Chocolate coated cats: TYRP1 mutations for brown color indomestic cats

Leslie A. Lyons, Ian T. Foe, Hyung Chul Rah, Robert A. Grahn

Department of Population Health and Reproduction, School of Veterinary Medicine, University of California, Davis, 1114 Tupper Hall,Davis, California 95616, USA

Received: 19 November 2004 / Accepted: 17 February 2005

Abstract

Brown coat color phenotypes caused by mutations intyrosinase-related protein-1 (TYRP1) are recognized inmany mammals. Brown variations are also recognizedin the domestic cat, but the causative mutations areunknown. In cats, Brown, B, has a suggested allelicseries, B > b > bl. The B allele is normal wild-type blackcoloration. Cats with the brown variation genotypes,bb or bbl, are supposedly phenotypically chocolate(aka chestnut) and the light brown genotype, blbl, aresupposedly phenotypically cinnamon (aka red). Thecomplete coding sequence of feline TYRP1 and aportion of the 5¢ UTR was analyzed by directsequencing of genomic DNA of wild-type and browncolor variant cats. Sixteen single nucleotide poly-morphisms (SNPs) were identified. Eight SNPs werein the coding regions, six are silent mutations. Twoexon 2 on mutations cause amino acid changes. The Cto T nonsense mutation at position 298 causes anarginine at amino acid 100 to be replaced by the opal(UGA) stop codon. This mutation is consistent withthe cinnamon phenotype and is the putative lightbrown, bl, mutation. An intron 6 mutation thatpotentially disrupts the exon 6 downstream splice-donor recognition site is associated with the chocolatephenotype and is the putative brown, b, mutation.The allelic series was confirmed by segregation andsequence analyses. Three microsatellite makers hadsignificant linkage to the brown phenotype and twofor the TYRP1 mutations in a 60-member pedigree.These mutations could be used to identify carriers ofbrown phenotypes in the domestic cat.

Brown coat color phenotypes have been recognizedin the domestic cat for over 100 years (CFA 1993).

The cat locus for the brown phenotypes was origi-nally designated as Brown, B, which followsnomenclature for the mouse. Domestic cats have asuggested allelic series, B > b > bl (Robinson 1977).The wild-type black (B) allele is dominant withnormal, black (eumelanin) coloration. Cats with abrown (b) allele, either bb or bbl genotypes, arechocolate (aka chestnut), and the phenotype result-ing from light brown homozygotes, blbl, are cinna-mon (aka red). Several of the oldest and founding catbreeds, such as Abyssinians and Siamese, segregatefor brown variants but neither the segregation northe allelic series of the brown color variants has beendocumented in a peer-reviewed journal for thedomestic cat.

Tyrosinase-related protein-1 (TYRP1) is the geneassigned to the B locus (Jackson 1988). The Tyrp1enzyme has been shown to be involved in the syn-thesis of the eumelanin pigment (Jimenez–Cervanteset al. 1994; Kobayashi et al. 1994). As shown in mice,brown fur has 30%–40% less eumelanin content thanwild-type black fur (Tamate et al. 1989; Hirobe et al.1998). Brown phenotypes resulting from mutationsin tyrosinase-related protein-1 (TYRP1) have beenrecognized in several species such as mice (Jackson1988; Javerzat and Jackson 1998), cattle (Berryereet al. 2003), and dogs (Schmutz et al. 2002). However,some brown phenotypes of other cattle breeds(Adalsteinsson et al. 1995) and horses (Rieder et al.2001) are non-TYRP1-related.

Because of the involvement of TYRP1 in melaninsynthesis and since mutations in other species causesimilar brown phenotypes, TYRP1 was investigatedas a candidate gene for the brown phenotypes in thedomestic cat. Presented are both linkage analysesand sequence analyses that associate TYRP1 muta-tions with feline brown color variants. Breeding andsequencing data also support the historically sug-gested allelic series.Correspondence to: Leslie. A. Lyons; E-mail: lalyons@ucdavis.edu

356 DOI: 10.1007/s00335-004-2455-4 � Volume 16, 356–366 (2005) � � Springer Science+Business Media, Inc. 2005

Materials and methods

Sample collection and DNA preparation. Domes-tic cat breed samples were collected as previouslydescribed (Lyons et al. 2005). Phenotypes were veri-fied by visual inspection, pedigrees, and photo-graphs. DNA was isolated from buccal swabs aspreviously described (Young et al. 2005). DNA wasextracted from white cell preparations from wholeblood by standard phenol/chloroform extractions(Sambrook and Russell 2001).

