Proc. Natl. Acad. Sci. USAVol. 86, pp. 32-36, January 1989Biochemistry

Cloning and expression of the gene cluster encoding key proteinsinvolved in acetyl-CoA synthesis in Clostridium thermoaceticum: COdehydrogenase, the corrinoid/Fe-S protein, and methyltransferase

(acetogenic bacteria/gene expression/CO metabolism/metalloenzymes/iron-sulfur proteins)

DAVID L. ROBERTS*, JULIE E. JAMES-HAGSTROM*, DENISE K. GARVIN*, CAROL M. GORST*,JENNIFER A. RUNQUIST*, JACQUELINE R. BAUR*, F. CARL HAASEt, AND STEVE W. RAGSDALE*t*Department of Chemistry, University of Wisconsin-Milwaukee, Milwaukee, WI 53201; and tRohm and Haas, Spring House, PA 19477

Communicated by Harland G. Wood, September 9, 1988 (received for review June 21, 1988)

ABSTRACT Acetogenic bacteria fix CO or CO2 by apathway of autotrophic growth called the acetyl-CoA (orWood) pathway. Key enzymes in the pathway are a methyl-transferase, a corrinoid/Fe-S protein, a disulfide reductase,and a carbon monoxide dehydrogenase. This manuscriptdescribes the isolation of the genes that code for the methyl-transferase, the two subunits of the corrinoid/Fe-S protein,and the two subunits of carbon monoxide dehydrogenase.These five genes were found to be clustered within an10-kilobase segment on the Clostridium thermoaceticum ge-nome. The proteins were expressed at up to 5-10% of Esche-richia coli cell protein, and isopropyl .8-D-thiogalactopyran-oside had no effect on the levels of expression, implying that theC. thermoaceticum inserts contained transcriptional and trans-lational signals that were recognized by E. coli. The methyl-transferase is expressed in E. coli in a fully active dimeric formwith a specific activity and heat stability similar to the enzymeexpressed in C. thermoaceticum. However, both thecorrinoid/Fe-S protein and carbon dioxide dehydrogenase,although expressed in high amounts and with identical subunitmolecular weights in E. coli, are inactive and less heat stablethan are the native enzymes from C. thermoaceticum.

The pathway ofacetyl-CoA synthesis, which has been namedthe Wood pathway, is a specific mode of autotrophic andheterotrophic growth involving tetrahydrofolate (H4fblate)enzymes and enzyme-bound organometallic intermediates(for recent reviews, see refs. 1-3). In this pathway, meth-yltetrah,ydrofolate (MeH4folate) is formed from CO or CO2via a sernes of reactions involving formate dehydrogenase andH4folate enzymes. Methyltransferase (MeTr) transfers themethyl group of MeH4folate to the cobalt center of acorrinoid/Fe-S protein (C/Fe-SP), forming a methyl-Co3+species. MeTr was first purified by Drake et al. (4) and shownto be a 59-kDa protein containing two 26-kDa subunits.C/Fe-SP contains two subunits with molecular masses of 55kDa and 33 kDa. Partial purification of the C/Fe-SP andimportant mechanistic studies (5) were followed by purifica-tion to homogeneity and characterization of the metal centers(a cobalt corrin and a [4Fe-4S] cluster) of the enzyme (6).Carbon monoxide dehydrogenase (CODH), also called,

more appropriately, acetyl-CoA synthase, catalyzes the finalsteps in the synthesis ofacetyl-CoA. CODH has been purifiedto homogeneity from the acetogenic bacteria Clostridiumthermoaceticum (7) and Acetobacterium woodii (8). CODHconsists of two subunits with Mr values of 78,000 and 71,000and contains 2 Ni atoms, '12 Fe atoms, "14 acid-labilesulfides, and 1-3 Zn atoms per dimer (7). The roles of CODHin the pathway are to bind CO (9, 10), a methyl group (11), and

CoA (12, 13) and to catalyze the actual synthesis ofacetyl-CoA(12).

In this manuscript, we report the cloning of the genes forCODH, MeTr, and C/Fe-SP and the expression of theproteins at high levels in Escherichia coli in the absence ofany inducer. We have established that these genes areclustered within a 10-kilobase (kb) DNA segment in the C.thermoaceticum genome and that the CODH genes aredirectly upstream of the 55-kDa subunit of the C/Fe-SP. Wesuggest that these clustered genes contain promoter-likesequences and translational signals that are recognized by E.coli. MeTr is expressed in E. coli as a heat-stable dimer andis fully active. Both the C/Fe-SP and CODH, althoughexpressed in high amounts by E. coli, are inactive and aremuch less heat stable than are the active enzymes from C.thermoaceticum.A preliminary report describing the cloning ofthe C/Fe-SP

and MeTr-encoding genes has been published (14).

