Chromatin assembly factor CAF-1 represses priming of plant ... · Chromatin assembly factor CAF-1 represses priming of plant defence response genes ... (50 mM Tris-Cl pH8, 10 mM NaCl,

SUPPLEMENTARY INFORMATIONDOI: 10.1038/NPLANTS.2015.127

NATURE PLANTS | www.nature.com/natureplants 1

1

Chromatin assembly factor CAF-1 represses priming of plant defence response genes

Mozgová, Wildhaber et al.

Supplementary Information

Supplementary methods

Plant growth conditions Seeds were surface sterilized using 70% ethanol and 5% sodium hypochlorite and plants were grown on ½ strength Murashige & Skoog (MS) medium (Basal salts incl. vitamins - Duchefa) supplemented with 0.8% agar where applicable. Seeds were stratified for 48 hrs at 4°C in the dark, plants were grown at long day (LD) conditions (16 hrs light 100 µmoles m-2 s-1, 8 hrs dark), 22°C. Plants used for microarray experiments were grown under short day (SD) conditions (8 hrs light 100 µmoles m-2 s-1, 16 hrs dark), 22 °C. For ChIP, Mnase assays and gene expression studies, Col and fas2 seedlings were grown vertically on ½ MS plates with filter paper for 7 days at LD. Fas2 and control Col seedlings were left to grow for an additional day under the same conditions. Col seedlings from the remaining plates were transferred to liquid ½ MS without (mock) or with 100 µM SA or 100 µM BABA and incubated under the same LD conditions for 24 hrs. Final concentrations of SA and BABA used for treatments were selected after testing concentrations of 25, 50, 100 and 200 µM. Treated and untreated 8-day Col and fas2 seedlings were collected for RNA isolation or crosslinked for nuclei isolation as described further. Subsets of seedlings from all individual samples were kept and treated with 50 µM SA in liquid ½ MS for 4, 8 and 12 hrs to test the dynamics of PR1 induction by RT-qPCR. The effect of BTH on phenotype was tested by pre-growing Col and fas2 G2 plants on ½ MS plates with or without BTH. Concentrations in the range 5 - 100 µM BTH were tested and 25 µM was the highest that allowed plant survival. 20 µM BTH was used in plates to pre-grow plants for 3 weeks at LD. Plants were transferred to soil, grown for 3 more weeks at LD and phenotypes were scored.

Plant phenotype measurements For measuring leaf area, leaf number 4 was scanned after bolting. Images were analysed using ImageJ. The juvenile-adult phase transition was determined by counting rosette leaves without trichomes emerging on the abaxial (lower) surface 1. 14 – 30 plants per genotype were scored in each experiment. Each experiment was repeated at least twice.

Microarray analysisRibosomal RNA was depleted using RiboMinus Plant Kit (Life Technologies) according to the manufacturer´s instructions. RNA was labelled using the GeneChip WT Sense Target Labeling Assay according to the manufacturer’s protocol and hybridized onto Affymetrix

Chromatin assembly factor CAF-1 represses priming of plant defence response genes

Mozgová, Wildhaber et al

http://dx.doi.org/10.1038/nplants.2015.127

2 NATURE PLANTS | www.nature.com/natureplants

SUPPLEMENTARY INFORMATION DOI: 10.1038/NPLANTS.2015.127

2

AGRONOMICS1 Arabidopsis tiling arrays as described 2. Arrays were then washed using an Affymetrix Fluidics Station 450, and signals were measured using an Affymetrix GeneChip Scanner 3000. Data were normalized and analysed as described 2, based on TAIR10 annotations (http://www.arabidopsis.org). Differential expression was tested with LIMMA 3

and multiple testing correction according to 4. Genes were considered to be differentially expressed when p < 0.05 and fold change > 1.5.

