Characterization of the promoter for vascular cell adhesion molecule

THE JOURNAL OF BIOLOGICAL CHEMISTRY 8 1992 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 267, No. 23, Issue of August 15, pp. 16323-16329.1992 Printed in 11. S. A

Characterization of the Promoter for Vascular Cell Adhesion Molecule- 1 (VCAM- 1)*

(Received for publication, February 27,1992)

Michael F. IademarcoSB, Jay J. McQuillan$, Glenn D. Roseny, and Douglas C. Dean11 From the Deoartments of Internal Medicine and Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Mksouri 631 10

Vascular cell adhesion molecule-1 (VCAM-1) was first identified as a protein that appears on the surface of endothelial cells after exposure to inflammatory cytokines. Through interaction with its integrin counter receptor VLA-4, VCAM-1 mediates cell-cell interactions important for immune function. We have cloned and begun characterization of the promoter for the VCAM-1 gene. In a series of transfection assays into human umbilical vein endothelial cells (HUVECs), we find that silencers between positions -1.641 kilo- bases and -288 base pairs restrict promoter activity, and that treatment with tumor necrosis factor-a overcomes this inhibition and activates the promoter through two NFKB sites located at positions -77 and -63 base pairs of the VCAM-1 gene. This responsiveness appears cell-specific since constructs containing the VCAM-1 NFKB sites are not responsive to tumor necrosis factor a in the T-cell line Jurkat. The two VCAM-1 NFKB sites, which differ slightly in their sequence, form distinct complexes in gel retardation assays, suggesting that they interact with different NFKB-site binding proteins. The distribution of these proteins could then control activity of the NFKB sites. We conclude that the pattern of VCAM-1 expression in HUVECs is controlled by a combination of these silencers and NFKB sites.

The recruitment of immune cells to the endothelium is a complex process involving the interaction of ligands or counter receptors on the surface of endothelial cells with receptors on immune cells (1-4). The endothelial cell ligands can be divided into two classes. The first class consists of proteins that are members of the immunoglobulin gene superfamily (5-7). These ligands are recognized by integrin receptors on immune cells. One protein in this class is vascular cell adhe-

* This work was supported by National Institutes of Health Grants HL29594 and HL43418 and a Career Investigator Award from the American Lung Association (to D. C. D.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ These two authors contributed equally to this article.

HL07317. Supported by National Institutes of Health Training Grant

7 Supported by National Institutes of Health Grant HL02428 Clinical Investigator Award.

11 To whom correspondence and reprint requests should be ad- dressed Box 8052, Washington University School of Medicine, 660 S. Euclid, St. Louis, MO 63110. Tel.: 314-362-8989; Fax: 314-362- 8987.

sion molecule-1 (VCAM-1)’ (also known as INCAM-110), which is a ligand for the integrin receptor very late activation antigen-4 (VLA-4) (8). VLA-4 is found on the surface of T - cells and monocytes where it mediates the adhesion of these cells to cytokine-stimulated endothelium via VCAM-1 on endothelial cells (9). Two other members of this class are ICAM-1 and ICAM-X. Like VCAM-1, both of these proteins are cytokine-inducible and they bind to an integrin receptor, LFA-1, on immune cells (3, 10). ICAM-1 also binds to the integrin MAC-1 (11). ICAM-2 is another member of this class. I t also binds to LFA-1, but, unlike the other members, it is expressed constitutively on endothelial cells (7).

The second class is known as selectins and consists of the lectin-like proteins L-selectin (Mel-14), P-selectin (GMP- 140), and E-selectin (ELAM-1) that bind carbohydrate receptors on immune cells (2, 12-20). As with VCAM-1, ICAM-1, and ICAM-X, the selectins E-selectin and P-selectin are responsive to cytokines. Therefore, inflammatory cells can be recruited to the endothelium through pathways involving two seemingly unrelated sets of interactions: members of the immunoglobulin gene superfamily interacting with integrins and selectins binding to carbohydrates.

There is evidence that receptors for some of these endothelial cell ligands may signal the nucleus during receptor-ligand binding. For example, the interaction of VLA-4 or LFA-1 on T-cells with VCAM-1 or ICAM-1 on endothelial cells, respectively, induces T-cell antigen receptor-dependent activation of CD4+ T lymphocytes (21, 22), suggesting that the function of these receptor-ligand pairs extends beyond cell-cell interactions to include nuclear signaling.

Endothelial cell surface ligands may also be involved in metastasis of tumor cells. It has been proposed that the interaction of tumor cells with activated endothelium is a mechanism that facilitates the migration of circulating tumor cells into tissues (23, 24). VLA-4 is not present on melano- cytes, osteoclasts, and osteoblasts, but its expression is activated on melanoma and osteosarcoma cell lines, which allows these tumor cells to adhere to VCAM-1 on cytokine-stimulated endothelial cells (23-26). These interactions are specific for VCAM-1 and are not mediated by other endothelial cell- surface ligands (24). However, other endothelial cell surface ligands may be involved in metastasis of different types of tumor cells. For example, E-selectin has been shown to mediate the binding of colon carcinoma cell lines to activated endothelial cells (24), and small cell lung cancers express LFA-1 and MAC-1 (27), suggesting that they may utilize

The abbreviations used are: VCAM-1, vascular cell adhesion molecule-1; TNF, tumor necrosis factor-a; CAT, chloramphenicol acetyltransferase; HUVEC(s), human umbilical vein endothelial cells; VLA-4, very late activation antigen-4; Hepes, 4-(2-hydroxyethyl)-l- piperazineethanesulfonic acid bp, base pair(s); kb, kilobase(s); PCR, polymerase chain reaction.

16323

16324 VCAM-1 Promoter Activity

ICAM-1 to adhere to endothelial cells. Even though selectins (E-selectin and P-selectin) and mem-

bers of the immunoglobulin gene superfamily (VCAM-1 and ICAM-1) have distinct structures and interact with different receptors, their pattern of expression on endothelial cells is similar. Therefore, a common mechanism may control expression of these different genes. An understanding of this mechanism should provide further insight into the role of these ligands on endothelial cells.

