Clinical StudyA Randomized Double-Blind Placebo-Controlled TrialThe Efficacy of Multispecies Probiotic Supplementation inAlleviating Symptoms of Irritable Bowel SyndromeAssociated with Constipation

Valerio Mezzasalma1 Enrico Manfrini1 Emanuele Ferri1

Anna Sandionigi1 Barbara La Ferla1 Irene Schiano2 Angela Michelotti2

Vincenzo Nobile2 Massimo Labra1 and Patrizia Di Gennaro1

1Department of Biotechnology and Biosciences University of Milano-Bicocca Piazza della Scienza 2 20126 Milan Italy2Farcoderm Srl Via Angelini 21 San Martino Siccomario 27028 Pavia Italy

Correspondence should be addressed to Patrizia Di Gennaro patriziadigennarounimibit

Received 22 March 2016 Revised 28 June 2016 Accepted 3 July 2016

Academic Editor Clara G de los Reyes-Gavilan

Copyright copy 2016 Valerio Mezzasalma et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Background and Aim The efficacy of supplementation treatment with two multispecies probiotic formulates on subjects diagnosedwith IBS-C and the assessment of their gut microbiota were investigatedMethods A randomized double-blind three-arm parallelgroup trial was carried out on 150 IBS-C subjects divided into three groups (F 1 F 2 and F 3) Each group received a dailyoral administration of probiotic mixtures (for 60 days) F 1 or F 2 or placebo F 3 respectively Fecal microbiological analyseswere performed by species-specific qPCR to assess the different amount of probiotics Results The percentage of respondersfor each symptom was higher in the probiotic groups when compared to placebo group during the treatment period (11990560) andwas maintained quite similar during the follow-up period (11990590) Fecal analysis demonstrated that probiotics of the formulationsincreased during the times of treatment only in fecal DNA from subjects treated with F 1 and F 2 and not with F 3 and the samelevel was maintained during the follow-up period Conclusions Multispecies probiotic supplementations are effective in IBS-Csubjects and induce a different assessment in the composition of intestinal microbiota This clinical study is registered with theclinical study registration number ISRCTN15032219

1 Introduction

The intestinal microbiota consists of a wide range of bacterialspecies [1] The microbial community resides in the gut ofthe host establishing a mutually beneficial relationship andmodulating through its metabolic activities the hostrsquos healthstatus [2 3] The microbiota exerts different physiologicalfunctions such as inhibition of pathogenic bacteria andsynthesis of short fatty acids stimulation of nutrient andmineral absorption as well as modulation of the intestinalimmune system synthesis of vitamins and amino acidsand the decomposition of protein compounds [4 5] Theintestinal microbiota in healthy adults is generally considered

stable over time in predominance of bacteria belonging tofour main phyla Bacteroidetes and Firmicutes as prevalentand Actinobacteria and Proteobacteria that are less rep-resented The microbiota in subjects with Irritable BowelSyndrome (IBS) has been shown to be less stable compared tohealthy adults [5 6] A controlled balance between bacterialspecies considered beneficial (lactobacilli and bifidobacteria)associated with the reduction of those considered harmful(Clostridium E coli Salmonella and Pseudomonas) is fun-damental for maintenance of the gut physiological state andshould attenuate IBS symptomsAlteration of themicrobiotarsquoscomposition which can be caused by psychophysical dietaryor environmental stress is defined as dysbiosis and can lead

Hindawi Publishing CorporationBioMed Research InternationalVolume 2016 Article ID 4740907 10 pageshttpdxdoiorg10115520164740907

2 BioMed Research International

to pathological conditionsMoreover aberrant stimulation ofthe immune system leading to inflammation may be reliablyencountered as the potential link between dysbiosis andmetabolic diseases [7ndash9]

Experimental evidences have increasingly shown a cor-relation between microbiota imbalance and the induction ofIrritable Bowel Syndrome In particular dysbiosis was provento underlie a modification of intercellular tight junctionsresponsible under normal conditions for the correct structureof the epithelial layer of intestinal mucosa which is knownto increase the mucosal permeability Consequently antigenshave been detected in the intercellular space with the activa-tion of the inflammatory cascade production of cytokinesand tissue damage [9ndash11]

Oral administration of appropriate probiotic strains maytherefore be beneficial to health and in particular with respectto IBS However clinical data reporting changes in thedetection of ingested probiotic traceability in the gastroin-testinal tract of patients and the related effects on the gutare still few and inconclusive [12ndash15] Studies have reportedan improvement in global symptoms with probiotics whileothers have failed to demonstrate any benefit [16ndash18]

Moreover it is widely known that the effect of probioticsis species-specific [19 20] These indications combined withthe diversity and complexity of IBS may indicate that aprobiotic combination could be more efficient than a singlestrain in this particular syndrome Some authors suggestedthat multispecies probiotics may in some conditions be moreefficient than monospecies probiotics due to for exampleenhanced intestinal adhesion and the production of a greatervariety of antimicrobial compounds compared with singleprobiotic [15]

In this regard the present study was aimed at testingdifferent probiotics which we had previously characterized[19] for their in vitro activities in order to demonstrateby means of in vivo detection procedures their distinctiveeffects on the intestine after oral administration The aimof this randomized double-blind placebo-controlled studywas to investigate the efficacy of two probiotic formulationsin ameliorating IBS-C subjects The effects of probioticson IBS symptoms in comparison with placebo and theirassessment in the gut microbiota after probiotic therapy byanalysing fecal bacteria were evaluated In order to reachthis goal 150 volunteer subjects were recruited and includedin three groups (F 1 F 2 and F 3) Each group received60-day oral administration of different probiotic mixturesF 1 containing L acidophilus and L reuteri F 2 containingL plantarum L rhamnosus and B animalis subsp lactisand F 3 containing placebo At different time points afterprobiotic oral administration fecal microflora was analysedby real-time quantitative PCR performed on DNA fromstool samples of the subjects An additional 30-day follow-up period was encountered in order to assess whetherthe observed beneficial effects still persist after treatmentsuspension

Our investigation provides a relevant contribution toinvestigate the efficacy of multispecies probiotics in treatingIBS-C and other gastrointestinal syndromes related to the gutdisorders

2 Materials and Methods

21 Study Design This randomized double-blind study wascarried out in accordance with the Declaration of Helsinkiand the Good Clinical Practice guidelines E6 The study pro-tocol and the informed consent form were approved by theldquoIndependent Ethical Committee for Non-PharmacologicalClinical studiesrdquo during its meeting on July 17 2013 All sub-jects provided a written informed consent before initiationof any study-related procedures The study took place atFarcoderm Srl facilities Farcoderm Srl is an independenttesting laboratory for in vitro and in vivo safety and efficacyassessment of cosmetics food supplements and medicaldevices

Enrolled subjects were randomly assigned to receive onecapsule of the two different formulations of probiotics (mixF 1 and mix F 2) or placebo (mix F 3) once daily for a periodof 60 days andwere followed up for a further period of 30 daysafter a follow-up period from the last ingestion of the testedproducts

The tested products consisted of food supplements (cap-sules) containing lactobacilli and bifidobacteria (PrincipiumEurope Srl Solaro MI Italy) (Table 1) The compositionof the probiotic mix F 1 was as follows 5 times 109 CFU Lacidophilus (30mg as lyophilized) 5 times 109 CFU L reuteri(30mg as lyophilized) 330mg inulin 5mg silica and 5mgtalc The F 2 composition was as follows 5 times 109 CFU Lplantarum (12mg as lyophilized) 5 times 109 CFU L rhamnosus(20mg as lyophilized) 5 times 109 CFU B animalis subsp lactis(60mg as lyophilized) 298mg inulin 5mg silica and 5mgtalc Placebo (F 3) compositionwas as follows 390mg inulin5mg silica 5mg talc

The study flow and the schedule of assessment chart isreported in Figure 1 A questionnaire and an explanation ofthe protocol of the study were given to the subjects Symptomquestionnaire was performed as an interview to the enrolledsubjects at the time points of the study (each 10 days)

Stool samples for fecal microbiota analysis were obtainedat the start of the treatment (1199050) and at times 11990510 11990530 and11990560 days during the treatment for a total period of 60 daysfollowed by a sample at 11990590 days after washing up for 30days for a total period of 90 days from the start of the treat-ment

22 Subjects of the Study Eligible subjects were all adultmales and females aged between 18 and 65 years sufferingfrom Irritable Bowel Syndrome with constipation (IBS-C)diagnosed by clinical analyses and self-reported interviewsSubjects suffering from IBS-C were screened by means ofthe Rome III diagnostic criteria questionnaire [21] Exclusioncriteria were (i) pregnancy or the intention to become preg-nant (ii) lactation (iii) food intolerancesallergy (iv) knownhistory of other gastrointestinal disorders (v) chronic oracute gastrointestinal disorders (vi) participation in anothersimilar study and (vii) unwillingness or inability to complywith the study protocol requirements

The study further excluded subjects using food supple-ments (included probiotics different from the study) or drugscontaining actives having an influence on gastrointestinal

BioMed Research International 3

Table 1 List of the strains used in this study deposit number and the most relevant antimicrobial activities described in Presti et al 2015[19] Abbreviations used in the present work were also included

Probiotic strain Deposit number Antimicrobial activity V119904 AbbrLactobacillus rhamnosus LRH020(formerly PBS070) DSM 25568 C albicans E faecalis P aeruginosa S aureus E coli L Rha

Lactobacillus plantarum PBS067 DSM 24937 C albicans E faecalis P aeruginosa S aureus E coli L PlaBifidobacterium animalis subsp lactisBL050 (formerly PBS075) DSM 25566 E faecalis P aeruginosa E coli B Lac

Lactobacillus acidophilus PBS066 DSM 24936 C albicans E faecalis P aeruginosa S aureus E coli L AciLactobacillus reuteri PBS072 DSM 25175 E faecalis L Reu

No Yes

No Yes EnrolmentStart

10

Informed consent signature

Eligibility checkRandomization

Rome III diagnostic criteriaProduct intakeAlimentary diary

EndpointsStool collectionSymptoms questionnaireQuality of life (QoL)

No

Yes

End

30

60

90

0

DB screening

1st visit

2nd visit

3rd visit

4th visit

Basal visit

Screening of eligible participants in the Farcoderm volunteers database using the following keywords ldquosexrdquo ldquoagerdquoldquopathologyrdquo ldquotesting preferencesrdquo (setting the query as follows sex

Screening periodSubj meet incl crit

Subj meet incl crit

Subj meet incl crit Screening visit

1st subject enrolled Last subject screened0610201417092013

1st subject screened

pathology ldquonullrdquo testing preferences ldquofood supplementsrdquo)

Last subject completed

Study-related procedures

Medical examination

13012015

17092013

= ldquofemalerdquo and ldquomalerdquo ldquo rdquo18 lt age lt ldquo65rdquo

Figure 1 Study flow and schedule of assessment chart

physiology Changes in diet or lifestyle were not allowedduring all the study period

23 Assessment of Clinical Effects

231 Endpoints Patientswere evaluated five times during thecourse of the study at baseline after 10 30 and 60 days fromthe start period and 30 days after the follow-up of the inter-vention period to assess postintervention effects Primaryefficacy endpoints were the proportion of participants whoseIBS symptoms after probiotic supplementations were relievedup to 60 days and the assessment of their gut microbiotaThe secondary efficacy endpoint was the maintenance of theobtained effects 30 days after the last product(s) intake

232 Symptoms Questionnaire IBS-C related symptoms ofsubjects were reported daily by a questionnaire according toGuide Lines of FDA (Guidance for Industry-Irritable BowelSyndrome-Clinical Evaluation of Drugs for Treatment) IBS-C questionnaire consisted of 5 items as follows (i) bloat-ing (ii) abdominal pain (iii) constipation (iv) abdominalcramps and (v) flatulence For each item subjects scored thesymptom severity on a 10-point Visual Analogue Scale (VAS)Data are reported as the mean values after every 10 days

233 Health-Related Quality of Life (HR-QOL) HR-QOLwas assessed by means of the Italian version of the Quality ofLife Measure for Persons with IBS [22] From the original 34items questionnaire the following 12 items were selected (i) I

4 BioMed Research International

Table 2 List of primers used in this study

Probiotic Primer code Sequence (51015840 rarr 31015840) DNA region Amplifiedlength (bp)

L rhamnosus LraF CTAGCGGGTGCGACTTTGTT 16S23S IS 123 bpLraR CAGCGGTTATGCGATGCGAA

L plantarum Lpl2F CATTGGAACCGAACCAGTTG 16S23S IS 203 bpLpl2R CGGTGTTCTCGGTTTCATTATG

B animalis subsp lactis AnimF GCACGGTTTTGTGGCTGG pre16S 171 bpAnimR GACCTGGGGGACACACTG

L acidophilus Lacid2F GGGCAAATCACGAACGAGTA pre16S 132 bpLacid2R CTTTGTTTTCGTTCGCTTCA

L reuteri Lreu2F GTTGACGAAAGAATGAAATCCA pre16S 118 bpLreu2R TCATGTCGTCAATCAGATGTCA

am embarrassed by the smell caused by my bowel problems(ii) I feel vulnerable to other illnesses because of my bowelproblems (iii) I feel fat because of my bowel problems (iv) Ifeel my life is less enjoyable because of my bowel problems(v) I feel depressed about my bowel problems (vi) I have towatch the amount of food I eat because ofmy bowel problems(vii) because of my bowel problems sexual activity is difficultforme (viii) I feel angry that I have bowel problems (ix) I feelI get less done because of my bowel problems (x) my bowelproblems limit what I can wear (xi) I have to watch the kindof food I eat because of my bowel problems and (xii) I fearthat I wonrsquot be able to have a bowel movement

For each item the following five-point response scale wasused 1 not at all 2 slightly 3 moderately 4 quite a bit and5 extremely HR-QOL was interviewer-administered

24 Fecal Samples (Stools Type Classification) Fecal sampleswere collected from subjects at 11990510 11990530 11990560 and 11990590 timepoints during the study Fresh fecal samples were homoge-nized by vortex mixing of the fecal mass and separated intoaliquots to be stored at minus80∘C until the analysis using DNA-based method quantitative PCR

Stool types were classified according to Bristol scale[23] Bristol values were divided in two categories values3 (sausage shape with cracks in the surface normal) 4(smooth soft sausage or snake normal) and 5 (soft blobswith clear-cut edges lacking fiber) corresponding to healthybowel situation were assigned to class 1 whereas values1 (separate hard lumps very constipated) 2 (lumpy andsausage like slightly constipated) 6 (mushy consistency withragged edges inflammation) and 7 (liquid consistency withno solid pieces inflammation) were assigned to class 0 Thenumber of volunteer subjects with stool samples with Bristolvalues belonging to class 1 was calculated for each treatmentand for each experimental time

25 Probiotic Strains and DNA Extraction In this study atotal of four Lactobacillus spp strains and one Bifidobac-terium strain supplied from a private collection were takeninto consideration for the preparation of the two formulations(F 1 and F 2) Table 1 describes the characteristics of each

strain In order to prepare standard curves of DNA extractedfrom probiotics microbial cultures were performed in MRS(Conda) medium and incubated at 37∘C for 24 hours inanaerobic conditions using anaerobic atmosphere generationbags (Anaerogen Oxoid) For B animalis subsp lactis asupplementation of 03 gL L-cysteine hydrochloride mono-hydrate was included in the growthmedium (cMRS) (Sigma-Aldrich)

DNA from microbial cultures was extracted by the ZRfecal DNA MiniPREP (Zymo Research) A total of 1mL of109 CFUmL culture was used for obtaining genomic DNAfollowing the protocol provided by the manufacturer

DNA extraction from stool samples was performed from150mg of feces by the ZR fecal DNA MiniPREP BothDNA extracted from probiotic cultures and DNA from stoolsamples were utilized to perform qPCR

26 Fecal Microbiology Analysis by Quantitative PCR qPCRreactions were carried out using an ABI 7500 (AppliedBiosystems) and the SsoFast EvaGreen Supermix with LowROX (BIO-RAD) dye We designed species-specific primersets developed by the authors in a previous study and reportedin Table 2 [24] Reactions were carried out in a 10120583L qPCRmix containing 5120583L of SsoFast EvaGreen Supermix with LowROX 02 120583L of 10 120583M forward primer and 10 120583M reverseprimer 4 120583L of DNA template and 24120583L of H

2O according

to the following qPCR program 101015840 95∘C and 40 cycles of 151015840101584095∘C and 11015840 60∘C (followed by a dissociation step)

For each strain standard curves were constructed usingDNA extracted from microbial cultures using tenfold dilu-tions ranging from 108 CFUmL to 10CFUmL Each DNAsample both from feces and from culture dilution wasanalysed in triplicate

27 Sample Size Sample size was calculated with a two-side 5 significance level and a power of 80 taking intoaccount a 23mmmargin of equivalence among treatments Asample size of 50 subjects per treatment arm was considerednecessary given an anticipated dropout rate of 40 Takinginto consideration the duration of the treatment and the

BioMed Research International 5

complexity of the inclusion we expected a high rate ofdropout

28 Randomization Subjects were assigned to treatmentarms using a computer-generated PASS 11 statistical software(version 1108 for Windows PASS LLC Kaysville UT USA)restricted randomization list (ldquoEfronrsquos biased coinrdquo algo-rithm) Subjects were randomized in a 1 1 1 (F 1 F 2 F 3)ratio The software was running on Windows Server 2008R2 Standard SP1 64 Edition (Microsoft USA) Subjectsinvestigator and collaborators were kept blind to productsassignment The randomization list was stored in a safe placeby the in site study director

29 Statistical Methods Statistical analysis was performedusing NCSS 8 (version 804 for Windows NCCS LLC)running on Windows Server 2008 R2 64 Edition Internalconsistency was checked before statistical analysis in orderto assess subjectrsquos reliability For IBS-C related symptomsthe number of responders to treatment was calculated Aresponder was defined as the subject reporting a decrease ofsymptoms of at least 30 compared to the basal condition forat least 50 of the intervention time (Guidance for Industry-Irritable Bowel Syndrome-Clinical Evaluation of Drugs forTreatment) Positivenegative responses to treatmentplacebowere tested using Fisherrsquos exact ratio test HR-QOL andfollow-up data were submitted to RM-ANOVA followed byTukey-Kramer posttest Data normality was checked usingskewness kurtosis and omnibus test Statistical significancewas reported as follows lowast119875 lt 005 lowastlowast119875 lt 001 and lowastlowastlowast119875 lt0001

In order to apply generalized linear mixed model(GLMM) under Poisson-lognormal error to account forhigher variation at the lower end of target abundanceMCMCqPCR R package [25] was used to convert Ct data inbacterial counts The conversion to approximate counts usesthe following formula

Count 119864(Ct1minusCt) (1)

where 119864 is the efficiency of amplification and Ct1 is the num-ber of qPCR cycles required to detect a single target mole-cule

Markov Chain Monte Carlo (MCMC) algorithm imple-mented in the package is used to sample from the jointposterior distribution over all model parameters in order toestimate the effects of all experimental factors on the levels ofspecific microbial species GLMM was used to test whetherthe levels of the different microbial species in differentformulation groups (F 1 F 2 and F 3) differed between thebaseline (1199050) and the subsequent time points (11990510 11990530 11990560and 11990590)

The experimental design is incorporated into the follow-ing model

ln(counts) sim species + speciesFormulation + spe-ciesTime + sample + speciessample + speciesresidual

where the logarithm of bacterial counting rate is the vari-able response and the fixed factors are Formulation and

Table 3 Demographic and baseline characteristics of the subjectsof the clinical studylowast Data are mean plusmn SE

F 1 F 2 F 3Number of subjects 50 50 50Age 360 plusmn 119 380 plusmn 121 381 plusmn 135Bloating (VAS) 63 plusmn 02 62 plusmn 02 61 plusmn 02Abdominal pain 50 plusmn 02 49 plusmn 02 48 plusmn 02Constipation 66 plusmn 01 65 plusmn 01 61 plusmn 02Abdominal cramps 42 plusmn 02 39 plusmn 02 41 plusmn 02Flatulence 46 plusmn 03 44 plusmn 02 44 plusmn 02lowastThere were no statistically significant differences between the three groups

Time (baseline and subsequent time points) The threeremaining factors sample (different subjects of the study)speciessampleand speciesresidual are defined as randomfactors accounting for the variation in quality and quantityof biological material among samples

To produce graphical chart we used ggplot2 R package[26]

3 Results

31 Subjects of the Study The study was conducted betweenSeptember 2013 and January 2015 A total of 157 maleand female subjects suffering from IBS-C were successfullyenrolled (Figure 2) Subjects were randomized to active orplacebo treatments as follows (i) 53 subjects were random-ized to F 1 (ii) 52 subjects were randomized to F 2 and (iii)52 subjects were randomized to F 3 Seven subjects discon-tinued intervention because they were no longer interestedin participating in the study

After randomization subjects attended four clinic visitsevery month except for the first visit (10 days after productuse) The population was Caucasian and the mean (plusmnSD) agewas 374plusmn125 years Demographic and baseline characteris-tics (Table 3) were similar across treatment arms indicatingan unbiased randomization The per-protocol populationconsisted of 150 subjects All subjects were included in thesafety analysis dataset

32 Primary Efficacy Endpoint The results of IBS-C relatedsymptoms amelioration of the responder are reported inFigure 3The number of responders to treatment was definedas the subject reporting a decrease of symptoms of at least30 compared to the basal condition for at least 50 of theintervention time Internal consistency for each item overtime was good (Cronbachrsquos alpha gt 088) The percentage ofresponders for each clinical symptom was higher in the F 1and F 2 group when compared to placebo F 3 (F 1 versusF 3 in the range of 66ndash78 versus 6ndash36 and F 2versus F 3 in the range of 78ndash90 versus 6ndash36) (119875 lt0001) Neither statistical nor clinically significant differenceswere detected between F 1 and F 2 except for constipationsymptom which was less significant during the treatment(119875 lt 001)

6 BioMed Research InternationalEn

rollm

ent

Allo

catio

nA

naly

sis

Placebo

Follo

w-u

p

(ii) Did not receive allocated

(i) Received allocated intervention(i) Received allocated intervention

(ii) Did not receive allocatedintervention (n = 0)

Allocated to intervention (n = 53)

(n = 53)

Allocated to intervention (n = 52)

(n = 52)

intervention (n = 0)

Discontinued intervention (n = 3)Lost to follow-up (n = 0)

Discontinued intervention (n = 2)Lost to follow-up (n = 0)

Discontinued intervention (n = 2)Lost to follow-up (n = 0)

(i) Excluded from analysis (n = 0)(i) Excluded from analysis (n = 0)Analysed (n = 50)Analysed (n = 50)

(i) Excluded from analysis (n = 0)Analysed (n = 50)

Allocated to intervention (n = 52)

(ii) Did not receive allocated intervention(i) Received allocated intervention (n = 52)

n = 0)(

Randomized (n = 157)

(i) Not meeting the inclusioncriteria (n = 40)

(ii) Declined to participate (n = 0)

Excluded (n = 0)

Assessed for eligibility (N = 197)

F_1 F_2

Figure 2 Disposition of the subjects of the study

F_1F_2F_3

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowast

Bloa

ting

Abdo

min

alpa

in

Con

stipa

tion

Abdo

min

alcr

amps

Flat

ulen

ce

0

20

40

60

80

100

Resp

onde

rs (

)

Figure 3 Percentage of responders to IBS-C related symptomduring the treatment period (11990560 days) with probiotic formulationsF 1 and F 2 The Responders was defined as the subject reportinga decrease of symptoms of at least 30 compared to the basalcondition for at least 50 of the intervention time Bloatingabdominal pain constipation abdominal cramps and flatulencesymptoms were assessed on a numbering scale from 0 to 10 foreach item subjects scored Data are mean plusmn SE Upon the squarebrackets are reported the intergroups F 1 and F 2 (versus placeboF 3) statistical analysis (lowastlowastlowast119875 lt 0001) The intergroups F 1 versusF 2 statistical analysis (lowastlowast119875 lt 001) is also reported

The results of HR-QOL are reported in Table 4 Data werereported as the sum of each score given by the subject to eachitem of the HR-QOL questionnaire Internal consistency foreach item over time was good (Cronbachrsquos alphagt 086)TheHR-QOL was ameliorated for subjects treated with both F 1and F 2 during the treatment period Relatively to baselinethe sum of each score given by the subject to each symptom

during the treatment (11990560) was significantly reduced in theprobiotics group (312 plusmn 10 rarr 202 plusmn 09 119875 lt 0001for F 1 group and 320 plusmn 09 rarr 204 plusmn 09 119875 lt 0001for F 2 group) but not so clinically relevant in the placebogroup (300 plusmn 09 rarr 269 plusmn 12 119875 lt 0001 for F 3group) As expected mild amelioration of HR-QOL was seenin the placebo-treated subjects probably due to the placeboeffect The intergroup amelioration of HR-QOL during thetreatment (11990560) was bigger in the actives-treated (F 1 andF 2) subjects compared to placebo-treated (F 3) subjects (F 1versus F 3 202 plusmn 09 versus 269 plusmn 12 and F 2 versus F 3204plusmn 09 versus 269 plusmn 12 119875 lt 0001) Neither statistical norclinically significant differences were found between F 1 andF 2

In addition the analysis of the stool type classificationwas performed (data not shown) The numbers of sampleswith values of 3 4 and 5 according to Bristol scale andrepresenting a healthy bowel movement were calculatedSignificant differences were observed between F 1 or F 2 withrespect to F 3 representing an increase in the number of stoolsamples with a healthier characteristic in the probiotic treatedgroups

33 Secondary Efficacy Endpoint In order to assess themaintenance of the obtained effects the study design foresawa further 30-day follow-up period after the 60-day productintake period The results of IBS-C related symptoms main-tenance for responder are reported in Figure 4 During thefollow-up period (from day 61 to day 90) the percentage ofresponders for each clinical symptom was higher in the F 1and F 2 groups when compared to placebo F 3 (F 1 versusF 3 in the range of 56ndash74versus 10ndash40 and F 2 versusF 3 in the range of 76ndash82 versus 10ndash40) (119875 lt 0001)Neither statistical nor clinically significant differences weredetected between F 1 and F 2 except for abdominal cramps

BioMed Research International 7

Table 4 HR-QOL amelioration at the different times of treatment (1199050 11990510 11990530 and 11990560 days) and at the follow-up period that is 30 daysafter the last product intake (11990590 days) between F 1 and F 2 groups compared with F 3 Bloating abdominal pain constipation abdominalcramps and flatulence were assessed on a numbering scale from 0 to 10 for each item subjects scored Data are mean plusmn SE In brackets isreported the intergroups (versus placebo) statistical analysis

Time (days) F 1 P value F 2 P value F 3 P value F 1 vs F 3 (P value) F 2 vs F 3 (P value)0 312 plusmn 10 320 plusmn 09 300 plusmn 0910 283 plusmn 09 lt001 270 plusmn 08 lt0001 289 plusmn 10 gt005 gt005 gt00530 231 plusmn 09 lt0001 228 plusmn 08 lt0001 278 plusmn 11 lt005 lt001 lt000160 202 plusmn 09 lt0001 204 plusmn 09 lt0001 269 plusmn 12 lt0001 lt0001 lt000190 222 plusmn 10 lt0001 220 plusmn 08 lt005 287 plusmn 12 lt001 lt0001 lt0001

F_1F_2F_3

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowast

lowastlowastlowast

Bloa

ting

Abdo

min

alpa

in

Con

stipa

tion

Abdo

min

alcr

amps

Flat

ulen

ce

0102030405060708090

Resp

onde

rs (

)

Figure 4 Percentage of responders to IBS-C related symptom atthe follow-up period that is 30 days after the last product intake(11990590 days) of probiotic formulations F 1 and F 2 The Responderswas defined as the subject reporting a decrease of symptoms ofat least 30 compared to the basal condition for at least 50of the intervention time Bloating abdominal pain constipationabdominal cramps and flatulence symptoms were assessed on anumbering scale from 0 to 10 for each item subjects scored Data aremean plusmn SE Upon the square brackets are reported the intergroupsF 1 and F 2 (versus placebo F 3) statistical analysis (lowastlowastlowast119875 lt 0001)The intergroups F 1 versus F 2 statistical analysis (lowastlowast119875 lt 001) is alsoreported

symptom which was less significant during the follow-upperiod (119875 lt 001)

The results of HR-QOL are reported in Table 4 Data werereported as the sum of each score given by the subject to eachitem of the HR-QOL questionnaire Data obtained 30 days(11990590) after the last product intake were lower in the probioticgroups with respect to the basal scoring of symptoms at 1199050(312 plusmn 10 rarr 222 plusmn 10 119875 lt 0001 for F 1 group and 320 plusmn09 rarr 220plusmn08119875 lt 005 for F 2 group) but not so clinicallyrelevant in the placebo group (300 plusmn 09 rarr 287 plusmn 12 119875 lt001 for F 3 group)

The intergroup amelioration of HR-QOL was biggerin the actives-treated (F 1 and F 2) subjects compared toplacebo-treated (F 3) subjects (222 plusmn 10 versus 287 plusmn 12and 220plusmn09 versus 287plusmn12 119875 lt 0001) Neither statisticalnor clinically significant differences were detected betweenF 1 and F 2

Comparing follow-up period (11990590) with the end oftreatment period (11990560) the HR-QOL was not significantlydifferent for both F 1 and F 2 probiotic groups indicating themaintenance of the obtained effects

