Clinical VignetteClinical and Cellular Manifestations of OSTM1-Related

Infantile Osteopetrosis

Bruno Maranda,1 Gilles Chabot,2 Jean-Claude Décarie,3 Monica Pata,4 Bouziane Azeddine,5,6 Alain Moreau,5,6

and Jean Vacher4

ABSTRACT: Infantile ARO is a genetic disorder characterized by osteoclast dysfunction that leads to osteo-petrosis. We describe a novel mutation affecting the OSTM1 locus responsible for ARO. In addition tocommon clinical features of osteopetrosis, the patient developed a unique neuronal pathology that providedevidence for an essential role of OSTM1 in normal neuronal cell development.

Introduction: Infantile autosomal recessive osteopetrosis (ARO) is a genetic disorder characterized by os-teoclast dysfunction that leads to osteopetrosis. We describe a novel mutation affecting the OSTM1 locusresponsible for ARO. In addition to common clinical features of osteopetrosis, the patient developed a uniqueneuronal pathology that provided evidence for an essential role of OSTM1 in normal neuronal cell develop-ment.Materials and Methods: We report a new case of ARO caused by an homozygous mutation in OSTM1. Inaddition to osteopetrosis and bone marrow failure, this patient also had neurological impairment not relatedto bone entrapment. Retinal dystrophy with absent evoked visual potentials and sensorineural deafness weredocumented, as well as cerebral atrophy and bilateral atrial subependymal heterotopias.Results: The patient developed generalized seizures and had a profound developmental delay. Nerve biopsyfailed to show inclusion material suggestive of neuroaxonal dystrophy. Bone marrow transplantation wasdeclined considering the severe neurological compromise. The patient died at 1 yr of age. Osteoclasts derivedfrom peripheral blood were mature and multinucleated. Expression analysis showed that the amount ofOSTM1 cDNA transcript was significantly lowered but not absent.Conclusions: These results support the role of OSTM1 in osteoclast function and activation. However, theyalso suggest that OSTM1 has a primary role in neural development not related to lysosomal dysfunction.J Bone Miner Res 2008;23:296–300. Published online on October 8, 2007; doi: 10.1359/JBMR.071015

Key words: OSTM1, osteopetrosis, neuronal cell development

INTRODUCTION

INFANTILE AUTOSOMAL RECESSIVE osteopetrosis (ARO) isa disorder characterized by osteoclast dysfunction that

leads to defective bone resorption and progressive osteo-sclerosis. The most effective treatment for this disease hasbeen bone marrow transplantation because the osteoclastsare from hematopoietic cell origin. ARO have also beenassociated with neurological symptoms secondary to bonecompression. Three genes have been found to be respon-sible for this disease. The most frequently mutated geneTCIRG1 encodes the a3 subunit of vacuolar proton

pump,(1,2) a protein responsible for bone–osteoclast inter-face acidification, which is a process required for efficientbone resorption. The neurological symptoms associatedwith TCIRG1 mutations are secondary to nerve compres-sion. The second gene, CLCN7, encodes a chloride channel(CLC-7) that provides electroneutrality during the acidifi-cation process. In addition to severe osteopetrosis, patientswith ARO with mutations in CLCN7 develop a primaryencephalopathy and retinopathy that does not regress afterbone marrow transplant.(3,4) The third gene, OSTM1, hasrecently been cloned, and OSTM1 mutations lead to a verysevere ARO phenotype with shorter life expectancy than inthe other two ARO genetic groups. The four individualsidentified until now seem to have developed additionalThe authors state that they have no conflicts of interest.

1Service de Génétique Médicale, Département de pédiatrie, CHUL-CHUQ, Université Laval, Quebec, Canada; 2Département dePédiatrie, Hôpital Ste-Justine, Université de Montréal, Montreal, Canada; 3Département d’Imagerie, Hôpital Ste-Justine, Université deMontréal, Montreal, Canada; 4Clinical Research Institute of Montreal, Faculty of Medicine, Université de Montreal, Montreal, Canada;5Molecular Genetic Laboratory of Musculoskeletal Diseases, Research Center Sainte-Justine University Hospital, Université de Mon-tréal, Montreal, Canada; 6Department of Stomatology, Faculty of Dentistry and Department of Biochemistry, Faculty of Medicine,Université de Montréal, Montreal, Canada.