MATERIALS AND METHODSBacterial Strains, Plasmids, and Growth Conditions. C.

thermoaceticum, DSM 521, was cultured in 20-liter carboysat 55°C under CO2 as described by Ljungdahl and Andreesen(15). E. coli K-12 strain JM109 (F' traD36 proAB laclqZAM-15/supE44 thi) was cultured on SOB medium (16). Coloniestransformed with pUC9 (17) were grown at pH 7.5 at 37°C onLB-ampicillin medium (16) containing 0.8% tryptone, 0.5%yeast extract, 0.5% sodium chloride, and ampicillin at 0.1mg/ml. 5-Bromo-4-chloro-3-indolyl (3-D-galactopyranosideand isopropyl B-D-thiogalactopyranoside (IPTG) (both fromBoehringer Mannheim) were added to the LB-ampicillinmedium to final concentrations of 0.032% and 1.6 mM,respectively, for colony screening.

Construction and Screening of C. thermoaceticum Library.High-molecular weight DNA from C. thermoaceticum wasisolated by the method of Saito and Miura (18). The purifiedDNA was then partially digested with Sau3A endonucleaseand fractionated by ultracentrifugation in a 5-30%o sucrosegradient. Fractions in the 10-kb size range were ligated intopUC9, which had been digested with BamHI and treated withalkaline phosphatase. E. coli strain JM109 was transformedby the method of Hanahan (19) and spread onto LB-ampicillin plates containing 5-bromo-4-chloro-3-indolyl /8-D-galactopyranoside and IPTG. White colonies were isolatedand screened by colony hybridization (18) with oligonucle-

Abbreviations: MeTr, methyltransferase; C/Fe-SP, corrinoid/Fe-Sprotein; CODH, carbon monoxide dehydrogenase; H4folate, tet-rahydrofolate; MeH4folate, methyltetrahydrofolate; SDS, sodiumdodecyl sulfate; IPTG, isopropyl 3-D-thiogalactopyranoside.tTo whom reprint requests should be addressed at: Department ofChemistry, Box 413, University of Wisconsin-Milwaukee, Milwau-kee, WI 53201.

32

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 30

, 202

1

Proc. Natl. Acad. Sci. USA 86 (1989) 33

otide probes that had been end-labeled with [y-32P]ATP(ICN) by T4 polynucleotide kinase (Boehringer Mannheim).Enzyme Determinations, Protein and Subunit Isdation, Pro-

tein Sequencing, and DNA Synthesis. MeTr (5), CODH (12), andC/Fe-SP (6) activities were determined as described previously.MeTr (4) and C/Fe-SP (6) were purified to homogeneity.

Individual subunits of the C/Fe-SP were separated andisolated to -95% homogeneity by ion-exchange chromatog-raphy after treatment with 6 M urea. Typically, 378 mg ofurea was added to 0.6 ml of C/Fe-SP (15 mg of protein in 50mM Tris HC1, pH 7.6) and incubated overnight in an anaer-obic chamber (Coy Laboratory Products, Ann Arbor, MI) at16'C. The solution was then applied to a 15-ml DEAE-Sephacel column equilibrated with 30 mM TrisHCI/6 Murea, and a linear gradient from 0 to 0.4 M NaCl in the samebuffer was run. The large subunit (55 kDa) eluted at -100mMNaCi, and the 33-kDa subunit eluted at -200 mM NaCl. TheN-terminal residues were determined by the dansylationmethod of Gray (20) with 1 gmol of peptide.

Purified 33-kDa subunit of the C/Fe-SP (10 nmol) wasincubated overnight with trypsin (3 1.d of 1 mg of trypsin/mlin 1 mM HCl) in 0.1 M ammonium bicarbonate at 370C.Peptides were isolated and purified on a C4 HPLC column ina gradient of 0-55% acetonitrile in 0.1% trifluoroacetic acid.Approximately 1 nmol of each purified subunit or tryptic