34 Fecal Microbiology Analysis by Quantitative PCR DNAwas extracted from fecal samples of the subjects enrolled inthis study at the times 1199050 11990510 11990530 11990560 and 11990590 from the firstingestion of the probiotic formulations The qPCR analysisdemonstrated that the species-specific sequences associatedwith the probiotics of the formulations were detected onlyin fecal DNA from subjects treated with the formulationsF 1 and F 2 and not with the formulation F 3 and that nosignificant difference was detected between the two kinds offormulations

The qPCR assay for L plantarum and L rhamnosus(contained in the mix F 2) demonstrated a quite similarquantity of these probiotic bacteria during the times oftreatment while B animalis subsp lactis decreases at time 90after the follow-up period Concerning results of probioticscontained in the formulation F 1 we can observe that Lacidophilus increases during the treatment but decreases afterthe follow-up period while the quantity of L reuteri wasquite similar during all the period of treatment including time11990590 (Figure 5) All these results indicate that all probioticsutilized in this study were enhanced in the gut tract after theiringestion at least for 90 days the only exceptionwas observedfor B animalis subsp lactis in which a lower concentration ofthis probiotic in the postintervention samples was obtained

4 Discussion

Probiotics exert their actions through interaction with hostintestinal cells Their supplementation significantly modifiesthe intestinal microbiota by increasing lactobacilli and bifi-dobacteria that can improve through the combination withspecific probiotics providing a health benefit to the host[27] Multispecies probiotics may have a variety of differentbeneficial effects particularly on IBS symptoms because eachspecies acts in a particular way on the gastrointestinaltract and two or more species acting together may have asynergistic effect [15]

Although several trials have demonstrated the superiorityof probiotics (above all lactobacilli and bifidobacteria) overplacebo in controlling IBS symptoms [16ndash18] however given

8 BioMed Research International

F_1

F_2

F_3

Time

02468

10

Ratio

of b

acte

rial

coun

ts

02468

10

Ratio

of b

acte

rial

coun

tsRa

tio o

f bac

teria

l

02468

10

coun

ts

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast lowast

lowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowastlowast

lowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowastlowast

lowastlowast

lowastlowastlowastlowast

lowastlowastlowast

lowastlowast

lowastlowastlowast

t10

t30

t60

t90

Figure 5 Ratio of probiotics of formulations (F 1 and F 2 versusF 3) by qPCR of species-specific sequences at the different times oftreatment versus the amount at the baseline time point expressedas bacterial counts Upon the bars is reported the statistical analysisbetween treatments (lowastlowastlowast119875 lt 0001)

the controversies in IBS pathophysiology or lack of clearevidence for gut microbiota abnormalities in patients withIBS additional randomized clinical trials with appropriateendpoints and design are needed to evaluate to which extentprobiotics are a useful therapeutic strategy in the manage-ment of IBS symptoms

In this study a randomized double-blind placebo-controlled clinical trial with two formulations containingdifferent probiotics was developed and the evaluation ofgut microbiota assessment and gastrointestinal benefits ofIBS-C patients was determined until 90 days Multispeciesprobiotics were used for the treatment of IBS-C in our studyL acidophilus L reuteri L plantarum L rhamnosus andB animalis subsp lactis Indeed it is known that the levelof bifidobacteria and lactobacilli species is lower in IBSpatients compared to healthy persons [28 29] and severalstudies show that the supplementation of them or mixturesincluding species of these genera is effective in alleviatingsymptoms of IBS Moreover the selected strains were alreadyknown for their effect on intestinal cell lines as previouslyreported [19]

To investigate the alterations in the intestinal microbiotathe number of lactobacilli and bifidobacteria present in fecal

samples of recruited subjects was determined by quantita-tive real-time PCR The numbers of Lactobacillus spp andBifidobacterium spp of the mixtures (F 1 and F 2) increasedduring the times of treatment until 60 days in the probioticgroups with respect to the placebo group (F 3) All thespecies included in the formulations remained in the gut also30 days after the follow-up from the last ingestion exceptfor Bifidobacterium Our results confirmed data reported byKajander et al These authors demonstrated that all supple-mented strains remained stable during the treatment withthe exception of Bifidobacterium species which decreasedafter treatments with a multispecies probiotic mixture [14]

Moreover in our study significant differences in thenumber of responders to the severity of symptoms wererecorded between the two probiotic mixtures F 1 and F 2with respect to placebo F 3 group (119875 lt 0001) No significantdifferences were registered between F 1 and F 2 (119875 gt 005)and the effects of both of them are significant when comparedto their respective baselinesThese data are in agreement withprevious data from multispecies probiotics treatment of IBSsubjects [14 15] Compared with placebo probiotic groupsF 1 and F 2 were effective for the primary efficacy endpointsof the study as well as for the secondary endpoints thatis the maintaining of the obtained effects 30 days after thelast product intake The change of symptoms is correlated tothe improvement in the quality of life and resulted in beingsignificantly higher in the probiotic groups compared withthe placebo group Although a great number of data derivingfrom literature [16ndash18 30] indicate that probiotics may behelpful in the treatment of IBS symptoms in particular withrespect to constipation their conclusions vary because ofinadequate sample size type of study design and use ofvarious probiotic strains These data are in agreement withour data concerning the improvement of specific probiotictreatment versus placebo (specifically in patients with IBS-C) for some of the endpoints improving symptoms such aspain flatulence and bloating but not others (transit time andurgency and abdominal cramps) [30] Moreover in most ofthe reported cases the decrease in constipation frequencyscore was approximately twofold greater in the probioticgroups than in the placebo groups and these results are in linewith data deriving from our clinical study

Thus the clinical improvement of this study may beassociated with the maintenance (species-specific) of thecompositional stability of the intestinal microbiota fromprobiotics consumption and with their positive effects insubjects affected by irritable bowel syndromes

5 Conclusions

In conclusion the different species of probiotics admin-istered to the IBS-C subjects determine a cooccurrencebetween the changes in the analysed probiotic groups andan improvement of IBS-C symptoms This study representsthe development of a clinical trial that can support the role ofintestinal bacteria in the IBS diseases and the potential role ofprobiotics belonging to various species in themanagement ofthese disorders

BioMed Research International 9

Ethical Approval

All procedures performed in studies involving human partic-ipants were in accordance with the ethical standards of theinstitutional andor national research committee and withthe 1964 Helsinki declaration and its later amendments orcomparable ethical standards

Consent

Informed consent was obtained from all individual partici-pants included in the study

Competing Interests

All the authors declare that they have no conflict of interests

Acknowledgments

The research was conducted through the Probioplus4FoodProject no 30221122 funded by MIUR and LombardyRegion Italy The authors thank Principium Europe Srlfor supplying the bacterial strains and Farcoderm for therecruited subjects of this study

References

[1] P B Eckburg E M Bik C N Bernstein et al ldquoMicrobiologydiversity of the human intestinal microbial florardquo Science vol308 no 5728 pp 1635ndash1638 2005

[2] S K Mazmanian H L Cui A O Tzianabos and D L KasperldquoAn immunomodulatorymolecule of symbiotic bacteria directsmaturation of the host immune systemrdquo Cell vol 122 no 1 pp107ndash118 2005

[3] V R Alonso and F Guarner ldquoLinking the gut microbiota tohuman healthrdquo British Journal of Nutrition vol 109 supplement2 pp S21ndashS26 2013

[4] G Tomasello M Bellavia V D Palumbo M C Gioviale PDamiani and A I L Monte ldquoFrom gut microflora imbalanceto mycobacteria infection is there a relationship with chronicintestinal inflammatory diseasesrdquo Annali Italiani di Chirurgiavol 82 no 5 pp 361ndash368 2011

[5] F Guarner and J-R Malagelada ldquoGut flora in health anddiseaserdquoThe Lancet vol 361 no 9356 pp 512ndash519 2003

[6] J Matto L Maunuksela K Kajander et al ldquoComposition andtemporal stability of gastrointestinal microbiota in irritablebowel syndromemdasha longitudinal study in IBS and controlsubjectsrdquo FEMS Immunology andMedical Microbiology vol 43no 2 pp 213ndash222 2005

[7] C Abraham and J H Cho ldquoMechanisms of disease inflamma-tory bowel diseaserdquo The New England Journal of Medicine vol361 no 21 pp 2066ndash2078 2009

[8] M Bellavia G Damiano M C Gioviale et al ldquoAbnormalexpansion of segmented filamentous bacteria in the gut a rolein pathogenesis of chronic inflammatory intestinal diseasesrdquoReviews in Medical Microbiology vol 22 no 3 pp 45ndash47 2011

[9] M Bellavia G Tomasello M Romeo et al ldquoGut microbiotaimbalance and chaperoning system malfunction are central toulcerative colitis pathogenesis and can be counteracted withspecifically designed probiotics a working hypothesisrdquoMedical

Microbiology and Immunology vol 202 no 6 pp 393ndash4062013

[10] W Strober I Fuss and P Mannon ldquoThe fundamental basis ofinflammatory bowel diseaserdquo Journal of Clinical Investigationvol 117 no 3 pp 514ndash521 2007

[11] M Llopis M Antolin M Carol et al ldquoLactobacillus caseidownregulates commensalsrsquo inflammatory signals in Crohnrsquosdisease mucosardquo Inflammatory Bowel Diseases vol 15 no 2 pp275ndash283 2009

[12] M Pammi A Flores M Leeflang and J Versalovic ldquoMolecularassays in the diagnosis of neonatal sepsis a systematic reviewand meta-analysisrdquo Pediatrics vol 128 no 4 pp e973ndashe9852011

[13] M Venkatesh A Flores R A Luna and J Versalovic ldquoMolecu-larmicrobiologicalmethods in the diagnosis of neonatal sepsisrdquoExpert Review of Anti-Infective Therapy vol 8 no 9 pp 1037ndash1048 2010

[14] K Kajander E Myllyluoma M Rajilic-Stojanovic et al ldquoClin-ical trial multispecies probiotic supplementation alleviates thesymptoms of irritable bowel syndrome and stabilizes intestinalmicrobiotardquoAlimentary Pharmacology andTherapeutics vol 27no 1 pp 48ndash57 2008

[15] J S Yoon W Sohn O Y Lee et al ldquoEffect of multispeciesprobiotics on irritable bowel syndrome a randomized double-blind placebo-controlled trialrdquo Journal of Gastroenterology andHepatology vol 29 no 1 pp 52ndash59 2014

[16] A P S Hungin C Mulligan B Pot et al ldquoSystematicreview probiotics in the management of lower gastrointestinalsymptoms in clinical practicemdashan evidence-based internationalguiderdquo Alimentary Pharmacology and Therapeutics vol 38 no8 pp 864ndash886 2013

[17] A Agrawal L A Houghton J Morris et al ldquoClinical trial theeffects of a fermentedmilk product containing Bifidobacteriumlactis DN-173 010 on abdominal distension and gastrointestinaltransit in irritable bowel syndrome with constipationrdquo Alimen-tary Pharmacology and Therapeutics vol 29 no 1 pp 104ndash1142009

[18] S Guglielmetti D Mora M Gschwender and K PoppldquoRandomised clinical trial Bifidobacterium bifidumMIMBb75significantly alleviates irritable bowel syndrome and improvesquality of lifemdasha double-blind Placebo-Controlled Studyrdquo Ali-mentary Pharmacology and Therapeutics vol 33 no 10 pp1123ndash1132 2011

[19] I Presti G DrsquoOrazio M Labra et al ldquoEvaluation of theprobiotic properties of new Lactobacillus and Bifidobacteriumstrains and their in vitro effectrdquo Applied Microbiology andBiotechnology vol 99 no 13 pp 5613ndash5626 2015

[20] I Aloisio C Santini B Biavati et al ldquoCharacterization of Bifi-dobacterium spp strains for the treatment of enteric disordersin newbornsrdquo Applied Microbiology and Biotechnology vol 96no 6 pp 1561ndash1576 2012

[21] D A Drossman E Corazziari M Delvaux et al EdsRome IIIThe Functional Gastrointestinal Disorders Degnon AssociatesMcLean Va USA 3rd edition 2006

[22] D L Patrick D A Drossman I O Frederick J Dicesare andK L Puder ldquoQuality of life in persons with irritable bowelsyndrome development and validation of a new measurerdquoDigestive Diseases and Sciences vol 43 no 2 pp 400ndash411 1998

[23] S J Lewis and KW Heaton ldquoStool form scale as a useful guideto intestinal transit timerdquo Scandinavian Journal of Gastroen-terology vol 32 no 9 pp 920ndash924 1997

10 BioMed Research International

[24] M Enrico Biological sciences [PhD thesis] The University ofMilano-Bicocca 2015

[25] M V Matz R M Wright and J G Scott ldquoNo control genesrequired bayesian analysis of qRT-PCR datardquo PloS ONE vol 8no 8 Article ID e71448 2013

[26] H Wickham ggplot2 Elegant Graphics for Data AnalysisSpringer Science amp BusinessMedia Springer-Verlag New YorkNY USA 2009

[27] J Plaza-Diaz C Gomez-Llorente L Fontana and A GilldquoModulation of immunity and inflammatory gene expressionin the gut in inflammatory diseases of the gut and in the liverby probioticsrdquoWorld Journal of Gastroenterology vol 20 no 42pp 15632ndash15649 2014

[28] A P M Kerckhoffs M Samsom M E van der Rest etal ldquoLower Bifidobacteria counts in both duodenal mucosa-associated and fecal microbiota in irritable bowel syndromepatientsrdquo World Journal of Gastroenterology vol 15 no 23 pp2887ndash2892 2009

[29] E Malinen T Rinttila K Kajander et al ldquoAnalysis of thefecal microbiota of irritable bowel syndrome patients andhealthy controls with real-time PCRrdquo American Journal ofGastroenterology vol 100 no 2 pp 373ndash382 2005

[30] P Moayyedi A C Ford N J Talley et al ldquoThe efficacy ofprobiotics in the treatment of irritable bowel syndrome asystematic reviewrdquo Gut vol 59 no 3 pp 325ndash332 2010

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

2 BioMed Research International

to pathological conditionsMoreover aberrant stimulation ofthe immune system leading to inflammation may be reliablyencountered as the potential link between dysbiosis andmetabolic diseases [7ndash9]

Experimental evidences have increasingly shown a cor-relation between microbiota imbalance and the induction ofIrritable Bowel Syndrome In particular dysbiosis was provento underlie a modification of intercellular tight junctionsresponsible under normal conditions for the correct structureof the epithelial layer of intestinal mucosa which is knownto increase the mucosal permeability Consequently antigenshave been detected in the intercellular space with the activa-tion of the inflammatory cascade production of cytokinesand tissue damage [9ndash11]

Oral administration of appropriate probiotic strains maytherefore be beneficial to health and in particular with respectto IBS However clinical data reporting changes in thedetection of ingested probiotic traceability in the gastroin-testinal tract of patients and the related effects on the gutare still few and inconclusive [12ndash15] Studies have reportedan improvement in global symptoms with probiotics whileothers have failed to demonstrate any benefit [16ndash18]

Moreover it is widely known that the effect of probioticsis species-specific [19 20] These indications combined withthe diversity and complexity of IBS may indicate that aprobiotic combination could be more efficient than a singlestrain in this particular syndrome Some authors suggestedthat multispecies probiotics may in some conditions be moreefficient than monospecies probiotics due to for exampleenhanced intestinal adhesion and the production of a greatervariety of antimicrobial compounds compared with singleprobiotic [15]

In this regard the present study was aimed at testingdifferent probiotics which we had previously characterized[19] for their in vitro activities in order to demonstrateby means of in vivo detection procedures their distinctiveeffects on the intestine after oral administration The aimof this randomized double-blind placebo-controlled studywas to investigate the efficacy of two probiotic formulationsin ameliorating IBS-C subjects The effects of probioticson IBS symptoms in comparison with placebo and theirassessment in the gut microbiota after probiotic therapy byanalysing fecal bacteria were evaluated In order to reachthis goal 150 volunteer subjects were recruited and includedin three groups (F 1 F 2 and F 3) Each group received60-day oral administration of different probiotic mixturesF 1 containing L acidophilus and L reuteri F 2 containingL plantarum L rhamnosus and B animalis subsp lactisand F 3 containing placebo At different time points afterprobiotic oral administration fecal microflora was analysedby real-time quantitative PCR performed on DNA fromstool samples of the subjects An additional 30-day follow-up period was encountered in order to assess whetherthe observed beneficial effects still persist after treatmentsuspension

Our investigation provides a relevant contribution toinvestigate the efficacy of multispecies probiotics in treatingIBS-C and other gastrointestinal syndromes related to the gutdisorders

2 Materials and Methods

21 Study Design This randomized double-blind study wascarried out in accordance with the Declaration of Helsinkiand the Good Clinical Practice guidelines E6 The study pro-tocol and the informed consent form were approved by theldquoIndependent Ethical Committee for Non-PharmacologicalClinical studiesrdquo during its meeting on July 17 2013 All sub-jects provided a written informed consent before initiationof any study-related procedures The study took place atFarcoderm Srl facilities Farcoderm Srl is an independenttesting laboratory for in vitro and in vivo safety and efficacyassessment of cosmetics food supplements and medicaldevices

Enrolled subjects were randomly assigned to receive onecapsule of the two different formulations of probiotics (mixF 1 and mix F 2) or placebo (mix F 3) once daily for a periodof 60 days andwere followed up for a further period of 30 daysafter a follow-up period from the last ingestion of the testedproducts

The tested products consisted of food supplements (cap-sules) containing lactobacilli and bifidobacteria (PrincipiumEurope Srl Solaro MI Italy) (Table 1) The compositionof the probiotic mix F 1 was as follows 5 times 109 CFU Lacidophilus (30mg as lyophilized) 5 times 109 CFU L reuteri(30mg as lyophilized) 330mg inulin 5mg silica and 5mgtalc The F 2 composition was as follows 5 times 109 CFU Lplantarum (12mg as lyophilized) 5 times 109 CFU L rhamnosus(20mg as lyophilized) 5 times 109 CFU B animalis subsp lactis(60mg as lyophilized) 298mg inulin 5mg silica and 5mgtalc Placebo (F 3) compositionwas as follows 390mg inulin5mg silica 5mg talc

The study flow and the schedule of assessment chart isreported in Figure 1 A questionnaire and an explanation ofthe protocol of the study were given to the subjects Symptomquestionnaire was performed as an interview to the enrolledsubjects at the time points of the study (each 10 days)

Stool samples for fecal microbiota analysis were obtainedat the start of the treatment (1199050) and at times 11990510 11990530 and11990560 days during the treatment for a total period of 60 daysfollowed by a sample at 11990590 days after washing up for 30days for a total period of 90 days from the start of the treat-ment

22 Subjects of the Study Eligible subjects were all adultmales and females aged between 18 and 65 years sufferingfrom Irritable Bowel Syndrome with constipation (IBS-C)diagnosed by clinical analyses and self-reported interviewsSubjects suffering from IBS-C were screened by means ofthe Rome III diagnostic criteria questionnaire [21] Exclusioncriteria were (i) pregnancy or the intention to become preg-nant (ii) lactation (iii) food intolerancesallergy (iv) knownhistory of other gastrointestinal disorders (v) chronic oracute gastrointestinal disorders (vi) participation in anothersimilar study and (vii) unwillingness or inability to complywith the study protocol requirements

The study further excluded subjects using food supple-ments (included probiotics different from the study) or drugscontaining actives having an influence on gastrointestinal

BioMed Research International 3

Table 1 List of the strains used in this study deposit number and the most relevant antimicrobial activities described in Presti et al 2015[19] Abbreviations used in the present work were also included

Probiotic strain Deposit number Antimicrobial activity V119904 AbbrLactobacillus rhamnosus LRH020(formerly PBS070) DSM 25568 C albicans E faecalis P aeruginosa S aureus E coli L Rha

Lactobacillus plantarum PBS067 DSM 24937 C albicans E faecalis P aeruginosa S aureus E coli L PlaBifidobacterium animalis subsp lactisBL050 (formerly PBS075) DSM 25566 E faecalis P aeruginosa E coli B Lac

Lactobacillus acidophilus PBS066 DSM 24936 C albicans E faecalis P aeruginosa S aureus E coli L AciLactobacillus reuteri PBS072 DSM 25175 E faecalis L Reu

No Yes

No Yes EnrolmentStart

10

Informed consent signature

Eligibility checkRandomization

Rome III diagnostic criteriaProduct intakeAlimentary diary

EndpointsStool collectionSymptoms questionnaireQuality of life (QoL)

No

Yes

End

30

60

90

0

DB screening

1st visit

2nd visit

3rd visit

4th visit

Basal visit

Screening of eligible participants in the Farcoderm volunteers database using the following keywords ldquosexrdquo ldquoagerdquoldquopathologyrdquo ldquotesting preferencesrdquo (setting the query as follows sex

Screening periodSubj meet incl crit

Subj meet incl crit

Subj meet incl crit Screening visit

1st subject enrolled Last subject screened0610201417092013

1st subject screened

pathology ldquonullrdquo testing preferences ldquofood supplementsrdquo)

Last subject completed

Study-related procedures

Medical examination

13012015

17092013

= ldquofemalerdquo and ldquomalerdquo ldquo rdquo18 lt age lt ldquo65rdquo

Figure 1 Study flow and schedule of assessment chart

physiology Changes in diet or lifestyle were not allowedduring all the study period

23 Assessment of Clinical Effects

231 Endpoints Patientswere evaluated five times during thecourse of the study at baseline after 10 30 and 60 days fromthe start period and 30 days after the follow-up of the inter-vention period to assess postintervention effects Primaryefficacy endpoints were the proportion of participants whoseIBS symptoms after probiotic supplementations were relievedup to 60 days and the assessment of their gut microbiotaThe secondary efficacy endpoint was the maintenance of theobtained effects 30 days after the last product(s) intake

232 Symptoms Questionnaire IBS-C related symptoms ofsubjects were reported daily by a questionnaire according toGuide Lines of FDA (Guidance for Industry-Irritable BowelSyndrome-Clinical Evaluation of Drugs for Treatment) IBS-C questionnaire consisted of 5 items as follows (i) bloat-ing (ii) abdominal pain (iii) constipation (iv) abdominalcramps and (v) flatulence For each item subjects scored thesymptom severity on a 10-point Visual Analogue Scale (VAS)Data are reported as the mean values after every 10 days

233 Health-Related Quality of Life (HR-QOL) HR-QOLwas assessed by means of the Italian version of the Quality ofLife Measure for Persons with IBS [22] From the original 34items questionnaire the following 12 items were selected (i) I

4 BioMed Research International

Table 2 List of primers used in this study

Probiotic Primer code Sequence (51015840 rarr 31015840) DNA region Amplifiedlength (bp)

L rhamnosus LraF CTAGCGGGTGCGACTTTGTT 16S23S IS 123 bpLraR CAGCGGTTATGCGATGCGAA

L plantarum Lpl2F CATTGGAACCGAACCAGTTG 16S23S IS 203 bpLpl2R CGGTGTTCTCGGTTTCATTATG

B animalis subsp lactis AnimF GCACGGTTTTGTGGCTGG pre16S 171 bpAnimR GACCTGGGGGACACACTG

L acidophilus Lacid2F GGGCAAATCACGAACGAGTA pre16S 132 bpLacid2R CTTTGTTTTCGTTCGCTTCA

L reuteri Lreu2F GTTGACGAAAGAATGAAATCCA pre16S 118 bpLreu2R TCATGTCGTCAATCAGATGTCA

am embarrassed by the smell caused by my bowel problems(ii) I feel vulnerable to other illnesses because of my bowelproblems (iii) I feel fat because of my bowel problems (iv) Ifeel my life is less enjoyable because of my bowel problems(v) I feel depressed about my bowel problems (vi) I have towatch the amount of food I eat because ofmy bowel problems(vii) because of my bowel problems sexual activity is difficultforme (viii) I feel angry that I have bowel problems (ix) I feelI get less done because of my bowel problems (x) my bowelproblems limit what I can wear (xi) I have to watch the kindof food I eat because of my bowel problems and (xii) I fearthat I wonrsquot be able to have a bowel movement

For each item the following five-point response scale wasused 1 not at all 2 slightly 3 moderately 4 quite a bit and5 extremely HR-QOL was interviewer-administered

24 Fecal Samples (Stools Type Classification) Fecal sampleswere collected from subjects at 11990510 11990530 11990560 and 11990590 timepoints during the study Fresh fecal samples were homoge-nized by vortex mixing of the fecal mass and separated intoaliquots to be stored at minus80∘C until the analysis using DNA-based method quantitative PCR

Stool types were classified according to Bristol scale[23] Bristol values were divided in two categories values3 (sausage shape with cracks in the surface normal) 4(smooth soft sausage or snake normal) and 5 (soft blobswith clear-cut edges lacking fiber) corresponding to healthybowel situation were assigned to class 1 whereas values1 (separate hard lumps very constipated) 2 (lumpy andsausage like slightly constipated) 6 (mushy consistency withragged edges inflammation) and 7 (liquid consistency withno solid pieces inflammation) were assigned to class 0 Thenumber of volunteer subjects with stool samples with Bristolvalues belonging to class 1 was calculated for each treatmentand for each experimental time

25 Probiotic Strains and DNA Extraction In this study atotal of four Lactobacillus spp strains and one Bifidobac-terium strain supplied from a private collection were takeninto consideration for the preparation of the two formulations(F 1 and F 2) Table 1 describes the characteristics of each

strain In order to prepare standard curves of DNA extractedfrom probiotics microbial cultures were performed in MRS(Conda) medium and incubated at 37∘C for 24 hours inanaerobic conditions using anaerobic atmosphere generationbags (Anaerogen Oxoid) For B animalis subsp lactis asupplementation of 03 gL L-cysteine hydrochloride mono-hydrate was included in the growthmedium (cMRS) (Sigma-Aldrich)

DNA from microbial cultures was extracted by the ZRfecal DNA MiniPREP (Zymo Research) A total of 1mL of109 CFUmL culture was used for obtaining genomic DNAfollowing the protocol provided by the manufacturer

DNA extraction from stool samples was performed from150mg of feces by the ZR fecal DNA MiniPREP BothDNA extracted from probiotic cultures and DNA from stoolsamples were utilized to perform qPCR

26 Fecal Microbiology Analysis by Quantitative PCR qPCRreactions were carried out using an ABI 7500 (AppliedBiosystems) and the SsoFast EvaGreen Supermix with LowROX (BIO-RAD) dye We designed species-specific primersets developed by the authors in a previous study and reportedin Table 2 [24] Reactions were carried out in a 10120583L qPCRmix containing 5120583L of SsoFast EvaGreen Supermix with LowROX 02 120583L of 10 120583M forward primer and 10 120583M reverseprimer 4 120583L of DNA template and 24120583L of H

2O according

to the following qPCR program 101015840 95∘C and 40 cycles of 151015840101584095∘C and 11015840 60∘C (followed by a dissociation step)

For each strain standard curves were constructed usingDNA extracted from microbial cultures using tenfold dilu-tions ranging from 108 CFUmL to 10CFUmL Each DNAsample both from feces and from culture dilution wasanalysed in triplicate

27 Sample Size Sample size was calculated with a two-side 5 significance level and a power of 80 taking intoaccount a 23mmmargin of equivalence among treatments Asample size of 50 subjects per treatment arm was considerednecessary given an anticipated dropout rate of 40 Takinginto consideration the duration of the treatment and the

BioMed Research International 5

complexity of the inclusion we expected a high rate ofdropout

28 Randomization Subjects were assigned to treatmentarms using a computer-generated PASS 11 statistical software(version 1108 for Windows PASS LLC Kaysville UT USA)restricted randomization list (ldquoEfronrsquos biased coinrdquo algo-rithm) Subjects were randomized in a 1 1 1 (F 1 F 2 F 3)ratio The software was running on Windows Server 2008R2 Standard SP1 64 Edition (Microsoft USA) Subjectsinvestigator and collaborators were kept blind to productsassignment The randomization list was stored in a safe placeby the in site study director

29 Statistical Methods Statistical analysis was performedusing NCSS 8 (version 804 for Windows NCCS LLC)running on Windows Server 2008 R2 64 Edition Internalconsistency was checked before statistical analysis in orderto assess subjectrsquos reliability For IBS-C related symptomsthe number of responders to treatment was calculated Aresponder was defined as the subject reporting a decrease ofsymptoms of at least 30 compared to the basal condition forat least 50 of the intervention time (Guidance for Industry-Irritable Bowel Syndrome-Clinical Evaluation of Drugs forTreatment) Positivenegative responses to treatmentplacebowere tested using Fisherrsquos exact ratio test HR-QOL andfollow-up data were submitted to RM-ANOVA followed byTukey-Kramer posttest Data normality was checked usingskewness kurtosis and omnibus test Statistical significancewas reported as follows lowast119875 lt 005 lowastlowast119875 lt 001 and lowastlowastlowast119875 lt0001

In order to apply generalized linear mixed model(GLMM) under Poisson-lognormal error to account forhigher variation at the lower end of target abundanceMCMCqPCR R package [25] was used to convert Ct data inbacterial counts The conversion to approximate counts usesthe following formula

Count 119864(Ct1minusCt) (1)

where 119864 is the efficiency of amplification and Ct1 is the num-ber of qPCR cycles required to detect a single target mole-cule

Markov Chain Monte Carlo (MCMC) algorithm imple-mented in the package is used to sample from the jointposterior distribution over all model parameters in order toestimate the effects of all experimental factors on the levels ofspecific microbial species GLMM was used to test whetherthe levels of the different microbial species in differentformulation groups (F 1 F 2 and F 3) differed between thebaseline (1199050) and the subsequent time points (11990510 11990530 11990560and 11990590)

