and maturity, and only the mature cells can express

12

, , I I I I I

I , 1

i

I , i I

, I , , i ., I ! I

i

j I .. ,

j .j

hetR at high levels. Thus, the mature cells provide the first stage of initiation for

differentiation in the 'two-stage' model. The second stage of the 'two-stage' model is the

same as the inhibition stage of the 'one-stage' model by Wolk and Quine (1975).

Accordingly, the inhibitory diffusible peptide PatS is produced in the cells that express

high levels of HetR. PatS diffuses to the neighboring cells and prevents them from

differentiation. Thus, a gradient of PatS is formed in the filament. Cells located further

away from a hetR- and patS-expressing cell receives the least amount the inhibitory

peptide PatS and therefore can differentiate.

Similarities and differences between heterocyst differentiation and other bacterioJ cell

differentiation

Based on our understanding of spore formation in Bacillus subtilis, development

of swarming cells in Caulobacter crescentus, and differentiation of fruiting bodies in

Myxococcus xanthus, it was long expected that Anabaena would also have a similar

regulatory system comprising an external or internal signal molecule. a histidine kinase

like sensor and response regulator, which would serve as a regulator of transcription for

genes for heterocyst differentiation (Table 2. I). As expected, a signal molecule has been

identified; 2-0G serves as the internal signal for reduced nitrogen availability in the cell.

It has been recently shown that Anabaena PCC 7120 has at least 77 sets of two-

component regulatory proteins. None of these have so far been shown to be directly

involved in heterocyst differentiation.

Surprisingly, nitrogen fIXation in heterocysts requires at least three DNA

rearrangements (Golden et al. 1985). Three DNA elements, 10.5-kb, II -kb, and 50-kb in

13

I

I I

'i I i

size, are excised from the chromosome, resulting in the transcriptional activation of the

nif and hup genes. As a result of this rearrangement, functional nitrogenase enzymes are

synthesized for nitrogen fixation (Haselkorn 1978, 1992).

In Bacillus, there is an alternative sigma factor, which combines with the core

RNA polymerase to produce a new type of RNA polymerase holoenzyme for

transcription of genes involved in sporulation (Table 2.1). It was expected that Anabaena

might also have a similar alternative sigma factor for transcription of genes involved in

heterocyst differentiation. Such an alternative sigma factor directly involved in

heterocyst differentiation has not been found. Although, Aldea et al. (2007) have shown

that the expression of three sigma factor genes sigC. sigE. and sigG are upregulated in the

proheterocyst, these genes hllve not been shown to be directly involved in heterocyst

differentiation. Instead, another gene, hetR, a master regulatory gene for heterocyst

differentiation was discovered. These results show that there is a wide diversity among

different bacteria that undergo differentiation to develop specialized cell types for

specific functions. Differentiation can be achieved in a nwnber of ways that include gene

rearrangement, use of alternate sigma factors for transcriptional activation of specific

genes, a variety of sensor proteins to sense internal or external stimuli, and a regulatory

cascade of genes involving one or more regulatory genes.

Heterocyst differentiation involves a genetic mechanism that requires both

positive and negative regulators to maintain a steady relationship between vegetative

cells and heterocysts. The directionality of the regulatory cascade is orchestrated at

several levels. First, the intemallevels of2-oo determines the expression of the positive

regulator ntcA, which triggers the expression of the early heterocyst development genes,

14

i 1

I ,I I 1

i

.1

I

i

i I

I

i " .1

I i

I

I .1 I

the master regulatory gene for heterocyst differentiation, hetR, and nif genes for nitrogen

fixation. However, the expression of the master regulator is fine-tuned by two negative

regulators, PatS and HetN. Another regulator patA modulates hetR gene expression by

attenuating negative effects of both PatS and HetN on differentiation and promotes

differentiation independent of its effects on PatS and HetN activity (Orozco et al. 2006).

Thus, Anabaena has multiple levels of regulation for heterocyst differentiation and

nitrogen fixation.

Specific objectives

Objective I: Characterization of heterocyst differentiation and pattern formation in the

absence of negative regulators, patS and hetN, in Anabaena PCC 7120.

Objective 2. Identification of additional genes involved in heterocyst differentiation

using the patS-hetN-double mutant UHMIOO.

15

I j

I 'I

I

! I I

.1

" I

I ! I , .,

I ,

C02

fAictoptumodesmata (TflInsportltton through cds)

P SI

Nitrogen fi x:ation

fAtc:,oplasmodcsmati (Tl"lnsportltion through ulls)

{jl--:.~. 1:: "", ...... -... t Vegef.ltive cell

Heterocyst

(Nitrogen Fixation celli

Hydroxy .. ted g~cop/ipid .. yet

Fig. 1.1 . A schematic representation of physiology of a heterocyst.

Transport of fixed nitrogen as ammonia from heterocyst 10 vegetative cell

and sugars to heterocyst takes place through microplasmodesmata, a bridge

between the two types of cells.

16

Table 1.1. Similarities and differences in biochemical and genetics of heterocyst in

compared to three other bacterial cell differentiation.

Characteristics

Purpose of differentiation

Bacterial type

Inducer

Cen wall

DNA

MaJor genes Involved In

differentiation

Signal for dlfferentiatiou

Ultimate fate

Heterocyst

Specialized for nitrogen fixation, ensures

microaerobic condition

Gram-negative

Absence of combined nitrogen such as NO, or

ammonium

Glycolipid and polysaccharides,

impenneable to 0,

Undergo DNA rearrangement resulting

in activation of nif genes, loss of DNA

fragments

Het genes: heIR, hetN, helM, hetC; Pattern genes: patS, patA, Other genes: ntcA

Signal for differentiation Increase

level of2-OG (2a-ketoglutarate)

Heterocyst is terminally differentiated cell, it

dies

Endospore of Badl/JIs subtOJs

Survive harsh environmental

conditions

Gram-positive

Absence of nutrients, harsh environmental

conditions

Dipicolinic acid is • major component of

the inner coat

No gene arrangement

rpoN, Seven genes: spoD closter

External conditions seased by two­

component signal transduction pathway

Germinate in suitable condition and develop new vegetative cells

17

Swarming eeIIs of Cau/olnu:ter

cresuntus

Survie harsh environmental

condition

Gram-negative

Absence of nutrients such as phosphate

Flagella attached to cell wall

No gene arrangement

DivJ and PleC, CtrA­master transcripton

regulator

Fruldog body of Myxoeoecos

xanthos

Survie harsh environmental

condition

Gram-negative

Absence of nutrients

Partial peptidoglycan

No gene arrangement

asgA, asgB,and rpoD

3'-<li-5'­External conditions (tri)diphosphate

sed b tw nucleotides c:'pon~ si;ru [(P)PPG!?p) is the

tnmsd cti path global SIgnal for u on way starvation

Divide to new cells Divide to new cells

, I I , , ,

I " I I

'!

I I i

!

"

I I ..

CHAPTER 2

Inactivation of pIllS and hetN eauses lethal levels of beterocyst differentiation In the

filamentous cyanobacterium Anabaena sp. PCC 7120

IThis chapter was published as "Borthakur. P.B., Orozco, C.C., Young-Robbins, S.S., Haselkorn, R.. and Callahan, S.M. (2005) Inactivation of palS and ketN causes lethal levels of heterocyst differentiation in the filamentous cyanobacterium Anabaena sp. PCC 7120. Mol Microbiol 57: 111-123.,,]

Introduction

Heterocyst differentiation in Anabaena represents one of the simplest

developmental patterns found in a multicellular organism. This simplicity makes it an

ideal system for elucidation of the minimal developmental genetic requirements for the

formation of a sustainable pattern of differentiated cell types. The one-dimensional

pattern of terminally differentiated cells allows the organism to simultaneously carry out

the incompatible processes of non-cyclic photosynthesis and dinitrogen fixation in an

aerobic environment Driving the differentiation of vegetative cells into nitrogen-fixing

beterocysts is HeIR, which is both necessary and sufficient for differentiation (Buikema

and Haselkorn 1991, 200 I ). Expression of hetR involves positive autoregulation, which

appears to have both direct and indirect components that affect some of the four putative

transcriptional start sites in the promoter of hetR (Black et al. 1993; Mura-Pastor et al.

2002). The products of two genes, patS and hetN, are thought to down-regulate the

expression of hetR (Callahan and Buikema 2001; Huang et aI. 2004), which may increase

indefinitely ifleft unchecked.

The gene patS governs de novo pattern formation wben filaments are induced to

differentiate. A patS-null mutant exhibits a phenotype of multiple contiguous heterocysts

(Mch), an altered pattern of shortened vegetative cell intervals (Pat) on nitrogen-<ieficient

18

I I

,; i

'I I

I 1

, ,j

media and abnonnal differentiation in the presence of fixed nitrogen (Yoon and Golden

1998). The gene encodes a 17- or 13-amino acid peptide, and exogenous addition of its

C-terminal pentapeptide to a culture of Anabaena prevents heterocyst differentiation.

Recent evidence that the receptor for PatS signal is cytoplasmic (Wu et aI. 2004) and that

PatS pentapeptide prevents binding of HetR to regions of the hetR promoter (Huang et

aI., 2004) suggests a direct action of PatS in prevention of hetR auto-regulation. To

govern pattern fonnation PatS acts non-cell autonomously (Y oon and Golden 1998).

Consequently, it has been proposed that the PatS peptide diffuses away from

differentiating proheterocysts along the filament to create a gradient of inhibitory signal.

Expression of patS is induced soon after nitrogen deprivation, but after differentiation is

complete, expression of patS returns to preinduction levels, suggesting that patS controls

de novo pattern fonnation but may not be the sole factor controlling maintenance of the

pattern. The fact that a patS-deletion strain shifts from a Pat, Mch pattern of heterocysts

to a more wild-type pattern after 72 hours (y oon and Golden 200 1) suggests that another

factor(s) independent of patS is involved in pattern maintenance.

The hetN gene is predicted to encode a ketoacyl reductase (Black and Wolk,

1994). Unlike a patS mutant, filaments that do not express hetN first develop a nonnal

pattern of heterocysts at 24 hours after induction. It is not until 48 hours that

overproduction of heterocysts results in a Mch phenotype (Callahan and Buikema 2001).

The delay in the Mch phenotype when hetN is not expressed and the fact that hetN is

nonnally not expressed until 12 h after induction (Bauer et a!. 1995) suggest that HetN

does not playa role in de novo heterocyst-pattern fonnation. Instead, it appears to be

necessal)' for maintenance of the pattern as filaments lengthen by cell growth and

19

.1 I , ,

division, and new heterocysts form between existing ones. A low level of HetN protein

is present in vegetative cells under non-inducing conditions, but localization of HetN

protein exclusively to mature heterocysts (Li et aI. 2002) and expression of hetN

primarily in heterocysts after induction (Callahan and Buikema, 200 I) imply that HetN is

involved in production of an inhibitory signal that originates in heterocysts and is

communicated to neighboring vegetative cells. This putative HetN-dependent signal

blocks heterocyst formation at points both upstream and downstream of hetR

transcription. Overexpression of hetN both prevents patterned expression of hetR and the

Mch phenotype that normally results from ectopic expression of hetR from an inducible

promoter. These findings have led to the suggestion that HetN inhibits heterocyst

formation by blocking hetR positive autoregulation (Callahan and Buikema 2001). In

this chapter, the effect of simultaneous inactivation of patS and hetN on heterocyst

differentiation will be presented.

Results

PatS and HetN work independently to suppress differentiation

Both patS and hetN are expressed at low levels in vegetative cells growing with nitrate,

and their expression is induced in proheterocysts when a fixed nitrogen source is

removed from the medium (Callahan and Buikema, 2001; Li et aI. 2002; Yoon and

Golden 200 I). In addition, overexpression or extra copies of either patS or hetN prevent

heterocyst differentiation in a wild-type genetic background (Bauer et aJ. 1995; Black and

Wolk, 1994; Callahan and Buikema, 2001; Yoon and Golden, 1998). It is possible that

patS and hetN work either in parallel as members of independent suppression pathways

20

I I

I I I

"

I

"

i !

, , I ,

or in series as members of a single pathway. If they are members of the same pathway,

each gene should be dependent on the other for its ability to suppress differentiation. If

they represent separate pathways, inactivation of one should not prevent function of the

other. To discriminate between these two possibilities, the ability of patS and hetN to

suppress differentiation in the absence of the other was tested.

Strain PCC 7 I 20, the wild-type strain in this study, forms a pattern of single

heterocysts separated by approximately 10 vegetative ce\1s when grown without a source

of combined nitrogen (Fig. 2.IA). The pattern ofheterocysts in filaments of Anabaena

strain UHMI15, a hetN-nu\1 mutant, was initially wild type, but became Mch

approximately 48 hafter induction (Fig 2. I B). This phenotype is similar to that described

for other hetN mutants (Black and Wolk, 1994; Callahan and Buikema, 2001). In

contrast, strain UHM II 5 carrying extra copies of patS uoder the control of its native

promoter on plasmid pSMCI51 did not form heterocysts in medium lacking fixed

nitrogen (BG-I 10; Fig. 2.1 C). Therefore, patS does not require a functional hetN gene for

its expression or its activity post-transcription.

Unlike patS, extra copies of hetN on a plasmid only partially suppress

differentiation in a wild-type backgrouod (Black and Wolk, 1994), probably due to the

low level of expression of hetN or negative autoregulation of hetN expression. To permit

an uoambiguous assessment of whether hetN requires patS for activity, hetN was

overexpressed from the copper-inducible petE promoter (P petE) in a patS-null mutant

Anabaena strain UHMI 14 has the patS gene deleted and plasmid pSMCl15 (Ca\1ahan

and Buikema, 200 I) carries a copy of hetN with the normal promoter of hetN replaced by

P peJE. In BG-I 10. which has a copper concentration of about 0.3 J,tM and induces half-

21

1 I , :

.1

I

I

I

i

I ! ! I

I

I !

I

I I

I I .,

maximal expression from P petE (Buikema and Haselkorn, 200 I), no heterocyst

differentiation was observed in the patS mutant overexpressing hetN. Therefore, after

transcription of hetN, patS is not required for suppression of differentiation. To

determine if patterned expression of hetN requires patS, a hetN-gfp fusion on plasmid

pSMCI26 (Callahan and Buikerna, 2001) was used to assess expression of hetN in a

!¥JatS background. GFP signal consistent with expression of hetN in maturing

proheterocysts was observed in strain UHM114 carrying plasmid pSMCI26 (Fig. 2.1D)

indicating that normal expression of hetN does not require a functional patS gene.