fragment was subjected to automated Edman degradationsequencing. Sequencing ofthe 55-kDa and 33-kDa subunits ofC/Fe-SP and MeTr was done on an Applied Biosystemsmodel 470A gas-phase sequencer at Rohm and Haas. TheN-terminal residue of MeTr was N-formylmethionine. Theformyl group was removed by treatment with 0.5 M HCl inmethanol for 48 hr at 230C (21). Sequencing of the trypticfragments of the 33-kDa subunit was done on an AppliedBiosystems model 477A pulsed liquid-phase sequenator withan on-line amino acid analyzer at the Protein and NucleicAcid Sequencing Facility, Medical College of Wisconsin,Milwaukee, WI.DNA Syntheses, DNA Hybridizations, Restriction Endonu-

clease Mapping, and DNA Sequencing. Based on the aminoacid sequences of MeTr and the large (55 kDa) and small (33kDa) subunits of C/Fe-SP, 17-mers were synthesized on anApplied Biosystems model 380B DNA synthesizer. TheDNA probes were then purified by electrophoresis on a 20%polyacrylamide gel.Plasmid DNA was isolated essentially as described (16)

after lysing the cells with sodium dodecyl sulfate (SDS). TheDNA was then digested with a number of restriction endo-nucleases and electrophoresed on 1.0% agarose gels. TheDNA was denatured, transferred to GeneScreen (New En-gland Nuclear), baked, and hybridized with 32P-labeledoligonucleotide probes in the presence of dextran sulfateusing conditions recommended by the manufacturer (NewEngland Nuclear). Hybridizations with probes for MeTr, andfor the 55-kDa and 33-kDa subunits of C/Fe-SP were done at520C, 480C, and 450C, respectively. Restriction endonucleasemapping of pCt946B was also performed by partial cleavageof end-labeled DNA (22) with HindIII and BamHI.

Purified plasmid DNA was sequenced essentially by themethod of Sanger et al. (23) with the heptadecanucleotideprobes (17-mers) as primers. DNA sequencing was per-formed with modified T4 polymerase (Sequenase), adenosine5'-[a-35S]thiotriphosphate (New England Nuclear), and theSequenase kit according to the instructions of the manufac-turer (United States Biochemical).

Inmunoblotting of Cell Extracts with Antibodies Against thePurified Proteins. E. coli cells (1 ml with an OD of =1.0 at 660nm) were centrifuged at 2000 x g and resuspended in 0.1 ml ofcell-lysis solution containing 10%o glycerol and 0.4% SDS. Thecell suspension was boiled for 5 min and centrifuged at 14,000x g. In other experiments cell suspensions were prepared

anaerobically, and cells were lysed with a French press asdescribed (12) in buffer containing 50 mM Tris-HCl, pH 7.6/5mM dithiothreitol. The cell suspension was centrifuged, and thesupernatant was used for subsequent studies (12). With theextract obtained by the French press procedure, protein wasdetermined by the method of Elliott and Brewer (24). For thecells obtained by SDS lysis, protein was determined in thesupernatant by the method of Smith et al. (25) before additionof dithiothreitol (1.0%6) and bromphenol blue (0.1%). This cellextract was applied to a 10%o SDS/polyacrylamide gel underdenaturing conditions (26) or to a nondenaturing gradient gel(27) (10-35% acrylamide gradient) in the anaerobic chamberandeither silver stained (28) (Bio-Rad) or electrophoretically trans-ferred to nitrocellulose for Western (immunologic) hybridiza-tion analysis. Incubation with primary rabbit antibodies andsecondary goat anti-rabbit alkaline phosphatase antibody andstaining with nitro blue tetrazolium and 5-bromo,4-chloro-indolyl phosphate were performed as described by the manu-facturer (Bio-Rad). The polyclonal antibodies were preparedagainst CODH, C/Fe-SP, and MeTr in New Zealand Whiterabbits and purified by elution from columns containing theseproteins immobilized on Affi-Gel 10. The proteins were boundto Affi-Gel 10 following the instructions of the manufacturer(Bio-Rad).Heat Treatment of Extracts. Cells (4 g, wet weight) from E.

coli or C. thermoaceticum were suspended in anaerobicbuffer and lysed in a French press under anaerobic conditionsas described (12). After centrifuging at 27,000 rpm in a type35 rotor in stainless steel centrifuge tubes, the supernatantswere maintained at temperatures between 25°C and 77°C for10 min. The suspension was then centrifuged, and thesupernatants, containing the heat-stable proteins, were thenused for electrophoresis and for determination of enzymeactivity.