Pedigree and linkage analysis. Whole-bloodDNA samples were collected from cats that formed a60-member multigenerational pedigree that segre-gates for the chocolate coat color phenotype (Fig. 1).Phenotypes were confirmed by visual inspection.The relationship of the cats was verified by parent-age testing using 19 microsatellites markers of astandardized feline parentage identification panelfollowing the procedures of Lyons (in preparation,

data not shown). Based on chromosome homology tohumans, seven microsatellites (FCA030, FCA119,FCA242, FCA641, FCA742, FCA743, and FCA744)that are within the potential region for TYRP1 on catChromosome D4 (Menotti–Raymond et al. 2003a, b)were analyzed in the cat pedigree as previously de-scribed (Grahn et al. 2004). Allele frequencies weredetermined from the unrelated cats of the pedigreeby direct counting. The chocolate phenotype wasexamined as an autosomal recessive locus withcomplete penetrance using LINKAGE software(Lathrop et al. 1984).

Pedigree records from registered Abyssinian catswere analyzed to confirm the inheritance andsegregation of the light brown (aka cinnamon or red)allele.

PCR and exon-based primer design. To gener-ate TYRP1 exon sequence, eight internal exon primerpairs were designed from publicly available sequences

Fig. 1. Pedigree segregating for TYRP1 ‘‘chocolate’’ and wild-type ‘‘black’’ alleles in Persian cats. Circles represent females,squares represent males, open symbols indicate wild-type black animals, solid symbols indicate brown cats. A diamond isa cat of unknown sex. Symbols with ‘‘?’’ have unknown phenotypes. Numbers in bold represent the laboratory samplenumber. Genotype haplotypes are drawn for each cat in the order: TYRP1 SNP, FCA742, FCA743, FCA119. The ‘‘1’’ allelerepresents the wild-type SNPs and the ‘‘2’’ allele represents the brown-associated SNPs. An ‘‘R’’ identifies recombinantindividuals between the phenotype and haplotype to the markers.

L.A. LYONS ET AL.: CAT BROWN MUTATION IN TYRP1 357

in GenBank (http://www.ncbi.nlm.nih.gov/Genbank/index.html) from human (NM_000550), dog(AY052751), mouse (NM_031202), and goat(AF136926). These sequences were compared for re-gions of high homology using Megalign software(DNASTAR, Madison, WI). The 3¢ region of exon 8 hadpoor cross-species homology, thus the reverse primerfor exon 8 was developed from human sequence only.Primers pairs were designed and optimized for use inthe cat as previously described (Lyons et al. 1997).Generated PCR products were amplified and verifiedby sequence analyses as previously described (Lyonset al. 2005).

XL PCR and intron-based primer design. Theexon-based primers were used in different combina-tions to amplify the exonic and intronic sequences ofTYRP1 by extra-long PCR using DNA from a TYRP1-containing BAC clone and a MasterAmp Extra-LongPCR Kit (Epicentre Technologies, Madison, WI). TheTYRP1 BAC clone was isolated from the RPCI–86BAC library (BACPAC Resources, CHORI, Oakland,CA) using oligo screening following the manufac-turer�s recommendations and as previously described(McPherson et al. 2001). The ‘‘overgo’’ primer used toidentify the BAC clone was TYRP1-Ovatcaccctcagtttgtcattgccac; TYRP1-Ovb tttcttctgacctcctggtggcaat. Long PCR reactions were performed

according to manufacturer�s suggestions. The XLPCR products of the introns were cloned using theTOPO TA Cloning Kit (Invitrogen, Carlsbad, CA).The plasmids were directly sequenced using themanufacturer�s primers and sequence verified as de-scribed (Lyons et al. 2005). New exon-specific prim-ers were designed from generated feline sequence andwere placed approximately 100 bp from each exon–intron boundary, within the flanking introns of eachexon. For the introns that could not be amplified byXL PCR, introns 1, 3, and 6, primers were developedfrom dog sequence available through the Universityof California, Santa Cruz genome browser (http://www.genome.ucsc.edu/). The intron-based primerpairs (Table 1) were then optimized and the sequenceconfirmed as described above.