ControUed expression ofhetN in a patS-null background

Knowing that patS and hetN represent separate pathways, we were interested in the

phenotype of a strain that has both genes inactivated. Anabaena strain UHM 100 was

created to study the effect of simultaneous inactivation of patS and hetN on heterocyst

differentiation and patterning. In this strain patS has been deleted, and the normal

promoter of hetN in the chromosome has been replaced by a copper-inducible promoter,

P petE. Transcription from P petE increases with copper concentration. We reasoned that

inactivation of one of the two suppressors of differentiation should be conditional to

avoid the complication of acquiring additional mutations that down-regulate heterocyst

formation, a problem that has been noted previously in strains that differentiate excessive

numbers ofheterocysts (Black and Wolk, 1994; Buikema and Haselkorn, 1991).

22

I I

1

.1

I

;

I

I ., ,

I ! I

I .,

I , ! ,

"

, 'i

I I I

. , ,

.1 1

Fig. 2. 1. PatS and HetN are members of separate heterocyst-suppression pathways.

(A) The wild-type pattern of heterocysts of PCC 7 120 48 h after induction. (8) The

t1helN mutant stTai n UHM li S is MCH 48 h after induction. (C) Strain UHM 11 5

with extra copies of paIS on pSMC I51 does not differentiate heterocysts. (D)

Strain UHMI15 with apalS-gfp fusion on plasmid pSMC I26 shows transcription of

paIS in heterocysts and proheterocysts.

23

The extent of heterocyst differentiation by strain UHM 1 00 is inversely proportional to the

concentration of copper in the medium, which controls the level of expression of heN

(Fig. 2.2). A concentration of 5 nM copper reduced the number of heterocysts by half,

and complete suppression of differentiation was seen at a concentration of 100 nM.

Heterocyst differentiation by strain 7120PN, which has the coding region of hetN fused to

the petE promoter in a wild-type background, was also controlled by the level of copper,

as expected. Copper concentration had no effect on heterocyst frequency in strains PCC

7120 and UHMI14, which represent the wild-type and the !.patS strains, respectively.

The heterocysts observed in strain UHM 1 00 are mature, functional heterocysts. It

has been noted previously that the products of nitrogen fixation appear to influence

patterning and, therefore, cell differentiation (Yoon and Golden, 2001). It is conceivable

that the excessive differentiation phenotype of UHMl00 at low copper concentrations

could result in the formation of immature, nonfunctional heterocysts that do not fix

nitrogen, and therefore do not prevent excessive differentiation. Mature heterocysts

possess a cell envelope containing a layer of polysaccharide that is necessary for creation

of an anaerobic environment for fixation, one of the last steps in heterocyst maturation.

This polysaccharide layer can be detected by staining with a1cian blue (Gantar et at.,

1995). The presence of a polysaccharide layer in the heterocysts formed by UHMIOO

was confirmed by differential staining with a1cian blue (Fig. 2.3). Acetylene-reduction

assays indicated that UHM I 00 fixes nitrogen at approximately half the rate of the wild

type soon after induction of differentiation and at approximately the same rate thereafter.

Other mutant strains that form more heterocysts than the wild type have been noted to fix

24

, 1

.j I

.1 , ! ! .,

j

I I I

I ,I i ,

·1

·1 1

I 1

I I

nitrogen at a rate equivalent to or below that of the wild type. This is the case with strain

UHMIOO.

Inactivation of patS and hetN causes complete differentiation offlJaments

With hetN inactivated, approximately 97% of cells in filaments of UHM 1 00 were

heterocysts 192 h after induction of differentiation in liquid medium, compared to about

9% of cells in the wild type under the same conditions (Fig. 2.4). The increase in

heterocyst percentage was most dramatic at 24 h post-induction, and 48 h after the switch

to dinitrogen as the sole source of nitrogen over half of the cells in filaments

differentiated (Fig. 2.4.A). Over the next four days, the percentage of cells that

differentiated increased to over 90% (Fig 2.4.B), and thereafter the percentage increased

to nearly 100%, although in liquid BO-1 10 some undifferentiated vegetative cells

remained indefinitely in some filaments. Heterocyst formations by PCC 7120, UHM 114,

7120PN, and UHMIOO in BGI 10 lacking CUS04 are shown in Fig. 2.4.0. UHMIOO

formed about 10% heterocysts with nitrate supplied as a nitrogen source in liquid BO-I I,

similar to the patS-null mutant strain UHMI 14.

Consistent with the results in liquid BO-IlOo plating UHMIOO on solid BO-Ilo

lacking copper to inactivate hetN prevented growth of the strain. Heterocysts are

terminally differentiated and do not divide, so complete differentiation of heterocysts is,

essentially, a lethal phenotype. Surprisingly, UHM 1 00 with hetN inactivated also

underwent complete differentiation on BO-Il agar, which contains approximately 17

mM nitrate. Initially after being plated, the strain appeared to grow normally, forming

green colonies similar to those of the wild type. But after approximately 30 days, several

days after colony size had stopped increasing, the plate culture turned white.

25

1 i I I 1

,i i I I j i ,

I I I

,I I

i A .1

I i

Microscopic analysis of the filaments from the plate revealed that essentially all the cells

had differentiated into heterocysts (Fig. 2.4C). The growth rate of UHMI 00 on both BG-

11 and BG-11 agar was similar to those of PCC 7120, strain 7120PN, and UHM114,

indicating that UHM I 00 is not impaired in its ability to use nitrate as a source of nitrogen

and, premature nitrogen starvation is unlikely to account for excessive differentiation on

nitrate. On a confluent plate, green colonies eventually grew through the layer of white

heterocysts. All of the 8 I colonies isolated and examined produced less than 1%

heterocysts under conditions that induce near complete differentiation of the parent strain,

UHMIOO. Presumably, each of the 81 colonies arose from a cell that acquired a mutation

that prevents or severely down-regulates differentiation. In contrast to nitrate, ammonia

at a concentration of 2 mM suppressed differentiation by UHMIOO.

26

·i

j

I

i i

I I , ,

'I

I I I

I i

i ';I

I I j

100

- 80 ~ 0 -III 60 -III >-u 40 0 I-Q) - 20 Q)

J:

0 1 10 100 1000

CuSo4 (nM)

Figure 2.2. In strain UHMIOO expression of ketN determines the nwnber of

cells that will differentiate into heterocysts. The percentage of heterocysts

fonned by four strains at 96 h after induction is plotted as a function of the

concentration ofCuS04 included in the otherwise standard BO-Ilo. +, PCC

7120; .A.. UHM 114; •• 7120PN; • UHM 100.

27

, 1 , , I ~

I

j I

.1

I ., ,

i 1

, I ,

,.~

Figure 2.3. Strain UHM100 forms mature, functional heterocysts.

Aiclan blue staining of heterocysts detects the presence of

heterocyst-specific polysaccharides in filaments deprived of fixed

nitrogen for 48 h.

28

.1 I ; I

:1 !

i , I

'I

I I , i

I I i I !

:1 I

i I

I

i

I ! , ; , "

D 100

!!80

t: I 20

o 24 48 72 91 120 144 168 19 TIme Ib\

Fig. 2.4. With helN inactivated, strain UHMlOO differentiates nearly all

heterocysts. Strain UHMIOO 48 h (A) and 192 h (8) after being switched to

BG-llo medium lacking CUS04. (C) Cells from BG-l1 agar, which

contains approximately 17 mM nitrate, lacking CUS04 30 days after

inoculation. (D) Plot of the percentage of cells that are heterocysts as a

function of time after being switched to BG-II 0 medium lacking CUS04. .,

PCC 7120; "', UHM114; ., 7120PN; -UHM100.

29

i ',i

.1

I

!

I ,

i .1

I , :

i I

Limiting factors for complete differentiation

With both 8G-llo liquid medium and 8G-ll agar heterocyst differentiation was

asynchronous; cells in filaments did not all differentiate simultaneously 24 hours after

induction, but instead the percentage of heterocysts in filaments of UHM 1 00 increased

over time. Such a lag in complete differentiation suggests four possible scenarios that

may account for the limited rate of heterocyst differentiation when the negative effects of

patS and hetN are removed: i. removal or inactivation of an inhibitor of differentiation

from the medium during growth may be necessary for complete differentiation; ii.

accumulation of a substance that promotes differentiation in the medium during growth

may be necessary for complete differentiation; iii. a minimal amount of time needed for

complete differentiation; iv. or a particular phase of growth may be needed for complete

differentiation.

To address the first two possibilities, the effect of "conditioned" medium on

heterocyst formation was investigated. Cells of UHM I 00 that had differentiated into

mostly heterocysts after 192 h were removed from liquid 8G-ll0 lacking copper, and this

conditioned medium was used to induce heterocyst formation of a second culture of

UHMIOO. The second culture formed heterocysts at a rate similar to that of the first,

indicating that removal or accumulation of a substance that affects differentiation is

unlikely to account for the delay in nearly complete differentiation in liquid 8G-l1 o. The

same type of test was performed using 8G-II agar containing nitrate and lacking copper.

UHMIOO was grown on a filter overlaying the medium. After 30 days filaments had

completely differentiated and the filter was removed. A second culture ofUHMlOO on

the conditioned plate also required approximately 30 days to differentiate completely,

30

1

I 1

I 'I ;

,I

I I

1

I I I

I

indicating that as with liquid 80-110, removal or accumulation of a substance that affects

differentiation is unlikely to account for the delay in differentiation on 80-110 agar.

Removal of nitrate from the plate is an obvious factor that may have limited

differentiation on the plate, but the results above suggest otherwise, because

differentiation of UHMIOO on 80-110 agar is complete after approximately 5 days, and

differentiation on the conditioned plate still required 30 days. To further show that the

conditioned plate retained a substantial concentration of nitrate, a strain of Anabaena

with the hetR gene deleted, UHM I 03, was streaked on the conditioned plate. Despite its

inability to form heterocysts or fIX nitrogen, strain UHM I 03 grew on the conditioned

plate in a manner similar to that of the same strain on a fresh plate of the same medium,

indicating that a substantial concentration of nitrate remained in the conditioned plate.

To address the question of whether time or growth phase of the cells may limit

complete differentiation, liquid cultures of UHMIOO were induced at different cell

densities, and heterocyst percentage, time since induction, and cell density were

monitored. The percentage of cells that are heterocysts correlates with the time since

induction and is independent of cell density in liquid medium lacking a fixed nitrogen

source (Fig. 2.5). A similar approach was taken with UHMIOO on solid medium

containing nitrate, except instead of varying the starting concentration of the cells, the

concentration of the plate culture was reduced after 20 days by restreaking part of the

culture onto a new plate. Filaments of the original plate culture differentiated completely

after approximately 30 days. On the other hand, cells on the restreak:ed plate required an

additional 30 days from the time of restreak:ing (about 50 days total) for complete

differentiation. Complete differentiation on solid media in the presence of nitrate appears

31

I I I 1

, 'I

I

I I I

I

I ,j

I

I '1

I I ,I

, I

to be independent of the duration of time that both patS and hetN are not expressed.

Instead, filaments appear to differentiate completely when the culture ages, vegetative

growth slows, and cells enter stationary phase.

Induction ofhetR and pattern formation in the absence of patS and hetN expression

Both patS and hetN prevent differentiation by negatively regulating the expression of

hetR (Callahan and Buikema, 200 I; Huang et aI., 2004), whose expression is both

necessary and sufficient for differentiation (Buikema and Haselkorn, 1991, 2001). The

lag in complete differentiation when both patS and hetN are inactivated suggests that

either hetR expression increases in all cells and some unknown event downstream of hetR

limits the timing of differentiation, or expression of hetR continues to limit differentiation

in the absence of patS and heIN. In the former case patS and hetN would be the only

factors limiting hetR expression. To distinguish between these two possibilities plasmid

pSMCI27 (Callahan and Buikema, 2001), which contains a hetR-gfp fusion, was

introduced into strain UHMIOO and the fluorescent GFP signal was monitored during

differentiation in BG-110 with both patS and hetN inactivated The pattern of

fluorescence observed at 48 h post-induction, when approximately 55% of cells are

heterocysts, indicates that expression of hetR is not immediate in all cells under inducing

conditions when patS and hetN are inactivated (Fig. 2.6A). Instead, expression of hetR

was apparent in most heterocysts and some vegetative cells that will presumably become

heterocysts within 24 h, as in the wild type, while in other vegetative cells expression of

hetR remained at basal levels.

32

1 I I

i

I I I I .

I I

!

I , !

j I

I I

J

To test whether the delay in complete differentiation may be attributed to the

asynchronous expression of hetR in cells of the filament, plasmid pWB2l6S2.4. a

replicating plasmid that contains heIR under its native promoter (Buikema and Haselkorn.

2001). was added to strain UHMIOO. In the wild-type strain. this plasmid causes

abnonnal differentiation on media containing fixed nitrogen (Buikema and Haselkom,

1991). presumably by increasing expression levels. Extra copies of hetR eliminated the

30-day delay in differentiation seen with UHM I 00 with hetN conditionally inactivated on

solid media containing nitrate. Growth was precluded by near complete differentiation in

3 days with extra copies of hetR. suggesting that the level of expression of hetR limits the

timing of differentiation by individual cells of UHM I 00.

The lack of a negative regulator of heterocyst differentiation that can prevent

complete differentiation when patS and hetN are inactivated raised the question whether

all cells have the same probability of differentiating or if certain positions along the

filament favor differentiation. To address this issue. the occurrence of the various

vegetative-cell intervals (number of vegetative cells between heterocysts) was tabulated

and plotted as the length of vegetative cell intervals versus the frequency of their

occurrence (Fig. 2.6B). The positions ofheterocysts relative to other vegetative cells and

heterocysts was examined using a runs test for randomness to determine if the

distribution of heterocysts along the filament appears to be random. The test indicated

that the distribution of heterocysts was likely nonrandom, with a strong bias in favor of

clusters of heterocysts accounting for the deviation from randomness at 24 h after

removal of fixed nitrogen (p < 0.0002; Experimental Procedures). Analysis of three

replicate experiments gave similar results. A similar bias towards clusters of heterocysts

33

·1 I

, ··1'

I I

I

,I I 1

I , ; I I

,I

I I

I

I

I I

I I i i

I

has been observed in most mutant strains that produce supernumerary heterocysts (Black

and Wolk, 1994; Buikema and Haselkorn, 1991; Callahan and Buikema, 2001; Yoon and

Golden, 1998).