RESULTS AND DISCUSSIONIsolation and Analyses ofProteins and Peptides. CODH (12),

MeTr (5), and C/Fe-SP (6) were purified to homogeneity asreported earlier. For MeTr, we determined the sequence forthe first 27 amino acids (the first 18 of these are shown in Fig.1) and synthesized a 17-mer with 24-fold degeneracy corre-

METHYLTRANSFERASE

ATGCTCATTATCGGTGAACGGATTM L I I G E R I

fM L I I G E R I N G M F G D I K R A

CORRINOID/FE-S PROTEIN

55 kDa Subunit

ATGCCTTTGACGGGACTGGAGATTM P L T G L E I

P L T G L E I Y K O L P K K N C G E

33 kDa Subunit

Tryntic Fragment

CGCAGCCATACCATCGTCGTCGGTGGCGAATGCTGCC CTGCCTTTCACR S H T I V V G G D A A L P F H

S I T I V V G G D A A L P F H

CATTTCGAAGGAGAGATTGTCAACGAGH F E G E I V N EH F E G E I V N E P V I G M E V O D I

FIG. 1. Partial sequences ofMeTr and C/Fe-SP. In each case, thefirst line shows the DNA sequence obtained using the oligonucleotideprobe as a primer in the dideoxynucleotide chain-termination sequenc-ing reaction. The second line shows the amino acid sequence (inone-letter code) predicted from the DNA sequence. The bottom lineis the amino acid sequence determined by Edman degradation of thepurified peptide. The sequences shown for MeTr and the 55-kDasubunit of C/Fe-SP are from the N-terminal of the protein. Thesequences shown for the 33-kDa subunit are from the N-terminal of atryptic fragment. Underlined residues correspond to sequences usedto predict DNA sequences that were then used as oligonucleotideprobes in colony and Southern hybridization and DNA sequencingexperiments. The residue marked ¶ was ambiguous.

Biochemistry: Roberts et al.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 30

, 202

1

34 Biochemistry: Roberts et al.

FIG. 2. Colony hybridization of E. coli transformed with pUC9containing -5- to 8-kb inserts of C. thermoaceticum DNA. Colonieswere grown on nitrocellulose on a YT-ampicillin plate and lysed; theDNA was denatured and baked onto the filters. The colonies werehybridized to 32P-end-labeled probes for the 55-kDa (Top), and33-kDa (Middle) subunits of C/Fe-SP and for MeTr (Bottom). Thecolonies labeled A-E are as follows: A, pCt946A; B, pCt946B; C,pCt946C; D, pCtJ9A; and E, JM109 containing pUC9 without anyinsert.

sponding to amino acid residues 11-17.After separating the two subunits ofC/Fe-SP as described,

we determined partial N-terminal sequences. Based on thesequence of the first 18 residues of the 55-kDa protein (Fig.1), two 17-mers were synthesized, corresponding to residues6-11 and 13-18. Because the N-terminal sequence of the33-kDa subunit of the C/Fe-SP (data not shown) wouldgenerate oligonucleotide probes of 17 bases or longer, toodegenerate for hybridization studies, we digested the purifiedsubunit with trypsin and purified a number of peptides.Sequencing of one peptide yielded an N-terminal sequenceconsisting of 38 residues (Fig. 1 shows the first 34 residues)from which a 17-mer with 32-fold redundancy was synthe-sized, corresponding to residues 29-34 of the tryptic frag-ment.

Identification of the Genes Encoding MeTr and C/Fe-SP.We screened a genomic library of C. thermoaceticum DNAin E. coli consisting of -1400 colonies with 32P-labeledoligonucleotide probes for MeTr and the large and smallsubunits of C/Fe-SP. Several colonies that hybridized to theoligonucleotides for one or more of the three genes (Fig. 2)were isolated and purified. One colony, containing theplasmid pCt946B, hybridized to all three probes (colony B,Fig. 2). Two colonies, containing plasmids pCt946A andpCt946C (colonies A and C, respectively) hybridized to theprobe for the 55-kDa subunit only; and another colony,

IE HlillE

pCtJ9A (colony D), hybridized to the probes for the 33-kDasubunit and MeTr. Because each insert was =4-7 kb and thegenes overlapped in separate colonies, these results indicatedthat the three genes were clustered.