Brown mutation screening. Two cats repre-senting each brown phenotype, wild-type black,chocolate, and cinnamon, were sequenced for thecomplete coding region, portions of the 5¢ untrans-lated region (UTR), and introns to identify potentialSNPs conferring phenotypic changes. The sequencesfrom the different phenotypes were then comparedusing the Sequencher program (GeneCodes, AnnArbor, MI). Once putative SNPs were identified, theTYRP1 exons containing the SNPs were amplifiedfrom genomic DNA of cats with the appropriate

Table 1. Primer sequences and accession numbers for domestic cat TYRP1

TYRP1exon

Exonsize

PCR productsize

5¢–3¢ Forward primerReverse primer

GenBank Accession(wt, b¢, b)

1 30 171 AGCAGAAACCCACATGCAATCCCATCCTAATGGAGTTTTGG

AY804218AY804226AY804234

2 470 638 GAAGGGCTCATGCCTGTTTAa

TCCAGATGTGCTTCCAGTTCAAY804219AY804227AY804235

3 323 417 GTGGCACATTTTCACGTTTGACCAAACGATCCACCTTGTCT

AY804220AY804228AY804236

4 205 642 AGCAAAGGGGGAGAATTTTACGGCGTATTTCAGATTTCCT

AY804221AY804229AY804237

5 172 369 TGGCTTCCAAAGATGTTTCACCAGGGAGAACCTATCTTTCAGT

AY804222AY804230AY804238

6 173 318 CCCGATATAATCGCTGCTGTCTTGCTGAGCCTGCAAAAa

AY804223AY804231AY804239

7 147 256 AACAAGATGTCTTTGGCATATTTGCCTCAGAATACTGTCATTACCT

AY804224AY804232AY804240

8 1273 319 GCTGATTTTTGGTGGCAACTTCAACCAGGTGGTTTTGTGTGA

AY804225AY804233AY804241

aPrimers based on dog sequence.

358 L.A. LYONS ET AL.: CAT BROWN MUTATION IN TYRP1

Table 2. TYRP1 genotypes for cats of wild-type and brown phenotypes

Exon or intron nucleotide site

2 2 2 3 3 I3 4 4 I4 I4 I4 I4 I4 I6 7Breed Color 8 92 298 630 645 13 873 876 71 130 158 176 )74 5 1305

Wild-type C T C A C T G C C T T C C G T

Domestic SH Orange C T C A C T G C C T T C C G TDomestic SH Tabby & white C T C G C C T T C GDomestic SH Unknown C Y C G C C T T C GDomestic SH Orange C C C G C C T T C GDomestic SH Grey C Y C G C C T T C GDomestic SH Black C T C G C C T T C GDomestic SH Seal Point C C C G C C T T C GDomestic SH Black C Y C G C C T T C GDomestic SH Orange C T C G C C T T C GDomestic SH Calico G C C T T CDomestic SH Brown tabby G C C T T CDomestic SH Cream tabby G C C T T CAbyssinian Blue C T C A C T G C C T T C C G TAbyssinian Blue (2) C T C G C C T T CChartreux Blue A C TKorat Blue A C T G C C T T CMunchkin Black smoke A C T G C C T T CMunchkin Silver spotted A C T G C C T T CMunchkin Brown mackerel A C T G C C T T CMunchkin Black tortoise A C TRagdoll Seal Point A C G C C T T C GRussian Blue Blue (5) A C TSingapura Sepia (3) A C T

Cinnamon C T T A C T G C C T T C C G T

Abyssinian Red C T T A C T G C C T T C C G TAbyssinian Red (3) C T T G C C T T C GAbyssinian Fawn C T T G C C T T C GMunchkin Cinnamon C T T G C C T T C GOcicat Cinnamon spot G C C A T T C G TOriental SH Cinnamon C T TSomali Fawn C T T A C T G C C T T C GSomali Fawn silver C T T G C C T T C G

Chocolate G C C G T C A T T C G T G A C

Balinese Chocolate point G C C A T T C G T ABirman Chocolate point G T C A T T C G TBurmese Chocolate (2) G T C A T T C G TBurmese Brown G T C A T T C G TBurmese Blue (2) G T C A T T C G TDomestic SH Brown G T C A T T C G TDomestic SH Brown G T CHavana G T C G CBrown Brown G C C A T T C G T AHavanaBrown Brown (5) G C C A T T C G T AJavanese Chocolate point G C C A T T C G T AKorat Blue (3) G C C A T T C G T AKorat Blue G C C G T C A T T C G TOcicat Chocolate spotted G C C A T T C G T AOriental SH Chocolate G C C A T T C G T AOriental SH Chestnut G T CPersian Chocolate point G C C A T T C G T APersian Chocolate G C C G T C A T T C G T G A CPersian White G C C A T T C G T APeterbald Chocolate G C C A T T C G T ATonkinese Champagne G T C A T T C G T