Nucleosome occupancy micrococcal nuclease (MNase) assay Nucleosome occupancy was determined using SA-primed and non-primed Col-0 and non-primed fas2 G2 10-day LD-grown seedlings. Seedlings were collected and crosslinked in 1% formaldehyde under vacuum for 10 min. Crosslinking was reversed by addition of final 0.125 M glycin and incubation for 5 min under vacuum. 100 mg of ground material was used to extract crude nuclei as described 5. Nuclei were washed once with 300 µl of MNase buffer (50 mM Tris-Cl pH8, 10 mM NaCl, 5 mM CaCl2, 1 x cOmplete EDTA-free proteinase inhibitor - Roche) and collected by centrifugation (1500×g, 10 min, 4°C). Extracted nuclei were diluted with MNase buffer and divided into 4 samples – three were digested for 8 min with 5U MNase (New England BioLabs, NEB, cat. #M0247S) in 100 µl reaction at 37°C. The fourth sample was processed in parallel without the addition of Mnase, serving as non-digested input control. Mnase digestion was stopped by the addition of EDTA to give 10 mM. All samples were sonicated in 2 cycles of 30 s ON/ 30 s OFF using a Bioruptor® (Diagenode). Crosslinking was reversed by addition of NaCl to give 0.25 M and overnight incubation at 65°C. Samples were treated with 10 mg of Proteinase K (NEB) for 1 hr at 45°C and DNA was extracted using phenol/chloroform, precipitated by 0.3 M NaAc and 2.5/1 (v/v) ethanol and dissolved in 100 µl of TE buffer (10 mM Tris-Cl-pH 8, 1 mM EDTA). Recovered DNA from each sample was analysed by qPCR in triplicates using primers specified in Table S2. Signal from digested samples was related to respective non-digested control and normalized to Col-0. Two independent nuclei extracts per treatment/genotype were processed in parallel and the experiment was repeated two times. Results of the four independent MNase digests were averaged.

Chromatin immunoprecipitation (ChIP) 100 mg of Col-0 and fas2 10-day LD-grown seedlings were collected, cross-linked and nuclei were extracted as described above. Extracted nuclei were washed once with ChIP dilution buffer (16.7 mM Tris-HCl - pH 8.0, 167 mM NaCl, 1.2 mM EDTA, 1.1% Triton X-100, 1 x cOmplete EDTA-free proteinase inhibitor (Roche)) and resuspended in 100 µl of lysis buffer (50 mM Tris-HCl - pH 8.0, 1% SDS, 1 x cOmplete EDTA-free proteinase inhibitor (Roche)). Chromatin was sheared by 7 cycles of sonication of 30 s ON/ 30 s OFF using a Bioruptor® (Diagenode) and diluted ten times with ChIP dilution buffer. It was cleared by centrifugation (4500×g, 5 min, 4°C). 25 µl of chromatin was used as input control and 250 µl chromatin was




3

used in one immunoprecipitation reaction with 1 µg of antibody (IgG, Sigma, cat. no. I5006, anti-histone H3, Millipore, cat. no. 07-690; and anti-H3K4me3, Diagenode, cat. no. pAb-003-050) and incubated overnight. Immunoprecipitated complexes were collected using 20 µl of Dynabeads® Protein A (Life Technologies) per reaction after incubation for 1.5 hr at 4°C. Beads were washed two times for 5 min with 300 µl of low salt wash buffer (20 mM Tris-HCl - pH 8.0, 150 mM NaCl, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 1 x cOmplete EDTA-free proteinase inhibitor (Roche)) and two times for 5 min with 300 µl of high salt wash buffer (20 mM Tris-HCl - pH 8.0, 500 mM NaCl, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 1 x cOmplete EDTA-free proteinase inhibitor (Roche)). Bound complexes were eluted by incubating the beads with 2 x 250 µl elution buffer (0.1 M NaHCO3, 1% SDS) for 2 x 15 min at 65°C. De-crosslinking and DNA extraction was performed as described for the MNase assay. Precipitated DNA was dissolved in 100 µl of TE buffer and analysed by qPCR using the same primers as for MNase assay (see Table S2). DNA recovery after ChIP was quantified as percentage of input and relative abundance of H3K4me3 was expressed as anti-H3K4me3 or IgG signal relative to anti-H3 signal (% H3). Control genomic regions enriched (ACT2) or depleted (AG) in H3K4me3 were selected based on data from 6. ChIP experiments were repeated at least twice and results of two independent biological replicates were averaged.

Supplementary References

1. Telfer, A., Bollman, K.M. & Poethig, R.S. Phase change and the regulation of trichome distribution in Arabidopsis thaliana. Development 124, 645-654 (1997).