Plasmid DNA was isolated from pCt946A, pCt946B,pCt946C, and pCtJ9A. To confirm that we, indeed, hadisolated the genes of interest, we sequenced the regions oftheplasmid DNAs directly adjacent to the regions that hybrid-ized with the various probes. For all three proteins, weobtained perfect agreement between the predicted sequencesand those determined by Edman degradation of the peptides(Fig. 1). For the 55-kDa subunit of C/Fe-SP, the DNAsequence predicts methionine as the N-terminal amino acid,whereas the protein sequence determined by Edman degra-dation begins with proline, which is the second amino acidbased on the DNA sequence. The DNA sequence of the33-kDa subunit gene predicts an Arg-Ser sequence at theborder of the tryptic peptide; this is expected because theproduct of trypsin cleavage is a C-terminal arginine or lysine.We showed above that pCt946B contains the genes encod-

ing MeTr and also the 55-kDa and 33-kDa subunits ofC/Fe-SP. To determine the relative location of the genes, wemapped the insert with a variety of restriction endonucleases.Results of Southern hybridizations of the restriction frag-ments with the probes demonstrate that the three genes areclustered within a region of -5 kb (Fig. 3). In this figure, thevertical bars indicate the locations to which the oligonucle-otide probes hybridized. The exact distances between theregions that hybridize to the probes and the nearest upstreamrestriction sites were determined by DNA sequence analy-ses. To reflect the actual size ofeach gene, an arrow is drawnbelow the DNA segment that corresponds to the predictedsize and the orientation of each gene.For the 33-kDa subunit, we do not know the exact location

of the probe because it corresponded to a region in a trypticfragment of unknown relationship to the N-terminal region.Therefore, two arrows are drawn below the DNA segment forthis -1-kb gene, showing its possible extreme locations. The5' end ofthe MeTr gene is the farthest possible location ofthe3' end of the gene for the 33-kDa subunit. The farthestlocation of the 5' end of the MeTr gene is =1 kb upstream ofthe 3' end of the DNA sequence we have determined. Thus,the 33-kDa subunit gene is located between these twoextremes (Fig. 3). There is a segment of DNA of 1.6-2.1 kbbetween the genes for the 55-kDa and 33-kDa subunits thatcould code for a protein of between 50,000 and 70,000 kDa.The insert in pCtJ9A, which overlaps with the insert in

pCt946B, contains the entire MeTr gene as well as the genefor the 33-kDa subunit of C/Fe-SP. The orientation andpredicted size of the MeTr gene is shown in Fig. 3.

Kilobase

HIH HHE P PI 1

iiIC H P PL pCt946B

j pt94I6CpCt946CI pCt946A

CODH 55kDaSubunit ofC/Fe-SP

c = = _= =>==c===: MeTr

33kDaSubunit ofC/Fe-SP

FIG. 3. Restriction map of the insert in pCt946B and partial maps of pCt946A, pCt946C, and pCtJ9A. Plasmid DNAs were digested withrestriction enzymes, electrophoresed in agarose gels, transferred to nitrocellulose, and probed with the 32P-labeled oligonucleotides shown inFig. 1. The insert in pCt946B also was mapped by the partial digestion method (22). The abbreviations for the restriction enzymes are as follows:C, Cla I; E, EcoRI; H, HindII; HIII, HindIII; P, Pst I. The multiple cloning sites of pUC9 (data not shown) are at the borders of each insert.Locations of the regions that hybridized to the probes are designated by vertical bars. Arrows show approximate location and orientation ofthe genes. We do not yet know the orientation or order of the genes for the 78- and 71-kDa subunits ofCODH or the exact location for the 33-kDasubunit of C/Fe-SP.

Proc. Natl. Acad. Sci. USA 86 (1989)

UEf

Dow

nloa

ded

by g

uest

on

Nov

embe

r 30

, 202

1

Proc. Natl. Acad. Sci. USA 86 (1989) 35

Expression of the Genes in E. coil. We then determined thelevels of expression of these genes in E. coli. The amounts ofeach protein were estimated by immunological staining bycomparison with purified proteins as standards (Table 1). Cellextracts from E. coli containing pCt946A and pCt946C reactwith antibodies raised against the 55-kDa subunit ofC/Fe-SP(Fig. 4A, lanes 8 and 13). This protein is expressed at levelsup to 5% of cell protein in pCt946A and l100 of cell proteinin pCt946C.Both the 55-kDa and 33-kDa subunits of C/Fe-SP are

expressed at a level of -1% of the cell protein in pCt946B(Fig. 4A, lane 11). Based on the results shown in Fig. 3,pCt946B apparently contains :60% of the MeTr gene;however, we never detected by immunoblotting any peptidethat would correspond to this segment of the gene with theMeTr antibody. The MeTr gene (Fig. 4A, lane 6) and the33-kDa subunit of C/Fe-SP (Fig. 4B, lane 9) are bothexpressed in pCtJ9A at a level of -1% of cell protein.