(Continued)

L.A. LYONS ET AL.: CAT BROWN MUTATION IN TYRP1 359

phenotypes using the optimal PCR condition thatwas consistent for all primers, 1.5 mM Mg2+ at 56�C.DNA samples were analyzed for 11–16 SNPs from 9random-bred cats and 31 cats representing 11 breeds(Table 2). Additionally, 10 or less of the SNP geno-types for a variety of other cats were determined andare presented in Table 2. The cat breeds representedindividuals from the United States, England, Europe,and Australia. Overall, 75 cats representing 19 breedswere genotyped for different combinations of theSNPs.

Results

Pedigree and linkage analyses. The linkage analy-ses among seven microsatellites, the chocolate phe-notype, and an exon 4 SNP haplotype suggestedsignificant linkage. TYRP1 SNP and microsatellitedata were available for all cats; phenotypic data wereavailable for only 49 cats because some kittens hadnot yet developed their point-restricted coloration.The TYRP1 exon 4 mutations were completelyconcordant with the chocolate phenotype (Z = 4.05,h = 0.0). Three markers (FCA742, FCA743, andFCA119) suggested linkage to the brown phenotype(Z = 4.02, 4.02, 3.11, all at h = 0.0, respectively).Markers FCA742 and FCA743 also suggested linkageto the TYRP1 SNPs (Z = 3.96 at h = 0.14, for bothmarkers), although recombinants could be detected.The other five markers were not statistically signif-icant or did not suggest tight linkage. The linkagedata and the identified recombinants between theSNP haplotype and the three linked microsatellitemarkers are presented in Fig. 1.

An informal segregation analysis of 30 Abyssin-ian cats segregating for the cinnamon mutation wasconducted using pedigrees from one Abyssinian catbreeder. The segregation ratios for all mating types of

cats with the ruddy (wild-type black) and red (cin-namon, light brown) phenotype are consistent withan autosomal recessive inheritance that is allelic towild-type black. All red-to-red Abyssinian breedingsproduced all red cats (N = 10). The ruddy heterozy-gous · homozygous red mating has produced 65% redcats, but deviation from expected Hardy–Weinbergsegregation ratios was not significant as determinedwith a chi-squared analysis with one degree of free-dom (p > 0.15). No gender bias was observed (p >0.53).

Feline TYRP1. The intron-based primers devel-oped for each TYRP1 exon, product sizes, and Gen-Bank Accession numbers are presented in Table 1.The entire coding sequence of the feline TYRP1 geneand partial sequence of the 5¢ UTR and introns II –VII were analyzed. The complete coding sequence forfeline TYRP1 and partial intron sequence, as se-quenced from genomic DNA, is available as Sup-plemental Fig. 1. Feline sequence features werebased on human TYRP1. Human sequence featureswas obtained from the Ensembl database (http://www.ensembl.org/). The feline TYRP1 sequence is1725 bp, of which 1614 bp codes for a 537-amino-acid Tyrp1 protein in the domestic cat. The con-sensus feline sequence has an 88% nucleotide iden-tity to the human sequence. The dog sequence has a90% nucleotide identity to cat, while mouse and goatsequences are 84% and 88% identical to cat, respec-tively.

Figure 2 presents the amino acid translation forthe domestic cat and the alignment to other species.At the protein level, the cat TYRP1 has 88%homology in amino acid sequence to human TYRP1,the dog sequence has 92% homology to cat, while themouse and goat have homologies of 83% and 87%,respectively.

Table 2. Continued

Exon or intron nucleotide site

2 2 2 3 3 I3 4 4 I4 I4 I4 I4 I4 I6 7Breed Color 8 92 298 630 645 13 873 876 71 130 158 176 )74 5 1305

Heterozygotes

Munchkin Lilac S Y Y R Y Y R Y Y Y K Y RMunchkin Silver spotted R Y Y R Y Y Y KOriental SH Ebony silver C Y C G C C T T C C GPersiana Black S Y C R Y Y R Y Y Y K Y S RSomali Chocolate silver S Y Y R Y Y Y K Y RSomali Blue R Y YSphynx Blue R Y Y

Heterozygous individuals follow IUPAC nomenclature (Y = C or T, S = G or C, R = A or G, K = G or T).Bold entries represent the haplotypes for each phenotype. Introns are represented in italics. The SNP in the 5¢ UTR was identified in onlyone Korat, thus is not presented.aPersian cat proven as brown carrier from breeding.