The experimental design is incorporated into the follow-ing model

ln(counts) sim species + speciesFormulation + spe-ciesTime + sample + speciessample + speciesresidual

where the logarithm of bacterial counting rate is the vari-able response and the fixed factors are Formulation and

Table 3 Demographic and baseline characteristics of the subjectsof the clinical studylowast Data are mean plusmn SE

F 1 F 2 F 3Number of subjects 50 50 50Age 360 plusmn 119 380 plusmn 121 381 plusmn 135Bloating (VAS) 63 plusmn 02 62 plusmn 02 61 plusmn 02Abdominal pain 50 plusmn 02 49 plusmn 02 48 plusmn 02Constipation 66 plusmn 01 65 plusmn 01 61 plusmn 02Abdominal cramps 42 plusmn 02 39 plusmn 02 41 plusmn 02Flatulence 46 plusmn 03 44 plusmn 02 44 plusmn 02lowastThere were no statistically significant differences between the three groups

Time (baseline and subsequent time points) The threeremaining factors sample (different subjects of the study)speciessampleand speciesresidual are defined as randomfactors accounting for the variation in quality and quantityof biological material among samples

To produce graphical chart we used ggplot2 R package[26]

3 Results

31 Subjects of the Study The study was conducted betweenSeptember 2013 and January 2015 A total of 157 maleand female subjects suffering from IBS-C were successfullyenrolled (Figure 2) Subjects were randomized to active orplacebo treatments as follows (i) 53 subjects were random-ized to F 1 (ii) 52 subjects were randomized to F 2 and (iii)52 subjects were randomized to F 3 Seven subjects discon-tinued intervention because they were no longer interestedin participating in the study

After randomization subjects attended four clinic visitsevery month except for the first visit (10 days after productuse) The population was Caucasian and the mean (plusmnSD) agewas 374plusmn125 years Demographic and baseline characteris-tics (Table 3) were similar across treatment arms indicatingan unbiased randomization The per-protocol populationconsisted of 150 subjects All subjects were included in thesafety analysis dataset

32 Primary Efficacy Endpoint The results of IBS-C relatedsymptoms amelioration of the responder are reported inFigure 3The number of responders to treatment was definedas the subject reporting a decrease of symptoms of at least30 compared to the basal condition for at least 50 of theintervention time Internal consistency for each item overtime was good (Cronbachrsquos alpha gt 088) The percentage ofresponders for each clinical symptom was higher in the F 1and F 2 group when compared to placebo F 3 (F 1 versusF 3 in the range of 66ndash78 versus 6ndash36 and F 2versus F 3 in the range of 78ndash90 versus 6ndash36) (119875 lt0001) Neither statistical nor clinically significant differenceswere detected between F 1 and F 2 except for constipationsymptom which was less significant during the treatment(119875 lt 001)

6 BioMed Research InternationalEn

rollm

ent

Allo

catio

nA

naly

sis

Placebo

Follo

w-u

p

(ii) Did not receive allocated

(i) Received allocated intervention(i) Received allocated intervention

(ii) Did not receive allocatedintervention (n = 0)

Allocated to intervention (n = 53)

(n = 53)

Allocated to intervention (n = 52)

(n = 52)

intervention (n = 0)

Discontinued intervention (n = 3)Lost to follow-up (n = 0)

Discontinued intervention (n = 2)Lost to follow-up (n = 0)

Discontinued intervention (n = 2)Lost to follow-up (n = 0)

(i) Excluded from analysis (n = 0)(i) Excluded from analysis (n = 0)Analysed (n = 50)Analysed (n = 50)

(i) Excluded from analysis (n = 0)Analysed (n = 50)

Allocated to intervention (n = 52)

(ii) Did not receive allocated intervention(i) Received allocated intervention (n = 52)

n = 0)(

Randomized (n = 157)

(i) Not meeting the inclusioncriteria (n = 40)

(ii) Declined to participate (n = 0)

Excluded (n = 0)

Assessed for eligibility (N = 197)

F_1 F_2

Figure 2 Disposition of the subjects of the study

F_1F_2F_3

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowast

Bloa

ting

Abdo

min

alpa

in

Con

stipa

tion

Abdo

min

alcr

amps

Flat

ulen

ce

0

20

40

60

80

100

Resp

onde

rs (

)

Figure 3 Percentage of responders to IBS-C related symptomduring the treatment period (11990560 days) with probiotic formulationsF 1 and F 2 The Responders was defined as the subject reportinga decrease of symptoms of at least 30 compared to the basalcondition for at least 50 of the intervention time Bloatingabdominal pain constipation abdominal cramps and flatulencesymptoms were assessed on a numbering scale from 0 to 10 foreach item subjects scored Data are mean plusmn SE Upon the squarebrackets are reported the intergroups F 1 and F 2 (versus placeboF 3) statistical analysis (lowastlowastlowast119875 lt 0001) The intergroups F 1 versusF 2 statistical analysis (lowastlowast119875 lt 001) is also reported

The results of HR-QOL are reported in Table 4 Data werereported as the sum of each score given by the subject to eachitem of the HR-QOL questionnaire Internal consistency foreach item over time was good (Cronbachrsquos alphagt 086)TheHR-QOL was ameliorated for subjects treated with both F 1and F 2 during the treatment period Relatively to baselinethe sum of each score given by the subject to each symptom

during the treatment (11990560) was significantly reduced in theprobiotics group (312 plusmn 10 rarr 202 plusmn 09 119875 lt 0001for F 1 group and 320 plusmn 09 rarr 204 plusmn 09 119875 lt 0001for F 2 group) but not so clinically relevant in the placebogroup (300 plusmn 09 rarr 269 plusmn 12 119875 lt 0001 for F 3group) As expected mild amelioration of HR-QOL was seenin the placebo-treated subjects probably due to the placeboeffect The intergroup amelioration of HR-QOL during thetreatment (11990560) was bigger in the actives-treated (F 1 andF 2) subjects compared to placebo-treated (F 3) subjects (F 1versus F 3 202 plusmn 09 versus 269 plusmn 12 and F 2 versus F 3204plusmn 09 versus 269 plusmn 12 119875 lt 0001) Neither statistical norclinically significant differences were found between F 1 andF 2

In addition the analysis of the stool type classificationwas performed (data not shown) The numbers of sampleswith values of 3 4 and 5 according to Bristol scale andrepresenting a healthy bowel movement were calculatedSignificant differences were observed between F 1 or F 2 withrespect to F 3 representing an increase in the number of stoolsamples with a healthier characteristic in the probiotic treatedgroups

33 Secondary Efficacy Endpoint In order to assess themaintenance of the obtained effects the study design foresawa further 30-day follow-up period after the 60-day productintake period The results of IBS-C related symptoms main-tenance for responder are reported in Figure 4 During thefollow-up period (from day 61 to day 90) the percentage ofresponders for each clinical symptom was higher in the F 1and F 2 groups when compared to placebo F 3 (F 1 versusF 3 in the range of 56ndash74versus 10ndash40 and F 2 versusF 3 in the range of 76ndash82 versus 10ndash40) (119875 lt 0001)Neither statistical nor clinically significant differences weredetected between F 1 and F 2 except for abdominal cramps

BioMed Research International 7

Table 4 HR-QOL amelioration at the different times of treatment (1199050 11990510 11990530 and 11990560 days) and at the follow-up period that is 30 daysafter the last product intake (11990590 days) between F 1 and F 2 groups compared with F 3 Bloating abdominal pain constipation abdominalcramps and flatulence were assessed on a numbering scale from 0 to 10 for each item subjects scored Data are mean plusmn SE In brackets isreported the intergroups (versus placebo) statistical analysis

Time (days) F 1 P value F 2 P value F 3 P value F 1 vs F 3 (P value) F 2 vs F 3 (P value)0 312 plusmn 10 320 plusmn 09 300 plusmn 0910 283 plusmn 09 lt001 270 plusmn 08 lt0001 289 plusmn 10 gt005 gt005 gt00530 231 plusmn 09 lt0001 228 plusmn 08 lt0001 278 plusmn 11 lt005 lt001 lt000160 202 plusmn 09 lt0001 204 plusmn 09 lt0001 269 plusmn 12 lt0001 lt0001 lt000190 222 plusmn 10 lt0001 220 plusmn 08 lt005 287 plusmn 12 lt001 lt0001 lt0001

F_1F_2F_3

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowast

lowastlowastlowast

Bloa

ting

Abdo

min

alpa

in

Con

stipa

tion

Abdo

min

alcr

amps

Flat

ulen

ce

0102030405060708090

Resp

onde

rs (

)

Figure 4 Percentage of responders to IBS-C related symptom atthe follow-up period that is 30 days after the last product intake(11990590 days) of probiotic formulations F 1 and F 2 The Responderswas defined as the subject reporting a decrease of symptoms ofat least 30 compared to the basal condition for at least 50of the intervention time Bloating abdominal pain constipationabdominal cramps and flatulence symptoms were assessed on anumbering scale from 0 to 10 for each item subjects scored Data aremean plusmn SE Upon the square brackets are reported the intergroupsF 1 and F 2 (versus placebo F 3) statistical analysis (lowastlowastlowast119875 lt 0001)The intergroups F 1 versus F 2 statistical analysis (lowastlowast119875 lt 001) is alsoreported

symptom which was less significant during the follow-upperiod (119875 lt 001)

The results of HR-QOL are reported in Table 4 Data werereported as the sum of each score given by the subject to eachitem of the HR-QOL questionnaire Data obtained 30 days(11990590) after the last product intake were lower in the probioticgroups with respect to the basal scoring of symptoms at 1199050(312 plusmn 10 rarr 222 plusmn 10 119875 lt 0001 for F 1 group and 320 plusmn09 rarr 220plusmn08119875 lt 005 for F 2 group) but not so clinicallyrelevant in the placebo group (300 plusmn 09 rarr 287 plusmn 12 119875 lt001 for F 3 group)

The intergroup amelioration of HR-QOL was biggerin the actives-treated (F 1 and F 2) subjects compared toplacebo-treated (F 3) subjects (222 plusmn 10 versus 287 plusmn 12and 220plusmn09 versus 287plusmn12 119875 lt 0001) Neither statisticalnor clinically significant differences were detected betweenF 1 and F 2

Comparing follow-up period (11990590) with the end oftreatment period (11990560) the HR-QOL was not significantlydifferent for both F 1 and F 2 probiotic groups indicating themaintenance of the obtained effects

34 Fecal Microbiology Analysis by Quantitative PCR DNAwas extracted from fecal samples of the subjects enrolled inthis study at the times 1199050 11990510 11990530 11990560 and 11990590 from the firstingestion of the probiotic formulations The qPCR analysisdemonstrated that the species-specific sequences associatedwith the probiotics of the formulations were detected onlyin fecal DNA from subjects treated with the formulationsF 1 and F 2 and not with the formulation F 3 and that nosignificant difference was detected between the two kinds offormulations

The qPCR assay for L plantarum and L rhamnosus(contained in the mix F 2) demonstrated a quite similarquantity of these probiotic bacteria during the times oftreatment while B animalis subsp lactis decreases at time 90after the follow-up period Concerning results of probioticscontained in the formulation F 1 we can observe that Lacidophilus increases during the treatment but decreases afterthe follow-up period while the quantity of L reuteri wasquite similar during all the period of treatment including time11990590 (Figure 5) All these results indicate that all probioticsutilized in this study were enhanced in the gut tract after theiringestion at least for 90 days the only exceptionwas observedfor B animalis subsp lactis in which a lower concentration ofthis probiotic in the postintervention samples was obtained

4 Discussion

Probiotics exert their actions through interaction with hostintestinal cells Their supplementation significantly modifiesthe intestinal microbiota by increasing lactobacilli and bifi-dobacteria that can improve through the combination withspecific probiotics providing a health benefit to the host[27] Multispecies probiotics may have a variety of differentbeneficial effects particularly on IBS symptoms because eachspecies acts in a particular way on the gastrointestinaltract and two or more species acting together may have asynergistic effect [15]

Although several trials have demonstrated the superiorityof probiotics (above all lactobacilli and bifidobacteria) overplacebo in controlling IBS symptoms [16ndash18] however given

8 BioMed Research International

F_1

F_2

F_3

Time

02468

10

Ratio

of b

acte

rial

coun

ts

02468

10

Ratio

of b

acte

rial

coun

tsRa

tio o

f bac

teria

l

02468

10

coun

ts

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast lowast

lowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowastlowast

lowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowastlowast

lowastlowast

lowastlowastlowastlowast

lowastlowastlowast

lowastlowast

lowastlowastlowast

t10

t30

t60

t90

Figure 5 Ratio of probiotics of formulations (F 1 and F 2 versusF 3) by qPCR of species-specific sequences at the different times oftreatment versus the amount at the baseline time point expressedas bacterial counts Upon the bars is reported the statistical analysisbetween treatments (lowastlowastlowast119875 lt 0001)

the controversies in IBS pathophysiology or lack of clearevidence for gut microbiota abnormalities in patients withIBS additional randomized clinical trials with appropriateendpoints and design are needed to evaluate to which extentprobiotics are a useful therapeutic strategy in the manage-ment of IBS symptoms

In this study a randomized double-blind placebo-controlled clinical trial with two formulations containingdifferent probiotics was developed and the evaluation ofgut microbiota assessment and gastrointestinal benefits ofIBS-C patients was determined until 90 days Multispeciesprobiotics were used for the treatment of IBS-C in our studyL acidophilus L reuteri L plantarum L rhamnosus andB animalis subsp lactis Indeed it is known that the levelof bifidobacteria and lactobacilli species is lower in IBSpatients compared to healthy persons [28 29] and severalstudies show that the supplementation of them or mixturesincluding species of these genera is effective in alleviatingsymptoms of IBS Moreover the selected strains were alreadyknown for their effect on intestinal cell lines as previouslyreported [19]

To investigate the alterations in the intestinal microbiotathe number of lactobacilli and bifidobacteria present in fecal

samples of recruited subjects was determined by quantita-tive real-time PCR The numbers of Lactobacillus spp andBifidobacterium spp of the mixtures (F 1 and F 2) increasedduring the times of treatment until 60 days in the probioticgroups with respect to the placebo group (F 3) All thespecies included in the formulations remained in the gut also30 days after the follow-up from the last ingestion exceptfor Bifidobacterium Our results confirmed data reported byKajander et al These authors demonstrated that all supple-mented strains remained stable during the treatment withthe exception of Bifidobacterium species which decreasedafter treatments with a multispecies probiotic mixture [14]

Moreover in our study significant differences in thenumber of responders to the severity of symptoms wererecorded between the two probiotic mixtures F 1 and F 2with respect to placebo F 3 group (119875 lt 0001) No significantdifferences were registered between F 1 and F 2 (119875 gt 005)and the effects of both of them are significant when comparedto their respective baselinesThese data are in agreement withprevious data from multispecies probiotics treatment of IBSsubjects [14 15] Compared with placebo probiotic groupsF 1 and F 2 were effective for the primary efficacy endpointsof the study as well as for the secondary endpoints thatis the maintaining of the obtained effects 30 days after thelast product intake The change of symptoms is correlated tothe improvement in the quality of life and resulted in beingsignificantly higher in the probiotic groups compared withthe placebo group Although a great number of data derivingfrom literature [16ndash18 30] indicate that probiotics may behelpful in the treatment of IBS symptoms in particular withrespect to constipation their conclusions vary because ofinadequate sample size type of study design and use ofvarious probiotic strains These data are in agreement withour data concerning the improvement of specific probiotictreatment versus placebo (specifically in patients with IBS-C) for some of the endpoints improving symptoms such aspain flatulence and bloating but not others (transit time andurgency and abdominal cramps) [30] Moreover in most ofthe reported cases the decrease in constipation frequencyscore was approximately twofold greater in the probioticgroups than in the placebo groups and these results are in linewith data deriving from our clinical study

Thus the clinical improvement of this study may beassociated with the maintenance (species-specific) of thecompositional stability of the intestinal microbiota fromprobiotics consumption and with their positive effects insubjects affected by irritable bowel syndromes

5 Conclusions

In conclusion the different species of probiotics admin-istered to the IBS-C subjects determine a cooccurrencebetween the changes in the analysed probiotic groups andan improvement of IBS-C symptoms This study representsthe development of a clinical trial that can support the role ofintestinal bacteria in the IBS diseases and the potential role ofprobiotics belonging to various species in themanagement ofthese disorders

BioMed Research International 9

Ethical Approval

All procedures performed in studies involving human partic-ipants were in accordance with the ethical standards of theinstitutional andor national research committee and withthe 1964 Helsinki declaration and its later amendments orcomparable ethical standards

Consent

Informed consent was obtained from all individual partici-pants included in the study

Competing Interests

All the authors declare that they have no conflict of interests

Acknowledgments

The research was conducted through the Probioplus4FoodProject no 30221122 funded by MIUR and LombardyRegion Italy The authors thank Principium Europe Srlfor supplying the bacterial strains and Farcoderm for therecruited subjects of this study

References

[1] P B Eckburg E M Bik C N Bernstein et al ldquoMicrobiologydiversity of the human intestinal microbial florardquo Science vol308 no 5728 pp 1635ndash1638 2005

[2] S K Mazmanian H L Cui A O Tzianabos and D L KasperldquoAn immunomodulatorymolecule of symbiotic bacteria directsmaturation of the host immune systemrdquo Cell vol 122 no 1 pp107ndash118 2005

[3] V R Alonso and F Guarner ldquoLinking the gut microbiota tohuman healthrdquo British Journal of Nutrition vol 109 supplement2 pp S21ndashS26 2013

[4] G Tomasello M Bellavia V D Palumbo M C Gioviale PDamiani and A I L Monte ldquoFrom gut microflora imbalanceto mycobacteria infection is there a relationship with chronicintestinal inflammatory diseasesrdquo Annali Italiani di Chirurgiavol 82 no 5 pp 361ndash368 2011

[5] F Guarner and J-R Malagelada ldquoGut flora in health anddiseaserdquoThe Lancet vol 361 no 9356 pp 512ndash519 2003

[6] J Matto L Maunuksela K Kajander et al ldquoComposition andtemporal stability of gastrointestinal microbiota in irritablebowel syndromemdasha longitudinal study in IBS and controlsubjectsrdquo FEMS Immunology andMedical Microbiology vol 43no 2 pp 213ndash222 2005

[7] C Abraham and J H Cho ldquoMechanisms of disease inflamma-tory bowel diseaserdquo The New England Journal of Medicine vol361 no 21 pp 2066ndash2078 2009

[8] M Bellavia G Damiano M C Gioviale et al ldquoAbnormalexpansion of segmented filamentous bacteria in the gut a rolein pathogenesis of chronic inflammatory intestinal diseasesrdquoReviews in Medical Microbiology vol 22 no 3 pp 45ndash47 2011

[9] M Bellavia G Tomasello M Romeo et al ldquoGut microbiotaimbalance and chaperoning system malfunction are central toulcerative colitis pathogenesis and can be counteracted withspecifically designed probiotics a working hypothesisrdquoMedical

Microbiology and Immunology vol 202 no 6 pp 393ndash4062013

[10] W Strober I Fuss and P Mannon ldquoThe fundamental basis ofinflammatory bowel diseaserdquo Journal of Clinical Investigationvol 117 no 3 pp 514ndash521 2007

[11] M Llopis M Antolin M Carol et al ldquoLactobacillus caseidownregulates commensalsrsquo inflammatory signals in Crohnrsquosdisease mucosardquo Inflammatory Bowel Diseases vol 15 no 2 pp275ndash283 2009

[12] M Pammi A Flores M Leeflang and J Versalovic ldquoMolecularassays in the diagnosis of neonatal sepsis a systematic reviewand meta-analysisrdquo Pediatrics vol 128 no 4 pp e973ndashe9852011

[13] M Venkatesh A Flores R A Luna and J Versalovic ldquoMolecu-larmicrobiologicalmethods in the diagnosis of neonatal sepsisrdquoExpert Review of Anti-Infective Therapy vol 8 no 9 pp 1037ndash1048 2010

[14] K Kajander E Myllyluoma M Rajilic-Stojanovic et al ldquoClin-ical trial multispecies probiotic supplementation alleviates thesymptoms of irritable bowel syndrome and stabilizes intestinalmicrobiotardquoAlimentary Pharmacology andTherapeutics vol 27no 1 pp 48ndash57 2008

[15] J S Yoon W Sohn O Y Lee et al ldquoEffect of multispeciesprobiotics on irritable bowel syndrome a randomized double-blind placebo-controlled trialrdquo Journal of Gastroenterology andHepatology vol 29 no 1 pp 52ndash59 2014

[16] A P S Hungin C Mulligan B Pot et al ldquoSystematicreview probiotics in the management of lower gastrointestinalsymptoms in clinical practicemdashan evidence-based internationalguiderdquo Alimentary Pharmacology and Therapeutics vol 38 no8 pp 864ndash886 2013

[17] A Agrawal L A Houghton J Morris et al ldquoClinical trial theeffects of a fermentedmilk product containing Bifidobacteriumlactis DN-173 010 on abdominal distension and gastrointestinaltransit in irritable bowel syndrome with constipationrdquo Alimen-tary Pharmacology and Therapeutics vol 29 no 1 pp 104ndash1142009

[18] S Guglielmetti D Mora M Gschwender and K PoppldquoRandomised clinical trial Bifidobacterium bifidumMIMBb75significantly alleviates irritable bowel syndrome and improvesquality of lifemdasha double-blind Placebo-Controlled Studyrdquo Ali-mentary Pharmacology and Therapeutics vol 33 no 10 pp1123ndash1132 2011

[19] I Presti G DrsquoOrazio M Labra et al ldquoEvaluation of theprobiotic properties of new Lactobacillus and Bifidobacteriumstrains and their in vitro effectrdquo Applied Microbiology andBiotechnology vol 99 no 13 pp 5613ndash5626 2015

[20] I Aloisio C Santini B Biavati et al ldquoCharacterization of Bifi-dobacterium spp strains for the treatment of enteric disordersin newbornsrdquo Applied Microbiology and Biotechnology vol 96no 6 pp 1561ndash1576 2012

[21] D A Drossman E Corazziari M Delvaux et al EdsRome IIIThe Functional Gastrointestinal Disorders Degnon AssociatesMcLean Va USA 3rd edition 2006

[22] D L Patrick D A Drossman I O Frederick J Dicesare andK L Puder ldquoQuality of life in persons with irritable bowelsyndrome development and validation of a new measurerdquoDigestive Diseases and Sciences vol 43 no 2 pp 400ndash411 1998

[23] S J Lewis and KW Heaton ldquoStool form scale as a useful guideto intestinal transit timerdquo Scandinavian Journal of Gastroen-terology vol 32 no 9 pp 920ndash924 1997

10 BioMed Research International

[24] M Enrico Biological sciences [PhD thesis] The University ofMilano-Bicocca 2015

[25] M V Matz R M Wright and J G Scott ldquoNo control genesrequired bayesian analysis of qRT-PCR datardquo PloS ONE vol 8no 8 Article ID e71448 2013

[26] H Wickham ggplot2 Elegant Graphics for Data AnalysisSpringer Science amp BusinessMedia Springer-Verlag New YorkNY USA 2009

[27] J Plaza-Diaz C Gomez-Llorente L Fontana and A GilldquoModulation of immunity and inflammatory gene expressionin the gut in inflammatory diseases of the gut and in the liverby probioticsrdquoWorld Journal of Gastroenterology vol 20 no 42pp 15632ndash15649 2014

[28] A P M Kerckhoffs M Samsom M E van der Rest etal ldquoLower Bifidobacteria counts in both duodenal mucosa-associated and fecal microbiota in irritable bowel syndromepatientsrdquo World Journal of Gastroenterology vol 15 no 23 pp2887ndash2892 2009

[29] E Malinen T Rinttila K Kajander et al ldquoAnalysis of thefecal microbiota of irritable bowel syndrome patients andhealthy controls with real-time PCRrdquo American Journal ofGastroenterology vol 100 no 2 pp 373ndash382 2005

[30] P Moayyedi A C Ford N J Talley et al ldquoThe efficacy ofprobiotics in the treatment of irritable bowel syndrome asystematic reviewrdquo Gut vol 59 no 3 pp 325ndash332 2010

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

BioMed Research International 3

Table 1 List of the strains used in this study deposit number and the most relevant antimicrobial activities described in Presti et al 2015[19] Abbreviations used in the present work were also included

Probiotic strain Deposit number Antimicrobial activity V119904 AbbrLactobacillus rhamnosus LRH020(formerly PBS070) DSM 25568 C albicans E faecalis P aeruginosa S aureus E coli L Rha

Lactobacillus plantarum PBS067 DSM 24937 C albicans E faecalis P aeruginosa S aureus E coli L PlaBifidobacterium animalis subsp lactisBL050 (formerly PBS075) DSM 25566 E faecalis P aeruginosa E coli B Lac

Lactobacillus acidophilus PBS066 DSM 24936 C albicans E faecalis P aeruginosa S aureus E coli L AciLactobacillus reuteri PBS072 DSM 25175 E faecalis L Reu

No Yes

No Yes EnrolmentStart

10

Informed consent signature

Eligibility checkRandomization

Rome III diagnostic criteriaProduct intakeAlimentary diary

EndpointsStool collectionSymptoms questionnaireQuality of life (QoL)

No

Yes

End

30

60

90

0

DB screening

1st visit

2nd visit

3rd visit

4th visit

Basal visit

Screening of eligible participants in the Farcoderm volunteers database using the following keywords ldquosexrdquo ldquoagerdquoldquopathologyrdquo ldquotesting preferencesrdquo (setting the query as follows sex

Screening periodSubj meet incl crit

Subj meet incl crit

Subj meet incl crit Screening visit

1st subject enrolled Last subject screened0610201417092013

1st subject screened

pathology ldquonullrdquo testing preferences ldquofood supplementsrdquo)

Last subject completed

Study-related procedures

Medical examination

13012015

17092013

= ldquofemalerdquo and ldquomalerdquo ldquo rdquo18 lt age lt ldquo65rdquo

Figure 1 Study flow and schedule of assessment chart

physiology Changes in diet or lifestyle were not allowedduring all the study period

23 Assessment of Clinical Effects

231 Endpoints Patientswere evaluated five times during thecourse of the study at baseline after 10 30 and 60 days fromthe start period and 30 days after the follow-up of the inter-vention period to assess postintervention effects Primaryefficacy endpoints were the proportion of participants whoseIBS symptoms after probiotic supplementations were relievedup to 60 days and the assessment of their gut microbiotaThe secondary efficacy endpoint was the maintenance of theobtained effects 30 days after the last product(s) intake

232 Symptoms Questionnaire IBS-C related symptoms ofsubjects were reported daily by a questionnaire according toGuide Lines of FDA (Guidance for Industry-Irritable BowelSyndrome-Clinical Evaluation of Drugs for Treatment) IBS-C questionnaire consisted of 5 items as follows (i) bloat-ing (ii) abdominal pain (iii) constipation (iv) abdominalcramps and (v) flatulence For each item subjects scored thesymptom severity on a 10-point Visual Analogue Scale (VAS)Data are reported as the mean values after every 10 days

233 Health-Related Quality of Life (HR-QOL) HR-QOLwas assessed by means of the Italian version of the Quality ofLife Measure for Persons with IBS [22] From the original 34items questionnaire the following 12 items were selected (i) I

4 BioMed Research International

Table 2 List of primers used in this study

Probiotic Primer code Sequence (51015840 rarr 31015840) DNA region Amplifiedlength (bp)

L rhamnosus LraF CTAGCGGGTGCGACTTTGTT 16S23S IS 123 bpLraR CAGCGGTTATGCGATGCGAA

L plantarum Lpl2F CATTGGAACCGAACCAGTTG 16S23S IS 203 bpLpl2R CGGTGTTCTCGGTTTCATTATG

B animalis subsp lactis AnimF GCACGGTTTTGTGGCTGG pre16S 171 bpAnimR GACCTGGGGGACACACTG

L acidophilus Lacid2F GGGCAAATCACGAACGAGTA pre16S 132 bpLacid2R CTTTGTTTTCGTTCGCTTCA

L reuteri Lreu2F GTTGACGAAAGAATGAAATCCA pre16S 118 bpLreu2R TCATGTCGTCAATCAGATGTCA

am embarrassed by the smell caused by my bowel problems(ii) I feel vulnerable to other illnesses because of my bowelproblems (iii) I feel fat because of my bowel problems (iv) Ifeel my life is less enjoyable because of my bowel problems(v) I feel depressed about my bowel problems (vi) I have towatch the amount of food I eat because ofmy bowel problems(vii) because of my bowel problems sexual activity is difficultforme (viii) I feel angry that I have bowel problems (ix) I feelI get less done because of my bowel problems (x) my bowelproblems limit what I can wear (xi) I have to watch the kindof food I eat because of my bowel problems and (xii) I fearthat I wonrsquot be able to have a bowel movement

For each item the following five-point response scale wasused 1 not at all 2 slightly 3 moderately 4 quite a bit and5 extremely HR-QOL was interviewer-administered

24 Fecal Samples (Stools Type Classification) Fecal sampleswere collected from subjects at 11990510 11990530 11990560 and 11990590 timepoints during the study Fresh fecal samples were homoge-nized by vortex mixing of the fecal mass and separated intoaliquots to be stored at minus80∘C until the analysis using DNA-based method quantitative PCR