In addition to the 55-kDa subunit of C/Fe-SP, pCt946Aexpresses both the 78-kDa and 71-kDa subunits of CODH(Fig. 4C, lanes 13-15) at quite high levels, amounting to =5%of cell protein for all three peptides. The genes are full length(2.3 and 2.1 kb for the 78-kDa and 71-kDa subunits, respec-tively) because the sizes of the subunits expressed bypCt946A are identical to those from C. thermoaceticum. Theinsert in pCt946A is =7 kb long, leaving only =0.6 kb in theinsert that would not code for either CODH or the 55-kDasubunit of C/Fe-SP.Even though the levels of expression in pCt946B and

pCtJ9A are less than those in pCt946A and pCt946C, expres-sion of these cloned proteins at levels of even 1% of cellprotein in the absence of IPTG is interesting. JM109 is a lacIq host; thus, expression from the lac promoter of pUC9would be expected to be minimal in the absence of theinducer, IPTG. Apparently, the high level of expression ofthese genes is due to promoter and translational signalspresent on the C. thermoaceticum DNA. It is clear that E.coli efficiently recognizes these C. thermoaceticum tran-scriptional and translational signals. Recently, another genefrom C. thermoaceticum has been cloned and expressed atlevels of 15-30%o of cell protein in E. coli (29).

Properties of the Cloned and Native Proteins. The clonedMeTr expressed in E. coli is extremely active in transfer ofthe methyl group of [3H]methyl-B12 to H4folate, forming[3H]MeH4folate. The activity of MeTr in extracts of pCtJ9Aand C. thermoaceticum were 1.6 and 2.7 nmol min-1 mg-1,respectively. Under these conditions, the specific activity ofhomogeneous MeTr from C. thermoaceticum was 150.

Table 1. Expression of genes coding for MeTr, C/Fe-SP, andCODH in E. coli

Level of expression of gene product,% of cell protein*

C/Fe-SPPlasmid MeTr 55-kDa subunit 33-kDa subunit CODH

pCt946A ND 5 ND 5pCt946B ND 1 1 NDpCt946C ND 10 ND NDpCtJ9A 1 ND 1 ND

ND, not detected.*Levels of expression were determined by Western hybridization ofcell extracts with purified antibodies using alkaline phosphatase-conjugated goat anti-rabbit secondary antibody. Various concen-trations of purified MeTr, C/Fe-SP, and CODH were electropho-resed and blotted, along with the cell extracts, to serve as standardsfor the amount of specific protein expressed. The concentration ofprotein in the extract was obtained as described, and the sampleswere electrophoresed in a 10%o polyacrylamide gel under denaturingconditions in the presence of SDS.

A 2 4 6 8 10 12I

14. I

B 2.46 8 10 12 14

C 2 4 6 8 10 12 14

FIG. 4. Immunological identification of CODH, C/Fe-SP, andMeTr in E. coli transformants. Cells were grown in 1 ml ofYT-ampicillin medium, lysed with SDS, and electrophoresed underdenaturing conditions in 10%o polyacrylamide gels. Proteins weretransferred to nitrocellulose membranes and probed with antibodiesraised against C/Fe-SP (A), MeTr (B), and CODH (C). (A) Lanes: 1-3, 50, 15, and 5 ng, respectively, of purified C/Fe-SP; 4 and 5, 2400and 480 ng, respectively, of JM109 with pUC9 but no insert; 6 and7, 2400 and 480 ng, respectively, of pCtJ9A; 8-10, 2400, 480, and 160ng, respectively, of pCt946C; 11 and 12, 2400 and 480 ng, respec-tively, of pCt946B; 13-15, 2400, 480, and 160 ng, respectively, ofpCt946A. (B) Lanes: 2 and 3, 480 and 2400 ng, respectively, ofpCt946A; 4 and 5, 480 and 2400 ng, respectively, of pCt946B; 6 and7, 480 and 2400 ng, respectively, of pCt946C; 8 and 9, 480 and 2400ng, respectively, of pCtJ9A; 10 and 11, 480 and 2400 ng, respectively,of JM109 containing pUC9 but no insert; 12-14, 5, 10, and 20 ng,respectively, of purified MeTr. (C) Lanes: 1-4, 100, 50, 20, and 10ng, respectively, of purified CODH; 5 and 6, 5000 and 2000 ng,respectively, of JM109 containing pUC9 but no insert; 7 and 8, 5000and 2000 ng, respectively, of pCtJ9A; 9 and 10, 5000 and 2000 ng,respectively, of pCt946C; 11 and 12, 5000 and 2000 ng, respectively,ofpCt946B; 13-15, 5000, 2000, and 800 ng, respectively, ofpCt946A.