2. Rehrauer, H. et al. AGRONOMICS1: A new resource for Arabidopsis transcriptome profiling. Plant Physiol 152, 487-499 (2010).

3. Smyth, G.K. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol 3, 1-26 (2004).

4. Storey, J.D. & Tibshirani, R. Statistical significance for genomewide studies. ProcNatl Acad Sci U S A 100, 9440-9445 (2003).

5. Shu, H., Gruissem, W. & Hennig, L. Measuring Arabidopsis chromatin accessibility using DNase I-polymerase chain reaction and DNase I-chip assays. Plant Physiol 162,1794-1801 (2013).

6. Zhang, X., Bernatavichute, Y.V., Cokus, S., Pellegrini, M. & Jacobsen, S.E. Genome-wide analysis of mono-, di- and trimethylation of histone H3 lysine 4 in Arabidopsis thaliana. Genome Biol 10, R62 (2009).




4

Supplementary figures

Fig. S1: Quantification of phenotypes of soil-grown wild type (WT) and fas2 mutants. (a) Area of leaf no. 4 at bolting, (b) number of seeds per silique and (c) number of total, juvenile and adult rosette leaves at bolting. Error bars represent SEM (N = 14). ** = p<0.01 in Student´s t-test, related to WT.




5

a

b

c




6

d

Fig. S2: Biclustering analysis of misexpressed genes in fas2 reveals activation of defence genes. (a) The AtGenExpress stress series comprising 452 samples of diverse biotic and abiotic stresses was used to analyse the up-regulated genes. Expression data were available for 254 of the 307 up-regulated genes. The most prominent bicluster with at least 3 conditions contained 85 genes (= 33% of the genes with data) responding to 3 different Pseudomonas syringae treatments (threshold 0.8). (b) A collection of 118 AtGenExpress samples with hormone and elicitor treatments was used to analyse the up-regulated genes. The dominating bicluster contained 3 conditions and 75 genes. The conditions were treatments with SA and with the bacterial elicitors FLG22 and HrpZ. (c) The AtGenExpress stress series comprising 452 samples of diverse biotic and abiotic stresses was used to analyse the down-regulated genes. Expression data for 60 of the 64 down-regulated genes were available. The most prominent bicluster with at least 3 conditions contained had 22 genes and conditions of treatments with the pathogens (P. syringeae, P.infestans and B. cinerea treatments). (d) The 118 AtGenExpress samples with hormone and elicitor treatments were used to analyse the down-regulated genes. In this case, we identified a dominating bicluster of 3 conditions and 10 genes. The conditions were treatments with the bacterial and fungal elicitors FLG22, HrpZ and NPP1.




7

Fig. S3: Defence response gene expression and NahG transgene expression in seedlings used for chromatin analysis by MNase assay and ChIP. (a) PR1 activation occurs more rapidly in BABA-treated and fas2seedlings than in wild type (WT). Dynamics of relative PR1 expression in sterile-grown seedlings in the course of 12-hour treatment with 50 µM SA. 8-day old WT and fas2 seedlings were compared to WT seedlings pre-treated for 24 hrs with 100 µM BABA (WT-BABA). (b) Relative expression of defence genes in samples analysed by MNase assay or ChIP (shown in Fig. 3 and 5). 7-day-old WT seedlings were pre-treated with 100 µM SA (WT-SA) or 100 µM BABA (WT-BABA) for 24 hours and compared to 8-day-old WT and fas2 (or fas2NahG) seedlings. Error bars represent SEM of 3 technical replicates. Similar expression patterns were obtained




8

in two independent experiments. (c) Expression of NahG in WT and fas2 T2 transgenic lines used in the study. T2 plants from two independent fas2 NahG T1 lines (“A” and “B”) were used. Error bars represent SEM of biological replicates (N = 3). (d) Comparison of relative expression of PR1 in WT and fas2 sterile-grown seedlings and in soil-grown plants. Relative amount of PR1 transcript is low in untreated seedlings grown under sterile conditions in all genotypes tested (left). In the rosette leaves of untreated soil-grown plants (right), relative expression of PR1 is higher in fas2 compared to WT but the presence of NahG is sufficient to reduce PR1expression below WT-level in fas2 NahG plants. Each seedling sample analysed represents a pool of seedlings and similar effect was observed in at least two independent experiments. Each sample of soil-grown plants consists of rosette leaves no. 5 pooled from 3 individual plants. 2 such samples per transgenic NahG line were analysed and T2 plants from two independent fas2 NahG T1 lines (“A” and “B”) were used. Error bars represent SEM of technical replicates (N = 3). (a – d) PP2A (AT1G13320) expression was used for normalization. Identical letters above columns indicate absence of significant difference based on unpaired two-sided Student´s t-test (p = 0.05), absence of letter indicates significant difference to all other samples. WT – wild type.