Stool types were classified according to Bristol scale[23] Bristol values were divided in two categories values3 (sausage shape with cracks in the surface normal) 4(smooth soft sausage or snake normal) and 5 (soft blobswith clear-cut edges lacking fiber) corresponding to healthybowel situation were assigned to class 1 whereas values1 (separate hard lumps very constipated) 2 (lumpy andsausage like slightly constipated) 6 (mushy consistency withragged edges inflammation) and 7 (liquid consistency withno solid pieces inflammation) were assigned to class 0 Thenumber of volunteer subjects with stool samples with Bristolvalues belonging to class 1 was calculated for each treatmentand for each experimental time

25 Probiotic Strains and DNA Extraction In this study atotal of four Lactobacillus spp strains and one Bifidobac-terium strain supplied from a private collection were takeninto consideration for the preparation of the two formulations(F 1 and F 2) Table 1 describes the characteristics of each

strain In order to prepare standard curves of DNA extractedfrom probiotics microbial cultures were performed in MRS(Conda) medium and incubated at 37∘C for 24 hours inanaerobic conditions using anaerobic atmosphere generationbags (Anaerogen Oxoid) For B animalis subsp lactis asupplementation of 03 gL L-cysteine hydrochloride mono-hydrate was included in the growthmedium (cMRS) (Sigma-Aldrich)

DNA from microbial cultures was extracted by the ZRfecal DNA MiniPREP (Zymo Research) A total of 1mL of109 CFUmL culture was used for obtaining genomic DNAfollowing the protocol provided by the manufacturer

DNA extraction from stool samples was performed from150mg of feces by the ZR fecal DNA MiniPREP BothDNA extracted from probiotic cultures and DNA from stoolsamples were utilized to perform qPCR

26 Fecal Microbiology Analysis by Quantitative PCR qPCRreactions were carried out using an ABI 7500 (AppliedBiosystems) and the SsoFast EvaGreen Supermix with LowROX (BIO-RAD) dye We designed species-specific primersets developed by the authors in a previous study and reportedin Table 2 [24] Reactions were carried out in a 10120583L qPCRmix containing 5120583L of SsoFast EvaGreen Supermix with LowROX 02 120583L of 10 120583M forward primer and 10 120583M reverseprimer 4 120583L of DNA template and 24120583L of H

2O according

to the following qPCR program 101015840 95∘C and 40 cycles of 151015840101584095∘C and 11015840 60∘C (followed by a dissociation step)

For each strain standard curves were constructed usingDNA extracted from microbial cultures using tenfold dilu-tions ranging from 108 CFUmL to 10CFUmL Each DNAsample both from feces and from culture dilution wasanalysed in triplicate

27 Sample Size Sample size was calculated with a two-side 5 significance level and a power of 80 taking intoaccount a 23mmmargin of equivalence among treatments Asample size of 50 subjects per treatment arm was considerednecessary given an anticipated dropout rate of 40 Takinginto consideration the duration of the treatment and the

BioMed Research International 5

complexity of the inclusion we expected a high rate ofdropout

28 Randomization Subjects were assigned to treatmentarms using a computer-generated PASS 11 statistical software(version 1108 for Windows PASS LLC Kaysville UT USA)restricted randomization list (ldquoEfronrsquos biased coinrdquo algo-rithm) Subjects were randomized in a 1 1 1 (F 1 F 2 F 3)ratio The software was running on Windows Server 2008R2 Standard SP1 64 Edition (Microsoft USA) Subjectsinvestigator and collaborators were kept blind to productsassignment The randomization list was stored in a safe placeby the in site study director

29 Statistical Methods Statistical analysis was performedusing NCSS 8 (version 804 for Windows NCCS LLC)running on Windows Server 2008 R2 64 Edition Internalconsistency was checked before statistical analysis in orderto assess subjectrsquos reliability For IBS-C related symptomsthe number of responders to treatment was calculated Aresponder was defined as the subject reporting a decrease ofsymptoms of at least 30 compared to the basal condition forat least 50 of the intervention time (Guidance for Industry-Irritable Bowel Syndrome-Clinical Evaluation of Drugs forTreatment) Positivenegative responses to treatmentplacebowere tested using Fisherrsquos exact ratio test HR-QOL andfollow-up data were submitted to RM-ANOVA followed byTukey-Kramer posttest Data normality was checked usingskewness kurtosis and omnibus test Statistical significancewas reported as follows lowast119875 lt 005 lowastlowast119875 lt 001 and lowastlowastlowast119875 lt0001

In order to apply generalized linear mixed model(GLMM) under Poisson-lognormal error to account forhigher variation at the lower end of target abundanceMCMCqPCR R package [25] was used to convert Ct data inbacterial counts The conversion to approximate counts usesthe following formula

Count 119864(Ct1minusCt) (1)

where 119864 is the efficiency of amplification and Ct1 is the num-ber of qPCR cycles required to detect a single target mole-cule

Markov Chain Monte Carlo (MCMC) algorithm imple-mented in the package is used to sample from the jointposterior distribution over all model parameters in order toestimate the effects of all experimental factors on the levels ofspecific microbial species GLMM was used to test whetherthe levels of the different microbial species in differentformulation groups (F 1 F 2 and F 3) differed between thebaseline (1199050) and the subsequent time points (11990510 11990530 11990560and 11990590)

The experimental design is incorporated into the follow-ing model

ln(counts) sim species + speciesFormulation + spe-ciesTime + sample + speciessample + speciesresidual

where the logarithm of bacterial counting rate is the vari-able response and the fixed factors are Formulation and

Table 3 Demographic and baseline characteristics of the subjectsof the clinical studylowast Data are mean plusmn SE

F 1 F 2 F 3Number of subjects 50 50 50Age 360 plusmn 119 380 plusmn 121 381 plusmn 135Bloating (VAS) 63 plusmn 02 62 plusmn 02 61 plusmn 02Abdominal pain 50 plusmn 02 49 plusmn 02 48 plusmn 02Constipation 66 plusmn 01 65 plusmn 01 61 plusmn 02Abdominal cramps 42 plusmn 02 39 plusmn 02 41 plusmn 02Flatulence 46 plusmn 03 44 plusmn 02 44 plusmn 02lowastThere were no statistically significant differences between the three groups

Time (baseline and subsequent time points) The threeremaining factors sample (different subjects of the study)speciessampleand speciesresidual are defined as randomfactors accounting for the variation in quality and quantityof biological material among samples

To produce graphical chart we used ggplot2 R package[26]

3 Results

31 Subjects of the Study The study was conducted betweenSeptember 2013 and January 2015 A total of 157 maleand female subjects suffering from IBS-C were successfullyenrolled (Figure 2) Subjects were randomized to active orplacebo treatments as follows (i) 53 subjects were random-ized to F 1 (ii) 52 subjects were randomized to F 2 and (iii)52 subjects were randomized to F 3 Seven subjects discon-tinued intervention because they were no longer interestedin participating in the study

After randomization subjects attended four clinic visitsevery month except for the first visit (10 days after productuse) The population was Caucasian and the mean (plusmnSD) agewas 374plusmn125 years Demographic and baseline characteris-tics (Table 3) were similar across treatment arms indicatingan unbiased randomization The per-protocol populationconsisted of 150 subjects All subjects were included in thesafety analysis dataset

32 Primary Efficacy Endpoint The results of IBS-C relatedsymptoms amelioration of the responder are reported inFigure 3The number of responders to treatment was definedas the subject reporting a decrease of symptoms of at least30 compared to the basal condition for at least 50 of theintervention time Internal consistency for each item overtime was good (Cronbachrsquos alpha gt 088) The percentage ofresponders for each clinical symptom was higher in the F 1and F 2 group when compared to placebo F 3 (F 1 versusF 3 in the range of 66ndash78 versus 6ndash36 and F 2versus F 3 in the range of 78ndash90 versus 6ndash36) (119875 lt0001) Neither statistical nor clinically significant differenceswere detected between F 1 and F 2 except for constipationsymptom which was less significant during the treatment(119875 lt 001)

6 BioMed Research InternationalEn

rollm

ent

Allo

catio

nA

naly

sis

Placebo

Follo

w-u

p

(ii) Did not receive allocated

(i) Received allocated intervention(i) Received allocated intervention

(ii) Did not receive allocatedintervention (n = 0)

Allocated to intervention (n = 53)

(n = 53)

Allocated to intervention (n = 52)

(n = 52)

intervention (n = 0)

Discontinued intervention (n = 3)Lost to follow-up (n = 0)

Discontinued intervention (n = 2)Lost to follow-up (n = 0)

Discontinued intervention (n = 2)Lost to follow-up (n = 0)

(i) Excluded from analysis (n = 0)(i) Excluded from analysis (n = 0)Analysed (n = 50)Analysed (n = 50)

(i) Excluded from analysis (n = 0)Analysed (n = 50)

Allocated to intervention (n = 52)

(ii) Did not receive allocated intervention(i) Received allocated intervention (n = 52)

n = 0)(

Randomized (n = 157)

(i) Not meeting the inclusioncriteria (n = 40)

(ii) Declined to participate (n = 0)

Excluded (n = 0)

Assessed for eligibility (N = 197)

F_1 F_2

Figure 2 Disposition of the subjects of the study

F_1F_2F_3

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowast

Bloa

ting

Abdo

min

alpa

in

Con

stipa

tion

Abdo

min

alcr

amps

Flat

ulen

ce

0

20

40

60

80

100

Resp

onde

rs (

)

Figure 3 Percentage of responders to IBS-C related symptomduring the treatment period (11990560 days) with probiotic formulationsF 1 and F 2 The Responders was defined as the subject reportinga decrease of symptoms of at least 30 compared to the basalcondition for at least 50 of the intervention time Bloatingabdominal pain constipation abdominal cramps and flatulencesymptoms were assessed on a numbering scale from 0 to 10 foreach item subjects scored Data are mean plusmn SE Upon the squarebrackets are reported the intergroups F 1 and F 2 (versus placeboF 3) statistical analysis (lowastlowastlowast119875 lt 0001) The intergroups F 1 versusF 2 statistical analysis (lowastlowast119875 lt 001) is also reported

The results of HR-QOL are reported in Table 4 Data werereported as the sum of each score given by the subject to eachitem of the HR-QOL questionnaire Internal consistency foreach item over time was good (Cronbachrsquos alphagt 086)TheHR-QOL was ameliorated for subjects treated with both F 1and F 2 during the treatment period Relatively to baselinethe sum of each score given by the subject to each symptom

during the treatment (11990560) was significantly reduced in theprobiotics group (312 plusmn 10 rarr 202 plusmn 09 119875 lt 0001for F 1 group and 320 plusmn 09 rarr 204 plusmn 09 119875 lt 0001for F 2 group) but not so clinically relevant in the placebogroup (300 plusmn 09 rarr 269 plusmn 12 119875 lt 0001 for F 3group) As expected mild amelioration of HR-QOL was seenin the placebo-treated subjects probably due to the placeboeffect The intergroup amelioration of HR-QOL during thetreatment (11990560) was bigger in the actives-treated (F 1 andF 2) subjects compared to placebo-treated (F 3) subjects (F 1versus F 3 202 plusmn 09 versus 269 plusmn 12 and F 2 versus F 3204plusmn 09 versus 269 plusmn 12 119875 lt 0001) Neither statistical norclinically significant differences were found between F 1 andF 2

In addition the analysis of the stool type classificationwas performed (data not shown) The numbers of sampleswith values of 3 4 and 5 according to Bristol scale andrepresenting a healthy bowel movement were calculatedSignificant differences were observed between F 1 or F 2 withrespect to F 3 representing an increase in the number of stoolsamples with a healthier characteristic in the probiotic treatedgroups

33 Secondary Efficacy Endpoint In order to assess themaintenance of the obtained effects the study design foresawa further 30-day follow-up period after the 60-day productintake period The results of IBS-C related symptoms main-tenance for responder are reported in Figure 4 During thefollow-up period (from day 61 to day 90) the percentage ofresponders for each clinical symptom was higher in the F 1and F 2 groups when compared to placebo F 3 (F 1 versusF 3 in the range of 56ndash74versus 10ndash40 and F 2 versusF 3 in the range of 76ndash82 versus 10ndash40) (119875 lt 0001)Neither statistical nor clinically significant differences weredetected between F 1 and F 2 except for abdominal cramps

BioMed Research International 7

Table 4 HR-QOL amelioration at the different times of treatment (1199050 11990510 11990530 and 11990560 days) and at the follow-up period that is 30 daysafter the last product intake (11990590 days) between F 1 and F 2 groups compared with F 3 Bloating abdominal pain constipation abdominalcramps and flatulence were assessed on a numbering scale from 0 to 10 for each item subjects scored Data are mean plusmn SE In brackets isreported the intergroups (versus placebo) statistical analysis

Time (days) F 1 P value F 2 P value F 3 P value F 1 vs F 3 (P value) F 2 vs F 3 (P value)0 312 plusmn 10 320 plusmn 09 300 plusmn 0910 283 plusmn 09 lt001 270 plusmn 08 lt0001 289 plusmn 10 gt005 gt005 gt00530 231 plusmn 09 lt0001 228 plusmn 08 lt0001 278 plusmn 11 lt005 lt001 lt000160 202 plusmn 09 lt0001 204 plusmn 09 lt0001 269 plusmn 12 lt0001 lt0001 lt000190 222 plusmn 10 lt0001 220 plusmn 08 lt005 287 plusmn 12 lt001 lt0001 lt0001

F_1F_2F_3

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowast

lowastlowastlowast

Bloa

ting

Abdo

min

alpa

in

Con

stipa

tion

Abdo

min

alcr

amps

Flat

ulen

ce

0102030405060708090

Resp

onde

rs (

)

Figure 4 Percentage of responders to IBS-C related symptom atthe follow-up period that is 30 days after the last product intake(11990590 days) of probiotic formulations F 1 and F 2 The Responderswas defined as the subject reporting a decrease of symptoms ofat least 30 compared to the basal condition for at least 50of the intervention time Bloating abdominal pain constipationabdominal cramps and flatulence symptoms were assessed on anumbering scale from 0 to 10 for each item subjects scored Data aremean plusmn SE Upon the square brackets are reported the intergroupsF 1 and F 2 (versus placebo F 3) statistical analysis (lowastlowastlowast119875 lt 0001)The intergroups F 1 versus F 2 statistical analysis (lowastlowast119875 lt 001) is alsoreported

symptom which was less significant during the follow-upperiod (119875 lt 001)

The results of HR-QOL are reported in Table 4 Data werereported as the sum of each score given by the subject to eachitem of the HR-QOL questionnaire Data obtained 30 days(11990590) after the last product intake were lower in the probioticgroups with respect to the basal scoring of symptoms at 1199050(312 plusmn 10 rarr 222 plusmn 10 119875 lt 0001 for F 1 group and 320 plusmn09 rarr 220plusmn08119875 lt 005 for F 2 group) but not so clinicallyrelevant in the placebo group (300 plusmn 09 rarr 287 plusmn 12 119875 lt001 for F 3 group)

The intergroup amelioration of HR-QOL was biggerin the actives-treated (F 1 and F 2) subjects compared toplacebo-treated (F 3) subjects (222 plusmn 10 versus 287 plusmn 12and 220plusmn09 versus 287plusmn12 119875 lt 0001) Neither statisticalnor clinically significant differences were detected betweenF 1 and F 2

Comparing follow-up period (11990590) with the end oftreatment period (11990560) the HR-QOL was not significantlydifferent for both F 1 and F 2 probiotic groups indicating themaintenance of the obtained effects

34 Fecal Microbiology Analysis by Quantitative PCR DNAwas extracted from fecal samples of the subjects enrolled inthis study at the times 1199050 11990510 11990530 11990560 and 11990590 from the firstingestion of the probiotic formulations The qPCR analysisdemonstrated that the species-specific sequences associatedwith the probiotics of the formulations were detected onlyin fecal DNA from subjects treated with the formulationsF 1 and F 2 and not with the formulation F 3 and that nosignificant difference was detected between the two kinds offormulations

The qPCR assay for L plantarum and L rhamnosus(contained in the mix F 2) demonstrated a quite similarquantity of these probiotic bacteria during the times oftreatment while B animalis subsp lactis decreases at time 90after the follow-up period Concerning results of probioticscontained in the formulation F 1 we can observe that Lacidophilus increases during the treatment but decreases afterthe follow-up period while the quantity of L reuteri wasquite similar during all the period of treatment including time11990590 (Figure 5) All these results indicate that all probioticsutilized in this study were enhanced in the gut tract after theiringestion at least for 90 days the only exceptionwas observedfor B animalis subsp lactis in which a lower concentration ofthis probiotic in the postintervention samples was obtained

4 Discussion

Probiotics exert their actions through interaction with hostintestinal cells Their supplementation significantly modifiesthe intestinal microbiota by increasing lactobacilli and bifi-dobacteria that can improve through the combination withspecific probiotics providing a health benefit to the host[27] Multispecies probiotics may have a variety of differentbeneficial effects particularly on IBS symptoms because eachspecies acts in a particular way on the gastrointestinaltract and two or more species acting together may have asynergistic effect [15]

Although several trials have demonstrated the superiorityof probiotics (above all lactobacilli and bifidobacteria) overplacebo in controlling IBS symptoms [16ndash18] however given

8 BioMed Research International

F_1

F_2

F_3

Time

02468

10

Ratio

of b

acte

rial

coun

ts

02468

10

Ratio

of b

acte

rial

coun

tsRa

tio o

f bac

teria

l

02468

10

coun

ts

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast lowast

lowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowastlowast

lowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowastlowast

lowastlowast

lowastlowastlowastlowast

lowastlowastlowast

lowastlowast

lowastlowastlowast

t10

t30

t60

t90

Figure 5 Ratio of probiotics of formulations (F 1 and F 2 versusF 3) by qPCR of species-specific sequences at the different times oftreatment versus the amount at the baseline time point expressedas bacterial counts Upon the bars is reported the statistical analysisbetween treatments (lowastlowastlowast119875 lt 0001)

the controversies in IBS pathophysiology or lack of clearevidence for gut microbiota abnormalities in patients withIBS additional randomized clinical trials with appropriateendpoints and design are needed to evaluate to which extentprobiotics are a useful therapeutic strategy in the manage-ment of IBS symptoms

In this study a randomized double-blind placebo-controlled clinical trial with two formulations containingdifferent probiotics was developed and the evaluation ofgut microbiota assessment and gastrointestinal benefits ofIBS-C patients was determined until 90 days Multispeciesprobiotics were used for the treatment of IBS-C in our studyL acidophilus L reuteri L plantarum L rhamnosus andB animalis subsp lactis Indeed it is known that the levelof bifidobacteria and lactobacilli species is lower in IBSpatients compared to healthy persons [28 29] and severalstudies show that the supplementation of them or mixturesincluding species of these genera is effective in alleviatingsymptoms of IBS Moreover the selected strains were alreadyknown for their effect on intestinal cell lines as previouslyreported [19]

To investigate the alterations in the intestinal microbiotathe number of lactobacilli and bifidobacteria present in fecal

samples of recruited subjects was determined by quantita-tive real-time PCR The numbers of Lactobacillus spp andBifidobacterium spp of the mixtures (F 1 and F 2) increasedduring the times of treatment until 60 days in the probioticgroups with respect to the placebo group (F 3) All thespecies included in the formulations remained in the gut also30 days after the follow-up from the last ingestion exceptfor Bifidobacterium Our results confirmed data reported byKajander et al These authors demonstrated that all supple-mented strains remained stable during the treatment withthe exception of Bifidobacterium species which decreasedafter treatments with a multispecies probiotic mixture [14]

Moreover in our study significant differences in thenumber of responders to the severity of symptoms wererecorded between the two probiotic mixtures F 1 and F 2with respect to placebo F 3 group (119875 lt 0001) No significantdifferences were registered between F 1 and F 2 (119875 gt 005)and the effects of both of them are significant when comparedto their respective baselinesThese data are in agreement withprevious data from multispecies probiotics treatment of IBSsubjects [14 15] Compared with placebo probiotic groupsF 1 and F 2 were effective for the primary efficacy endpointsof the study as well as for the secondary endpoints thatis the maintaining of the obtained effects 30 days after thelast product intake The change of symptoms is correlated tothe improvement in the quality of life and resulted in beingsignificantly higher in the probiotic groups compared withthe placebo group Although a great number of data derivingfrom literature [16ndash18 30] indicate that probiotics may behelpful in the treatment of IBS symptoms in particular withrespect to constipation their conclusions vary because ofinadequate sample size type of study design and use ofvarious probiotic strains These data are in agreement withour data concerning the improvement of specific probiotictreatment versus placebo (specifically in patients with IBS-C) for some of the endpoints improving symptoms such aspain flatulence and bloating but not others (transit time andurgency and abdominal cramps) [30] Moreover in most ofthe reported cases the decrease in constipation frequencyscore was approximately twofold greater in the probioticgroups than in the placebo groups and these results are in linewith data deriving from our clinical study

Thus the clinical improvement of this study may beassociated with the maintenance (species-specific) of thecompositional stability of the intestinal microbiota fromprobiotics consumption and with their positive effects insubjects affected by irritable bowel syndromes

5 Conclusions

In conclusion the different species of probiotics admin-istered to the IBS-C subjects determine a cooccurrencebetween the changes in the analysed probiotic groups andan improvement of IBS-C symptoms This study representsthe development of a clinical trial that can support the role ofintestinal bacteria in the IBS diseases and the potential role ofprobiotics belonging to various species in themanagement ofthese disorders

BioMed Research International 9

Ethical Approval

All procedures performed in studies involving human partic-ipants were in accordance with the ethical standards of theinstitutional andor national research committee and withthe 1964 Helsinki declaration and its later amendments orcomparable ethical standards

Consent

Informed consent was obtained from all individual partici-pants included in the study

Competing Interests

All the authors declare that they have no conflict of interests

Acknowledgments

The research was conducted through the Probioplus4FoodProject no 30221122 funded by MIUR and LombardyRegion Italy The authors thank Principium Europe Srlfor supplying the bacterial strains and Farcoderm for therecruited subjects of this study

References

[1] P B Eckburg E M Bik C N Bernstein et al ldquoMicrobiologydiversity of the human intestinal microbial florardquo Science vol308 no 5728 pp 1635ndash1638 2005

[2] S K Mazmanian H L Cui A O Tzianabos and D L KasperldquoAn immunomodulatorymolecule of symbiotic bacteria directsmaturation of the host immune systemrdquo Cell vol 122 no 1 pp107ndash118 2005

[3] V R Alonso and F Guarner ldquoLinking the gut microbiota tohuman healthrdquo British Journal of Nutrition vol 109 supplement2 pp S21ndashS26 2013

[4] G Tomasello M Bellavia V D Palumbo M C Gioviale PDamiani and A I L Monte ldquoFrom gut microflora imbalanceto mycobacteria infection is there a relationship with chronicintestinal inflammatory diseasesrdquo Annali Italiani di Chirurgiavol 82 no 5 pp 361ndash368 2011

[5] F Guarner and J-R Malagelada ldquoGut flora in health anddiseaserdquoThe Lancet vol 361 no 9356 pp 512ndash519 2003

[6] J Matto L Maunuksela K Kajander et al ldquoComposition andtemporal stability of gastrointestinal microbiota in irritablebowel syndromemdasha longitudinal study in IBS and controlsubjectsrdquo FEMS Immunology andMedical Microbiology vol 43no 2 pp 213ndash222 2005

[7] C Abraham and J H Cho ldquoMechanisms of disease inflamma-tory bowel diseaserdquo The New England Journal of Medicine vol361 no 21 pp 2066ndash2078 2009

[8] M Bellavia G Damiano M C Gioviale et al ldquoAbnormalexpansion of segmented filamentous bacteria in the gut a rolein pathogenesis of chronic inflammatory intestinal diseasesrdquoReviews in Medical Microbiology vol 22 no 3 pp 45ndash47 2011

[9] M Bellavia G Tomasello M Romeo et al ldquoGut microbiotaimbalance and chaperoning system malfunction are central toulcerative colitis pathogenesis and can be counteracted withspecifically designed probiotics a working hypothesisrdquoMedical

Microbiology and Immunology vol 202 no 6 pp 393ndash4062013

[10] W Strober I Fuss and P Mannon ldquoThe fundamental basis ofinflammatory bowel diseaserdquo Journal of Clinical Investigationvol 117 no 3 pp 514ndash521 2007

[11] M Llopis M Antolin M Carol et al ldquoLactobacillus caseidownregulates commensalsrsquo inflammatory signals in Crohnrsquosdisease mucosardquo Inflammatory Bowel Diseases vol 15 no 2 pp275ndash283 2009

[12] M Pammi A Flores M Leeflang and J Versalovic ldquoMolecularassays in the diagnosis of neonatal sepsis a systematic reviewand meta-analysisrdquo Pediatrics vol 128 no 4 pp e973ndashe9852011

[13] M Venkatesh A Flores R A Luna and J Versalovic ldquoMolecu-larmicrobiologicalmethods in the diagnosis of neonatal sepsisrdquoExpert Review of Anti-Infective Therapy vol 8 no 9 pp 1037ndash1048 2010

[14] K Kajander E Myllyluoma M Rajilic-Stojanovic et al ldquoClin-ical trial multispecies probiotic supplementation alleviates thesymptoms of irritable bowel syndrome and stabilizes intestinalmicrobiotardquoAlimentary Pharmacology andTherapeutics vol 27no 1 pp 48ndash57 2008

[15] J S Yoon W Sohn O Y Lee et al ldquoEffect of multispeciesprobiotics on irritable bowel syndrome a randomized double-blind placebo-controlled trialrdquo Journal of Gastroenterology andHepatology vol 29 no 1 pp 52ndash59 2014

[16] A P S Hungin C Mulligan B Pot et al ldquoSystematicreview probiotics in the management of lower gastrointestinalsymptoms in clinical practicemdashan evidence-based internationalguiderdquo Alimentary Pharmacology and Therapeutics vol 38 no8 pp 864ndash886 2013

[17] A Agrawal L A Houghton J Morris et al ldquoClinical trial theeffects of a fermentedmilk product containing Bifidobacteriumlactis DN-173 010 on abdominal distension and gastrointestinaltransit in irritable bowel syndrome with constipationrdquo Alimen-tary Pharmacology and Therapeutics vol 29 no 1 pp 104ndash1142009

[18] S Guglielmetti D Mora M Gschwender and K PoppldquoRandomised clinical trial Bifidobacterium bifidumMIMBb75significantly alleviates irritable bowel syndrome and improvesquality of lifemdasha double-blind Placebo-Controlled Studyrdquo Ali-mentary Pharmacology and Therapeutics vol 33 no 10 pp1123ndash1132 2011

[19] I Presti G DrsquoOrazio M Labra et al ldquoEvaluation of theprobiotic properties of new Lactobacillus and Bifidobacteriumstrains and their in vitro effectrdquo Applied Microbiology andBiotechnology vol 99 no 13 pp 5613ndash5626 2015

[20] I Aloisio C Santini B Biavati et al ldquoCharacterization of Bifi-dobacterium spp strains for the treatment of enteric disordersin newbornsrdquo Applied Microbiology and Biotechnology vol 96no 6 pp 1561ndash1576 2012

[21] D A Drossman E Corazziari M Delvaux et al EdsRome IIIThe Functional Gastrointestinal Disorders Degnon AssociatesMcLean Va USA 3rd edition 2006

[22] D L Patrick D A Drossman I O Frederick J Dicesare andK L Puder ldquoQuality of life in persons with irritable bowelsyndrome development and validation of a new measurerdquoDigestive Diseases and Sciences vol 43 no 2 pp 400ndash411 1998

[23] S J Lewis and KW Heaton ldquoStool form scale as a useful guideto intestinal transit timerdquo Scandinavian Journal of Gastroen-terology vol 32 no 9 pp 920ndash924 1997

10 BioMed Research International

[24] M Enrico Biological sciences [PhD thesis] The University ofMilano-Bicocca 2015

[25] M V Matz R M Wright and J G Scott ldquoNo control genesrequired bayesian analysis of qRT-PCR datardquo PloS ONE vol 8no 8 Article ID e71448 2013

[26] H Wickham ggplot2 Elegant Graphics for Data AnalysisSpringer Science amp BusinessMedia Springer-Verlag New YorkNY USA 2009

[27] J Plaza-Diaz C Gomez-Llorente L Fontana and A GilldquoModulation of immunity and inflammatory gene expressionin the gut in inflammatory diseases of the gut and in the liverby probioticsrdquoWorld Journal of Gastroenterology vol 20 no 42pp 15632ndash15649 2014

[28] A P M Kerckhoffs M Samsom M E van der Rest etal ldquoLower Bifidobacteria counts in both duodenal mucosa-associated and fecal microbiota in irritable bowel syndromepatientsrdquo World Journal of Gastroenterology vol 15 no 23 pp2887ndash2892 2009

[29] E Malinen T Rinttila K Kajander et al ldquoAnalysis of thefecal microbiota of irritable bowel syndrome patients andhealthy controls with real-time PCRrdquo American Journal ofGastroenterology vol 100 no 2 pp 373ndash382 2005

[30] P Moayyedi A C Ford N J Talley et al ldquoThe efficacy ofprobiotics in the treatment of irritable bowel syndrome asystematic reviewrdquo Gut vol 59 no 3 pp 325ndash332 2010

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

4 BioMed Research International

Table 2 List of primers used in this study

Probiotic Primer code Sequence (51015840 rarr 31015840) DNA region Amplifiedlength (bp)