360 L.A. LYONS ET AL.: CAT BROWN MUTATION IN TYRP1

L.A. LYONS ET AL.: CAT BROWN MUTATION IN TYRP1 361

TYRP1 mutations. Sixteen single nucleotidepolymorphism (SNPs) were identified in the felineTYRP1 sequence, eight were within the coding re-

gion and the positions are presented in Table 2. Theonly two SNPs that result in amino acid changes arein exon 2. One polymorphism causes a minor amino

Fig. 2. Protein alignment of coding sequence from TYRP1. Alignment of the 537 amino acid translation for TYRP1 be-tween human (Hsap, NM_000550.1), mouse (Mmus, X03687.1), dog (Cfam, AY052751.3), and an orange cat (Fcat wt), acinnamon cat (Fcat Cinn), and a chocolate cat (Feat Choc). Bold text indicates sites of feline phenotype sequence variants.The cinnamon phenotype has a variant at position 100 that results in a premature stop codon, while the chocolatephenotype has a variant at position 3. For the chocolate cat, exon 6 is underlined, indicating that this exon may be skipped.The possible translation of the known intron 6 sequence is provided should intron inclusion result from the intron 6mutation. The 3¢portion of the sequence is unknown and represented as question marks. The Cfam fragment is missingthe terminal 36 amino acids that are indicated by dashes.

362 L.A. LYONS ET AL.: CAT BROWN MUTATION IN TYRP1

acid change in exon 2. The C to G transversion atposition 8 causes the incorporation of glycine in-stead of alanine at amino acid position 3 of thecoding sequence, A3G (Fig. 2). This polymorphism iscorrelated with the chocolate phenotype and is partof the haplotype consistent with chocolate cats(Table 2). One C to T transition is in the 5¢ UTR,50 bp upstream of the translation start codon, and isfound in only one cat, a Korat. The locations of theother seven mutations in the noncoding region arepresented in Table 2.

Putative brown mutations. Common brownvariant phenotypes of the domestic cat are presentedin Fig. 3. The C to T transition at position 298 re-places an arginine at amino acid 100 with the opal(UGA) stop codon, R100OPA. This premature stopin exon 2 is concordant in nine cats from four dif-ferent breeds with the chestnut, cinnamon, fawn,and red phenotypes that are considered light brown,bl. No cats (N = 32) representing nine different

breeds with the brown or wild-type black pheno-types had this stop mutation (Table 2). One Ocicatwith reported cinnamon silver coloration did nothave the stop mutation.

The SNP in intron VI is within 5 bp of the exon 6boundary, disrupting the highly conserved ‘‘G’’ inposition 5 of the exon 6 downstream splice-donorrecognition signal. Additionally, all SNPs, except forthe exon 2 site that causes the R100OPA, are con-cordant with the chocolate phenotype and form aconsistent haplotype in nine cat breeds (Table 2).These mutations are unique and homozygous in allthe chocolate cats analyzed (N = 28). Eighteen choc-olate cats were typed for the extended haplotype(Table 2). This haplotype is distinct from the exon 2stop mutation found for the cinnamon phenotype.The stop mutation found in cinnamon (red) cats has ahaplotype consistent with the wild-type black allele.Ten cats with chocolate phenotypes were typed foronly the exon 2 or exon 4 mutations and were allconsistent with the brown haplotype, which extends

Fig. 3. Brown phenotypes of the domestic cat. a. Brown (bb) in a chocolate Exotic Shorthair (left), and light brown (bl bl) in ared (aka cinnamon) Abyssinian (right). b. Black (B-) in a wild-type brown tabby domestic shorthair (left) and wild-typeblack domestic shorthair (right). [Supplemental Fig. 1. Sequence alignment of domestic cat TYRP1 to other species.Messenger RNA, 1611 bp, from human (Hsap, Accession No. NM_000550.1), mouse (Mmus Accession No. X03687.1), anddog (Cfam Accession No. AY052751.3) and genomic sequence data from domestic cats; orange (wt), cinnamon (Cinn), andchocolate (Choc) from domestic cat (Fcat) are aligned. Arrows (fl) and bold text indicate sites of feline phenotype sequencevariants. The cinnamon (light brown, bl) phenotype has a single sequence variant at coding position 298 (597 above) thatresults in a premature stop codon. The brown phenotype has 7 coding sequence variants of which only the C to Gtransversion at coding position 8 (307 above) results in an amino acid change. The additional seven noncoding sequencevariants are also indicated. The Cfam mRNA fragment is missing the terminal 108 bp. The untranslated regions of exons 1and 2 and flanking intron sequence (lower case) for each exon are provided for the cat.