JOURNAL OF BONE AND MINERAL RESEARCHVolume 23, Number 2, 2008Published online on October 8, 2007; doi: 10.1359/JBMR.071015© 2008 American Society for Bone and Mineral Research

296

JO707391 296 300 February

anomalies such as hypotonia and cerebral atrophy.(5–8)

Herein, we report a new case with a novel mutation inOSTM1 that presents characteristic features of ARO withsignificant cortical and retinal dysplasias.

CASE REPORT

A 3-mo-old girl was admitted for feeding problems, irri-tability, and poor visual contact. She was born at term afteran uneventful pregnancy from consanguineous parents. Ce-sarean section was performed because of a breech presen-tation. Birth weight was 3.5 kg, and occipitofrontal circum-ference (OFC) was 34.5 cm (50th percentile). Apgar scoreswere 9 and 10 at 5 and 10 min, respectively. Parents re-ported increasing feeding difficulties from birth and neuro-logical irritability. Visual contact was also said to be poorsince birth.

Physical examination at 3 mo revealed an infant withheight and head circumference at the 25th percentile. Noweight gain was observed since the second month. Hepa-tosplenomegaly was present with a liver at 4 cm below thecostal margin. Minor dysmorphic features were observedsuch as gum hypertrophy and ogivale palate. Neurologicalexamination revealed a profound axial hypotonia with in-creased peripheral tone. Deep tendon reflexes were alsoincreased. Visual contact was absent with a wandering nys-tagmus. Developmental milestones were significantly de-layed, because no head control, eye tracking, or smilingwere observed at that time.

The patient developed generalized seizures at 4 mo ofage. A gastrostomy was installed at 5 mo. She suffered fromnontraumatic rib and humeral fractures at 9 mo of age. Nobone marrow transplant was performed because of the se-verely impaired neurological status. Treatment consisted ofvigabatrin for seizures, calcitriol and calcium supplementa-tion for the hypocalcemia associated with florid rickets,morphine, and sporadic transfusions. Palliative care wasimplemented, and she died at home at 1 yr of age. Anautopsy was refused by the parents.

Laboratory and radiological findingsEsophageal pH studies revealed severe gastro-

esophageal reflux disease. Funduscopy showed macular

pigmentation with pale and elongated optic nerves. Evokedvisual potentials did not reproduce any reproducible wave,and the electroretinogram showed no response. Evokedotoacoustic potentials emissions were also absent. How-ever, an electroencephalogram showed abundant epilepticactivity in the right posterior temporal region and anotherindependent focus of activity in the left posterior temporalregion. Electromyography and nerve conduction studieswere normal.

Laboratory work-up showed anemia and thrombocyto-penia. Signs of extramedullary hematopoiesis were notedon blood smear. Creatine kinase, alkaline phosphatase,PTH, �-glutamyl transferase, and alanine aminotransferasewere elevated. Calcium and phosphorus were low.

Bone survey revealed a homogenous and diffuse increaseof density, consistent with osteopetrosis. Osteodensitom-etry performed at the lumbar spine showed a BMD at +10SD above the mean for age, corroborating this increaseddensity. Bone age was consistent with chronological age.Abdominal ultrasound showed hepatosplenomegaly with aspleen of 7 cm of diameter. Head CT showed no signs ofoptic and auditory nerve compression by bone deposition.Cerebral MRI showed significantly delayed myelinization,diffuse cortical and subcortical atrophy, and bilateral atrialsubependymal heterotopias. There was also a subduralfrontal hematoma. A subsequent MRI revealed progres-sion of cerebral atrophy with no signs to indicate progressof myelinization (Fig. 1).

Histopathological findings

A muscle and nerve biopsy was initially performed toassess possible neuronoaxonal dystrophy. Extensive atro-phy of type 1 and 2 fibers was present, with moderate en-domysial and perimysial fibrosis. Immunohistochemicalstudies that included dystrophin, merosin, sarcoglycans,spectrin, desmin, and vimentin were normal. Electron mi-croscopy of muscle was consistent with histological resultswith no structural abnormalities. The nerve biopsy showedsubclinical multifocal nonspecific demyelinating neuropa-thy. Immunomarking with protein S100, CD3, CD5, CD20,and CD68 was normal, and there was no evidence of inclu-

FIG. 1. Cerebral MRI of our case. (A) Coronal T2: subependymal heterotopias, delayed myelinization, and global atrophy. (B) AxialT1: subependymal heterotopias follow normal cortex signal. (C) Axial T1: subependymal heterotopias follow normal cortex signal.