A separate, but related, question concerns the distribution of contiguous

heterocysts along the filament, in effect, ignoring the vegetative-cell intervals that equal

zero and regarding the cluster as a single unit From the plots in figure 3.6B there

appears to be a bias toward even-numbered intervals of vegetative cells between

heterocyst clusters 24 h after induction of differentiation. This bias was also seen in a

hetRR223W mutant that is insensitive to suppression of heterocyst differentiation by

overexpression of patS or hetN and was explained by the possible synchronous division

of nondifferentiating vegetative cells once during the time of heterocyst differentiation

and maturation (Khudyakov and Golden, 2004). The approximate times necessary for

mature heterocyst formation, commitment to differentiation, and vegetative cell division,

24 h, 12 h and 12 h respectively, are consistent with this hypothesis. With the exception

of I-cell intervals, which can be accounted for by the previous argument, the frequency

of vegetative cell intervals decreases as the interval length increases at 48 h after removal

of fixed nitrogen. A similar distribution of contiguous heterocysts was seen in a

hetRR223 W mutant and interpreted as a nearly random distribution of contiguous

heterocysts in filaments (Khudyakov and Golden, 2004).

34

I I

i I i

i

;

I I

I I I

:I I

I I

i i I

I

I j i i J

r-----------,- 2

E c

1 CI ~

~----_r------~-----+O

~~-----------------,

ot------r---y-----; o 24 48 72

Time (h)

u a o

Fig. 2.5. Extent of heterocyst differentiation as a function of time since

induction and phase of growth. The time since induction of heterocyst

formation Is plotted versus the percent of cells that are heterocysts In

filaments of strain UHM100 (lower panel) and cell density as measured

by the absorbance of the culture at 750 nm (upper panel). Starting A7&J

concentrations for both panels: .t... 0.1; •• 0.2; •• 0.4

35

, i I ,

I

I !

,

I I ,

A

B IOOOr------------------,r------------------,

wr7120.Z.a b UKM ,00.2"11

1"00 ! I.

UIIM '00. 192b

.... 100

J ,0

I h bN,.I,.-.-.,-,~~~.._I""' ..... ,I~~~~~ o a 4 6 8 10 12 14 16 'Ie 20 0 Z

_ ...... a1s .. 6 8101214'81820 Veo __

Fig. 2.6. Asynchronous. non-random differentiation of heterocysts by

strain UHM100. (A) Non-uniform transcription from the hetR promoter

as seen from a hetR-gfp fusion on plasmid pSMC127 in UHM100

correlates with the asynchronous differentiation of heterocysts.

Heterocysts that do not show GFP fluorescence most likely indicate older

heterocysts that may have lower levels of hetR expression or lack of

molecular oxygen. which is necessary for proper folding of GFP. (B) Bar

graphs of the frequency of vegetative-cell intervals between heterocysts

in filaments of UHM 1 00 at various times since induction.

36

;

I

I I i I

" 'I

i

I

Discussion

Factors that suppress cellular differentiation to form a developmental pattern are

found in organisms as evolutionarily distant as bacteria and mammals. In the

cyanobacterium Anabaena sp. strain PCC 7120, patS and hetN contribute to

developmental patterning by suppressing the differentiation of vegetative cells into

nitrogen-fixing heterocysts. The activity of each gene in the absence of the other

demonstrates that they do not work in series, but instead are members of parallel

suppression pathways that are, at a minimum, distinct to the point of the respective genes.

Our results do not rule out the convergence of these separate pathways immediately after

patS and/or hetN, and, in fact, the recent discovery of a hetRR223W allele that is less

sensitive to suppression of differentiation by overexpression of either patS or hetN

(Khudyakov and Golden, 2004) suggests convergence of the two pathways before or at

the point of HetR. Because binding of the C-terminal pentapeptide of PatS has been

shown to prevent binding of HetR to presumptive hetR-reguiatory regions (Huang et al.,

2004), the point of convergence of the patS- and hetN-suppression pathways is likely to

beat HetR.

Use of a conditional mutation appears to be essential for the study of

differentiation in the absence of patS and hetN activity. In BG-ll 0 or medium containing

nitrate as a nitrogen source the complete differentiation of filaments by strain UHM 1 00 is

a conditional lethal phenotype that is controlled by the presence or absence of copper in

the medium to activate or inactivate transcription, respectively, of hetN. A true double-

null mutant would, presumably, not grow under either of these conditions because

heterocysts do not divide and are terminally differentiated cells. Although ammonia

37

i

I ,

I

I

j

downregulated heterocyst fonnation in the absence of patS and hetN expression and its

-constant use may allow the isolation of a true patS, hetN double null mutant, maintenance

of heterocyst-free cultures in media containing ammonia requires frequent subculturing

due to inhibition of growth at high ammonia concentration and rapid degradation of

ammonia at high cell concentrations. On the other hand, strain UHMI00 was created and

can be maintained on nonnal BG-ll, which contains copper at a concentration of about

300 nM and activates transcription from the petE promoter to about half its maximum

level (Buikema and Haseikom, 2001). Under these standard growth conditions,

heterocyst fonnation is prevented. and selection for mutations that modulate heterocyst

frequency is eliminated. However, the conditional inactivation of hetN may not be

complete. There is likely to be some transcription of hetN even in the absence of copper.

Although the general nature of the UHM 1 00 phenotype should approximate that of a true

double-null mutant, the extent of differentiation by UHMI00 at different times may

underestimate that of a double-null mutant and may account for the lag in near complete

differentiation of filaments.

HetN protein can be detected in vegetative cells growing in nitrate (Li et aJ.,

2002). Our results suggest that in addition to contributing to patterning of heterocysts

under diazotrophic conditions, hetN also plays a role in preventing differentiation in the

presence of nitrate. A role for patS in suppressing differentiation in nitrate could be

sunnised from the fonnation of heterocysts by a patS-null mutant (Y oon and Golden,

1998), but hetN mutants, including the one created in this study, do not fonn heterocysts

in excess of the wild type in nitrate (Black and Wolk, 1994; Callahan and Buikema,

2001). However, complete differentiation of filaments by UHMIOO is markedly greater

38

I '.!

, I , I

.i , I ! ., , I

I I

I " I

I I I

I , . , , ,

than the approximately 10% differentiation seen in a ft,patS mutant in nitrate, the only

genetic difference in the two strains being a wild-type copy of hetN in the latter to

account for the difference in phenotype.

The phenotype of strain UHMlOO with both patS and hetN inactivated is

markedly different than the recently described HetR R223W mutant AMCl289, which is

insensitive to suppression of differentiation by patS and hetN (Khudyakov and Golden,

2004). If the only affect of the R223W missense mutation was to confer resistance to

suppression by patS and hetN, mutant filaments would be expected to differentiate almost

completely like strain UHMIOO. Instead, the R223W mutant differentiates

approximately 20% heterocysts after prolonged exposure to diazotrophic conditions, does

not produce heterocysts in media with combined nitrogen, initially lags behind the wild

type in the timing of differentiation, and has a lower nitrogen-concentration threshold for

induction of differentiation (Khudyakov and Golden, 2004). However, complete

differentiation is possible when the hetRR223W allele is overexpressed ectopically in a

hetRR223W background. The differences between UHMIOO and AMCl289 can be

explained either by a reduced ability of HetR R223W to activate transcription from the

hetR promoter or by a reduced ability of HetR R223W to initiate differentiation. If HetR

initiates differentiation by activating transcription of other genes as well as its own, the

latter argument may encompass the former.

The most striking phenotypic difference between UHMIOO and AMCl289 is their

behavior with nitrate as a nitrogen source. Reduced ability of the HetR R223 W to effect

differentiation may explain the lack of differentiation of AMCl289, but it does not

account for nearly complete differentiation of UHM 100 on nitrate. The correlation

39

i I

1 I

i I I

I I

j i , I

I , I

I I I I

1

I 'i

1

,!

I i

between extensive differentiation and the age and growth rate of the culture in nitrate

suggests that either the rate of differentiation correlates inversely with the rate of

vegetative-cell division, or a fixed rate of differentiation leads to complete differentiation

once the rate of vegetative-cell division falls below the rate of differentiation. The latter

scenario would imply that patS and/or hetN play a role in regulating the rate of

differentiation in response to growth rate.

It was observed several years ago that hetR appears to act stoichiometrically

instead of catalytically (Buikema and Haselkom, 1991), and recent evidence that HetR

may be a transcriptional activator is consistent with this observation (Huang et at., 2004).

The hetR-promoter region has four putative transcriptional start sites (Buikema and

Haselkom, 2001), one of which is dependent on HetR itself (Muro-Pastor et aI. 2002),

explaining the observed positive autoregulation of hetR (Black et at., 1993), and two of

which are dependent on NtcA (Muro-Pastor et ai., 2002), a member of the CRP family of

regulators, which activates the transcription of several genes in response to the

withdrawal of ammonia (Luque et at., 1994). Our results combined with those of others

support a model for differentiation that has at its center a hetR-positive-autoregulation

pathway that is primed by NtcA-dependent transcription upon nitrogen step-down and is

downregulated by patS- and hetN-dependent pathways. In this model, the ultimate level

of transcription of hetR in each cell detennines whether or not it will differentiate and is

detennined by the combined activities of the two independent suppression pathways. In

the absence of the patS- and hetN-dependent suppression pathways, levels of hetR

transcription spiral out of control due to unchecked positive autoregulation, and all cells

differentiate, as is the case for UHM100. Patterning is determined by the non-

40

I I I

autonomous nature of the suppression pathways, which has been demonstrated only for

patS (Y oon and Golden, 1998). Complete differentiation of filaments in the absence of

ammonia indicates that the ammonium-, patS- and hetN-dependent suppression pathways

are the only substantial suppression pathways that exist to prevent differentiation.

The lack of a pattern of differentiated cells in strain UHMIOO indicates that

suppression of differentiation by patS and hetN are the major influences on patterning.

This conclusion is supported by the similar phenotype of the hetRR223W mutant, which

is insensitive to suppression of differentiation by patS and hetN (Khudyakov and Golden,

2004). Despite complete differentiation of filaments and the lack of a discermole pattern

of cells in UHM I 00 in the absence of patS and hetN expression, the distribution of

heterocysts along filaments is not random. There is a strong bias in favor of clusters of

heterocysts. This tendency towards contiguous heterocysts also exists when cells are

grown in the presence of copper or ammonia prior to induction to eliminate preexisting

heterocysts that may introduce an additional bias towards clusters (Borthakur and

Callahan, unpublished). Therefore, contiguous cells and those adjacent to existing

proheterocysts or mature heterocysts appear more likely to differentiate than those

flanked by vegetative cells. The clustering of differentiated cells that characterizes the

Mch phenotype in Anabaena is typical of mutants that differentiate supernumerary

heterocysts and has also been observed in developmental mutants of other systems. For

example, inactivation of genes involved in patterning of trichomes in Arabidopsis and of

sensory bristles in Drosophila results in clusters of these _ structures forming in place of

the single structures seen in the wild-type organisms (HQIskamp et al., 1999; Simpson,

1990). Clustering of heterocysts in filaments of UHM 100 suggests that factors that

41

.1 !

., 1

! i

I 1

I I , I

I

I .1

I

I I 1

i I 1

J

influence pattern fonnation independent of patS and hetN exist. The nature of the

phenotype suggests that cell lineage (Meeks and Elhai. 2002). diffusion of a positive

activator of differentiation, or a cell contact-based mechanism of induction may influence

heterocyst development in addition to the patS- and hetN-dependent suppression

pathways.

42

'I i I I I

I i

i , .I

I

I I

! -, 'I I I

I

C HAPTER 3

Identification and characterization of a gene, alr90J8, which enhances frequencies of

heterocysts in the filaments of Allabaella PCC 7 120

In troduction

Many genes involved in heterocyst differentiation and pattern fonnation have so

far been identified. These include IlteA, hetR, hetC, heIF, hetP, helL, hetM, helN, hallA,

hepA, hepB, hepC, hepK, palA, patB, patN, palS, palU, devBCA, devH, devR, hewA,

hglG, hglE, hglK, pbpB, and fits (for reviews, see Herrero et al. 2004, Zhang et al. 2006).

It is likely that there are additional genes involved in heterocyst differentiation that are

yet to be identified. Recent identification of additional regulatory genes for heterocyst

differentiation, hetZ, palU3 (Zhang et al. 2007) asrl734 (Wu et al. 2007), and /raG

(Nayar et al. 2007) further supports the hypothesis that additional genes for heterocyst

differentiation exist. The objective of this chapter is to identify and characterize such

genes.

UHM IOO is a derivative of PCC 7120, where patS, a negative regulator of

heterocyst differentiation is deleted, and hetN, another negative regulator is expressed

from a copper-regulated promoter (Fig 3.1). Therefore, in presence of copper this strain

reacts

h etM P p e tE he tN he tl

• AT G

Fig 3.1. P pelE'hetN chromosomal fus ion, strain 7120PN (CaBahan and Buikema 200 I).

43

as a single mutant and without copper, this strain behaves as a double mutant of two

negative regulators, HetN and PatS, that suppress hetR expression. In the hetN-patS

double mutant (UHMIOO grown in copper-free media), the expression of hetR remains

unsuppressed. resulting in a Mch phenotype with nearly all vegetative cell differentiating

to heterocysts. Heterocysts are terminally differentiated cells and do not divide, so in the

absence of copper and fixed nitrogen, complete differentiation of heterocysts is,

essentially, a lethal phenotype. From the lethal phenotype, it may be possible to isolate

mutants ofUHMIOO with either a Her phenotype or a normal heterocyst forming wild-

type like phenotypes. Such mutants may arise as a result of several possible types of

spontaneous mutations. These include the following possibilities:

(i) Mutation in the hetR gene: A mutation in the heIR gene ofUHMIOO should result

in a Het- phenotype. Such a mutant could be complemented by cloned hetR or a

similar positive regulatory gene.

(ii) Mutation in other unknown regulatory genes that may have functions similar to

hetR: It is possible that there are other heIR-like positive regulatory genes in

Anabaena PCC 7120. hetZ identified recently by Zhang et aI. (2007) is an

example of hetR-like a gene. Mutation in such a gene ofUHMIOO should also

result in a Her or normal wild type-like phenotype.

(iii) Uo-mutation in a negative regulator that normally is expressed at a low level in

Anabaena PCC 7120: It is possible that besides hetN and patS, there are

additional negative regulatory genes that are expressed at low levels in Anabaena

PCC 7120. asr1734 and patU3 are two examples of such additional negative

regulatOl)' genes (Wu et al. 2007, Zhang et al. 2007). An up-mutation in such a

44

, I

,I I

I

I , '1 ,

i I

!