In addition to endothelial cells, VCAM-1 is also expressed on lymphoid dendritic cells, on stromal fibroblasts in bone marrow, in Peyer’s patch in the intestine, and on some tissue macrophages (28-30). In the bone marrow, VCAM-1 mediates the interaction between hematopoietic cells, which express VLA-4, and stromal fibroblasts (29, 30). This interaction is required for maturation of the hematopoietic cells. In lymphoid tissue, VCAM-1 mediates the interaction of maturing B- cells with dendritic cells at germinal centers (28). In contrast to an endothelial cell where its expression is dependent upon inflammatory cytokines, VCAM-1 is expressed constitutively at these other sites.

We began examining VCAM-1 as both a model for how expression of endothelial cell surface ligands is controlled and a model of a gene that is subject to alternate regulatory mechanisms in different tissues. As a first step in determining how VCAM-1 expression is controlled at the molecular level, we have cloned and begun an analysis of the promoter for the VCAM-1 gene. Here we show in a series of transfection assays that silencers restrict basal VCAM-1 promoter activity in human umbilical vein endothelial cells (HUVECs), and that the inflammatory cytokine tumor necrosis factor-a (TNF) can overcome the inhibitory effect of these silencers and activate the promoter. This activation requires two adjacent NFKB sites, which form different complexes with nuclear proteins. The activity of these sites appears to be cell-specific, and we suggest that the combination of these sites could be responsible for their cell-specific activity.

MATERIALS AND METHODS

Cell Culture and DNA Transfection-HUVECs were obtained from the American Type Culture Collection and were maintained in Ros- well Park Memorial Institute media (RPMI) (16401, 20% fetal calf serum, endothelial growth supplement (Sigma) at 50 pg/ml, and heparin at 100 pg/ml (endothelial cell media). The T-cell line Jurkat was maintained in RPMI 1640 containing 10% calf serum supple- mented with iron.

HUVECs on 10-cm plates were switched to Dulbecco’s modified Eagle’s media containing 10% fetal bovine serum and transfected with 10 pg of reporter plasmid along with 10 pg of the parent vector Bluescript SK (Stratagene Inc.) by the calcium phosphate method (31). Four h after transfection, cells were rinsed with phosphate- buffered saline, and endothelial cell media were replaced. Jurkat cells were transfected by electroporation using a BTX Transfector 300 (BTX Inc., San Diego, CA) as described (32). Briefly, approximately 1 X lo7 Jurkat cells were suspended in 0.1 ml of RPMI 1640 media containing 10 mM Hepes, 70 mM NaC1, 2.5 mM KCl, 0.35 mM NazHP04, 3.0 mM dextrose, 1.25 mg/ml salmon sperm DNA, and 30 pg of plasmid DNA and subjected to electroporation at 250 V and 950 pF. Two pg of pRSV/L, which contains the Rous sarcoma virus long terminal repeat fused to the firefly luciferase gene (33), were co- transfected into both HUVECs and Jurkats as an internal control, and equal amounts of luciferase activity were added to each CAT reaction. Luciferase assays were done using a bioluminometer (Ana- lytical Bioluminescence Laboratory) as described (33). Experiments were also done in the absence of pRSV/L to ensure that there was no promoter competition between pRSV/L and the VCAM-1 constructs. Thirty-six h after transfection, protein extracts were made, and chloramphenicol acetyltransferase (CAT) activity was determined (32). Approximately 20 pg of protein from HUVECS were used for CAT assays, and reactions were allowed to proceed for 3 h. CAT assays with extracts from Jurkat cells contained approximately 200

pg of protein, and reactions were for 16 h. Acetylation of [“C] chloramphenicol was quantified by thin layer chromatography fol- lowed by scintillation counting.

RNA Analysis-RNA was isolated by the guanidinium isothiocya- nate/CsCl method, and primer extension and S1 nuclease mapping assays were done as described previously (32). Poly(A+) RNA was isolated by affinity chromatography on oligo(dT)-cellulose (34).

Screening of a Genomic Library and DNA Characterization-A human lung fibroblast genomic library in XFix (Stratagene) was screened with a fragment of VCAM-1 cDNA (5) between positions +13 and +113 bp (see Fig. 4). This cDNA was constructed by reverse transcriptase/polymerase chain reaction (PCR) of VCAM-1 mRNA. Five pg of poly(A+) RNA derived from HUVECs that had been treated for 16 h with 10 ng/ml TNF was annealed to a primer (5’- TTGCTGTCGAGATGAGAAA ATA-3’) located at position +113 bp of the VCAM-1 gene, and cDNA was synthesized with reverse transcriptase (32). This cDNA was then amplified by PCR using the same 3’ primer along with a 5’ primer (5’-CGGGCCTCACTGGC- TTCAGGA-3’) located at position +13 bp. The resulting PCR product was gel-purified, labeled with 32P, and used as a probe to screen the human genomic library as described (32).

Southern blot analysis was done using the 32P-labeled VCAM-1 cDNA fragment derived from reverse transcriptase/PCR as a probe (32). Hybridization was done at 42 “C in 4 X SSPE (1 X SSPE is 0.18 M NaCl, 10 mM NaH2P04, 1 mM EDTA, pH 7.4), 10 X Denhardt’s (1 X Denhardt’s is 0.02% polyvinylpyrrolidone, 0.02% Ficoll, and 0.02% bovine serum albumin), 0.1% sodium dodecyl sulfate, and 0.4 mg/ml sheared, denatured salmon sperm DNA. Blots were washed a t 55 “C in 0.2 X SSPE.

DNA Sequencing-The 5’ end and flanking region of the VCAM- 1 gene was sequenced using the dideoxynucleotide method as described previously (32) with synthetic oligonucleotide primers made on an Applied Biosystems 391 DNA synthesizer. Both strands of DNA were completely sequenced.