OSTM1 MALIGNANT OSTEOPETROSIS 297

sion material suggestive of neuronoaxonal dystrophy. Askin biopsy including a hair follicle displayed no anomalies.

Primary osteoclasts were differentiated from peripheralblood and identified by phase-contrast microscopy andTRACP staining. Mature osteoclasts were multinucleated,with >10 nuclei per cell (Fig. 2).

Mutation and expression analysis

Genomic DNA was isolated from a blood sample ob-tained from the patient and parents after consent for ge-netic screening. Because osteopetrosis results principallyfrom mutations in TCIGR1, CLCN7, and OSTM1 and be-cause no mutations were detected in TCIGR1 and CLCN7,the OSTM1 gene was analyzed. All OSTM1 coding se-quences including exon–intron junctions were sequenced(Table 1), and a homozygous mutation was detected in thepatient sample. A substitution of G to T in position 256 inthe first exon of OSTM1 was detected and generated aTGA stop codon. DNA samples from the parents weresequenced and confirmed heterozygosity at the same siteaccording to a recessive mutation (Fig. 3A). Interestingly,this point mutation resulted in destruction of a conserved

SacI restriction site in the OSTM1 exon1, allowing confir-mation of homozygosity for the mutation with resistance toSacI digestion of the exon1 PCR-amplified product com-pared with unaffected control and heterozygous parentsamples (Fig. 3B).

Expression analysis was undertaken on total RNA iso-lated from primary skin fibroblasts derived from the patientand controls. OSTM1 cDNA was PCR amplified with theforward primer in exon 3 (5�-CCTGACCTGCTTTGAA-CATAACC-3�) and exon 6 (5�-TGTCTTCCACCATTC-ATTCACG-3�), and ClCN7 was amplified with the forwardprimer in exon 14 (5�-TTTCGAATCAGGTACATCCAC-CGG-3�) and reverse primer in exon 19 (5�-TTGCTG-GTGGCCTCCATCATGATG-3�). Amplification of S16ribosomal protein cDNA with forward (5�-GGCAGACC-GAGATGAATCCTCA-3�) and reverse (5�-CAGGTCC-AGGGGTCTTGGTCC-3�) primers was used as a control.Interestingly, the OSTM1 cDNA transcript was not de-tected in the patient sample compared with the control atlower amplification cycles, but with an increasing numberof cycles (30–35), low levels of OSTM1 expression (∼20- to50-fold lower) were marginally detectable (Fig. 3C).

DISCUSSION

ARO is a heterogeneous group of genetic disorders witha range of bone phenotype. This case report is the fifthpatient with proven OSTM1-related osteopetrosis andshares common features with our previously documentedpatients.(7) Because osteopetrosis results from a defect ofosteoclasts derived from the hematopoietic cell line, bonemarrow transplantation is a frequent therapeutic approach.However, in this case, correction of osteopetrosis by bonemarrow transplant was not considered because of the de-velopment of severe neurological handicap and not becauseof skeletal abnormalities.

Our molecular analysis of the osteopetrosis in this patientshowed a novel OSTM1 point mutation that created a stopcodon in the first exon. This mutation could possibly lead tosynthesis of a putative truncated 85 amino acids proteincompared with the 334 aa OSTM1 human protein. How-ever, the localization of the stop codon caused by this mu-tation at >50 bp upstream of the splice site will more likelyresult in nonsense mRNA decay process,(9) consistent withthe barely detectable level of OSTM1 messenger in thepatient fibroblasts.

Severe osteopetrosis with strong bone marrow involve-ment can result from absence of osteoclasts caused by adefect in osteoclast lineage precursor differentiation orfrom nonfunctional osteoclasts. Precursor differentiationassay from peripheral blood of the patient produced largemultinucleated osteoclast-like cells, showing that the poten-tial of osteoclast differentiation was not affected in this pa-tient. This finding corroborates with the occurrence of ma-ture osteoclasts in the first OSTM1 patient and in gl micewith an OSTM1 mutation.(10) Significantly, these resultsfurther support a critical role of OSTM1 in osteoclast acti-vation and bone resorption function.