Therefore, active MeTr represents 1.1% of cell protein inpCtJ9A and 1.9o in C. thermoaceticum. The amount ofMeTr in pCtJ9A determined by immunological staining alsois 1% of cell protein, which strongly suggests that the MeTrfrom E. coli is totally active. Comparison of MeTr assynthesized by E. coli with that from C. thermoaceticum bynondenaturing pore-limit electrophoresis (data not shown)demonstrates that both proteins migrate as a 55-kDa dimer.

Proteins isolated from C. thermoaceticum, which has anoptimal growth temperature of 55°C, are generally heat stable(30). There is <10o decrease in MeTr activity over the entiretemperature range of 25-77°C with the enzymes from both C.thermoaceticum and E. coli (data not shown). Identical resultswere obtained by immunological determination of the amountof MeTr remaining soluble after heat treatment (Fig. 5).

Biochemistry: Roberts et al.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 30

, 202

1

36 Biochemistry: Roberts et al.

2D is 16 14 12 10 8 6 4 2

~ ~ ~ ~ ~ - ;:

FIG. 5. Heat stability ofMeTr, C/Fe-SP, and CODH from E. coliand C. thermoaceticum. Extracts were prepared and heat treated for10 min as described. After centrifugation, the proteins remaining insolution were electrophoresed in SDS/polyacrylamide gels underdenaturing conditions and immunoblotted against purified polyclonalantibodies against MeTr, CODH, and C/Fe-SP. Lanes: 1-5, extractsfrom pCt946A; 6-10, extracts from pCt946B; 11-15, extracts frompCtJ9A; 16-20, extracts from C. thermoaceticum. Lanes 1, 6, 11, and16 are from extracts treated at 25°C; lanes 2, 7, 12, and 17 are fromextracts treated at 50°C; lanes 3, 8, 13, and 18 are from extractstreated at 60°C; lanes 4, 9, 14, and 19 are from extracts treated at68°C; lanes 5, 10, 15, and 20 are from extracts treated at 77°C.

Even though CODH protein is produced in large amountsby pCt946A, we were unable to detect any CO oxidationactivity from E. coli extracts. The cloned enzyme electro-phoresed on nondenaturing pore-limit gels as two separatesubunits instead of the normal a,/3 dimer of 150 kDa found forboth purified CODH and C. thermoaceticum extracts. Thetwo subunits of CODH from E. coli were =90% precipitatedfrom solution during a 10-min heat treatment at 67°C;whereas, the enzyme from C. thermoaceticum is fully activeafter heat treatment at this temperature and is :50% dena-tured at -75°C (Fig. 5).We were unable to detect significant amounts of activity of

C/Fe-SP in any E. coli extracts. The C/Fe-SP from E. colialso is more heat sensitive than the protein from C. ther-moaceticum. In addition, the 55- and 33-kDa subunits ex-pressed by pCt946B denature at different temperatures. The33-kDa subunit is -50% denatured at =65°C (Fig. 5) and the55-kDa subunit is 50% denatured at -55°C. As would beexpected for a dimeric protein, the subunits ofC/Fe-SP fromC. thermoaceticum denature together from solution, with"=50% of the protein denaturing at -75°C. Thus, it wouldappear that the subunits expressed in E. coli are not assem-bled into dimeric form.From these combined results, it appears that MeTr is

assembled into active, native form in E. coli. However,CODH and C/Fe-SP are inactive, and their subunits appearnot to be assembled. Further studies will be required todetermine whether modification of the growth conditions forE. coli (for example, growth under anaerobic conditions ormetal supplementation) could yield active C/Fe-SP andCODH.