L.A. LYONS ET AL.: CAT BROWN MUTATION IN TYRP1 363

the list of breeds to 11 that all have the same choc-olate haplotype. Five cats with the dominant blackphenotype are heterozygous for several SNPs in thebrown haplotype. Two cats, a lilac Munchkin and achocolate silver Somali, are heterozygous for the stopmutation and the SNPs associated with chocolate.

Discussion

Brown coat color variations have been recognized ina variety of domestic cat breeds and wild felids. Twoloci in the cat mimic brown coloration. The wild-type brown tabby cat has only black and yellowpigmentation; the brown phenotype is the result ofthe optical illusion of agouti fur, and a temperature-sensitive allele of tyrosinase, TYR, termed burmese,cb, produces a brown or sable appearance to the coatfor a genetically black cat.

Three alleles are suspected in truly brown-col-ored cats, normal black pigmentation (B), the brownphenotype (b), and a lighter brown phenotype (bl).The analysis of an extended pedigree segregating forchocolate confirms that the phenotype is allelic toblack. Analyses of Abyssinian pedigrees segregatingfor light brown (aka cinnamon or red in Abyssinians)suggests that light brown is also allelic to black,supporting and documenting the allelic series B > b >bl.

The linkage analyses supported TYRP1 as thecandidate gene for the cat brown phenotypes. Thisanalysis suggested that TYRP1 is telomeric on catChromosome D4, which is consistent with sus-pected homologies between humans and cats.

The light brown or cinnamon phenotype in thecat is concordant with a stop mutation in exon 2 thathas been identified in all breeds with light browncolor variants. The only difference between thecinnamon and wild-type black alleles is the singlenucleotide that causes the translation stop site. Allother breeds with the same phenotype had theidentical stop mutation, suggesting the phenotype iscaused by the same mutation that is identical bydescent across these breeds. One cat that was des-ignated a cinnamon Ocicat did not have the stopmutation. This suggests that the Ocicat phenotypecould caused by a different mutation in TYRP1 or bya mutation in a different gene. A more likely expla-nation is that the use of the same phenotypicdescription—cinnamon—for light brown variants indifferent breeds of cats could be misleading. Sincesome combinations of color alleles epistaticallyinfluence brown coloration, the cinnamon designa-tion for this cat could be erroneous.

The brown phenotype in the chocolate (akachestnut) cat is associated with a mutation in intron

6 that likely disrupts the splice-donor downstream ofexon 6. This alteration could allow exon skipping andthe removal of exon 6 from the mRNA. Although ararer event than exon skipping (O�Neill et al. 1998),intron inclusion due to the presence of a crypticsplice site in intron 6 may also occur, allowing pro-tein translation to continue into intron 6. The pro-tein translation up to the end of the availablesequence does not create a stop codon; however, thiscould occur downstream. Additionally, if introninclusion occurs and shifts the reading frame, stopcodons would be encountered early in exon 7, con-sidering either reading frame. Similar mutations havebeen noted in other genes that cause disease (Nich-olls et al. 1996; O�Neill et al. 1998). Analysis of themRNA sequence and expression levels would sup-port and clarify the effects of the intron 6 mutation.

The exon 2 nonsense mutation and several silentmutations found throughout the gene form a con-sistent haplotype in all chocolate cats. Interestingly,these mutations all occur on the same allele that hasnot been identified in nonchocolate cats. Unexpect-edly the Korat cat breed had the chocolate allele.Korats are accepted in only one color, blue, that isconsidered a dilution of black. However, there arevarious shades of blue (aka gray) and the data suggestthat Korats may actually be fixed for chocolate anddilution, although the intron 6 mutation still needsto be genotyped in these cats. The analysis of moreKorats and other breeds fixed for blue, such as Rus-sian Blues and Chartreux, would support this con-clusion. In addition, further analyses in a widervariety of cats may show disruption of the chocolatehaplotype.