L rhamnosus LraF CTAGCGGGTGCGACTTTGTT 16S23S IS 123 bpLraR CAGCGGTTATGCGATGCGAA

L plantarum Lpl2F CATTGGAACCGAACCAGTTG 16S23S IS 203 bpLpl2R CGGTGTTCTCGGTTTCATTATG

B animalis subsp lactis AnimF GCACGGTTTTGTGGCTGG pre16S 171 bpAnimR GACCTGGGGGACACACTG

L acidophilus Lacid2F GGGCAAATCACGAACGAGTA pre16S 132 bpLacid2R CTTTGTTTTCGTTCGCTTCA

L reuteri Lreu2F GTTGACGAAAGAATGAAATCCA pre16S 118 bpLreu2R TCATGTCGTCAATCAGATGTCA

am embarrassed by the smell caused by my bowel problems(ii) I feel vulnerable to other illnesses because of my bowelproblems (iii) I feel fat because of my bowel problems (iv) Ifeel my life is less enjoyable because of my bowel problems(v) I feel depressed about my bowel problems (vi) I have towatch the amount of food I eat because ofmy bowel problems(vii) because of my bowel problems sexual activity is difficultforme (viii) I feel angry that I have bowel problems (ix) I feelI get less done because of my bowel problems (x) my bowelproblems limit what I can wear (xi) I have to watch the kindof food I eat because of my bowel problems and (xii) I fearthat I wonrsquot be able to have a bowel movement

For each item the following five-point response scale wasused 1 not at all 2 slightly 3 moderately 4 quite a bit and5 extremely HR-QOL was interviewer-administered

24 Fecal Samples (Stools Type Classification) Fecal sampleswere collected from subjects at 11990510 11990530 11990560 and 11990590 timepoints during the study Fresh fecal samples were homoge-nized by vortex mixing of the fecal mass and separated intoaliquots to be stored at minus80∘C until the analysis using DNA-based method quantitative PCR

Stool types were classified according to Bristol scale[23] Bristol values were divided in two categories values3 (sausage shape with cracks in the surface normal) 4(smooth soft sausage or snake normal) and 5 (soft blobswith clear-cut edges lacking fiber) corresponding to healthybowel situation were assigned to class 1 whereas values1 (separate hard lumps very constipated) 2 (lumpy andsausage like slightly constipated) 6 (mushy consistency withragged edges inflammation) and 7 (liquid consistency withno solid pieces inflammation) were assigned to class 0 Thenumber of volunteer subjects with stool samples with Bristolvalues belonging to class 1 was calculated for each treatmentand for each experimental time

25 Probiotic Strains and DNA Extraction In this study atotal of four Lactobacillus spp strains and one Bifidobac-terium strain supplied from a private collection were takeninto consideration for the preparation of the two formulations(F 1 and F 2) Table 1 describes the characteristics of each

strain In order to prepare standard curves of DNA extractedfrom probiotics microbial cultures were performed in MRS(Conda) medium and incubated at 37∘C for 24 hours inanaerobic conditions using anaerobic atmosphere generationbags (Anaerogen Oxoid) For B animalis subsp lactis asupplementation of 03 gL L-cysteine hydrochloride mono-hydrate was included in the growthmedium (cMRS) (Sigma-Aldrich)

DNA from microbial cultures was extracted by the ZRfecal DNA MiniPREP (Zymo Research) A total of 1mL of109 CFUmL culture was used for obtaining genomic DNAfollowing the protocol provided by the manufacturer

DNA extraction from stool samples was performed from150mg of feces by the ZR fecal DNA MiniPREP BothDNA extracted from probiotic cultures and DNA from stoolsamples were utilized to perform qPCR

26 Fecal Microbiology Analysis by Quantitative PCR qPCRreactions were carried out using an ABI 7500 (AppliedBiosystems) and the SsoFast EvaGreen Supermix with LowROX (BIO-RAD) dye We designed species-specific primersets developed by the authors in a previous study and reportedin Table 2 [24] Reactions were carried out in a 10120583L qPCRmix containing 5120583L of SsoFast EvaGreen Supermix with LowROX 02 120583L of 10 120583M forward primer and 10 120583M reverseprimer 4 120583L of DNA template and 24120583L of H

2O according

to the following qPCR program 101015840 95∘C and 40 cycles of 151015840101584095∘C and 11015840 60∘C (followed by a dissociation step)

For each strain standard curves were constructed usingDNA extracted from microbial cultures using tenfold dilu-tions ranging from 108 CFUmL to 10CFUmL Each DNAsample both from feces and from culture dilution wasanalysed in triplicate

27 Sample Size Sample size was calculated with a two-side 5 significance level and a power of 80 taking intoaccount a 23mmmargin of equivalence among treatments Asample size of 50 subjects per treatment arm was considerednecessary given an anticipated dropout rate of 40 Takinginto consideration the duration of the treatment and the

BioMed Research International 5

complexity of the inclusion we expected a high rate ofdropout

28 Randomization Subjects were assigned to treatmentarms using a computer-generated PASS 11 statistical software(version 1108 for Windows PASS LLC Kaysville UT USA)restricted randomization list (ldquoEfronrsquos biased coinrdquo algo-rithm) Subjects were randomized in a 1 1 1 (F 1 F 2 F 3)ratio The software was running on Windows Server 2008R2 Standard SP1 64 Edition (Microsoft USA) Subjectsinvestigator and collaborators were kept blind to productsassignment The randomization list was stored in a safe placeby the in site study director

29 Statistical Methods Statistical analysis was performedusing NCSS 8 (version 804 for Windows NCCS LLC)running on Windows Server 2008 R2 64 Edition Internalconsistency was checked before statistical analysis in orderto assess subjectrsquos reliability For IBS-C related symptomsthe number of responders to treatment was calculated Aresponder was defined as the subject reporting a decrease ofsymptoms of at least 30 compared to the basal condition forat least 50 of the intervention time (Guidance for Industry-Irritable Bowel Syndrome-Clinical Evaluation of Drugs forTreatment) Positivenegative responses to treatmentplacebowere tested using Fisherrsquos exact ratio test HR-QOL andfollow-up data were submitted to RM-ANOVA followed byTukey-Kramer posttest Data normality was checked usingskewness kurtosis and omnibus test Statistical significancewas reported as follows lowast119875 lt 005 lowastlowast119875 lt 001 and lowastlowastlowast119875 lt0001

In order to apply generalized linear mixed model(GLMM) under Poisson-lognormal error to account forhigher variation at the lower end of target abundanceMCMCqPCR R package [25] was used to convert Ct data inbacterial counts The conversion to approximate counts usesthe following formula

Count 119864(Ct1minusCt) (1)

where 119864 is the efficiency of amplification and Ct1 is the num-ber of qPCR cycles required to detect a single target mole-cule

Markov Chain Monte Carlo (MCMC) algorithm imple-mented in the package is used to sample from the jointposterior distribution over all model parameters in order toestimate the effects of all experimental factors on the levels ofspecific microbial species GLMM was used to test whetherthe levels of the different microbial species in differentformulation groups (F 1 F 2 and F 3) differed between thebaseline (1199050) and the subsequent time points (11990510 11990530 11990560and 11990590)

The experimental design is incorporated into the follow-ing model

ln(counts) sim species + speciesFormulation + spe-ciesTime + sample + speciessample + speciesresidual

where the logarithm of bacterial counting rate is the vari-able response and the fixed factors are Formulation and

Table 3 Demographic and baseline characteristics of the subjectsof the clinical studylowast Data are mean plusmn SE

F 1 F 2 F 3Number of subjects 50 50 50Age 360 plusmn 119 380 plusmn 121 381 plusmn 135Bloating (VAS) 63 plusmn 02 62 plusmn 02 61 plusmn 02Abdominal pain 50 plusmn 02 49 plusmn 02 48 plusmn 02Constipation 66 plusmn 01 65 plusmn 01 61 plusmn 02Abdominal cramps 42 plusmn 02 39 plusmn 02 41 plusmn 02Flatulence 46 plusmn 03 44 plusmn 02 44 plusmn 02lowastThere were no statistically significant differences between the three groups

Time (baseline and subsequent time points) The threeremaining factors sample (different subjects of the study)speciessampleand speciesresidual are defined as randomfactors accounting for the variation in quality and quantityof biological material among samples

To produce graphical chart we used ggplot2 R package[26]

3 Results

31 Subjects of the Study The study was conducted betweenSeptember 2013 and January 2015 A total of 157 maleand female subjects suffering from IBS-C were successfullyenrolled (Figure 2) Subjects were randomized to active orplacebo treatments as follows (i) 53 subjects were random-ized to F 1 (ii) 52 subjects were randomized to F 2 and (iii)52 subjects were randomized to F 3 Seven subjects discon-tinued intervention because they were no longer interestedin participating in the study

After randomization subjects attended four clinic visitsevery month except for the first visit (10 days after productuse) The population was Caucasian and the mean (plusmnSD) agewas 374plusmn125 years Demographic and baseline characteris-tics (Table 3) were similar across treatment arms indicatingan unbiased randomization The per-protocol populationconsisted of 150 subjects All subjects were included in thesafety analysis dataset

32 Primary Efficacy Endpoint The results of IBS-C relatedsymptoms amelioration of the responder are reported inFigure 3The number of responders to treatment was definedas the subject reporting a decrease of symptoms of at least30 compared to the basal condition for at least 50 of theintervention time Internal consistency for each item overtime was good (Cronbachrsquos alpha gt 088) The percentage ofresponders for each clinical symptom was higher in the F 1and F 2 group when compared to placebo F 3 (F 1 versusF 3 in the range of 66ndash78 versus 6ndash36 and F 2versus F 3 in the range of 78ndash90 versus 6ndash36) (119875 lt0001) Neither statistical nor clinically significant differenceswere detected between F 1 and F 2 except for constipationsymptom which was less significant during the treatment(119875 lt 001)

6 BioMed Research InternationalEn

rollm

ent

Allo

catio

nA

naly

sis

Placebo

Follo

w-u

p

(ii) Did not receive allocated

(i) Received allocated intervention(i) Received allocated intervention

(ii) Did not receive allocatedintervention (n = 0)

Allocated to intervention (n = 53)

(n = 53)

Allocated to intervention (n = 52)

(n = 52)

intervention (n = 0)

Discontinued intervention (n = 3)Lost to follow-up (n = 0)

Discontinued intervention (n = 2)Lost to follow-up (n = 0)

Discontinued intervention (n = 2)Lost to follow-up (n = 0)

(i) Excluded from analysis (n = 0)(i) Excluded from analysis (n = 0)Analysed (n = 50)Analysed (n = 50)

(i) Excluded from analysis (n = 0)Analysed (n = 50)

Allocated to intervention (n = 52)

(ii) Did not receive allocated intervention(i) Received allocated intervention (n = 52)

n = 0)(

Randomized (n = 157)

(i) Not meeting the inclusioncriteria (n = 40)

(ii) Declined to participate (n = 0)

Excluded (n = 0)

Assessed for eligibility (N = 197)

F_1 F_2

Figure 2 Disposition of the subjects of the study

F_1F_2F_3

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowast

Bloa

ting

Abdo

min

alpa

in

Con

stipa

tion

Abdo

min

alcr

amps

Flat

ulen

ce

0

20

40

60

80

100

Resp

onde

rs (

)

Figure 3 Percentage of responders to IBS-C related symptomduring the treatment period (11990560 days) with probiotic formulationsF 1 and F 2 The Responders was defined as the subject reportinga decrease of symptoms of at least 30 compared to the basalcondition for at least 50 of the intervention time Bloatingabdominal pain constipation abdominal cramps and flatulencesymptoms were assessed on a numbering scale from 0 to 10 foreach item subjects scored Data are mean plusmn SE Upon the squarebrackets are reported the intergroups F 1 and F 2 (versus placeboF 3) statistical analysis (lowastlowastlowast119875 lt 0001) The intergroups F 1 versusF 2 statistical analysis (lowastlowast119875 lt 001) is also reported

The results of HR-QOL are reported in Table 4 Data werereported as the sum of each score given by the subject to eachitem of the HR-QOL questionnaire Internal consistency foreach item over time was good (Cronbachrsquos alphagt 086)TheHR-QOL was ameliorated for subjects treated with both F 1and F 2 during the treatment period Relatively to baselinethe sum of each score given by the subject to each symptom

during the treatment (11990560) was significantly reduced in theprobiotics group (312 plusmn 10 rarr 202 plusmn 09 119875 lt 0001for F 1 group and 320 plusmn 09 rarr 204 plusmn 09 119875 lt 0001for F 2 group) but not so clinically relevant in the placebogroup (300 plusmn 09 rarr 269 plusmn 12 119875 lt 0001 for F 3group) As expected mild amelioration of HR-QOL was seenin the placebo-treated subjects probably due to the placeboeffect The intergroup amelioration of HR-QOL during thetreatment (11990560) was bigger in the actives-treated (F 1 andF 2) subjects compared to placebo-treated (F 3) subjects (F 1versus F 3 202 plusmn 09 versus 269 plusmn 12 and F 2 versus F 3204plusmn 09 versus 269 plusmn 12 119875 lt 0001) Neither statistical norclinically significant differences were found between F 1 andF 2

In addition the analysis of the stool type classificationwas performed (data not shown) The numbers of sampleswith values of 3 4 and 5 according to Bristol scale andrepresenting a healthy bowel movement were calculatedSignificant differences were observed between F 1 or F 2 withrespect to F 3 representing an increase in the number of stoolsamples with a healthier characteristic in the probiotic treatedgroups

33 Secondary Efficacy Endpoint In order to assess themaintenance of the obtained effects the study design foresawa further 30-day follow-up period after the 60-day productintake period The results of IBS-C related symptoms main-tenance for responder are reported in Figure 4 During thefollow-up period (from day 61 to day 90) the percentage ofresponders for each clinical symptom was higher in the F 1and F 2 groups when compared to placebo F 3 (F 1 versusF 3 in the range of 56ndash74versus 10ndash40 and F 2 versusF 3 in the range of 76ndash82 versus 10ndash40) (119875 lt 0001)Neither statistical nor clinically significant differences weredetected between F 1 and F 2 except for abdominal cramps

BioMed Research International 7

Table 4 HR-QOL amelioration at the different times of treatment (1199050 11990510 11990530 and 11990560 days) and at the follow-up period that is 30 daysafter the last product intake (11990590 days) between F 1 and F 2 groups compared with F 3 Bloating abdominal pain constipation abdominalcramps and flatulence were assessed on a numbering scale from 0 to 10 for each item subjects scored Data are mean plusmn SE In brackets isreported the intergroups (versus placebo) statistical analysis

Time (days) F 1 P value F 2 P value F 3 P value F 1 vs F 3 (P value) F 2 vs F 3 (P value)0 312 plusmn 10 320 plusmn 09 300 plusmn 0910 283 plusmn 09 lt001 270 plusmn 08 lt0001 289 plusmn 10 gt005 gt005 gt00530 231 plusmn 09 lt0001 228 plusmn 08 lt0001 278 plusmn 11 lt005 lt001 lt000160 202 plusmn 09 lt0001 204 plusmn 09 lt0001 269 plusmn 12 lt0001 lt0001 lt000190 222 plusmn 10 lt0001 220 plusmn 08 lt005 287 plusmn 12 lt001 lt0001 lt0001

F_1F_2F_3

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowast

lowastlowastlowast

Bloa

ting

Abdo

min

alpa

in

Con

stipa

tion

Abdo

min

alcr

amps

Flat

ulen

ce

0102030405060708090

Resp

onde

rs (

)

Figure 4 Percentage of responders to IBS-C related symptom atthe follow-up period that is 30 days after the last product intake(11990590 days) of probiotic formulations F 1 and F 2 The Responderswas defined as the subject reporting a decrease of symptoms ofat least 30 compared to the basal condition for at least 50of the intervention time Bloating abdominal pain constipationabdominal cramps and flatulence symptoms were assessed on anumbering scale from 0 to 10 for each item subjects scored Data aremean plusmn SE Upon the square brackets are reported the intergroupsF 1 and F 2 (versus placebo F 3) statistical analysis (lowastlowastlowast119875 lt 0001)The intergroups F 1 versus F 2 statistical analysis (lowastlowast119875 lt 001) is alsoreported

symptom which was less significant during the follow-upperiod (119875 lt 001)

The results of HR-QOL are reported in Table 4 Data werereported as the sum of each score given by the subject to eachitem of the HR-QOL questionnaire Data obtained 30 days(11990590) after the last product intake were lower in the probioticgroups with respect to the basal scoring of symptoms at 1199050(312 plusmn 10 rarr 222 plusmn 10 119875 lt 0001 for F 1 group and 320 plusmn09 rarr 220plusmn08119875 lt 005 for F 2 group) but not so clinicallyrelevant in the placebo group (300 plusmn 09 rarr 287 plusmn 12 119875 lt001 for F 3 group)

The intergroup amelioration of HR-QOL was biggerin the actives-treated (F 1 and F 2) subjects compared toplacebo-treated (F 3) subjects (222 plusmn 10 versus 287 plusmn 12and 220plusmn09 versus 287plusmn12 119875 lt 0001) Neither statisticalnor clinically significant differences were detected betweenF 1 and F 2

Comparing follow-up period (11990590) with the end oftreatment period (11990560) the HR-QOL was not significantlydifferent for both F 1 and F 2 probiotic groups indicating themaintenance of the obtained effects

34 Fecal Microbiology Analysis by Quantitative PCR DNAwas extracted from fecal samples of the subjects enrolled inthis study at the times 1199050 11990510 11990530 11990560 and 11990590 from the firstingestion of the probiotic formulations The qPCR analysisdemonstrated that the species-specific sequences associatedwith the probiotics of the formulations were detected onlyin fecal DNA from subjects treated with the formulationsF 1 and F 2 and not with the formulation F 3 and that nosignificant difference was detected between the two kinds offormulations

The qPCR assay for L plantarum and L rhamnosus(contained in the mix F 2) demonstrated a quite similarquantity of these probiotic bacteria during the times oftreatment while B animalis subsp lactis decreases at time 90after the follow-up period Concerning results of probioticscontained in the formulation F 1 we can observe that Lacidophilus increases during the treatment but decreases afterthe follow-up period while the quantity of L reuteri wasquite similar during all the period of treatment including time11990590 (Figure 5) All these results indicate that all probioticsutilized in this study were enhanced in the gut tract after theiringestion at least for 90 days the only exceptionwas observedfor B animalis subsp lactis in which a lower concentration ofthis probiotic in the postintervention samples was obtained

4 Discussion

Probiotics exert their actions through interaction with hostintestinal cells Their supplementation significantly modifiesthe intestinal microbiota by increasing lactobacilli and bifi-dobacteria that can improve through the combination withspecific probiotics providing a health benefit to the host[27] Multispecies probiotics may have a variety of differentbeneficial effects particularly on IBS symptoms because eachspecies acts in a particular way on the gastrointestinaltract and two or more species acting together may have asynergistic effect [15]

Although several trials have demonstrated the superiorityof probiotics (above all lactobacilli and bifidobacteria) overplacebo in controlling IBS symptoms [16ndash18] however given

8 BioMed Research International

F_1

F_2

F_3

Time

02468

10

Ratio

of b

acte

rial

coun

ts

02468

10

Ratio

of b

acte

rial

coun

tsRa

tio o

f bac

teria

l

02468

10

coun

ts

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast lowast

lowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowastlowast

lowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowastlowast

lowastlowast

lowastlowastlowastlowast

lowastlowastlowast

lowastlowast

lowastlowastlowast

t10

t30

t60

t90

Figure 5 Ratio of probiotics of formulations (F 1 and F 2 versusF 3) by qPCR of species-specific sequences at the different times oftreatment versus the amount at the baseline time point expressedas bacterial counts Upon the bars is reported the statistical analysisbetween treatments (lowastlowastlowast119875 lt 0001)

the controversies in IBS pathophysiology or lack of clearevidence for gut microbiota abnormalities in patients withIBS additional randomized clinical trials with appropriateendpoints and design are needed to evaluate to which extentprobiotics are a useful therapeutic strategy in the manage-ment of IBS symptoms

In this study a randomized double-blind placebo-controlled clinical trial with two formulations containingdifferent probiotics was developed and the evaluation ofgut microbiota assessment and gastrointestinal benefits ofIBS-C patients was determined until 90 days Multispeciesprobiotics were used for the treatment of IBS-C in our studyL acidophilus L reuteri L plantarum L rhamnosus andB animalis subsp lactis Indeed it is known that the levelof bifidobacteria and lactobacilli species is lower in IBSpatients compared to healthy persons [28 29] and severalstudies show that the supplementation of them or mixturesincluding species of these genera is effective in alleviatingsymptoms of IBS Moreover the selected strains were alreadyknown for their effect on intestinal cell lines as previouslyreported [19]

To investigate the alterations in the intestinal microbiotathe number of lactobacilli and bifidobacteria present in fecal

samples of recruited subjects was determined by quantita-tive real-time PCR The numbers of Lactobacillus spp andBifidobacterium spp of the mixtures (F 1 and F 2) increasedduring the times of treatment until 60 days in the probioticgroups with respect to the placebo group (F 3) All thespecies included in the formulations remained in the gut also30 days after the follow-up from the last ingestion exceptfor Bifidobacterium Our results confirmed data reported byKajander et al These authors demonstrated that all supple-mented strains remained stable during the treatment withthe exception of Bifidobacterium species which decreasedafter treatments with a multispecies probiotic mixture [14]

Moreover in our study significant differences in thenumber of responders to the severity of symptoms wererecorded between the two probiotic mixtures F 1 and F 2with respect to placebo F 3 group (119875 lt 0001) No significantdifferences were registered between F 1 and F 2 (119875 gt 005)and the effects of both of them are significant when comparedto their respective baselinesThese data are in agreement withprevious data from multispecies probiotics treatment of IBSsubjects [14 15] Compared with placebo probiotic groupsF 1 and F 2 were effective for the primary efficacy endpointsof the study as well as for the secondary endpoints thatis the maintaining of the obtained effects 30 days after thelast product intake The change of symptoms is correlated tothe improvement in the quality of life and resulted in beingsignificantly higher in the probiotic groups compared withthe placebo group Although a great number of data derivingfrom literature [16ndash18 30] indicate that probiotics may behelpful in the treatment of IBS symptoms in particular withrespect to constipation their conclusions vary because ofinadequate sample size type of study design and use ofvarious probiotic strains These data are in agreement withour data concerning the improvement of specific probiotictreatment versus placebo (specifically in patients with IBS-C) for some of the endpoints improving symptoms such aspain flatulence and bloating but not others (transit time andurgency and abdominal cramps) [30] Moreover in most ofthe reported cases the decrease in constipation frequencyscore was approximately twofold greater in the probioticgroups than in the placebo groups and these results are in linewith data deriving from our clinical study

Thus the clinical improvement of this study may beassociated with the maintenance (species-specific) of thecompositional stability of the intestinal microbiota fromprobiotics consumption and with their positive effects insubjects affected by irritable bowel syndromes

5 Conclusions

In conclusion the different species of probiotics admin-istered to the IBS-C subjects determine a cooccurrencebetween the changes in the analysed probiotic groups andan improvement of IBS-C symptoms This study representsthe development of a clinical trial that can support the role ofintestinal bacteria in the IBS diseases and the potential role ofprobiotics belonging to various species in themanagement ofthese disorders

BioMed Research International 9

Ethical Approval

All procedures performed in studies involving human partic-ipants were in accordance with the ethical standards of theinstitutional andor national research committee and withthe 1964 Helsinki declaration and its later amendments orcomparable ethical standards

Consent

Informed consent was obtained from all individual partici-pants included in the study

Competing Interests

All the authors declare that they have no conflict of interests

Acknowledgments

The research was conducted through the Probioplus4FoodProject no 30221122 funded by MIUR and LombardyRegion Italy The authors thank Principium Europe Srlfor supplying the bacterial strains and Farcoderm for therecruited subjects of this study

References

[1] P B Eckburg E M Bik C N Bernstein et al ldquoMicrobiologydiversity of the human intestinal microbial florardquo Science vol308 no 5728 pp 1635ndash1638 2005

[2] S K Mazmanian H L Cui A O Tzianabos and D L KasperldquoAn immunomodulatorymolecule of symbiotic bacteria directsmaturation of the host immune systemrdquo Cell vol 122 no 1 pp107ndash118 2005

[3] V R Alonso and F Guarner ldquoLinking the gut microbiota tohuman healthrdquo British Journal of Nutrition vol 109 supplement2 pp S21ndashS26 2013

[4] G Tomasello M Bellavia V D Palumbo M C Gioviale PDamiani and A I L Monte ldquoFrom gut microflora imbalanceto mycobacteria infection is there a relationship with chronicintestinal inflammatory diseasesrdquo Annali Italiani di Chirurgiavol 82 no 5 pp 361ndash368 2011

[5] F Guarner and J-R Malagelada ldquoGut flora in health anddiseaserdquoThe Lancet vol 361 no 9356 pp 512ndash519 2003

[6] J Matto L Maunuksela K Kajander et al ldquoComposition andtemporal stability of gastrointestinal microbiota in irritablebowel syndromemdasha longitudinal study in IBS and controlsubjectsrdquo FEMS Immunology andMedical Microbiology vol 43no 2 pp 213ndash222 2005

[7] C Abraham and J H Cho ldquoMechanisms of disease inflamma-tory bowel diseaserdquo The New England Journal of Medicine vol361 no 21 pp 2066ndash2078 2009

[8] M Bellavia G Damiano M C Gioviale et al ldquoAbnormalexpansion of segmented filamentous bacteria in the gut a rolein pathogenesis of chronic inflammatory intestinal diseasesrdquoReviews in Medical Microbiology vol 22 no 3 pp 45ndash47 2011

[9] M Bellavia G Tomasello M Romeo et al ldquoGut microbiotaimbalance and chaperoning system malfunction are central toulcerative colitis pathogenesis and can be counteracted withspecifically designed probiotics a working hypothesisrdquoMedical

Microbiology and Immunology vol 202 no 6 pp 393ndash4062013

[10] W Strober I Fuss and P Mannon ldquoThe fundamental basis ofinflammatory bowel diseaserdquo Journal of Clinical Investigationvol 117 no 3 pp 514ndash521 2007

[11] M Llopis M Antolin M Carol et al ldquoLactobacillus caseidownregulates commensalsrsquo inflammatory signals in Crohnrsquosdisease mucosardquo Inflammatory Bowel Diseases vol 15 no 2 pp275ndash283 2009

[12] M Pammi A Flores M Leeflang and J Versalovic ldquoMolecularassays in the diagnosis of neonatal sepsis a systematic reviewand meta-analysisrdquo Pediatrics vol 128 no 4 pp e973ndashe9852011

[13] M Venkatesh A Flores R A Luna and J Versalovic ldquoMolecu-larmicrobiologicalmethods in the diagnosis of neonatal sepsisrdquoExpert Review of Anti-Infective Therapy vol 8 no 9 pp 1037ndash1048 2010

[14] K Kajander E Myllyluoma M Rajilic-Stojanovic et al ldquoClin-ical trial multispecies probiotic supplementation alleviates thesymptoms of irritable bowel syndrome and stabilizes intestinalmicrobiotardquoAlimentary Pharmacology andTherapeutics vol 27no 1 pp 48ndash57 2008

[15] J S Yoon W Sohn O Y Lee et al ldquoEffect of multispeciesprobiotics on irritable bowel syndrome a randomized double-blind placebo-controlled trialrdquo Journal of Gastroenterology andHepatology vol 29 no 1 pp 52ndash59 2014

[16] A P S Hungin C Mulligan B Pot et al ldquoSystematicreview probiotics in the management of lower gastrointestinalsymptoms in clinical practicemdashan evidence-based internationalguiderdquo Alimentary Pharmacology and Therapeutics vol 38 no8 pp 864ndash886 2013

[17] A Agrawal L A Houghton J Morris et al ldquoClinical trial theeffects of a fermentedmilk product containing Bifidobacteriumlactis DN-173 010 on abdominal distension and gastrointestinaltransit in irritable bowel syndrome with constipationrdquo Alimen-tary Pharmacology and Therapeutics vol 29 no 1 pp 104ndash1142009

[18] S Guglielmetti D Mora M Gschwender and K PoppldquoRandomised clinical trial Bifidobacterium bifidumMIMBb75significantly alleviates irritable bowel syndrome and improvesquality of lifemdasha double-blind Placebo-Controlled Studyrdquo Ali-mentary Pharmacology and Therapeutics vol 33 no 10 pp1123ndash1132 2011

[19] I Presti G DrsquoOrazio M Labra et al ldquoEvaluation of theprobiotic properties of new Lactobacillus and Bifidobacteriumstrains and their in vitro effectrdquo Applied Microbiology andBiotechnology vol 99 no 13 pp 5613ndash5626 2015

[20] I Aloisio C Santini B Biavati et al ldquoCharacterization of Bifi-dobacterium spp strains for the treatment of enteric disordersin newbornsrdquo Applied Microbiology and Biotechnology vol 96no 6 pp 1561ndash1576 2012

[21] D A Drossman E Corazziari M Delvaux et al EdsRome IIIThe Functional Gastrointestinal Disorders Degnon AssociatesMcLean Va USA 3rd edition 2006

[22] D L Patrick D A Drossman I O Frederick J Dicesare andK L Puder ldquoQuality of life in persons with irritable bowelsyndrome development and validation of a new measurerdquoDigestive Diseases and Sciences vol 43 no 2 pp 400ndash411 1998