,I 'j I ! i I I

J

gene will lead to inhibition of the Mch phenotype in the hetN-patS double mutant,

resulting in nonnal filament fonnation on CuW medium.

Results

Isolation ofHef mutants ofUHMlOO

UHMlOO was grown in BO-II CuW solid agar medium. After 30 days, about

99% of the cells differentiated into heterocysts (Borthakur et al. 2005). At this stage,

nearly all the cells on the agar plate appeared white. However, after careful observation,

a few green colonies were spotted among the white heterocysts. It is possible that these

colonies carry one of the three types of spontaneous mutation that mentioned above.

These green colonies were picked and streaked on BO-B N'" solid medium for

purification and characterization. In Cu"N liquid medium, these strains did not

differentiate and died within 4 days. However in CuW liquid medium, these mutants

grew nonnally like PCC 7120. In this way, three mutants, NSM4, NSM6, and NSM50,

were selected for further characterization (Fig. 3.2). Among three mutants, NSM6 was

selected to continue further work, because the complemented derivatives of this mutant

produced a Mch phenotype similar to the parent strain UHM I 00 (see below).

Complementation of NSM6 with an Anabaena genomic library

An Anabaena PCC 7120 genomic library (Buikema and Haselkom 1991) was

transferred to NSM6 by triparental conjugation. After incubating on BO-B CuWagar

containing 2% LB for 48 h, the conjugation mixture was plated on CuN' agar medium

containing 30 Jlglml neomycin to select for transconjugants. In this medium, the mutant

45

., , ,

I I I ,

I

I ,

,: , : i 1

I

I 1

I ,I j

I !

I

I I

NSM6 grows as well PCC 7120; however, the transconjugants, in which the mutation is

complemented by the wild-type copy of the gene, are expected to regain the Mch

phenotype, and consequently will tum yellow and die. As expected, within two weeks, a

few colonies appeared as yellow-brown (differentiating to heterocysts). In these

colonies, although the majority of cells were beginning to differentiate into pro-

heterocysts, there were a few green undifferentiated vegetative cells, because of which

the strain could be recovered by plating on 80-11 CuW medium. These colonies were

picked and revived by transferring to 80-11 Cu W agar containing 30 J.1g/ml neomycin.

Sixty such colonies were tested for an Mch phenotype in CuW and Cu"N" liquid media.

Eight transconjugants that had an Mch phenotype in Cu"N" liquid media were selected.

Among these, only four transconjugants, NSM6-I, NSM6-2, NSM6-13, NSM6-18,

formed Mch phenotype in both CuW and Cu"N" liquid media. Among these,

NSM6-1 was selected due to its similar Mch phenotype with UHMIOO for identifying

genes for heterocyst differentiation (Fig 3.3).

46

1

I I

.1

I I

I I i .,

i , I

'j i

I I

i

:1

I I

I I

j

Fig. 3.2 Three Hefmutants ofUHMIOO in Cu"N· liquid medium. A. TheNSM6, B. TheNSM4, c. TheNSM50

47

!

I

I

I I

I I , , I I

I

I , , I

i ! i I

Fig. 3.3. NSM6 and its complemented derivatives NSM6-l in CuN liquid medium.

A. NSM6, B. Complemented strain, NSM6-1-2.

48

I

! I j

I I

i I

.!

;

I

I 1

I I

Isolation and characterl:ation of a cosmld, pPB6-I, that restores an Mch phenotype to

NSM6

NSM6-1 is a derivative of NSM6 containing a cosmid that restored the Mch

phenotype. The cosmid was isolated from NSM6-1 and transformed into E. coli.

Restriction digests of the cosmid isolated from E. coli showed that it contained 36 kb of

insert DNA. This plasmid was named pPB6-1. When pPB6-1 was transferred to NSM6,

the transconjugants showed an Mch phenotype, confirming that the cloned DNA in

pPB6-1 indeed contains a gene that restores the Mch phenotype in NSM6. Furthermore,

when pPB6-1 was transferred to PCC 7120, the transconjugants also showed a Mch

phenotype even in BG-ll W medium (Fig 3. 4). Previously, Buikema and Haselkom

(2001) showed that overexpression of heiR in PCC 7120 increases heterocyst frequency

and induces heterocyst differentiation under fully repressing conditions. Similarly,

multiple copies ofa gene cloned in pPB6-I, when transferred to PCC 7120, resulted in a

Mch phenotype under W conditions. This suggests that pPB6-1 contains a gene that also

positively regulates other het genes.

Cosmid pPB6-1 contains cloned DNA of the Epsilon plllsmid of Anabaena PCC 7120

Partial sequencing of the insert DNA in pPB6-1 from the two ends showed that 36

kb DNA from the Anabaena PCC 7120 Epsilon plasmid was cloned in this cosmid. The

map of the cloned DNA in pPB6-1 is shown in Fig. 3.5. Sequence comparison ofpPB6-1

with Anabaena PCC 7120 Epsilon plasmid DNA indicated that pPB6-1 contained 29

open reading frames (ORF), the functions of most of which are not known. Fourteen of

these ORFs were located in a 21-kb Nhel fragment ofpPB6-1. This Nhel fragment was

49

i I

subcloned in plasmid pPBNhel and transferred to NSM6. The Mch phenotype was not

restored by pPBNhel, indicating that the gene conferring a Mch phenotype is not located

within the 21-kb Nhel fragment Therefore, it is likely that this gene is located in the

remaining IS-kb fragment ofpPB6-1. To localize this gene within this IS-kb fragment,

various ORFs were amplified by PCR and sub-cloned into the shuttle vector pAMS04.

These plasmids are summarized in Table 3.1. The resulting plasmids were transferred to

NSM6 and the transconjugants were tested for Mch phenotype on CuW and CuN liquid

BO-ll media. One of these plasmids, pALR9018, containing a 4.1-kb insert, restored

the Mch phenotype in NSM6, suggesting that a gene for heterocyst differentiation is

located within this fragment (Fig. 3.6). The 4.1-kb fragment contains a 3,909-bp ORF,

aJr9018. and 164 bp from the putative promoter region. The alr9018 ORF encodes a

148.7-kDa protein of unknown function. These results suggest that the alr9018 ORF is

involved in heterocyst differentiation.

Extra copies of hetR restores Mch phenotype in NSM6 mutant

To determine if extra copies of heiR can also restore the Mch phenotye in NSM6,

the plasmid phetRhetR, containing heiR, was transferred to NSM6 and the

transconjugants were plated on BO-II N medium. They formed heterocysts like PCC

7120 in BO-II Nliquid medium and showed Mchphenotype in CuNmedium. Thus, the

Mch phenotype of NSM6 was restored by heiR in the mutant NSM6. When the

NSM6(phetRhetR) was grown in liquid CuN medium, it produced Mch phenotype; it

produced almost 98% heterocysts in 48 h (Fig. 3.7).

so

" I

I

I

I I !

I J

Table 3.1 Plasmids containing genes in 14 kb ofpPB6-1

Plasmid Insert size (kb) Gene cloned

pPBPCR-I A total of 5 kb alr900S alr9006 alI9007 alr9008 alr9009 alr9010 alr9011 alr9012

pALR9013 90S bp alI9013

pALR9014 2.2kb alI9014

pALR90IS 2.1 kb alr901S

pALR9016/17 1.6 kb alI90 1 6117

I!ALR9018 4.1 alr9018

51

Function of the gene

unknown unknown unknown unknown unknown unknown unknown unknown Two-component response regulator unknown

unknown

unknown

hypothetica1l!rotein

1

i I !

I I :

I

I

I I , i

I

I

I I I

I

I

j

Fig. 3.4. Anabaena PCC 7120 (pPB6-1) showed Mch phenotype even in BO-ll N'" solid

medium.

A. The Anabaena PCC 7120, in solid, N'"

B. The transconjugants of Anabaena PCC 7120 (ppb6-1) in solid, 144 h

C. The transconjugants of Anabaena PCC 7120 in liquid, N"

D. The transconjugants of Anabaena PCC 7120 (ppb6-1) in liquid, in absence of combined

nitrogen, 144 h

52

I

I j

I I

'I I

, I

i I j

,. ...... .,.- ........ -.,..... .......

~.IfOid~ 4 -.--._--- ----------------.-~---

&1111019 auSI020 et1SICI2l 4l1SlOZ3 ....... ....... .......

Fig_ 35. The map of the cloned DNA in pPB6-1, the 36-kb DNA from

the Anabaena PCC 7120 Epsilon plasmid was cloned in this cosmid.

The sequence 4,674 to 8,528 is not contained in pPB6-1.

53

I I I

I I

I 'I I

I I

i

I

I 'I

I

I I I

.'

Fig. 3.6. NSM6 containing the alr9018 ORF restored Mch Phenotype in CuN,

liquid medium. A. Control: NSM6( pAMS04), B. NSM6 (pALR9018) at 48b, C.

NSM6 (pALR9018), 96h

S4

I

I

I

I

I I ;

J

B .~

Fig. 3.7. NSM (phetRhetR) shows Mch phenotype in CuNmedium.

A. NSM (PAM504), B. NSM (phetRhetR)

55

I

I °1

! i

I

I

I

I

!

NSM6 is not an aIr9018 mutllnt

To detennine if the alr90J8 sequence in NSM carries a mutation, a 4.6-kb

fragment containing the 4.I-kb alr90J8 coding region and a 0.5 upstream region was

PCR-amplified and sequenced using a set five forward and five reverse primers.

Sequence comparison did not show any sequence differences from the published

sequence of alr90J8, indicating that alr90J8 in NSM6 did not carry a mutation.

NSM6 is not a hetR mutant

The Mch phenotype in NSM6 can also be restored by heiR when present in a

multicopy plasmid. Therefore, to determine if NSM6 carries a heiR mutation, the hetR

gene including its promoter region was PCR-amplified and sequenced. Analysis of the

sequence showed that the heiR sequence from NSM6 did not carry any mutation,

suggesting that NSM6 is not a heiR mutant. Thus, NSM6 does not carry a mutation in

either alr90 J 8 or heiR.

NSM6 contalning alr9018 makes mature heterocysts

To determine if the heterocysts made by NSM6 (p90 18) are mature and similar to

those made by PCC 1120, heterocyst-induced cells of PCC 1120, and NSM6 (P9018)

were stained with alcian bue. which binds to the glycolipid layer of mature heterocysts.

The heterocysts ofNSM6 (P9018) were stained with the dye, suggesting that those were

mature heterocysts (Fig. 3.8).

56

I .1 !

i , I I

i

I I

I I

Fig 3.8. Strain NSM6(p9018) fonns mature, functional heterocysts. Alcian blue

staining of heterocysts detects the presence of heterocyst-specific polysaccharides in

liIaments deprived of fixed nitrogen for 96 h. A. NSM6(p9018), B. Alcian blue

stained NSM6(p901 8).

57

i .,

I I

.1

J

pee 7120 containing alr9018 produced increased number of heterocysts

Since NSM6 (P9018) showed Mch phenotype, it was expected that pee 7120

(P9018) might also produce a higher number of heterocysts. Therefore, pee 7120 and

pee 7120 (P9018) were grown in N" liquid medium and the number ofheterocysts was

counted every 24 hours for four days. It was observed that pee 7120 (p90 18) made at

least 5% more heterocysts than pee 7120 (Fig. 3.9).

pee 7120 containing alr9018jixed more nitrogen than pee 7120

pee 7120 (P9018) made -15% heterocysts compared to -10% in pee 7120. To

determine if the higher number of heterocysts in pee 7120 (p90 18) resulted in higher

amounts of nitrogen fixation. strains pee 7120 and pee 7120 (p90 18) were compared

for nitrogen fixation abilities by acetylene reduction assay. pee 7120 (P9018) showed

54% higher acetylene reduction activity than pee 7120 (Fig. 3.10). When the acetylene

reduction activity of NSM6 (P9018) and pee 7120 was compared, NSM6 (P9018)

showed 39% less acetylene reduction activity than pee 7120.

The expression of alr9018

The functional complementation of NSM6 by the alr9018 ORF affects in

heterocyst differentiation. The expression of some genes for heterocyst development

such as hetR increases in the heterocysts, while hetN is expressed primarily in the

heterocyst. Therefore, it was of interest to determine whether alr9018 is expressed

primarily in heterocysts, vegetative cells, or both. To determine the expression of

alr9018 in different cell types, an alr9018 transcriptional fusion was constructed by

58

, ., ,

"

I

I

i

,

I

I

i

cloning a promoterless gfp gene behind the alr9018 promoter. The 236-bp DNA segment

immediately upstream of the ATO start side of alr9018 was fused with the gfp in the

plasmid pAM1956 to obtain the alr9018 fusion plasmid pA1r9018-gfp. Plasmid

pALR9018-gfp was transferred to Anabaena PCC 7120, NSM6, and !:.hetR; and the

transconjugants were grown in BO-ll N- for 15h before observing under the microscope

for gfp expression. In PCC 7120, at 15h, alr9018-gfp expression was observed in about

half of the cells in groups of3-5 cells. Similar observations for alr9018-gfp expression

were made for NSM6 and !:.hetR mutants in 15 h (Fig. 3.11). At 24 h and 48 h also, the

alr9018-gfp expression was observed in nearly half of the cells in all three strains. At 96

h, the alr9018-gfp expression was observed in all cells of PCC 7120, although some cells

were brighter than others. The alr9018-gfp expression in the NSM6 and !:.hetR at 96 h

were also similar to that in PCC 7120. When the cells were grown in N' medium, the

alr9018-gfp expression in PCC 7120 and NSM6 at 96 h were observed in nearly half of

the cells, similar to cells grown in N' medium. Interestingly, the alr9018-gfp expression

in the !:.hetR mutant grown in N' medium at 96 h was significantly different from those in

PCC 7120 and NSM6. In !:.hetR, higher levels of alr9018-gfp expression were observed

in one or two cells every 10-20 cells (Fig. 3.12). Those cells that showed higher levels of

the alr9018-gfp expression showed dark greenish color under normal light

59

! , I I

I I I

,I

I ! , ,

I I

I

I I

i ! I

00

C Pet celltillJe of HEIer ocysts hi tIltr OIJ&l1 De1IIclent Medlton

..... PCC7120 ---PCC 7120 U)90181 20

15 t: Ii! a- 10 e ;; \'; :c 5

0

Oh 2-111 .wI1 OOh Tbne (III

Fig. 3.9. PCC 7120 (P9018) differentiates 5% more heterocysts compared to the

wild type, PCC 7120, in N", 48h. A. PCC 7120, B. PCC 7120 (P9018), and C.

Percent of heterocyst over time by the strains, A and B.

60

I !

"

1

!

I ., i I I !

Acetylene Reduction by PCC 7120 (p9018)

10.0 o pee 7120 o pee 71 20 (p9018)

E 8.0 !:

0 It> r-. 6.0 ~ N J: N 4.0 u 0 E 2.0 !:

0.0

48 h

Fig. 3.10. Acetylene reduction at 48h switched to 8G-11 0 medium. pCC7120 (p90 18) showed increased level of acety lene reduction compared to PCC 7 120.

61

A

Co ' ..

c

I'. I •

I •• I I :. •

. '.,

\

' "', """II . ""'--..

, ......... '. ''''j • . . ..•.•• ......,J

NSM6 (p9018gfp)

Fig. 3.1 1. alr9018-gfp expression in in pee 17120 (p90 1S) (A), t.hetR(p90 1S) (B), and

NSM 6(p901S-gfp) (C) at 15 h in nitrogen deficient medium . .

62

B

Fig. 3.12. a/r90JB-gfp expression in the ",heiR mutant grown in N+ medium at 96 h

was significantly different [Tom those in pee 7120 and NSM6. A. "'heiR (a/r90/B-gfP),

B. pee 7120 (a/r90JB-gfp), C. NSM6 (a/r90JB-g(p)

63

Possible /unctions of alr9018

Based on the deduced amino acid sequence, the alr9018 gene encodes a protein

with 1,302 residues and a molecular mass of 148.70 kOa. It has 41% identity and 59%

similarity with a hypothetical protein, 5110178, of Synechocystis sp. PCC 6803, the

function of which is not known. Hydrophobicity analysis shows that the A1r9018 may be

a cytoplasmic-associated protein with several clusters of7-17 hydrophobic residues (Fig.

3.13). The AIr9018 protein has a conserved domain for NTPase of the NACHT family.

Based on computer analysis, it has a predicted A TP/GTP binding site motif-A (P-loop) at

position 57-64. It has also a cAMP-cGMP dependent protein kinase phosphorylation site

at position 929-932. Based on these domains, A1r9018 may be involved in signal

transduction. Anabaena PCC 7120 has another gene, a1l9020. of the NACHT family.

The NTPase domain is found in the apoptosis proteins of animals as well as in some

fungal and bacterial proteins.

~3r-------------------------------..,~~~'V 4.0 Window: 21 L

3.0 CF

2.0 AM

1.0

o .0 t7WL.\-fllT.ffll\Jft/l -1.0

-2.0

-3.0 -4.0 ~NEZ ~O~~~ __ ~ __ ~~ __ ~~ ________ ~ __ ~~ __ ~R

1 0 1 00 QUERY

Fig. 3.13. Hydropathy profile of the amino acid sequences of AIr9018. This plot was

derived using the internet-based computer program, "HYDROPUS" based on the

principles of outlined by Kyte and Doolittle (1982).

64

! !

i I I

I I I I

j

Discussion

We have identified a novel gene, alr9018, which may be a modulator of

heterocyst differentiation. alr9018 was isolated by first isolating a Her mutant ofa Mch-

phenotype-strain UHMIOO, and then by restoring the Mch phenotype through

complementation. The gene that restored the Mch phenotype of the Her mutant was

localized to the Epsilon plasmid of Anabaena PCC 7120. Sub-cloning and

complementation analyses have established the location of a gene within a 4.1-kb

fragment. Sequence analysis showed that alr9018 encodes a relatively large protein with

1,302 amino acids. heIR on a plasmid restored the Mch phenotype to a Het- NSM6. Like

heIR, alr9018 is also expressed in both vegetative cells and heterocysts. The presence of

an NfPase domain and cAMP-cGMP dependent protein kinase phosphorylation site

indicates that AIr9018 may be involved in signal transduction. It is likely that it

perceives different signals, or the same signal at low and high concentrations in the two

cell types of the Anabaena filament. Such signals may be the presence or absence of

oxygen, glutamine concentration, or the availability of2-OG. It is also possible that such

a regulatory protein may serve as a kinase to add phosphate in one cell type and act as

phosphatase to remove phosphate in the other cell type. This suggests that AIr9018 may

be an enzyme of an alternative pathway for modulation of genes involved in heterocyst

differentiation.

To determine the exact role of alr9018 in heterocyst differentiation, an alr9018

knock-out mutant of PCC 7120 will be required. In order to develop a single-

recombination mutant involving alr9018 in PCC 7120, an internal fragment of size 0.6 kb

was cloned in plasmid pSMC127 to obtain palr9018KO. Plasmid palr9018KO has a Str-

65

; I I

I

I

I I

i

Spc resistance selectable marker and can be mobilized to PCC 7120. It does not contain

an origin of replication for Anabaena and therefore it cannot replicate in PCC 7120. It

was expected that the cloned O.6-kb internal fragment of alr9018 in pa/r9018KO would

undergo a single recombination with the homologous alr9018 sequences in PCC

7120(palr90l8KO) and thereby would produce an alr9018 knock-out mutant Several

attempts to develop such a knock-out mutant so far have been unsuccessful. Although

many Str-Spc resistant derivatives ofPCe 7120 were obtained, further analyses of these

presumed mutants by PCR amplification using different primers showed that these were

not alr9018 knock-out mutants. A different approach to develop such a mutant is

underway.

Recently, Zhang et al. (2007) identified and characterized a novel gene hetZ.

which appears to modulate heterocyst differentiation, but its expression requires HetR.

HetZ has positive effects on heterocyst differentiation, since a hetZ mutant had delayed or

no heterocysts. Another gene, n"A, which encoded a nitrogen-responsive response

regulator, was shown to facilitate heterocyst development (Ehira and Ohmori 2006). An

n"A mutant showed delayed heterocyst development Thus, in pce 7120 there are

additional genes like hetZ and n"A that enhance heterocyst development The alr9018

gene identified in this study also enhances heterocyst formation in PCC 7120. Therefore,

it is concluded that alr9018 is a gene that may be involved in modulation of heterocyst

development.

66

,i I

i I

i I I

I ,I I I i

CHAPTER 4

General Discussion

Anabaena sp. PCC 7120 is an ideal organism for the study of cell differentiation

and pattern fonnation. It is a Gram-negative filamentous bacterium having

photosynthetic ability due to the presence of photosystems I and II. It grows relatively

fast with a generation time of about 12 h. It has a genome size of 7.2 MB, which has

been already sequenced (Kaneko et a!. 2001). The methods for genetic manipulation of

Anabaena including DNA isolation, conjugation, and transposon mutagenesis, have been

well developed. The differentiation of the specialized nitrogen-fixing cell type,

heterocyst, takes place under nitrogen deprivation conditions within 24 h. The

heterocysts are morphologically distinct from the vegetstive cells and observable under

the microscope. Therefore, the induction of differentiation is simple and easy to monitor.

Most importantly, it is a prokaryotic organism with multicellular filaments, thus

combining the features of both prokaryotic and eukaroytic organisms.

There are more than 60 genes known to be involved in heterocyst differentiation

and nitrogen fixation (Kaneko et a!. 200 I), some of which have been characterized.

These include ntcA. hetR. hetC. hetF. hetP. hefT, hetL. hetM. hetN. hanA. hepA. hepB.

hepC. hepK, patA. patH. patN. patS. patu, devBCA. devH. devR. hcwA. hglC. hglE.

hglK, pbpB. jitsZ, and n"A. More recently, additional genes for heterocyst development

and pattern fonnation. including hetZ,patU3, and asr1734. have been identified. Among

these, hetR is the master regulator gene for heterocyst differentiation. HetR encodes a

DNA binding protein that may activate transcription of other genes for heterocyst

67

,I

I I

" I ,

I J

"

differentiation. It also has serine type protease activity that may degrade the negative

regulatory peptide PatS, which interferes with the DNA binding activity of hetR. The

protease activity of HetR may also release additional Ca2+ ions, which is necessary for

up-regulating other het genes in heterocyst differentiating cells (Zhao et al. 2005, Shi et

al. 2006). The expression of hetR is balanced by two negative regulators, HetN and PatS.

In the absence of these two negative regulators, hetR is over-expressed, as a result of

which multiple heterocyst formation takes place. Thus regulation of heterocyst

differentiation is not a unidirectional cascade of gene actions, but a bi-directional

modulation of activation and de-activation of genes. Such complex regulatory switches

are characteristics of eukaroytic systems.

In this study, the negative regulatory roles of the patS and hetN genes were further

elucidated. It was shown that patS and hetN are independent of each other. Inactivation

of either patS or hetN alone in PCC 7120 increases the heterocyst frequency to -20%,

while a patS and hetN double mutant ofPCC 7120 formed up to 98% heterocysts. Thus,

the activity of patS and hetN, in the absence of each other demonstrates that they do not

work in series, but they are members of two distinct pathways. Both of these genes are

involved in balancing hetR expression independently. PatS encodes a 17 or 13 amino

acid peptide that interferes with binding of HetR to DNA, whereas HetN encodes an

oxidoreductase that inhibits the autoregulation of hetR after an initial pattern of

heterocysts has been formed (Yoon and Golden 2001, Callahan and Buikema 2001).

Therefore, in the absence of both patS and hetN, hetR is expressed at higher levels,

leading to formation of an Mch phenotype.

68

·1 I ,

I

I I

i I j I

i I I

I :J

It has also been shown in this study that heterocyst differentiation in the patS-

hetN double mutant, UHM I 00, is a function of time when a source of fixed nitrogen is

absent from the medium. UHMIOO forms approximately 25% heterocysts at 24 h after

induction. At 48 h, the frequency of heterocysts rises to about 50%. At this state,

clusters of 5-10 contiguous heterocysts are seen in the filaments. Growth of this culture

beyond 48 h results in further increases of heterocyst frequency to 98%, which causes

fragmentation of the filaments in liquid medium. The percentage of cells that were

heterocysts correlated with hours after nitrogen step-down, and was independent of cell

density in the liquid medium. The percentage of cells that differentiated into heterocyts

in the patS-hetN double mutant, UHMIOO, is also a function of growth phase, when

nitrate was supplied. Complete heterocyst differentiation of UHM I 00 on solid medium

containing nitrate depended on the age of the culture and not on duration after hetN

suppression. In CuW medium also, UHMIOO develops a Mch phenotype after 4 days.

These results show that in the absence of PatS and HetN, hetR is expressed highly even in

the presence of combined nitrogen. Nitrogen deprivation and simultaneous hetN

suppression induce UHM I 00 to form nearly 100% heterocysts and eventually cause all

cells to die.

Besides hetR, hetN. and patS, there are other regulatory genes in Anabaena that

may also be involved in heterocyst differentiation. For example, a/rOI17, a two-

component histidine kinase is involved in heterocyst development (Ning and Xu (2004).

Similarly, nrrA encodes a response regulator that is required for heterocyst development

(Ehira and Ohmori 2006). The Anabaena genome has at least 77 two-component

regulatory systems (Ashby and Houmard 2006). at least a few of which may be involved

69

I , i I , I I I I I I

in the regulation of heterocyst differentiation and nitrogen fixation. Three other genes

involved in modulation of heterocyst differentiation have recently been identified.

Among these, hetZ is a positive regulator of heterocyst development, while patU and

asr 1734 are negative regulators that reduce heterocyst differentiation. In the present

study, it has been demonstrated that alr9018 is another gene that may play an important

role in heterocyst differentiation.

In the Anabaena filaments, the vegetative cells and heterocysts are dependent on

each other for the supply of fIXed nitrogen and carbon. A strain that differentiates all

cells to heterocyst does not contain vegetative cells next to heterocysts to supply carbon

supply. UHMI00 is such a Mch phenotype strain, which is lethal under both CuN and

CuW conditions, although it lives longer under the latter condition. This strain was

considered ideal to isolate Hef mutants, because such mutants will survive by

overcoming the lethal effects of the Mch phenotype. Such mutations may be located in

hetR, other het genes, or in other un-characterized genes involved in heterocyst

differentiation. Four such Hef mutants ofUHMlOO were selected and purified.

One Het· mutant ofUHMIOO, NSM6, was used to isolate a gene that can restore

the Mch phenotype to the mutant A cosmid, pPB6-1, was isolated which restored the

Mch phenotype of NSM6 and contained cloned DNA from the Epsilon plasmid of

Anabaena PCC 7120. It was not known previously that the Epsilon plasmid contained

any genes for heterocyst differentiation. Transfer of pPB6-1 to NSM6 confirmed that the

cloned DNA in this plasmid contained a gene(s) that restored the Mch phenotype.

Sequence analysis, sub-cloning, and further complementation analyses established that

the alr9018 gene in the Epsilon plasmid restored the Mch phenotype of NSM6. alr9018

70

, , , ,

I I

! ,

I

j

is different from any previously-characterized het genes and it did not show homology

with any genes with known function. alr9018 encodes a relatively large protein of size

148.7 kDa with many short hydrophobic domains, indicating that it may be cytoplasmic-

associated. Domain analysis further showed that it has a conserved domain for NTPase

found in the NACHT family. The NTPase domain is found in the apoptosis proteins of

animals as well as in some fungal and bacterial proteins and may be involved in signal

transduction. Interestingly, hetR on a multicopy plasmid could also restore the Mch

phenotype to NSM6. However. sequence analyses ofPCR-ampIified DNA fragments of

NSM6 containing alr90J8 and hetR showed that these genes did not contain any

mutations. The observations that two different genes in multiple copy can restore the

Mch phenotype ofNSM6, and that the Her phenotype ofNSM6 was not due a mutation

in either alr90 J 8 or hetR, suggest that overexpression of either of these two genes can

bypass the effect of the mutation that causes NSM6 become Hef. The suppressor

mutation in NSM6 could be an up-mutation in a negative regulatory gene such as patU3,

asr1734 "or other yet uncharacterized genes, or it could be a down-mutation in a positive

regulatory gene such as patA. hetZ or yet uncharacterized gene.

alr90 J 8 appears to be a positive regulator of heterocyst development. PCC 7 I 20

containing multiple copies of alr9018 formed -15% heterocysts compared to -10%

heterocysts formed by PCC 7120. Moreover, PCC 7120 carrying plasmid palr90J8

reduced at least 50% more acetylene than PCC 7120. Alcian blue staining confirmed that

the heterocysts formed by NSM6 (paIr9018) and PCC 7120 (paIr9018) were mature and

functional. AIr9018 did not show any structural or domain characteristics ofHetR, which

is known to be a DNA binding homo-dimmer and also a serine protease. However, like

71

"1 ,

i I

hetR, alr9018 is expressed in both vegetative cells and pro-heterocysts. Unlike HetR,

AlrJOJ 8 does not have DNA-binding domain or protease activity, but it may be involved

in signal transduction.

A null mutant of alr9018 has not been isolated in this study. Such a mutant will

establish if this gene is essential for heterocyst differentiation, or it has a supplemen!aIy

role for modulation of het gene regulation. Domain analyses of A1r90 18 reveal that it has

domains such as NTPase, kinase phosphorylation, and A TP/GTP binding site, indicating

that it is a regulatory protein. Site-directed mutagenesis involving substitution of

residues within these domains will establish the existence and possible functions of these

domains. It will be of interest to identify the genes that might be regulated by A1r9018.

A microarry comparison of Anabaena PCC 7120 and an air90J8 null mutant may reveal

the genes regulated by alr9018. The identification and characterization of air90J8 in the

present study further show that the regulation of heterocyst differentiation in Anabaena is

complex, involving both activation and de-activation of genes by different regulatory

genes, some of which may have compensatory roles in modulation of gene function.

Such modulation of gene action may be essential for maintaining a pattern of heterocyst

fonnation in every 10-12 vegetative cells.

72

'I I

"

I

i 1

I

i I

I I !

! I

I I

J

CHAPTERS

Material and Methods

Culture conditions for Anabaena

The wild type Anabaena sp. PCC 7120 and its mutants were grown in BO-II W.

BO-II N". BO-II eu"W. and BO-II eu"N" media, which are described below.

BG-ll N+ contains (gIL): NaN03 (7.5). CaCh.2H20 (0.036). Fe~ Citrate

(0.012). Na2EDTA (0.001). K2HP04 (0.04). MgS04°7H20 (0.075). Na2C03 (0.02). and I

ml of micronutrients. which contains the following components (gIL): H~DJ (0.143).

MnCh04H20 (0.091). Zns04 (0.011). Na2Mo04.2H20 (0002). CuS04.5H20 (0.004).

CO(N03) 2.6H20 (0.002). The media was prepared with these micronutrients and

autoclaved. After it cooled to room temperature, media was buffered by adding HEPES,

pH 7.5, NaCOH3 to a fina\ concentrations of 10mM and 5mM, respectively. For BG-II

Wagar medium, 12 gIL of purified agar was added before autoclaving.

BG-ll N" contains the same components as BO-II W, except that NaN03 is not

added.

BG-ll Cu"W is the same as BO-II W, except that CUS04 was omitted from the

medium, and all solutions were filter sterilized. Plastic ware was washed with lOOmM

HCL, sterilized with 95% ETO", and washed with filter-sterilized water before use.

BG-ll CuN is the same as BO-II Cu-N+ except that NaN03 was omitted. All

Anabaena cultures were incubated at 30°C with 2% COz and continually shaken at 200

rpm.

To induce heterocyst formation, exponentially growing cells at a chlorophyll a

concentration of approximately 15 uglml were washed two times and suspended in BG-

73

I I

I j 'i

I

I I I

I I

I

I

II without combined nitrogen, supplemented with 10 mM HEPES, pH 7.5, 5 mM

NaCOH3 and antibiotics if applicable. For heterocyst induction under copper free

conitions, strains growing in BO-II Cu' W for four days, cells were washed two times

and suspended in BO-II Cu'N medium, supplemented with 10 mM HEPES, pH 7.5, 5

mM NaCOH3 and antibiotics (Neomycine 30 ug/ml).

Culture conditions for Escherichia coli

Escherichia coli strains were grown in Luria-Bertaini (LB) broth for liquid culture

and LB agar for plated cultures. For selective growth, media were supplemented with 50

J.1g1ml ampicillin, 50 J.1g1ml kanamycin and 10 J.1g1ml chloramphenicol cultures were

incubated at 37° C cuntinually shaken at 200 rpm.

Bacterial strains and plasmids

Anabaena and E. coli strains used in this study are shown in Table 5.1. The

recombinant plasmids are shown in Table 5.2.

Conjugation

Twenty ml cultures of the appropriate Anabaena strain were grown in BO-II N+

liquid media with 10 mM HEPES and 5 mM NaCH03. For six days cultures were

incubated with light, at 30° C and continuously shaken at 200 rpm.

A 2 ml overnight culture of UC585 containing the appropriate pRL278 derivative

. was diluted to an optical density of 0.05 at an optical density (OD) of 600 nM (OD600)

(usually 1:100) in LB broth containing the appropriate antibiotics. Diluted cultures were

incubated at 37"C and continuously shaken at 250 rpm for 2 h or until OD600 equaled 0.5.

74

i , ,

I I i ,

j ., I

I ,

Once the OD600 reached 0.5 the E. coli pellet was washed two times with BG-II N+ to

eliminate the LB media and antibiotics. The cell pellet was suspended in 2.4 mls ofBG-

11 N+ and Anabaena cultures were diluted to a chlorophyll a concentration of 10 ug/ml.

A mixture of 1: 1 Anabaena; E. coli. equaling 300 ul was evenly spread onto filters

overlaying BG-II N+ plates with 5% LB.

Selection of trans con jug ants

The Anabaena genomic cosmid clone library in E. coli media was grown

overnight in LB supplemented with 50 J.lg/ml kanamycin. To select for transconjugants,

conjugation mixtures were first plated on filters overlaying Cu' BG-11 W with 2% LB

broth. After two days of incubation, filters were transferred onto Cu' BG-11 N+,

supplemented with 30 J.lg/ml of neomycin. Plates were incubated until colonies

appeared, then transferred to copper-free nitrogen-free BG-II containing 30 J.lg/ml of

neomycin.

Mutant selection

UHMIOO was grown in copper-free BG-11 containing nitrogen supplemented

with ImM ~(S04 )2 and incubated for four days. After the liquid culture reached a

chlorophyll a concentration of 10 ug/ml, 300 ul ofUHMlOO was plated onto copper free

BG-II media containing nitrogen. Cultures were incubated at the same conditions as

previously stated for 30 days. After 30 days all filaments differentiated into 95-99%

heterocysts turning the culture white. Mutant colonies recognized by their green color

75

I

I !

.1 I

I I

i I I

'I , i , I

!

were picked and restreaked for isolation. Each mutant's phenotype was identified, and

the mutant was subsequently stored as a UHMlOO mutant (NSM) at -SO·C.

Identifying the phenotype o/the mutant

To confmn that there was no heterocyst formation in the NSM's, they were

viewed with a Nikon Diaphot 300 microscope at 400x magnification in Cu-BO-II N+.

The same procedure to induce heterocyst formation in wild type was used for NSM (see

above). Exponentially growing cells at a concentration of 15 uglml were washed two

times and suspended in Cu-BO-II N-, supplemented with 10mM HEPES, pH 7.5,5 mM

NaCOH3 and/or antibiotics. All strains were viewed at 24 h and 4S h post nitrogen step

down.

76

J

"

I ! ! I

I !

I I

I i I

j

I I

' I

i

i .,

Table 5"1 Anabaena and E. coli strains use in this study

Strain Relevant cbaracterlstics

Anabaena

strains

PCC 7120 Wild type

UHMI00 P petE"hetN, llpatS

UHMI03 !;.hetR

UHM114 llpatS

UHM115 !;.hetN::n sp'/sm'

7120PN PpelE"hetN

NSM4 A mutant strain ofUHMI00

NSM6 A mutant strain ofUHMI00

NSM50 A mutant strain ofUHMI00

E. cou

strain

DH5a Bacterial strain for transformation,

MCR conjugation and plasmid amplification

77

Source

Pasteur Culture Collection

This study

This study

This study

This study

(Callahan and Buikema, 2001)

This study

This study

This study

Bethesda Research Laboratory

.1

I

I ,

.1 1

.1

., i i I I 1

I

Table 5.2 Recombinant plasmids use in this study

Plasmid Relevant CbaracterIstlcs Source

PIasmids

pSMCl04 Suicide plasmid used to delete heiR This study

pSMCI15 Shuttle vector carrying P petJrheIN fusion (Callahan and Buikema, i 2001) I

pSMCI26 Shuttle vector carrying P~ fusion (Callahan and Buikema, I I 2001) I

pSMCI47 Suicide plasmid used to delete patS This study i 1

pSMCI5I Shuttle vector carrying patS This study " ,

pSMCI69 Suicide plasmid used to reintroduce heIN promoter This study

pSMCl82 Suicide plasmid used to replace hetN with sp'/sm' n This study

interposon

pRL278 Mobilizable suicide vector (Cal and Wolk, 1990)

pPB6-1 Shuttle vector carrying complementing het genes This study

pPBNhel Shuttle vector carrying partial complementing hel genes This study . ~

pPBPCRI Shuttle vector carrying 5-kb Epsilon region This study

pPBPCR2 Shuttle vector carryin8 5-kb Epsilon region This study I I

pBPCR3 Shuttle vector carrying 5-kb Epsilon region This study I pBPCR4 Shuttle vector carrying 5-kb Epsilon region This study I pALR9013 Shuttle vector carryin8 Epsilon gene aIr90 13 This study i

pALR9014 Shuttle vector carrying Epsilon gene alr9014 This study

I pALR90l5 Shuttle vector carrying Epsilon gene aIr9Ol5 This study

pALR9016n Shuttle vector carrying Epsilon gene alr9016I17 This study

pALR9018 Shuttle vector carrying Epsilon gene aIr90 18 This study ,

PAM 1956 PAM505 with gfp, mobilizable shuttle vector This study I I pDUCA7- Shuttle vector with Anabaena genomic clone This study

I Lib

pAM504 Mobilizable shuttle vector (Wei et aI., 1994) I

I pGEMT Cloning vector Promego

pBluescript Cloning vector Stratagene

SK+

1

j 78

I !

:1 ,

NSM strain archival 100 ml UHM 1 00 mutants were grown in BO-ll N+ and resuspended in one ml

of BO-ll N+ media and 80 III of filter sterilized dimethyl sulfoxide (DMSO). The

DMSO was added to preserve the strain. The strains were then archived at -80aC for

future recovery and study.

Plasmid constructions

Plasmid pSMCI04 was used to delete the hetR gene from strain PCC 7120 to

create UHM103. It is a mobilizable plasmid that cannot replicate in Anabaena. A 857-

bp region of DNA located 837 bp upstream of the hetR-coding region and a 967-bp

region of DNA located 51 bp downstream were amplified from the chromosome (using

primers HetR5'for, HetRS'rev, HetR3'for, and HetR3'rev) and fused in a 4-primer PCR

reaction using a previously described procedure (Callahan and Buikema, 2001). The

resulting fragment was cloned into the TA site of plasmid pOEM-T Easy (Prom ega) and

subsequently moved to pRL278 (Cai and Wolk, 1990) as a Bgill-Sacl fragment using

restriction sites engineered in the PCR primers to create pSMCI04.

Plasmid pSMC147 was used to delete the patS gene from straius PCC 7120 and

7120PN (Callahan and Buikema, 2001) to create strains UHMI14 and UHMIOO,

respectively. It is a mobilizable plasmid that cannot replicate in Anabaena. Two DNA

fragments corresponding to 797 bp located 152 bp upstream of patS and 789 bp located

173 bp downstream of patS were amplified from the chromosome (using primers

5'PatSSacF, 5'PatSR, 3'PatSF, and 3'PatSBglIlR) and joined as before. The resulting

fragment was cloned into the TA site ofpOEM-T and subsequently moved to pRL278 as

79

i I i i I

I

I

I

J

a Bgill-SacI fragment using restriction sites engineered in the PCR primers to create

pSMCI47.

Plasmid pSMCl5l is a mobilizable shuttle vector that contains the patS gene

under the control of its native promoter. A region of the Anabaena chromosome from

948 bp upstream to 961 bp downstream of the patS-coding region was amplified by PCR

(using primers 5'PatSSacF and 3'PatSBglIIR), cloned into the TA site ofpGEM-T and

subsequently moved into the BamHI-KpnI sites ofpAM504 (Wei et al., 1994) as a Bgill-

KpnI fragment using sites engineered in the PCR primers to create pSMC151.

Plasmid pSMC 169 was used to reintroduce the normal promoter of hetN to strain

UHMI00 to create strain UHM1l4, which is a single mutant that has the patS gene

deleted. It is a mobilizable plasmid that cannot replicate in Anabaena. The region of

DNA from nucleotide 834 of the hetM gene extending to the translational stop codon of

hetN was amplified from the chromosome of strain PCC 7120 (using primers HetM I 142F

and HetNR) and cloned into the TA site ofpGEM-T. This 2103-bp region containing the

promoter region of hetN roughly at its center was moved to pRL278 as a SacI-Bgill

fragment using restriction sites engineered into the PCR primers to create pSMCI69.

Plasmid pSMC182 was used to replace most of the coding region of hetNin strain

PCC 7120 with an interposon that confers resistance to spectinomycin and streptomycin

to create strain UHM115. It is a mobilizable plasmid that cannot replicate in Anabaena.

PCR was used to amplifY one region of DNA that begins at nucleotide 1330 of hetM, the

gene immediately upstream of helN, and extends to nucleotide 93 of hetN (using primers

HetMF-BamHI and HetMR-KpnI) and a second region that begins at nucleotide 593 of

hetN and extends to nucleotide 255 of hetl (using primers HetIF-KpnI and HetIR-SacI),

80

I I i i

I

.i I , I j , ,

the gene immediately downstream and oriented convergently to hetN. These two

fragments were joined at a KpnI site engineered into the PCR primers and cloned into

plasmid pGEM-T. An n interposon carrying the aadA gene (Fellay et aI., 1987) was

inserted as a SmaI fragment into the blunt-ended [(pnl site. The resulting construct was

moved to pBluescript SK+ (Stratagene) as a SaeI-Kspl fragment and subsequently moved

to pRL278 as a SacI-Xhoi fragment to create pSMCI82. All PCR fragments used in the

construction of plasmids were sequenced to verify their integrity.

Construction of alr901 8-gfp transcriptional fusion

An alr9018-gfp transcriptional fusion was constructed by cloning a promoterless

gfp gene behind the putative alr9018 promoter. The 236-bp DNA segment immediately

upstream of the ATG start side of alr9018 was fused with the gfp ORF in the shuttle

vector plasmid pAM1956 to obtain the alr9018-gfp fusion plasmid pALR9018-gfp.

Plasmid DNA isolation and analyses

The library plasmid was isolated using alkaline lyses and a phenol/chloroform

extraction. The plasmids were then transformed into E. coli DH5a MCR. It is important

to use DH5a MCR, to prevent the E. coli endonucleases from recognizing the Anabaena

DNA as foreign and damaging it. Once transformed, the plasmid was isolated from E.

coli by alkaline mini prep for restriction and sequence analyses. The plasmids isolated

were cut with various restriction endonucleases, such as EeoRl, Hindlll, NheI, [(pnI, and

SacI. For each cut sample, 5111 of DNA was run on a 1 % agarose gel.

81

., I

.i

I I

:, ,

I

I !

I i .,

i ,

peR ampUjiclltion of DNA fragments

Polymerase chain reaction (PCR) was used to amplify target regions of DNA

from the Anabaena PCC 7120 genome using complementaIy forward and reverse

primers. Taq DNA polymerase, from Thermus aquiaticus (Promega, Madison, WI) was

used for most routine amplification of DNA, while Pfx polymerase from Pyrococcus

furiosus (Invitrogen, Carlsbad, CA) was used for amplification of the alr9018 ORF.

Stock solutions for PCR included: dNTP mix containing 10 mM each of ATP, CTP, TIP

and GTP, lOx PCR buffer comprising 500 mM KCI, 100 mM Tris-HCI, Ph 8.3, 15 mM

MgCh. Primers were chemically synthesized by Integrated DNA Technologies

(Coralville, JA) and shipped lyophilized (standard desalted 25 nMol) via the Greenwood

Molecular Biology Core Facility, UH (Table 5.3). Upon arrival, primers were

resuspended in 10 mM Tris-HCL, pH 8.0, 0.1 mM EDTA to a final concentration of 100

pmol, and stored at _20°C as stock solutions. Working solutions were made by making a

1:4 dilution ~f the primers into sterile H20 and storing at _20° C. PCR reactions were

carried out for 30 cycles with initial denaturation at 94° C for 5 min and a final extension

at 72°C for 5 min. A typical PCR cycle comprised of the following steps: denaturation at

94° C for I min, annealing with primers at 50-60°C for 30 s, and extension for 30 s. PCR

reactions were carried out in 50 jll reactions containing 1 ng template, 1 jlM forward and

reverse primers, 1 unit of Taq polymerase, 200 jlM dNTPs, and 1 x PCR buffer.

Following PCR reaction, 10 jll reaction mix was loaded on an agarose gel for

electrophoresis and visualization under UV following staining with ethidium bromide.

PCR fragments were cloned into TOPO cloning vector for sequencing.

82

I I ,

I

i

i

·1

I I

.1

I 1

,! .'

i

I I

ColonyPCR

The following primers were used for PCR: HetRS'for and HetR3'rev, 5'patS-sacf and

3'patS-r, and PatAProF and PatA3'Rev (Table 5.3). Anabaena was suspended in 100 ul

of autoclaved M-Q autoclaved water. For samples larger than 2.5 kb, the 100 ul cell

suspension was boiled for five minutes prior to the PCR reaction. Also, for the larger

PCR products 1 ul extra 2 mM\dNTP's were used per sample. Traditional PCR

conditions were used with a 55° C melting temperature and a one minutelkb extension

time.

Following the PCR reaction, a 1% agarose gel was prepared and run with 10 ul of sample

per lane.

83

1 I

I

i I ! i I

Table 5.3 Oligonucleotides use in this study

Oligonucleotide

HetRS'F HetRS'R HetRJ'F HetRJ'R 5CPatSSacF 5'PatSR 3'PatSF 3 'PatSBglIIR HetM1I42F HetNR HetMF-Bamlll HetMR-KpnI HetIF-KpnI HetIR-SacI 5'pPBPCRlBamHIF 3 'pPBPCRI SacIR 5'pPBPCR2BamHIF 3 'pPBPCR2SacIR 5'pPBPCR3BamHIF 3 'pPBPCR3SacIR 5'pPBPCR4BamHIF 3'pPBPCR4SacIR 5'pPB9013BamHIF 3'pPBa1r9013SacIR 5'pPB9014BamHIF 3 'pPBalr90 14SacIR 5'pPB90 15BamHIF 3'pPBalr9015SacIR 5'pPB90 16/7BamHIF 3'pPBa1r9016/17SacIR 5'pPB901SBamHIF 3 'pPBalr90 lSSacIR 5 'palr90 lSKOF 3'palr901SKOR 5'paIr901S::gfpSacIF 3'paIr901S::gfpKpnR

Sequences

TTTAGATCTGCTGTCGTTCTCAGCCACAGAGATTTGTCC TCATCACTAGCATCATTAAGCCATTATGCTACTGAGCCAG TAATGGCTTAATGATGCTAGTGATCACAAATGACTCGGCG TTTCTGCAGATGTCTTGGCTCAGTCGCGGATGATGG GAGCTCCGCATCTTTTATTCAAGCTAACTAGC CTGCTTAGTACTGATATCTAGGAAGTTGGAAGATG TTCCTAGATATCAGTACTAAGCAGCGII I IIACC AGATCTGGGAGTAAATTGTAAATCATAGAAC TTTAGATCTGCTGGTAAGGTAGTCAAGGAAAGTG TTTCATATGCATGAGCGATGAGACTCAACAGCTA GGATCCTAGAACGCTGGTCTGATGAACAA GGTACCAGAACGAGAAACACAAACTACCG GGTACCATTAGCAGGTATTTCTACGCCCA GAGCTCTGGAACCAGGGCAAGTTAAATTT TCATCGGATCCAAATCGCACAAAAACCTGTTTG GGGTGGAGCTCGGTCTAGTGTCTGCTGGTG TGGATGGATCCGGGTGTTATCAAGCTTAATC CGAGAGCTCTGGCGATCGCCCTGTGTGAG TCGCGGGATCCGAGTTCAAACGGGATTAAGC TTGGAGCTCGGGATGTTGAAGGATTCCGA TGGATCCTTTGGATGTCGCAGATTTAC GGAGCTCGGGATGTTGAAGGATTCCGA AATTTGGATCCGATTGGTGTCTAGTGTCTAGC CATTCGAGCTCCCTCACCAATACATCATTCATTCAC GTGAAGGATCCATGTATTGGTGAGGAGAGTGG GTTTGGGAGCTCCTATTGAGGTTAATATTTACTTGG GTAAAGGATCCCCTCAATAGAAAACACCAAACGAG GTGAGGAGCTCGTATCTGCTTAATCCCCGTTTGAACTCC TCGCGGGATCCGAGTTCAAACGGGATTAAGC ATTTGAGCTCCCAGTTATTCAAGAGGACAATCA GATAAGGATCCAGGCATATTCTCTACTCTGTCGC GGAGCTCGGGATGTTGAAGGATTCCGA CAGAAGATGTTGTGATTCGGGAGC AACTCTGCTGCTGTTATATGATTCG AGAGAGCTCTTAATGTCGAGCCATCTATCATTG CTGGGTACCCCAAATAAGTTAATAGCTGGACAT

All oligonucleotides read in the 5' to 3' direction.

84

I

I I 1

, ,

i I

:1

I

I

I

!

I , i

·.1 1

DNA sequence analyses

DNA sequences were analyzed by using online programs from the National

Center for Biotechnology Information (NCBl). DNA homology searches were made

using BLAST tools (Altschul et aI., 1997) at NCBL The highly conserved domains

containing the signature patterns of proteins were identified by PROSITE SCAN

(Bairoch et al., 1997) analysis using the ExPASy Molecular Biology Server. The

ClustalW program used from online bioinformatics and molecular biology links

Ortto://www.molbiol.net)

Primers Npt2-629 forward and pUC 19-245-2 reverse, were used to sequence from

the pDUCA 7 vector into the Anabaena chromosomal fragment. Sequence alignments

were done using Cyanobase Blast to determine identity with the Anabaena genome

sequence.

Strain constructions

Defmed mutations were made in Anabaena sp. strain PCC 7120 and its

derivatives by gene replacement as previously described (Callahan and Buikema, 2001)

using the indicated suicide vectors. To confirm the mutant constructions, primers

flanking the mutation and located outside the region of Anabaena DNA used to make the

mutation were used to amplifY the region of the mutation. The sizes of the various PCR

products were used to confirm that the mutant construct had replaced the wild-type

region of DNA. In each case, a minimum of two mutants derived from separate single-

recombinants were used to evaluate the mutant phenotype.

85

, i I i ; , ,

i , I

I

i ,

I I

I

I

! ,

: J

Strain UHMI00 is a double mutant that has the nonnal promoter of hetN replaced

by the copper-inducible petE promoter and the patS gene deleted. Plasmid pSMC147

was used to introduce the deletion to strain 7120PN, the parent strain, which has only the

hetN locus altered. Strain UHM114 is a single mutant that has the patS gene deleted and

is isogenic with PCC 7120 otherwise. It was constructed by reintroduction of the nonnal

promoter of hetN into strain UHMlOO using plasmid pSMCI69. In both cases, a 375-bp

EcoRV-Scal fragment containing patS has been deleted from the chromosome. This

deletion is similar to the deletion made by Y oon and Golden to make the patS-deletion

strain AMC451 (Y oon and Golden, 1998). Differences in the two types of deletions

include the presence of 6 extra bp in the strains described here (the EcoRV and Seal sites

abut each other instead of being ligated to one another as in AMC451), and the deletions

in UHMlOO and UHMI14 are not marked, whereas an Q Sp'/Sm' cassette replaces the

deleted fragment in AMC451.

Strain UHMI03 is a derivative of PCC 7120 that has the heIR-promoter and -

coding regions deleted. The l783-bp unmarked deletion was created by gene

replacement using plasmid pSMCl04. Strain UHM115 is a derivative ofPCC 7120 that

has a SOO-bp internal region of the hetN gene replaced by an Q interposon that confers

resistance to spectinomycin and streptomycin. It was created by gene replacement using

plasmid pSMC 182.

Clean deletions were made for all of the double mutants except UHMlll which

contains a streptomycin, spectinomycin resistance cassette. This was done by

conjugating E. coli UC585 containing derivatives of the mobilzable plasmid pRL278 into

86

I I

I I I

I I

i i

.~

, "

! 'j

I I I

I I

I

the appropriate Anabaena strain. The suicide plasmid pRL278 contains an Anabaena

origin of replication pDUl, a neomycin resistance gene, and the sacB gene. The pRL278

derivatives, pSMCl04, pSMC I 04, pSMCl64, pSMC136, and pSMC136 and were

conjugated into UHMlOI. 7l20PN. UHMl03. UHMIOO and 7120PN respectively (Table

6.1 and Table 6.2).

Microscopy

Cells were viewed through a Nikon Diaphot 300 inverted microscope using either

a 60x oil or a 40x objective. and images were captured with an Olympus DP70 digital

camera. For fluorescent images a Chroma Technologies 41001 filter set having an

excitation of 480 ± 20 om and emission of 535 ± 25 om was used to monitor fluorescence

specific to the green fluorescent protein (GFP). Images were processed in Adobe

Photoshop version 7.0.

Heterocyst number, pattern and statistical analysis

The criteria used to distinguish heterocysts and to determine heterocyst numbers

were as previously described (Yoon and Golden, 2001). To stain heterocysts with alcian

blue dye 10 "I of a 0.5% alcian blue solution in 50% ethanol was combined with I ml of

Anabaena culture and incubated for 30 min prior to observation.

For the runs test for randomness (Daniel, 1990), 500 cells were considered for

each sample. Because none of the filaments examined were 500 cells in length, changing

from one filament to another could be considered the beginning of a new run or the

87

I .,

I

I i

.1 i

, .1

"

,; I ,

I

i I

I i i

',J

continuation of the previous run. Both choices give the same overall result, but because

counting the change as a new run would bias the results against our eventual conclusion

ofnonrandomness. the change to a new filament was regarded as a new run. At 24 h, nl

= 231. the number of heterocysts; n2 = 269. the number of vegetative cells; and r = 169.

the number of runs. The calculated z value was -6.67 indicating nonrandom distribution

of the two cell types with a bias towards clustering at a very high confidence level (p <

0.0002).

Acetylene reduction assays

Filaments that had been induced for heterocyst formation for various times were

transferred in 1 ml volumes to 3 ml serum bottles and sealed with butyl stoppers. 0.34 ml

of headspace was replaced with acetylene and the bottle was incubated under standard

lighting and shaking conditions. After 2 h, 10 J.l1 gas samples were removed and

analyzed at 55°C for ethylene production on a Hewlett Packard 5890 gas chromatograph

using an 8-ft packed column containing 80% Porapak N and 20% Porapak Q. Assays

were done in triplicate. and each measured value differed by less than 10% of the

average.

88

i

I

I ,i , " I I

I I

!

i I

I

REFERENCES

Adams, D. G. 2000. Cyanobacterial phylogeny and development: questions and

challenges, p. 51-81. In Y. V. Brun and L. J. Shimkets (ed.), Prokaryotic

Development. American Society for Microbiology, Washington, DC.

Adams, D. G. 2002. The liverwort~yanobacterial symbiosis. BioI. and Environ.

Proceedings of the Royal Irish Academy, 102B, 1: 27-29.

Adams, D. G., and N. G. Carr. 1981. The developmental biology of heterocyst and

akinete formation in cyanbacteria. 45-100.

Aldea, R. M., R. A. Mella-Herrea, and J.W. Golden. 2007. Sigma factor genes sigC,

sigE, and sigG are upregulated in heterocys of the cyanobacterium Anabaena sp.

strain PCC 7120. J. Bacterio. 10: 0821-39.

Allan, M. M., and A. J. Smith. 1969. Nitrogen chlorosis in blue-green algae.

Microbiology. 69: 114-120.

Ashby, M. K. and J. Houmar. 2006. Cyanobacterial Two-Component Proteins: Structure,

Diversity, Distribution, and Evolution, Microbiol and Mol. BioI. 70: 472-509.

Baier, B.A., H. Lehmann, D. P. Stephan, and W. Lockau. 2004. NbIA is essential for

phycobilisome degradation in Anabaena sp. PCC 7120 but not for development of

funcitonai heterocysts. Microbiol.. 150: 2739-2749.

Bienert, R., K. Baier, R. Volkmer. W. Lockau, and U. Heinemann. 2006. Crystal

Structure of NbIA from Anabaena sp. PCC 7120, a small protein playing a key

role in phycobilisome degradation. J. BioI. Chem .. 281: 5216-5223.

89

I

I I I

I , I

"l

I

J

Black, T., A. and C. P. Wolk. 1994. Analysis of a Her mutation in Anabaena sp. strain

PCC 7120 implicates a secondary metabolite in the regulation of heterocyst

spacing. J. Bacteriol. 176: 2282-2292.

Black, T. A., Y. Cai, and C. P. Wolk. 1993. Spatial expression and autoregulation of

hetR, a gene involved in the control of heterocyst development in Anabaena. Mol.

Microbiol. 9: 77-84.

Borthakur, P. B., C. C. Orozco, S. S. Young-Robbins, R. Haselkorn, and S. M. Callahan.

2005. Inactivation of patS and hetN causes lethal levels of heterocyst

differentiation in the filamentous cyanobacterium Anabaena sp. PCC 7120. Mol

Microbiol. 57: 111-123.

Buikema, W. J., and R. Haselkom. 1991. Characterization of a gene controlling

heterocyst development in the cyanobacterium Anabaena 7120. Genes Dev. 5:

321-330.

Buikema, W. J., and R. Haselkom. 1991. Isolation and complementation of nitrogen I

fixation mutants of the cyanobacterium Anabaena sp. strain PCC 7120. J. 'I

I Bacteriol. 173: 1879-1885.

Buikema, W. J., and R. Haselkom. 2001. Expression of the Anabaena hetR gene from a

copper-regulated promoter leads to heterocyst differentiation under repressing

conditions. Proc. Natl. Acad. Sci., U.S.A. 98: 2729-2734.

Cai, Y., and C. P. Wolk. 1990. Use ofa conditionally lethal gene in Anabaena sp. strain

PCC 7120 to select for double recombinants and to entrap insertion sequences. J.

Bacteriol. 172: 3138-3145.

90

I i

I I

Cai, Y., and C. P. Wolk. 1997. Anabaena sp. strain PCC 7120 responds to nitrogen

deprivation with cascade-like sequence of transcriptional activations. J.

Bacteriol.. 179: 267-271.

Callahan, S. M. and W. J. Buikema. 2001. The role of HetN in maintenance of the

heterocyst pattern inAnabaenasp. PCC 7120. Mol. Microbiol. 40: 941-950.

Cordell, H. 2002. Epistasis: what it means, what it doesn't mean, and statistical methods

to detect it in humans. Human Molecular Genetics 11: 2463-2468.

Dong, Y., X., X.-Y. Huang, Wu, and J. Zhao. 2000. Identification of the active site of

HetR protease and its requirement for heterocyst differentiation in the

cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol.182: 1575-1579.

Ehira, S. and M. Ohmori. 2006. NrrA, a nitrogen-responsive response regulator facilitates

heterocyst development in the cyanobacterium Anabaena sp. strain PCC 7120.

Mol Microbiol 59: 1692 -1703.

Ernst, A., T. Black, Y. Cai, J.-M. Panoff, D. N. Tiwari, and C. P. Walk. 1992. Synthesis

of nitrogenase in mutants of the cyanobacterium Anabaena sp. strain PCC 7120

affected in heterocyst development or metabolism. J. Bacterial. 174: 6025-6032.

I

I

Fay, P. 1992. Oxygen relations of nitrogen fixation in cyanobacteria. Microbiol. Rev. 56:

340-373.

Frias, J. E., E. Flores, and A. Herrero. 1994. Requirement of the regulatory protein NtcA

for the expression of nitrogen assimilation and heterocyst development genes in

the cyanobacterium Anabaena sp. PCC 7120. Mol. Microbiol. 14: 823-832.

Fuchs, G. 1999. Assimilation of Macroelements and Microelements. Blackwell science,

Stuttgart, Germany.

91

Golden, J. W., S. J. Robinson, and R. Haselkorn. 1985. Rearrangement of nitrogen

fixation genes during heterocyst differentiation in the cyanobacterium Anabaena.

Nature 314: 419-423.

Grossman, A. R.. M. R. Schaefer. G.G. Chiang, and J. L. Collier. 1993. The

phycobilisome, a light-harvesting complex responsive to environmental

conditions. Microbiol. Rev. 57: 725-749.

Huang, X., Y. Dong. and J. D. Zhao. 2004. HetR homodirner is a DNA-binding protein

required for heterocyst differentiation, and the DNA-binding activity is inhibited

by PatS. Proc. Natl. Acad. Sci. USA. 101: 4848-4853.

Haseikorn, R. 1978. Heterocysts. Ann. Rev. Plant Physiol. 29: 319-344.

Haselkorn, R. 1992. Developmentally regulated gene rearrangements in prokaryotes.

Ann. Rev. Genet. 26: 111-128.

Herrero. A., A. M. Muro-Pastor. A. Valladares, and E. Flores. 2004. Cellular

differentiation and the NtcA transcription factor in filamentous cyanobacteria.

FEMS Microbiology Reviews. 28: 469-474.

Kaneko, T.; Y. Nakamura, C. P. Wolk, T. Kuritz, S. Sasamoto, A. Watanabe. M. Iriguchi,

A. Ishikawa, K. Kawashima, T. Kimura, Y. Kishida, M. Kohara, M. Matsumoto,

M. Matsuno. A. MuraId, N. Nakazaki, S. Shimpo, M. Sugimoto. M. Takazawa,

M. Yamada, M. Yasuda, and S. Tabata. 2001. Complete genome sequence of the

filamentous nitrogen-fIXing cyanobacterium Anabaena sp. strain PCC 7120. DNA

Res. 8: 205-213; 227-253.

92

1

"

j

I I

I

I I I I

I

I

j I I I I I

, I I j

Khudyakov, I. and C.P. Wolk. 1997. hetC, a gene coding for a protein similar to

bacterial ABC protein exporters, is involved in early regulation of heterocyst

differentiation in Anabaena sp. strain PCC 7120. J. Bacteriol. 179: 6971-6978.

Kyte. J. and R. F. Doolittle. 1982. A simple method for displaying the hydrophatic

character of a protein. J. Mol. BioI. 157: 105-132.

Leganes, F. 1994. Genetic evidence that hepA gene is involved in the normal deposition

of the envelope of both heterocysts and akinetes in Anabaena variabilis A TCC

29413. Ferns Microbiol. Lett. 123: 63-67.

Li, 8., X. Huang, and J. Zhao. 2002. Expression of hetN during heterocyst differentiation

and its inhibition of heIR up-regulation in the cyanobacterium Anabaena sp. PCC

7120. PEBS Lett. 517: 87-91.

Liang, J., L. Scappino, and R. Haselkorn. 1992. The parA gene product, which contains a

region similar to Che Y of Escherichia coli, controls heterocyst pattern formation

in the cyanobacterium Anabaena 7120. Proc. Natl. Acad. Sci, USA 89: 5655-

5659.

Mariscal, V., A. Herrero, and E. Flores, 2007. Continuous periplasm in a filamentous,

heterocyst-forming Cyanobacterium. Mol. Micro. 65(4): 1139-1145.

Meek, J. C., E. L. Campbell, M. L. Summers, and F. C. Wong. 2002. Cellular

differentiation in the cyanobacterium Nostoc punctiforme. Arch Microbiol. 178 :

395-403

Meeks, J. C. and J. Elhai 2002. Regulation of cellular differentiation in filamentous

cyanobacteria in free-living and plant associated symbiotic growth states.

Microbiol. and Mol. BioI. Reviews. 94-121.

93

I I I I

.1

i I ,

.,

Muny, M. A. and C. P. Wolk. 1989. Evidence that the barrier to the penetration of

oxygen into heterocysts depends upon two layers of the cell envelope. Arch.

Microbiol. 151: 469-74.

Muro-Pastor, A. M., A. Valladares, E. Flores, and A. Herrero. 2002. Mutual dependence

of the expression of the cell differentiation regulatory protein HetR and the global

nitrogen regulator NtcA during heterocyst development. Mol. Microbiol. 44:

1377-1385.

Nayar, A. S., H. Yamaura, R. Rajagopalan, D. D. Risser, and S.M. Callahan. 2007.

FmG is necessary for filament integrity and heterocyst maturation in the

cyanobacterium Anabaena sp. strain PCC 7120. Mol Microbiol 57: 111-123.

Ning, D. and X. Xu. 2004. alrOIl7, a two-component histidine kinase gene, is involved

in heterocyst development in Anabaena sp. strain PCC 7120. Microbiol. 150:

447-453.

Orozco, C. C., D. D. Risser, and S. M. Callahan. 2006. Epistasis analysis of four genes

from Anabaena sp. strain PCC 7120 suggests a connection between PatA and

PatS in heterocyst pattern formation. J. Bacteriol. 188:1808-1816.

Shi, Y., W. Zhao, W. Zhang, Z. Ye, and J. Zhao. 2006. Regulation of intercellular free

calcium concentmtion during heterocyst differentiation by HetR and NtcA in

Anabaena sp. PCC 7120. Proceed. of the National Academy of Sciences. 103.

11334-11339.

Shimkets, L. J., and Y. V. Brun. 2000. Prokaryotic development: strategies to enhance

survival, p. 1-7. In Y. V. Brun and L. J. Shimkets (ed.), Prokaryotic Development.

,. American Society for Microbiology, Wachington, DC.

94

1

I I

i I

I I

I ,

I I

Vaccari, D. A., P. F. Strom, and J. E. Alleman. 2005. Environmental Biology for

Engineers and Scientist, p246. Wiley-Interscience publisher (A John Wiley and

Son's publication).

Walsby, A. E. 1985. The permeability of heterocysts to the gases nitrogen and oxygen.

Proc. R. Soc. Lond. Ser. B 226: 345-366.

White, D. 2000. The Physiology and Biochemistry of Prokaryotes, 2nd ed. Oxford

University Press, New York. Oxford.

Whitton, B. A. and M. Potts. 2000. The Ecology of Cyanobacteia Their Diversity in

Time and Space, eds. Whitton, B. A. and M. Potts. Kluwer Academic Publishers,

Dordrecht, Netherlands, Page I - 11.

Winkenbach, F., C. P Wolk. and M. Jost, 1972. Lipids of membrane and of the cell

envelope in heterocysts ofa blue-green agIa. Planta 107: 69-80.

Wolk. C. P. 1968. Movement of Carbon from Vegetative Cells to Heterocysts in

Anabaena cylindrica. J. Bacteriol. 96: 2138-2143.

Wolk. C. P. 1996. Heterocyst formation. Annual Rev. of Gen. 30: 59-78.

Wolk. C. P. 2000. Heterocyst formation in Anabaena, p. 83-104. In Y. V. Brun and L. J.

Shimkets (ed.), Prokaryotic Development. American Society for Microbiology

Press, Washington, DC.

Wolk. C. P., A. Ernst, and J. Elhai. 1994. Heterocyst metabolism and development. In

the Molecular Biology of Cyanobacteria, ed. DA BI}'IIIlt, pp. 769-823. Dordrecht:

Kluwer.

95

i i

i I ,

I i

I

I I

I I

. . J

Wolk, C. P., S. M. Austin, 1. Bortins, and A. Galonsky. 1974. Autoradiograph

localizatoin of 13N after fixation of I3N-lableled nitrogen gas by a heterocyst-

forming blue-green alga. J. Bacteriol. 61: 440-453.

Wolk, C. P., Y. Cai, L. Cardemil, E. Flores, B. Hohn, M. Murry, O. Scbmetterer, B.

Schrautemeier, and R Wilson. 1988. Isolation and complementation of mutants of

Anabaena sp. strain PCC 7120 unable to grow aerobically on dinitrogen. J.

Bacteriol. 170: 1239-1244.

Wolk, C. P., A. Ernst, and J. Elhai. 1995. Heterocyst metabolism and development, p.

769-823. In D. A. Bryant (ed.), The Molecular Biology of Cyanobacteria, vol. I.

K1uwer Academic Publishers, Dordrecht, The Netherlands.

Wolk, C. P., and M. P. Quine. 1975. Formation of one-dimensional pattern by stochastic

possesses and by filamentous blue-green algae. Dev. BioI. 46: 370-382.

Wood, N.B., R Haselkorn. 1979. Proteinase activity during heterocyst differentiation

in nitrogen-fixing cyanobacteria. In Limited Proteolysis in Microorganisms,

ed. OH Cohen, H Hoizer, pp. 15'Hi6. Bethesda, MD: US DHEW Publ. No.

(NIH) 79-1591.

Wood, N. B. and R. Haselkorn. 1980. Control of phycobiliprotein proteolysis and

heterocyst

differentiation in Anabaena. J. Bacteriol. 141:1375-85.

Wu, X., D. W. Lee, R. A. Mella, and J. W. Golden. 2007. The Anabaena sp. strain PCC

7120 asrI734 gene encodes a negative regulator of heterocyst development.

Molecular Microbiol. 64: 782-794.

96

I

,

I I I . , I

! I

Yoon, H.-S., and J. W. Golden. 1998. Heterocyst pattero formation controlled by a

diffusible peptide. Science 282: 935-938.

Yoon, H.-S., and J. W. Golden. 2001. PatS and products of nitrogen fixation control

heterocyst pattern. J. Bacteriol. 183: 2605-2613.

Zhang, C. C., S. Huguenin, and A. Friry. 1995. Analysis of genes encoding the cell

division protein FtsZ and a glutathione synthetase homologue in the I

cyanobacterium Anabaena sp. PCC 7120. Res. Microbiol.146: 445-455.

Zhang, W.,1. Y. Du, I. V. Khudyakov, Q. Fan, H. Gao,l. D. Ning, C. P. Wolk and X. Xu.

2007. A gene cluster that regulates both heterocyst differentiaiton and pattern

formatoin in Anabaena sp. strain PCC 7120. Mol. Microbiol. 66: 1429-1443.

Zhao, Y., Y. Shi, W. Zhao, X. Huang, D. Wang, N. Brown, J. Brand and J. Zhao. 2005.

CcbP, a calcium-binding protein from Anabaena sp. Strain PCC 7120, provides

evidence that calcium ions regulate heterocyst differentiation. Proceed. of the

National Academy of Sciences, 102(16): 5744-5748.

Zhou, R., Z. Cao, and J. Zhao. 1998. Characterization of HeIR protein turnover in

Anabaena sp. PCC 7120. Arch. Microbiol. 169: 417-423.

Zhou, R., X. Wei, N. Jiang, H. Li, Y. Dong, K.-L. Hsi, and J. Zhao. 1998. Evidence that

HetR is an unusual serine-type protease. Proc. Natl. Acad. Sci., U.S.A. 95: 4959-

4963.

97