Patients with ARO from mutations in different genesfrequently display sensorineural visual and hearing impair-

FIG. 2. Osteoclasts morphology. (A) Differentiated osteoclastswith numerous nuclei derived from primary culture of PBMCscollected from our osteopetrotic patient. (B) TRACP stainingshowing TRACP+ multinucleated cells. Cell pictures were takenusing Leica Microsystems microscope (×20).

MARANDA ET AL.298

Fig 2 live 4/C

ment that have been ascribed to secondary bone compres-sion.(11,12) Consistently, retinal dysplasia with absentevoked visual potentials and absent evoked otoacousticemissions was observed in our patient but without evidenceof compression of the optic and auditory nerve. However,our patient and most OSTM1 cases also display seizuresand profound hypotonia with increased muscle tone,(6)

which suggests that these neurological symptoms are notsecondary to bone entrapment. In fact, the cerebral atrophyin our patient would argue for a direct cause of OSTM1mutation. Most importantly, characterization in this patientof cerebral heterotopias provides the first evidence of ab-normal neuronal development caused by an OSTM1 muta-tion. Consequently, such a developmental defect would re-sult in progressive neurodegeneration. These findings

support a crucial role of OSTM1 during neuronal develop-ment and are concordant with our studies in the gl mutantmouse (unpublished data). Furthermore, the histologicalfindings on nerve biopsy from our patient do not seemrelated to any lysosomal storage disorder, whereas theyshowed nonspecific demyelinization. This result highlightsdistinct features relative to other ARO pathologies, in par-ticular the CLC-7 ARO. Indeed, it was proposed thatOSTM1 patients should share similarities with CLC-7 pa-tients based on the recent description of OSTM1 andCLC-7 molecular complex formation ex vivo.(13) Whereasretinal and central nervous system abnormalities are com-mon clinical characteristics,(4,14) the CLC-7 ARO displayeda lysosomal disorder with neuronal ceroid lipofuscinosis-like phenotype that was not observed in this OSTM1 pa-

TABLE 1. PRIMERS FOR OSTM1 PCR AMPLIFICATION AND DIRECT SEQUENCING

Exon Forward primer Reverse primer PCRPCR size

(bp)

1 CTCCTCGTGACCCGGCTCTC CGCTGACCATCATTACACCCTCC 65°C, 2 mM MgCl2,

20% DMSO593

2 ACTTAGTTCCTTGCTTGGGGC TACTACTGAACCATAACTGCAACA 58°C, 2 mM MgCl2 5363 CCGTGATTATGACCTTGTGCC GTGCTCTAAAAACTTGGAACTGC 60°C 4604 TGCCATCTGCTTCACATACCG ACTGAAGGTACATTCAATAACACTC 60°C, 2 mM MgCl2 4705 CCTGGCAGAAGAAGTTGTC GCCACTGCACCTAGCCCTG 65°C 5416 TGATGTTGTTTTATTTGTACTGCTTC TGTCTTCCACCATTCATTCACG 65°C 344

FIG. 3. (A) Pedigree of affected family.(B) Diagnostic PCR/restriction enzyme as-say. (C) Expression analysis.

OSTM1 MALIGNANT OSTEOPETROSIS 299

tient.(3) The novel insights provided herein on the OSTM1phenotypic characterization indicate that additional clinicalinterventions will be required together with bone marrowtransplantation for correction OSTM1 neuronal and osteo-petrotic defects.

A molecular OSTM1 genotype–phenotype correlation isdifficult to establish with only four mutations to date. How-ever, all four OSTM1 mutations presently described couldlead, if produced, to truncated proteins that exclude thetransmembrane domain.(5,6,8) Such putative proteins arelikely to be mislocalized within a different subcellular com-partment and possibly disrupt protein partner interactions.

In summary, OSTM1 mutations in humans, as in mice,consistently lead to osteopetrosis. Importantly, our datasupport that the neonatal onset and progressive neurode-generation in OSTM1 ARO patients is directly linked toOSTM1 gene mutations. Future studies of OSTM1 neuro-nal function are critical toward preventing fatal neurode-generation observed in these patients.

ACKNOWLEDGMENTS

This work was supported by the Canadian Institute ofHealth Research (CIHR Grant MOP-440790 to JV). Theauthors thank the family of the patient for collaboration inthis study and the clinical expertise of Dr M Robert.

REFERENCES

1. Frattini A, Orchard PJ, Sobacchi C, Giliani S, Abinun M,Mattsson JP, Keeling DI, Andersson AK, Wallbrandt P, ZeccaL, Notarangelo LD, Vezzoni P, Villa A 2000 Defects inTCIRG1 subunit of the vacuolar proton pump are responsiblefor a subset of human autosomal recessive osteopetrosis. NatGenet 25:343–346.

2. Kornak U, Schulz A, Friedrich W, Uhlhaas S, Kremens B, VoitT, Hasan C, Bode U, Jenisch TJ, Kubisch C 2000 Mutations inthe a3 subunit of the vacuolar H(+)-ATPase cause infantilemalignant osteopetrosis. Hum Mol Genet 9:2059–2063.

3. Kasper D, Planells-Cases R, Fuhrmann JC, Scheel O, Zeitz O,Ruether K, Schmitt A, Poci M, Steinfeld R, Schweizer M, Kor-nak U, Jentsch TJ 2005 Loss of the chloride channel ClC-7leads to lysosomal storage disease and neurodegeneration.EMBO J 24:1079–1091.

4. Kornak U, Kasper D, Bosl MR, Kaiser E, Schweizer M, SchulzA, Freidrich W, Delling G, Jenisch TJ 2001 Loss of the ClC-7chloride channel leads to osteopetrosis in mice and man. Cell104:205–215.

5. Chalhoub N, Benachenhou N, Rajapurohitam V, Pata M, Fer-ron M, Frattini A, Villa A, Vacher J 2003 Grey-lethal mutationinduces severe malignant autosomal recessive osteopetrosis inmouse and human. Nat Med 9:399–406.

6. Pangrazio A, Poliani PL, Megarbane A, Lefranc G, Lanino E,Di Rocco M, Rucci F, Lucchini F, Ravanini M, Facchetti F,Abinun M, Vezzoni P, Villa A, Frattini A 2006 Mutations inOSTM1 (grey lethal) define a particularly severe form of au-tosomal recessive osteopetrosis with neural involvement. JBone Miner Res 21:1098–1105.

7. Quarello P, Forni M, Barberis L, Defilippi C, Campagnoli MF,Silvestro L, Frattini A, Chalhoub N, Vacher J, Ramenghi U2004 Severe malignant osteopetrosis caused by a GL gene mu-tation. J Bone Miner Res 19:1194–1199.

8. Ramirez A, Faupel J, Goebel J, Stiller A, Beyer S, Stockle C,Hasan C, Bode U, Kornak U, Kubisch C 2004 Identification ofa novel mutation in the coding region of the grey-lethal geneOSTM1 in human malignant infantile osteopetrosis. Hum Mu-tat 23:471–476.

9. Maquat LE 2004 Nonsense-mediated mRNA decay: Splicing,translation and mRNP dynamics. Nat Rev Mol Cell Biol 5:89–99.

10. Rajapurohitam V, Chalhoub N, Benachenhou N, Neff L,Baron R, Vacher J 2001 The mouse osteopetrotic grey-lethalmutation induces a defect in osteoclast maturation/function.Bone 28:513–523.

11. Siatkowski RM, Vilar NF, Sternau I, Coin CG 1999 Blindnessfrom bad bones. Surv Ophthalmol 43:487–490.

12. Steward CG 2003 Neurological aspects of osteopetrosis. Neu-ropathol Appl Neurobiol 29:87–97.

13. Lange PF, Wartosch L, Jentsch TJ, Fuhrmann JC 2006 ClC-7requires Ostm1 as a beta-subunit to support bone resorptionand lysosomal function. Nature 440:220–223.

14. Frattini A, Pangrazio A, Susani L, Sobacchi C, Mirolo M, Abi-nun M, Andolina M, Flanagan A, Horwitz EM, Mihci E, No-tarangelo LD, Ramenghi U, Teti A, Van Hove J, Vujic D,Young T, Albertini A. Orchard PJ, Vezzoni P, Villa A 2003Chloride channel ClCN7 mutations are responsible for severerecessive, dominant, and intermediate osteopetrosis. J BoneMiner Res 18:1740–1747.

Address reprint requests to:Bruno Maranda, MD, MSc

Medical Genetics ServiceDepartment of Pediatrics

CHUL-CHUQ2705 Boul Laurier

Sainte-Foy, Quebec G1V 4G2, CanadaE-mail: bruno.maranda@mail.chuq.qc.ca

Received in original form July 11, 2007; revised form August 29,2007; accepted October 3, 2007.

MARANDA ET AL.300