[23] S J Lewis and KW Heaton ldquoStool form scale as a useful guideto intestinal transit timerdquo Scandinavian Journal of Gastroen-terology vol 32 no 9 pp 920ndash924 1997

10 BioMed Research International

[24] M Enrico Biological sciences [PhD thesis] The University ofMilano-Bicocca 2015

[25] M V Matz R M Wright and J G Scott ldquoNo control genesrequired bayesian analysis of qRT-PCR datardquo PloS ONE vol 8no 8 Article ID e71448 2013

[26] H Wickham ggplot2 Elegant Graphics for Data AnalysisSpringer Science amp BusinessMedia Springer-Verlag New YorkNY USA 2009

[27] J Plaza-Diaz C Gomez-Llorente L Fontana and A GilldquoModulation of immunity and inflammatory gene expressionin the gut in inflammatory diseases of the gut and in the liverby probioticsrdquoWorld Journal of Gastroenterology vol 20 no 42pp 15632ndash15649 2014

[28] A P M Kerckhoffs M Samsom M E van der Rest etal ldquoLower Bifidobacteria counts in both duodenal mucosa-associated and fecal microbiota in irritable bowel syndromepatientsrdquo World Journal of Gastroenterology vol 15 no 23 pp2887ndash2892 2009

[29] E Malinen T Rinttila K Kajander et al ldquoAnalysis of thefecal microbiota of irritable bowel syndrome patients andhealthy controls with real-time PCRrdquo American Journal ofGastroenterology vol 100 no 2 pp 373ndash382 2005

[30] P Moayyedi A C Ford N J Talley et al ldquoThe efficacy ofprobiotics in the treatment of irritable bowel syndrome asystematic reviewrdquo Gut vol 59 no 3 pp 325ndash332 2010

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

BioMed Research International 5

complexity of the inclusion we expected a high rate ofdropout

28 Randomization Subjects were assigned to treatmentarms using a computer-generated PASS 11 statistical software(version 1108 for Windows PASS LLC Kaysville UT USA)restricted randomization list (ldquoEfronrsquos biased coinrdquo algo-rithm) Subjects were randomized in a 1 1 1 (F 1 F 2 F 3)ratio The software was running on Windows Server 2008R2 Standard SP1 64 Edition (Microsoft USA) Subjectsinvestigator and collaborators were kept blind to productsassignment The randomization list was stored in a safe placeby the in site study director

29 Statistical Methods Statistical analysis was performedusing NCSS 8 (version 804 for Windows NCCS LLC)running on Windows Server 2008 R2 64 Edition Internalconsistency was checked before statistical analysis in orderto assess subjectrsquos reliability For IBS-C related symptomsthe number of responders to treatment was calculated Aresponder was defined as the subject reporting a decrease ofsymptoms of at least 30 compared to the basal condition forat least 50 of the intervention time (Guidance for Industry-Irritable Bowel Syndrome-Clinical Evaluation of Drugs forTreatment) Positivenegative responses to treatmentplacebowere tested using Fisherrsquos exact ratio test HR-QOL andfollow-up data were submitted to RM-ANOVA followed byTukey-Kramer posttest Data normality was checked usingskewness kurtosis and omnibus test Statistical significancewas reported as follows lowast119875 lt 005 lowastlowast119875 lt 001 and lowastlowastlowast119875 lt0001

In order to apply generalized linear mixed model(GLMM) under Poisson-lognormal error to account forhigher variation at the lower end of target abundanceMCMCqPCR R package [25] was used to convert Ct data inbacterial counts The conversion to approximate counts usesthe following formula

Count 119864(Ct1minusCt) (1)

where 119864 is the efficiency of amplification and Ct1 is the num-ber of qPCR cycles required to detect a single target mole-cule

Markov Chain Monte Carlo (MCMC) algorithm imple-mented in the package is used to sample from the jointposterior distribution over all model parameters in order toestimate the effects of all experimental factors on the levels ofspecific microbial species GLMM was used to test whetherthe levels of the different microbial species in differentformulation groups (F 1 F 2 and F 3) differed between thebaseline (1199050) and the subsequent time points (11990510 11990530 11990560and 11990590)

The experimental design is incorporated into the follow-ing model

ln(counts) sim species + speciesFormulation + spe-ciesTime + sample + speciessample + speciesresidual

where the logarithm of bacterial counting rate is the vari-able response and the fixed factors are Formulation and

Table 3 Demographic and baseline characteristics of the subjectsof the clinical studylowast Data are mean plusmn SE

F 1 F 2 F 3Number of subjects 50 50 50Age 360 plusmn 119 380 plusmn 121 381 plusmn 135Bloating (VAS) 63 plusmn 02 62 plusmn 02 61 plusmn 02Abdominal pain 50 plusmn 02 49 plusmn 02 48 plusmn 02Constipation 66 plusmn 01 65 plusmn 01 61 plusmn 02Abdominal cramps 42 plusmn 02 39 plusmn 02 41 plusmn 02Flatulence 46 plusmn 03 44 plusmn 02 44 plusmn 02lowastThere were no statistically significant differences between the three groups

Time (baseline and subsequent time points) The threeremaining factors sample (different subjects of the study)speciessampleand speciesresidual are defined as randomfactors accounting for the variation in quality and quantityof biological material among samples

To produce graphical chart we used ggplot2 R package[26]

3 Results

31 Subjects of the Study The study was conducted betweenSeptember 2013 and January 2015 A total of 157 maleand female subjects suffering from IBS-C were successfullyenrolled (Figure 2) Subjects were randomized to active orplacebo treatments as follows (i) 53 subjects were random-ized to F 1 (ii) 52 subjects were randomized to F 2 and (iii)52 subjects were randomized to F 3 Seven subjects discon-tinued intervention because they were no longer interestedin participating in the study

After randomization subjects attended four clinic visitsevery month except for the first visit (10 days after productuse) The population was Caucasian and the mean (plusmnSD) agewas 374plusmn125 years Demographic and baseline characteris-tics (Table 3) were similar across treatment arms indicatingan unbiased randomization The per-protocol populationconsisted of 150 subjects All subjects were included in thesafety analysis dataset

32 Primary Efficacy Endpoint The results of IBS-C relatedsymptoms amelioration of the responder are reported inFigure 3The number of responders to treatment was definedas the subject reporting a decrease of symptoms of at least30 compared to the basal condition for at least 50 of theintervention time Internal consistency for each item overtime was good (Cronbachrsquos alpha gt 088) The percentage ofresponders for each clinical symptom was higher in the F 1and F 2 group when compared to placebo F 3 (F 1 versusF 3 in the range of 66ndash78 versus 6ndash36 and F 2versus F 3 in the range of 78ndash90 versus 6ndash36) (119875 lt0001) Neither statistical nor clinically significant differenceswere detected between F 1 and F 2 except for constipationsymptom which was less significant during the treatment(119875 lt 001)

6 BioMed Research InternationalEn

rollm

ent

Allo

catio

nA

naly

sis

Placebo

Follo

w-u

p

(ii) Did not receive allocated

(i) Received allocated intervention(i) Received allocated intervention

(ii) Did not receive allocatedintervention (n = 0)

Allocated to intervention (n = 53)

(n = 53)

Allocated to intervention (n = 52)

(n = 52)

intervention (n = 0)

Discontinued intervention (n = 3)Lost to follow-up (n = 0)

Discontinued intervention (n = 2)Lost to follow-up (n = 0)

Discontinued intervention (n = 2)Lost to follow-up (n = 0)

(i) Excluded from analysis (n = 0)(i) Excluded from analysis (n = 0)Analysed (n = 50)Analysed (n = 50)

(i) Excluded from analysis (n = 0)Analysed (n = 50)

Allocated to intervention (n = 52)

(ii) Did not receive allocated intervention(i) Received allocated intervention (n = 52)

n = 0)(

Randomized (n = 157)

(i) Not meeting the inclusioncriteria (n = 40)

(ii) Declined to participate (n = 0)

Excluded (n = 0)

Assessed for eligibility (N = 197)

F_1 F_2

Figure 2 Disposition of the subjects of the study

F_1F_2F_3

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowast

Bloa

ting

Abdo

min

alpa

in

Con

stipa

tion

Abdo

min

alcr

amps

Flat

ulen

ce

0

20

40

60

80

100

Resp

onde

rs (

)

Figure 3 Percentage of responders to IBS-C related symptomduring the treatment period (11990560 days) with probiotic formulationsF 1 and F 2 The Responders was defined as the subject reportinga decrease of symptoms of at least 30 compared to the basalcondition for at least 50 of the intervention time Bloatingabdominal pain constipation abdominal cramps and flatulencesymptoms were assessed on a numbering scale from 0 to 10 foreach item subjects scored Data are mean plusmn SE Upon the squarebrackets are reported the intergroups F 1 and F 2 (versus placeboF 3) statistical analysis (lowastlowastlowast119875 lt 0001) The intergroups F 1 versusF 2 statistical analysis (lowastlowast119875 lt 001) is also reported

The results of HR-QOL are reported in Table 4 Data werereported as the sum of each score given by the subject to eachitem of the HR-QOL questionnaire Internal consistency foreach item over time was good (Cronbachrsquos alphagt 086)TheHR-QOL was ameliorated for subjects treated with both F 1and F 2 during the treatment period Relatively to baselinethe sum of each score given by the subject to each symptom

during the treatment (11990560) was significantly reduced in theprobiotics group (312 plusmn 10 rarr 202 plusmn 09 119875 lt 0001for F 1 group and 320 plusmn 09 rarr 204 plusmn 09 119875 lt 0001for F 2 group) but not so clinically relevant in the placebogroup (300 plusmn 09 rarr 269 plusmn 12 119875 lt 0001 for F 3group) As expected mild amelioration of HR-QOL was seenin the placebo-treated subjects probably due to the placeboeffect The intergroup amelioration of HR-QOL during thetreatment (11990560) was bigger in the actives-treated (F 1 andF 2) subjects compared to placebo-treated (F 3) subjects (F 1versus F 3 202 plusmn 09 versus 269 plusmn 12 and F 2 versus F 3204plusmn 09 versus 269 plusmn 12 119875 lt 0001) Neither statistical norclinically significant differences were found between F 1 andF 2

In addition the analysis of the stool type classificationwas performed (data not shown) The numbers of sampleswith values of 3 4 and 5 according to Bristol scale andrepresenting a healthy bowel movement were calculatedSignificant differences were observed between F 1 or F 2 withrespect to F 3 representing an increase in the number of stoolsamples with a healthier characteristic in the probiotic treatedgroups

33 Secondary Efficacy Endpoint In order to assess themaintenance of the obtained effects the study design foresawa further 30-day follow-up period after the 60-day productintake period The results of IBS-C related symptoms main-tenance for responder are reported in Figure 4 During thefollow-up period (from day 61 to day 90) the percentage ofresponders for each clinical symptom was higher in the F 1and F 2 groups when compared to placebo F 3 (F 1 versusF 3 in the range of 56ndash74versus 10ndash40 and F 2 versusF 3 in the range of 76ndash82 versus 10ndash40) (119875 lt 0001)Neither statistical nor clinically significant differences weredetected between F 1 and F 2 except for abdominal cramps

BioMed Research International 7

Table 4 HR-QOL amelioration at the different times of treatment (1199050 11990510 11990530 and 11990560 days) and at the follow-up period that is 30 daysafter the last product intake (11990590 days) between F 1 and F 2 groups compared with F 3 Bloating abdominal pain constipation abdominalcramps and flatulence were assessed on a numbering scale from 0 to 10 for each item subjects scored Data are mean plusmn SE In brackets isreported the intergroups (versus placebo) statistical analysis

Time (days) F 1 P value F 2 P value F 3 P value F 1 vs F 3 (P value) F 2 vs F 3 (P value)0 312 plusmn 10 320 plusmn 09 300 plusmn 0910 283 plusmn 09 lt001 270 plusmn 08 lt0001 289 plusmn 10 gt005 gt005 gt00530 231 plusmn 09 lt0001 228 plusmn 08 lt0001 278 plusmn 11 lt005 lt001 lt000160 202 plusmn 09 lt0001 204 plusmn 09 lt0001 269 plusmn 12 lt0001 lt0001 lt000190 222 plusmn 10 lt0001 220 plusmn 08 lt005 287 plusmn 12 lt001 lt0001 lt0001

F_1F_2F_3

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowast

lowastlowastlowast

Bloa

ting

Abdo

min

alpa

in

Con

stipa

tion

Abdo

min

alcr

amps

Flat

ulen

ce

0102030405060708090

Resp

onde

rs (

)

Figure 4 Percentage of responders to IBS-C related symptom atthe follow-up period that is 30 days after the last product intake(11990590 days) of probiotic formulations F 1 and F 2 The Responderswas defined as the subject reporting a decrease of symptoms ofat least 30 compared to the basal condition for at least 50of the intervention time Bloating abdominal pain constipationabdominal cramps and flatulence symptoms were assessed on anumbering scale from 0 to 10 for each item subjects scored Data aremean plusmn SE Upon the square brackets are reported the intergroupsF 1 and F 2 (versus placebo F 3) statistical analysis (lowastlowastlowast119875 lt 0001)The intergroups F 1 versus F 2 statistical analysis (lowastlowast119875 lt 001) is alsoreported

symptom which was less significant during the follow-upperiod (119875 lt 001)

The results of HR-QOL are reported in Table 4 Data werereported as the sum of each score given by the subject to eachitem of the HR-QOL questionnaire Data obtained 30 days(11990590) after the last product intake were lower in the probioticgroups with respect to the basal scoring of symptoms at 1199050(312 plusmn 10 rarr 222 plusmn 10 119875 lt 0001 for F 1 group and 320 plusmn09 rarr 220plusmn08119875 lt 005 for F 2 group) but not so clinicallyrelevant in the placebo group (300 plusmn 09 rarr 287 plusmn 12 119875 lt001 for F 3 group)

The intergroup amelioration of HR-QOL was biggerin the actives-treated (F 1 and F 2) subjects compared toplacebo-treated (F 3) subjects (222 plusmn 10 versus 287 plusmn 12and 220plusmn09 versus 287plusmn12 119875 lt 0001) Neither statisticalnor clinically significant differences were detected betweenF 1 and F 2

Comparing follow-up period (11990590) with the end oftreatment period (11990560) the HR-QOL was not significantlydifferent for both F 1 and F 2 probiotic groups indicating themaintenance of the obtained effects

34 Fecal Microbiology Analysis by Quantitative PCR DNAwas extracted from fecal samples of the subjects enrolled inthis study at the times 1199050 11990510 11990530 11990560 and 11990590 from the firstingestion of the probiotic formulations The qPCR analysisdemonstrated that the species-specific sequences associatedwith the probiotics of the formulations were detected onlyin fecal DNA from subjects treated with the formulationsF 1 and F 2 and not with the formulation F 3 and that nosignificant difference was detected between the two kinds offormulations

The qPCR assay for L plantarum and L rhamnosus(contained in the mix F 2) demonstrated a quite similarquantity of these probiotic bacteria during the times oftreatment while B animalis subsp lactis decreases at time 90after the follow-up period Concerning results of probioticscontained in the formulation F 1 we can observe that Lacidophilus increases during the treatment but decreases afterthe follow-up period while the quantity of L reuteri wasquite similar during all the period of treatment including time11990590 (Figure 5) All these results indicate that all probioticsutilized in this study were enhanced in the gut tract after theiringestion at least for 90 days the only exceptionwas observedfor B animalis subsp lactis in which a lower concentration ofthis probiotic in the postintervention samples was obtained

4 Discussion

Probiotics exert their actions through interaction with hostintestinal cells Their supplementation significantly modifiesthe intestinal microbiota by increasing lactobacilli and bifi-dobacteria that can improve through the combination withspecific probiotics providing a health benefit to the host[27] Multispecies probiotics may have a variety of differentbeneficial effects particularly on IBS symptoms because eachspecies acts in a particular way on the gastrointestinaltract and two or more species acting together may have asynergistic effect [15]

Although several trials have demonstrated the superiorityof probiotics (above all lactobacilli and bifidobacteria) overplacebo in controlling IBS symptoms [16ndash18] however given

8 BioMed Research International

F_1

F_2

F_3

Time

02468

10

Ratio

of b

acte

rial

coun

ts

02468

10

Ratio

of b

acte

rial

coun

tsRa

tio o

f bac

teria

l

02468

10

coun

ts

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast lowast

lowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowastlowast

lowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowastlowast

lowastlowast

lowastlowastlowastlowast

lowastlowastlowast

lowastlowast

lowastlowastlowast

t10

t30

t60

t90

Figure 5 Ratio of probiotics of formulations (F 1 and F 2 versusF 3) by qPCR of species-specific sequences at the different times oftreatment versus the amount at the baseline time point expressedas bacterial counts Upon the bars is reported the statistical analysisbetween treatments (lowastlowastlowast119875 lt 0001)

the controversies in IBS pathophysiology or lack of clearevidence for gut microbiota abnormalities in patients withIBS additional randomized clinical trials with appropriateendpoints and design are needed to evaluate to which extentprobiotics are a useful therapeutic strategy in the manage-ment of IBS symptoms

In this study a randomized double-blind placebo-controlled clinical trial with two formulations containingdifferent probiotics was developed and the evaluation ofgut microbiota assessment and gastrointestinal benefits ofIBS-C patients was determined until 90 days Multispeciesprobiotics were used for the treatment of IBS-C in our studyL acidophilus L reuteri L plantarum L rhamnosus andB animalis subsp lactis Indeed it is known that the levelof bifidobacteria and lactobacilli species is lower in IBSpatients compared to healthy persons [28 29] and severalstudies show that the supplementation of them or mixturesincluding species of these genera is effective in alleviatingsymptoms of IBS Moreover the selected strains were alreadyknown for their effect on intestinal cell lines as previouslyreported [19]

To investigate the alterations in the intestinal microbiotathe number of lactobacilli and bifidobacteria present in fecal

samples of recruited subjects was determined by quantita-tive real-time PCR The numbers of Lactobacillus spp andBifidobacterium spp of the mixtures (F 1 and F 2) increasedduring the times of treatment until 60 days in the probioticgroups with respect to the placebo group (F 3) All thespecies included in the formulations remained in the gut also30 days after the follow-up from the last ingestion exceptfor Bifidobacterium Our results confirmed data reported byKajander et al These authors demonstrated that all supple-mented strains remained stable during the treatment withthe exception of Bifidobacterium species which decreasedafter treatments with a multispecies probiotic mixture [14]

Moreover in our study significant differences in thenumber of responders to the severity of symptoms wererecorded between the two probiotic mixtures F 1 and F 2with respect to placebo F 3 group (119875 lt 0001) No significantdifferences were registered between F 1 and F 2 (119875 gt 005)and the effects of both of them are significant when comparedto their respective baselinesThese data are in agreement withprevious data from multispecies probiotics treatment of IBSsubjects [14 15] Compared with placebo probiotic groupsF 1 and F 2 were effective for the primary efficacy endpointsof the study as well as for the secondary endpoints thatis the maintaining of the obtained effects 30 days after thelast product intake The change of symptoms is correlated tothe improvement in the quality of life and resulted in beingsignificantly higher in the probiotic groups compared withthe placebo group Although a great number of data derivingfrom literature [16ndash18 30] indicate that probiotics may behelpful in the treatment of IBS symptoms in particular withrespect to constipation their conclusions vary because ofinadequate sample size type of study design and use ofvarious probiotic strains These data are in agreement withour data concerning the improvement of specific probiotictreatment versus placebo (specifically in patients with IBS-C) for some of the endpoints improving symptoms such aspain flatulence and bloating but not others (transit time andurgency and abdominal cramps) [30] Moreover in most ofthe reported cases the decrease in constipation frequencyscore was approximately twofold greater in the probioticgroups than in the placebo groups and these results are in linewith data deriving from our clinical study

Thus the clinical improvement of this study may beassociated with the maintenance (species-specific) of thecompositional stability of the intestinal microbiota fromprobiotics consumption and with their positive effects insubjects affected by irritable bowel syndromes

5 Conclusions

In conclusion the different species of probiotics admin-istered to the IBS-C subjects determine a cooccurrencebetween the changes in the analysed probiotic groups andan improvement of IBS-C symptoms This study representsthe development of a clinical trial that can support the role ofintestinal bacteria in the IBS diseases and the potential role ofprobiotics belonging to various species in themanagement ofthese disorders

BioMed Research International 9

Ethical Approval

All procedures performed in studies involving human partic-ipants were in accordance with the ethical standards of theinstitutional andor national research committee and withthe 1964 Helsinki declaration and its later amendments orcomparable ethical standards

Consent

Informed consent was obtained from all individual partici-pants included in the study

Competing Interests

All the authors declare that they have no conflict of interests

Acknowledgments

The research was conducted through the Probioplus4FoodProject no 30221122 funded by MIUR and LombardyRegion Italy The authors thank Principium Europe Srlfor supplying the bacterial strains and Farcoderm for therecruited subjects of this study

References

[1] P B Eckburg E M Bik C N Bernstein et al ldquoMicrobiologydiversity of the human intestinal microbial florardquo Science vol308 no 5728 pp 1635ndash1638 2005

[2] S K Mazmanian H L Cui A O Tzianabos and D L KasperldquoAn immunomodulatorymolecule of symbiotic bacteria directsmaturation of the host immune systemrdquo Cell vol 122 no 1 pp107ndash118 2005

[3] V R Alonso and F Guarner ldquoLinking the gut microbiota tohuman healthrdquo British Journal of Nutrition vol 109 supplement2 pp S21ndashS26 2013

[4] G Tomasello M Bellavia V D Palumbo M C Gioviale PDamiani and A I L Monte ldquoFrom gut microflora imbalanceto mycobacteria infection is there a relationship with chronicintestinal inflammatory diseasesrdquo Annali Italiani di Chirurgiavol 82 no 5 pp 361ndash368 2011

[5] F Guarner and J-R Malagelada ldquoGut flora in health anddiseaserdquoThe Lancet vol 361 no 9356 pp 512ndash519 2003

[6] J Matto L Maunuksela K Kajander et al ldquoComposition andtemporal stability of gastrointestinal microbiota in irritablebowel syndromemdasha longitudinal study in IBS and controlsubjectsrdquo FEMS Immunology andMedical Microbiology vol 43no 2 pp 213ndash222 2005

[7] C Abraham and J H Cho ldquoMechanisms of disease inflamma-tory bowel diseaserdquo The New England Journal of Medicine vol361 no 21 pp 2066ndash2078 2009

[8] M Bellavia G Damiano M C Gioviale et al ldquoAbnormalexpansion of segmented filamentous bacteria in the gut a rolein pathogenesis of chronic inflammatory intestinal diseasesrdquoReviews in Medical Microbiology vol 22 no 3 pp 45ndash47 2011

[9] M Bellavia G Tomasello M Romeo et al ldquoGut microbiotaimbalance and chaperoning system malfunction are central toulcerative colitis pathogenesis and can be counteracted withspecifically designed probiotics a working hypothesisrdquoMedical

Microbiology and Immunology vol 202 no 6 pp 393ndash4062013

[10] W Strober I Fuss and P Mannon ldquoThe fundamental basis ofinflammatory bowel diseaserdquo Journal of Clinical Investigationvol 117 no 3 pp 514ndash521 2007

[11] M Llopis M Antolin M Carol et al ldquoLactobacillus caseidownregulates commensalsrsquo inflammatory signals in Crohnrsquosdisease mucosardquo Inflammatory Bowel Diseases vol 15 no 2 pp275ndash283 2009

[12] M Pammi A Flores M Leeflang and J Versalovic ldquoMolecularassays in the diagnosis of neonatal sepsis a systematic reviewand meta-analysisrdquo Pediatrics vol 128 no 4 pp e973ndashe9852011

[13] M Venkatesh A Flores R A Luna and J Versalovic ldquoMolecu-larmicrobiologicalmethods in the diagnosis of neonatal sepsisrdquoExpert Review of Anti-Infective Therapy vol 8 no 9 pp 1037ndash1048 2010

[14] K Kajander E Myllyluoma M Rajilic-Stojanovic et al ldquoClin-ical trial multispecies probiotic supplementation alleviates thesymptoms of irritable bowel syndrome and stabilizes intestinalmicrobiotardquoAlimentary Pharmacology andTherapeutics vol 27no 1 pp 48ndash57 2008

[15] J S Yoon W Sohn O Y Lee et al ldquoEffect of multispeciesprobiotics on irritable bowel syndrome a randomized double-blind placebo-controlled trialrdquo Journal of Gastroenterology andHepatology vol 29 no 1 pp 52ndash59 2014

[16] A P S Hungin C Mulligan B Pot et al ldquoSystematicreview probiotics in the management of lower gastrointestinalsymptoms in clinical practicemdashan evidence-based internationalguiderdquo Alimentary Pharmacology and Therapeutics vol 38 no8 pp 864ndash886 2013

[17] A Agrawal L A Houghton J Morris et al ldquoClinical trial theeffects of a fermentedmilk product containing Bifidobacteriumlactis DN-173 010 on abdominal distension and gastrointestinaltransit in irritable bowel syndrome with constipationrdquo Alimen-tary Pharmacology and Therapeutics vol 29 no 1 pp 104ndash1142009

[18] S Guglielmetti D Mora M Gschwender and K PoppldquoRandomised clinical trial Bifidobacterium bifidumMIMBb75significantly alleviates irritable bowel syndrome and improvesquality of lifemdasha double-blind Placebo-Controlled Studyrdquo Ali-mentary Pharmacology and Therapeutics vol 33 no 10 pp1123ndash1132 2011

[19] I Presti G DrsquoOrazio M Labra et al ldquoEvaluation of theprobiotic properties of new Lactobacillus and Bifidobacteriumstrains and their in vitro effectrdquo Applied Microbiology andBiotechnology vol 99 no 13 pp 5613ndash5626 2015

[20] I Aloisio C Santini B Biavati et al ldquoCharacterization of Bifi-dobacterium spp strains for the treatment of enteric disordersin newbornsrdquo Applied Microbiology and Biotechnology vol 96no 6 pp 1561ndash1576 2012

[21] D A Drossman E Corazziari M Delvaux et al EdsRome IIIThe Functional Gastrointestinal Disorders Degnon AssociatesMcLean Va USA 3rd edition 2006

[22] D L Patrick D A Drossman I O Frederick J Dicesare andK L Puder ldquoQuality of life in persons with irritable bowelsyndrome development and validation of a new measurerdquoDigestive Diseases and Sciences vol 43 no 2 pp 400ndash411 1998

[23] S J Lewis and KW Heaton ldquoStool form scale as a useful guideto intestinal transit timerdquo Scandinavian Journal of Gastroen-terology vol 32 no 9 pp 920ndash924 1997

10 BioMed Research International

[24] M Enrico Biological sciences [PhD thesis] The University ofMilano-Bicocca 2015

[25] M V Matz R M Wright and J G Scott ldquoNo control genesrequired bayesian analysis of qRT-PCR datardquo PloS ONE vol 8no 8 Article ID e71448 2013

[26] H Wickham ggplot2 Elegant Graphics for Data AnalysisSpringer Science amp BusinessMedia Springer-Verlag New YorkNY USA 2009

[27] J Plaza-Diaz C Gomez-Llorente L Fontana and A GilldquoModulation of immunity and inflammatory gene expressionin the gut in inflammatory diseases of the gut and in the liverby probioticsrdquoWorld Journal of Gastroenterology vol 20 no 42pp 15632ndash15649 2014

[28] A P M Kerckhoffs M Samsom M E van der Rest etal ldquoLower Bifidobacteria counts in both duodenal mucosa-associated and fecal microbiota in irritable bowel syndromepatientsrdquo World Journal of Gastroenterology vol 15 no 23 pp2887ndash2892 2009

[29] E Malinen T Rinttila K Kajander et al ldquoAnalysis of thefecal microbiota of irritable bowel syndrome patients andhealthy controls with real-time PCRrdquo American Journal ofGastroenterology vol 100 no 2 pp 373ndash382 2005

[30] P Moayyedi A C Ford N J Talley et al ldquoThe efficacy ofprobiotics in the treatment of irritable bowel syndrome asystematic reviewrdquo Gut vol 59 no 3 pp 325ndash332 2010

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

6 BioMed Research InternationalEn

rollm

ent

Allo

catio

nA

naly

sis

Placebo

Follo

w-u

p

(ii) Did not receive allocated

(i) Received allocated intervention(i) Received allocated intervention

(ii) Did not receive allocatedintervention (n = 0)

Allocated to intervention (n = 53)

(n = 53)

Allocated to intervention (n = 52)

(n = 52)

intervention (n = 0)

Discontinued intervention (n = 3)Lost to follow-up (n = 0)

Discontinued intervention (n = 2)Lost to follow-up (n = 0)

Discontinued intervention (n = 2)Lost to follow-up (n = 0)

(i) Excluded from analysis (n = 0)(i) Excluded from analysis (n = 0)Analysed (n = 50)Analysed (n = 50)

(i) Excluded from analysis (n = 0)Analysed (n = 50)

Allocated to intervention (n = 52)

(ii) Did not receive allocated intervention(i) Received allocated intervention (n = 52)

n = 0)(

Randomized (n = 157)

(i) Not meeting the inclusioncriteria (n = 40)

(ii) Declined to participate (n = 0)

Excluded (n = 0)

Assessed for eligibility (N = 197)

F_1 F_2

Figure 2 Disposition of the subjects of the study

F_1F_2F_3

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowast

Bloa

ting

Abdo

min

alpa

in

Con

stipa

tion

Abdo

min

alcr

amps

Flat

ulen

ce

0

20

40

60

80

100

Resp

onde

rs (

)