9

Fig. S4: The phenotype of the fas1 mutants resembles fas2. (a) Example of morphological phenotype of soil-grown wild-type and fas1 mutant plants. (b) Relative expression of PR1 is increased in fas1 and fas2 mutant seedlings compared to wild type after 12 hrs of SA-treatment. (c) PR1 expression is elevated only in non-sterile (soil)-grown fas1 and fas2 mutants. PP2A (AT1G13320) expression was used for normalization in (a) and (b)




10

and error bars represent SEM of biological replicates (N = 2). (d) Increased H3K4me3 abundance (represented as % DNA recovery after anti-H3K4me3 or IgG ChIP related to DNA recovery after anti-H3 ChIP) at promoters/TSS of defence response genes in fas1. ACT2 served as positive (H3K4me3-enriched) and AG as negative (H3K4me3-depleted) control regions. Error bars represent SEM (N = 2). (e) Reduced nucleosome occupancy at promoters/TSS of defence response genes in fas1 determined by MNase assay. Sterile-grown WT signal was arbitrarily set as 1. AT5G36080 served as MNase digestion control region. Genic regions amplified by qPCR in (d) and (e) are shown in Fig. 3a. Error bars represent SEM (N = 3). Gray line in (d) and (e) represents WT-level. (a – e) Identical letters above columns indicate absence of significant difference based on unpaired two-sided Student´s t-test (p = 0.05), absence of letter indicates significant difference to all other samples. WT – wild type; S – sterile-grown; NS – non-sterile-grown.




11




12

Fig. S5: Comparison of phenotypes of sterile-grown and soil-grown (non-sterile) WT and fas2 plants. (a and b) Rosette diameter in fas2 is reduced only in soil-grown plants. Rosette diameter of 28-day-old sterile-grown (a) and soil-grown (b) wild-type (WT) and fas2 mutant plants. Error bars represent SEM (N = 38 – 44 plants), ** = p<0.01 in Student´s t-test. (c) Increased salicylic acid (SA) content is limited to non-sterile-grown fas2 plants. Error bars represent SEM of biological replicates (N = 3). (d) Relative ISOCHORISMATE SYNTHASE 1 (ICS1) transcript abundance related to PP2A (AT1G13320) is only increased in non-sterile-grown fas2. Error bars represent SEM of independent seedling pools (N = 2). (e) Relative abundance of H3K4me3 (represented as % DNA recovery after anti-H3K4me3 or IgG ChIP related to DNA recovery after anti-H3 ChIP) at promoters/TSS of defence response genes in sterile- and non-sterile-grown 28-day-old plants. ACT2 served as positive (H3K4me3-enriched) and AG as negative (H3K4me3-depleted) control regions. (f) Relative nucleosome occupancy at promoters/TSS of defence response genes in sterile- and non-sterile-grown 28-day-old plants. Sterile-grown WT signal was arbitrarily set as 1. AT5G36080 served as MNase digestion control region. Genic regions amplified by qPCR in (e) and (f) are shown in Fig. 3a. Identical letters above columns in (c - f) indicate absence of significant difference based on two-sided Student´s t-test (p = 0.05), absence of letter indicates significant difference to all other samples. WT – wild type; S – sterile-grown; NS – non-sterile-grown.




13

Fig. S6: Root length and leaf serration phenotypes are not reverted in fas2 35S::NahG. (a) Primary root length in 9-days-old seedlings. Error bars represent SEM (N = 20). (b) Leaf morphology in 5-week-old plants. Scale bar = 1 cm. * = p<0.05; ** = p<0.01 in Student´s t-test related to WT. WT – wild type.




14

Fig. S7: Infection of fas2 with virulent bacteria Pseudomonas syringae pv. tomato (Pst) DC3000. (a)Relative expression of ICS1 before and after Pst DC3000 infection of 5-week-old SD soil-grown (NS) and 3-week-old sterile (S) plants. In assays with non-sterile grown plants, non-infected rosette leaves were collected from 5-week-old SD soil-grown plants (0 HAI). Remaining plants were inoculated with Pst DC3000, and infected leaves were collected 3 days after infiltration (72 HAI). One rosette leaf of comparable developmental stage was collected from each of 3 individual plants and these were pooled into one biological replicate. In sterile-grown plant assays, 3 individual plants were pooled per one replicate. (b) PR1 expression in non-sterile- and sterile-grown plants after Pst DC3000 infection. PP2A (AT1G13320) expression was used for normalization and error bars represent SEM of biological replicates (N = 2-3) in panels (a) and (b). (c) Bacterial growth in rosette leaves of 5-week-old plants grown on soil in SD after syringe infiltration with Pst DC3000 at OD = 0.0001. Log-transformed values represent means ± SEM of biological replicates (N = 6). (d) Bacterial growth in 3-week-old plants grown in sterile conditions after flooding with Pst DC3000 at OD = 0.0001. Log-transformed values represent means ± SEM of biological replicates (N = 5). (a-d) Identical letters above columns indicate absence of significant difference based on unpaired two-sided Student´s t-test (p = 0.05), absence of letter indicates significant difference to all other samples. WT – wild type; HAI – hours after infection (infiltration/flooding); CFU - colony forming units; S – sterile-grown plants; NS – non-sterile-grown plants.




15

Supplementary tables

Table S1: Genes with change in expression level in fas2-4 G6 rosette leaves (xls file)

Table S2: Primers used

Primers used for MNase assay/ChIP ‐ qPCR AGI Gene name Primer sequence 5´‐ 3´

AT2G14610 PR1 TATATAAGCGATGTTTACGAACCCCAAA CGAGAATAGCCAGTAAAATTCATT

AT1G75040 PR5 CCCCTCGAACCAACATCTATAAAT TCTCTGTGCTGTGGGTGAT

AT1G62300 WRKY6 ACAAAATCGGTCCACGTCCCAA GGGTTTGGTTGAAAGAGAGAGAGATT

AT4G23550 WRKY29‐a AGATATATGGGTGAGGTGGCTT GAGTAGCCTCTGACTATTGCTTCTA

WRKY29‐b GTCGGAGATGGATATTTGACAAGTT CCATGTGAACCCGTTAAGTCATTAA

AT4G23810 WRKY53 CAAACACTGAAAATCCAATGCCTT TGAGAGTGTTATAGGATTGGTGAT

At5G36080 GAAGAAAGCGATGATGACACAGA TCAATGGCAACACGATACACTT

AT3G18780 ACT2 GGTGATGAAGCACAATCCAAGA TGTAGAAAGTGTGATGCCAGAT

AT4G18960 AG GCCAGGAGGATCTAACTACGAG AAACGGTTGAGATTGCGTTT

Primers used for RT‐qPCR AGI Gene name Primer sequence 5´‐ 3´

AT1G13320 PP2A GGAGAGTGACTTGGTTGAGCA CATTCACCAGCTGAAAGTCG

AT2G14610 PR1 CGTCTTTGTAGCTCTTGTAGGT TCCTCGTGCCTGGTTGTGAA

AT1G75040 PR5 TGTTCATCACAAGCGGCATT CTTGACCGGCGAGAGTTC

AT1G62300 WRKY6 GCAACAGCAACAACAGAACAA TGCCTTGGTACTATCGTCTCC

AT4G23550 WRKY29 AAGGATCTCCATACCCAAGGA GGGTTTTGAGGATTTCTTTCG

AT4G23810 WRKY53 CGGAAGTCCGAGAAGTGAAG TCTGACCACTTTGGTAACATCTTT

AT1G74710 ICS1 GCGGGACCTATTGGATTTTT AGATCAATGCCCCAAGACC NahG ATAAACTTGGCTTGCGCATC TATGGGAGTAGCGGCAGAGT


Documents

Chromatin assembly factor CAF-1 represses priming of plant ... · Chromatin assembly factor CAF-1 represses priming of plant defence response genes ... (50 mM Tris-Cl pH8, 10 mM NaCl,