Five cats that have wild-type phenotypes areheterozygous for the wild-type and chocolate alleles,and two cats with the chocolate phenotype are likelyto be heterozygous for the chocolate and red muta-tions. These data show that wild-type is dominant tochocolate and chocolate is a dominant allele to red,further supporting the allelic series for brown in cats.

None of the currently identified brown muta-tions are identical between cats, mice, dogs, andhumans, including the mutation in humans thatcauses oculocutaneous albinism 3 (OCA3). TheOCA3 is a single-base-pair deletion in exon 6 thatleads to a downstream stop codon. The TYRP1mutations in the cat are associated with differentshades of brown, which is also true in the mouse.The three mutations identified in dog TYRP1 areassociated with brown phenotypes from differentbreeds; however, the brown phenotype across thebreeds appears to be the same shade of brown.

In the United States, there are approximately 50cat breeds, some of which are hybrids with wildcat

364 L.A. LYONS ET AL.: CAT BROWN MUTATION IN TYRP1

species and long-haired and short-haired varieties ofthe same breed. Not all breeds or colors are acceptedby different cat fancier organizations but basicallythere are two breeds (Havana Brown and Singapura)that are fixed for brown (chocolate) and six breeds(Abysinnian, Devon Rex, Ocicat, Oriental, Somali,and Sphynx) that segregate for the light brown (cin-namon) allele. The different breeds use differentterms for the brown coloration including brown,chestnut, chocolate, champagne, and lilac. Lilac andchampagne are brown variants associated with otherepistatic color genes such as tyrosinase and dilution.Cinnamon or red is generally recognized as the lightbrown allele, bl. Fawn and platinum are dilutions oflight brown. However, the variations in pigmentintensity caused by the environment, dilution fac-tors of other genes, point-restriction, and minorpolygenic effects make distinguishing the phenotypeof brown present in a cat challenging for breeders.

The fear of undesirable traits, such as particularcolor variants and diseases, quenches the enthusi-asm for opening stud books and allowing the out-crossing of many domestic breeds. Many new breedshave a very limited population size, thus, the eradi-cation of cats that have only a single allele that isundesirable could be very detrimental to the geneticdiversity of the population. Genetic testing for someof the undesirable traits can alleviate some of thesefears and can promote better genetic diversity, in-creased heterozygosity, and hence possibly enhanc-ing the health of our companion animal breeds.Thus, if adopted as genetic tests for color, thesemutations can improve the efficiency of breedingprograms for a variety of breeds.

Acknowledgments

We appreciate the assistance of the cat breeders fromthroughout the world for providing samples, catshow managers for allowing the collection of sam-ples at various cat shows, and UC Davis veterinarystudent Amanda Payne–deVega for collection ofrandom-bred cat samples. Technical assistance forthe project was provided by Mark T. Ruhe and Car-olyn A. Erdman. Funding for this project was pro-vided to L. A. Lyons from NIH-NCRR R24RR016094 and a UC Davis faculty research grant andto A. Payne–deVega by the UC Davis School ofVeterinary Medicine Students Training in AdvancedResearch (STAR) program. We acknowledge theNational Cancer Institute for allocation of comput-ing time and staff support at the Advanced Biomed-ical Computing Center of the Frederick CancerResearch and Development Center. The UC Davisfeline research colony cats are bred under Animal

Care and Use Protocol 10390. Food for the cat colonywas gratefully provided by Royal Canin.

References

1. Adalsteinsson S, Bjarnadottir S, Vage DI, JonmundssonJV (1995) Brown coat color in Icelandic cattle producedby the loci Extension and Agouti. J Hered 86(5), 395–398

2. Berryere TG, Schmutz SM, Schimpf RJ, Cowan CM,Potter J (2003) TYRP1 is associated with dun coatcolour in Dexter cattle or how now brown cow? AnimGenet 34(3), 169–175

3. CFA (1993) The Cat Fanciers�Association Cat Ency-clopedia (New York: Simon & Schuster), pp 128–136

4. Grahn RA, Biller DS, Young AE, Roe BA, Qin B, et al.(2004) Genetic testing for feline polycystic kidneydisease. Anim Genet 35(6), 503–504

5. Hirobe T, Wakamatsu K, Ito S (1998) Effects of genicsubstitution at the agouti, brown, albino, dilute, andpink-eyed dilution loci on the proliferation and dif-ferentiation of mouse epidermal melanocytes in ser-um-free culture. Eur J Cell Biol 75(2), 184–191