Plasmid Construction-To create 2.18OVCAMCAT, the VCAM-1 genomic clone XVCAM-1-1 was digested with BglI (position +22 bp) and EcoRI (position -2.18 kb), and the resulting fragments were blunt-ended with T4 DNA polymerase and cloned into the EcoRV site of the promoterless CAT expression vector SKCAT-Pst/Bam (32). In this vector, the 5’ end of the CAT gene is cloned into the PstI site of Bluescript SK, whereas the 3’ end of the gene is cloned into the EamHI site. In 2.18OVCAMCAT, the orientation of the VCAM-1 gene fragment is such that the end containing the EglI site at position +22 bp is adjacent to the 5’ end of the CAT gene. The orientation of the insert was determined by DNA sequencing.

288VCAMCAT was constructed by digesting XVCAM-1-1 with EglI, blunt-ending the site with T4 DNA polymerase, digesting with HindIII (position -288 bp), and cloning the resulting VCAM-1 promoter fragment into SKCAT-Pst/Bam that had been digested with EcoRV (blunt-ended BglI site) and HindIII. The orientation of the insert was determined by DNA sequencing.

1.641VCAMCAT was constructed by first digesting 2.18OVCAMCAT with PstI (the 5’ end of the CAT gene) and EamHI (position -1.641 bp of the VCAM-1 gene). The resulting VCAM-1 promoter fragment was then cloned into SKCAT-Xho that had been digested with PstI and BamHI. SKCAT-Xho was constructed by digesting SKCAT-Pst/Bam with PstI (5’ end of CAT gene) and EamHI (3’ end of CAT gene), blunt-ending the CAT gene fragment with T4 DNA polymerase, and cloning it into Bluescript SK digested with XhoI. In SKCAT-Xho, the 5’ end of the CAT gene is adjacent to the PstI site in the vector (determined by DNA sequencing).

933VCAMCAT was constructed by digesting 2.18OVCAMCAT with PstI (5’ end of the CAT gene) and StuI (position -933 bp of the VCAM-1 gene) and cloning the resulting VCAM promoter fragment into SKCAT-Pst/Bam that had been digested with PstI and EcoRV.

32VCAMCAT, 68VCAMCAT, and 68VCAMCAT-M were constructed using synthetic oligonucleotides. To create 32VCAMCAT, complementary oligonucleotides corresponding to the region between positions -32 and +12 bp were synthesized such that, after annealing, a HindIII site is present on the 5’ end and a PstI site is present on the 3’ end. The double-stranded oligonucleotide was then cloned into SKCAT-Pst/Bam that had been digested with PstI and HindIII. 68VCAMCAT was constructed in the same fashion. Synthetic oligonucleotides extending from position -68 to +12 bp were annealed and cloned into SKCAT-Pst/Bam that had been digested with PstI and HindIII. 68VCAMCAT-M is identical with 68VCAMCAT except the NFKB site at position -63 bp 5’-GGGATTTCCC-3’ in 68VCAMCAT is changed to 5’-CTCATCTCCC-3’ in 68VCAMCAT-

VCAM-1 Promoter Activity M. This mutation is known to disrupt the binding of nuclear protein (35). The VCAM-1 gene insert in each of the above plasmids was sequenced.

224VCAMCAT, lZOVCAMCAT, and 85VCAMCAT were constructed using PCR. Ten ng of 288VCAMCAT that had been digested with HindIII were used as a template in each PCR reaction along with a common 3’ primer (5”GCGTCTGCAGATACCGCGGAGT- GAGGT-3’) located a t position +12 bp. The italicized sequence corresponds to a PstI site that was used to clone resulting PCR fragments into CAT vectors. The 5’ PCR primers for 224VCAMCAT, lZOVCAMCAT, and 85VCAMCAT are 5“ACATAAGCTTGATG

TTAAAC-3’, and 5’-AGTGGAAGCTTCTGCCCTGGGTTTCCCC T- 3 ‘ , respectively. The italicized sequence in each oligonucleotide corresponds to a HindIII site that was used to clone resulting PCR fragments into CAT vectors. Products from PCR reactions were digested with PstI and HindIII and cloned into SKCAT-PstlBarn that had been digested with the same enzymes. The VCAM-1 fragment in each of the resulting constructs was completely sequenced to ensure that no mutations occurred during PCR.

Complementary double-stranded oligonucleotides containing the NFKB site at position -77 bp (5”AGCTTGCCCTGGGTTTCCCCTT- GAAGA-3’, the coding strand is shown and italicized portions are from the VCAM-1 promoter) were synthesized such that, after annealing, HindIII sites are present on each end. The annealed oligonucleotides were then cloned into pTACAT (36), a minimal promoter construct containing the SV40 early gene TATA equivalent driving the CAT gene, that had been digested with HindIII to create pTA(-77)CAT. The HindIII site is located immediately upstream of the TATA box. Likewise, oligonucleotides containing both NFKB sites (positions -77 and -63 bp) (5”AGCTTGCCCTGG GTTTCCCCTTGAAGGGATTTCCCTCCGCCA-3‘, the coding strand is shown and italicized portions are from the VCAM-1 promoter) were cloned into pTACAT to create pTA(-77/-63)CAT. In both pTA(-77)CAT and pTA(-77/-63)CAT, the insert is in the same orientation as in the VCAM-1 gene; orientation was determined by DNA sequencing.

Gel Retardation Assays-Nuclear protein extracts were prepared from HUVECs that were either untreated or which had been stimulated for 2 h with 10 ng/ml TNF as described (37). Double-stranded synthetic oligonucleotides were labeled on their 5‘ ends with :12P using polynucleotide kinase and used as probes in gel retardation assays as described (31). Samples were subjected to electrophoresis on 4% polyacrylamide gels at approximately 4 V/cm a t room temperature. Gels were dried and exposed to x-ray film with an intensifying screen a t -70 “C. Probes for sites at positions -77 and -63 bp, and -77 bp alone were described above in construction of pTACAT vectors. The probe for the site at position -63 is described above in the construction of 68VCAMCAT.

AGGAAAAGCCTGT-3’, 5”ACATAAGCTTGGCTGGGTGTCTG

RESULTS

Effect of TNF and IL-1 on Expression of VCAM-1 mRNA- It has been demonstrated that VCAM-1 expression is stimulated by TNF and IL-1 in HUVECs and that the activation by TNF occurs at the level of VCAM-1 mRNA (5). Here we compare the effect of IL-1 and TNF on VCAM-1 mRNA levels. The results demonstrate that TNF increases the level of VCAM-1 mRNA more effectively than IL-1 (Fig. 1).