Figure 3 Percentage of responders to IBS-C related symptomduring the treatment period (11990560 days) with probiotic formulationsF 1 and F 2 The Responders was defined as the subject reportinga decrease of symptoms of at least 30 compared to the basalcondition for at least 50 of the intervention time Bloatingabdominal pain constipation abdominal cramps and flatulencesymptoms were assessed on a numbering scale from 0 to 10 foreach item subjects scored Data are mean plusmn SE Upon the squarebrackets are reported the intergroups F 1 and F 2 (versus placeboF 3) statistical analysis (lowastlowastlowast119875 lt 0001) The intergroups F 1 versusF 2 statistical analysis (lowastlowast119875 lt 001) is also reported

The results of HR-QOL are reported in Table 4 Data werereported as the sum of each score given by the subject to eachitem of the HR-QOL questionnaire Internal consistency foreach item over time was good (Cronbachrsquos alphagt 086)TheHR-QOL was ameliorated for subjects treated with both F 1and F 2 during the treatment period Relatively to baselinethe sum of each score given by the subject to each symptom

during the treatment (11990560) was significantly reduced in theprobiotics group (312 plusmn 10 rarr 202 plusmn 09 119875 lt 0001for F 1 group and 320 plusmn 09 rarr 204 plusmn 09 119875 lt 0001for F 2 group) but not so clinically relevant in the placebogroup (300 plusmn 09 rarr 269 plusmn 12 119875 lt 0001 for F 3group) As expected mild amelioration of HR-QOL was seenin the placebo-treated subjects probably due to the placeboeffect The intergroup amelioration of HR-QOL during thetreatment (11990560) was bigger in the actives-treated (F 1 andF 2) subjects compared to placebo-treated (F 3) subjects (F 1versus F 3 202 plusmn 09 versus 269 plusmn 12 and F 2 versus F 3204plusmn 09 versus 269 plusmn 12 119875 lt 0001) Neither statistical norclinically significant differences were found between F 1 andF 2

In addition the analysis of the stool type classificationwas performed (data not shown) The numbers of sampleswith values of 3 4 and 5 according to Bristol scale andrepresenting a healthy bowel movement were calculatedSignificant differences were observed between F 1 or F 2 withrespect to F 3 representing an increase in the number of stoolsamples with a healthier characteristic in the probiotic treatedgroups

33 Secondary Efficacy Endpoint In order to assess themaintenance of the obtained effects the study design foresawa further 30-day follow-up period after the 60-day productintake period The results of IBS-C related symptoms main-tenance for responder are reported in Figure 4 During thefollow-up period (from day 61 to day 90) the percentage ofresponders for each clinical symptom was higher in the F 1and F 2 groups when compared to placebo F 3 (F 1 versusF 3 in the range of 56ndash74versus 10ndash40 and F 2 versusF 3 in the range of 76ndash82 versus 10ndash40) (119875 lt 0001)Neither statistical nor clinically significant differences weredetected between F 1 and F 2 except for abdominal cramps

BioMed Research International 7

Table 4 HR-QOL amelioration at the different times of treatment (1199050 11990510 11990530 and 11990560 days) and at the follow-up period that is 30 daysafter the last product intake (11990590 days) between F 1 and F 2 groups compared with F 3 Bloating abdominal pain constipation abdominalcramps and flatulence were assessed on a numbering scale from 0 to 10 for each item subjects scored Data are mean plusmn SE In brackets isreported the intergroups (versus placebo) statistical analysis

Time (days) F 1 P value F 2 P value F 3 P value F 1 vs F 3 (P value) F 2 vs F 3 (P value)0 312 plusmn 10 320 plusmn 09 300 plusmn 0910 283 plusmn 09 lt001 270 plusmn 08 lt0001 289 plusmn 10 gt005 gt005 gt00530 231 plusmn 09 lt0001 228 plusmn 08 lt0001 278 plusmn 11 lt005 lt001 lt000160 202 plusmn 09 lt0001 204 plusmn 09 lt0001 269 plusmn 12 lt0001 lt0001 lt000190 222 plusmn 10 lt0001 220 plusmn 08 lt005 287 plusmn 12 lt001 lt0001 lt0001

F_1F_2F_3

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowast

lowastlowastlowast

Bloa

ting

Abdo

min

alpa

in

Con

stipa

tion

Abdo

min

alcr

amps

Flat

ulen

ce

0102030405060708090

Resp

onde

rs (

)

Figure 4 Percentage of responders to IBS-C related symptom atthe follow-up period that is 30 days after the last product intake(11990590 days) of probiotic formulations F 1 and F 2 The Responderswas defined as the subject reporting a decrease of symptoms ofat least 30 compared to the basal condition for at least 50of the intervention time Bloating abdominal pain constipationabdominal cramps and flatulence symptoms were assessed on anumbering scale from 0 to 10 for each item subjects scored Data aremean plusmn SE Upon the square brackets are reported the intergroupsF 1 and F 2 (versus placebo F 3) statistical analysis (lowastlowastlowast119875 lt 0001)The intergroups F 1 versus F 2 statistical analysis (lowastlowast119875 lt 001) is alsoreported

symptom which was less significant during the follow-upperiod (119875 lt 001)

The results of HR-QOL are reported in Table 4 Data werereported as the sum of each score given by the subject to eachitem of the HR-QOL questionnaire Data obtained 30 days(11990590) after the last product intake were lower in the probioticgroups with respect to the basal scoring of symptoms at 1199050(312 plusmn 10 rarr 222 plusmn 10 119875 lt 0001 for F 1 group and 320 plusmn09 rarr 220plusmn08119875 lt 005 for F 2 group) but not so clinicallyrelevant in the placebo group (300 plusmn 09 rarr 287 plusmn 12 119875 lt001 for F 3 group)

The intergroup amelioration of HR-QOL was biggerin the actives-treated (F 1 and F 2) subjects compared toplacebo-treated (F 3) subjects (222 plusmn 10 versus 287 plusmn 12and 220plusmn09 versus 287plusmn12 119875 lt 0001) Neither statisticalnor clinically significant differences were detected betweenF 1 and F 2

Comparing follow-up period (11990590) with the end oftreatment period (11990560) the HR-QOL was not significantlydifferent for both F 1 and F 2 probiotic groups indicating themaintenance of the obtained effects

34 Fecal Microbiology Analysis by Quantitative PCR DNAwas extracted from fecal samples of the subjects enrolled inthis study at the times 1199050 11990510 11990530 11990560 and 11990590 from the firstingestion of the probiotic formulations The qPCR analysisdemonstrated that the species-specific sequences associatedwith the probiotics of the formulations were detected onlyin fecal DNA from subjects treated with the formulationsF 1 and F 2 and not with the formulation F 3 and that nosignificant difference was detected between the two kinds offormulations

The qPCR assay for L plantarum and L rhamnosus(contained in the mix F 2) demonstrated a quite similarquantity of these probiotic bacteria during the times oftreatment while B animalis subsp lactis decreases at time 90after the follow-up period Concerning results of probioticscontained in the formulation F 1 we can observe that Lacidophilus increases during the treatment but decreases afterthe follow-up period while the quantity of L reuteri wasquite similar during all the period of treatment including time11990590 (Figure 5) All these results indicate that all probioticsutilized in this study were enhanced in the gut tract after theiringestion at least for 90 days the only exceptionwas observedfor B animalis subsp lactis in which a lower concentration ofthis probiotic in the postintervention samples was obtained

4 Discussion

Probiotics exert their actions through interaction with hostintestinal cells Their supplementation significantly modifiesthe intestinal microbiota by increasing lactobacilli and bifi-dobacteria that can improve through the combination withspecific probiotics providing a health benefit to the host[27] Multispecies probiotics may have a variety of differentbeneficial effects particularly on IBS symptoms because eachspecies acts in a particular way on the gastrointestinaltract and two or more species acting together may have asynergistic effect [15]

Although several trials have demonstrated the superiorityof probiotics (above all lactobacilli and bifidobacteria) overplacebo in controlling IBS symptoms [16ndash18] however given

8 BioMed Research International

F_1

F_2

F_3

Time

02468

10

Ratio

of b

acte

rial

coun

ts

02468

10

Ratio

of b

acte

rial

coun

tsRa

tio o

f bac

teria

l

02468

10

coun

ts

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast lowast

lowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowastlowast

lowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowastlowast

lowastlowast

lowastlowastlowastlowast

lowastlowastlowast

lowastlowast

lowastlowastlowast

t10

t30

t60

t90

Figure 5 Ratio of probiotics of formulations (F 1 and F 2 versusF 3) by qPCR of species-specific sequences at the different times oftreatment versus the amount at the baseline time point expressedas bacterial counts Upon the bars is reported the statistical analysisbetween treatments (lowastlowastlowast119875 lt 0001)

the controversies in IBS pathophysiology or lack of clearevidence for gut microbiota abnormalities in patients withIBS additional randomized clinical trials with appropriateendpoints and design are needed to evaluate to which extentprobiotics are a useful therapeutic strategy in the manage-ment of IBS symptoms

In this study a randomized double-blind placebo-controlled clinical trial with two formulations containingdifferent probiotics was developed and the evaluation ofgut microbiota assessment and gastrointestinal benefits ofIBS-C patients was determined until 90 days Multispeciesprobiotics were used for the treatment of IBS-C in our studyL acidophilus L reuteri L plantarum L rhamnosus andB animalis subsp lactis Indeed it is known that the levelof bifidobacteria and lactobacilli species is lower in IBSpatients compared to healthy persons [28 29] and severalstudies show that the supplementation of them or mixturesincluding species of these genera is effective in alleviatingsymptoms of IBS Moreover the selected strains were alreadyknown for their effect on intestinal cell lines as previouslyreported [19]

To investigate the alterations in the intestinal microbiotathe number of lactobacilli and bifidobacteria present in fecal

samples of recruited subjects was determined by quantita-tive real-time PCR The numbers of Lactobacillus spp andBifidobacterium spp of the mixtures (F 1 and F 2) increasedduring the times of treatment until 60 days in the probioticgroups with respect to the placebo group (F 3) All thespecies included in the formulations remained in the gut also30 days after the follow-up from the last ingestion exceptfor Bifidobacterium Our results confirmed data reported byKajander et al These authors demonstrated that all supple-mented strains remained stable during the treatment withthe exception of Bifidobacterium species which decreasedafter treatments with a multispecies probiotic mixture [14]

Moreover in our study significant differences in thenumber of responders to the severity of symptoms wererecorded between the two probiotic mixtures F 1 and F 2with respect to placebo F 3 group (119875 lt 0001) No significantdifferences were registered between F 1 and F 2 (119875 gt 005)and the effects of both of them are significant when comparedto their respective baselinesThese data are in agreement withprevious data from multispecies probiotics treatment of IBSsubjects [14 15] Compared with placebo probiotic groupsF 1 and F 2 were effective for the primary efficacy endpointsof the study as well as for the secondary endpoints thatis the maintaining of the obtained effects 30 days after thelast product intake The change of symptoms is correlated tothe improvement in the quality of life and resulted in beingsignificantly higher in the probiotic groups compared withthe placebo group Although a great number of data derivingfrom literature [16ndash18 30] indicate that probiotics may behelpful in the treatment of IBS symptoms in particular withrespect to constipation their conclusions vary because ofinadequate sample size type of study design and use ofvarious probiotic strains These data are in agreement withour data concerning the improvement of specific probiotictreatment versus placebo (specifically in patients with IBS-C) for some of the endpoints improving symptoms such aspain flatulence and bloating but not others (transit time andurgency and abdominal cramps) [30] Moreover in most ofthe reported cases the decrease in constipation frequencyscore was approximately twofold greater in the probioticgroups than in the placebo groups and these results are in linewith data deriving from our clinical study

Thus the clinical improvement of this study may beassociated with the maintenance (species-specific) of thecompositional stability of the intestinal microbiota fromprobiotics consumption and with their positive effects insubjects affected by irritable bowel syndromes

5 Conclusions

In conclusion the different species of probiotics admin-istered to the IBS-C subjects determine a cooccurrencebetween the changes in the analysed probiotic groups andan improvement of IBS-C symptoms This study representsthe development of a clinical trial that can support the role ofintestinal bacteria in the IBS diseases and the potential role ofprobiotics belonging to various species in themanagement ofthese disorders

BioMed Research International 9

Ethical Approval

All procedures performed in studies involving human partic-ipants were in accordance with the ethical standards of theinstitutional andor national research committee and withthe 1964 Helsinki declaration and its later amendments orcomparable ethical standards

Consent

Informed consent was obtained from all individual partici-pants included in the study

Competing Interests

All the authors declare that they have no conflict of interests

Acknowledgments

The research was conducted through the Probioplus4FoodProject no 30221122 funded by MIUR and LombardyRegion Italy The authors thank Principium Europe Srlfor supplying the bacterial strains and Farcoderm for therecruited subjects of this study

References

[1] P B Eckburg E M Bik C N Bernstein et al ldquoMicrobiologydiversity of the human intestinal microbial florardquo Science vol308 no 5728 pp 1635ndash1638 2005

[2] S K Mazmanian H L Cui A O Tzianabos and D L KasperldquoAn immunomodulatorymolecule of symbiotic bacteria directsmaturation of the host immune systemrdquo Cell vol 122 no 1 pp107ndash118 2005

[3] V R Alonso and F Guarner ldquoLinking the gut microbiota tohuman healthrdquo British Journal of Nutrition vol 109 supplement2 pp S21ndashS26 2013

[4] G Tomasello M Bellavia V D Palumbo M C Gioviale PDamiani and A I L Monte ldquoFrom gut microflora imbalanceto mycobacteria infection is there a relationship with chronicintestinal inflammatory diseasesrdquo Annali Italiani di Chirurgiavol 82 no 5 pp 361ndash368 2011

[5] F Guarner and J-R Malagelada ldquoGut flora in health anddiseaserdquoThe Lancet vol 361 no 9356 pp 512ndash519 2003

[6] J Matto L Maunuksela K Kajander et al ldquoComposition andtemporal stability of gastrointestinal microbiota in irritablebowel syndromemdasha longitudinal study in IBS and controlsubjectsrdquo FEMS Immunology andMedical Microbiology vol 43no 2 pp 213ndash222 2005

[7] C Abraham and J H Cho ldquoMechanisms of disease inflamma-tory bowel diseaserdquo The New England Journal of Medicine vol361 no 21 pp 2066ndash2078 2009

[8] M Bellavia G Damiano M C Gioviale et al ldquoAbnormalexpansion of segmented filamentous bacteria in the gut a rolein pathogenesis of chronic inflammatory intestinal diseasesrdquoReviews in Medical Microbiology vol 22 no 3 pp 45ndash47 2011

[9] M Bellavia G Tomasello M Romeo et al ldquoGut microbiotaimbalance and chaperoning system malfunction are central toulcerative colitis pathogenesis and can be counteracted withspecifically designed probiotics a working hypothesisrdquoMedical

Microbiology and Immunology vol 202 no 6 pp 393ndash4062013

[10] W Strober I Fuss and P Mannon ldquoThe fundamental basis ofinflammatory bowel diseaserdquo Journal of Clinical Investigationvol 117 no 3 pp 514ndash521 2007

[11] M Llopis M Antolin M Carol et al ldquoLactobacillus caseidownregulates commensalsrsquo inflammatory signals in Crohnrsquosdisease mucosardquo Inflammatory Bowel Diseases vol 15 no 2 pp275ndash283 2009

[12] M Pammi A Flores M Leeflang and J Versalovic ldquoMolecularassays in the diagnosis of neonatal sepsis a systematic reviewand meta-analysisrdquo Pediatrics vol 128 no 4 pp e973ndashe9852011

[13] M Venkatesh A Flores R A Luna and J Versalovic ldquoMolecu-larmicrobiologicalmethods in the diagnosis of neonatal sepsisrdquoExpert Review of Anti-Infective Therapy vol 8 no 9 pp 1037ndash1048 2010

[14] K Kajander E Myllyluoma M Rajilic-Stojanovic et al ldquoClin-ical trial multispecies probiotic supplementation alleviates thesymptoms of irritable bowel syndrome and stabilizes intestinalmicrobiotardquoAlimentary Pharmacology andTherapeutics vol 27no 1 pp 48ndash57 2008

[15] J S Yoon W Sohn O Y Lee et al ldquoEffect of multispeciesprobiotics on irritable bowel syndrome a randomized double-blind placebo-controlled trialrdquo Journal of Gastroenterology andHepatology vol 29 no 1 pp 52ndash59 2014

[16] A P S Hungin C Mulligan B Pot et al ldquoSystematicreview probiotics in the management of lower gastrointestinalsymptoms in clinical practicemdashan evidence-based internationalguiderdquo Alimentary Pharmacology and Therapeutics vol 38 no8 pp 864ndash886 2013

[17] A Agrawal L A Houghton J Morris et al ldquoClinical trial theeffects of a fermentedmilk product containing Bifidobacteriumlactis DN-173 010 on abdominal distension and gastrointestinaltransit in irritable bowel syndrome with constipationrdquo Alimen-tary Pharmacology and Therapeutics vol 29 no 1 pp 104ndash1142009

[18] S Guglielmetti D Mora M Gschwender and K PoppldquoRandomised clinical trial Bifidobacterium bifidumMIMBb75significantly alleviates irritable bowel syndrome and improvesquality of lifemdasha double-blind Placebo-Controlled Studyrdquo Ali-mentary Pharmacology and Therapeutics vol 33 no 10 pp1123ndash1132 2011

[19] I Presti G DrsquoOrazio M Labra et al ldquoEvaluation of theprobiotic properties of new Lactobacillus and Bifidobacteriumstrains and their in vitro effectrdquo Applied Microbiology andBiotechnology vol 99 no 13 pp 5613ndash5626 2015

[20] I Aloisio C Santini B Biavati et al ldquoCharacterization of Bifi-dobacterium spp strains for the treatment of enteric disordersin newbornsrdquo Applied Microbiology and Biotechnology vol 96no 6 pp 1561ndash1576 2012

[21] D A Drossman E Corazziari M Delvaux et al EdsRome IIIThe Functional Gastrointestinal Disorders Degnon AssociatesMcLean Va USA 3rd edition 2006

[22] D L Patrick D A Drossman I O Frederick J Dicesare andK L Puder ldquoQuality of life in persons with irritable bowelsyndrome development and validation of a new measurerdquoDigestive Diseases and Sciences vol 43 no 2 pp 400ndash411 1998

[23] S J Lewis and KW Heaton ldquoStool form scale as a useful guideto intestinal transit timerdquo Scandinavian Journal of Gastroen-terology vol 32 no 9 pp 920ndash924 1997

10 BioMed Research International

[24] M Enrico Biological sciences [PhD thesis] The University ofMilano-Bicocca 2015

[25] M V Matz R M Wright and J G Scott ldquoNo control genesrequired bayesian analysis of qRT-PCR datardquo PloS ONE vol 8no 8 Article ID e71448 2013

[26] H Wickham ggplot2 Elegant Graphics for Data AnalysisSpringer Science amp BusinessMedia Springer-Verlag New YorkNY USA 2009

[27] J Plaza-Diaz C Gomez-Llorente L Fontana and A GilldquoModulation of immunity and inflammatory gene expressionin the gut in inflammatory diseases of the gut and in the liverby probioticsrdquoWorld Journal of Gastroenterology vol 20 no 42pp 15632ndash15649 2014

[28] A P M Kerckhoffs M Samsom M E van der Rest etal ldquoLower Bifidobacteria counts in both duodenal mucosa-associated and fecal microbiota in irritable bowel syndromepatientsrdquo World Journal of Gastroenterology vol 15 no 23 pp2887ndash2892 2009

[29] E Malinen T Rinttila K Kajander et al ldquoAnalysis of thefecal microbiota of irritable bowel syndrome patients andhealthy controls with real-time PCRrdquo American Journal ofGastroenterology vol 100 no 2 pp 373ndash382 2005

[30] P Moayyedi A C Ford N J Talley et al ldquoThe efficacy ofprobiotics in the treatment of irritable bowel syndrome asystematic reviewrdquo Gut vol 59 no 3 pp 325ndash332 2010

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

BioMed Research International 7

Table 4 HR-QOL amelioration at the different times of treatment (1199050 11990510 11990530 and 11990560 days) and at the follow-up period that is 30 daysafter the last product intake (11990590 days) between F 1 and F 2 groups compared with F 3 Bloating abdominal pain constipation abdominalcramps and flatulence were assessed on a numbering scale from 0 to 10 for each item subjects scored Data are mean plusmn SE In brackets isreported the intergroups (versus placebo) statistical analysis

Time (days) F 1 P value F 2 P value F 3 P value F 1 vs F 3 (P value) F 2 vs F 3 (P value)0 312 plusmn 10 320 plusmn 09 300 plusmn 0910 283 plusmn 09 lt001 270 plusmn 08 lt0001 289 plusmn 10 gt005 gt005 gt00530 231 plusmn 09 lt0001 228 plusmn 08 lt0001 278 plusmn 11 lt005 lt001 lt000160 202 plusmn 09 lt0001 204 plusmn 09 lt0001 269 plusmn 12 lt0001 lt0001 lt000190 222 plusmn 10 lt0001 220 plusmn 08 lt005 287 plusmn 12 lt001 lt0001 lt0001

F_1F_2F_3

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowast

lowastlowastlowast

Bloa

ting

Abdo

min

alpa

in

Con

stipa

tion

Abdo

min

alcr

amps

Flat

ulen

ce

0102030405060708090

Resp

onde

rs (

)

Figure 4 Percentage of responders to IBS-C related symptom atthe follow-up period that is 30 days after the last product intake(11990590 days) of probiotic formulations F 1 and F 2 The Responderswas defined as the subject reporting a decrease of symptoms ofat least 30 compared to the basal condition for at least 50of the intervention time Bloating abdominal pain constipationabdominal cramps and flatulence symptoms were assessed on anumbering scale from 0 to 10 for each item subjects scored Data aremean plusmn SE Upon the square brackets are reported the intergroupsF 1 and F 2 (versus placebo F 3) statistical analysis (lowastlowastlowast119875 lt 0001)The intergroups F 1 versus F 2 statistical analysis (lowastlowast119875 lt 001) is alsoreported

symptom which was less significant during the follow-upperiod (119875 lt 001)

The results of HR-QOL are reported in Table 4 Data werereported as the sum of each score given by the subject to eachitem of the HR-QOL questionnaire Data obtained 30 days(11990590) after the last product intake were lower in the probioticgroups with respect to the basal scoring of symptoms at 1199050(312 plusmn 10 rarr 222 plusmn 10 119875 lt 0001 for F 1 group and 320 plusmn09 rarr 220plusmn08119875 lt 005 for F 2 group) but not so clinicallyrelevant in the placebo group (300 plusmn 09 rarr 287 plusmn 12 119875 lt001 for F 3 group)

The intergroup amelioration of HR-QOL was biggerin the actives-treated (F 1 and F 2) subjects compared toplacebo-treated (F 3) subjects (222 plusmn 10 versus 287 plusmn 12and 220plusmn09 versus 287plusmn12 119875 lt 0001) Neither statisticalnor clinically significant differences were detected betweenF 1 and F 2

Comparing follow-up period (11990590) with the end oftreatment period (11990560) the HR-QOL was not significantlydifferent for both F 1 and F 2 probiotic groups indicating themaintenance of the obtained effects

34 Fecal Microbiology Analysis by Quantitative PCR DNAwas extracted from fecal samples of the subjects enrolled inthis study at the times 1199050 11990510 11990530 11990560 and 11990590 from the firstingestion of the probiotic formulations The qPCR analysisdemonstrated that the species-specific sequences associatedwith the probiotics of the formulations were detected onlyin fecal DNA from subjects treated with the formulationsF 1 and F 2 and not with the formulation F 3 and that nosignificant difference was detected between the two kinds offormulations

The qPCR assay for L plantarum and L rhamnosus(contained in the mix F 2) demonstrated a quite similarquantity of these probiotic bacteria during the times oftreatment while B animalis subsp lactis decreases at time 90after the follow-up period Concerning results of probioticscontained in the formulation F 1 we can observe that Lacidophilus increases during the treatment but decreases afterthe follow-up period while the quantity of L reuteri wasquite similar during all the period of treatment including time11990590 (Figure 5) All these results indicate that all probioticsutilized in this study were enhanced in the gut tract after theiringestion at least for 90 days the only exceptionwas observedfor B animalis subsp lactis in which a lower concentration ofthis probiotic in the postintervention samples was obtained

4 Discussion

Probiotics exert their actions through interaction with hostintestinal cells Their supplementation significantly modifiesthe intestinal microbiota by increasing lactobacilli and bifi-dobacteria that can improve through the combination withspecific probiotics providing a health benefit to the host[27] Multispecies probiotics may have a variety of differentbeneficial effects particularly on IBS symptoms because eachspecies acts in a particular way on the gastrointestinaltract and two or more species acting together may have asynergistic effect [15]

Although several trials have demonstrated the superiorityof probiotics (above all lactobacilli and bifidobacteria) overplacebo in controlling IBS symptoms [16ndash18] however given

8 BioMed Research International

F_1

F_2

F_3

Time

02468

10

Ratio

of b

acte

rial

coun

ts

02468

10

Ratio

of b

acte

rial

coun

tsRa

tio o

f bac

teria

l

02468

10

coun

ts

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast lowast

lowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowastlowast

lowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowastlowast

lowastlowast

lowastlowastlowastlowast

lowastlowastlowast

lowastlowast

lowastlowastlowast

t10

t30

t60

t90

Figure 5 Ratio of probiotics of formulations (F 1 and F 2 versusF 3) by qPCR of species-specific sequences at the different times oftreatment versus the amount at the baseline time point expressedas bacterial counts Upon the bars is reported the statistical analysisbetween treatments (lowastlowastlowast119875 lt 0001)

the controversies in IBS pathophysiology or lack of clearevidence for gut microbiota abnormalities in patients withIBS additional randomized clinical trials with appropriateendpoints and design are needed to evaluate to which extentprobiotics are a useful therapeutic strategy in the manage-ment of IBS symptoms

In this study a randomized double-blind placebo-controlled clinical trial with two formulations containingdifferent probiotics was developed and the evaluation ofgut microbiota assessment and gastrointestinal benefits ofIBS-C patients was determined until 90 days Multispeciesprobiotics were used for the treatment of IBS-C in our studyL acidophilus L reuteri L plantarum L rhamnosus andB animalis subsp lactis Indeed it is known that the levelof bifidobacteria and lactobacilli species is lower in IBSpatients compared to healthy persons [28 29] and severalstudies show that the supplementation of them or mixturesincluding species of these genera is effective in alleviatingsymptoms of IBS Moreover the selected strains were alreadyknown for their effect on intestinal cell lines as previouslyreported [19]

To investigate the alterations in the intestinal microbiotathe number of lactobacilli and bifidobacteria present in fecal

samples of recruited subjects was determined by quantita-tive real-time PCR The numbers of Lactobacillus spp andBifidobacterium spp of the mixtures (F 1 and F 2) increasedduring the times of treatment until 60 days in the probioticgroups with respect to the placebo group (F 3) All thespecies included in the formulations remained in the gut also30 days after the follow-up from the last ingestion exceptfor Bifidobacterium Our results confirmed data reported byKajander et al These authors demonstrated that all supple-mented strains remained stable during the treatment withthe exception of Bifidobacterium species which decreasedafter treatments with a multispecies probiotic mixture [14]

Moreover in our study significant differences in thenumber of responders to the severity of symptoms wererecorded between the two probiotic mixtures F 1 and F 2with respect to placebo F 3 group (119875 lt 0001) No significantdifferences were registered between F 1 and F 2 (119875 gt 005)and the effects of both of them are significant when comparedto their respective baselinesThese data are in agreement withprevious data from multispecies probiotics treatment of IBSsubjects [14 15] Compared with placebo probiotic groupsF 1 and F 2 were effective for the primary efficacy endpointsof the study as well as for the secondary endpoints thatis the maintaining of the obtained effects 30 days after thelast product intake The change of symptoms is correlated tothe improvement in the quality of life and resulted in beingsignificantly higher in the probiotic groups compared withthe placebo group Although a great number of data derivingfrom literature [16ndash18 30] indicate that probiotics may behelpful in the treatment of IBS symptoms in particular withrespect to constipation their conclusions vary because ofinadequate sample size type of study design and use ofvarious probiotic strains These data are in agreement withour data concerning the improvement of specific probiotictreatment versus placebo (specifically in patients with IBS-C) for some of the endpoints improving symptoms such aspain flatulence and bloating but not others (transit time andurgency and abdominal cramps) [30] Moreover in most ofthe reported cases the decrease in constipation frequencyscore was approximately twofold greater in the probioticgroups than in the placebo groups and these results are in linewith data deriving from our clinical study

Thus the clinical improvement of this study may beassociated with the maintenance (species-specific) of thecompositional stability of the intestinal microbiota fromprobiotics consumption and with their positive effects insubjects affected by irritable bowel syndromes

5 Conclusions

In conclusion the different species of probiotics admin-istered to the IBS-C subjects determine a cooccurrencebetween the changes in the analysed probiotic groups andan improvement of IBS-C symptoms This study representsthe development of a clinical trial that can support the role ofintestinal bacteria in the IBS diseases and the potential role ofprobiotics belonging to various species in themanagement ofthese disorders