6. Jackson IJ (1988) A cDNA encoding tyrosinase-relatedprotein maps to the mouse brown locus. Proc NatlAcad Sci USA 85(12), 4391–4396

7. Javerzat S, Jackson IJ (1998) White-based brown(TYRP1B-w) is a dominant mutation causing reducedhair pigmentation owing to a chromosomal inversion.Mamm Genome 9(6), 469–471

8. Jimenez–Cervantes C, Solano F, Kobayashi T, UrabeK, Hearing VJ, et al. (1994) A new enzymatic functionin the melanogenic pathway: The 5,6-dihydroxyin-dole-2-carboxylic acid oxidase activity of tyrosinase-related protein-1 (TYRP1). J Biol Chem 269(27),17993–18000

9. Kobayashi T, Urabe K, Winder A, Tsukamoto K,Brewington T, et al. (1994) DHICA oxidase activity ofTYRP1 and interactions with other melanogenic en-zymes. Pigment Cell Res 7(4), 227–234

10. Lathrop GM, Lalouel JM, Julier C, Ott J (1984) Strate-gies for multilocus linkage analysis in humans. ProcNat Acad Sci USA 81(11), 3443–3446

11. Lyons LA, Laughlin TF, Copeland NG, Jenkins NA,Womack JE, et al. (1997) Comparative anchor taggedsequences (CATS) for integrative mapping of mam-malian genomes. Nat Genet 15(1), 47–56

12. Lyons LA, Imes DL, Rah HC, Grahn RA (2005) Tyrosi-nase mutations associated with Siamese and Burmesepatternsinthedomesticcat (Feliscatus).AnimGenet (inpress) 36:119–26

13. McPherson JD, Marra M, Hillier L, Waterston RH,Chinwalla A, et al. (2001) A physical map of the hu-man genome. Nature 409(6822), 934–941

14. Menotti–Raymond M, David VA, Agarwala R, SchafferAA, Stephens R, et al. (2003a) Radiation hybrid map-ping of 304 novel microsatellites in the domestic catgenome. Cytogenet Genome Res 102(1–4), 272–276

15. Menotti–Raymond M, David VA, Roelke ME, ChenZQ, Menotti KA, et al. (2003b) Second-generation

L.A. LYONS ET AL.: CAT BROWN MUTATION IN TYRP1 365

integrated genetic linkage/radiation hybrid maps ofthe domestic cat (Felis catus). J Hered 94(1), 95–106

16. Nicholls AC, Oliver J, McCarron S, Winter GB, PopeFM (1996) Splice site mutation causing deletion ofexon 21 sequences from the pro alpha 2(I) chain of typeI collagen in a patient with severe dentinogenesis im-perfecta but very mild osteogenesis imperfecta. HumMutat 7(3), 219–227

17. O�Neill JP, Rogan PK, Cariello N, Nicklas JA (1998)Mutations that alter RNA splicing of the humanHPRT gene: a review of the spectrum. Mutat Res411(3), 179–214

18. Rieder S, Taourit S, Mariat D, Langlois B, Guerin G(2001) Mutations in the agouti (ASIP), the extension(MC1R), and the brown (TYRP1) loci and their asso-ciation to coat color phenotypes in horses (Equus ca-ballus). Mamm Genome 12(6), 450–455

19. Robinson R (1977) Genetics for cat breeders, 2nd ed.(New York: Pergamon Press), pp 108–109

20. Sambrook J, Russell DW (2001) Molecular cloning: ALaboratory Manual, 3rd ed. (New York: Cold SpringHarbor Press), pp 611–1614

21. Schmutz SM, Berryere TG, Goldfinch AD (2002)TYRP1 and MC1R genotypes and their effects on coatcolor in dogs. Mamm Genome 13(7), 380–387

22. Tamate HB, Hirobe T, Wakamatsu K, Ito S, ShibaharaS, et al. (1989) Levels of tyrosinase and its mRNA incoat-color mutants of C57BL/10 J congenic mice: ef-fects of genie substitution at the agouti, brown, albi-no, dilute, and pink-eyed dilution loci. J Exp Zool250(3), 304–311

23. Young A, Biller D, Herrgesell E, Roberts H, Lyons L(2005) Feline polycystic kidney disease linkage to thePKD1 region. Mamm Genome 16(1), 59–65

366 L.A. LYONS ET AL.: CAT BROWN MUTATION IN TYRP1