We thank Drs. Vicki Murtif, David Samols, Sharon Weldon,Chuck Thornton, Shiu-Ih Hu, and Pieter L. deHaseth (Departmentof Biochemistry, Case Western Reserve University, Cleveland) fortheir advice and valuable discussions. We thank Dr. David Setzer(Department of Microbiology, Case Western Reserve University) forhelp in synthesis of some of the oligonucleotide probes used in thisstudy. We thank Dr. Leane Mende-Mueller (Medical College ofWisconsin, Milwaukee, WI) for N-terminal sequence analysis of the

small subunit and tryptic peptides of the C/Fe-SP and also forsynthesizing some of the oligonucleotide probes used in this work.We are indebted to Prof. Harland G. Wood (Department of Bio-chemistry, Case Western Reserve University) for his support duringthe early phases of the work. We thank the Milwaukee Foundationfor a Shaw Scholars Award to S.W.R., the National Institutes ofHealth for their support to S.W.R. under Grant 1-R29-GM39451 fromthe Institute of General Medical Sciences, and the Department ofEnergy for Grant DE-FG02-88ER13875 to S.W.R.

1. Ljungdahl, L. G. (1986) Annu. Rev. Microbiol. 40, 415-450.2. Wood, H. G., Ragsdale, S. W. & Pezacka, E. (1986) Trends

Biochem. Sci. 11, 14-18.3. Wood, H. G., Ragsdale, S. W. & Pezacka, E. (1986) Biochem.

Int. 12, 421-440.4. Drake, H. L., Hu, S.-I. & Wood, H. G. (1981) J. Biol. Chem.

256, 11137-11141.5. Hu, S.-I., Pezacka, E. & Wood, H. G. (1984) J. Biol. Chem.

259, 8892-8897.6. Ragsdale, S. W., Lindahl, P. A. & Munck, E. (1987) J. Biol.

Chem. 262, 14289-14297.7. Ragsdale, S. W., Clark, J. E., Ljungdahl, L. G., Lundie, L. L.

& Drake, H. L. (1983) J. Biol. Chem. 258, 2364-2369.8. Ragsdale, S. W., Ljungdahl, L. G. & DerVartanian, D. V.

(1983) J. Bacteriol. 155, 1224-1237.9. Ragsdale, S. W., Ljungdahl, L. G. & DerVartanian, D. V.

(1983) Biochem. Biophys. Res. Commun. 115, 658-665.10. Ragsdale, S. W., Wood, H. G. & Antholine, W. E. (1985)

Proc. Natl. Acad. Sci. USA 82, 6811-6814.11. Pezacka, E. & Wood, H. G. (1988) J. Biol. Chem. 263,

16000-16006.12. Ragsdale, S. W. & Wood, H. G. (1985) J. Biol. Chem. 260,

3970-3977.13. Shanmugasundaram, T., Ragsdale, S. W. & Wood, H. G.

(1988) BioFactors 1, 147-152.14. James, J. E., Haase, F. C. & Ragsdale, S. W. (1988) FASEB J.

2, A768 (abstr. 2740).15. Ljungdahl, L. G. & Andreesen, J. R. (1978) Methods Enzymol.

53, 360-372.16. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular

Cloning:A Laboratory Manual (Cold Spring Harbor Lab., ColdSpring Harbor, NY).

17. Vieira, J. & Messing, J. (1982) Gene 19, 259-268.18. Saito, H. & Miura, K.-I. (1963) Biochem. Biophys. Acta 72,

619-629.19. Hanahan, D. (1983) J. Mol. Biol. 166, 557-580.20. Gray, W. R. (1972) Methods Enzymol. 25, 121-138.21. Sheehan, J. C. & Yang, D.-D. H. (1958) J. Am. Chem. Soc. 80,

1154-1158.22. Danna, K. J. (1980) Methods Enzymol. 65, 449-467.23. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl.

Acad. Sci. USA 74, 5463-5467.24. Elliott, J. I. & Brewer, J. M. (1978) Arch. Biochem. Biophys.

190, 351-357.25. Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K.,

Gartner, F. H., Provenzano, M. D., Fujimoto, E. K., Goeke,N. M., Olson, B. J. & Klenk, D. C. (1985) Anal. Biochem. 150,76-85.

26. Laemmli, U. K. (1970) Nature (London) 227, 680-685.27. Slater, G. G. (1969) Anal. Chem. 41, 1039-1041.28. Merril, C. R., Goldman, D., Sedman, S. A. & Ebert, M. H.

(1981) Science 211, 1437-1438.29. Lovell, C. R., Przybyla, A. & Ljungdahl, L. G. (1988) Arch.

Microbiol. 149, 280-285.30. Ljungdahl, L. G. (1979) Adv. Microb. Physiol. 19, 149-243.

Proc. Natl. Acad. Sci. USA 86 (1989)

Dow

nloa

ded

by g

uest

on

Nov

embe

r 30

, 202

1