Isolation of a VCAM-1 Genomic Clone-In order to under- stand the molecular details of how VCAM-1 expression is controlled, we began studies to isolate the promoter for the VCAM-1 gene. The primer extension assay in Fig. 1 demon- strates that the 5’ end of the VCAM-1 gene is only approximately 13 nucleotides beyond the 5’ end of the published cDNA sequence (5) (Fig. 1).

A 100-bp fragment of VCAM-1 cDNA (located between positions +13 and +113 bp) was used as a probe to screen a genomic library for clones containing the 5’ end of the VCAM- 1 gene. At least three different genomic clones were obtained. A Southern blot of restriction enzyme digests of one clone, XVCAM-1-1, is shown in Fig. 2A. The blot was hybridized to the same cDNA fragment used to screen the genomic library. A Southern blot of restriction enzyme digests of human

16325 D

-63

FIG. 1. Stimulation of VCAM-1 mRNA in HUVECs by TNF and IL-1. A primer extension assay was used to quantify VCAM-1 mRNA levels in response to TNF and IL-1. Cells were treated with

ACCTGTGTGTGCCTGGGAGGG TATTCAGCT-3’) located 50 bp 10 ng/ml TNF or IL-1 for 16 h, and RNA was isolated. A primer (5’-

from the 5’ end of the known VCAM-1 cDNA was used in the assays along with 20 pg of RNA (see “Materials and Methods”). Extension products were separated on an 8% sequencing gel; the size of the extension product and the size of the standards (std. ) is given in nucleotides.

genomic DNA was hybridized to the same VCAM-1 cDNA fragment (Fig. 2B). Bands of similar mobility hybridized to the digests of XVCAM-1-1 and genomic DNA, indicating that the clone is not rearranged and that it is representative of genomic DNA. A single band is observed with each enzyme, suggesting that a single VCAM-1 gene is present. A restriction enzyme map of the area surrounding the 5‘ end of the VCAM- 1 gene is shown in Fig. 2C.

Identification of the 5’ End of the VCAM-1 Gene-A combination of S1 nuclease and primer extension analysis was used to define the 5‘ end of the VCAM-1 gene. A single band that mapped to the same location was observed with each assay, indicating that VCAM-1 gene transcription initiates from a single site designated +I in Fig. 3 (results not shown). Additionally, the same site was identified in Fig. 1 using a different primer for primer extension.

Sequence of the First Exon and 5’ Flanking Region of the VCAM-1 Gene-The sequence of the 5’ flanking region and first exon of VCAM-1 is shown in Fig. 3. The gene contains 120 bp of 5‘ untranslated region that is not interrupted by an intron and the first exon is 184 bp in length. A TATA box is located a t position -29 bp, and consensus binding sites for transcription factors are present throughout the 5’ flanking region.

Potential binding sites for NFKB are found at positions -63 and -77 bp), and a potential binding site for AP-1 is located a t position -495 bp. Both of these elements have been shown to be responsive to TNF in other promoters (38-45).

Consensus binding sites for the ets family of proto-onco- genes (46) are found a t positions -221, -981, and -1033 bp of the VCAM-1 gene. Members of this family are important in cell cycle control and are thought to play a role in control- ling tissue and developmental specific expression (47-51).

GATA boxes are found at positions -259 and -245 bp. These elements can bind a family of zinc-finger nuclear proteins that differ in their tissue specificity: GATA-1 is

16326 VCAM-1 Promoter Activity

important in red cell differentiation (52), GATA-2 is important for expression of endothelin-1 and, thus, may play a role in endothelial cell differentiation (53, 54), and GATA-3 is T- cell specific (55).

21 2 - .) ,, 9 4- - 6 6 - 4 4-

23. 2 0-

0

0 56-

C. @

21 2 -

9 4-

6 6 -

. ""...I.

4 4-

2 3- 2 0-

fiPJ+&-JJ.~& -6 k l l PSt I

1-23> B I1

FIG. 2. Southern blot analysis of the VCAM-1 gene. A , Southern blot of restriction enzyme digests of XVCAM-1-1, a genomic clone that contains the 5' end of the VCAM-1 gene. The probe for the blot was a cDNA fragment between positions +13 and +113 bp of the VCAM-1 gene (see Fig. 3). B, Southern blot of human genomic DNA. Fifteen pg of human genomic DNA were digested with the indicated restriction enzyme, separated by agarose gel electrophoresis, and Southern blotted. The blot was hybridized to the probe described in panel A . Note that the size of the restriction fragments match those obtained with XVCAM-1-1 in panel A (the Hind111 fragment ran off the end of the gel), indicating that the clone has not undergone rearrangement. C, a restriction enzyme map of the 5' end and flanking region of the VCAM-1 gene. This map was derived from Southern blots of XVCAM-1-1 that had been digested with the indicated enzymes and hybridized to the same probe as in panels A and B.

-2180

-2060

-1940

-1820

-1700

-1 580

-1460

-1340

FIG. 3. Sequence of the 5' end and -1220 flanking region of the human -lloo VCAM-1 gene. The site of transcriptional initiation is indicated by + I and an arrow. Boxed sequences correspond to -860 potential regulatory elements and are -740 discussed in the text.

-620

-500

-380

-260

-1 40

-20

+lo1

+208

Three potential octamer binding sites are found at positions -729, -1180, and -1554 bp. Octamer binding sites are found in a number of different enhancers and they bind a family of homeobox proteins that are differentially expressed during development and in adult tissues (56, 57). While octamer binding sites are normally thought to mediate transcriptional activation, they can also be targets of repression (58).

Finally, there is a consensus binding site for TEF-1 (position -719 bp), a tissue-specific enhancer factor that binds to the GT-IIC, Sph-I, and Sph-I1 enhansons in the SV40 enhancer (59).

While our studies were being completed, the sequence and chromosomal localization of the VCAM-1 gene was reported (60). In this study, the sequence of the first 520 bp of 5' flanking sequence was reported. Comparison of the two sequences in the region of overlap revealed complete identity. However, there was a discrepancy in the identification of the 5' end of the gene. Using a combination of primer extension and S1 nuclease protection assays, we find that transcription initiates at a G residue 5 bp 3' of the A residue suggested previously to be the 5' end of the gene.

The VCAM-1 Promoter Is TNF-responsive and Cell-specific-To determine if the 5' flanking region of the VCAM-1 gene functions as a promoter, a 2.18-kb fragment of VCAM- 1 5' flanking sequence was fused to the CAT reporter gene, and the resulting construct (2.18OVCAMCAT) was transfected into HUVECs. Basal expression was low, but signifi- cant activation occurred in the presence of TNF (Fig. 4A). Additionally, transcription from 2.18OVCAMCAT initiated from the same site as in the endogenous VCAM-1 gene (data not shown). These results suggest that the first 2.18 kb of VCAM-1 gene 5' flanking region is an active promoter and that its activity reflects the pattern of expression of the endogenous VCAM-1 gene in HUVECs.

As a control, 2.180VCAMCAT was transfected into the T- cell line Jurkat, which is responsive to TNF (61) but does not express VCAM-1 (data not shown). The promoter showed little basal activity in Jurkat cells and was unresponsive to T N F (Fig. 4, right).

Silencers Restrict VCAM-1 Promoter Activity in the Absence

VCAM-1 Promoter Activity 16327

HUVEC Jurkat

TNF ” ”

I + I I I

FIG. 4. The VCAM-1 5’ flanking region is an active promoter that is TNF-responsive and tissue-specific. Left, transfection of 2.18OVCAMCAT, which contains 2.18 kb of the VCAM-1 gene 5’ flanking region fused to the CAT gene, into HUVECs. Right, transfection of 2.18OVCAMCAT into Jurkat cells. Percent conversion of [‘4C]chloramphenicol to acetylated forms was determined by scintillation counting. Where indicated, cells were treated with 10 ng/ml TNF for 16 h. RSVCAT (right lane in each panel) contains the Rous sarcoma virus long terminal repeat driving the CAT gene.

FIG. 5 . Effect of 5’ deletions on VCAM-1 promoter activity. Constructs containing different amounts of VCAM-1 gene 5’ flanking region were transfected into HUVECs as in Fig. 4. Numbers in the construct name indicate the length of VCAM-1 gene 5’ flanking region. Constructs are described under “Materials and Methods.” In 68VCAMCAT-M, the NFKB site at position -63 bp is mutated. SKCAT-PstlBam is the parent vector and does not contain a promoter. Relative CAT activity was determined by first separating the acetylated and unacetylated forms of [’4C]chloramphenicol using thin layer chromatography (as in Fig. 4) and then quantifying the forms by scintillation counting. Results are an average of duplicate assays from two separate experiments.

of Cytokines-VCAM-1 is not expressed on HUVECs in the absence of inflammatory cytokines, and, accordingly, promoter activity is not above background in transfection assays (Fig. 5). Deletion of VCAM-1 5’ flanking region from position -1.641 kb (1.641VCAMCAT) to position -933 (933VCAMCAT) stimulated promoter activity (Fig. 5), indicating that a silencer that normally suppresses promoter activity is removed with this deletion. A subsequent deletion to position -288 bp (288VCAMCAT) further stimulated promoter activity, implying that this deletion removes an additional silencer.

Treatment with T N F overcomes the inhibitory effect of these silencers and activates the VCAM-1 promoter (Fig. 5). However, the silencers do blunt the response to TNF. Com- pare the effect of TNF on expression of 2.180VCAMCAT (contains silencers) and 288VCAMCAT (lacks silencers) in Fig. 5.

The Effect of 5’ Deletions on TNF Responsiveness of the VCAM-1 Promoter-Deletion of VCAM-1 5’ flanking region from position -288 bp to position -224 bp (224VCAMCAT) decreased promoter activity (Fig. 5). GATA boxes a t positions -259 and -254 bp are the only apparent elements in this region (Fig. 3), implying that these sites are important for

expression of 224VCAMCAT. However, expression of 224VCAMCAT is still activated by TNF, indicating that the GATA boxes are not important for TNF responsiveness. Subsequent deletions to positions -120 (120VCAMCAT) and -85 bp (85VCAMCAT) also failed to eliminate TNF responsiveness. However, responsiveness was lost on deletion to position -68 bp (68VCAMCAT). This deletion removes an NFKB site at position -77 bp but leaves a second NFKB site a t position -63 bp. These results suggest that the upstream NFKB site is required for T N F responsiveness but do not preclude the possibility that the downstream site plays a role. The most active VCAM-1 promoter construct in HUVECs, 288VCAMCAT, was not active in Jurkat cells and it did not respond to treatment with T N F (data not shown). Since NFKB sites from other promoters are responsive to TNF in Jurkat cells (39-42), tissue-specific factors could be involved in the response of the VCAM-1 promoter to TNF.

Two NFKB Sites Are Required for TNF Responsiveness- To determine if the NFKB sites at positions -63 and -77 bp were able to convey TNF responsiveness on a heterologous promoter, they were cloned into pTACAT, which contains the SV40 early gene minimal promoter (contains only the TATA equivalent) fused to the CAT gene (36). In transfection assays into HUVECs, these NFKB sites significantly stimulated basal expression and also were sufficient to mediate TNF responsiveness (Fig. 6). We show in Fig. 5 that deletion of the NFKB site a t position -77 bp eliminated T N F responsiveness, indicating that this site is required and that the site at position -63 bp is not sufficient for the effect. The NFKB site at position -77 bp was then cloned into pTACAT to determine if it alone could mediate T N F responsiveness. This construct was not TNF-responsive; therefore, we conclude that both NFKB sites are required for the effect (Fig. 6).

NFKB Sites at Positions -77 and -63 bp Form Different Protein Complexes-Binding of nuclear proteins to the NFKB sites was examined using gel retardation assays. Three complexes of different mobility were observed when both sites were present in the probe (Fig. 7). Competitibn with an excess of the site at position -77 bp selectively inhibited formation of complex 3, whereas competition with the site at position -63 bp selectively inhibited formation of complexes 1 and 2.

FIG. 6. Both the NFKB site at position -77 bp and the site at position -63 bp are required for TNF responsiveness in HUVECs. Both NFKB sites (positions -77 and -63 bp) or only a single site (position -77 bp) were cloned into the minimal promoter construct pTACAT (36), which contains only the SV40 early gene TATA equivalent driving the CAT gene, to determine the effect of these sites on a heterologous minimal promoter. The resulting constructs, pTA(-77/-63)CAT and pTA(-77)CAT, and the parent vector were transfected into HUVECs, and CAT activity was determined as in Fig. 5.

16328 VCAM-1 Promoter Activity Probe -77/.63

r-"%

FIG. 7. NFKB sites at positions -77 and -63 bp form different complexes with nuclear proteins. Probes containing either both NFKB sites or individual sites were used in gel retardation assays with nuclear protein extracts prepared from HUVECs that were either untreated (-) or that had been treated for 2 h with 10 ng/ml TNF (+). Approximately 2 ng of probe and 20 pg of nuclear extract were used in each assay. In competition assays, 50 ng of the indicated unlabeled competitor was included. The numbers 1-3 denote specific complexes, whereas NS denotes a nonspecific complex. The nonspecific complex was not seen with the probe containing only the position -63-bp site.

Consistent with these competition assays, the site at position -77 bp only formed complex 3, whereas the site a t position -63 bp formed predominantly complexes 1 and 2. Therefore, the two NFKB sites appear to interact with different subsets of NFKB site binding proteins.

DISCUSSION

As a first step in discerning the molecular events that control VCAM-1 expression, we have cloned and begun a characterization of the promoter for the VCAM-1 gene. Here we show that the activity of the VCAM-1 promoter determines the pattern of VCAM-1 expression and that this activity is dependent upon the interplay between silencer elements and cytokine-dependent enhancers.

Silencers located between positions -1.641 kb and -288 bp in the VCAM-1 promoter are responsible, at least in part, for preventing expression of VCAM-1 in HUVECs in the absence of inflammatory cytokines. There are at least two silencers in this region: one located between positions -1.641 and -933 bp and a second between positions -933 and -288 bp. Inter- estingly, these regions contain consensus binding sites for octamer binding proteins (positions -1554, -1180, and -729 bp). In two of these sites (positions -1554 and -1180 bp), there is a substitution of an A for the G in the consensus sequence (ATTTGCAT to ATTTACAT), which results in an element identical with that bound by MAT a2, a yeast homeobox protein that functions as a silencer (62). Additional studies are currently under way to more precisely localize and characterize the silencer elements in the VCAM-1 promoter.

In contrast to endothelial cells, VCAM-1 is constitutively expressed on lymphoid dendritic cells, bone marrow fibroblasts, and certain tissue macrophages (28-30). It is possible that constitutive expression occurs because silencer elements are not active in these cell types. In addition to these normal cells, VCAM-1 is expressed constitutively on endothelial cell lines (29), suggesting that its expression is activated during transformation. A transformation-dependent loss of silencer activity could cause constitutive expression of VCAM-1 in these cell lines. However, it is conceivable that transformation-dependent activation of VCAM-1 involves elements other than the silencers. The VCAM-1 promoter contains AP- 1, NFKB, and ets sites which are all known to be involved in cell cycle control. Therefore, a binding site for one of these

proteins could be a target for constitutive activation of the VCAM-1 promoter in transformed cells where cell cycling is aberrant.

TNF-responsiveness of the VCAM-1 promoter is dependent upon two adjacent NFKB sites at positions -77 and -63 bp. The site at position -77 bp is similar to an NFKB site identified recently in the c-myc promoter (63). The c-myc site was shown to be serum-responsive and seems to be important in activation of gene expression during the G,/G, transition. The site at position -63 bp is similar in sequence to an NFKB site in the E-selectin promoter (35). It was shown that this E-selectin promoter site binds nuclear proteins in response to TNF and it competes efficiently with other NFKB sites for binding of NFKB-like proteins. However, another group demonstrated that this site, like the site at position -63 bp in the VCAM-1 promoter, is necessary but not sufficient for TNF responsiveness of the E-selectin promoter (43).

Interestingly, the NFKB sites from the VCAM-1 promoter are not TNF-responsive in the T-cell line Jurkat even though NFKB sites from other promoters are known to be responsive to TNF in this cell line (61), suggesting that the VCAM-1 NFKB sites are cell-specific. Since a family of proteins are known to interact with NFKB sites (39, 64-66), it is conceivable that the NFKB sites in the VCAM-1 promoter bind selectively to cell-specific proteins. In support of this possibility, we show that the two VCAM-1 NFKB sites appear to interact with distinct nuclear proteins, indicating that different NFKB sites can discriminate between NFKB site binding proteins. Since both NFKB sites are required for TNF responsiveness and the two sites seem to interact with different nuclear proteins, it is also possible that the specific combination of proteins interacting with the sites could be responsible for their cell-specific activity.

Finally, the VCAM-1 promoter contains consensus binding sites for GATA binding proteins, ets, and octamer binding proteins, which are all critical for development. Furthermore, GATA-1 and ets-1 may be important in differentiation of endothelium (51,53). The presence of binding sites for developmentally specific proteins in the VCAM-1 promoter could indicate a role for VCAM-1 in development. In support of this possibility, we have found that VCAM-1 is expressed in a developmentally specific fashion in skeletal muscle where it, along with its counter receptor VLA-4, appears to play a role in muscle differentiation (67). Continuing studies with the VCAM-1 promoter should provide further insight into the mechanisms that control the intriguing pattern of VCAM-1 expression in different tissues.

REFERENCES 1. Albelda, S. M. (1991) Am. J. Respir. Cell Mol. Biol. 4, 195-203 2. Bevilacqua, M., Butcher, E., Furie, B., Furie, B., Gallatin, M., Gimbrone,

M., Harlan, J., Kishimoto, K., Lasky, L., McEver, R., Paulson, J., Rosen, S., Seed, B., Siegelman, M., Springer, T., Stoolman, L., Tedder, T., Varki,

3. Shimizu, Y., Newman, W., Gopal, T. V., Horgan, K. J., Graber, N., Beall, A., Wagner, D., Weissman, I., and Zimmerman, G. (1991) Cell 67,233

L. D., van Seventer, G. A., and Shaw, S. (1991) J. Cell Biol. 113, 1203- 1212

4. Springer, T. A., and Lasky, L. A. (1991) Nature 349,196-197 5. Osborn, L., Hession, C., Tizard, R., Vassallo, C., Luhowskyj, S., Chi-Rosso,

6. Staunton, D. E., Marlin, S. D., Stratowa, C., Dustin, M. L., and Springer,

7. Staunton, D. E., Dustin, M. L., and Springer, T. A. (1989) Nature 339,

G., and Lobb, R. (1989) Cell 59,1203-1211

T. A. (1988) Cell 52,925-933

8. Elices, M. J., Osborn, L., Takada, Y., Crouse, C., Luhowskyj, S., Hemler,

9. Hemler. M. E., Elices. M. J.. Parker, C.. and Takada, Y. (1990) Immunol.

61-64

M. E., and Lobb, R. R. (1990) Cell 60,577-584

10. 11.

12.

13.

. .

Dustin, M. L., and Springer, T. A. (1988) J. Cell Biol. 107, 321-331 Diamond, M. S., Staunton, D. E., de Fougerolles, A. R., Stacker, S. A.,

Garcia-Aguilar, J., Hibbs, M. L., and Springer, T. A. (1990) J. Cell Biol. 111,3129-3139

Bevilacqua, M. P., Pober, J. S., Mendrick, D. L., Cotran, R. S., and Gimbrone, M. J. (1987) Proc. Natl. Acad. Sei. U. S. A. 84, 9238-9242

Bevilacqua, M. P., Stengelin, S., Gimbrone, M. J., and Seed, B. (1989) Science 243, 1160-1165

Reu. 114,45-65 Reu. 114,45-65 . .

Dustin, M. L., and Springer, T. A. (1988) J. Cell Biol. 107, 321-331 Diamond, M. S., Staunton, D. E., de Fougerolles, A. R., Stacker, S. A,,

Garcia-Aguilar, J., Hibbs, M. L., and Springer, T. A. (1990) J. Cell Biol.

Bevilacqua, M. P., Pober, J. S., Mendrick, D. L., Cotran, R. S., and 111,3129-3139

Bevilacqua, M. P., Stengelin, S., Gimbrone, M. J., and Seed, B. (1989) Gimbrone, M. J. (1987) Proc. Natl. Acad. Sei. U. S. A. 84, 9238-9242

Science 243, 1160-1165

14.

15. 16. 17.

18.

19.

20.

21.

22.

23. 24.

25.

26. 27.

28.

29.

30.

31.

32.

33.

34.

35.

36. 37.

38. 39.

40.

VCAM-1 Promoter Activity 16329

Geng, J. G., Bevilacqua, M. P., Moore, K. L., McIntyre, T. M., Prescott, S. M., Kim, J. M., Bliss, G. A,, Zimmerman, G. A., and McEver, R. P.

Johnston, G. I., Cook, R. G., and McEver, R. P. (1989) Cell 56,1033-1044 (1990) Nature 343 , 757-760

Lawrence, M. B., and Springer, T. A. (1991) Cell 65,859-873 Moore, K. L., Varki, A,, and McEver, R. P. (1991) J. Cell Biol. 1 1 2 , 491-

Phillips, M. L., Nudelman, E., Gaeta, F. C., Perez, M., Singhal, A. K.,

Spertini, O., Kansas, G. S., Munro, J. M., Griffin, J. D., and Tedder, T. F.

Walz. G.. Aruffo. A.. Kolanus. W.. Bevilacaua. M.. and Seed. B. (1990)

499

Hakomori, S., and Paulson, J. C. (1990) Science 2 5 0 , 1130-1132

(1991) Nature 3 4 9 , 691-694 ~I

Science 2 5 0 , 1132-1135

Immunol. 144.4579-4586

I

Van Sevente, G. A,, Shimizu, Y., Horgan, K. J., and Shaw, S. (1990) J.

Damle, N. K., and Aruffo, A. (1991) Proc. Natl. Acad. Sci. U. S. A. 8 8 ,

Rice, G. E., and Bevilacqua, M. P. (1989) Science 2 4 6 , 1303-1306 Taichman, D. B., Cybulsky, M. I., Djaffar, I., Longenecker, B. M., Teixido,

Albelda, S. M., Mette, S. A,, Elder, D. E., Stewart, R., Darnjanovich, L., J., Rice, G. E., and Aruffo, A. (1991) Cell Regul. 2 , 347-355

Horton, A. N., and Davies, J. (1989) J. Bone Miner. Res. 4,803-808 Herlyn, M., and Buck, C. A. (1990) Cancer Res. 50,6757-6764

Feldman, L. E., Shin, K. C., Natale, R. B., and Todd, R. (1991) Cancer Res. 5 1 , 1065-1070

Freedman, A. S., Munro, J. M., Rice, G. E., Bevilacqua, M. P., Morimoto,

Science 249,1030-1033 C., McIntyre, B. W., Rhynhart, K., Pober, J. S., and Nadler, L. M. (1991)

Miyake, K., Medina, K., Ishihara, K., Kimoto, M., Auerbach, R., and

Ryan, D. H., Nuccie, B. L., Abboud, C. N., and Winslow, J. M. (1991) J. Kincade, P. W. (1991) J. Cell Biol. 114 , 557-565

Bowlus. C. L.. McQuillan, J. J.. and Dean, D. C. (1991) J. Biol. Chem. 266, Clin. Inuest. 8 8 , 995-1004

6403-6407

1122-1127

Sci. U. S. A. 88,4094-4098

S. (1987) Mol. C ~ l l . Riol. 7. 725-737

Rosen, G. D., Birkenmeier, T. M., and Dean, D. C. (1991) Proc. Natl. Acad.

de Wet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R., and Subramani,

Aviv, H., and Leder, P. (1972) Proc. Natl. Acad. Sci. U. S .A . 6 9 , 1408-

Montgomery, K. F., Oshorn, L., Hession, C., Tizard, R., Goff, D., Vassallo, 1412

C., Tarr, P. I., Bomsztyk, K., Lobb, R., Harlan, J. M., and Pohlman, T. H. (1991) Proc. Natl. Acad. Sci. U. S. A. 8 8 , 6523-6527

~". , ~~~ ."" "" ~, ".

Weintraub, S. J., and Dean, D. C. (1992) Mol. Cell. Biol. 12 , 512-517 Dignam, J. D., Lebowitz, R. M., and Roeder, R. G. (1983) Nucleic Acids

Sen, R., and Baltimore, D. (1986) Cell 46 , 705-716 Israel, A., LeBail, O., Hatat, D., Piette, J., Kieran, M., Logeat, F., Wallach,

Lowenthal, J., Ballard, D., Bogerd, N., Bohnlein, E., and Greene, W. (1989)

Res. 1 1 , 1475-1489

D., Fellous, M., and Kourilsky, P. (1989) EMBO J. 8 , 3793-3800

J. Immunol. 142, 3121-3128

41.

42. 43.

44.

45.

46.

47.

48.

49.

50.

51.

52.

53.

54.

55.

56. 57.

58.

59.

60.

61. 62. 63.

64.

65.

66.

67.

Osborn, L., Kunkel, S., and Nabel, G. (1989) Proc. Natl. Acad. Sci. U. S. A. 85. 1482-1486

Sen,R:, and Baltimore, D. (1986) Cell 47,921-928 Whelan, J., Ghersa, P., Hooft, V. H. R., Gray, J., Chandra, G., Talabot, F.,

Brenner, D. A,, O'Hara, M., Angel, P., Chojkier, M., and Karin, M. (1989) and DeLamarter, J. F. (1991) Nucleic Acids Res. 1 9 , 2645-2653

Dixit, V. M., Marks, R. M., Sarma, V., and Prochownik, E. V. (1989) J . Nature 337,661-663

Biol. Chem. 264.16905-16909 Watson, D. K., Ascione, R., and Papas, T. S. (1990) Crit. Reu. Oncog. 1,

409-436 Bhat, N. K., Fisher, R.J., Fujiwara, S., Ascione, R., and Papas, T. S. (1987)

Proc. Natl. Acad. SCL. U. S. A. 8 4 , 3161-3165 Bhat, N. K., Thompson, C. B., Lindsten, T., June, C. H., Fujiwara, S.,

Koizumi, S., Fisher, R. J., and Papas, T. S. (1990) Proc. Natl. Acad. Sci. U. S. A . 87. 1792-2797 Y I I V - Y I 1 I

zdett, LA!:,, Seth, A,, K,, Lautenberger, J. A,, and Pappas, 416-1418

Chen, Z. Q., B I T. S. (1990) science m u , I

Seth, A. K., Watson, D. K., BI Acad. Sci. U. S. A

Vandenbunder, B., Stehelin, D.;

Whitelaw, E..

Lee, M . E Biol. 10

Rir .

air, D. G., and Papas, T. S. (1989) Proc. Natl. 86,7833-7837 Pardanaud, L., Jafferedo, T., Mirabel, M. A,, and

(1989) Deuelo ment 107,265-274 rsai, S. F., d g b e n , P., and Orkin, S. H. (1990) Mol. Cell.

I. 6k96-6finfi ., Temizer, D. H., Clifford, J. A,, and Quertermous, T. (1991) J.

11. Chern. 266,16188-16192 m, D. B., Dorfman, D. M., and Orkin, S. H. (1990) Mol. Cell. Biol. 10 ,

, -1" ""

iA-ARfi? Wilsc

Joulin, V., Bories, D., Eleouet, J. F., Labastie, M. C., Chretien, S., Mattei,

Kemler, I . , and Schaffner, W. (1990) FASEB J . 4 Pierani, A., Heguy, A., Fujii, H., and Roeder, R. 1

I ._

4at. _ _ _ _ M. G., and Romeo, P. H. (1991) EMBO J. 10,1809-1816

1 n. wn4-~m5 G. (1990) Mol. Cell. Biol. , 1444-1449

Lenardo, M. J., Staudt, L., Robbins, P., Kuang, A,, Mulligan, R. C., and

Xiao, J. H., Davidson, I., Matthes, H., Gamier, J. M., and Chambon, P. Baltimore, D. (1989) Science 243 , 544-546

Cybulsky, M. I., Frles, J. W. U., Williams, A. J., Sultan, P., Eddy, R., Byers, (1991) Cell 65,551-568

M. Shows T., Gimbrone M. A., and Collins, T. (1991) Proc. Natl. Acad. Sei. U. S. A. 8 8 , 7859-7t363

- - , - - . . - - - -

Nabel, G., and Baltimore, D. (1987) Nature 326 , 711-713 Porter, S. D., and Smith, M. (1986) Nature 320 , 766-768 Baldwin, A. B., Azikhan, J. C., Jensen, D. E., Beg, A. A,, and Coodly, L. R.

(1991) Mol. Cell. Bid. 11 , 4943-4951 Ghosh, S., Gifford, A,, Riviere, L., Tempst, P., Noland, G., and Baltimore,

D. (1990) Cell 6 2 , 1019-1029 Kieren, M., Blank, V., Logeat, F., Vondekerckhove, J., Lottspeich, F.,

LeBail, O., Urban, M., Kourllsky, P., Baeurele, P., and Israel, A. (1990)

Nolan, G., Ghosh, S., Liou, H.-C., Tempst, P., and Baltimore, D. (1991) Cell 6 2 , 1007-1018

Rosen, G. D., Sanes, J. R., La Chance, R., Cunningham, J. M., Roman, J., Cell 64,961-969

and Dean, D. C. (1992) Cell, in press

Documents

Characterization of the promoter for vascular cell adhesion molecule