BioMed Research International 9

Ethical Approval

All procedures performed in studies involving human partic-ipants were in accordance with the ethical standards of theinstitutional andor national research committee and withthe 1964 Helsinki declaration and its later amendments orcomparable ethical standards

Consent

Informed consent was obtained from all individual partici-pants included in the study

Competing Interests

All the authors declare that they have no conflict of interests

Acknowledgments

The research was conducted through the Probioplus4FoodProject no 30221122 funded by MIUR and LombardyRegion Italy The authors thank Principium Europe Srlfor supplying the bacterial strains and Farcoderm for therecruited subjects of this study

References

[1] P B Eckburg E M Bik C N Bernstein et al ldquoMicrobiologydiversity of the human intestinal microbial florardquo Science vol308 no 5728 pp 1635ndash1638 2005

[2] S K Mazmanian H L Cui A O Tzianabos and D L KasperldquoAn immunomodulatorymolecule of symbiotic bacteria directsmaturation of the host immune systemrdquo Cell vol 122 no 1 pp107ndash118 2005

[3] V R Alonso and F Guarner ldquoLinking the gut microbiota tohuman healthrdquo British Journal of Nutrition vol 109 supplement2 pp S21ndashS26 2013

[4] G Tomasello M Bellavia V D Palumbo M C Gioviale PDamiani and A I L Monte ldquoFrom gut microflora imbalanceto mycobacteria infection is there a relationship with chronicintestinal inflammatory diseasesrdquo Annali Italiani di Chirurgiavol 82 no 5 pp 361ndash368 2011

[5] F Guarner and J-R Malagelada ldquoGut flora in health anddiseaserdquoThe Lancet vol 361 no 9356 pp 512ndash519 2003

[6] J Matto L Maunuksela K Kajander et al ldquoComposition andtemporal stability of gastrointestinal microbiota in irritablebowel syndromemdasha longitudinal study in IBS and controlsubjectsrdquo FEMS Immunology andMedical Microbiology vol 43no 2 pp 213ndash222 2005

[7] C Abraham and J H Cho ldquoMechanisms of disease inflamma-tory bowel diseaserdquo The New England Journal of Medicine vol361 no 21 pp 2066ndash2078 2009

[8] M Bellavia G Damiano M C Gioviale et al ldquoAbnormalexpansion of segmented filamentous bacteria in the gut a rolein pathogenesis of chronic inflammatory intestinal diseasesrdquoReviews in Medical Microbiology vol 22 no 3 pp 45ndash47 2011

[9] M Bellavia G Tomasello M Romeo et al ldquoGut microbiotaimbalance and chaperoning system malfunction are central toulcerative colitis pathogenesis and can be counteracted withspecifically designed probiotics a working hypothesisrdquoMedical

Microbiology and Immunology vol 202 no 6 pp 393ndash4062013

[10] W Strober I Fuss and P Mannon ldquoThe fundamental basis ofinflammatory bowel diseaserdquo Journal of Clinical Investigationvol 117 no 3 pp 514ndash521 2007

[11] M Llopis M Antolin M Carol et al ldquoLactobacillus caseidownregulates commensalsrsquo inflammatory signals in Crohnrsquosdisease mucosardquo Inflammatory Bowel Diseases vol 15 no 2 pp275ndash283 2009

[12] M Pammi A Flores M Leeflang and J Versalovic ldquoMolecularassays in the diagnosis of neonatal sepsis a systematic reviewand meta-analysisrdquo Pediatrics vol 128 no 4 pp e973ndashe9852011

[13] M Venkatesh A Flores R A Luna and J Versalovic ldquoMolecu-larmicrobiologicalmethods in the diagnosis of neonatal sepsisrdquoExpert Review of Anti-Infective Therapy vol 8 no 9 pp 1037ndash1048 2010

[14] K Kajander E Myllyluoma M Rajilic-Stojanovic et al ldquoClin-ical trial multispecies probiotic supplementation alleviates thesymptoms of irritable bowel syndrome and stabilizes intestinalmicrobiotardquoAlimentary Pharmacology andTherapeutics vol 27no 1 pp 48ndash57 2008

[15] J S Yoon W Sohn O Y Lee et al ldquoEffect of multispeciesprobiotics on irritable bowel syndrome a randomized double-blind placebo-controlled trialrdquo Journal of Gastroenterology andHepatology vol 29 no 1 pp 52ndash59 2014

[16] A P S Hungin C Mulligan B Pot et al ldquoSystematicreview probiotics in the management of lower gastrointestinalsymptoms in clinical practicemdashan evidence-based internationalguiderdquo Alimentary Pharmacology and Therapeutics vol 38 no8 pp 864ndash886 2013

[17] A Agrawal L A Houghton J Morris et al ldquoClinical trial theeffects of a fermentedmilk product containing Bifidobacteriumlactis DN-173 010 on abdominal distension and gastrointestinaltransit in irritable bowel syndrome with constipationrdquo Alimen-tary Pharmacology and Therapeutics vol 29 no 1 pp 104ndash1142009

[18] S Guglielmetti D Mora M Gschwender and K PoppldquoRandomised clinical trial Bifidobacterium bifidumMIMBb75significantly alleviates irritable bowel syndrome and improvesquality of lifemdasha double-blind Placebo-Controlled Studyrdquo Ali-mentary Pharmacology and Therapeutics vol 33 no 10 pp1123ndash1132 2011

[19] I Presti G DrsquoOrazio M Labra et al ldquoEvaluation of theprobiotic properties of new Lactobacillus and Bifidobacteriumstrains and their in vitro effectrdquo Applied Microbiology andBiotechnology vol 99 no 13 pp 5613ndash5626 2015

[20] I Aloisio C Santini B Biavati et al ldquoCharacterization of Bifi-dobacterium spp strains for the treatment of enteric disordersin newbornsrdquo Applied Microbiology and Biotechnology vol 96no 6 pp 1561ndash1576 2012

[21] D A Drossman E Corazziari M Delvaux et al EdsRome IIIThe Functional Gastrointestinal Disorders Degnon AssociatesMcLean Va USA 3rd edition 2006

[22] D L Patrick D A Drossman I O Frederick J Dicesare andK L Puder ldquoQuality of life in persons with irritable bowelsyndrome development and validation of a new measurerdquoDigestive Diseases and Sciences vol 43 no 2 pp 400ndash411 1998

[23] S J Lewis and KW Heaton ldquoStool form scale as a useful guideto intestinal transit timerdquo Scandinavian Journal of Gastroen-terology vol 32 no 9 pp 920ndash924 1997

10 BioMed Research International

[24] M Enrico Biological sciences [PhD thesis] The University ofMilano-Bicocca 2015

[25] M V Matz R M Wright and J G Scott ldquoNo control genesrequired bayesian analysis of qRT-PCR datardquo PloS ONE vol 8no 8 Article ID e71448 2013

[26] H Wickham ggplot2 Elegant Graphics for Data AnalysisSpringer Science amp BusinessMedia Springer-Verlag New YorkNY USA 2009

[27] J Plaza-Diaz C Gomez-Llorente L Fontana and A GilldquoModulation of immunity and inflammatory gene expressionin the gut in inflammatory diseases of the gut and in the liverby probioticsrdquoWorld Journal of Gastroenterology vol 20 no 42pp 15632ndash15649 2014

[28] A P M Kerckhoffs M Samsom M E van der Rest etal ldquoLower Bifidobacteria counts in both duodenal mucosa-associated and fecal microbiota in irritable bowel syndromepatientsrdquo World Journal of Gastroenterology vol 15 no 23 pp2887ndash2892 2009

[29] E Malinen T Rinttila K Kajander et al ldquoAnalysis of thefecal microbiota of irritable bowel syndrome patients andhealthy controls with real-time PCRrdquo American Journal ofGastroenterology vol 100 no 2 pp 373ndash382 2005

[30] P Moayyedi A C Ford N J Talley et al ldquoThe efficacy ofprobiotics in the treatment of irritable bowel syndrome asystematic reviewrdquo Gut vol 59 no 3 pp 325ndash332 2010

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

8 BioMed Research International

F_1

F_2

F_3

Time

02468

10

Ratio

of b

acte

rial

coun

ts

02468

10

Ratio

of b

acte

rial

coun

tsRa

tio o

f bac

teria

l

02468

10

coun

ts

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

L_Aci L_Pla L_Reu L_RhaB_LacProbiotic

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast lowast

lowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowastlowast

lowastlowast

lowastlowastlowast

lowastlowastlowast

lowastlowastlowastlowast

lowastlowast

lowastlowastlowastlowast

lowastlowastlowast

lowastlowast

lowastlowastlowast

t10

t30

t60

t90

Figure 5 Ratio of probiotics of formulations (F 1 and F 2 versusF 3) by qPCR of species-specific sequences at the different times oftreatment versus the amount at the baseline time point expressedas bacterial counts Upon the bars is reported the statistical analysisbetween treatments (lowastlowastlowast119875 lt 0001)

the controversies in IBS pathophysiology or lack of clearevidence for gut microbiota abnormalities in patients withIBS additional randomized clinical trials with appropriateendpoints and design are needed to evaluate to which extentprobiotics are a useful therapeutic strategy in the manage-ment of IBS symptoms

In this study a randomized double-blind placebo-controlled clinical trial with two formulations containingdifferent probiotics was developed and the evaluation ofgut microbiota assessment and gastrointestinal benefits ofIBS-C patients was determined until 90 days Multispeciesprobiotics were used for the treatment of IBS-C in our studyL acidophilus L reuteri L plantarum L rhamnosus andB animalis subsp lactis Indeed it is known that the levelof bifidobacteria and lactobacilli species is lower in IBSpatients compared to healthy persons [28 29] and severalstudies show that the supplementation of them or mixturesincluding species of these genera is effective in alleviatingsymptoms of IBS Moreover the selected strains were alreadyknown for their effect on intestinal cell lines as previouslyreported [19]

To investigate the alterations in the intestinal microbiotathe number of lactobacilli and bifidobacteria present in fecal

samples of recruited subjects was determined by quantita-tive real-time PCR The numbers of Lactobacillus spp andBifidobacterium spp of the mixtures (F 1 and F 2) increasedduring the times of treatment until 60 days in the probioticgroups with respect to the placebo group (F 3) All thespecies included in the formulations remained in the gut also30 days after the follow-up from the last ingestion exceptfor Bifidobacterium Our results confirmed data reported byKajander et al These authors demonstrated that all supple-mented strains remained stable during the treatment withthe exception of Bifidobacterium species which decreasedafter treatments with a multispecies probiotic mixture [14]

Moreover in our study significant differences in thenumber of responders to the severity of symptoms wererecorded between the two probiotic mixtures F 1 and F 2with respect to placebo F 3 group (119875 lt 0001) No significantdifferences were registered between F 1 and F 2 (119875 gt 005)and the effects of both of them are significant when comparedto their respective baselinesThese data are in agreement withprevious data from multispecies probiotics treatment of IBSsubjects [14 15] Compared with placebo probiotic groupsF 1 and F 2 were effective for the primary efficacy endpointsof the study as well as for the secondary endpoints thatis the maintaining of the obtained effects 30 days after thelast product intake The change of symptoms is correlated tothe improvement in the quality of life and resulted in beingsignificantly higher in the probiotic groups compared withthe placebo group Although a great number of data derivingfrom literature [16ndash18 30] indicate that probiotics may behelpful in the treatment of IBS symptoms in particular withrespect to constipation their conclusions vary because ofinadequate sample size type of study design and use ofvarious probiotic strains These data are in agreement withour data concerning the improvement of specific probiotictreatment versus placebo (specifically in patients with IBS-C) for some of the endpoints improving symptoms such aspain flatulence and bloating but not others (transit time andurgency and abdominal cramps) [30] Moreover in most ofthe reported cases the decrease in constipation frequencyscore was approximately twofold greater in the probioticgroups than in the placebo groups and these results are in linewith data deriving from our clinical study

Thus the clinical improvement of this study may beassociated with the maintenance (species-specific) of thecompositional stability of the intestinal microbiota fromprobiotics consumption and with their positive effects insubjects affected by irritable bowel syndromes

5 Conclusions

In conclusion the different species of probiotics admin-istered to the IBS-C subjects determine a cooccurrencebetween the changes in the analysed probiotic groups andan improvement of IBS-C symptoms This study representsthe development of a clinical trial that can support the role ofintestinal bacteria in the IBS diseases and the potential role ofprobiotics belonging to various species in themanagement ofthese disorders

BioMed Research International 9

Ethical Approval

All procedures performed in studies involving human partic-ipants were in accordance with the ethical standards of theinstitutional andor national research committee and withthe 1964 Helsinki declaration and its later amendments orcomparable ethical standards

Consent

Informed consent was obtained from all individual partici-pants included in the study

Competing Interests

All the authors declare that they have no conflict of interests

Acknowledgments

The research was conducted through the Probioplus4FoodProject no 30221122 funded by MIUR and LombardyRegion Italy The authors thank Principium Europe Srlfor supplying the bacterial strains and Farcoderm for therecruited subjects of this study

References

[1] P B Eckburg E M Bik C N Bernstein et al ldquoMicrobiologydiversity of the human intestinal microbial florardquo Science vol308 no 5728 pp 1635ndash1638 2005

[2] S K Mazmanian H L Cui A O Tzianabos and D L KasperldquoAn immunomodulatorymolecule of symbiotic bacteria directsmaturation of the host immune systemrdquo Cell vol 122 no 1 pp107ndash118 2005

[3] V R Alonso and F Guarner ldquoLinking the gut microbiota tohuman healthrdquo British Journal of Nutrition vol 109 supplement2 pp S21ndashS26 2013

[4] G Tomasello M Bellavia V D Palumbo M C Gioviale PDamiani and A I L Monte ldquoFrom gut microflora imbalanceto mycobacteria infection is there a relationship with chronicintestinal inflammatory diseasesrdquo Annali Italiani di Chirurgiavol 82 no 5 pp 361ndash368 2011

[5] F Guarner and J-R Malagelada ldquoGut flora in health anddiseaserdquoThe Lancet vol 361 no 9356 pp 512ndash519 2003

[6] J Matto L Maunuksela K Kajander et al ldquoComposition andtemporal stability of gastrointestinal microbiota in irritablebowel syndromemdasha longitudinal study in IBS and controlsubjectsrdquo FEMS Immunology andMedical Microbiology vol 43no 2 pp 213ndash222 2005

[7] C Abraham and J H Cho ldquoMechanisms of disease inflamma-tory bowel diseaserdquo The New England Journal of Medicine vol361 no 21 pp 2066ndash2078 2009

[8] M Bellavia G Damiano M C Gioviale et al ldquoAbnormalexpansion of segmented filamentous bacteria in the gut a rolein pathogenesis of chronic inflammatory intestinal diseasesrdquoReviews in Medical Microbiology vol 22 no 3 pp 45ndash47 2011

[9] M Bellavia G Tomasello M Romeo et al ldquoGut microbiotaimbalance and chaperoning system malfunction are central toulcerative colitis pathogenesis and can be counteracted withspecifically designed probiotics a working hypothesisrdquoMedical

Microbiology and Immunology vol 202 no 6 pp 393ndash4062013

[10] W Strober I Fuss and P Mannon ldquoThe fundamental basis ofinflammatory bowel diseaserdquo Journal of Clinical Investigationvol 117 no 3 pp 514ndash521 2007

[11] M Llopis M Antolin M Carol et al ldquoLactobacillus caseidownregulates commensalsrsquo inflammatory signals in Crohnrsquosdisease mucosardquo Inflammatory Bowel Diseases vol 15 no 2 pp275ndash283 2009

[12] M Pammi A Flores M Leeflang and J Versalovic ldquoMolecularassays in the diagnosis of neonatal sepsis a systematic reviewand meta-analysisrdquo Pediatrics vol 128 no 4 pp e973ndashe9852011

[13] M Venkatesh A Flores R A Luna and J Versalovic ldquoMolecu-larmicrobiologicalmethods in the diagnosis of neonatal sepsisrdquoExpert Review of Anti-Infective Therapy vol 8 no 9 pp 1037ndash1048 2010

[14] K Kajander E Myllyluoma M Rajilic-Stojanovic et al ldquoClin-ical trial multispecies probiotic supplementation alleviates thesymptoms of irritable bowel syndrome and stabilizes intestinalmicrobiotardquoAlimentary Pharmacology andTherapeutics vol 27no 1 pp 48ndash57 2008

[15] J S Yoon W Sohn O Y Lee et al ldquoEffect of multispeciesprobiotics on irritable bowel syndrome a randomized double-blind placebo-controlled trialrdquo Journal of Gastroenterology andHepatology vol 29 no 1 pp 52ndash59 2014

[16] A P S Hungin C Mulligan B Pot et al ldquoSystematicreview probiotics in the management of lower gastrointestinalsymptoms in clinical practicemdashan evidence-based internationalguiderdquo Alimentary Pharmacology and Therapeutics vol 38 no8 pp 864ndash886 2013

[17] A Agrawal L A Houghton J Morris et al ldquoClinical trial theeffects of a fermentedmilk product containing Bifidobacteriumlactis DN-173 010 on abdominal distension and gastrointestinaltransit in irritable bowel syndrome with constipationrdquo Alimen-tary Pharmacology and Therapeutics vol 29 no 1 pp 104ndash1142009

[18] S Guglielmetti D Mora M Gschwender and K PoppldquoRandomised clinical trial Bifidobacterium bifidumMIMBb75significantly alleviates irritable bowel syndrome and improvesquality of lifemdasha double-blind Placebo-Controlled Studyrdquo Ali-mentary Pharmacology and Therapeutics vol 33 no 10 pp1123ndash1132 2011

[19] I Presti G DrsquoOrazio M Labra et al ldquoEvaluation of theprobiotic properties of new Lactobacillus and Bifidobacteriumstrains and their in vitro effectrdquo Applied Microbiology andBiotechnology vol 99 no 13 pp 5613ndash5626 2015

[20] I Aloisio C Santini B Biavati et al ldquoCharacterization of Bifi-dobacterium spp strains for the treatment of enteric disordersin newbornsrdquo Applied Microbiology and Biotechnology vol 96no 6 pp 1561ndash1576 2012

[21] D A Drossman E Corazziari M Delvaux et al EdsRome IIIThe Functional Gastrointestinal Disorders Degnon AssociatesMcLean Va USA 3rd edition 2006

[22] D L Patrick D A Drossman I O Frederick J Dicesare andK L Puder ldquoQuality of life in persons with irritable bowelsyndrome development and validation of a new measurerdquoDigestive Diseases and Sciences vol 43 no 2 pp 400ndash411 1998

[23] S J Lewis and KW Heaton ldquoStool form scale as a useful guideto intestinal transit timerdquo Scandinavian Journal of Gastroen-terology vol 32 no 9 pp 920ndash924 1997

10 BioMed Research International

[24] M Enrico Biological sciences [PhD thesis] The University ofMilano-Bicocca 2015

[25] M V Matz R M Wright and J G Scott ldquoNo control genesrequired bayesian analysis of qRT-PCR datardquo PloS ONE vol 8no 8 Article ID e71448 2013

[26] H Wickham ggplot2 Elegant Graphics for Data AnalysisSpringer Science amp BusinessMedia Springer-Verlag New YorkNY USA 2009

[27] J Plaza-Diaz C Gomez-Llorente L Fontana and A GilldquoModulation of immunity and inflammatory gene expressionin the gut in inflammatory diseases of the gut and in the liverby probioticsrdquoWorld Journal of Gastroenterology vol 20 no 42pp 15632ndash15649 2014

[28] A P M Kerckhoffs M Samsom M E van der Rest etal ldquoLower Bifidobacteria counts in both duodenal mucosa-associated and fecal microbiota in irritable bowel syndromepatientsrdquo World Journal of Gastroenterology vol 15 no 23 pp2887ndash2892 2009

[29] E Malinen T Rinttila K Kajander et al ldquoAnalysis of thefecal microbiota of irritable bowel syndrome patients andhealthy controls with real-time PCRrdquo American Journal ofGastroenterology vol 100 no 2 pp 373ndash382 2005

[30] P Moayyedi A C Ford N J Talley et al ldquoThe efficacy ofprobiotics in the treatment of irritable bowel syndrome asystematic reviewrdquo Gut vol 59 no 3 pp 325ndash332 2010

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

BioMed Research International 9

Ethical Approval

All procedures performed in studies involving human partic-ipants were in accordance with the ethical standards of theinstitutional andor national research committee and withthe 1964 Helsinki declaration and its later amendments orcomparable ethical standards

Consent

Informed consent was obtained from all individual partici-pants included in the study

Competing Interests

All the authors declare that they have no conflict of interests

Acknowledgments

The research was conducted through the Probioplus4FoodProject no 30221122 funded by MIUR and LombardyRegion Italy The authors thank Principium Europe Srlfor supplying the bacterial strains and Farcoderm for therecruited subjects of this study

References

[1] P B Eckburg E M Bik C N Bernstein et al ldquoMicrobiologydiversity of the human intestinal microbial florardquo Science vol308 no 5728 pp 1635ndash1638 2005

[2] S K Mazmanian H L Cui A O Tzianabos and D L KasperldquoAn immunomodulatorymolecule of symbiotic bacteria directsmaturation of the host immune systemrdquo Cell vol 122 no 1 pp107ndash118 2005

[3] V R Alonso and F Guarner ldquoLinking the gut microbiota tohuman healthrdquo British Journal of Nutrition vol 109 supplement2 pp S21ndashS26 2013

[4] G Tomasello M Bellavia V D Palumbo M C Gioviale PDamiani and A I L Monte ldquoFrom gut microflora imbalanceto mycobacteria infection is there a relationship with chronicintestinal inflammatory diseasesrdquo Annali Italiani di Chirurgiavol 82 no 5 pp 361ndash368 2011

[5] F Guarner and J-R Malagelada ldquoGut flora in health anddiseaserdquoThe Lancet vol 361 no 9356 pp 512ndash519 2003

[6] J Matto L Maunuksela K Kajander et al ldquoComposition andtemporal stability of gastrointestinal microbiota in irritablebowel syndromemdasha longitudinal study in IBS and controlsubjectsrdquo FEMS Immunology andMedical Microbiology vol 43no 2 pp 213ndash222 2005

[7] C Abraham and J H Cho ldquoMechanisms of disease inflamma-tory bowel diseaserdquo The New England Journal of Medicine vol361 no 21 pp 2066ndash2078 2009

[8] M Bellavia G Damiano M C Gioviale et al ldquoAbnormalexpansion of segmented filamentous bacteria in the gut a rolein pathogenesis of chronic inflammatory intestinal diseasesrdquoReviews in Medical Microbiology vol 22 no 3 pp 45ndash47 2011

[9] M Bellavia G Tomasello M Romeo et al ldquoGut microbiotaimbalance and chaperoning system malfunction are central toulcerative colitis pathogenesis and can be counteracted withspecifically designed probiotics a working hypothesisrdquoMedical

Microbiology and Immunology vol 202 no 6 pp 393ndash4062013

[10] W Strober I Fuss and P Mannon ldquoThe fundamental basis ofinflammatory bowel diseaserdquo Journal of Clinical Investigationvol 117 no 3 pp 514ndash521 2007

[11] M Llopis M Antolin M Carol et al ldquoLactobacillus caseidownregulates commensalsrsquo inflammatory signals in Crohnrsquosdisease mucosardquo Inflammatory Bowel Diseases vol 15 no 2 pp275ndash283 2009

[12] M Pammi A Flores M Leeflang and J Versalovic ldquoMolecularassays in the diagnosis of neonatal sepsis a systematic reviewand meta-analysisrdquo Pediatrics vol 128 no 4 pp e973ndashe9852011

[13] M Venkatesh A Flores R A Luna and J Versalovic ldquoMolecu-larmicrobiologicalmethods in the diagnosis of neonatal sepsisrdquoExpert Review of Anti-Infective Therapy vol 8 no 9 pp 1037ndash1048 2010

[14] K Kajander E Myllyluoma M Rajilic-Stojanovic et al ldquoClin-ical trial multispecies probiotic supplementation alleviates thesymptoms of irritable bowel syndrome and stabilizes intestinalmicrobiotardquoAlimentary Pharmacology andTherapeutics vol 27no 1 pp 48ndash57 2008

[15] J S Yoon W Sohn O Y Lee et al ldquoEffect of multispeciesprobiotics on irritable bowel syndrome a randomized double-blind placebo-controlled trialrdquo Journal of Gastroenterology andHepatology vol 29 no 1 pp 52ndash59 2014

[16] A P S Hungin C Mulligan B Pot et al ldquoSystematicreview probiotics in the management of lower gastrointestinalsymptoms in clinical practicemdashan evidence-based internationalguiderdquo Alimentary Pharmacology and Therapeutics vol 38 no8 pp 864ndash886 2013

[17] A Agrawal L A Houghton J Morris et al ldquoClinical trial theeffects of a fermentedmilk product containing Bifidobacteriumlactis DN-173 010 on abdominal distension and gastrointestinaltransit in irritable bowel syndrome with constipationrdquo Alimen-tary Pharmacology and Therapeutics vol 29 no 1 pp 104ndash1142009

[18] S Guglielmetti D Mora M Gschwender and K PoppldquoRandomised clinical trial Bifidobacterium bifidumMIMBb75significantly alleviates irritable bowel syndrome and improvesquality of lifemdasha double-blind Placebo-Controlled Studyrdquo Ali-mentary Pharmacology and Therapeutics vol 33 no 10 pp1123ndash1132 2011

[19] I Presti G DrsquoOrazio M Labra et al ldquoEvaluation of theprobiotic properties of new Lactobacillus and Bifidobacteriumstrains and their in vitro effectrdquo Applied Microbiology andBiotechnology vol 99 no 13 pp 5613ndash5626 2015

[20] I Aloisio C Santini B Biavati et al ldquoCharacterization of Bifi-dobacterium spp strains for the treatment of enteric disordersin newbornsrdquo Applied Microbiology and Biotechnology vol 96no 6 pp 1561ndash1576 2012

[21] D A Drossman E Corazziari M Delvaux et al EdsRome IIIThe Functional Gastrointestinal Disorders Degnon AssociatesMcLean Va USA 3rd edition 2006

[22] D L Patrick D A Drossman I O Frederick J Dicesare andK L Puder ldquoQuality of life in persons with irritable bowelsyndrome development and validation of a new measurerdquoDigestive Diseases and Sciences vol 43 no 2 pp 400ndash411 1998

[23] S J Lewis and KW Heaton ldquoStool form scale as a useful guideto intestinal transit timerdquo Scandinavian Journal of Gastroen-terology vol 32 no 9 pp 920ndash924 1997

10 BioMed Research International

[24] M Enrico Biological sciences [PhD thesis] The University ofMilano-Bicocca 2015

[25] M V Matz R M Wright and J G Scott ldquoNo control genesrequired bayesian analysis of qRT-PCR datardquo PloS ONE vol 8no 8 Article ID e71448 2013

[26] H Wickham ggplot2 Elegant Graphics for Data AnalysisSpringer Science amp BusinessMedia Springer-Verlag New YorkNY USA 2009

[27] J Plaza-Diaz C Gomez-Llorente L Fontana and A GilldquoModulation of immunity and inflammatory gene expressionin the gut in inflammatory diseases of the gut and in the liverby probioticsrdquoWorld Journal of Gastroenterology vol 20 no 42pp 15632ndash15649 2014

[28] A P M Kerckhoffs M Samsom M E van der Rest etal ldquoLower Bifidobacteria counts in both duodenal mucosa-associated and fecal microbiota in irritable bowel syndromepatientsrdquo World Journal of Gastroenterology vol 15 no 23 pp2887ndash2892 2009

[29] E Malinen T Rinttila K Kajander et al ldquoAnalysis of thefecal microbiota of irritable bowel syndrome patients andhealthy controls with real-time PCRrdquo American Journal ofGastroenterology vol 100 no 2 pp 373ndash382 2005

[30] P Moayyedi A C Ford N J Talley et al ldquoThe efficacy ofprobiotics in the treatment of irritable bowel syndrome asystematic reviewrdquo Gut vol 59 no 3 pp 325ndash332 2010

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

10 BioMed Research International

[24] M Enrico Biological sciences [PhD thesis] The University ofMilano-Bicocca 2015

[25] M V Matz R M Wright and J G Scott ldquoNo control genesrequired bayesian analysis of qRT-PCR datardquo PloS ONE vol 8no 8 Article ID e71448 2013

[26] H Wickham ggplot2 Elegant Graphics for Data AnalysisSpringer Science amp BusinessMedia Springer-Verlag New YorkNY USA 2009

[27] J Plaza-Diaz C Gomez-Llorente L Fontana and A GilldquoModulation of immunity and inflammatory gene expressionin the gut in inflammatory diseases of the gut and in the liverby probioticsrdquoWorld Journal of Gastroenterology vol 20 no 42pp 15632ndash15649 2014

[28] A P M Kerckhoffs M Samsom M E van der Rest etal ldquoLower Bifidobacteria counts in both duodenal mucosa-associated and fecal microbiota in irritable bowel syndromepatientsrdquo World Journal of Gastroenterology vol 15 no 23 pp2887ndash2892 2009

[29] E Malinen T Rinttila K Kajander et al ldquoAnalysis of thefecal microbiota of irritable bowel syndrome patients andhealthy controls with real-time PCRrdquo American Journal ofGastroenterology vol 100 no 2 pp 373ndash382 2005

[30] P Moayyedi A C Ford N J Talley et al ldquoThe efficacy ofprobiotics in the treatment of irritable bowel syndrome asystematic reviewrdquo Gut vol 59 no 3 pp 325ndash332 2010

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom