Community analysis of coral mucus-associated bacteria and

P a g e | I

COMMUNITY ANALYSIS OF CORAL

MUCUS-ASSOCIATED BACTERIA AND

IMPACT OF TEMPERATURE AND CO2

CHANGES ON THEM

By

JULIANA HO SING FANG

A thesis submitted in partial fulfilment of

the requirements for the degree of

Masters of Science (by Research)

Faculty of Engineering, Computing and Science

Swinburne University of Technology (Sarawak campus)

2015

P a g e | II

Abstract The coral holobiont is a complex assemblage of the coral animal and microbial organism. Coral

mucus harbours distinct microbial communities and bacteria living in the coral mucus play a

major role in the survival of corals. While several studies have assessed their importance in

protecting their coral hosts from disease, very little is known about the response of these

bacteria to climate change. One of the major consequences of climate changes are enhanced

ocean temperatures which lead to coral bleaching. Another major cause of coral bleaching is

the increased amount of anthropogenic carbon dioxide (CO2) which leads to a phenomenon

called ocean acidification. In both cases, very little its known about how bacteria living in the

coral mucus react to the changing conditions. In a laboratory-based experiment, we assessed

the impact of temperature and carbon dioxide elevation on mucus-associated bacteria in

Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.. Fragments of the selected

corals were placed into tanks and exposed to enhanced concentrations of CO2 and

temperature in a series of experiments. Coral mucus samples were collected on a weekly basis

and CO2 concentrations monitored using a Fourier-Transform Infrared (FTIR) trace gas

analyzer. Potential changes in the coral mucus-associated bacteria communities were

monitored by (a) culture based and (b) molecular approaches. Mucus samples were cultured

weekly and bacterial isolates identified using Sanger sequencing. Furthermore, fingerprinting

methods such as Denaturing Gel Gradient Electrophoresis (DGGE) and Ribosomal Intergenic

Spacer analysis (RISA) were applied to monitor changes in the microbial communities.

Enzymatic properties (amylase, caseinase, gelatinase and phospholipase) of the coral mucus-

associated bacteria were also assessed to identify potential pathogenic bacteria. Significant

shifts were detected in all three corals. For Trachyphyllia geoffroyi, Euphyllia ancora and

Corallimorphs sp., When the temperature and carbon dioxide were maintained around 25°C to

28°C and 500 ppm, Vibrio sp., Bacillus sp. and Pseudomonas sp. were found but as temperature

increases up to 29°C, Bacillus sp. started to dominate. However, when both temperature and

carbon dioxide were rised up to stressful conditions for the corals, Vibrio sp. dominated the

corals mucus layers. Lastly, the isolation of bacteriophage that has the ability to cause a plaque

in the Bacteriophage Plaque Assay when tested against selected potential pathogens was also

identified. The species identified are phylogenetically 96% similar to Enterobacteriophage

reference strain, which are potential bacteriophages for the inhibition of marine pathogens.

There were shifts in Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. mucus-

associated bacteria community when temperature and carbon dioxide content of the corals

surrounding changes.

P a g e | III

Acknowledgements

For since the creation of the world God’s invisible qualities – his eternal power and

divine nature – have been clearly seen, being understood from what has been made, so

that people are without excuse.

(Romans 1:20)

Foremost, I would like to express my sincere gratitude to my principal coordinating

supervisor, Dr. Moritz Müller for his continuous support of my MSc study and research,

for his patience, motivation, enthusiasm, and immense knowledge. Thank you for

giving me the chance to explore this field, allowing me freedom and space to make

mistakes and for believing in me. I would also like to extend my appreciation to my co-

supervisors: Dr. Aazani Mujahid, and Dr. Irine Henry Ninjom for their encouragements,

insightful comments, hard questions, as well as access to laboratories and facilities in

Universiti Malaysia Sarawak (UNIMAS).

Heartfelt thanks also to the Biotechnology laboratory officers and technicians: Chua Jia

Ni, Nurul Arina, and Dyg. Rafika Atiqah for allowing me to use the labs past office hours

and for giving me access to use the apparatus and experiment materials. Without your

help, this project may not have been completed on time.

A big thank you to my fellow lab mates and student helpers: Edward Cheah, Miandy

Lee and Angelica Chong, or the stimulating discussions, the company during long hours

in the lab, the support during various existential crises and for all the fun we have had

in the last two years.

Last but not least, I would like to thank my family, especially my mother, for

encouraging me to take up this MSc opportunity and for having my back throughout

every circumstance in the past two years. I am grateful to Swinburne University of

Techonology for providing me with funding via the Swinburne Postgraduate Student

Scholarship which enabled me to pursue this postgraduate study.

Declaration

P a g e | IV

I hereby declare that this research entitled “COMMUNITY ANALYSIS OF CORAL MUCUS-

ASSOCIATED BACTERIA AND IMPACT OF TEMPERATURE AND CO2 CHANGES ON THEM”

is original and contains no material which has been accepted for the award to the

candidate of any other degree or diploma, except where due reference is made in the

text of the examinable outcome; to the best of my knowledge contains no material

previously published or written by another person except where due reference is made

in the text of the examinable outcome; and where work is based on joint research or

publications, discloses the relative contributions of the respective workers or authors.

(JULIANA HO SING FANG)

Date: 29.06.2015

P a g e | V

Table of Contents

Page

List of Figures

List of Tables

1 Introduction

1.1 Microbial life in the ocean

1.2 Coral reefs

1.3 Coral reefs and bacteria

1.3.1 Coral surface mucus layer (SML) and bacteria

1.4 Threats to coral reefs

1.4.1 Ocean Acidification

1.4.2 Temperature rise

1.4.3 Coral bleaching and coral diseases

1.4.4 Coral diseases and the role of microbes in coral surface mucus

layer

1.5 Phage Therapy

1.6 Significance and aims of the present study and dissertation outline

2 Methodology

2.1 Methodology Flowchart

2.2 Field sampling and Experimental Setup

2.2.1 Week 1 to week 4

2.3 Laboratory procedures

2.3.1 Isolation and DNA Extraction of bacteria of Coral Mucus

Associated Bacteria

2.3.2 Molecular characterisation

2.3.3 Constructing phylogenetic trees for coral mucus-associated

bacteria

2.3.4 Indices for bacteria diversity

VIII

XIII

1

2

3

4

7

8

10

11

16

18

20

21

23

25

32

32

32

34

36

37

P a g e | VI

2.3.5 Fingerprinting Analysis

2.3.5 (i) Extraction of genomic DNA from coral mucus

samples

2.3.5 (ii) Automated Ribosomal Internal Spacer (ARISA)

Analysis

2.3.5 (iii) Denaturing gradient gel electrophoresis (DGGE)

Analysis

2.3.6 Enzyme Essays

2.3.6 (i) Amylase Activity

2.3.6 (ii) Caseinase Activity

2.3.6(iii) Phospholipase Activity

2.3.6. (iv) Gelatinase Activity

2.3.7 Screening and Isolation of Bacteriophages

2.3.8 Whole Genome Amplification via Multiple Displacement

Amplification (MDA) of Bacteriophages

2.3.9 Sequencing Analysis For Bacteriophages Identification

2.3.9(i) g20 genes

2.3.9(ii) phoH genes

2.3.9 (iii) Phylogenetic analyses

3 3 Diversity of the Bacterial Communities Associated to Coral Mucus Layer

3.1 Introduction

3.1.1 Bacteria associated with Trachyphyllia geoffroyi

3.1.2 Bacteria associated with Euphyllia ancora

3.1.3 Bacteria associated with Corallimorphs sp.

3.1.4 Diversity of Coral Mucus-Associated Bacteria

39

40

42

43

47

47

48

49

50

52

54

56

56

57

59

60

61

67

74

76

P a g e | VII

4 Bacterial Communities Shifts

4.1 Introduction on Bacteria Communities Shifts

4.2 Shifts in Bacterial Community Associated to Coral Mucus Layer of

Trachyphyllia sp.

4.2.1 Week 5 to Week 6 for Trachyphyllia geoffroyi 4.5.1(ii) Week 7 to

Week 8 For Trachyphyllia geoffroyi

4.2.2 Week 7 to Week 8 for Trachyphyllia geoffroyi

4.2.3 Week 9 for Trachyphyllia geoffroyi


Euphyllia ancora

4.3.1 Week 5 to Week 6 for Euphyllia ancora


4.3.3 Week 9 for Euphyllia ancora


Corallimorphs sp.

4.4.1 Week 5 to Week 6 for Corallimorphs sp.


4.4.3 Week 9 for Corallimorphs sp.

4.5 Conclusion Bacterial Diversity Shifts in mucus layers of Trachyphyllia

geoffroyi, Euphyllia ancora and Corallimorphs sp. under temperature and

CO2 stress

5 Bacteriophages

5.1 Potential coral pathogens and phage therapy

5. 2 Identification of potential coral pathogens

5.3 Results and Discussions for Bacteriophages Screening

6.0 Summary and Future Work

84

93

93

94

95

97

97

98

99

100

100

101

103

103

107

107

108

110

115

P a g e | VIII

References 118-159

Appendix 159-172

P a g e | IX

Figure Page

I: Distribution of coral reefs in the East Asian Seas

II: The Ocean Acidification cycle process which summarizes the whole process

on how this phenomenon occurs (UK Ocean Acidification Programme 2012).

III: Overall methodology flowchart that summarizes the overall experimental

procedures. The identity and enzymatic properties of Trachyphyllia

geoffroyi, Euphyllia ancora and Corallimorphs sp. mucus-associated

bacteria were assessed and potential coral pathogens isolated were tested

against potential bacteriophages to detect whether their growth could be

inhibited by the potential bacteriophages chosen (phage therapy).

IV: Types of coral species investigated in this experimental study (top left:

Euphyllia ancora; top right: Corallimorphs sp. and bottom left; Trachyphyllia

geoffroyi)

V: llustrations of experimental instruments used to monitor the parameters in

the aquaria

VI: Graph showing overall parameters during week 1 to 4 of the experiment.

Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and

temperature on secondary y-axis.

VII: Graph showing overall parameters during week 5 to 6 of the experiment.

Dissolved oxygen and carbon dioxide are shown on primary y-axis, pH and


VIII: Graph showing overall parameters during week 7 to 8 of the experiment.

3

10

22

23

23

26

27

28

P a g e | X

Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and


IX: Graph showing overall parameters during Week 9 of the experimental

weeks. Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and


X: Graph showing Week 1 to week 9 overall experimental period for carbon

dioxide (ppm) and temperature (°C) in the aquaria. Carbon dioxide is shown on

primary y-axis, temperature on secondary y-axis.

XI: The condition of Trachyphyllia geoffroyi., Euphyllia ancora and Corallimorphs

sp. after a period of 9 experimental weeks..

XII: Crude DNA Extraction of bacterial isolates-associated to Trachyphyllia

geoffroyi, Euphyllia ancora and Corallimorphs sp. on gel Band with 1kbp

DNA ladder. L1 (Lane 1) represents the 1kbp DNA ladder. L2-L11 represents

the DNA smears of bacterial isolates-associated to Trachyphyllia geoffroyi,

Euphyllia ancora and Corallimorphs sp.

XIII: PCR bands result obtained from amplification of bacterial 16S rRNA genes

of bacteria-associated to Trachyphyllia geoffroyi., Euphyllia ancora and

Corallimorphs sp. on gel band with 1kbp DNA ladder.

XIV: Genomic DNA of bacteria-associated to Trachyphyllia geoffroyi, Euphyllia

ancora and Corallimorphs sp. on gel band with 1kbp DNA ladder.

XV: PyElph Software Analysis System. Screenshot showcases band matching

step during gel analysis.

XVI: Example bacterial isolates showing positive amylase activity (zig-zag clear

halo zone).

XVII: Example bacterial isolates showing positive caseinase activity (clear

zones).

XVIII: Example bacterial isolates showing positive phospholipase activity

29

30

31

33

36

41

46

48

49

50

P a g e | XI

(opalescence around the bacterial growth).

XIX: Example bacterial isolates showing positive gelatinase activity (clear zones).

XX: Comparison of TFF and FeCl3 flocculation methods and the results of the

concentration efficiency via viral fraction (< 0.22µm filtrate)s

XXI: Experimental controls of Potential Coral Pathogen Isolates to make sure

that there is no experimental errors during phage assay experiment.

XXII: The Genomic DNA bands of the bacteriophages isolated and amplified via

MDA on gel band with 1kbp DNA ladder.

XXIII: The DNA bands of the bacteriophages isolated and amplified via PCR using

primers CPS1/8. Lane 1(L1) represents DNA ladder and L3 and L4 represents the

DNA of bacteriophages amplified.

XXIV: The DNA bands of the bacteriophages isolated and amplified via PCR using

primers vPhof.

XXVI: 16S rRNA Phylogenetic Tree representing bacterial sequences found in

Trachyphyllia geoffroyi (Brain coral).

XXVII: 16S rRNA Phylogenetic Tree representing bacterial sequences found in

Euphyllia ancora (Hammer coral).

XXVIII: 16S rRNA Phylogenetic Tree representing bacterial sequences found in

Corallimorphs sp. (Mushroom coral).

XXIX: ARISA analysis result to detect the bacteria community associated to

Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. shifting

pattern.

XXX: DGGE Analysis Gel Result detect the bacteria community associated to

51

53

54

55

58

59

60

69

75

87

88

P a g e | XII

Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. shifting pattern.

XXXI: Complete linkage agglomeration tree with genetic distances calculated

using PyElph software analysis tool.

XXXII: UPGMA tree with genetic distances calculated using PyElph software

analysis tool.

XXXIII(a): Results of Bacteriophages Plaque Assay showing the activity of phage

Cand E in forming plaques on the agar plates inoculated with the selected

potential coral pathogen isolates.

XXXIII (b): Results of Bacteriophages Plaque Assay showing the activity of phage

C and E in forming plaques on the agar plates inoculated with the selected


XXXIII (c): Results of Bacteriophages Plaque Assay showing the activity of phage

B and C in forming plaques on the agar plates inoculated with the selected


89

90

111

112

113

P a g e | XIII

List of Tables

Table Page

A: Regional distribution of coral reefs (source: Veron & Stafford-Smith 2000) B: Overview of coral diseases, their common hosts and pathogens.

C: Overview of parameters (pH, CO2, dissolved oxygen, temperature) observed

during weeks 1 to 9

D: Components of 16S rRna PCR reaction per PCR tube

E: List of Variables for Biodiversity Indices

F: Components of ARISA PCR reaction per PCR tube

G: Components of DGGE PCR reaction per PCR tube

H: Indices used to quantify the diversity of 3 selected corals’ mucus layer

associated bacterial communities

I: Results of Corallimorphs sp. after testing for their enzyme assays

J: Results of Euphyllia ancora after testing for their enzyme assays

K: Results Trachyphyllia geoffroyi after testing for their enzyme assays

L: Indices used to quantify the diversity of Trachyphyllia geoffroyi mucus layer


M: Indices used to quantify the diversity of Euphyllia ancora corals’ mucus layer


N: Indices used to quantify the diversity of Corallimorphs sp. corals’ mucus layer


2

13

25

35

38

42

44

77

79

80

81

91

91

92

P a g e | 1

CHAPTER 1

1 Introduction

1.1 Microbial Life in the Ocean

One of the major community members residing in the ocean are marine microbes with

an estimated number of 3.6×1029 microbial cells (Singh 2010). Marine

microorganisms have experienced billions of years worth of evolution, forming vast

and complex communities of bacteria, archaea, protists and fungi, within what is said

to be the dominant biome of the E a r t h (DeLong 2009). According to Karl (2002)

and Sogin et al. (2006), many marine microbes are still in the process of being

identified as an equally great percentage still remains undiscovered (Karl 2002; Sogin et

al. 2006).

Marine microbes play important roles in the oceanic ecosystem by mediating

geochemical cycles in the ocean (Arrigo 2005) and allowing for rapid nutrient recycling

in an environment that is poor in essential nutrients (Mayer & Wild 2010). They are

said to be responsible for around 98% of overall primary production in the ocean,

providing sustainability to the marine ecosystem (Karl 2002; Sogin et al. 2006). Since

Oceans cover approximately 40% of the Earth’s surface, marine microbes and their

involvement in biogeochemical processes are significant on a global scale (Karl 2002).

One of the most biologically diverse and productive ecosystem in the world are coral

reefs. They are a major source of protein and income to many people (Wilkinson &

Buddemeier 1994) and also contribute in revenue earned from tourism, recreation,

and education (Wilkinson & Buddemeier 1994). Coral reefs also act as a natural

protection between the open seas and coastlines by acting as wave breaks, thus

effectively preventing coastal erosion (McLeod et al. 2013). According to Wilkinson

(1999), they perform a vital role in protecting coastal areas from the consequences of

P a g e | 2

rising sea levels such as storm flooding (Wilkinson 1999). Corals are further known to

act as host organisms to diverse bacterial populations (Wegley et al. 2007) and these

are the focus of the present study and will be introduced in the following.

1.2 Coral reefs

Southeast Asia is home to a large number of coral reefs with an approximate area of

87,000 km2 covered by reefs (see Table A).

Table A: Regional distribution of coral reefs (source: Veron & Stafford-Smith 2000)

Region Reef area (km2)

South Pacific

116,200

Southeast Asia 87,760

Indian Ocean 31,930

Middle East 21,450

Caribbean 20,360

Western Atlantic 2.820

Figure 1 shows an overview of reef distribution in the East Asian Seas and Southeast

Asia’s coral reefs have the highest biodiversity of all the world’s reefs (Veron &

Stafford-Smith 2000). This region contains more than 600 of the nearly 800 reef

building coral species found worldwide (Veron & Stafford-Smith 2000).

P a g e | 3

Figure I: Distribution of coral reefs in the East Asian Seas ( S t a t e o f R e e f s

1 9 9 5 ) .

In the following, we introduce the various roles of microbes in coral reefs (with a focus

on the surface mucus layer), before we move to introduce threats to coral reefs and

their impacts on the microbes.

a

1.3 Coral reefs and bacteria

Bacterial communities residing in coral reefs are extremely diverse in their identities

(Rohwer et al. 2002) and have been found to play major roles in nutrient

recycling(Wild et al. 2004b). There are many different species of bacteria

discovered in the coral reefs environment ranging from α-proteobacteria, β-

proteobacteria, firmicutes, anaerobes and also actinobacteria (Ducklow & Mitchell

1979a; Tringe et al. 2005; Wegley et al. 2007).Generally, for coral associated bacteria

to sustain their normal health and survivability, they have to ensure that they are

P a g e | 4

supplemented with adequate amount of nutrition. Corals obtain their nutrition via

capturing particulate organic material using their tentacles and also by sharing

photosynthetic products that are initially produced by their symbiotic algae

(zooxanthellae). The symbiotic algae provide the corals with carbon and energy

sources while prokaryotes associated to the corals often seem to provide nitrogen to

the corals (Lesser et al. 2004; Shashar et al. 1994). Nitrogen is vital to corals because

they need it for synthesizing essential building blocks such as amino acids, purines,

pyrimidines and amino-sugars. As for carbon and energy sources, the corals need these

for their growth and survival as well. Other than that, reef corals are also host to a

group of dinoflagellates symbionts which belong to the Symbiodinium genus.

Symbiodiniums are important symbionts tp the coral reefs as their loss in the reefs

during coral bleaching phenomenon will lead to mass mortality of coral reefs (Baker

2003).

1.3.1 Coral Surface Mucus Layer (SML) and Bacteria

The coral surface mucus layer (SML) plays a very important role in maintaining the coral

reefs ecosystem. It acts as protective physicochemical barrier (Hayes & Goreau 1998;

Peters 1997; Santavy & Peters 1997; Sutherland, Porter & Torres 2004), medium for

growth of bacteria, barrier for potential marine pathogens (Ducklow & Mitchell 1979a,

b), and is also involved in sediment cleansing (Brown & Bythell 2005)

Coral mucus is comprised of mucins which are complex mixture of polymeric

glycoprotein and also other exudates such as lipids that are secreted by mucocytes of

the epithelium (Brown & Bythell 2005). Mucins are highly heterogeneous glycoproteins

that consist of a filamentous protein core to which short polysaccharide side- chains

are attached. The core amounts are made up of about 20 % of the polymer by weight,

and the remaining 80 % are carbohydrate (Verdugo 1990). The composition of the coral

mucus layer is also greatly affected by the coral algae symbionts as about 20 to 45% of

photosynthate are being released as part of coral mucus and dissolved organic carbon

(Bythell 1988; Crossland 1987; Davies 1984; Edmunds & Davies 1989). It follows

then that during coral bleaching, when densities of algal symbionts are significantly

reduced, both the composition and secretion of mucus may be markedly affected. A

P a g e | 5

decrease in mucus release has been shown to negatively affect the coral reef

ecosystem (Brown & Bythell 2005).

Since corals are able to obtain additional nutrients via their mucus layer, the potential

food resources for their growth is greatly increased (Lewis 1977). These food resources

include not only the zooplankton but also some suspended particulate material that

involves bacterioplankton, bacterial aggregates(Bak et al. 1998; Sorokin 1973) and

other fine particulates, such as silts and fine sands (Mills & Sebens 1997). However, the

coral host also known to use up energy for the production of coral mucus layer. For

example, about 40% of all carbon fixed by symbiotic algae in Acropora acuminata goes

into mucus production (Crossland 1987).

The SML helps corals in protecting them from desiccation, as well as binding or

absorbing pollutants such as heavy metals (Brown & Howard 1985; Howard & Brown

1984; Howell 1982) and aromatic hydrocarbons (Neff & Anderson 1981). There are

several studies showing an increase of mucus secretion when corals are exposed to

mechanical stresses and pollutants such as crude oil (Mitchell & Chet 1975; Neff &

Anderson 1981) and copper sulphate (Mitchell & Chet 1975). In addition, the coral

mucus layer also aids in excreting excess organic carbon produced by symbiont

photosynthesis of the dinoflagellates on the coral hosts (Davies 1984). Besides acting as

protecting layer to the coral host, coral mucus is also involved in reproduction and

larval behavior of the coral host. For example, “surface brooding” is a mode of

reproduction that has been observed in the Red Sea soft coral Parerythropodium

fulvum fulvum (Benayahu & Loya 1983). This mode of reproduction actually means

presence of larvae development in a protective mucous coat surrounding the parent

colony.

The coral mucus layer composes of 56 to 80% of a dissolved organic matter (DOM)

fraction so it is expected to be readily available for microbial biomineralisation.

However, there are also finding by Vacelet & Thomassin (1991) that argued that the

released coral mucus layer does not contribute to seawater microbial growth as the

dissolved organic matter (DOM) was not readily accessible and/or that the mucus

contained bacterial inhibitors (Vacelet & Thomassin 1991). According to Rohwer &

P a g e | 6

Kelley (2004), corals have the ability to control the bacterial colonies that inhabit the

SML through changing the composition of the mucus (Rohwer & Kelley 2004). By

altering the mucus’ composition, the growth of beneficial bacteria (such as nitrogen

fixers or bacteria that inhibit potential pathogens), could be promoted. Recent studies

have indeed shown that the bacterial community harboring the surface layer of corals

is distinctly different from the bacteria of the water column surrounding the corals

(Cooney et al. 2002; Frias-Lopez et al. 2002). The SML was found to contain 100 times

the number of culturable bacteria than in of the surrounding seawater (Ritchie & Smith

2004). The coral mucus-associated bacteria are also several orders of magnitude more

metabolically active (Ritchie & Smith 2004) than the ones in seawater column.

According to Wegley et al. (2007), the coral-associated microorganisms are mostly

heterotrophic as they aid in carbon and nitrogen fixation processes of the corals

(Wegley et al. 2007). In return, the carbohydrate-rich mucus is exploited by these

microorganisms as a medium for their growth. This shows a symbiotic relationship

between the bacteria and the coral colony. However, the carbon source utilization

pattern by the coral mucus bacteria is coral specific and thus, the utilization pattern

differs among different species of corals (Brown & Bythell 2005).The bacterial

community does however not contribute much to the amount of carbon content of

mucous sheets which is only about < 0.1 % (Coffroth 1990). Oligotrophic tropical seas

lack of nutrients and organic matter. Therefore, the release of mucus to the seawater

can become an important substrate for microbial growth (Linley & Koop 1986;

Moriarty, Pollard & Hunt 1985; Paul, DeFlaun & Jeffrey 1986; Wild et al. 2004a; Wild

et al. 2004b). Bacterial communities living within the coral mucus layer are viable,

functional, and their diversity depends significantly on the physiological state of the

coral host (Ducklow & Mitchell 1979a). It has been shown that the organic content of

mucus collected from stressed corals was much higher (76 to 82% ash- free dry weight,

AFDW) than mucus collected in-situ from unstressed corals (9 to 60% AFDW)

(Gottfried & Roman 1983).

The coral mucus layer plays an important role in protecting the coral tissues against

bacterial attack. SML acts as a physical barrier to microbes inform the surrounding

seawater (Cooney et al. 2002) and also helps in mucociliary transport of food particles

P a g e | 7

to the coral polyp’s opening (Ducklow 1990; Sorokin 1978), preventing colonization of

potential pathogenic bacteria on coral tissues (Garrett & DUCKLOW 1975; Rublee et al.

1980). For example, anti-bacterial activity was not observed against coral- associated

bacterial strains isolated from coral tissue and its mucoid surface while very high

activity was found against Vibrio sp. isolated from necrotic coral tissue in the Red Sea

soft Paerythropodium fulvum (Kelman et al. 1998). The specificity of SML antibacterial

property is important to allow only specific bacteria to live in association with the coral

host while the others are not allowed to. The SML also serves as a medium into which

allelochemicals, which have an antibacterial role, are deposited (Kelman et al. 1998;

Koh 1997; Slattery, McClintock & Heine 1995).

Novel bioactivities of coral mucus have been discovered in the scleractinian coral

Galaxea fascicularis in which mucus compounds showed a DNAse-like activity and

apoptotic activity against a multiple drug-resistant leukemia cell line (Ding et al. 1999)

and also contained a novel anti-tumour compound (Fung & Ding 1998).

As introduced above, the symbiotic interaction between corals and their associated

microbial community can influence on coral’s physiology and health. Therefore,

many studies have investigated the pathogens related to coral diseases (Hoegh-

Guldberg et al. 2007) and also the beneficial coral- associated bacteria which provides

essential nutrients for the coral host (for example, nitrogen) (Wegley et al. 2007)

and at the same time protecting the coral from infection by producing antimicrobial

agents that restrict the growth of potential pathogens ( R i t c h i e 2 0 0 6 ) .

The occurrence of coral pathogens is closely linked to a weakened state of health and

in the following, we highhlight ocean acidification and temperature increase as major

threats to corals, and move on to discuss microbial coral diseases.

P a g e | 8

1.4 Threats to coral reefs

Due to the combined effects of global changes (increment in seawater

temperature) and local anthropogenic stressors (for example water pollution,

industrial pollution, overfishing), the coral reefs survival are threatened. Most reefs are

affected by diseases and their health starts to deteriorate during the past few

decades. According to ( D o w n s e t a l . 2 0 0 5 ) , the emerging pathogen-causing

diseases and vast global climate changes have contributed to estimated loss of 30% of

corals worldwide. Coral biologists also predicted that if current stresses on coral reefs

are not prevented, most of the world’s coral reefs may be destroyed by the year 2050

( D o w n s e t a l . 2 0 0 5 ) .

Due to the combined effects of global changes (increment in seawater temperature)

and local anthropogenic stressors (for example water pollution, industrial pollution,

overfishing), the coral reefs survival are threatened (Richmond 1993 ).

The increase in CO2 leads to a phenomenon known as ocean acidification (Rodriguez‐

Lanetty, Harii & Hoegh‐Guldberg 2009) which will be introduced in the following.

1.4.1 Ocean Acidification

The ocean plays a fundamental role in gaseous exchange such as absorbing and

releasing carbon dioxide gas (CO2) with the atmosphere. The factors that affect the

CO2 uptake by the ocean are chemical processes involving the changes to the CO2

buffering capacity (Gruber 1998) and also the effects of temperature on CO2

solubility. Hence, once the normal ocean environmental condition undergo changes

(change in pH value of the ocean), marine organism’s growth and survival will be

affected too.

The exchange of carbon dioxide gasses between important reservoirs of the

biosphere, the atmosphere and the ocean is part of the carbon cycle. The ocean

plays an important role as a carbonate buffer. The pH of the seawater is determined

by the composition of three forms of dissolved inorganic carbon (DIC), CO2, HCO3- and

P a g e | 9

CO3

2-. DIC functions as the natural buffer during the addition of hydrogen ions

(carbonate buffer). When CO2 is absorbed by the ocean, hydrogen ions will react with

readily available carbonate (CO32-) ions, which results in the formation of bicarbonate

(HCO3-) ions. In that case, the hydrogen ions (that increase ocean’s acidity) added into

the ocean via CO2 absorption are reduced. Therefore, the change in pH value of the

ocean is not very visible (Gruber 1998).

When atmospheric CO2 dissolves in seawater, the acidity of the ocean should

increase but because of the efficiency of the carbonate buffer reaction, the seawater

remains alkaline. Scientifically, the seawater carbonate chemistry can be explained by

a series of chemical reactions below:

CO2(atmosphere) CO2(aq) + H2O H2CO3 H+ + HCO3- 2H+ + CO3

2-

The capacity of the carbonate buffer in restricting pH changes of the ocean is

however limited (Raven et al. 2005) . When the ocean loses its capability to act as a

carbonate buffer, the absorption of CO2 by the ocean will result in the surface

waters to become more acidic. This phenomena h a s b e e n t e r m e d called ocean

acidification ( D o n e y e t a l . 2 0 0 9 ) . Ocean acidification is predicted to become

more severe over the century unless future emissions of CO2 are reduced

dramatically (Doney et al. 2009). It is stated that the uptake of anthropogenic CO2

is the major reason why there is long-term increase in dissolved inorganic carbon

(DIC) and decrease in CaCO3 saturation state in the ocean (Takahashi et al. 2006).

Ocean acidification does not occur by itself as it is a phenomenon linked to climate

change and other factors (Doney et al. 2009).

According to Millero et al. (2006), the seawater reactions are reversible and near

equilibrium for surface seawater with pH of ∼8.1. The released of H+ ions results in

reduction of the ocean’s pH. Liberated H+ will react with the available carbonate

(CO3

2−) ion which further increases the bicarbonate (HCO3

−) in the ocean, causing a

http://en.wikipedia.org/wiki/File:U+21CC.svg




P a g e | 10

reduction in (CO3

2−) ions. Changing the acidity of the oceans can cause adverse

effects on calcifying marine organisms such as corals and shell animals because these

organisms undergo calcification which is impeded progressively as the ocean becomes

acidified (Raven et al. 2005). Figure II shows the process of how ocean acidification

phenomenon occurs in a simplified chemical equation form. Most carbon dioxide

released to the atmosphere due to human activity for example, burning of fossil fuels

will be absorbed by the ocean and eventually bring adverse consequences to marine

organism particularly calcifying organisms (Gruber 1998).

Figure ii: The Ocean Acidification cycle process which summarizes the whole process on

how this phenomenon occurs (UK Ocean Acidification Programme 2012).

Many studies have been carried out to investigate the ocean acidification phenomenon

as it has been a rising concern to everyone and researchers are trying to understand

the overall phenomenon process in order to come out with solutions to overcome it

(Ben-Yaakov & Goldhaber 1973; Gruber 1998; Takahashi, Broecker & Bainbridge 1981).

P a g e | 11

1.4.2 Temperature rise

Back in the twentieth century, there was an average of 1°C increase in temperature,

which is the largest in more than 1000 years, and meteorologists are expecting a higher

increment in temperature in this century due to excessive pollutions and many other

contributing factors (Bijlsma et al. 1996). The rise of temperature in the world will

affects the weather, sea levels, distribution of flora and fauna as well as the

environment surrounding microorganisms. Bleaching of corals has been correlated

with high seawater temperatures and high levels of solar irradiance (Jokiel & Brown

2004). The phenomena of coral bleaching have been widespread and increased

dramatically over the last few decades. The big destruction of coral reefs is highly

correlated to increase in seawater temperature, which is indirectly caused by global

warming (Rosenberg & Ben‐Haim 2002). According to (Carpenter et al. 2008), coral

bleaching and disease outbreaks have been on the rise and several reefs around the

world are in danger of extinction. Coral bleaching events have been reported to

increase over wide geographical scales over the last two decades and in certain

location, the entire coral reefs ecosystems have been badly impacted ( B o u r n e et

a l . 2 0 0 8 ) . It is also stated that coral bleaching occurs in the world’s three major

oceans and involves more than 50 countries worldwide (Wilkinson & Network

2008). Therefore, many studies have been carried out to study the impact of gradual

environmental changes such as thermal changes (climate changes) and pH changes

(ocean acidification) on the coral reefs ecosystems in order to discover ways to

decrease bleaching events.

1.4.3 Coral Bleaching and Coral Diseases

Coral bleaching is defined as the disruption of symbiosis between coral hosts and

photosynthetic microalgae endosymbionts (zooxanthellae) (Brown 1997). Coral

bleaching is reversible within a few weeks or months, depending on the specific coral

species and condition. However, it can cause mortality to the coral species if left to

persist as the zooxanthellae, which produce the major portion of the coral’s nutrition,

P a g e | 12

are gone (Glynn & De Weerdt 1991). It is expected that predicted ocean warming in

the current century will result in more coral bleaching events in the future which will

lead to mortality of the coral reefs ecosystem (Bourne et al. 2008).

Increases in temperature have also been linked to increase diseased outbreaks and

although coral reefs extend to water depths greater than 100 m (Goreau & Wells

1967), hermatypic (reef-building) scleractinian corals are most prevalent and

ecologically prone to suffer from diseases as they reside in warm, shallow (less than

10 m), near-shore reef environments. These stony corals develop diseases due to

elevated seawater temperatures and increase in concentrations of pollutants (Navas-

Camacho et al. 2010). The high seawater temperature surrounding the coral reefs

influence the outcome of bacterial infections by lowering resistance of the coral to

diseases and/ or increasing pathogen growth, infectivity as well as virulence

(Rodriguez‐Lanetty, Harii & Hoegh-Guldberg 2009; Ward, Kim & Harvell 2007).

Many disease outbreaks involve opportunistic infections by endemic microbes

following periods of stress ( B o u r n e e t a l . 2 0 0 9 ; L e s s e r e t a l . 2 0 0 7 ) .

Bleached corals are additionally vulnerable because the loss of algae reduces the

concentration of oxygen and the resulting radicals that protect the coral animal

(Banin et a l . 2000b ). One good example of how closely linked coral bleaching and

disease outbreaksare, was shown by studies on the scleractinian coral O.patagonica

along the Mediterranean coast of Israel in the year of 1993 (Fine & Loya 1995). Similar to

other bleaching phenomena, it occurred due to relations with high sea-water

temperature which lead to loss of endosymbiotic zooxanthellae and also impairment in

the coral’s reproductive ability (Rosenberg & Ben-Haim 2002). When the corals are

exposed to increase in sea-water temperature up to 29°C, the bleaching occurred.

Firstly, the infection process started with adhesion of the V.shiloi to a beta-galactoside-

containing receptor on the coral surface (Toren et al. 1998) and the adhesion process

was specific between the coral host and bacteria. Adhesion of V.shiloi on coral host

only occurs when the temperature surrounding the corals have been elevated to 25-

30°C (Rosenberg & Ben-Haim 2002). This showed that environmental stress condition

P a g e | 13

such as higher sea-water temperature is needed to cause coral bleaching marine

pathogen to initiate infection on the coral host itself and become virulent itself. Other

than that, the synthesis and secretion of the bacterium’s receptor requires active

photosynthesis process by the zooxanthellae in the coral mucus layer (Banin et al.

2000b). After adhesion of the receptor on the coral host, the bacterium V. shiloi will

penetrate into the epidermal cells of the coral host. Then, these bacteria will start to

differentiate and multiply intracellularly. Although V.shiloi appears as viable –but-not-

culturable state (VBNC) in the epidermal cell, they are highly infectious (Israely, Banin

& Rosenberg 2001). Once the V.shiloi penetrates the coral host and become virulent, it

will produce extracellular toxins that block photosynthesis, bleach and lyse

zooxanthellae (Rosenberg et al. 1999). This bacterium produces heat-sensitive, high

molecular weight toxins which function in bleaching and lysing isolated zooxanthellae

especially when exposed to temperature at 28°C (Rosenberg et al. 1999).

There have been numerous reports being made on different types of coral diseases for

the last 20 years (Rosenberg & Ben-Haim 2002). For example, black band, white band,

red band, yellow band, dark spot, white pox and many other necrosis diseases. As

mentioned above. Infectious diseases could often be correlated to the increment in

seawater temperature. For example, coral diseases occur when there is increased in

virulence of the marine pathogen, increased in the sensitivity of the host to the

pathogen, higher frequency of transmission via a vector or the combination of all three

factors (Rosenberg & Ben-Haim 2002). . Table B summarises well-studied coral

diseases, their causative agents, the coral species involved and also the relevant

scientific publication.

Table B: Overview of coral diseases, their common hosts and pathogens.

Disease Hosts Pathogen Reference

Bleaching Oculina Vibrio shiloi (Kushmaro et al. 1996)

Bleaching and tissue

lysis

Pocillopora Vibrio corallyliiticus (Rosenberg et al. 2008)

Black Band Many species Consortium (Antonius 1973)

P a g e | 14

White Band Acropora Vibrio charcharia (Gladfelter 1982)

(Peters 1993)

(Ritchie & Smith 1995)

Coral Plague Acropora,

Dichocenia

and other

species

Sphingomonas sp. (Dustan 1977;

Richardson et al. 1998)

Aspergillosis Gorgonacea Aspergillus sydowii (Ritchie & Smith 1995;

Smith et al. 1996)

The consortium contains Phormidium corallyticum, a marine fungus, Desulfovibrio and

Beggiatoa.

spp.

As for coral’s black band disease, it was first investigated by (Antonius 1973) and it is

known as a dark band that moves around across coral colonies destroying coral tissues.

According to (Kuta & Richardson 1996), this disease is most active on warm summer

days. During the occurrence of black band disease on corals, heterotrophic and

photosynthetic bacteria were discovered. For example, a few bacteria were identified

as the possible marine pathogens that caused the disease such as Phormidium

corallyticum (Antonius 1981; Rützler & Santavy 1983), a marine fungus (Ramos- Flores

1983) , Beggiatoa spp. (Ducklow & Mitchell 1979b) and sulphate-reducing bacteria

(Garrett & Ducklow 1975). The microbial communities found during the occurrence of

black band disease produces high level of sulphide which harms the coral’s tissue. In

order for the spreading and presence of black band disease, the presence of

Desulfovibrio sp. and sulphate-reducing bacterium are needed to establish a complete

set of conditions (sharp gradients of oxygen, sulphate-sulphide and nutrients)

(Antonius 1981). In addition, Cooney and colleagues also discovered the presence of a

Cytophaga sp., an α- Proteobacteriaium and a single cyanobacterial during the

spreading of the disease (Cooney et al. 2002).

Another well-known coral disease is the white band disease. This disease is known as a

white band appearing of bare coral skeleton of seen at the base of the coral Acropora

P a g e | 15

sp. (Gladfelter 1982). The microbial communities present in the corals that are infected

with white band disease are mostly gram-negative bacteria which, indirectly means

these bacteria are mostly the causative agent of the disease (Rosenberg & Ben‐Haim

2002). However, it is not proven yet that these gram-negative bacteria are the

confirmed causative agent of the disease as the pathogenicity is not tested. White band

diseases are said to occur in two forms. Ritchie & Smith (1998) stated that type 1 white

band disease shows coral tissue undergo major necrosis while type 2 shows bleached

area on the coral that subsequently lysed (Ritchie & Smith 1998).

According to (Ritchie & Smith 1998; Ritchie & Smith 1995), they found out that Vibrio

charcharia is always present in the corals that infected by white band disease type 2.

Moreover, corals can also suffer from plague which is described further as spreading

disease of massive and plate-forming corals which in the end leads to mortality of

coral’s individual colonies (Dustan 1977). It was found that Sphingomonas sp. is one of

the causative agent of this plague disease (Richardson et al. 1998). Researchers have

managed to identify a few causative agents that contribute to the occurrence of certain

coral species’ bleaching and diseases. For example, the bleaching phenomenon of coral

Oculina patalogica is caused by a marine pathogen named Vibrio Shiloi (Kushmaro et

al. 1996) while the bleaching of coral Pocillopora damicronis by Vibrio coraliilyticus

(Rosenberg & Ben-Haim 2002), the black band disease is caused by a microbial

consortium (Antonius 1973), sea-fan disease which is better known as “aspergillosis” is

caused by Aspergillus sydowlii (Smith et al. 1996) and lastly, the coral white plague

disease caused by Sphingomonas sp. (Dustan 1977; Richardson et al. 1998).

Although the coral mucus layer serves as a protection against pathogenic bacterial

infection, there is also an exceptional case. For example, there is a study that showed

that the Mediterranean coral Oculina patagonica was infected by V.shiloi, a pathogen

that targets the symbiotic algae of the coral (Kushmaro et al. 1998;Kushmaro et al.

1997; Rosenberg & Ben-Haim 2002). Its infection is due to the fact the bacteria is able

to adhere to the coral mucus layer (Banin et al. 2000a). The study also shows that

adhesion of the pathogen to the coral was reduced when there was depletion of the

mucus layer and also the reduction in the symbiotic algae presence. For this case, it can

P a g e | 16

be seen that the pathogen utilizes the mucus layer’s component to enter the coral

host.

1.4.4 Coral diseases and the role of microbes in coral surface mucus layer (SML)

Disease susceptibility is positively correlated with a change in coral SML composition,

loss of antibiotic activity and an increase in pathogenic microbes (Reshef et al .

2006b). The bacterial communities of diseased corals are different from healthy

ones, both qualitatively and quantitatively (Reshef et al. 2006). The bacterial

population of apparently healthy corals undergo changes within a period of a few

months, probably as a result of temperature changes (Koren & Rosenberg 2006).

Previous studies have shown a sudden shift to pathogen dominance occurring in the

coral SML prior to a bleaching event (Ritchie 2006; Rosenberg & Ben-Haim 2002) and

it has been demonstrated that antibiotic activity and antibiotic-producing bacteria in

the SML decline in times of increased water temperature when bleaching is most

likely to occur (Rit ch ie 2006 ) . One possible explanation for an increased

incidence of coral diseases is stress-induced susceptibility to opportunistic microbes

trapped in the coral SML (Ritchie 2006). Indigenous bacteria may help prevent

infection by pathogens by producing antibacterial materials (Koh 1997).

Vibrio shiloi is a known bacterial pathogen to the coral Oculina patagonica found in

the Mediterranean sea (Kushmaro et al. 2001; Kushmaro et al. 1996; Kushmaro et al.

1997). It induces bleaching by reducing the amount of viable zooxanthellae available

for symbiosis with the coral. This is achieved by the secretion of a toxin (a proline-rich,

12 amino acid peptide) (Banin et al. 2000a) that inhibits photosynthesis, and

bleaches and lyses zooxanthellae (Rosenberg et al. 1999). Vibrio shilonii only actively

pathogenic at temperatures of 20-32°C and displays maximum efficacy around 29-

30°C (Kushmaro et al. 2001).

A more recently discovered temperature-dependent agent of bleaching is Vibrio

coralliilyticus which infects the coral Pocillopora damicornis (Ben-Haim et al. 2003). A

patchy pattern of bleaching of Pocillopora damicornis has been observed at 24 °C,

P a g e | 17

suggesting that bacterial bleaching results from an attack on the zooxanthellae,

followed by bacterium-induced coral lysis and death caused by bacterial extracellular

proteases which were produced at temperatures of 24 to 28 °C ( B e n - H a i m ,

Z i c h e r m a n - K e r e n & R o s e n b e r g 2 0 0 3 ) .

There is evidence that a community shift in the coral SML from beneficial bacteria

to Vibrio-dominance occurs prior to zooxanthellae loss (Ritchie 2006). Studies have

shown that Vibrio may be normal constituents of the coral microbial assemblages and

can opportunistically proliferate if holobiont health is compromised (Bourne & Munn

2005a). Previous studies have implicated Vibrio sp. as the principal causative agent in

seasonal and species-specific episodes of coral bleaching (Ben-Haim et al. 2003;

Kushmaro et al. 1996; Kushmaro et al. 1997). Three separate studies (Ben-Haim,

Zicherman-Keren & Rosenberg 2003; Kushmaro et al. 1996) showed that the

number of Vibrio in coral SML did increase with increasing temperatures. In elevated

temperatures, Vibrio sp. will produce a photosynthesis inhibitor (Rosen b erg et a l .

1 9 9 9) , thereby allowing them to multiply, leading to overgrowth and in turn,

causing the loss of antibiotic properties of the SML inhabiting microorganisms (Ritchie

2006). It was speculated that the endosymbiotic zooxanthellae (Symbiodinium sp.)

play a significant role in restricting Vibrio growth in the coral SML by producing free

radicals (Sharon & Rosenberg 2008) but their limited temperature tolerance leads

to the loss of the protective function for the coral.

Elevated sea water temperatures can also induce pathogens to produce adhesions

that allow it to adhere to the coral surface and subsequently establish infections in

the pathogenic systems of the coral (Banin et al. 2000a). The production of toxins and

lytic enzymes which cause bleaching and lysis of zooxanthellae were also found to be

temperature-regulated (Banin et al. 2000a).

Since mucus-associated bacteria play a major role as a first line of defence against

pathogens (Shnit-Orland, Sivan & Kushmaro 2012), and are of significance to the

survival of coral reefs in the area, the present study aimed to investigate:

P a g e | 18

the bacterial communities in three different coral species, namely Trachyphyllia

geoffroyi, Euphyllia ancora and Corallimorphs sp. and

the shift in the bacterial community associated to these three corals when their

surrounding temperature and carbon dioxide concentrations were increased.

Trachyphyllia geoffroyi and Euphyllia ancora belong to the order of scleractianian and

they are the most basal eumetazan taxon that provided the biological and physical

framework for coral reefs (Mydlarz, Jones & Harvell 2006). Although Corallimorphs sp.

is not classified under the order of scleractinian corals, they are closely related to

scleractinian corals. Scleractinian corals play an important role as they form the

tropical coral reef ecosystems adjacent to developing countries (Mydlarz, Jones &

Harvell 2006). In addition to that, they also support major industries such as in terms of

food production, tourism, and biotechnology development (Vidal-Dupiol et al. 2011).

Coral mucus associated bacteria that took over at higher temperatures were likely

pathogenic to the coral host (Banin et al. 2000a). In an extension to the above

questions, we performed phage assays to identify potential bacteriophages that could

potentially in the future be utilised as a treatment for diseased corals.

1.5 Phage Therapy

Bacteriophages are bacterial viruses that play an important role in the evolution of

their host and whole genome sequencing of the bacteria showed that phage elements

contribute to sequence diversity and are potential to influence bacterial pathogenicity

(Hanlon 2007).One of the best approaches to combat the issue of deteriorating coral’s

health condition due to diseases is through the application of phage therapy.

Bacteriophage (phage) therapy is defined as using phages or their products as

bioagents for the treatment or prophylaxis of bacterial infectious diseases

(M at suz ak i et a l . 2005 ) . Phage therapy is said to be a better approach in curing

coral’s disease rather than other methods such as immunization and antibiotic

P a g e | 19

treatments. This is due to the fact that introduction of antibiotics in an open system

like the coral reefs is not practical and corals generally do not possess an adaptive

immune system (Nair et al. 2005). Phage therapy of coral diseases has many

advantages such as host specificity, self-replication ability and it is an environmentally

safety procedure (Efrony et al. 2006). Besides, phages used for phage therapy only

targets on specific pathogens and thus will not harm the remaining beneficial

microorganisms. In addition, phage multiplies at a very fast rate at the expense of its

host bacterium which in the end will increase the phage titer leading to more effective

control of the specific pathogen (Efrony et al. 2006). According to Weld et. al. (2004),

the phage concentration will also decline once the pathogens concentration starts

declining (Weld, Butts & Heinemann 2004). Therefore, this therapy is a good

alternative to help in combating coral diseases worldwide.

To hypothesize, changes of temperature and carbon dioxide (CO2) will affect the

diversity of coral-mucus associated bacteria.

P a g e | 20

1.6 Aims of the present study and dissertation outline

In this present study, the main aim of the project is to investigate the diversity of

microbial community associated with the coral of Corallimorphs sp. (Mushroom coral),

Euphyllia ancora (Hammer coral) and Trachyphyllia geoffroyi (Brain coral) to

understand the bacterial community that reside in them.

Besides investigating the coral mucus-associated bacterial communities of the three

corals, t he second aim of the project is to understand the dynamics of the bacterial

community development changes when the corals are exposed to environmental

changes (eg. surrounding temperature changes).

The third aim of the study is to investigate potential bacteriophages isolates that can

inhibit growths of potential marine pathogens.

The objectives of this study are:

To isolate and identify microbial communities associated with the coral mucus

layer for the selected scleractinian stony corals.

To assess the effects of elevated temperatures on the microbial communities.

To identify potential bacteriophage isolates that can inhibit growths of

potential marine pathogens.

The results obtained will contribute in our understanding of the coral’s health

(Bourne et al. 2009) which will eventually aid in searching for potential ways to solve

the current deteriorating coral reefs' health.

P a g e | 21

CHAPTER 2

2 Methodology

2.1 Methodology Overview

In the beginning, culture-based studies were applied by microbiologist in order to

study the marine microbial diversity. Although this methodology enables

microbiologist to gain understanding about the marine microbial diversity, there are a

number of limitations in this method such as the inability to detect those

‘unculturable’ bacteria (Jørgensen 2006). Today, the advances in molecular biology

have brought ecological studies in microbiology to even greater heights. Physiological

and biochemical studies, previously hindered by obstacles in culturing the

‘unculturable’, can now be carried out to establish the identities, phylogenetic

relationships and metabolic processes of both cultured and uncultured microbial

populations via DNA or RNA based methods (Jørgensen 2006).

The characterization of microbes by genera and species, which previously could not

be achieved through biochemical methods alone, can now be carried out with the

help of sequence-classifier algorithms (Petrosino et al. 2009). Sequencing studies are

conventionally carried out via the Sanger method (Sanger, Nicklen & Coulson 1977)

which is widely used in microbial population studies. Sequencing provides us with

an indication of whether specific genes of interest (for example a bacterial group) are

present in a sample (Rajendhran & Gunasekaran 2011). In this study, coral mucus-

associated bacteriawere investigated using both approaches; culture based, as well as

molecular approach. A summary of the methods utilised is provided in the following in

form of a flowchart.

P a g e | 22

Figure III: Overall methodology flowchart that summarizes the overall experimental

procedures. The identity and enzymatic properties of Trachyphyllia geoffroyi, Euphyllia

ancora and Corallimorphs sp. mucus-associated bacteria were assessed and potential

coral pathogens isolated were tested against potential bacteriophages to detect

whether their growth could be inhibited by the potential bacteriophages chosen

(phage therapy).

Detecting the presence of plaques caused by isolated phages on the selected potential coral pathogens and sequence the postiive resutls for phages identities

Screening of potential bacteriophage

Phylogenetic Trees construction , Results and Discussions

Identifying types of coral mucus associated bacteria and their enzymatic

properties

Detecting the bacteria that present and disappear during changes in

environmental condition

Amplification of genes via PCR

16S rDNA ARISA and DGGE Fingerprinting Analysis

Assessing bacteria community of coral mucus-associated bacteria from Week 1 to Week 11

Cuturing for pure bacterial isolates and DNA Extraction

Genomic bacterial DNA Extraction

P a g e | 23

2.2 Field Sampling and Experimental Set Up

The selected coral samples; Euphyllia ancora, Corallimorphs sp., and Trachyphyllia

geoffroyi (Figure IV) were obtained from Aquadot Aquarium Shop, Kuching, Malaysia in

1st July 2014 and placed into a 240 litre aquaria tank. The corals were allowed to settle

in the tank for a period of 4 weeks before any changes of temperature and carbon

dioxide content in their surrounding were applied.

Euphyllia ancora coral

Corallimorphs sp. coral

P a g e | 24

Trachyphyllia geoffroyi coral

Figure IV: Types of coral species investigated in this experimental study (top left:

Euphyllia ancora; top right: Corallimorphs sp. and bottom left; Trachyphyllia geoffroyi.)

The main equipment used to monitor the aquarium conditions are the WTW 3420

Multiparameter and LI-COR 820 Carbon Dioxide Analyzer (Figure V). The WTW 3420

Multiparameter is a device used to measure and monitor the two parameters namely

the DO (dissolved oxygen) and pH value of the set-up aquarium tank. The software

used to output the data is called the SoftwareMultiLab® User (WTW Xylem Brand).

LI-COR 820 measures carbon dioxide content (ppm) via pumping air to the air inlet and

passing the sample gas through the instrument's optical path. As for data collection,

four convenient data output options are available such as Windows® Interface

Software, Analog Outputs, Digital Outputs and lastly the XML Communications

Protocol (LI-COR Environmental Home). The sampling intervals for throughout the

experiment are 30 minutes interval time.

LI-COR 820 Carbon Dioxide Analyzer

WTW Multi 3420 Multiparameter

P a g e | 25

Figure V: llustrations of experimental instuments used to monitor the parameters in

the aquaria

The overall experimental period was a total of 9 weeks. The starting date of the

experiment was from 26.07.2013 and ended on 29.10.2013. Table C summarises the

detail on the exact dates of the experiment and also the changes in the parameters

throughout the experimental weeks. The experiment is divided into 4 different sets of

environmental conditions which are going to be discussed in the following paragraphs.

Table C: Overview of parameters (pH, CO2, dissolved oxygen, temperature) observed

during weeks 1 to 9

Date of

Experiment

26.07.2013-

22.08.2013

23.08.2013-

05.09.2013

06.09.2013-

19.09.2013

09.10.2013-

29.10.2013

Week of

Experiment

Week1 to

Week 4

Week 5 to

Week 6

Week 7 to

Week 8

Week 9

Temperature (°C) 25 27 29 29

Carbon dioxide

(ppm)

380 450 450 ~2000

pH value 8.1 8.1 8.1 7.5

Dissolved oxygen

(%)

~101 ~101 ~101 ~101

2.2.1 Week 1 to Week 4

The selected corals for testing were maintained in artificial seawater (Red Sea Salt) at a

set of controlled parameters during Week 1 to Week 4 of the experimental period:

Temperature (°C): 25

P a g e | 26

Carbon dioxide (ppm): 380

Dissolved oxygen (%): 100

pH value: 8.1

Figure VI shows that the conditions did not vary significantly.

Figure VI: Graph showing overall parameters during week 1 to 4 of the experiment.

Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and temperature

on secondary y-axis.

2.2.2 Week 5 to Week 6, Temperature increase to 27°C






pH value: 8.1

P a g e | 27

Figure VII shows that the temperature was constant around 27°C and other

parameters were stable.

Figure VII: Graph showing overall parameters during week 5 to 6 of the experiment.

Dissolved oxygen and carbon dioxide are shown on primary y-axis, pH and


2.2.3 Week 7 to Week 8, Temperature increase to 29°C






pH value: 8.1

P a g e | 28

Figure VIII shows that the temperature was constant around 28°C and other

parameters were stable.

Figure VIII: Graph showing overall parameters during week 7 to 8 of the experiment.

Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and temperature

on secondary y-axis.

2.2.4 Week 9, Temperature 25°C and CO2 increase


set of controlled parameters during week 9 of the experimental period:




pH value: 8.1

Figure IX shows that the temperature was constant around 25°C and other parameters

were stable, except the CO2 increase upto close to 2500 ppm.

P a g e | 29

Figure X provides an overview of the CO2 and temperature over the course of the

whole experiment.

Figure IX: Graph showing overall parameters during Week 9 of the experimental

weeks. Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and


P a g e | 30

Figure X: Graph showing Week 1 to week 9 overall experimental period for carbon

dioxide (ppm) and temperature (°C) in the aquaria. Carbon dioxide is shown on

primary y-axis, temperature on secondary y-axis.

After the conclusion of the experiment, Euphyllia ancora and Trachyphyllia geoffroyi

were dead (see Figure XI), whereas Corralimorphs sp. was struggling but still alive

(Figure XI).

P a g e | 31

Figure XI: The condition of Trachyphyllia geoffroyi, Euphyllia ancora and

Corallimorphs sp. after a period of 9 experimental weeks.

Euphyllia ancora

• The coral experiences bleaching and gradually loses its polyps till it undergo mortality when temperature rised up to 30°C and with elevated CO2 content. The mucus secretion reduces gradually throughtout the experiment.

Trachyphyllia geoffroyi

• The coral experiences bleaching and increases in mucus secretion when undergo thermal stress (27°C). It undergo mortality when temperature rised to 30°C along with elevated temperature. The colour changes from neon green and red centre to faded color and dry skeletal condition.

Corralimorphs sp.

• The zooxanthellae that resides on the corals survived and threfore the coral does not undergo mortality throughout the experiment. There is no change in the morphology condition except producing less mucus secretion when the coral is exposed to temperature up to 30°C.

P a g e | 32

2.3 Laboratory procedures

The first step to obtain the bacterial community identity associated to Trachyphyllia

geoffroyi, Euphyllia ancora and Corallimorphs sp. is the need to extract their DNA. DNA

extraction is a step of removing the deoxyribonucleic acid (DNA) from the bacterial

cells. The target of any isolation and extraction procedure should be to maximise yield

and purity of the resulting DNA. The yield of DNA is important for increasing the

efficiency of lysis, as a yield 9 μg instead of 10 μg from the same sample can mean

either 90% efficiency of the lysis of all the different cells present or lysis of only 90% of

cells which are the most sensitive to the lytic protocol used (Rohwer et al. 2001). Purity

will determine the extent to which the microbial DNA template can be analysed by PCR

for community analysis. Also different PCR primers vary in sensitivity to impurities.

Pure DNA is essential also for other molecular techniques.

2.3.1 Isolation and DNA Extraction of coral mucus associated bacteria

Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. mucus layer were

extracted on weekly basis starting from week 1 to week 9 respectively. The corals are

taken out from the aquaria tanks left in a beaker to let their mucus layers drip into the

beaker for collections. Then, in order to culture only the original residents of coral

mucus layer, steps for inhibition of potentially invasive microorganisms were applied.

For every tested coral samples, 50 µl of the fresh undiluted coral mucus samples were

collected from the corals and using a pipette and spreader, the mucus was spread

evenly onto the half-strength marine agar plate (HI-MEDIA) and allowed to dry for 10

minutes (Ritchie 2006). These mucus treated plate were sterilized via UV irradiation by

placing the plates onto laminar flow for UV irradiation treatment (10 mins at 320 nm

wavelength) as previously described by Ritchie KB (2006). UV irradiated mucus-treated

plates that were un-inoculated by mucus sample were used to control for complete UV

killing in the experiment. Then, the inoculated plates were spread with another 50 µL

of mucus layer on top evenly. Each sample was made duplicates. Then, these plates

P a g e | 33

were incubated for 48 hours at 30 °C, followed by continuous sub-culturing and

isolation for purification(Ritchie 2006).

To extract the DNA of the pure isolates, the colony of each pure culture was inoculated

in 10ml of marine broth (HI-MEDIA) and left overnight for growth. Then, the inoculated

cultures were spun in 13,000g for 20minutes and the supernatant were removed.

100µL of autoclaved TE buffer was added to each bacterial pellets and the mixture was

vortexed to homogenize. Then, 3 cycles of freeze-thawing (5 minutes in -80 °C

followed by 3 minutes in 85 °C) were carried out(Ritchie 2006). Gel electrophoresis on

an agarose gel containing ethidium bromide (1 %, 100 V, 35 min) and viewing under

UV light and Geldoc was carried out to confirm the presence of the crude bacterial

DNA. Figure XII shows an example of crude bacterial DNA extracted from the pure

isolates.

Figure XII: Crude DNA Extraction of bacterial isolates-associated to Trachyphyllia

geoffroyi, Euphyllia ancora and Corallimorphs sp. on gel Band with 1kbp DNA ladder. L1

(Lane 1) represents the 1kbp DNA ladder. L2-L11 represent the DNA smears of

L1 L2 L3 L4 L5 L6 L7 L8 L9 L10 L11

P a g e | 34

bacterial isolates-associated to Trachyphyllia geoffroyi, Euphyllia ancora and

Corallimorphs sp.

2.3.2 Molecular characterisation

Small subunit ribosomal RNA (16S rRNA) has been proven to be most useful for

establishing evolutionary relationships because of their high information content,

conservative nature, and universal distribution (Lane et al. 1985). The 16S sequence

analysis is used in two major applications: (a) identification and classification of

isolated pure cultures and, (b) estimation of bacterial diversity in environmental

samples without culturing through metagenomic approaches. New bacterial isolates

are identified based on the 16S sequence homology analysis with existing sequences in

the databases (Rajendhran & Gunasekaran 2011).

Sequence analysis is chosen as one of the methods to assess the biodiversity of the

coral mucus associated bacteria because is the ability to use it for generation of

additive and retrievable data which can be used to generate phylogenetic probes and

primers for use in further studies (McCaig, Glover & Prosser 1999).

The bacterial DNA were amplified by polymerase chain reaction (PCR) and PCR

products were purified using PureLink® PCR Purification Kit following the

manufacturer’s protocol (Invitrogen Life Technologies). Amplification of bacterial 16S

rRNA genes was performed with primers 8F (Eden et al. 1991) and 519R (Lane et al.

1985). The availability of this set of universal 16s rRNA gene primers made the

amplification of a mixed population of 16s rRNA possible and enable the

characterization of phylogenetic diversity of coral-associated bacteria communities

(Rohwer et al. 2001). Amplification was performed by using REDTaq® ReadyMix™ PCR

Reaction Mix (Sigma Aldrich) using instructions provided by the Sigma Aldrich. An

overview of the reaction mixture in each PCR tube is provided below in Table D.

P a g e | 35

Table D: Components of 16S Rrna PCR reaction per PCR tube

Components Volume (L)

2x Bioline Red Taq Mix 12.5

Forwardprimer

8F (AGAGTTTGATCCTGGCTCAG) 1.0

Reverse primer

519R (GWATTACCGCGGCKGCTG)

1.0

DNA template 3.0

ddH2O 7.5

Final volume 25.0

Amplification reactions were performed as follows: initial denaturation at 94°C for 5

min, followed by 30 cycles of 94°C for 30 sec, 55°C for 30 sec, 72°C for 45 sec, and final

extension at 72 °C for 10 min (Eden et al. 1991). PCR reaction results were checked

using 1% agarose gel containing 1 µg of ethidium bromide per ml for pure DNA bands

(see Figure XIII) via electrophoresis (100V, 40 min), then sent for sequencing to BGI

Tech, Hong Kong.

P a g e | 36

Figure XIII: PCR bands result obtained from amplification of bacterial 16S rRNA genes

of bacteria-associated to Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs

sp. on gel band with 1kbp DNA ladder. L1 (Lane 1) represents the 1kbp DNA ladder. L2-

L22 represents the DNA smears of bacterial isolates-associated to Trachyphyllia

geoffroyi, Euphyllia ancora and Corallimorphs sp.

Nucleotide sequences were determined by the dideoxynucleotide method by cycle

sequencing of the purified PCR products. An ABI Prism BigDye Terminator Cycle

Sequencing Kit was used in combination with an ABI Prism 877 Integrated Thermal

Cycler and ABI Prism 377 DNA Sequencer (Perkin Elmer Applied Biosystems).

2.3.3 Construction of phylogenetic trees for coral mucus-associated bacteria

A total of 265 isolates were isolated from the three selected corals mucus layer

samples (Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.) via culturing

method. However, only 104 amounts of isolates are successfully sequenced for their

identity via Sanger sequencing (see Figures Figures XXVI, XVII and XXVIII for

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

P a g e | 37

phylogenetic trees). This is due to some experimental errors such as failure in

optimization PCR condition for certain isolates, complications in yielding pure PCR

samples and low concentration of bacterial DNA extracted.

Returned DNA sequences were analysed using Basic Local Alignment Search Tool

software (NCBI) and Chromas 2.22 (Zhang et al. 2000). Phylogenetic analysis was

performed with Mega6.0 software. Sequences were aligned with ClustalX. BLASTN

from the source http://www.ncbi.nlm.nih.gov/BLAST/BLAST.cgi was then used to

characterize each sequence cluster. The phylogenetic tree was generated with

distance methods, and sequence distances were estimated with the neighbour-joining

method. Bootstrap values ≥50 are shown and the scale bar represents a difference of

0.05 substitution per site. Accession numbers for the reference sequences are

indicated. Resulting trees are presented in Figures XXVI, XVII and XXVIII.

Phylogenetic analysis and culture-based approaches used in this study provide

information regarding the identity of microbes present in the coral mucus layer and at

the same time also some information regarding the elucidation of true coral residents

which are microbes that benefits the coral host, zooxanthellae or other resident

microbes.

2.3.4 Indices for Bacterial Diversity

In order to retrieve more information about the bacteria diversity associated to the

coral mucus layer, a few ecological diversity indices are applied. These diversity indices

are defined as mathematical measures of species diversity in a community (Beals,

Gross & Harrell 2000). Diversity indices generally compare the diversity among

microbial communities that enables us to quantify the diversity within the

communities and describe their numerical structure (see Table E).

These mathematical formulae provide important information about rarity and

commonness of species in a community. Therefore, the ability to quantify diversity in

this way is a useful tool to understand community structure.

P a g e | 38

Table E: List of Variables for Biodiversity Indices

H Shannon's diversity index

S total number of species in the community (richness)

N Total Number of Isolates

pi proportion of S made up of the ith species

EH equitability (evenness)

J’ Shannon Evenness

DMg Margalef Index

The first index method applied is the Margalef Index (DMg) which functions in

measuring the species richness and is highly sensitive to sample sizes although it tries

to compensate for sampling effects (Magurran 2004). It is calculated in this formula:

DA= (S-1)/logeN

Where S is the number of bacteria species, N is the total number of species present in

the coral on respective weeks. According to (Gamito 2010), DMg is a more accurate

index if data is related to species richness as it uses absolute numbers compared to a

density data matrix. Berger and Parker (1970) also stated that Margalef Index is useful

in conjuction with indices sensitive to evenness or changes in dominant species(Berger

& Parker 1970). Besides this method, another commonly use index formula called

Shannon index (H’) is also applied. The Shannon diversity index (H) is another index

that is commonly used to characterize species diversity in a community(Gamito 2010).

Shannon's index accounts for both abundance and evenness of the species present.

This method considers proportions which will ensure no differences when using either

data set (Gamito 2010). The proportion of species i relative to the total number of

species (pi) is calculated, and then multiplied by the natural logarithm of this

proportion (lnpi). The resulting product is summed across species, and multiplied by -1:

P a g e | 39

As a result, if the particular sample has the highest H’, it appears to be the most

diverse. The Shannon evenness index (J’) is derived from H’ which therefore makes it

sensitive to changes in evenness of rare species, thereby possibly overestimating its

true value (Hill et al. 2003). The Smith and Wilson evenness index (Evar), however, is

known to show greater resolution in reflecting true values (Blackwood et al. 2007).

Shannon's equitability (EH) can be calculated by dividing H by Hmax (here Hmax = lnS).

Equitability assumes a value between 0 and 1 with 1 being complete evenness.

2.3.5 Fingerprinting Analyses

In order to assess the changes in the bacterial communities associated to the coral

mucus layer, advanced molecular fingerprinting techniques such as denaturing gel

gradient electrophoresis (DGGE) (Ferris, Muyzer & Ward 1996) were applied in this

study. The use of molecular biological techniques is getting more popular and is

frequently used to explore microbial diversity (Muyzer & Smalla 1998) . This advanced

technique has also aid in overcome the limitations of traditional cultivation techniques

to retrieve the bacterial diversity (Muyzer & Smalla 1998). Examples include

Denaturing Gradient Gel Electrophoresis (DGGE), Temperature Gradient Gel

Electrophoresis (TGGE), Terminal Restriction Fragment Length Polymorphism (T-RFLP)

and (Automated) Ribosomal Intergenic Spacer Analysis (ARISA). These molecular

techniques have in common that they determine the variants of a certain gene (often

the small subunit ribosomal RNA; ssu rRNA or 16S rRNA in case of bacteria) and use

this measurement as a proxy for the actual microbial cell abundances in the sample. It

is thereby assumed that each gene variant (apparent as a band or peak in the

fingerprint) corresponds to a certain microbial taxon, often referred to as a phylotype

or Operational Taxonomic Unit (OTU) (Muyzer & Smalla 1998).

For this study, ARISA and DGGE analysis methods were chosen because both are

genetic fingerprinting techniques which provide a pattern or profile of the genetic

P a g e | 40

diversity in a microbial community. The details of these methods are provided in the

following procedures below.

2.3.5.1 Extraction of genomic DNA from coral mucus samples

In order to perform DGGE and ARISA analysis, the genomic DNA of corals’ bacteria

needs to be extracted. Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.

mucus layers were extracted weekly throughout the experiment. The mucus for

molecular analysis was collected by holding the corals out of the water for 3 minutes,

rinsing them with seawater from the tank and dripping the freshly produced mucus

into autoclaved 1.5 ml Eppendorf centrifuge tubes. Mucus samples were maintained at

-20°C and processed within 2 hours of collections to prevent DNA degradations.

Initially, genomic DNA of coral mucus layer was extracted via the Nucleospin protein

purification kit (Macherey-Nagel, Duren, Germany). However, the product yielded very

low DNA concentrations. Another conventional method was also applied which is by

using the beat beater to break apart or "lyse" the bacterial cells in the early steps of

extraction in order to make the DNA accessible. Glass beads are added to an

Eppendorf tube containing a sample of interest and the bead beater vibrates the

solution causing the glass beads to physically break apart the bacterial cells in 8000 g

for 1 minute. The results were negative as there was very little genomic DNA detected

via gel electrophoresis. It could be due to excessive break down of the cells causing

damages to the bacterial DNA. Hence, another method for genomic DNA extraction

was applied which is by using SDS/Proteinase K. First, lysozyme was added (75 µL of

100 mg /ml) to the mucus samples and incubated at 37°C for an hour followed by 3

cycles of freeze and thaw (-80°C and +65°C). Lysozyme was added to break down the

lipid membranes so that the DNA in the bacterial cells can be freed (Bourne et al.

2008). Then, sodium dodecyl sulphate (SDS) was added (100µL of 25%) then mixed and

incubated at 70°C for 10 minutes. SDS is a detergent that used to further break down

the lipid membrane of the bacterial cell wall. The samples were cooled to room

temperature before adding 10 µl of 20 mg ml of Proteinase K solution and followed by

incubation in 37°C for an hour. The proteinase K solution is used to digest the

P a g e | 41

contaminating proteins of the bacteria cells. Then, another 3 cycles of DNA freeze and

thaw method is applied to further rupture and lyse the bacterial cell wall so that the

bacteria DNA can be obtained (Bourne et al. 2008). Samples were then spun in

centrifuge machine for 1 min in 13,000rpm and supernatant was removed. The

genomic DNA pellets were eluted using 30 μL of TE buffer and stored at −20 °C. Gel

electrophoresis on an agarose gel containing ethidium bromide (1%, 100 V, 35 min)

and viewing under UV light and Geldoc was carried out to confirm the presence of the

genomic DNA.This method has yielded high genomic DNA (see Figure XIV) and was

therefore chosen as the method of choice.

Figure XIV: Genomic DNA of bacteria-associated to Trachyphyllia geoffroyi, Euphyllia

ancora and Corallimorphs sp. on gel band with 1kbp DNA ladder. L1 (Lane 1)

represents the 1kbp DNA ladder. L2-L7 represent the genomic DNA of bacterial

isolates-associated to Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.

L1 L2 L3 L4 L5 L6 L7

P a g e | 42

2.3.5.2 (Automated) Ribosomal Internal Spacer Analysis (ARISA)

After obtaining the genomic DNA of the bacteria from the selected corals’ mucus

layers, Ribosomal Intergenic Apacer Analysis (ARISA) was carried out. ARISA is a

commonly used method for microbial community analysis that provides estimates of

microbial richness and diversity (Cardinale et al. 2004; Danovaro et al. 2006). This

method is based on the length heterogeneity of the bacterial rRNA operon 16S and 23S

intergenic spacer (better known as the internal transcribed spacer or ITS). In this study,

this analysis method is chosen because it is a suitable tool for comparing bacterial

community structure across multiple coral mucus samples on profile patterns and

estimate the bacterial richness and diversity (Cardinale et al. 2004).

RISA was performed as previously described by Cardinale et al. (2004) using primer set

ITS F/ITSReub. The 5’ and 3’ ends of primers ITSF (5’-GTC GTA ACA AGG TAG CCG TA-3’)

and ITSReub (5’-GCC AAG GCA TCC ACC-3’) are complementary to positions 1423 and

1443 of the 16S rDNA and 38 and 23 of the 23S rDNA of Escherichia coli, respectively

(Cardinale et al. 2004). An overview of the reaction mixture in each PCR tube is

provided in Table F:

Table F: Components of ARISA PCR reaction per PCR tube



Forward primer

ITSF

(5’-GTCGTAACAAGGTAGCCGTA-3’)

1.0

Reverse primer

ITSReub

(5’-GCCAAGGCATCCACC-3’)

1.0

P a g e | 43

DNA template 3.0

ddH2O 7.5

Final volume 25.0

The mixture was amplified at 94 °C for 3 min, followed by 30 cycles of 94 °C for 45

seconds, 55 °C for 1 minute, 72 °C for 2 minutes, and a final extension at 72 °C for 7

minutes (Cardinale et al. 2004). PCR products were then analysed on a 3% agarose gel

(100 V for 40 minutes) and viewed under UV transluminator and Geldoc.

2.3.5.3 Denaturing gradient gel electrophoresis (DGGE) Analysis

Same as RISA, by using DGGE, many coral mucus samples taken at different time

intervals during the study can be simultaneously analysed. This makes the techniques a

suitable tool for monitoring community behaviour after environmental changes (eg.

temperature changed in the tank). With the attachment of a GC-rich sequence (GC

clamp) on the selected primer for DGGE, nearly 100% of the sequence variants can be

detected in DNA fragments up to 500 bp (Muyzer, De Waal & Uitterlinden 1993).

For this analysis, the bacterial genomic DNA was extracted from coral mucus samples

and segments of the 16S rRNA genes were amplified in the polymerase chain

reaction(Saiki et al. 1988). As a result, a mixture of PCR products obtained from the

different bacteria present in the sample. Then, the individual PCR products were

subsequently separated by DGGE. The result was a pattern of bands, for which the

number of bands corresponded to the number of predominant members in the

microbial communities.

PCR for DGGE was performed using the primers of GC341f (5'-

CCTACGGGAGGCAGCAG-3)

(Muyzer et al. 1996) and 907R(5'-CCGTCAATTCMTTTRAGTTT-3') (Ishii & Fukui 2001)for

P a g e | 44

amplification of V3 region of the 16S rRNA genes of bacteria. The GC clamp ( 5'-

CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG-3') was attached to the 5’

end of the GC341f primer. It is recommended that 10-20 ng of template DNA. These

primers produce a 600 bp product (including the gc clamp sequence) (Muyzer, De Waal

& Uitterlinden 1993). An overview of the reaction mixture in each PCR tube is provided

in Table G.

Table G: Components of DGGE PCR reaction per PCR tube



Forwardprimer

341GCF 1.0

Reverse primer

907R

1.0

DNA template 5.0

ddH2O 20.5

Final volume 50.0

The thermocycling program for the touchdown PCR was as follows: initial denaturation

was performed at 95°C for 3 min and then at 95°C for 30 sec, followed by touchdown

primer annealing from 65°C to 55°C (the annealing temperature was decreased 1°C

every second cycle for the first 10 cycles, to touchdown at 55°C), followed by extension

at 72°C for 1min (for each of the 10 cycles), 20 more cycles were then performed at

95°oC for 30 sec, 55°C for 30 sec, and 72°C for 1 min, with a final extension step at

72°C for 10 min (Muyzer & Smalla 1998).

P a g e | 45

PCR products availability was then checked on a 1% agarose gel (100 V for 40 minutes)

and view under UV transluminator and Geldoc. The preparation for the conduct of

DGGE analysis is done according to the manufacturer’s procedures (BioRad Manual). A

summary is provided in the following:

Gel Casting for DGGE Analysis

As for gel casting for parallel DGGE which the gradient and electrophoresis run in the

same direction, the gel is run overnight, at 70V for 16 hours. Before starting the

electrophoresis, 8 liters of 0.5X TAE are made and filled into the buffer tank. Then, the

lid is put on to ensure the stirring bar fits into support hole in tank. The buffer in the

gel tank is heated up by turning on the power and set the temperature to 65°C.

Running the DGGE Gel

The next step after gel casting is loading the DGGE PCR product into the wells of the

gel. 5 µl of gel-loading buffer is added to each PCR product before loading. Then, the

lid was placed and the power and heater are turned on. The gel is run for 16 hours at

70V and 60°C.

Staining

The last part is staining of the gel after electrophoresis. The gel is carefully transferred

to a plastic wrap. Then SYBR Green is poured onto the gel for staining purpose. The gel

is covered with aluminum foil (SYBR Green is light sensitive) and left for staining for 15-

30 minutes. Lastly.the gel image is viewed under Geldoc.

Analysing the DGGE Gel

Since the resulting DNA fragments in the DGGE analysis gel were not excised for

further sequencing process, the DGGE gel image were analysed via a software tool

called PyElph. Although sequencing analysis of the specific DNA bands obtained from

DGGE analysis enables the determination of more specific community structure traits,

the complex nature of the resulted DGGE fingerprinting makes interpretation of data

difficult. Many bands present in the gel have almost similar mobility and thus making

P a g e | 46

the excision of the DNA bands difficult to be done. In order to gain a better

understanding and interpretation from the DGGE gel, the software PyElph was used

because it is software that automatically extracts data from gel images (Pavel & Vasile

2012). It then computes the molecular weights of the analysed molecules or fragments

and compares the DNA patterns which result from the experiments with molecular

markers and finally generating phylogenetic trees computed by 5 clustering methods

based on the information extracted from the analysed gel image (Pavel & Vasile 2012).

There are many different software that function almost similarly with PyElph such as

QuantityOne from Bio-Rad and GelAnalyzer but both these software have their

disadvantages. QuantityOne is expensive and has a complex design while GelAnalyzer

is not an open source and does not have phylogenetic analysis (Pavel & Vasile 2012).

To first start using the software, DGGE gel image is loaded into it and some editing

operation is done in order for the software to be able to detect all the bands present

(see Figure XV for an example in form of a screenshot). Then, the three selected coral

samples data are combined to infer a phylogenetic tree.

P a g e | 47

Figure XV: PyElph Software Analysis System. Screenshot showcases band matching

step during gel analysis.

The PyElph software automatically detects the migration lanes and bands, computes

the molecular weight of each separated fragment, matches the bands from all

samples, based on their migration distance and finally computes similarity and

distance matrices which are then used to generate the phylogenetic trees(Pavel &

Vasile 2012). The results of the phylogenetic trees constructed for DGGE Analysis are

presented in the following chapter.

2.3.6 Enzyme Assays

Besides identifying the bacterial community associated to Trachyphyllia geoffroyi,

Euphyllia ancora and Corallimorphs sp. it is important to know about their enzymatic

properties too to further understand the roles they might play while harbouring the

coral hosts’ mucus layer. Therefore, enzymatic assays were carried out to test for the

presence of amylase, caseinase, phospholipase and gelatinase enzymes in bacterial

isolates of Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.

2.3.6.1 Amylase Activity

Overnight bacterial isolates were inoculated in corn starch–agarose: 1% (w/v) agarose,

50 mM Tris-HCl pH 6.8, 1 mM CaCl2, and 0.5% (w/v) corn starch (Alves et al. 2014).

After incubation at room temperature for 5 days, the culture plates were flooded with

2% iodine solution to colorize the remaining starch, and the amylase-producing

isolates showed a clear halo (Alves et al. 2014). Example of a positive amylase activity

is shown below in Figure XVI:

P a g e | 48

Figure XVI: Example bacterial isolates showing positive amylase activity (zig-zag clear

halo zone).

2.3.6.2 Caseinase Activity

Skimmed milk agar plates were prepare with double strength TNA mixed with an equal

volume of 4% (w/v) sterile (115°C for 10 min) skimmed milk (Oxoid) (Austin et al.

2005). Pure bacterial isolates were inoculated onto the skimmed milk agar plates and

incubated at room temperature (27°C) for up to 5 days. Example of a positive response

was recorded as the presence of clear zones around the bacterial colonies (Figure

XVII).

P a g e | 49

Figure XVII: Example bacterial isolates showing positive caseinase activity (clear zones).

2.3.6.3 Phospholipase Activity

Overnight bacterial cultures were inoculated onto TNA supplemented with either 1%

(v/v) egg yolk emulsion (Oxoid) or 1% (w/v) Tween 80 (GibcoBRL; Life Sciences) for the

determination of phospholipase and lipase activity (Liuxy, Lee & Chen 1996). The

cultures were incubated in the agar at room temperature (27°C) for 7 days. A positive

P a g e | 50

response was recorded as the development of opalescence around the bacterial

growth (Figure XVIII).

Figure XVIII: Example bacterial isolates showing positive phospholipase activity

(opalescence around the bacterial growth).

2.3.6.4 Gelatinase Acitivity

For gelatinase activity, pure bacteria cultures were inoculated on TNA agar which are

supplemented with 0.5% (w/v) gelatin (Oxoid)(Loghothetis & Austin 1996). Saturated

ammonium sulfate solution was poured over the plates after incubation at room

P a g e | 51

temperature (27°C) for 7 day. A a positive response is recorded where there is the

presence of zones of clearing around the colonies (Figure XIX).

Figure XIX: Example bacterial isolates showing positive gelatinase activity (clear zones).

Testing the ability of coral-associated bacteria abilities to produce enzyme is vital as

some enzymes produce by marine bacteria such as amylase and proteases are useful

to produce industrial enzymes (Alves et al. 2014). Enzymes such as amylase and

proteases are widely used for the manufacturing of pharmaceuticals, foods, beverages,

confectioneries and even for waste water treatment (Alves et al. 2014). Results

P a g e | 52

presented in Tables I, J and K are the bacteria isolates that produced positive results to

the enzyme assays. However, some of the bacteria were not identified due to failure in

sequencing of the 16S rRNA genes.

Bacteriophage assay was also conducted on selected potential coral pathogens derived

from the three corals. This assay is to find a suitable environmental friendly way to

inhibit the growth of coral pathogen to save the corals’ health from declining. Six (6)

bacterial strains which are potential pathogens (see chapter 5) derived from

Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. were tested for phage

sensitivity via plaque assay.

2.3.7 Screening and Isolation of Bacteriophages

The extraction of marine bacteriophages began with concentrating the marine phages

in the seawater via the Fe-Virus Concentration Method. This method benefits in terms

of cost, reliability add recovery efficiency if compared to other method such as

Centramate Tangential Flow FilterTFF (John et al. 2011). Therefore, it has been chosen

to be implied in this research work. According to John et. al. (2011), TFF-set up will cost

up to 10 thousand dollars while FeCl2 method only cost above a few hundred dollars.

Figure XX shows the experiment done to prove the efficiency of virus recovery is higher

when using FeCl3 flocculation method compared to TFF.

P a g e | 53

Figure XX: Comparison of TFF and FeCl3 flocculation methods and the results of the

concentration efficiency via viral fraction (< 022µM filtrate) seawater .

The recovery of the virus is based on virus counts by epifluorescence microscopy

(retrieved from . John, 2011). However, this method did not yield any positive result as

there was no phage DNA detected after the filtration process.

Bacteriophages utilised for this experiment were kindly provided by Associate

Professor Dr. Peter Morin Nissom of Swinburne University of Technology, Sarawak. The

phages were isolated as described in Tang and Ong (2013). In summary, the

bacteriophages were isolated from soil samples collected from a chicken farm in

Kuching, Sarawak, Malaysia. 5 g of soil sample were inoculated into 20 mL of Muller

Hinton Broth (HI-Media) and inoculated with a variety of test (host) bacteria. The

cultures were shaken at 150 rpm and incubated at 37⁰C for 18 hours. Five (5) ml of the

cultures were then transferred to sterile 15 ml falcon tube and centrifuged at 13,400

rpm, 4⁰C, for 30 minutes. The supernatant was filtered to remove sediments through

0.22 μm filters and used as phage lysate. The function of the 0.22 μm filter membrane

is to filter the liquid by removing microorganisms in the samples.

In order to detect the phages isolated, spot test method was applied to screen for the

presence of lytic phage activity. After bacterial lysis was observed, the solution was

centrifuged and the supernatant containing phage particles was filtered through 0.22-

μm filter membranes and used as the phage suspension. The phages were further

purified by soft agar method so as to ensure the homogeneity of the phage stock. Soft

agar method or known as the Double Layer Agar technique is a technique used to

enumerate and purify the isolated phages (Santos et al. 2009). High-titer phage stocks

were prepared from the lysates by liquid infection (Sambrook, Fritsch & Maniatis

1989).

Five (5) phages were chosen at random (termed A, B, C D and E for the remainder) and

used for phage assay to investigate their potential capability to inhibit the growth of

the six (6) selected potential coral pathogens derived from Trachyphyllia geoffroyi,

Euphyllia ancora and Corallimorph sp.. Before conducting the assay, chosen potential

P a g e | 54

marine pathogens isolates cultured on marine agar and inoculated with one drop of

distilled water in replaced of bacteriophages for confirmation of plaque assay’s

accuracy (control set; see Figure XXI). All test organisms grew well without appearance

of any plaques or other growth inhibition.

Figure XXI: Experimental controls of Potential Coral Pathogen Isolates to make sure

that there is no experimental errors during phage assay experiment.

2.3.8 Whole Genome Amplification via Multiple Displacement Amplification (MDA) of

Bacteriophages

After the plaque assay, bacteriophages that successfully formed plaques on the

selected bacterial cultures were identified. Crude DNA extraction of the selected

bacteriophage samples was carried out via DNA freeze and thaw method. The selected

bacteriophages underwent whole-metagenome amplification to amplify their genomic

DNA before Sanger sequencing (Yokouchi et al. 2006). Multiple Disaplacement

Ampification is used to enrich the small and circular ssDNA genomes (Haible, Kober &

Jeske 2006), and has successfully assisted to identify many ssDNA phages and

eukaryotic viruses in the ocean. MDA can generate large amount of high quality

Vibrio azureus

Bacillus thuringiensis

Vibrio harveyi

Bacillus cereus

Bacilllus cereus

Vibrio

neoccalledonicus

Marine broth as Control

P a g e | 55

bacteriophages DNA from a small amount of phage DNA using the ϕ29 DNA

polymerase and random exonuclease-resistant primers to amplify the entire genome

(Dean et al. 2001).

Extracted DNA of selected bacteriophages were used as template for the MDA. MDA

was performed by denaturing the DNA template at 95°C for 3 minutes after mixing

with 5– 110 µM random primers, 2.5 mM dNTP and 1x reaction buffer. The

bacteriophages samples were cooled on ice and added to 900 units of ϕ29 DNA

polymerase (EPICENTRE, Madison,WI). Multiple displacement amplification reactions

were performed up to 20 hours at 30°C followed by incubation at 65°C for 10 min to

inactivate the enzyme. DNA concentrations of the MDA products were subjected to gel

electrophoresis under the following conditions: 1% agarose, 100 V, 35 minutes to

confirm the presence of the genomic DNA samples. Figure XXII shows the presence of

genomic DNA after the MDA process.

Figure XXII: The Genomic DNA bands of the bacteriophages isolated and amplified via

MDA on gel band with 1kbp DNA ladder. L1 (Lane 1) represents the 1kbp DNA ladder.

L1 L2 L3 L4 L5

P a g e | 56

L2-L5 represent the genomic DNA bands of samples bacteriophages extracted from

chicken dunk samples.

2.3.9 Sequencing Analysis For Bacteriophages Identification

Several signature genes of phages are used to study phage diversities such as primers

available for amplifying the DNA polymerase gene of T7-like podophages which are

only restricted to a subset of that particular phage group and g20 primers that target

specifically on cyanomyophages (Goldsmith et al. 2011). The presence of phoH genes

in phages that infect both herotrophic and autotrophic hosts allows the primers that

targets on that specific phoH genes have the potential to capture a wider range of

phage diversity (Goldsmith et al. 2011). For example, phoH genes are detected in a

group of phages infecting the heterotrophic bacteria such as roseophage SI01 and a

broad range of vibrio phage (Rohwer et al. 2000). Besides, another benefit of having

phoH gene as a signature gene for identifying phages diversity is this gene is not

restricted to only one morphological type of phage. These genes are discovered in the

genomes of podophages, siphophages and enterobacterial phage as well as

myophages (Goldsmith et al. 2011).The MDA products were subjected to amplification

of the g20 and the phoH genes.

2.3.9.1 g20 gene

Primers CPS 1 and CPS 8 were used to amplify g20 gene fragments from our samples.

The primers sequences were CPS1 (59-GTAG[T/A]ATTTTCTACATTGA[C/T]GTTGG-39)

designed by (Fuller et al. 1998) and CPS 8 5’-

AAATA(C/T)TT(G/A/T)CCAACA(A/T)ATGGA-3, respectively (Zhong et al. 2002). 3 µL of

extracted phageDNA were used as DNA template for PCR amplification. The reaction

mixture (total volume, 25 µL) contained 3 µL of template DNA, 1 µL each of 25 µmol of

CPS1or CPS8, 12.5 µL of MyRedtaq (Bioline) and 8.5 µL of MilliQ deionised water.

P a g e | 57

PCR amplification was carried out with thermal cycling consisted of an initial

denaturation step of 94°Cfor 3 min, followed by 35 cycles of denaturation at 94°C for

15s, annealing at 35°Cfor 15s, ramping at 0.3°C/s, and elongation at 73°C for 1 min,

with a final elongation step of 73°C for 4 min (Zhong et al. 2002). A 6µl aliquot of PCR

product was analysed by electrophoresis in a 1.5% agarose gel and stained with

ethidium bromide for 15 min. The results of the amplication are displayed in Figure

XXXVI can be seen that the amplification of expected products of 592 bp was

successful.

2.3.9.2 phoH gene

The phoH primers are based on a CLUSTALX alignment of the full-length phoH gene

from Synechococcus phage S-PM2, Prochlorococcus phages P-SSM2 and P-SSM4, and

Vibrio phage KVP40.PCR primers of vPhoHf (5_-TGCRGGWACAGGTAARACAT-3_) and

vPhoHr (5_-TCRCCRCAGAAAAYMATTTT-3_) were used to amplify a product of

approximately 420 bp (Goldsmith et al. 2011). The 25 µL reaction mixture for PCR

amplification of the phoH gene contained 12.5 µL MyRedTaq reaction buffer, 1 µL of

each 25 µM of the primers, 3 µL of the DNA templates and 8.5 µL of milliQ deionized

water.

P a g e | 58

Figure XXIII: The DNA bands of the bacteriophages isolated and amplified via PCR using

primers CPS1/8. Lane 1(L1) represents DNA ladder and L3 and L4 represents the DNA

of bacteriophages amplified.

The PCR reaction conditions were (i) 5 min of initial denaturation at 95°C; (ii) 35 cycles

of 1 min of denaturation (95°C), 1 min of annealing (53°C), and 1 min of extension

(72°C); and (iii) 10 min of final extension at 72°C (Goldsmith et al. 2011).

L1 L2 L3 L4 L5 L6 L7 L8 L9

P a g e | 59

Figure XXIV: The sDNA bands of the bacteriophages isolated and amplified via PCR

using primers vPhof . Lane 1(L1) represents 1kbp DNA ladder and L5 and L6 represents

the DNA of bacteriophages amplified.

2.3.9.3 Phylogenetic analyses

The DNA sequences were analyzed with MEGA 5 software (Kumar et al. 2008). From

All sequences were aligned at the amino acid level using CLUSTALW (using default

parameters). This is because protein-coding sequences such as phoH and g20 are more

conserved at the amino acid level than they are at the nucleotide level and thus

alignments are more accurate when conducted at the amino acid level. Genbank

analysis via MEGA 5 software, reference sequences from cultured phages were

obtained. The back-translated nucleotide sequences obtained from the amino acid

alignments were used to build the tree.

L1 L2 L3 L4 L5

P a g e | 60

CHAPTER 3

3 Diversity of the Bacterial Communities Associated to Coral

Mucus Layer

3.1 Introduction

Studies show that many coral microbes reside within or upon the coral mucus layer

which is a layer secreted onto the surface of the exposed coral tissues area (Bythell

1988; Ducklow & Mitchell 1979a). These mucus layers are suitable for microbial

growth as it has high concentration of proteins, polysaccharides and lipids (Bythell

1988; Ducklow & Mitchell 1979a) (Ducklow & Mitchell 1979b; Wild et al. 2004a).

Therefore, many researchers assumed that the mucus composition must play an

important role in shaping microbial communities (Ritchie and Smith, 2004).

Investigations on corals via molecular analysis have shown that the microbial

community associated to corals is extremely diverse in terms of species richness and

abundance (Bourne & Munn 2005b; Cooney et al. 2002; Frias-Lopez et al. 2002;

Rohwer et al. 2002). One good example is a study by Rohwer and colleagues in 2002

who managed to identify a total of 430 ribotypes from 14 coral sample in the

Carribean (Rohwer et al. 2002). The coral associated bacteria that they managed to

identify and considered the most common ranged from ɣ-Proteobacteria to α-

Proteobacteria. In addition to that, Bacillus/ Clostridium, Cytophaga-

Flavobacter/Flexibacter-Bacteroides and cyanobacteria were also found to be common

except that these groups were less dominant in the 16S DNA banks (Rohwer et al.

2002).

Generally, coral-associated bacteria are also discovered to be involved in additional

nitrogen cycling processes which includes nitrification, ammonium assimilation,

ammonification and denitrification. The members of the coral-associated microbiota

were also found to be involved in carbon and sulfur cycling (Wegley et al. 2007).

P a g e | 61

In the following we introduce the bacteria associated with the three coral mucus layers

under normal conditions, before we move to discuss changes in bacterial communities

over the course of the experiment in chapter 4.

3.1.1 Bacteria associated with Trachyphyllia geoffroyi

Based on Genbank analysis, the genus of bacteria obtained from Trachyphyllia

geoffroyi mucus layers ranged from the Vibrio sp, Bacillus sp., Pseudoalteromonas sp.

and Chromohalobacter sp. and Halophilic sp. group (see Figure XXVI for phylogenetic

tree and Table 1 in Appendix for overview of closest matches).

The dominant bacteria group in Trachyphyllia geoffroyi mucus layer comprised of the

ɤ-Proteobacteria and Firmicutes. ɤ-Proteobacteriaare commonly found as coral

associated bacteria (Kvennefors et al. 2010). Isolates linked to the ɤ -Proteobacteria

were related mostly to Vibrio species such as V. parahaemolyticus, V. communis,

V.harveyi, V. owensii, V. alginolyticus (Figure XXVI). Isolates linked to Firmicutes were

mostly related to Bacilli such as B. cereus, B. subtilis, B. anthracis, B. thuriengiensis.

In week 1 of the experiment where all the parameters were set to normal seawater

condition, there were isolates collected that showed similarities to the references

Pseudoalteromonas sp. up to >91% as well as P. piscicida and P. flaviputra (Figure

XXXIX and Table 1, Appendix). Pseudoalteromonas sp. has been reported to display

activity against the coral pathogen Vibrio shilonii (Nissimov, Rosenberg & Munn 2009).

The study by Nissimov, Rosenberg & Munn (2009) also reported that during the test on

the antimicrobial property of Pseudoalteromonas sp. on V. shilonii, there was complete

inhibition of the V. shilonii observed with stationary-phase cultures at low cell

densities. From the finding by Nissimov, Rosenberg & Munn (2009), it is likely to state

that Pseudoaltermonas sp. plays a role in protecting the coral host by producing

antibiotics and therefore, it is reasonable to have abundance of this genus found

during the beginning of the experiment (Week 1) as they act as potential beneficial

bacteria to Trachyphyllia geoffroyi that protects Trachyphyllia geoffroyi from

opportunistic pathogens. Pseudoalteromonas piscicida or originally known as

P a g e | 62

Flavobacterium piscicida (sp. nov), was also discovered as a reference strain that has

91% similarity with one of the isolates derived from Trachyphyllia geoffroyi during

week 1. This species was indicated as bacteria that is capable of killing certain fishes

when exist as pure culture in laboratory condition (Bein 1954).

P a g e | 63

Figure XXVI: 16S rRNA Phylogenetic Tree representing bacterial sequences found in

Trachyphyllia geoffroyi (Brain coral). The phylogenetic tree was generated with

P a g e | 64

distance methods, and sequence distances were estimated with the neighbour-

joining method. Bootstrap values ≥50 are shown and the scale bar represents a

difference of 0.05 substitution per site. Accession numbers for the reference

sequences are indicated.

Pseudoalteromonas piscicida is also investigated to have anti-yeast properties aside

from its virulent factor in killing certain fishes (Buck & Meyers 1966). A bacteria strain

identified as Pseudoalteromonas piscicida designated as X153, was known for its

production of a vibriostatic protein with a broad spectrum inhibition against marine

bacteria (Longeon et al. 2004). Other than that, NJ6-3-1, also related to

Pseudoalteromonas piscicida, showed antimicrobial activity against Staphylococcus

aureus (Zheng et al. 2005) by a β-carboline alkaloid. The discovery of bacteria strain

that are related to Pseudomonas piscicida in Trachyphyllia geoffroyi can be considered

normal because this species is commonly found in the marine environment (Rohwer et

al. 2001). It might be not harmful to Trachyphyllia geoffroyi’s health and play a role in

the corals defense against potential pathogens. Pseudoalteromonas flavipulchra is

classified under the pigmented species clades as it is P.flavipulchra JG1 has been

shown to produce a protein PfaP and small-molecule compounds which inhibit the

growth of Vibrio anguillarum, a pathogen which causes vibrosis (a type of fish

diseases) (Austin & Austin 2007). This JG1 strain has excellent antibacterial activated

against pathogens in marine aquaculture and is harmless to aquatic animals (Bowman

2007). This isolate could potentially also play an important role in the corals initial

defense.

In week 3 of the experiment (control experiment period), a strain with 97% similarities

to Lysinibacillus fusiformis was identified in Trachyphyllia geoffroyi mucus layer. In a

study on antibacterial activity of marine bacteria, an isolate which was phylogenetically

identical to L. sphaericus and L. fusiformis, has shown positive results in inhibiting a

selection of bacteria such as Bacillus lentus, Pseudomonas aeruginosa, Yersinia

enercolitica and Bacillus cereus. This shows that Lysinibacillus sp. has antimicrobial

P a g e | 65

properties and therefore, making it theoretically reasonable to conclude that it is

common to discover this species when Trachyphyllia geoffroyi is in healthy state as

Lysinibacillus sp. act as one of the coral’s symbionts that aids in maintaining coral’s

health. Based on the phylogenetic tree of Trachyphyllia geoffroyi in Figure XXVI, one of

the isolates collected in Week 4 has 100% similarity with the reference strain of

Chromohalobacter salexigens. This is the first study that has found bacteria related to

Chromohalobacter salexigens to be associated with scleractinian corals. It was

reported in Rodriguez-Moya et al. (2013) that C. salexigens is a natural producer of

hydroxyectoine, which is an extremolyte produced by halophiles to cope with extreme

saline environments (Rodríguez-Moya et al. 2013). This capability might aid the the

coral itself to become more resilient towards environmental changes in terms of

salinity. In another study, it has been shown that Chromohalobacter sp. possesses

antimicrobial activity against Aerobacter aerogenes (Velho-Pereira & Furtado 2012)

and might also serve as protection to the coral host.

Approximately 70% of the isolates derived from Trachyphyllia geoffroyi mucus layer

have >97% similarities with various Vibrio species. In week 1, isolates having

similarities up to >97% with reference strains V. rotiferianus and V. algonolyticus were

identified in Trachyphyllia geoffroyi mucus layer. In week 2, isolates with 99% of

similarities with V. parahaemolyticus and V. alginolyticus were discovered followed by

week 3 with also isolates that have 99% similarities with reference V. communis, V.

owensii, V. harveyi and V. parahaemolyticus were identified. It is interesting that Vibrio

sp. is dominant during this stage of the experiment as Trachyphyllia geoffroyi is still in

a healthy state because Vibrio sp. are associated with disease in corals (Rosenberg et

al. 2007) in many studies. The presence of Vibrio sp. when the coral species are

exposed to normal seawater temperature (25°C) indicate that the members of this

group form natural part of the microbial community associated to the healthy corals

too besides being classified as potential marine pathogens. This is supported by finding

from Bourne and Munn (2005) who also discovered Vibrionaceae when the selected

corals are in normal and healthy state (Bourne & Munn 2005a). According to Bourne

and Munn (2005), Vibrionaceae can exist as normal microbial residents on coral mucus

layer when the surrounding seawater condition is normal. Only when the

P a g e | 66

environmental condition changes such as increment in temperature will switch on

their virulent factors (Rosenberg & Falkovitz 2004). These will cause the occurrence of

infections and subsequently lead to bleaching or necrosis of corals (Rosenberg &

Falkovitz 2004). Vibrio sp. are said to be involved in nitrogen fixation (Kvennefors et al.

2010) (Chimetto et al. 2008a; Rincón‐Rosales et al. 2009) and also breakdown of amino

acids.

During Week 4 of the experiment where the parameters were still in constant normal

condition with temperature of 25°C, one of the strains were discovered to have 99%

similarities with Vibrio coraliilytiicus, which is a well-known marine coral pathogen

(Reshef et al. 2006b). Vibrio coraliilytiicus’ cells are Gram-negative, in non-sporing

forming rods that are motile (Ben-Haim et al. 2003). Vibrio coraliilytiicus is identified as

temperature-dependent coral pathogen in Pocillopora damicornis in the Red Sea and

Indian Ocean (Ben-Haim et al. 2003). It is very interesting that the isolate found in this

Trachyphyllia geoffroyi is similar to Vibrio coraliilytiicus as Trachyphyllia geoffroyi is still

exposed to normal seawater temperature (25°C) during its presence while Ben-Haim

et. al. (2003) stated that infection by this species will only occur when the seawater

rised up to 27°C and above as it is a temperature-dependent bacteria species. The

pathogenicity of Vibrio corallytiicus is related to their function in producing putative

toxins, also known as zinc-metalloprotease (Ben-Haim et al. 2003). This zinc-

metalloprotease compound was proven to be able to cause coral tissue damage within

18 hours at 27°C (Ben-Haim et al. 2003).The result finding in this experiment could

indicate that Vibrio corallytiicus possibly survive in non-virulent state in Trachyphyllia

geoffroyi as this isolate brought no damage to the Trachyphyllia geoffroyi’s health as

observed.

P a g e | 67

3.1.2 Bacteria associated with Euphyllia ancora.

According to the phylogenetic tree in Figure XXVII of Euphyllia ancora, it has variety of

bacterial community harbouring at the mucus layer.

There is presence of isolates related to Vibrio sp., Bacillus sp., Pseudoalteromonas sp.,

Shewanella and Photobacterium sp. (see Figure XXVII for phylogenetic tree and Table 2

in Appendix for overview of closest matches) which is relatively similar to other related

journals findings such as (Geffen & Rosenberg 2004). All these groups of bacteria are

very common in the marine environment and can be found either as residents of the

coral hosts or in the seawater column (Geffen & Rosenberg 2004).

In week 1 to week 4 of the control experiment week, approximately more than 50% of

the isolates derived in the mucus layer of Euphyllia ancora were from the family of ɤ-

Proteobacteria. Vibrio sp. was the dominant group during this duration of the

experiment This data further support the report finding that stated Vibrio core group

(V. harveyi, V. rotiferianus, V. campbellii, V.alginolyticus, V. mediterranei(= V. shilonii)

as common marine coral inhabitants as they are found abundant associated to

Brazilian coral Mussismilia hispida (V. meditteranei). These Vibrio core groups are said

to contribute beneficial effects to the coral host which include nitrogen fixation

(Chimetto et al. 2009), food resource(Shashar et al. 1994), chitin decomposition and

production of antibiotics (Chimetto et al. 2009). Several isolates were related to V.

parahaemolyticus which is a gram-negative, halophilic bacteria that occurs naturally in

the marine environment (DePaola et al. 2003). Higher densities of V. parahaemolyticus

are often associated with an increment of seawater temperatures (DePaola et al. 2003)

as they are known for their pathogenicity role on coral hosts. V. parahaemolyticus

produces a thermostable direct hemolysin (TDH), which is the product of tdh gene

(Nishibuchi & Kaper 1995). Based on Nishibuchi & Kaper (1995), V. parahaemolyticus

are normally classified as coral pathogen due to their virulence factor which did not

correlate with our data finding which has discovered this pathogen when Euphyllia

ancora was still in healthy state. However, there is also a report that can explain our

data finding in terms of occurrence of V. parahaemolyticus which is that Vibrio sp. can

generally appear as a considerable fraction of the microbiota of coral species (with

P a g e | 68

counts of up to 107 cells ml-1 of coral mucus), in both healthy (Koren & Rosenberg

2006) and diseased specimens (Chimetto et al. 2009) (Kooperman et al. 2007).

P a g e | 69

P a g e | 70

Figure XXVII: 16S rRNA Phylogenetic Tree representing bacterial sequences found in

Euphyllia ancora (Hammer coral).The phylogenetic tree was generated with distance

methods, and sequence distances were estimated with the neighbour-joining method.

Bootstrap values ≥50 are shown and the scale bar represents a difference of 0.05

substitution per site. Accession numbers for the reference sequences are indicated.

There is also isolated that is 99% similar of 1432 bp to the reference strain of V.

proteolyticus during week 1 of the experiment which are associated to Euphyllia

ancora. Based on a report that detected two of their coral-bacteria isolates are 99%

similar to V. proteolyticus, this report has identified that V. proteolyticus which in the

report is associated to Oculina patagonica, showed high protease activity which

suggest that they could utilize the high protein available in the coral mucus (Sharon &

Rosenberg 2008). Other than that, V. proteolyticus were also tested to be able to carry

out nitrogen fixing process (Sharon & Rosenberg 2008) which could explain the

presence of this bacteria species in Euphyllia ancora during the early experimental

week as they could serve as the coral symbionts that contribute in nitrogen fixation for

Euphyllia ancora health maintenance (Sharon & Rosenberg 2008).

In week 3 and 4of the experiment, one of the isolates were sequenced and found to

have 99% similarities with the reference species of Vibrio shilonii or better known as V.

shilonii. And another was found to be 97% similar to V. mediterranei which is also

regarded as phylogenetically related to V. shilonii (Chimetto et al. 2009). Kushmaro

and colleagues were the first to discover about V. shilonii as the causative agent that

caused the infection and bleaching of O. patagonica sp. (Kushmaro et al. 1996;

Kushmaro et al. 1997). The infection by V. shilonii is temperature dependent as it does

not occur at 16-20°C and only stimulated when the temperature is above 25°C

(Kushmaro et al. 1998). V. shilonii only infects the coral species at high temperature

condition which it will adhere to the β-galactoside receptor of the coral surface and

also only on corals that possesses photosynthetically active zooxanthellae (Ben‐Haim

et al. 1999). When V. shilonii successfully enters the coral host’s tissue, this coral

pathogen itself will multiply and produce extracellular protein toxin that blocks

P a g e | 71

photosynthesis and results in the bleaching and lysing of the zooxanthellae (Banin et

al. 2001a; Banin et al. 2000a; Banin et al. 2001b). Since Kushmaro et. al. (1996) has

acknowleged and identified V. shilonii as a coral pathogen, it is interesting that the

isolate collected when Euphyllia ancora is still in healthy state is closely related to V.

shilonii. Another interesting finding about V.shilonii presence in the coral of O.

patagonica is that its presence was no longer detected during the annual bleaching

event in year 2005 (Ainsworth et al. 2007). V. shilonii is reported to still adhere to the

O. patagonica tissue but its population in the coral slowly decline and eventually no

longer present in the coral host. One possible explanation to this incident is based on

the Coral Probiotic Hypotheses proposed by (Reshef et al. 2006a) and developed by

(Rosenberg & Falkovitz 2004). This hypothesis proposed that the abundance and types

of microorganisms associated to the coral species will change in response to

environmental changes such as temperature in order to adapt to the new condition for

survival purpose. In a study, Pseudoalteromonas sp. is known for being the strongest

inhibitor to a coral pathogen, Vibrio shilonii (Nissimov, Rosenberg & Munn 2009;

Rosenberg et al. 1999). Vibrio shilonii were first discovered during week 3 of the

experiment but its presence was not detected on the following week (week 4). Based

on the experimental result from NIssimov et. al. (2009) which Pseudoaltermonas sp.

was found to inhibit the growth of Vibrio shilonii, it is theoretically reasonable to

speculate that one of the isolates found in Week 4 which has 97% similarity with

reference strain of Pseudoalteromonas rubra has inhibited the growth of V. shilonii

found previously resulting to the absence of Vibrio shilonii in Euphyllia ancora This

statement supports the concept of probiotic effect on microbial communities that are

related with the coral holobiont.

Isolates that are 97% similar to the reference strain of Photobacterium rosenbergii and

97% similar to Photobacterium rubra were also discovered associated to Euphyllia

ancora. Although there is study that discovered P. rosenbergii isolated from mucus and

surrounding bleached corals, researchers stated that there was no evidence that that

particular species exhibits any pathogenic characteristic (Austin et al. 2005; Munn,

Marchant & Moody 2008b). Moreover, in a study which investigates superoxide

P a g e | 72

dismutase activity of Photobacterium rosenbergii, the result shows that P. rosenbergii

has the highest activity observed among other tested species such as Vibrio

corallyliiticus which means it contains high amount of SOD enzyme that responsible to

break down oxygen obtained to superoxide (O2-) radical and hydrogen peroxide (H2O2).

In addition, the study also revealed that the tested P. rosenbergii shows very low levels

of catalase which is an enzyme responsible in breaking down hydrogen peroxide (H202)

(Munn, Marchant & Moody 2008a). Therefore, the tested P. rosenbergii strain is very

sensitive to even an extremely low level of H2O2. Judging from this study, P.rosenbergii

could be classify under the non-pathogenic bacteria that are associated to Euphyllia

ancora and that would be the reason why this strain existed when the coral host is still

in healthy state during normal control experimental weeks. Also, Photobacterium

mandapamensis which is a type of Photobacterium sp. was classified as commensal

bacteria for the coral Acopora palmata (Krediet et al. 2009; Ritchie 2006). Hence, it

could be possible that Photobacterium sp. is coral-associated commensal bacteria that

bring no threat to coral species.

During week 2 to week 4, a few isolates collected from Euphyllia ancora also have

similarity with the genus of Bacillus sp. such as B.cereus with 100% similarity and

Lysinibacillus fusiformis with 99% similarity as well as Bacillus firmus with (100%). The

Bacillus sp. genus is well-known to produce lipoproteins, phenolic derivatives, aromatic

acids, acetyl-amino acids (amino acid analogues), peptides (Gebhardt et al. 2002),

isocoumarin antibiotics (Pinchuk et al. 2002) and bacteriocin like substances (Bizani &

Brandelli 2002) which classified this genus as having a broad antibiotic spectrum. In a

study conducted to investigate potential marine bacteria that can act as a source of

anti-biofilm agents against Pseudomonas aeruginosa, strains with >99% similarities to

B.cereus and B. arseniscus were identified as showing antibiofilm activity (Itoh et al.

1981). Therefore, it is reasonable for us to find Bacillus sp during the beginning of the

experiment where Euphyllia ancora is exposed to normal parameter condition with

temperature of 25°C as this species will serve as symbiotic bacteria that contribute in

defending Euphyllia ancora from any harmful pathogens via their ability in producing

antimicrobial properties. The presence of strains similar to the reference strains of

P a g e | 73

Bacillus sp. could possibly inhibit the growth of harmful bacteria such as P. aeruginosa

from invading Euphyllia ancora.

P a g e | 74

3.1.3 Bacteria associated with Corallimorphs sp.

As for Mushroom coral, there is also variety of bacterial community in reference to the

Vibrio sp., Photobacterium sp., Pseudoalteromonas sp., Chlomahalobacter sp. and

Bacillus sp. and this findings can be correlated with the data in other journal that is

related to coral bacteria biodiversity (Geffen & Rosenberg 2004). For Corallimorphs sp.,

based on the references bacteria from Genbank analysis, when the corals were

exposed to 25°C (normal temperature), α-Proteobacteria such as V. parahaemolyticus,

V. alginolyticus, V. owensii and V. harveyi dominated the coral mucus layer (see Figure

XXVIII for phylogenetic tree and Table 3 in Appendix for overview of closest matches).

Approximately 85% of the isolates associated to Corallimorphs sp. were discovered

during the first four weeks of the experiment were phylogenetically related to Vibrio

sp.. There was little diversity discovered associated to Corallimophs sp. One isolate is

found 99% similar to Lysinibacillus fusiformis and another one is 95% similar to

Photobacterium leiognathi. Presence of Lysinibacillus fusiformis is considered not

unusual as this species has been associated to antibiotic production (Pinchuk et al.

2002) for maintenance of coral host’s health as discussed in Trachyphyllia geoffroyi

phylogenetic studies. As for Photobacterium leiognathi, this species is also known as

coral-associated commensal bacteria (Krediet et al. 2009; Ritchie 2006).

Among the Vibrio sp. discovered associated to Corallimophs sp. during the control

experiment weeks were isolates related to V. rotiferianus, V harveyi, V. alginolyticus, V.

parahaemolyticus, V. azureus and V, owensii. Since these Vibrio sp. are categorised

under the Vibrio core group, it has the same observation as the investigation of

bacteria community associated to the Brazilian coral Mussismilia hispida which also

stated the dominance of Vibrio sp. even when the coral host was in healthy state

(Chimetto et al. 2009). Since during the presence of these Vibrio sp. the health

condition of Corallimorphs sp. is favourable, we can conclude that these Vibrio sp. are

in a non-virulent state for the beginning of the experiment despite their abundance.

P a g e | 75

P a g e | 76

Figure XXVIII: 16S rRNA Phylogenetic Tree representing bacterial sequences found in

Corallimorphs sp. (Mushroom coral).The phylogenetic tree was generated with

distance methods, and sequence distances were estimated with the neighbour-joining

method. Bootstrap values ≥50 are shown and the scale bar represents a difference of

0.05 substitution per site. Accession numbers for the reference sequences are

indicated.

3.1.4 Diversity of Coral Mucus-Associated Bacteria

This study is the first report of coral mucus-associated bacteria isolated from corals

Euphyllia ancora and Trachyphyllia geoffroyi. Limited scientific papers have been

published on bacteria interactions with genus Euphyllia. Only two evaluations of

bacterial association with coral genuses Trachyphyllia and Euphyllia (Vob, Larrieu &

Wells 2013) respectively have been made but with emphasis on green fluorescent

protein and its isolation. No studies could be found on the characterisation of mucus-

associated bacteria with the host coral Trachyphyllia geofroyyi.

In addition, based on phylogenetic trees in Figure Figures XXVI, XVII and XXVIII, our

results show the first and successful isolation of an isolate related to Vibrio azureus

from the mucus of Euphyllia ancora and Corralimorphs sp.. Chimetto et al. (2011) are

the only previous study that found V. azureus to be associated with Mussismilia

hispida, which is a coral native to Brazil (Chimetto et al. 2011).

V. azureus differ from related Vibrio species in the utilization of starch and other

complex carbohydrates. Hence current research focuses on unique enzymes which can

only be isolated from this Vibrio strain. Another successful and first isolation from the

mucus of coral Trachyphyllia geofroyyi, Euphyllia ancora and Corallimorph sp. is Vibrio

communis, a novel Vibrio species isolated in 2011. In the previous study, Vibrio

communis sp. was also linked with marine corals (Chimetto et al. 2011).

Many microbes identified in the mucus layer are not only comprised of the actual

‘residents’ or mutualist of the coral hosts but they can be also the ‘visitors’ which

consist of commensal organisms that do not bring any benefit or harm to the hosts.

P a g e | 77

These microbes could also be potential opportunistic pathogens when they are

exposed to the right condition for their proliferation.

Due to the fact that diversity indices provide more information than simply the

number of species present (i.e., they account for some species being rare and others

being common), they serve as valuable tools that enable biologists to quantify diversity

in a community and describe its numerical structure.

Diversity indices were calculated by using sequence data of isolates obtained from the

coral mucus of all three corals. Isolates which showed >97% sequence similarity were

clustered into OTUs after normalization of sample sizes in order to directly compare

individual corals. Table H shows the diversity indices obtained.

Figures that are underlined and in blue font indicate the highest values of biodiversity

for Shannon Index and Smith and Wilson evenness indices methods. Both the highest

biodiversity values appear to be under Euphyllia ancora.

Table H: Indices used to quantify the diversity of 3 selected corals’ mucus layer

associated bacterial communities.

Genus Trachyphyllia

geoffroyi.

Euphyllia

ancora

Corallimorph

s sp.

Total isolates (N) 17 19 15

Total genus (S) 4 4 3

Margalef index (DMg) 10.57 11.73 10.20

Shannon index (H’) 0.66 0.95 0.62

Shannon evenness (J’) 0.82 0.34 0.46

Smith and Wilson evenness (Evar) 1.87 3.57 2.20

*Formulae of diversity indices are from(Margalef 1958; Shannon-Weaver 1963; Smith

& Wilson 1996)

P a g e | 78

Based on the indices values, it can be concluded that all three corals has approximately

similar diverse community associated to their mucus layer (DMg of Trachyphyllia

geoffroyi = 10.57, Euphyllia ancora = 11.33 and Corallimorphs sp. = 10.20). The limited

findings of species diversity for this research study could possibly be due to the choice

of coral samples as different coral samples would yield different result findings. These

three selected corals’ mucus layer associated bacteria community were never studied

by other researchers before in terms of its coral mucus layer associated bacteria

community and thus, no comparison can be made.

Differences between the diversities of the three coral samples bacterial diversity were

still evident though as the values of the Shannon Index, Shannon evenness and Smith

and Wilson evenness values are quite varied (see Table I). The calculated bacterial

indices show that diversity and evenness of the bacterial community associated to

Euphyllia ancora coral mucus layer are much higher than the Trachyphyllia geoffroyi

and Euphyllia ancora. corals (shown by the highest value for Evar and DMg in Table H.

In order to understand the mechanism of the coral-associated bacteria community in

more detail, enzyme assay have also been carried out. Corals are generally harboured

by bacteria that produce enzymes which have ability to overcome toxic effects of

reactive oxygen species (ROS) which includes superoxide dismutase (SOD) and catalase

as well as amylase and many more other enzymes that aid In coral’s and their own

survival (Munn, Marchant & Moody 2008b). These assays are important to investigate

whether the coral-associated bacteria community contains enzymes that contribute or

harm the health and survival of Trachyphyllia geoffroyi, Euphyllia ancora. and

Corallimorphs sp. The amylase assay for example was carried out to identify if coral-

associated bacteria are involved in degrading carbon sources into glucose to provide

the coral hosts with food source. Although many coral-associated bacteria function are

still not widely known, there are studies that show certain bacteria provide food

source to the coral hosts either directly or indirectly ( Environmental Protection Agency

P a g e | 79

United States 2007). Based on our results, among the total 104 isolates tested, only 12

isolates produced amylase (Table I, J and K).

Table I : Results of Corallimorphs sp. after testing for their enzyme assays

STRAIN ID Amylase Gelatinase Caseinase Phospholipa

se

MH

WK4 (1)

Unidentified YES

(STRONG)

YES NO YES

MH

WK4 (4)

Vibrio harveyi YES NO NO NO

MH

WK8 (2)

Pseudoalteromonas

prydensis

YES YES NO YES

MH

WK8 (5)

Vibrio harveyi YES NO YES NO

Bacillus subtilis is widely used to produce enzymes such as amylase, protease , inosine,

ribosides and amino acids ( Environmental Protection Agency United States, 2007). In

addition, B. subtilis also known to produce a variety of proteases and other enzymes

that enables it to degrade a variety of natural substrates and contribute to nutrient

cycling ( Environmental Protection Agency United States, 2007). From the data finding

regarding Bacillus subtilis, we know that Bacillus sp. contains amylase that will function

in degrading carbon sources such as starch into glucose. A bacterium identified

associated with Trachyphyllia geoffroyi as Bacillus cereus via phylogenetic analysis was

found to have positive result when tested for amylase assay. Hence, the result data

correlates with the journal that also stated Bacillus sp. possesses amylase. This Bacillus

sp. strain discovered during Week 8 of the experiment in Trachyphyllia geoffroyi could

be contributing in supplying Trachyphyllia geoffroyi with food sources (glucose) for the

P a g e | 80

coral host survival. However, this isolate does not show any positive results for other

enzyme assays tested in this study.

Table J: Results of Euphyllia ancora after testing for their enzyme assays


se

HM

WK4 (3)

Unidentified YES NO NO NO

HM

WK4 (5)

Pseudoalteromas

rubra

YES

(WEAK)

NO NO NO

HM

WK4 (6)

Unidentified YES

(WEAK)

NO NO YES

HM

WK8 (1)

Unidentified YES

(WEAK)

NO NO NO

HM

WK8 (5)

Unidentified YES

(STRONG)

NO NO NO

HM

WK8 (8)

Unidentified NO NO YES NO

Other than Bacillus cereus, isolates with phylogenetic similarity with Chromahalobacter

salaxigens were also discovered to yield positive result when tested with amylase

assay. This result showed that C. salaxigens play a role in contributing food sources by

breaking down carbon sources to glucose for Trachyphyllia geoffroyi survival.

However, the data finding did not correlate with an article (Arahal et al. 2001) which

discovered that C. salaxigen is catalase- positive, oxidase-negative, caseinase-positive

P a g e | 81

and amylase negative (does not hydrolysed starch into glucose) (Arahal et al. 2001).

Based on our result finding, C. salaxigens found in Trachyphyllia geoffroyi was found to

be casein-negative. It was only found to be amylase-positive while the other enzyme

assays tested results were negative.

Table K: Results Trachyphyllia geoffroyi after testing for their enzyme assays


se

BR WK4

(1)

Chromahalobacter

salaxigens

YES

(WEAK)

NO NO NO

BR WK4

(2)

Unidentified NO NO NO NO

BR WK4

(3)

Unidentified YES YES NO YES

BR WK8

(3)


BR WK8

(4)

Bacillus cereus YES NO NO NO

BR WK8

(6)


For isolates discovered in Euphyllia ancora mucus layer, identified isolate strain which

is the Pseudoalteromonas rubra found in Euphyllia ancora during Week 4 (control

experimental week) only shows positive result for amylase assay. The rest of the

enzyme assay tested was negative. Based on a study that stated Pseudoalteromonas

P a g e | 82

sp. utilized glucose oxidatively and hydrolysed starch (Lee et al. 2010), it is reasonable

to conclude that Pseudoalteromonas sp. plays a role in degrading carbon sources to

glucose for coral host’s growth and maintenance. Besides being amylase-positive,

Pseudoalteromonas sp. strain discovered to be associated with Corallimorphs sp. is

also found to be gelatinase and phospholipase positive. However, it is not caseinase

positive in this study. This result correlated well with Lee et. al. (2010) as they also

stated that the Pseudoalteromonas sp. strain tested appeared to be gelatinase and

lipase positive while catalase was negative. Gelatinase enzyme found in

Pseudoalteromonas sp. plays an important role as proteolytic enzyme that hydrolysed

gelatin into its sub-compound such as polypeptides, peptides and amino acids so that

the compounds can cross the cell membrane and be utilized by itself and also

Trachyphyllia geoffroyi for growth and maintenance (Lee et al. 2010). As for

phospholipase enzyme, Pseudoalteromonas sp. would utilize them to hydrolysed

phospholipids intro fatty acids and other lipophilic substances. A novel extracellular

phospholipase C was discovered from a marine bacterium, Pseudoalteromonas sp.

J937 (Mo, Kim & Cho 2009), which showed the potential of Pseudoalteromonas sp. in

secreting phospholipase enzyme. Generally, coral mucus layer consists of polymers of

mixed origin (Krediet et al. 2009) and glycoprotein is the major component for soft and

hard corals (Meikle, Richards & Yellowlees 1987, 1988; Molchanova et al. 1985). One

of the components in glycoproteins are lipids (Krediet et al. 2009). Therefore,

Pseudoalteromonas sp. could secrete phospholipase enzymes which will contribute in

breaking phospholipids down into smaller units which is used by Trachyphyllia

geoffroyi to construct its mucus layer.

Another isolate discovered to be amylase-positive and caseinase-positive was an

isolate related to Vibrio harveyi. However, this isolate yielded negative result for

enzyme assays for gelatinase and phospholipase. This isolate was discovered in week 8

of the experiment where temperature surrounding Corallimorphs sp. was high. Based

on a study on virulence of Vibrio to Artemia nauplii, the Vibrio harveyi strains tested

were able to hydrolyse glucose, produce phospholipase and gelatinase (Lee 1995). This

data finding does not correlate with our data as we did not discover positive results for

phospholipase and gelatinase assay. The differences could be due to the fact that the

P a g e | 83

Vibrio strains were obtained from different areas and therefore, exhibit different

properties.

As for isolates discovered in Corallimorphs sp., one of the isolates identified as Vibrio

harveyi (discovered during week 4 of the experiment), showed positive results for

amylase test only. Vibrio are known to be able to function as corals symbionts

(providing nutrients for coral’s survival) or opportunistic pathogens when they turn

virulent due to environmental factors (Chimetto et al. 2009). In this scenario, Vibrio

harveyi could be concluded as playing a role as coral symbiont in terms of contributing

to nutrient cycling by breaking down carbon sources into glucose for Corallimorphs sp.

There are not many studies on enzymatic properties of Vibrio sp. Some other studies

include the discovery that V. communis and is catalase and oxidase positive (Chimetto

et al. 2011) which has similar result with another paper investigating Vibrio azureus

which is also classified as oxidase-positive and catalase-positive (Yoshizawa et al.

2009). These findings could indicate that many Vibrio sp. yield similar enzymatic assay

results.

To sum up, every bacterial strain associated to the coral species are seen to have

different enzymatic properties. The enzymes produced such as amylase are important

for the coral host and the bacterial isolate itself sustainability of their growth and

health.

P a g e | 84

CHAPTER 4

4 Shift in Bacterial Communities of Coral Mucus-Associated

Bacteria

4.1 Introduction on Bacterial Communities Shifting

Reef-building corals have a narrow range of thermal tolerance, making them extremely

susceptible to temperature stress and outbreaks of coral diseases, whereby the

immunity of corals decrease (Baker, Glynn & Riegl 2008). This makes the corals more

vulnerable towards pathogens that are more virulent, especially at higher

temperatures (Goreau & Hayes 2008). The coral surface mucus layer (SML) contains a

complex microbial community that respond to such changes in the environment

(Ritchie & Smith 2004). The normal microbial flora within the SML can protect the coral

against pathogen invasion and disturbances which may have led to coral diseases

(Sutherland, Porter & Torres 2004). On average, 20-30 % of bacterial isolates

originating from coral SML possess antibacterial properties (Ritchie 2006) that may

assist the coral’s survival. Elevated seawater temperature of 1-3°C above with increase

solar irradiance can result in large scale of coral bleaching (Brown 1997; Klaus et al.

2007). Bleaching normally caused the corals to be susceptible to diseases and previous

studies have demonstrated shift in the microbial populations of diseased corals

(Cooney et al. 2002).

Generally, the chemical nature and quantity of mucus can change when corals are

exposed to environmental stresses (Ritchie & Smith 1995), which in the end changes

the coral mucus layer’s environment. Changes in the coral mucus layer will therefore

affect the survival of the coral-mucus associated bacteria. Also, the differences among

the bacterial community found among the three selected corals can be explained by

the fact that the biochemical composition of the coral mucus layer differ among

different species. Hence, it results in different populations of coral associated

microorganisms among different coral types (Ritchie & Smith 1995). Changes in

environmental conditions will alter the coral host physiology which leads to variable

microbiota. For instance, since coral mucus is an important carbon source to coral-

P a g e | 85

associated bacteria (Ferrier-Pages et al. 1998), the changes in the mucus secretion rate

and amount due to abiotic factors changes (eg. temperature and carbon dioxide

content changes) could also lead to shift in the bacteria community of the coral mucus

layer (La Barre 2011). Thurber et. al. (2009)demonstrated that elevation in seawater

temperature shifted the microbial community of Porites compressa to a more disease-

associated state which means the number of genes encoding the virulence pathways

and abundance of ribosomal sequences associated with diseased organism is greater

(Thurber et al. 2008). For most coral diseases, the growth rates and/or virulence

pathogens are temperature dependent (Alker, Smith & Kim 2001). To sum up, the

increase in seawater temperature could potentially shift the coral-associated microbial

assemblages by selecting for more pathogenic taxanomy (La Barre 2011). Infectious

diseases may be a major cause of biodiversity loss and change in bacterial species

distribution in the context of predicted climate warming (Bally & Garrabou 2007;

Harvell et al. 2002).

As discussed earlier, molecular fingerprinting methods such as DGGE and RISA are

helpful to monitor changes over time and have hence been used for this study. The

ARISA analysis showed shifting of banding patterns indicating changes in the bacterial

community when the selected corals are exposed to different environmental

conditions (Figure XXIV). According to ARISA gel results, it demonstrated that thermal

stresses and carbon dioxide content changes can result in shift in coral-associated

bacterial community which led to deteriorating coral health and mortality. Based on

Figure XXIX that shows the gel images of ARISA analysis, there are significant changes

in the bacteria community species as indicated by the positioning of the gel bands

which each of them represent the bacteria isolates’ identity. There is a clear decrease

in band numbers from week 2 to week 7 to week 9. Unfortunately, the DNA bands

were not sequenced so no species identity could be derived.

Figure XXX shows the gel results obtained from DGGE analysis. The coral mucus layers

of Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. show shifting in the

P a g e | 86

bacterial community based on the changes of the bands positioning. These DGGE band

results confirmed ARISA results and were further analyzed PyElph software.

P a g e | 87

Figure XXIX: ARISA analysis result to detect the bacteria community associated to

Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. shifting pattern.

Week 2 Week 7 Week 9

DNA TR EU CO TR EU CO TR EU CO

LEGEND

TR TRACHIPHYLLIA GEOFFROYI.

EU EUPHYLLIA ANCORA

CO CORALLIMORPHS SP.

P a g e | 88

Figure XXX: DGGE Analysis Gel Result detect the bacteria community associated to

Trachyphyllia geoffroyi, Euphyllia ancor. and Corallimorphs sp. shifting pattern.

LEGEND

TR TRACHYPHYLLIA

GEOFFROYI

EU EUPHYLLIA ANCORA

CO CORALLIMORPHS SP.

TR EU CO TR EU CO TR EU

Week 2 Week 7 Week 9

P a g e | 89

Based on the gel image of the DGGE analysis, a complete linkage agglomeration tree or

also known as furthest neighbour sorting was calculated (Figure XXX). In this method,

proposed by Sorensen (1948), the fusion of two clusters depends on the most distant

pair of objects instead of the closest (Sørensen 1948). Thus, an isolate joins a cluster

only when it is linked to the all the other isolates that are already members of the

same cluster. Two clusters can only fuse when all isolates of the first are linked to

isolates of the second and vice-versa.

Figure XXXI: Complete linkage agglomeration tree with genetic distances calculated

using PyElph software analysis tool.

According to Figure XXXI, the bacterial communities from week 2 of all three corals

(Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.) were all grouped in

the same cluster. Some was true for communities from week 7 and week 9 (CO2), thus

supporting the observed shifts in community structures (DDGE, RISA) and highlighting

P a g e | 90

the significant differences of the bacterial communties isoalted under different

conditions. The same analysis was repeated using the Unweighted Pair-Group Method

(UPGMA; Figure XLVII). It is also called the “average linkage” (Sneath & Sokal 1973) and

in this method, the lowerst distance (or highest similarity) identifies the next cluster to

be formed. This method computes the arithmetic average of the distance between a

candidate isolate and each of the cluster members between all members of two

clusters. All isolates of bacteria receive equal weights in the computation.

Figure XXXIII: UPGMA tree with genetic distances calculated using PyElph software

analysis tool.

Both methods produced the same distinction between the microbial communities.

Based on Tables L, M and N, the values of Margalef index (DMG) for all three coral

species (Trachyphyllia geoffroyi, Corallimorphs sp. and Euphyllia ancora) shows that

the values are highest on the first four weeks (Week 1-4), indicating a high biodiversity

of bacteria when the corals are exposed to normal seawater temperature of 25°C.

P a g e | 91

Table L: Indices used to quantify the diversity of Trachyphyllia geoffroyi mucus layer


Genus Week 1-4 Week 5-6 Week 7-8 Week 9

Total isolates (N) 17 9 9 1

Total genus (S) 4 3 3 1

Margalef index (DMg) 10.57 7.33 6.29 0

Shannon index (H’) 0.66 1.06 0.85 0

Shannon evenness (J’) 0.82 1.06 0.63 0

Smith and Wilson evenness (Evar) 1.87 2.47 2.71 1

*Formulae of diversity indices are from Margalef (1958), Shannon & Weaver (1963)

and Smith & Wilson (1996)

Table M: Indices used to quantify the diversity of Euphyllia ancora corals’ mucus layer





Margalef index (DMg) 11.73 5.4 8.3 6.65

Shannon index (H’) 0.95 1.00 0.56 0.56

Shannon evenness (J’) 0.34 0.56 0.20 0.20

Smith and Wilson evenness (Evar) 3.57 3.99 2.99 1.99

*Formulae of diversity indices

P a g e | 92

Table N: Indices used to quantify the diversity of Corallimorphs sp. corals’ mucus layer





Margalef index (DMg) 10.20 7.00 9.27 0

Shannon index (H’) 0.62 1.03 0.68 0

Shannon evenness (J’) 0.46 1.01 0.39 0

Smith and Wilson evenness (Evar) 2.20 2.38 1.89 1

*Formulae of diversity indices

However, it is also observed that Corallimorphs sp. and Euphyllia ancora mucus

samples’ H’, J’ and EVAR values show the same pattern as they have gradual decrease in

the EVAR values starting from Week 5-6 to Week 9. These indicate the decrease in

biodiversity of bacteria in both Corallimorphs sp. and Euphyllia ancora when their

environmental temperature starts increasing from 27°C to 30°C. All three corals

species mucus samples show increment int the EVAR values from Week 1-4 to Week 5-6

indicating the increment in the biodiversity of the bacteria group when the corals are

exposed to temperature increment from 25°C to 27°C. The H’ and J’ values for all three

corals are at the highest when the corals are exposed to 27°C (Week5-6) indicating

wide range of diversity. All three corals have the lowest amount of values for all the

indices calculated in week 9 as the diversity of bacteria decreases when the corals are

exposed to both elevated temperature and carbon dioxide content.

In the following, we discuss shifts in microbial communities associated with the mucus

layer in more detail for each coral tested.

P a g e | 93


Trachyphyllia geoffroyi


On week 5 of the experiment when Trachyphyllia geoffroyi surrounding temperature

were increased to 27°C, there were diverse groups of bacteria identified. There were

isolates that are phylogenetically identical to Bacillus sp. such as to reference strains of

Bacillus thuringiensis (99%), Lysinibacillus boronitolerans (99%) and Lysinibacillus

fusiformis (97%; Figure XXXIX and Table 1, Appendix). Lysinibacillus sp. isolates are

discovered in this stage of the experiment where it was observed that Trachyphyllia

geoffroyi started to secrete more mucus secretions. It could be possible that during

this stage which Trachyphyllia geoffroyi started to undergo thermal stress that Bacillus

sp. present are also secreting antibiotic protection to protect the coral host from

pathogenic infections. There were no papers found that stated about the virulence of

this bacteria species when they are exposed to different environmental condition

except that they turned dormant when they are exposed to extreme environment such

as heat, UV and chemicals (Abideen & Babuselvam 2014).

Besides Bacillus sp., Pseudoalteromonas sp. strains were also discovered during week 5

of the experiment in Trachyphyllia geoffroyi mucus layer. The isolates were 95%

identical with the reference strain of P. plecoglossicida in Genbank analysis. It is

common to find P.plecoglossicida from Trachyphyllia geoffroyi because there was also

study that found P. plecoglossicida is one of the bacteria-associated with the

Caribbean coral Montastraea franksi (also a scleractianian coral) (Rohwer et al. 2001).

Moreover, there were also isolates phylogenetically related to Vibrio sp. discovered

during Week 5 of the experiment that are associated to Trachyphyllia geoffroyi. The

isolates are phylogenetically similar to the reference strains of V. persian (99%) and V.

owensii (100%). Vibrio persian and V. owensii are classified under the Vibrio core group

and these strains are also abundantly found associated to the mucus layer of Brazillian

P a g e | 94

coral Musssismilia hispida and were also categorised as the dominant species

(Chimetto et al. 2009). This finding shows that it is reasonable to discover the

continuous presence of Vibrio sp. especially the core groups throughout the

experimental weeks as they are also found to be abundant in other coral species as

mentioned (Chimetto et al. 2009).


In week 8 where the coral’s surrounding temperature were elevated, one of the

isolates derived from Trachyphyllia geoffroyi has 99%similarity with the reference

strain of Bacillus subtilis. B. subtilis is generally known for possessing antagonistic

activities against numerous bacterial and also fungal pathogens (Logan 1988; Mazza

1994; Walker, Powell & Seddon 1998). Besides, this species is also known for its use as

biocontrol and probiotic agents for the treatment of different plants and animal

infections (Krebs et al. 1998). Isocoumarins compound is a type of antibiotic which was

discovered in B. subtilis and this compound exhibits specific UV absorption properties

(Kinder, Kopf & Margaretha 2000; Krohn et al. 1997; Schwebel & Margaretha 2000). To

be more specific, the antibiotic compounds found in B. subtilis are known as

amicoumacins A, B and C which belong to the Isocoumarins antibiotic family.

Amicoumacins A. B and C possess antibacterial, anti-inflammatory and anti-ulcer

activity (Itoh et al. 1981; Itoh et al. 1982). Since B. subtilis is a potential strain well-

known for producing antibiotic compounds, it is interesting that the strain similar to

this species was derived when Trachyphyllia geoffroyi is undergoing bleaching and

health deterioration as the seawater temperature was 29°C high. For theoretical

explanation, one possible reason for the occurence of B. subtilis strain during high

seawater temperature could be due to the fact that this bacteria species is trying to

secrete antibiotic compounds to kill the potential coral pathogens that will further

harm Trachyphyllia geoffroyi. Another valid explanation to explain the existing of B.

subtilis during week 8 where Trachyphyllia geoffroyi is exposed to extreme

environment (thermal stress) is that this bacterium might have produced an

endospore that allows it to endure extreme conditions of heat in the environment (

Environmental Protection Agency United States, 2007). Although this species synthesises a

P a g e | 95

variety of proteases and enzymes that contribute to nutrient cycling of the coral host,

it normally exist in a non-biologically active state which is in the spore form (Alexander

1977).Therefore, its presence in week 8 might be in an endospore form which did not

contribute in secreting any antibacterial compounds to protect the invasion of

opporturnistic pathogens which hence, making Trachyphyllia geoffroyi susceptible to

bleaching and eventually leading to mortality.

Other than B. subtilis, another strain identical to reference strain of B. cereus was also

found to be associated to Trachyphyllia geoffroyi mucus layer in week 7 and 8. Recent

studies discovered that strains of B. subtilis and B cereus are one of the common

inhabitants of the Pacific Ocean habitat (Pinchuk et al. 2002) and in fact they were also

reported to be have been detected in marine environments among other numerous

Bacillus species (Pinchuk et al. 2002).

Another strain isolated in week 8 was related to Oceanobacillus sp. with 88% of

similarity. Oceanobacillus sp. is known to be an extreme halotolerant and alkaliphilic

bacterium and it is gram positive (Lu, Nogi & Takami 2001). Its presence and potential

impact on the coral is uncertain and warrants further investigations. Its low match

percentage also indicates that it might be a novel species.

A bacteria strain related to Chromahalobacter salaxigens (99% similarity) was also

discovered in week 8. Since it is a halophilic bacteria, this bacteria is able to survive in

extreme environmental conditions which is environment with high salinity. However, it

is interesting to discover that C. salaxigens is also able to survive in high temperature.

A potential role for this isolate might be in the breakdown of amylase (see chapter

5.1).

4.2.3 Week 9 for Trachyphyllia geoffroyi

For week 11 when Trachyphyllia geoffroyi is exposed to extreme environmental

condition with increment of maximum temperature up to 29°C and approximately

P a g e | 96

2500 ppm of carbon dioxide content, an isolate was found with 99% similarity to

reference strain Vibrio communis. Vibrio communis is commonly widespread in the

marine environment and they are gram-negative bacteria and is catalase and oxidase

positive (Soto-Rodriguez et al. 2003). Since strain related to V. communis is discovered

during the elevation of both temperature and carbon dioxide concentration of

Trachyphyllia geoffroyi surrounding, this data can correlate with a report that stated

that Vibrio sp. produced a photosynthetic inhibitor when there is elevation of

temperature which allow Vibrio sp to have a conducive environment to survive and

multiply (Rosenberg & Ben-Haim 2002; Sharon & Rosenberg 2008). This data can also

explain the existence of Vibrio harveyi in week 8 of the experiment during high

temperature elevation (29°C) when there is no elevation in carbon dioxide content of

Trachyphyllia geoffroyi surrounding yet. Besides, according to V. proteolyticus, the

inhibition of Vibrio’s growth inhibition in the mucus by zooxanthellae via producing

free radicals is no longer there when the mucus layer of Trachyphylia geoffroyi is

extracted from the coral host itself and therefore, allowing the growth of Vibrio sp.

throughout the experimental weeks ( not just week 8 and above). As mentioned earlier

regarding the finding that scleractinian corals produces damicornin compound which

has antibacterial property against several marine Vibrio sp. such as the core group

inclusive of V. communis (Mydlarz, Jones & Harvell 2006), scleractinian coral’s immune

defense is also said to be supressed in terms of their production when they are

exposed to pathogenic virulent Vibrios sp.. (Choquet et al. 2003; Labreuche et al.

2006a; Labreuche et al. 2006b). This statement could be used as a logical explanation

regarding the mortality of Trachyphyllia geoffroyi once the coral is exposed to extreme

high temperature combined with high carbon dioxide content on its surrounding as

Trachyphyllia geoffroyi could have lost its ability to synthesize its immune defense due

to the presence of V. communis.

P a g e | 97


Euphyllia ancora.

It was observed that there is more diversity of bacteria species when Euphyllia ancora

is exposed to 25°C (Week1 to 4). The diversity slowly decreases as temperature rised

up to 29°C which only Bacillus sp. is found. However, the diversity of bacteria increases

again in week 8 when there are presence of both Vibrio sp. and Bacillus sp. When the

coral is exposed to both increment of temperature and CO2 content, more Vibrio sp. is

found to be dominating the Euphyllia ancora mucus layer than the Bacillus sp.


When Euphyllia ancora was exposed to increment in temperature up to 27°C, data

obtained shows one of the isolates closely related to Shewanella sp. (99%). According

to (Godwin et al. 2012), Shewanella sp. was only detected in healthy coral tissues.

Thus, it is reasonable to discover Shewanella sp. related isolates at this period of the

experiment when the coral host is still in semi-healthy state as the bleaching process

just started to occur after this phase. Supporting this, Shewanella species were only

detected during this period of the experiment and no longer presents when the

surrounding temperature was increased up to 29°C (Figure XL). Interestingly,

Shewanella-related isolates were not discovered in the other two tested corals,

Trachyphyllia geoffroyi and Corallimorphs sp., potentially pointing towards a close

relationship with Euphyllia ancora.

During week 6 of the experiment, an isolate with 99% similarity to Bacillus cereus was

isolated in Euphyllia ancora this finding is similar to Trachyphyllia geoffroyi as B.cereus

was also identified associated to Trachyphyllia geoffroyi. during Week 6 of the

experiment. Therefore, the interpretation regarding the existence of this species could

be similar as both coral hosts are of same order (scleractinians). One of the bacterial

isolates associated with an endermic marine sponge, Arenosclera brasiliensis, is

phylogenetically identical to B. cereus and based on a study investigating its

P a g e | 98

antimicrobial potential, B. cereus is said to have potential in producing antibiotic as the

strain showed inhibition against the growth of B. subtilis (Rua et al. 2014).

Many Vibrio sp. related isolates were also discovered in Euphyllia ancora mucus layer

in week 5. The isolates are mostly dominated by the Vibrio core group (V. harveyi, V.

owensii, V.alginolyticus, V. communis and V. campbelli). This data again correlates well

with the report by V. mediterranei which indicated that the Vibrio core group is

dominant in the mucus layer of Brazillian cnidarians. However, based on high Vibrio

colony counts and high proportion of different coral species in both healthy (Koren &

Rosenberg 2006) and diseased corals (Chimetto et al. 2008b; Weil, Smith & Gil-Agudelo

2006), some authors stated that high dominance of Vibrio sp. in coral mucus layer

could be an indication of an unhealthy environment (Chimetto et al. 2008a). As only

limited Bacillus sp. related strains and high abundance of Vibrio sp. were discovered

when Euphyllia ancora was exposed to higher temperatures (25 to 27°C), it could be an

indication that the environment is starting to get undesirable. Another supportive

observation would be that during this stage of the experiment, it was observed that

Euphyllia ancora started to produce less mucus secretions as it started to get more

difficult to extract Euphyllia ancora mucus for investigation purpose. One of the

isolates discovered during Week 5 is 97% similar to V. alginolyticus which is one of the

most well-known coral pathogens (Cervino et al. 2008; Chimetto et al. 2008a) and

therefore, making the interpretation more valid.


As the surrounding temperature of Euphyllia ancora rised up to 29°C, it is interesting to

discover the re-occurrence of Bacillus sp. such as isolates similar to reference strains B.

thuringiensis (99%) and B. cereus (95%). The occurrence of Bacillus sp. could be due to

their ability to produce endospores, as previously discussed under Trachyphyllia

geoffroyi. Bacillus sp. discovered could be present in order to defend Euphyllia ancora

by producing antibiotic from pathogens.

P a g e | 99

The abundance of Vibrio sp. detected declined and only one of the isolates discovered

was 95% similar to V. owensii. The decrease in the abundance of Vibrio sp. could be

due to PCR error as in less isolates were successfully been sequenced for their

identities due to laboratory errors when retrieving data. This study cannot conclusively

rule out that PCR bias may contribute to these findings of species replacements.

4.3.3 Week 9 for Euphyllia ancora

In week 9 of the experiment, Euphyllia ancora died after exposure to extreme

temperature and carbon dioxide content (29°C and approximately 2500 ppm). All the

isolates discovered during this period were phylogenetically related to Vibrio species

such as V. azureus (99%) and V. neocalledonicus (99%). There was a dramatic shift from

isolates with more Bacillus sp. related strains in week 7-8 to only Vibrio sp. related

strains in week 9. This observation is similar to a report which also showed the same

pattern of bacteria community distributions where S. pistillata and A. hyacinthus

associated bacteria switched to a community dominated by Vibrio sp. when the corals

are exposed to high temperature surroundings (Kvennefors et al. 2010). It is also

evident that various Vibrio sp. are well-known to be coral pathogens (Cervino et al.

2008; Sussman et al. 2008). A similar pattern of bacterial community shift was

observerd in Acropora millepora; from α-Proteobacteria to Vibrio sp. when the coral

host started to experience bleaching (Kvennefors et al. 2010).

P a g e | 100


Corallimorphs sp.


In week 5 and 6, isolates with 99% similarity to Lysinibacillus fusiformis were identified.

This species is well-known for their antimicrobial properties as mentioned under

Trachyphyllia geoffroyi’s coral’s sections. In the study by Abideen et. al. (2014), isolates

with phylogenetic identity similar to reference strain of Lysinibacillus fusiformis

presented a high inhibition zone against Streptococcus pneumonia which is another

evidence that this species exhibit antimicrobial properties (Abideen & Babuselvam

2014).

Pseudoalteromonas sp. genus is generally known for their antibacterial properties as

they produce a wide range of bioactive compounds (Bowman 2007). Generally,

Pseudoalteromonas sp. is found in both healthy (Kellogg 2004; Koren & Rosenberg

2006; Kushmaro et al. 1997; Nissimov, Rosenberg & Munn 2009; Wegley et al. 2004;

Wilson et al. 2005) and diseased corals(Kushmaro et al. 1996). Therefore, the presence

of isolates related to P. prydensis (99%) and 86% to P. plecoglossicida are common in

Corallimorphs. sp. There are many studies related to testing the antibacterial activity

of Pseudoalteromonas sp. against coral-related gram positive and gram negative

bacteria (Shnit-Orland, Sivan & Kushmaro 2012). However, the results on the types of

bacteria that Pseudoalteromonas sp. can inhibit differs between different studies. For

example, coral mucus layer collected from stony corals originating from Gulf of Eilat

contained isolates related to Pseudoalteromonas sp. which only inhibited gram-

positive bacteria strains (Shnit-Orland, Sivan & Kushmaro 2012). As for another study,

Pseudoalteromonas sp. was reported to only have antibacterial activity against gram-

negative bacterial strains (Nissimov, Rosenberg & Munn 2009; Shnit-Orland, Sivan &

Kushmaro 2012). For this study, we could speculate that the isolates related to

Pseudoalteromonas sp. inhibited the gram negative bacteria such as the Vibrio sp. as

according to the phylogenetic tree of Corallimorphs sp., most Vibrio sp. were no longer

present after week 5 of the experiment. In week 6, 7 and 8, there was only one isolate

P a g e | 101

found to be related to the Vibrio sp. genus. Therefore, it could be that

Pseudoalteromonas sp. had inhibited their growth during week 5 of the experiment.


There is one isolate in week 7 that is 100% identical to Lysinibacillus fusiformis. During

week 7 where the elevation of coral surrounding temperature (27°C) is already above

the normal seawater temperature (25°C), this species could form dormant endospores

as it is resistant to heat and forming dormant endospores is its natural way of surviving

in harsh conditions (Abideen & Babuselvam 2014). These spores are said to be able to

remain viable for a longer time which explains its survival around Corallimorphs’

mucus layer despite the unfavourable high surrounding temperature. As stated before,

this bacterial species possesses antimicrobial activity and no study mentioned it

turning virulent towards corals, so it can be regarded as not the causative agent for the

deteriorating health condition of Corallimorphs at this stage (week 7 and week 8).

An isolate closely related to Desulfovubrio vullgaris (100%) was also detected in the

Corallimorphs sp. mucus layer when the coral is exposed to temperature up to 29°C

and according to Schnell et.al (1996), sulphate-reducing bacteria were discovered to

be part of the microbial community that contributes to induction of black band disease

in corals (Meron et al. 2011; Schnell, Assmus & Richardson 1996). However, Arboleda

and Reichardt (2009) found that these sulfate-reducing bacteria are also present in

healthy corals. In general, all living organism require sulphur for the synthesis of

proteins and essential cofactors and therefore, sulphur compounds are usually

assimilated by microbes for the biosynthesis of amino acids such as cysteine and

methionine (Arboleda & Reichardt 2009; Wegley et al. 2007). No black band disease

was observed and we hence assume that this isolate was not harmful to the coral.

In week 8 of the experiment where Corallimorphs sp. was exposed to temperature up

to 29°C, an isolate related to Pseudoalteromonas prydensis (99% similarity) was

discovered. This is interesting as another study found that Pseudomoalteromonas sp.

P a g e | 102

wer able to survive in dead corals (Frias-Lopez et al. 2002). Therefore, it is reasonable

to discover this species during week 8 of the experiment.

One isolate that was discovered in Corallimorphs sp. mucus layer was similar to Vibrio

owensii (99%). According to an investigation in the Hawaii Reef Coral, Vibrio owensii

was found to be the main causative agent that induced the tissue loss disease which is

better known as Montipora white syndrome (MWS) in Montipora capitata (Vibrio

owensii). This finding is one good evident that Vibrio owensii is a potential coral

pathogen. Therefore, Vibrio owensii’s presence during high temperature exposure

(29°C) to Corallimorphs sp. that made the coral’s health decreased is not surprising as

they might be opportunistic pathogen that caused Corallimorphs sp.’ health to worsen

as they act as the opportunistic pathogen. Although in week 8 Corallimorphs sp. has

not undergone mortality yet, the health condition has already deteriorated (lack of

mucus secretion and some white discolouration spots on the coral tissues).

Besides the presence of isolates identical to V. owensii, isolates with similarities up to

95% with reference strains V. harveyi, were also found in week 8. It is found that Vibrio

harveyi and Vibrio alginolyticus function as nitrogen-fixing bacteria in the coral mucus

layer and they are discovered to even dominate the culturable nitrogen-fixing bacteria

of the Brazilian coral Mussismilia hispida (Klaus et al. 2007). In contrast, Vibrio harveyi

is also found to have caused vibrionic coral bleaching in the Mediterranean (Kushmaro

et. al. 2007). Vibrio harveyi sp. is only discovered in unhealthy coral host and not

discovered in healthy coral colonies (Klaus et al. 2007). This finding is contradict to our

finding as our study showed presence of isolates phylogenetically identical to V.

harveyi throughout the experiment even when Corallimorphs sp. is still in good health

condition. However, this statement regarding V. harveyi is closely related to the

unhealthy state of the coral at this point of time.

P a g e | 103

4.4.3 Week 9 for Corallimorphs sp.

When Corallimorphs sp. was exposed to high surrounding temperature and carbon

dioxide content, the only isolate discovered during this period is related to Vibrio

communis (99%). This finding is similar to Trachyphyllia geoffroyi as V. communis was

also discovered in Trachyphyllia geoffroyi during week 8 of the experiment.

Trachyphyllia geoffroyi experienced extreme health deterioration and eventually

mortality, we could speculate that Vibrio communis strains discovered within the

corals are among the potential causative agents that contribute to the deteriorating

health of Corallimorphs sp. and Trachyphyllia geoffroyi.

4.5 Conclusion Bacterial Diversity Shifts in mucus layers of

Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.

under temperature and CO2 stress

The shifting banding patterns observed using DGGE and RIASA can be correlated with

the finding by Cooney et. al. (2002) which stated that the community of coral-

associated bacteria will undergo changes in response to stress or disease (Cooney et al.

2002). Phylogenetic trees analysis also clearly indicated that there are obvious shifts in

the bacterial community when the corals are exposed to different impact of sudden

environmental changes such as the increment of temperature and carbon dioxide

content.

In general, Trachyphyllia geoffroyi and Euphyllia ancora experienced severe

deterioration of health and eventually mortalrty during the last week of the

experiment when they are exposed to extreme temperature and carbon dioxide

content. As for Corallimorphs sp., this coral also underwent health deterioration but

managed to survive after the whole experiment. Based on an investigation regarding

coral’s survival when they are exposed to extreme environmental condition, it is stated

that bleached coral reefs cannot survive very long unless conditions are changed back

to normal condition and the symbiosis between coral host and their associated

bacteria and zooxanthellae are re-established (Szmant & Gassman 1990). Therefore, it

is reasonable to conclude that in our experiment, the corals are exposed to

P a g e | 104

unfavourable environmental condition for too long and too extreme for them to

recover back to their normal health conditions. It was also observed that the mortality

rate among the corals differed. Euphyllia ancora was observed to have undergone

mortality first then followed by Trachyphyllia geoffroyi This observation could be

explained by a report that stated different species of corals showed different

sensitivity to bleaching with variation between individual colonies of the same species.

Some coral species were said to have higher resistance to bleaching and health

deterioration such as Montipora capitata and Montipora patula (Szmant & Gassman

1990). Besides, the rate of recovery of the coral hosts is also stated to be related to

bleaching sensitivity (Szmant & Gassman 1990). From here, we could conclude that

Euphyllia ancora is the most sensitive to bleaching copared to Trachyphyllia geoffroyi

and Corallimorphs sp. in terms of its rate of bleaching and mortality.

In terms of bacterial community shifts, Trachyphyllia geoffroyi, Euphyllia ancora and

Corallimorphs sp. experienced decrease in the diversity of bacteria community after

Week 4 where the surrounding temperature rose from 25 to 27°C. This data correlates

well with other findings which also show reduction in microbial group numbers

compared to when the coral hosts were in healthy states (Kooperman et al. 2007;

Pantos et al. 2003).

In this study, Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. have the

same class of bacteria that generally dominates the corals species throughout the

experimental weeks which are ɤ-Proteobacteria and Firmicutes. However, when it

comes to the classification of the bacteria species via their genus, there are differences

of isolates’ identities when compared among the three corals. This shows that coral-

associated bacteria are species specific and there was an evident study that also

observed that coral-associated bacteria are species specific regardless of their

geographical location (Rohwer et 2001, UV).

According to 16s rRNA gene sequences, for Trachyphyllia geoffroyi, 23 of the isolates

are related to ɤ-Proteobacteria while as for Euphyllia ancora coral 27 of them are also

related to the ɤ-Proteobacteria family. Corallimorphs sp. coral has 21 also in relation

P a g e | 105

with the family ɤ-Proteobacteria based on the bacteria references too. The results

show that ɤ-Proteobacteria is the dominant species for all three corals. The majority of

the isolates for all three corals are related to the Vibrio core group (Trachyphyllia

geoffroyi n= 18, Euphyllia ancora n=22 and Corallimorphs sp. n=21). This group also

appears to be dominant in other corals such as Montasstrea cavernosa from the

Caribbean (Frias-Lopez et al. 2002). According to Godwin and colleagues, based on

their culture based survey, they discovered that both healthy and Australian

Subtropical White Syndrome (ASWS) - affected Turbinaria mesenterina were

dominated by ɤ-Proteobacteria, in particular Vibrio species (Godwin et al. 2012). This

finding is also similar to our research data which shows the domination of ɤ-

Proteobacteria throughout the experiment. Shnit-Orland & Kusheuphyllmaro (2009)

also stated that Vibrio sp. associated with the coral mucus produce anti-bacterial

compounds against several pathogens, thereby protecting the coral host against

pathogens. This proves the potential of Vibrio as beneficial residential bacteria on the

coral mucus layer. This correlates with our data that shows Vibrio sp. dominance in the

Trachyphyllia geoffroyi, Euphylliaancora. and Corallimorphs sp.’ corals mucus layers

under control conditions.

The different roles played by Vibrio sp. such as coral mutualists and also coral

pathogens are due to the fact that they respond swiftly to changes in environmental

conditions. For example, when there is increase in temperature of seawater higher

than 25°C and in carbon-rich environments such as the coral mucus, the doubling time

of the Vibrio sp. growth rate may increase higher. When the corals are exposed to

stressful conditions such as high seawater temperature and high nutrient loads (high

concentration of dissolved ammonia, phosphate and organic matters), Vibrio sp. will

switch their roles to become opportunistic pathogens that will outcompete other

species present in the coral mucus (Chimetto et al. 2008a). These species will turn

virulence to the corals species to adapt with the surrounding environmental changes in

order to continue dominating and surviving in the corals. This statement explains why

there is domination of Vibrio sp. when the 3 selected corals in this study are exposed

to increment in both temperature and carbon dioxide content.

P a g e | 106

Ritchie and Smith (1995;2004) had demonstrated that Vibrio sp. population increase

during the bleaching of coral species and when the coral experience recovery, the

amount of Vibrio sp. returned to previous normal level (Ritchie & Smith 1995, 2004).

As observed on our results. Trachyphyllia geoffroyi, Euphyllia ancora and

Corallimorphs sp. did not revived back to their normal healthy state as both

Trachyphyllia geoffroyi and Euphyllia ancora experienced immediate mortality while

Corallimorphs sp. no longer secretes mucus. Therefore, the corals tested did not

manage to recover after our experiment due to too sudden and extreme

environmental impact conditions.

As observed in the phylogenetic trees in Figure XXVI, XXVII and XXVIII no

Photobacterium sp. were isolated when the selected corals are exposed to higher

seawater temperatures for all three tested coral species. Photobacterium sp. was not

found in the Trachyphyllia geoffroyi but they were discovered in both Euphyllia ancora

and Corallimorphs sp.. Photobacterium sp. is only discovered in both Hammer and

Mushroom corals when they are in the first four weeks of the control experiment

when the corals are exposed to normal condition which means they are in healthy

states at that period of time. This results correlate with other journal finding which

also stated that no Photobacterium sp. strains were isolated from any part of T.

mesenterina colonies affected by disease as these isolates only present when the coral

host is still in healthy condition(Godwin et al. 2012).

Another dominant family related to Trachyphyllia geoffroyi, Euphyllia ancora and

Corallimorphs sp. are the Firmicutes (Trachyphyllia geoffroyi n= 18, Euphyllia ancora

n=22 and Corallimorphs sp. n=21). Based on the phylogenetic results, Bacillus sp. was

found in the Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. during

Week1 to Week 4 which was during the control weeks of the experiment. It is common

to discover the presence of Bacillus sp. when the corals are still in normal state of

health condition. This is due to the fact that Bacillus sp. (Weisenborn, Brown & Meyers

1984) play important roles in producing antibiotics and also functions as UV-absorbing

bacteria that contribute to the coral’s health. According to Ravindran et. al. (2013),

majority UV-absorbing bacteria belonged to the Firmicutes family (Ravindran et al.

P a g e | 107

2013). However, it is also observed that Bacillus sp. dominates bacterial communities

in the mucus layers of Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.

during week 6 and 7.

All the three corals exhibit the same bacterial community shifting phase pattern in this

study. This domination of Bacillus sp. over Vibrio sp. in the coral mucus layer indicates

an obvious bacterial community shift. This finding did not correlate with previous

studies as normally Bacillus sp. appears as beneficial bacteria instead of potential

pathogenic species that would dominate the corals mucus layer during increase in

seawater temperature (Shnit‐Orland & Kushmaro 2009). Ritchie (2006) also stated the

opposite statement with the current finding which is that thermal stresses would

cause the increase of Vibrio sp. as these species would replace the community of

beneficial bacteria instead of other species (Ritchie 2006). When the temperature rose

further to 29°C in week 8, the diversity of the bacterial community increased back as

the coral is not only dominated by Bacillus sp. but also the Vibrio sp. Then, the shift is

followed by domination of only the Vibrio sp. when all the three corals are exposed to

both elevation in temperature (30°C) and carbon dioxide content. This pattern is again

in agreement with Ritchie et al. (2006). It seems that Bacilli living in the coral mucus try

to fight off the infection but cannot sustain their defense under more extreme

conditions.

CHAPTER 5

5.1 Potential coral pathogens and phage therapy

This study investigates the feasibility of applying bacteriophage therapy to treat the

assumed potential coral pathogens such as the Vibrios sp. and Bacillus sp. isolated in

the tested corals during an increase in temperature and carbon dioxide content of

their surroundings. The study of bacteriophage is applied here in this study in order to

seek for potential bacteriophages that can inhibit the growth of potential coral marine

pathogen as this will help to reduce the deterioration of coral’s health. The worldwide

decline of coral reefs ecosystems due to their health deterioration has brought up the

P a g e | 108

need to seek for tools and strategies to treat and control coral diseases. Antibiotics

were used as a way to treat the coral diseases but unfortunately, this method is not

applicable for long term. This is because of the general effects of antibiotic on bacteria

and the potential dangers of selection for antibiotic-resistant strains (Parisien et al.

2008). Besides, corals also do not possess an adaptive immune system (Nair et al.

2005). Therefore, another alternative should be applied instead and one of the most

suitable treatment is via phage therapy as it does not bring negative effects to the

coral hosts (Cohen et al. 2013). Bacteriophage plaque assay were carried out to

identify whether any of the selected bacteriophages samples collected from the

chicken dunk have the ability to cause plaques on the growth of the potential coral

pathogens.

5.2 Identification of potential coral pathogens

Since there is shift of bacteria community from more diverse population to only

dominating ones when temperature and carbon dioxide content increases, the isolates

that dominated the coral mucus layer in the later stages of the experiment are

expected to be potential coral pathogens. In this experiment, six (6) bacterial isolates

that are potential coral pathogens (based on analysis of experiment results and also

related journal regarding coral pathogens), were selected for the phage therapy assay.

The potential phages were isolated from chicken dunk samples and phage assay was

applied to investigate whether the potential phages can inhibit the growth of the

selected potential pathogens.

Potential coral pathogens derived from Trachyphyllia geoffroyi, Euphyllia ancora and

Corallimorphs sp. mucus layer were selected from isolates collected during Week 8

and also week 11 of the experimental period. The main reason is due to the fact that

Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. health condition only

started to show obvious deterioration and eventually mortality during week 8 of the

experiment. For Trachyphyllia geoffroyi, isolate identified as Vibrio harveyi (derived in

week 8) was selected because Vibrio sp. are well-known to be coral pathogens that

caused coral diseases (Cervino et al. 2008; Kvennefors et al. 2010; Sussman et al.

P a g e | 109

2008). It could be concluded that since V. harveyi was discovered during the period

where Trachyphyllia geoffroyi. underwent severe bleaching; V. harveyi could be the

virulent causative agent that contribute to this. Therefore, V. harveyi strain was

selected for the phage assay to see whether their growth could be inhibited by

potential bacteriophages.

Besides, Bacillus cereus strain derived from Trachyphyllia geoffroyi during week 8 was

also selected for the phage assay. This isolate was selected due to that fact that there

was more Bacillus sp. found during week 8 of the experiment in Trachyphyllia geoffroyi

compared to Vibrio sp. It is very unlikely to discover more Bacillus sp. isolates than

Vibrio sp. during elevation of temperature surrounding coral species as most studies

found that Vibrio sp. are the dominating species when there is an increase in

temperature that caused adverse health condition to coral host (Kushmaro et al. 1996;

Ritchie et al. 1994; Sharon & Rosenberg 2008). The trend of the bacterial community

shifting in this study could be considered as the first to discover higher abundance of

Bacillus sp. genus than Vibrio sp. during temperature elevation around the coral host.

Although there was no scientific journal evidence that stated that Bacillus sp. could be

virulent to coral host, it could be possible that this study is the first to discover that

Bacillus strain found in Trachyphyllia geoffroyi during week 8 is virulent to the coral

host as during its presence and dominance, Trachyphyllia geoffroyi health were

deteriorating badly.

As for Euphyllia ancora, three (3) isolates were selected for bacteriophages assay

which are derived from week 8 (temperature up to 29°C) and week 11 (temperature

29°C coupled by increment in CO2) of the experiment. Similar to Trachyphyllia

geoffroyi, there were more Bacillus sp. found in Euphyllia ancora during week 8 of the

experiment compared to Vibrio sp. therefore, Bacillus sp. could be a potential virulent

organism that contribute to the deteriorating health of Euphyllia ancora during week 8

when there is elevation in temperature up to 29°C. Vibrio azureus strain from week 11

isolated from Euphyllia ancora mucus layer were selected as Vibrio azureus is known to

be one of the V. harveyi-related species that are associated with diseased aquatic

oprganisms (Gomez-Gil et al. 2004). During its presence, Euphyllia ancora experienced

death (removal of all polyps). Therefore, based on the journal finding and also

P a g e | 110

experimental observation, V. azureus could be the potential causative agent that acted

as opportunistic pathogen which caused mortality to Euphyllia ancora. Another isolate

identified as V. neocalledonicus found in week 11 was also selected for phage assay for

similar reasons as V. azureus.

Only one isolate from Corallimorphs sp. mucus layer was selected for the phage assay

which was phylogenetically identified as Bacillus thuringiensis. This species is isolated

from Corallimorphs sp. during week 8 of the experiment where the coral host started

to experience less mucus secretion due to unfavourable environmental condition. B.

thuringiensis was selected as there were more Bacillus present compared to Vibrio sp.

during week 8 (similar to Trachyphyllia geoffroyi. and Euphyllia ancora bacterial shift

trend). Therefore, it could also be one of the potential coral pathogens that are

virulent to Corallimorphs sp.

The pathogenicity of these six (6) chosen isolates is not proven as no scientific

experimental procedures has been carried out to determine their pathogenicity factors

such as Koch postulates. Hence, there is a chance that these 6 isolates might not be

coral pathogens.

5.3 Results and Discussions for Bacteriophages Screening

Marine agar plates with selected bacterial isolates were used for phage assay. Each

isolate was analysed in duplicates for more accurate results. Each plate is divided into

5 sections with the 5 different isolated bacteriophages (labelled as A B C D E)

inoculated on top of the isolates on the plate. The isolates chosen were labelled as:

Isolate 1: Bacillus thuringiensis (derived from Corallimorphs.sp. during week 8)

Isolate 2: Vibrio harveyi (derived from Trachyphyllia geoffroyi during week 8)

Isolate 3: Vibrio azureus (derived from Euphyllia ancora during week 11)

Isolate 4: Vibrio neocalledonicus (derived from Euphyllia ancora during week 11)

Isolate 5: Bacillus cereus (derived from Trachyphyllia geoffroyi during week 8)

Isolate 6: Bacillus cereus (derived from Euphyllia ancora during week 8)

P a g e | 111

Bacteriophages that were able to form plaques on the marine agar plates inoculated

with the potential coral pathogens isolates were regarded as being able to inhibit the

growth of the isolates. The results were observed and recorded as follows:

Figure XXXIII(a): Results of Bacteriophages Plaque Assay showing the activity of phage

C and E in forming plaques on the agar plates inoculated with the selected potential

coral pathogen isolates.

P a g e | 112

Figure XXXIII (b): Results of Bacteriophages Plaque Assay showing the activity of phage

C and E in forming plaques on the agar plates inoculated with the selected potential


P a g e | 113

Figure XXXIII(c): Results of Bacteriophages Plaque Assay showing the activity of phage

B and C in forming plaques on the agar plates inoculated with the selected potential


The formation of plaques show the inhibition of the growth of the selected potential

coral pathogens isolates tested in this experiment. Based on Figures XXXIII(a), XXXIII

(b) and XXXIII(c), it is observed that bacteriophages labelled C and E yield positive

results by causing plaques against all isolates. Despite the positive results, there are

major limitations to this experiment. Plaque assay alone cannot conclude that the

potential bacteriophages that inhibited the growth of the potential coral pathogens

and the selected coral pathogens are also not certified experimentally as real coral

pathogens unless Koch’s postulates studies is applied and been satisfied (Efrony et al.

2006). Despite the limitations, intitial were highly promising and phages type C and E

were analysed further for their identifications.

P a g e | 114

Based on Figures XXIII and XXIV (methodology section), the gel results show the

success in amplifying the specific targeted genes of Phage C and E as they show clear

bands approximately of 500 to 600 bp. The results obtained show the potential of the

isolated bacteriophage to be a virus belonging to the family of cyanophages. However,

based on the BLAST result in NCBI, the reference sequence did not show any relation

to cyanophages. Instead, the reference sequence is related to the family of Inoviridae,

in particular the Enterobacterio phage M13 with phylogenetic similarity up to 96%

(accession number CP002824). Due to the complications in concentrating the viruses in

the marine water samples collected, bacteriophages isolated from other sources

(chicken dunk) were used instead. E.coli is the common host for the replication of

Enterobacterio phage M13 hand despite the high degree of host specificity; it seems to

be able to inhibit our potential coral pathogens.

It is definitely an interesting finding that both phages type C and E are closely related

to Enterobacterio phage M13 and they actually yield positive results in inhibiting the

selected potential coral pathogens growth in the phage plaque assay. There were no

studies found that shows the potential of phage M13 as potential phage that can

combat the growth of coral pathogens in the marine environment. These were only

studies related to utilizing phage M13 for technological purposes such as using it as a

viral gene delivery vehicle (Molenaar et al. 2002). Therefore, this finding could be the

first study to have identified Enterobacterio phage M13 ability in inhibiting the growth

of potential coral pathogens which are Bacillus thuringiensis, Vibrio harveyi, Vibrio

azureus, Bacillus cereus and Vibrio neocalledonicus.

P a g e | 115

CHAPTER 6

Summary and Future Work

This study has presented (i) an overview of culturable bacterial communities of corals

mucus layers obtained from 3 coral samples (ii) the shift in the bacteria community

patterns when exposed to different environmental changes such as temperature and

carbon dioxide content (iii) the role of potential bacteriophage inhibiting the growth of

the potential extracted marine pathgens.

The present study showed the complexity of the coral holobiont and its response to

changes in extreme environmental conditions. It is also found that the microbial

community associated to the coral mucus layer and the surrounding environmental

conditions determined the coral’s general health and function. Therefore, it is

important to find out possible solutions to solve the deteriorating health of the coral

reefs that are due to environmental factors. Phage therapy is one of the most

desirable methods to counter the deteriorating health of corals caused by marine

pathogens as it is not harmful. The threats to coral reefs worldwide give new urgency

to understanding the nature of the relationships between healthy corals and their

associated microbes. Characterizing these organisms and documenting their patterns

of distribution, as what had been applied here, is an essential first step.

In order to gain more insights understanding of the bacterial community shifts for this

research the DGGE gel obtained should be excised, re-amplified and re-run on the

DGGE gel to ensure correct migration and purity of the product and identified via

sequencing (Bourne & Munn 2005a). Then, the bands should be submitted for

sequencing to identify the bacterial community species in order to see the changes of

the species community throughout the experiment clearly (Bourne et al. 2008). Other

than that, bacterial communities of the corals could also be analysed via

pyrosequencing (Wegley et al. 2007). Metagenomics analysis via pyrosequencing,

provides an opportunity to describe the taxonomic components (Tyson et al. 2004),

P a g e | 116

relative abundances (Breitbart et al. 2002; Rodriguez-Brito, Rohwer & Edwards 2006)

and metabolic potential (Tringe et al. 2005) of all microbes within the coral holobiont.

Screening for secondary metabolite-producing bacteria associated with corals via 16S

rDNA approach should also be carried out. For example, polyketides and non-

ribosomal peptides are compounds widely used in pharmaceuticals, industrial agents

or agrochemicals (Silakowski et al, 2000). These compounds are biosynthesized by

large polyfunctional enzyme systems within the protein. The biosynthetic proteins are

known as polyketide synthases (PKS) and nonribosomal polypeptide sythetases (NRPS)

(Cane, 1997). Hence, to detect these two genes in the isolated bacteria cultures, PCR

screening needs to be conducted which a specific oligonucleotides primer was used to

amplify DNA non-ribosomal peptide synthetase (NRPS) and polyketide synthases (PKS)

(Radjasa OK. & Sabdono A., 2003). This is because PCR-based screening allows a rapid

evaluation of many isolates among coral-associated bacteria produced secondary

metabolites.

Bacteria isolates identified as phylogenetically similar to Vibrio sp. should be tested to

see whether they are scientifically proven as culturable nitrogen-fixing bacteria to

Trachyphyllia geoffroyi, Euphyllia ancora. and Corallimorph sp. The cultures identical to

Vibrio sp. should be cultured in nitrogen-free medium to see whether do they show

nitrogenase acitivity by means of the acetylene reduction assay (ARA) (Chimetto et. Al.,

2008).

Besides, an investigation should be carried out to determine whether or not any of the

isolated bacteria species are potentially pathogenic to coral. This can be done via

pathogenesis test. The test can be done by hatching Artemia cysts in seawater

(salinity = 32‰) at room temperature for 48 hours. The groups of nauplii were

transferred to filtered (0.22 µm) seawater into which was pipetted 1.0 ml volumes of

the overnight bacterial cultures isolated from the three selected corals, which were

incubated at room temperature in TNB or T2NB, as appropriate to achieve 106 cells

ml−1 (as deduced using an Improved Neubauer type haemocytometer slide at a

P a g e | 117

magnification of ×400 on a Carl Zeiss Axiophot light microscope) or ECP preparation

(Austin B. et. a.,2005). Then, these were incubated at room temperature, and

examined daily for the presence of dead nauplii over a 4-day period.

In addition, only surface mucus layer of Trachyphyllia geoffroyi, Euphyllia ancoraand

Corallimorph sp. samples were extracted for bacterial community analysis and in order

to understand better of the entire bacterial community of the corals, future study

should include the investigation of the corals’ tissue layer too. A study which compared

the bacteria diversity of Oculina patagonica’s mucus layer and tissue layer

demonstrated that there are differences in the diversity of the bacterial community

(Koren & Rosenberg 2006). The tissue layer of the coral host has larger bacterial

diversity compared to the mucus layer of the coral host (Koren & Rosenberg 2006). By

providing both microbial analysis investigation of the corals tissues and mucus extract,

it will help in providing a comprehensive database for future examinations of changes

in the bacterial community during bleaching events.

In a controlled experiment conducted to test the impact of increased partial pressure

of carbon dioxide (pCO2) on calcifying coral reefs organisms (Jokiel et al. 2008),

mesocosm approach was applied and it was very effective at detecting the relative

importance of various calcifying organisms in accounting for declines in reef

community calcification under acidified conditions. Jokiel and colleagues had

successfully identified groups of organisms that show a profound response to

conditions of ocean acidification. Therefore, another recommended future research

work would be conducting a mesocosm investigation where the corals are studied in

their actual habitat. This would contribute in providing a more accurate and realistic

data as the experiment will be conducted in replicate continuous flow coral reef

mesocosms flushed with unfiltered sea water and original seawater parameter such as

surrounding temperature and pH condtions.

In order to scientifically prove the pathogenicity of the bacterial isolates and their

identities as causative agents of coral bleaching, Koch’s postulates can be applied

(Bourne & Munn 2005a).

P a g e | 118

References

Abideen, S & Babuselvam, M 2014, 'Antagonistic activity of Lysinibacillus fusiformis n

139 strain isolated from marine fish Triacanthus strigilifer and genome sequence', Int.

J. Curr. Microbiol. App. Sci, vol. 3, no. 4, pp. 1066-1072.

Ainsworth, T, Fine, M, Roff, G & Hoegh-Guldberg, O 2007, 'Bacteria are not the primary

cause of bleaching in the Mediterranean coral Oculina patagonica', The ISME journal,

vol. 2, no. 1, pp. 67-73.

Ainsworth, T, Kramasky-Winter, E, Loya, Y, Hoegh-Guldberg, O & Fine, M 2007b, 'Coral

disease diagnostics: what's between a plague and a band?', Applied and environmental

microbiology, vol. 73, no. 3, pp. 981-992.

Alker, AP, Smith, GW & Kim, K 2001, 'Characterization of Aspergillus sydowii (Thom et

Church), a fungal pathogen of Caribbean sea fan corals', Hydrobiologia, vol. 460, no. 1-

3, pp. 105-111.

Alves, PDD, de Faria Siqueira, F, Facchin, S, Horta, CCR, Victória, JMN & Kalapothakis, E

2014, 'Survey of Microbial Enzymes in Soil, Water, and Plant Microenvironments', The

open microbiology journal, vol. 8, p. 25.

Antonius, A 1973, 'New observations on coral destruction in reefs,' Tenth Meeting of

the Association of Island Marine Laboratories of the Caribbean, University of Puerto

Rico (Mayaguez),

Antonius, A 1981, 'The ‘band’diseases in coral reefs,' Proc 4th Int Coral Reef Symp, 7-

14.

Arahal, DR, García, MT, Vargas, C, Cánovas, D, Nieto, JJ & Ventosa, A 2001,

'Chromohalobacter salexigens sp. nov., a moderately halophilic species that includes

P a g e | 118

Halomonas elongata DSM 3043 and ATCC 33174', International journal of systematic

and evolutionary microbiology, vol. 51, no. 4, pp. 1457-1462.

Arboleda, M & Reichardt, W 2009, 'Epizoic communities of prokaryotes on healthy and

diseased scleractinian corals in Lingayen Gulf, Philippines', Microbial ecology, vol. 57,

no. 1, pp. 117-128.

Austin, B, Austin, D, Sutherland, R, Thompson, F & Swings, J 2005, 'Pathogenicity of

vibrios to rainbow trout (Oncorhynchus mykiss, Walbaum) and Artemia nauplii',

Environ Microbiol, vol. 7, no. 9, Sep, pp. 1488-95.

Austin, B & Austin, DA 2007, Bacterial fish pathogens: disease of farmed and wild fish,

Springer.

Banin, E, Israely, T, Fine, M, Loya, Y & Rosenberg, E 2001a, 'Role of endosymbiotic

zooxanthellae and coral mucus in the adhesion of the coral‐bleaching pathogen Vibrio

shiloi to its host', FEMS Microbiology Letters, vol. 199, no. 1, pp. 33-37.

Banin, E, Israely, T, Kushmaro, A, Loya, Y, Orr, E & Rosenberg, E 2000, 'Penetration of

the Coral-Bleaching Bacterium Vibrio shiloi into Oculina patagonica', Applied and

Environmental Microbiology, vol. 66, no. 7, pp. 3031-3036.

Banin, E, Khare, SK, Naider, F & Rosenberg, E 2001b, 'Proline-Rich Peptide from the

Coral PathogenVibrio shiloi That Inhibits Photosynthesis of Zooxanthellae', Applied and

environmental microbiology, vol. 67, no. 4, pp. 1536-1541.

Bein, SJ 1954, 'A study of certain chromogenic bacteria isolated from “red tide” water

with a description of a new species', Bulletin of Marine Science, vol. 4, no. 2, pp. 110-

119.

P a g e | 118

Ben-Haim, Y, Thompson, F, Thompson, C, Cnockaert, M, Hoste, B, Swings, J &

Rosenberg, E 2003, 'Vibrio coralliilyticus sp. nov., a temperature-dependent pathogen

of the coral Pocillopora damicornis', International Journal of Systematic and

Evolutionary Microbiology, vol. 53, no. 1, pp. 309-315.

Bizani, D & Brandelli, A 2002, 'Characterization of a bacteriocin produced by a newly

isolated Bacillus sp. Strain 8 A', Journal of Applied Microbiology, vol. 93, no. 3, pp. 512-

519.

Buck, JD & Meyers, SP 1966a, 'Growth and Phosphate Requirement of Pseudomonas

Piscicida and Related Antiyeast Pseudomonads', Bulletin of Marine Science, vol. 16, no.

1, pp. 93-101.

Bak, R, Joenje, M, De Jong, I, Lambrechts, D & Nieuwland, G 1998, 'Bacterial

suspension feeding by coral reef benthic organisms', Marine Ecology Progress Series,

vol. 175, pp. 285-288.

Bally, M & Garrabou, J 2007, 'Thermodependent bacterial pathogens and mass

mortalities in temperate benthic communities: a new case of emerging disease linked

to climate change', Global Change Biology, vol. 13, no. 10, pp. 2078-2088.

Beals, M, Gross, L & Harrell, S 2000, 'Diversity indices: Shannon's H and E', The Institute

for Environmental Modelling (TIEM), University of Tennessee, USA.

Becking, LB, Kaplan, IR & Moore, D 1960, 'Limits of the natural environment in terms of

pH and oxidation-reduction potentials', The Journal of Geology, pp. 243-284.

Ben-Haim, Y, Zicherman-Keren, M & Rosenberg, E 2003, 'Temperature-regulated

bleaching and lysis of the coral Pocillopora damicornis by the novel pathogen Vibrio

coralliilyticus', Applied and Environmental Microbiology, vol. 69, no. 7, pp. 4236-4242.

P a g e | 118

Ben‐Haim, Y, Banim, E, Kushmaro, A, Loya, Y & Rosenberg, E 1999, 'Inhibition of

photosynthesis and bleaching of zooxanthellae by the coral pathogen Vibrio shiloi',


Benayahu, Y & Loya, Y 1983, 'Surface brooding in the Red Sea soft coral

Parerythropodium fulvum fulvum (Forskål, 1775)', The Biological Bulletin, vol. 165, no.

2, pp. 353-369.

Berger, WH & Parker, FL 1970, 'Diversity of planktonic foraminifera in deep-sea

sediments', Science, vol. 168, no. 3937, pp. 1345-1347.

Bochow, H & Hevesi, M 1998, 'Use of Bacillus subtilis as biocontrol agent. I. Activities

and characterization of Bacillus subtilis strains', Zeitschrift für Pflanzenkrankheiten und

Pflanzenschutz, vol. 105, no. 2, pp. 181-197.

Bijlsma, L, Ehler, C, Klein, R, Kulshrestha, S, McLean, R, Mimura, N, Nicholls, R, Nurse, L,

Nieto, HP & Stakhiv, E 1996, Cambridge University Press, Cambridge, United Kingdom

and New York, NY, USA, pp. 289-324.

Blackwood, CB, Hudleston, D, Zak, DR & Buyer, JS 2007, 'Interpreting ecological

diversity indices applied to terminal restriction fragment length polymorphism data:

insights from simulated microbial communities', Appl Environ Microbiol, vol. 73, no. 16,

Aug, pp. 5276-83.

Bonilla-Findji, O, Malits, A, Lefèvre, D, Rochelle-Newall, E, Lemée, R, Weinbauer, MG &

Gattuso, J-P 2008, 'Viral effects on bacterial respiration, production and growth

efficiency: consistent trends in the Southern Ocean and the Mediterranean Sea', Deep

Sea Research Part II: Topical Studies in Oceanography, vol. 55, no. 5, pp. 790-800.

Bourne, D 2005, 'Microbiological assessment of a disease outbreak on corals from

Magnetic Island (Great Barrier Reef, Australia)', Coral Reefs, vol. 24, no. 2, pp. 304-312.

P a g e | 118

Bourne, D, Iida, Y, Uthicke, S & Smith-Keune, C 2008, 'Changes in coral-associated

microbial communities during a bleaching event', ISME J, vol. 2, no. 4, Apr, pp. 350-63.

Bourne, DG, Garren, M, Work, TM, Rosenberg, E, Smith, GW & Harvell, CD 2009,

'Microbial disease and the coral holobiont', Trends in Microbiology, vol. 17, no. 12,

12//, pp. 554-562.

Bourne, DG & Munn, CB 2005a, 'Diversity of bacteria associated with the coral

Pocillopora damicornis from the Great Barrier Reef', Environ Microbiol, vol. 7, no. 8,

Aug, pp. 1162-74.

Bourne, DG & Munn, CB 2005b, 'Diversity of bacteria associated with the coral

Pocillopora damicornis from the Great Barrier Reef', Environmental Microbiology, vol.

7, no. 8, pp. 1162-1174.

Bowman, JP 2007, 'Bioactive compound synthetic capacity and ecological significance

of marine bacterial genus Pseudoalteromonas', Marine drugs, vol. 5, no. 4, pp. 220-

241.

Bratbak, G, Thingstad, F & Heldal, M 1994, 'Viruses and the microbial loop', Microbial

Ecology, vol. 28, no. 2, pp. 209-221.

Breitbart, M, Miyake, JH & Rohwer, F 2004, 'Global distribution of nearly identical

phage-encoded DNA sequences', FEMS Microbiol Lett, vol. 236, no. 2, Jul 15, pp. 249-

56.

Breitbart, M, Thompson, LR, Suttle, CA & Sullivan, MB 2007, 'Exploring the vast

diversity of marine viruses', OCEANOGRAPHY-WASHINGTON DC-OCEANOGRAPHY

SOCIETY-, vol. 20, no. 2, p. 135.

P a g e | 118

Brown, B 1997, 'Coral bleaching: causes and consequences', Coral reefs, vol. 16, no. 1,

pp. S129-S138.

Brown, B & Bythell, J 2005, 'Perspectives on mucus secretion in reef corals', Marine

Ecology Progress Series, vol. 296, pp. 291-309.

Brown, B & Howard, L 1985, 'Assessing the effects of “stress” on reef corals', Advances

in marine biology, vol. 22, pp. 1-63.

Buck, JD & Meyers, SP 1966, 'In vitro inhibition ofRhodotorula minuta by a variant of

the marine bacterium, Pseudomonas piscicida', Helgoländer Wissenschaftliche

Meeresuntersuchungen, vol. 13, no. 1-2, pp. 171-180.

Bythell, J 1988, 'A total nitrogen and carbon budget for the elkhorn coral Acropora

palmata (Lamarck),' Proceedings of the 6th International Coral Reef Symposium, 535-

540.

Cardinale, M, Brusetti, L, Quatrini, P, Borin, S, Puglia, AM, Rizzi, A, Zanardini, E, Sorlini,

C, Corselli, C & Daffonchio, D 2004, 'Comparison of different primer sets for use in

automated ribosomal intergenic spacer analysis of complex bacterial communities',

Applied and Environmental Microbiology, vol. 70, no. 10, pp. 6147-6156.

Carpenter, KE, Abrar, M, Aeby, G, Aronson, RB, Banks, S, Bruckner, A, Chiriboga, A,

Cortés, J, Delbeek, JC & DeVantier, L 2008, 'One-third of reef-building corals face

elevated extinction risk from climate change and local impacts', Science, vol. 321, no.

5888, pp. 560-563.

Cervino, J, Thompson, F, Gomez‐Gil, B, Lorence, E, Goreau, T, Hayes, R, Winiarski‐

Cervino, K, Smith, G, Hughen, K & Bartels, E 2008, 'The Vibrio core group induces

yellow band disease in Caribbean and Indo‐Pacific reef‐building corals', Journal of

Applied Microbiology, vol. 105, no. 5, pp. 1658-1671.

P a g e | 118

Chenard, C & Suttle, C 2008, 'Phylogenetic diversity of sequences of cyanophage

photosynthetic gene psbA in marine and freshwaters', Applied and environmental


Chimetto, LA, Brocchi, M, Gondo, M, Thompson, CC, Gomez-Gil, B & Thompson, FL

2009, 'Genomic diversity of vibrios associated with the Brazilian coral Mussismilia

hispida and its sympatric zoanthids (Palythoa caribaeorum, Palythoa variabilis and

Zoanthus solanderi)', J Appl Microbiol, vol. 106, no. 6, Jun, pp. 1818-26.

Chimetto, LA, Brocchi, M, Thompson, CC, Martins, RC, Ramos, HR & Thompson, FL

2008a, 'Vibrios dominate as culturable nitrogen-fixing bacteria of the Brazilian coral

Mussismilia hispida', Syst Appl Microbiol, vol. 31, no. 4, Sep, pp. 312-319.

Chimetto, LA, Brocchi, M, Thompson, CC, Martins, RCR, Ramos, HR & Thompson, FL

2008b, 'Vibrios dominate as culturable nitrogen-fixing bacteria of the Brazilian coral

Mussismilia hispida', Systematic and Applied Microbiology, vol. 31, no. 4, 9//, pp. 312-

319.

Chimetto, LA, Cleenwerck, I, Alves, N, Jr., Silva, BS, Brocchi, M, Willems, A, De Vos, P &

Thompson, FL 2011, 'Vibrio communis sp. nov., isolated from the marine animals

Mussismilia hispida, Phyllogorgia dilatata, Palythoa caribaeorum, Palythoa variabilis

and Litopenaeus vannamei', Int J Syst Evol Microbiol, vol. 61, no. Pt 2, Feb, pp. 362-8.

Cho, H-B, Lee, J-K & Choi, Y-K 2003, 'The genetic diversity analysis of the bacterial

community in groundwater by denaturing gradient gel electrophoresis (DGGE)',

JOURNAL OF MICROBIOLOGY-SEOUL-, vol. 41, no. 4, pp. 327-334.

P a g e | 118

Choquet, G, Soudant, P, Lambert, C, Nicolas, J-L & Paillard, C 2003, 'Reduction of

adhesion properties of Ruditapes philippinarum hemocytes exposed to Vibrio tapetis',

Diseases of aquatic organisms, vol. 57, no. 1-2, pp. 109-116.

Coffroth, M 1990, 'Mucous sheet formation on poritid corals: an evaluation of coral

mucus as a nutrient source on reefs', Marine biology, vol. 105, no. 1, pp. 39-49.

Cohen, Y, Joseph Pollock, F, Rosenberg, E & Bourne, DG 2013, 'Phage therapy

treatment of the coral pathogen Vibrio coralliilyticus', Microbiologyopen, vol. 2, no. 1,

Feb, pp. 64-74.

Cooney, RP, Pantos, O, Le Tissier, MD, Barer, MR & Bythell, JC 2002, 'Characterization

of the bacterial consortium associated with black band disease in coral using molecular

microbiological techniques', Environmental Microbiology, vol. 4, no. 7, pp. 401-413.

Correa, AM, Welsh, RM & Thurber, RLV 2012, 'Unique nucleocytoplasmic dsDNA and

+ ssRNA viruses are associated with the dinoflagellate endosymbionts of corals',

The ISME journal, vol. 7, no. 1, pp. 13-27.

Crossland, C 1987, 'In situ release of mucus and DOC-lipid from the corals Acropora

variabilis and Stylophora pistillata in different light regimes', Coral Reefs, vol. 6, no. 1,

pp. 35-42.

Danovaro, R, Luna, GM, Dell'anno, A & Pietrangeli, B 2006, 'Comparison of two

fingerprinting techniques, terminal restriction fragment length polymorphism and

automated ribosomal intergenic spacer analysis, for determination of bacterial

diversity in aquatic environments', Appl Environ Microbiol, vol. 72, no. 9, Sep, pp. 5982-

9.

P a g e | 118

Davies, PS 1984, 'The role of zooxanthellae in the nutritional energy requirements of

Pocillopora eydouxi', Coral Reefs, vol. 2, no. 4, pp. 181-186.

Deacon, E 1979, 'The role of coral mucus in reducing the wind drag over coral reefs',

Boundary-Layer Meteorology, vol. 17, no. 4, pp. 517-521.

Dean, FB, Nelson, JR, Giesler, TL & Lasken, RS 2001, 'Rapid amplification of plasmid and

phage DNA using Phi 29 DNA polymerase and multiply-primed rolling circle

amplification', Genome Res, vol. 11, no. 6, Jun, pp. 1095-9.

Denkin, SM & Nelson, DR 2004, 'Regulation of Vibrio anguillarum empA

metalloprotease expression and its role in virulence', Applied and environmental


Denner, EB, Smith, GW, Busse, H-J, Schumann, P, Narzt, T, Polson, SW, Lubitz, W &

Richardson, LL 2003, 'Aurantimonas coralicida gen. nov., sp. nov., the causative agent

of white plague type II on Caribbean scleractinian corals', International Journal of

Systematic and Evolutionary Microbiology, vol. 53, no. 4, pp. 1115-1122.

DePaola, A, Nordstrom, JL, Bowers, JC, Wells, JG & Cook, DW 2003, 'Seasonal

abundance of total and pathogenic Vibrio parahaemolyticus in Alabama oysters', Appl

Environ Microbiol, vol. 69, no. 3, Mar, pp. 1521-6.

Ding, J, Fung, F, Ng, G & Chou, L 1999, 'Novel bioactivities from a coral, Galaxea

fascicularis: DNase-like activity and apoptotic activity against a multiple-drug-resistant

leukemia cell line', Marine Biotechnology, vol. 1, no. 4, pp. 328-336.

Doney, SC, Fabry, VJ, Feely, RA & Kleypas, JA 2009, 'Ocean acidification: the other CO2

problem', Ann Rev Mar Sci, vol. 1, pp. 169-92.

P a g e | 118

Downs, CA, Woodley, CM, Richmond, RH, Lanning, LL & Owen, R 2005, 'Shifting the

paradigm of coral-reef ‘health’assessment', Marine Pollution Bulletin, vol. 51, no. 5, pp.

486-494.

Drollet, J, Glaziou, P & Martin, P 1993, 'A study of mucus from the solitary coral Fungia

fungites (Scleractinia: Fungiidae) in relation to photobiological UV adaptation', Marine

Biology, vol. 115, no. 2, pp. 263-266.

Ducklow, H 1990, 'The biomass, production and fate of bacteria in coral reefs',

Ecosystems of the world, vol. 25, pp. 265-289.

Ducklow, HW & Mitchell, R 1979a, 'Bacterial populations and adaptations in the mucus

layers on living corals', Limnol. Oceanogr.;(United States), vol. 24, no. 4

Ducklow, HW & Mitchell, R 1979b, 'Observations on naturally and artificially diseased

tropical corals: a scanning electron microscope study', Microbial ecology, vol. 5, no. 3,

pp. 215-223.

Dustan, P 1977, 'Vitality of reef coral populations off Key Largo, Florida: recruitment

and mortality', Environmental Geology, vol. 2, no. 1, pp. 51-58.

Edmunds, P & Davies, PS 1986, 'An energy budget for Porites porites (Scleractinia)',

Marine biology, vol. 92, no. 3, pp. 339-347.

Edmunds, P & Davies, PS 1989, 'An energy budget for Porites porites (Scleractinia),

growing in a stressed environment', Coral Reefs, vol. 8, no. 1, pp. 37-43.

Efrony, R, Loya, Y, Bacharach, E & Rosenberg, E 2006, 'Phage therapy of coral disease',

Coral Reefs, vol. 26, no. 1, pp. 7-13.

P a g e | 118

Ferrier-Pages, C, Gattuso, J, Cauwet, G, Jaubert, J & Allemand, D 1998, 'Release of

dissolved organic carbon and nitrogen by the zooxanthellate coral Galaxea fascicularis',

Marine Ecology Progress Series, vol. 172, pp. 265-274.

Ferris, M, Muyzer, G & Ward, D 1996, 'Denaturing gradient gel electrophoresis profiles

of 16S rRNA-defined populations inhabiting a hot spring microbial mat community',


Fine, M & Loya, Y 1995, 'The coral Oculina patagonica: a new immigrant to the

Mediterranean coast of Israel', Isr J Zool, vol. 41, p. 81.

Finkelstein, RA & Hanne, LF 1982, 'Purification and characterization of the soluble

hemagglutinin (cholera lectin)(produced by Vibrio cholerae', Infection and immunity,

vol. 36, no. 3, pp. 1199-1208.

Frias-Lopez, J, Zerkle, AL, Bonheyo, GT & Fouke, BW 2002, 'Partitioning of Bacterial

Communities between Seawater and Healthy, Black Band Diseased, and Dead Coral

Surfaces', Applied and Environmental Microbiology, vol. 68, no. 5, pp. 2214-2228.

Fuller, NJ, Wilson, WH, Joint, IR & Mann, NH 1998, 'Occurrence of a sequence in

marine cyanophages similar to that of T4 g20 and its application to PCR-based

detection and quantification techniques', Applied and Environmental Microbiology, vol.

64, no. 6, pp. 2051-2060.

Fung, FMY & Ding, JL 1998, 'A novel antitumour compound from the mucus of a coral, Galaxea fascicularis, inhibits topoisomerase I and II', Toxicon, vol. 36, no. 7, pp.

1053-1058.

Gamito, S 2010, 'Caution is needed when applying Margalef diversity index', Ecological

Indicators, vol. 10, no. 2, pp. 550-551.

P a g e | 118

Gauthier, G, Gauthier, M & Christen, R 1995, 'Phylogenetic analysis of the genera

Alteromonas, Shewanella, and Moritella using genes coding for small-subunit rRNA

sequences and division of the genus Alteromonas into two genera, Alteromonas

(emended) and Pseudoalteromonas gen. nov., and proposal of twelve new species

combinations', International journal of systematic bacteriology, vol. 45, no. 4, pp. 755-

761.

Gebhardt, K, Schimana, J, Müller, J, Fiedler, HP, Kallenborn, HG, Holzenkämpfer, M,

Krastel, P, Zeeck, A, Vater, J & Höltzel, A 2002, 'Screening for biologically active

metabolites with endosymbiotic bacilli isolated from arthropods', FEMS microbiology

letters, vol. 217, no. 2, pp. 199-205.

Geffen, Y & Rosenberg, E 2004, 'Stress-induced rapid release of antibacterials by

scleractinian corals', Marine Biology, vol. 146, no. 5, pp. 931-935.

Geffen, Y & Rosenberg, E 2005, 'Stress-induced rapid release of antibacterials by

scleractinian corals', Marine Biology, vol. 146, no. 5, 2005/04/01, pp. 931-935.

Gill, DM 1982, 'Bacterial toxins: a table of lethal amounts', Microbiological Reviews,

vol. 46, no. 1, p. 86.

Gladfelter, WB 1982, 'White-band disease in Acropora palmata: implications for the

structure and growth of shallow reefs', Bulletin of Marine Science, vol. 32, no. 2, pp.

639-643.

Glynn, P & De Weerdt, W 1991, 'Elimination of two reef-building hydrocorals following

the 1982-83 el nino warming event', Science(Washington), vol. 253, no. 5015, pp. 69-

71.

P a g e | 118

Godwin, S, Bent, E, Borneman, J & Pereg, L 2012, 'The role of coral-associated bacterial

communities in Australian Subtropical White Syndrome of Turbinaria mesenterina',

PLoS One, vol. 7, no. 9, p. e44243.

Goldberg, WM 2002, 'Feeding behavior, epidermal structure and mucus cytochemistry

of the scleractinian Mycetophyllia reesi, a coral without tentacles', Tissue and

Cell, vol. 34, no. 4, pp. 232-245.

Goldsmith, DB, Crosti, G, Dwivedi, B, McDaniel, LD, Varsani, A, Suttle, CA, Weinbauer,

MG, Sandaa, RA & Breitbart, M 2011, 'Development of phoH as a novel signature gene

for assessing marine phage diversity', Appl Environ Microbiol, vol. 77, no. 21, Nov, pp.

7730-9.

Gomez-Gil, B, Soto-Rodriguez, S, García-Gasca, A, Roque, A, Vazquez-Juarez, R,

Thompson, FL & Swings, J 2004, 'Molecular identification of Vibrio harveyi-related

isolates associated with diseased aquatic organisms', Microbiology, vol. 150, no. 6, pp.

1769-1777.

Goreau, TF & Wells, JW 1967, 'The Shallow-Water Scleractinia of Jamaica: Revised List

of Species and their Vertical Distribution Range', Bulletin of Marine Science, vol. 17, no.

2, //, pp. 442-453.

Gottfried, M & Roman, M 1983, 'Ingestion and incorporation of coral-mucus detritus

by reef zooplankton', Marine Biology, vol. 72, no. 3, pp. 211-218.

Green, EP & Bruckner, AW 2000, 'The significance of coral disease epizootiology for

coral reef conservation', Biological Conservation, vol. 96, no. 3, pp. 347-361.

Haible, D, Kober, S & Jeske, H 2006, 'Rolling circle amplification revolutionizes

diagnosis and genomics of geminiviruses', Journal of virological methods, vol. 135, no.

1, pp. 9-16.

P a g e | 118

Hall-Stoodley, L, Costerton, JW & Stoodley, P 2004, 'Bacterial biofilms: from the natural

environment to infectious diseases', Nature Reviews Microbiology, vol. 2, no. 2, pp. 95-

108.

Hanlon, GW 2007, 'Bacteriophages: an appraisal of their role in the treatment of

bacterial infections', Int J Antimicrob Agents, vol. 30, no. 2, Aug, pp. 118-28.

Harvell, CD, Mitchell, CE, Ward, JR, Altizer, S, Dobson, AP, Ostfeld, RS & Samuel, MD

2002, 'Climate warming and disease risks for terrestrial and marine biota', Science, vol.

296, no. 5576, pp. 2158-2162.

Hayes, RL & Goreau, NI 1998, 'The significance of emerging diseases in the tropical

coral reef ecosystem', Rev. Biol. Trop, vol. 46, no. Supl 5, pp. 173-185.

Hill, TC, Walsh, KA, Harris, JA & Moffett, BF 2003, 'Using ecological diversity measures

with bacterial communities', FEMS Microbiology Ecology, vol. 43, no. 1, pp. 1-11.

Hoegh-Guldberg, O, Mumby, P, Hooten, A, Steneck, R, Greenfield, P, Gomez, E, Harvell,

C, Sale, P, Edwards, A & Caldeira, K 2007, 'Coral reefs under rapid climate change and

ocean acidification', science, vol. 318, no. 5857, pp. 1737-1742.

Holmström, C, James, S, Egan, S & Kjelleberg, S 1996, 'Inhibition of common fouling

organisms by marine bacterial isolates ith special reference to the role of pigmented

bacteria', Biofouling, vol. 10, no. 1-3, pp. 251-259.

Howard, L & Brown, B 1984, 'Heavy metals and reef corals', Oceanogr. Mar. Biol. Ann.

Rev, vol. 22, pp. 195-210.

P a g e | 118

Howell, R 1982, 'The secretion of mucus by marine nematodes (Enoplus spp.): A

possible mechanism influencing the uptake and loss of heavy metal pollutants',

Nematologica, vol. 28, no. 1, pp. 110-114.

Hsieh, Y-J & Wanner, BL 2010, 'Global regulation by the seven-component P

i signaling system', Current opinion in microbiology, vol. 13, no. 2, pp. 198-203.

Isa, Y & Yamazato, K 1981, 'The ultrastructure of calicoblast and related tissues in

Acropora hebes (Dana),' Proc. 4th Int. Coral Reef Symp, 99-105.

Ishii, K & Fukui, M 2001, 'Optimization of annealing temperature to reduce bias caused

by a primer mismatch in multitemplate PCR', Applied and environmental microbiology,

vol. 67, no. 8, pp. 3753-3755.

Israely, T, Banin, E & Rosenberg, E 2001, 'Growth, differentiation and death of Vibrio

shiloi in coral tissue as a function of seawater temperature', Aquatic Microbial Ecology,

vol. 24, no. 1, pp. 1-8.

Itoh, J, Omoto, S, Shomura, T, Nishizawa, N, Miyado, S, Yuda, Y, Shibata, U & Inouye, S

1981, 'Amicoumacin-A, a new antibiotic with strong antiinflammatory and antiulcer

activity', The Journal of antibiotics, vol. 34, no. 5, p. 611.

Itoh, J, Shomura, T, Omoto, S, Miyado, S, Yuda, Y, Shibata, U & Inouye, S 1982,

'Isolation, physicochemical properties and biological activities of amicoumacins

produced by Bacillus pumilus', Agricultural and Biological Chemistry, vol. 46, no. 5, pp.

1255-1259.

Jensen, P, Harvell, C, Wirtz, K & Fenical, W 1996, 'Antimicrobial activity of extracts of

Caribbean gorgonian corals', Marine Biology, vol. 125, no. 2, pp. 411-419.

P a g e | 118

Jiang, SC & Paul, JH 1998, 'Gene transfer by transduction in the marine environment',


John, SG, Mendez, CB, Deng, L, Poulos, B, Kauffman, AK, Kern, S, Brum, J, Polz, MF,

Boyle, EA & Sullivan, MB 2011, 'A simple and efficient method for concentration of

ocean viruses by chemical flocculation', Environ Microbiol Rep, vol. 3, no. 2, Apr, pp.

195-202.

Jokiel, PL & Brown, EK 2004, 'Global warming, regional trends and inshore

environmental conditions influence coral bleaching in Hawaii', Global Change Biology,

vol. 10, no. 10, pp. 1627-1641.

Jones, RJ, Hoegh-Guldberg, O, Larkum, AWD & Schreiber, U 1998, 'Temperature-

induced bleaching of corals begins with impairment of the CO2 fixation mechanism in

zooxanthellae', Plant, Cell & Environment, vol. 21, no. 12, pp. 1219-1230.

Kushmaro, A, Loya, Y, Fine, M & Rosenberg, E 1996, 'Bacterial infection and coral

bleaching', Nature, vol. 380, no. 6573, pp. 396-396.

Kushmaro, A, Rosenberg, E, Fine, M & Loya, Y 1997, 'Bleaching of the coral Oculina

patagonica by Vibrio AK-1', Marine ecology progress series. Oldendorf, vol. 147, no. 1,

pp. 159-165.

Kellogg, CA 2004, 'Tropical Archaea: diversity associated with the surface microlayer of

corals', Marine ecology. Progress series, vol. 273, pp. 81-88.

Kelman, D, Kushmaro, A, Loya, Y, Kashman, Y & Benayahu, Y 1998, 'Antimicrobial

activity of a Red Sea soft coral, Parerythropodium fulvum fulvum: reproductive and

developmental considerations', Marine Ecology Progress Series, vol. 169, pp. 87-95.

P a g e | 118

Kinder, MA, Kopf, J & Margaretha, P 2000, 'Solid state photochemistry of isocoumarins

and isothiocoumarins', Tetrahedron, vol. 56, no. 36, pp. 6763-6767.

Klaus, JS, Janse, I, Heikoop, JM, Sanford, RA & Fouke, BW 2007, 'Coral microbial

communities, zooxanthellae and mucus along gradients of seawater depth and coastal

pollution', Environ Microbiol, vol. 9, no. 5, May, pp. 1291-305.

Koh, EG 1997, 'Do scleractinian corals engage in chemical warfare against microbes?',

Journal of Chemical Ecology, vol. 23, no. 2, pp. 379-398.

Kooperman, N, Ben-Dov, E, Kramarsky-Winter, E, Barak, Z & Kushmaro, A 2007, 'Coral

mucus-associated bacterial communities from natural and aquarium environments',

FEMS Microbiol Lett, vol. 276, no. 1, Nov, pp. 106-13.

Koren, O & Rosenberg, E 2006, 'Bacteria associated with mucus and tissues of the coral

Oculina patagonica in summer and winter', Appl Environ Microbiol, vol. 72, no. 8, Aug,

pp. 5254-9.

Krebs, B, Höding, B, Kübart, S, Workie, MA, Junge, H, Schmiedeknecht, G, Grosch, R,

Bochow, H & Hevesi, M 1998, 'Use of Bacillus subtilis as biocontrol agent. I. Activities

and characterization of Bacillus subtilis strains', Zeitschrift für Pflanzenkrankheiten und

Pflanzenschutz, vol. 105, no. 2, pp. 181-197.

Krediet, CJ, Ritchie, KB, Cohen, M, Lipp, EK, Sutherland, KP & Teplitski, M 2009,

'Utilization of mucus from the coral Acropora palmata by the pathogen Serratia

marcescens and by environmental and coral commensal bacteria', Applied and


Krohn, K, Bahramsari, R, Flörke, U, Ludewig, K, Kliche-Spory, C, Michel, A, Aust, H-J,

Draeger, S, Schulz, B & Antus, S 1997, 'Dihydroisocoumarins from fungi: isolation,

P a g e | 118

structure elucidation, circular dichroism and biological activity', Phytochemistry, vol.

45, no. 2, pp. 313-320.

Kudva, IT, Jelacic, S, Tarr, PI, Youderian, P & Hovde, CJ 1999, 'Biocontrol of Escherichia

coli O157 with O157-specific bacteriophages', Applied and environmental


Kumar, S, Nei, M, Dudley, J & Tamura, K 2008, 'MEGA: a biologist-centric software for

evolutionary analysis of DNA and protein sequences', Briefings in bioinformatics, vol. 9,

no. 4, pp. 299-306.

Kushmaro, A, Banin, E, Loya, Y, Stackebrandt, E & Rosenberg, E 2001, 'Vibrio shiloi sp.

nov., the causative agent of bleaching of the coral Oculina patagonica', International

journal of systematic and evolutionary microbiology, vol. 51, no. 4, pp. 1383-1388.

Kushmaro, A, Loya, Y, Fine, M & Rosenberg, E 1996, 'Bacterial infection and coral

bleaching', Nature, vol. 380, no. 6573, pp. 396-396.

Kushmaro, A, Rosenberg, E, Fine, M, Ben Haim, Y & Loya, Y 1998, 'Effect of

temperature on bleaching of the coral Oculina patagonica by Vibrio AK-1', Marine

Ecology Progress Series, vol. 171, pp. 131-137.

Kushmaro, A, Rosenberg, E, Fine, M & Loya, Y 1997, 'Bleaching of the coral Oculina

patagonica by Vibrio AK-1', Marine ecology progress series. Oldendorf, vol. 147, no. 1,

pp. 159-165.

Kuta, K & Richardson, L 1996, 'Abundance and distribution of black band disease on

coral reefs in the northern Florida Keys', Coral reefs, vol. 15, no. 4, pp. 219-223.

Kvennefors, ECE, Sampayo, E, Ridgway, T, Barnes, AC & Hoegh-Guldberg, O 2010,

'Bacterial communities of two ubiquitous Great Barrier Reef corals reveals both site-

P a g e | 118

and species-specificity of common bacterial associates', PloS one, vol. 5, no. 4, p.

e10401.

Labonté, JM, Reid, KE & Suttle, CA 2009, 'Phylogenetic analysis indicates evolutionary

diversity and environmental segregation of marine podovirus DNA polymerase gene

sequences', Applied and environmental microbiology, vol. 75, no. 11, pp. 3634-3640.

Labreuche, Y, Lambert, C, Soudant, P, Boulo, V, Huvet, A & Nicolas, J-L 2006a, 'Cellular

and molecular hemocyte responses of the Pacific oyster, Crassostrea gigas, following

bacterial infection with Vibrio aestuarianus strain 01/32', Microbes and Infection, vol.

8, no. 12, pp. 2715-2724.

Labreuche, Y, Soudant, P, Gonçalves, M, Lambert, C & Nicolas, J-L 2006b, 'Effects of

extracellular products from the pathogenic Vibrio aestuarianus strain 01/32 on

lethality and cellular immune responses of the oyster Crassostrea gigas,

Developmental & Comparative Immunology, vol. 30, no. 4, pp. 367-379.

Lee, K-K 1995, 'Pathogenesis studies on Vibrio alginolyticus in the grouper, Epinephelus

malabaricus, Microbial pathogenesis, vol. 19, no. 1, pp. 39-48.

Lee, SY, Oh, TK, Kim, W & Yoon, JH 2010, 'Oceanobacillus locisalsi sp. nov., isolated

from a marine solar saltern', Int J Syst Evol Microbiol, vol. 60, no. Pt 12, Dec, pp. 2758-

62.

Lenski, RE 1988, 'Dynamics of interactions between bacteria and virulent

bacteriophage', in Advances in microbial ecology, Springer, pp. 1-44.

Lesser, MP, Falcón, LI, Rodríguez-Román, A, Enríquez, S, Hoegh-Guldberg, O & Iglesias-

Prieto, R 2007, 'Nitrogen fixation by symbiotic cyanobacteria provides a source of

P a g e | 118

nitrogen for the scleractinian coral Montastraea cavernosa', Marine Ecology Progress

Series, vol. 346, pp. 143-152.

Lesser, MP, Mazel, CH, Gorbunov, MY & Falkowski, PG 2004, 'Discovery of symbiotic

nitrogen-fixing cyanobacteria in corals', Science, vol. 305, no. 5686, pp. 997-1000.

Lewis, JB 1977, 'Suspension feeding in Atlantic reef corals and the importance of

suspended particulate matter as a food source,' Proceedings of the 3rd International

Coral Reef Symposium, 405-408.

Lin, B, Wang, Z, Malanoski, AP, O'Grady, EA, Wimpee, CF, Vuddhakul, V, Alves Jr, N,

Thompson, FL, Gomez-Gil, B & Vora, GJ 2010, 'Comparative genomic analyses identify

the Vibrio harveyi genome sequenced strains BAA-1116 and HY01 as Vibrio campbellii',

Environ Microbiol Rep, vol. 2, no. 1, Feb, pp. 81-89.

Lindell, D, Jaffe, JD, Johnson, ZI, Church, GM & Chisholm, SW 2005, 'Photosynthesis

genes in marine viruses yield proteins during host infection', Nature, vol. 438, no.

7064, pp. 86-89.

Lindell, D, Sullivan, MB, Johnson, ZI, Tolonen, AC, Rohwer, F & Chisholm, SW 2004,

'Transfer of photosynthesis genes to and from Prochlorococcus viruses', Proceedings of

the National Academy of Sciences of the United States of America, vol. 101, no. 30, pp.

11013-11018.

Linley, E & Koop, K 1986, 'Significance of pelagic bacteria as a trophic resource in a

coral reef lagoon, One Tree Island, Great Barrier Reef', Marine Biology, vol. 92, no. 4,

pp. 457-464.

P a g e | 118

Liuxy, PC, Lee, KK & Chen, SN 1996, 'Pathogenicity of different isolates of Vibrio harveyi

in tiger prawn, Penaeus monodon', Letters in Applied Microbiology, vol. 22, no. 6, pp.

413-416.

Logan, N 1988, 'Bacillus species of medical and veterinary importance', Journal of

medical microbiology, vol. 25, no. 3, pp. 157-165.

Loghothetis, P & Austin, B 1996, 'Variations in antigenicity of Aeromonas hydrophila

strains in rainbow trout Oncorhynchus mykiss, Walbaum): an association with surface

characteristics', Fish & Shellfish Immunology, vol. 6, no. 1, pp. 47-55.

Longeon, A, Peduzzi, J, Barthelemy, M, Corre, S, Nicolas, J-L & Guyot, M 2004,

'Purification and partial identification of novel antimicrobial protein from marine

bacterium Pseudoalteromonas species strain X153', Marine biotechnology, vol. 6, no.

6, pp. 633-641.

Lu, J, Chen, F & Hodson, RE 2001, 'Distribution, isolation, host specificity, and diversity

of cyanophages infecting marine Synechococcus spp. in river estuaries', Applied and


Lu, J, Nogi, Y & Takami, H 2001, 'Oceanobacillus iheyensis gen. nov., sp. nov., a deep‐

sea extremely halotolerant and alkaliphilic species isolated from a depth of 1050 m on

the Iheya Ridge', FEMS microbiology letters, vol. 205, no. 2, pp. 291-297.

Mann, NH, Cook, A, Millard, A, Bailey, S & Clokie, M 2003, 'Marine ecosystems:

bacterial photosynthesis genes in a virus', Nature, vol. 424, no. 6950, pp. 741-741.

Margalef, R 1958, Temporal succession and spatial heterogeneity in phytoplankton,

University of California press.

P a g e | 118

Marshall, A & Wright, O 1993, 'Confocal laser scanning light microscopy of the extra-

thecal epithelia of undecalcified scleractinian corals', Cell and tissue research, vol. 272,

no. 3, pp. 533-543.

Matsuzaki, S, Rashel, M, Uchiyama, J, Sakurai, S, Ujihara, T, Kuroda, M, Ikeuchi, M,

Tani, T, Fujieda, M, Wakiguchi, H & Imai, S 2005, 'Bacteriophage therapy: a revitalized

therapy against bacterial infectious diseases', J Infect Chemother, vol. 11, no. 5, Oct,

pp. 211-9.

Mazza, P 1994, 'The use of Bacillus subtilis as an antidiarrhoeal microorganism',

Bollettino chimico farmaceutico, vol. 133, no. 1, pp. 3-18.

Mazza, P 1994, 'The use of Bacillus subtilis as an antidiarrhoeal microorganism',

Bollettino chimico farmaceutico, vol. 133, no. 1, pp. 3-18.

McCaig, AE, Glover, LA & Prosser, JI 1999, 'Molecular analysis of bacterial community

structure and diversity in unimproved and improved upland grass pastures', Applied

and Environmental Microbiology, vol. 65, no. 4, pp. 1721-1730.

McLeod, E, Anthony, KRN, Andersson, A, Beeden, R, Golbuu, Y, Kleypas, J, Kroeker, K,

Manzello, D, Salm, RV, Schuttenberg, H & Smith, JE 2013, 'Preparing to manage coral

reefs for ocean acidification: lessons from coral bleaching', Frontiers in Ecology and the

Environment, vol. 11, no. 1, pp. 20-27.

Meikle, P, Richards, G & Yellowlees, D 1987, 'Structural determination of the

oligosaccharide side chains from a glycoprotein isolated from the mucus of the coral

Acropora formosa', Journal of Biological Chemistry, vol. 262, no. 35, pp. 16941-16947.

Meikle, P, Richards, G & Yellowlees, D 1988, 'Structural investigations on the mucus

from six species of coral', Marine biology, vol. 99, no. 2, pp. 187-193.

P a g e | 118

Meron, D, Atias, E, Iasur Kruh, L, Elifantz, H, Minz, D, Fine, M & Banin, E 2011, 'The

impact of reduced pH on the microbial community of the coral Acropora eurystoma',

ISME J, vol. 5, no. 1, Jan, pp. 51-60.

Millard, A, Clokie, MR, Shub, DA & Mann, NH 2004, 'Genetic organization of the psbAD

region in phages infecting marine Synechococcus strains', Proceedings of the National

Academy of Sciences of the United States of America, vol. 101, no. 30, pp. 11007-

11012.

Millard, AD, Zwirglmaier, K, Downey, MJ, Mann, NH & Scanlan, DJ 2009, 'Comparative

genomics of marine cyanomyoviruses reveals the widespread occurrence of

Synechococcus host genes localized to a hyperplastic region: implications for

mechanisms of cyanophage evolution', Environmental microbiology, vol. 11, no. 9, pp.

2370-2387.

Mills, M & Sebens, K 1997, 'Particle ingestion efficiency of the corals Siderastrea

siderea and Agaricia agaricites: Effects of flow speed and sediment loads,' Proc 8th Int

Coral Reef Symp, 1059-1064.

Mitchell, R & Chet, I 1975, 'Bacterial attack of corals in polluted seawater', Microbial

Ecology, vol. 2, no. 3, pp. 227-233.

Miyoshi, Si & Shinoda, S 1988, 'Role of the protease in the permeability enhancement

by Vibrio vulnificus', Microbiology and immunology, vol. 32, no. 10, pp. 1025-1032.

Mo, S, Kim, J-h & Cho, K 2009, 'A novel extracellular phospholipase C purified from a

marine bacterium, Pseudoalteromonas sp. J937', Biotechnology Letters, vol. 31, no. 1,

2009/01/01, pp. 89-94.

P a g e | 118

Molchanova, VI, Ovodova, RG, Ovodov, YS, Elkin, YN & Fernandez Santana, V 1985,

'Studies of the polysaccharide moiety of corallan, a glycoprotein from

Pseudopterogorgia americana, Carbohydrate research, vol. 141, no. 2, pp. 289-293.

Molenaar, TJ, Michon, I, de Haas, SA, van Berkel, TJ, Kuiper, J & Biessen, EA 2002,

'Uptake and processing of modified bacteriophage M13 in mice: implications for phage

display', Virology, vol. 293, no. 1, Feb 1, pp. 182-191.

Moriarty, D, Pollard, P & Hunt, W 1985, 'Temporal and spatial variation in bacterial

production in the water column over a coral reef', Marine biology, vol. 85, no. 3, pp.

285-292.

Mouchka, ME, Hewson, I & Harvell, CD 2010, 'Coral-associated bacterial assemblages:

current knowledge and the potential for climate-driven impacts', Integr Comp Biol, vol.

50, no. 4, Oct, pp. 662-74.

Mumby, PJ & Steneck, RS 2008, 'Coral reef management and conservation in light of

rapidly evolving ecological paradigms', Trends in ecology & evolution, vol. 23, no. 10,

pp. 555-563.

Munn, CB, Marchant, HK & Moody, AJ 2008a, 'Defences against oxidative stress in

vibrios associated with corals', FEMS microbiology letters, vol. 281, no. 1, pp. 58-63.

Munn, CB, Marchant, HK & Moody, AJ 2008b, 'Defences against oxidative stress in

vibrios associated with corals', FEMS Microbiol Lett, vol. 281, no. 1, Apr, pp. 58-63.

Muscatine, L, Falkowski, P, Porter, J & Dubinsky, Z 1984, 'Fate of photosynthetic fixed

carbon in light-and shade-adapted colonies of the symbiotic coral Stylophora pistillata',

Proceedings of the Royal Society of London. Series B. Biological Sciences, vol. 222, no.

1227, pp. 181-202.

P a g e | 118

Muyzer, G, De Waal, EC & Uitterlinden, AG 1993, 'Profiling of complex microbial

populations by denaturing gradient gel electrophoresis analysis of polymerase chain

reaction-amplified genes coding for 16S rRNA', Applied and environmental


Muyzer, G, Hottenträger, S, Teske, A & Wawer, C 1996, 'Denaturing gradient gel

electrophoresis of PCR-amplified 16S rDNA—a new molecular approach to analyse the

genetic diversity of mixed microbial communities', Molecular microbial ecology

manual, vol. 3, no. 4, pp. 1-23.

Muyzer, G & Smalla, K 1998, 'Application of denaturing gradient gel electrophoresis

(DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology',

Antonie van Leeuwenhoek, vol. 73, no. 1, pp. 127-141.

Mydlarz, LD, Jones, LE & Harvell, CD 2006, 'Innate immunity, environmental drivers,

and disease ecology of marine and freshwater invertebrates', Annual Review of

Ecology, Evolution, and Systematics, pp. 251-288.

Nair, SV, Del Valle, H, Gross, PS, Terwilliger, DP & Smith, LC 2005, 'Macroarray analysis

of coelomocyte gene expression in response to LPS in the sea urchin. Identification of

unexpected immune diversity in an invertebrate', Physiological Genomics, vol. 22, no.

1, pp. 33-47.

Navas-Camacho, R, Gil-Agudelo, DL, Rodríguez-Ramírez, A, Reyes-Nivia, MC & Garzón-

Ferreira, J 2010, 'Coral diseases and bleaching on Colombian Caribbean coral reefs',

Revista de Biología Tropical, vol. 58, pp. 95-106.

Nishibuchi, M & Kaper, JB 1995, 'Thermostable direct hemolysin gene of Vibrio

parahaemolyticus: a virulence gene acquired by a marine bacterium', Infection and

Immunity, vol. 63, no. 6, p. 2093.

P a g e | 118

Nissimov, J, Rosenberg, E & Munn, CB 2009, 'Antimicrobial properties of resident coral

mucus bacteria of Oculina patagonica', FEMS Microbiol Lett, vol. 292, no. 2, Mar, pp.

210-5.

Okazaki, H, Kishi, T, Beppu, T & Arima, K 1975, 'Letter: A new antibiotic, baciphelacin',

The Journal of antibiotics, vol. 28, no. 9, pp. 717-719.

Pantos, O, Cooney, RP, Le Tissier, MD, Barer, MR, O'Donnell, AG & Bythell, JC 2003,

'The bacterial ecology of a plague‐like disease affecting the Caribbean coral

Montastrea annularis', Environmental Microbiology, vol. 5, no. 5, pp. 370-382.

Parisien, A, Allain, B, Zhang, J, Mandeville, R & Lan, C 2008, 'Novel alternatives to

antibiotics: bacteriophages, bacterial cell wall hydrolases, and antimicrobial peptides',

Journal of Applied Microbiology, vol. 104, no. 1, pp. 1-13.

Paul, JH, DeFlaun, MF & Jeffrey, WH 1986, 'Elevated levels of microbial activity in the

coral surface microlayer', Marine Ecology-Progress Series, vol. 33, no. 1, p. 29.

Pavel, AB & Vasile, CI 2012, 'PyElph - a software tool for gel images analysis and

phylogenetics', BMC Bioinformatics, vol. 13, p. 9.

Peters, E 1997, 'Diseases of coral-reef organisms', Life and death of coral reefs.

Chapman & Hall, New York, pp. 114-139.

Peters, EC 1993, 'Diseases of other invertebrate phyla: Porifera, cnidaria, ctenophora,

annelida, echinodermata', Pathobiology of Marine and Estuarine Organisms, pp. 393-

449.

Pinchuk, IV, Bressollier, P, Sorokulova, IB, Verneuil, B & Urdaci, MC 2002,

'Amicoumacin antibiotic production and genetic diversity of Bacillus subtilis

P a g e | 118

strains isolated from different habitats', Research in Microbiology, vol. 153, no. 5, pp.

269-276.

Raven, J, Caldeira, K, Elderfield, H, Hoegh-Guldberg, O, Liss, P, Riebesell, U, Shepherd, J,

Turley, C & Watson, A 2005, Ocean acidification due to increasing atmospheric carbon

dioxide, The Royal Society.

Ravindran, J, Kannapiran, E, Manikandan, B, Francis, K, Arora, S, Karunya, E, Kumar, A,

Singh, SK & Jose, J 2013, 'UV-absorbing bacteria in coral mucus and their response to

simulated temperature elevations', Coral Reefs, vol. 32, no. 4, pp. 1043-1050.

Reshef, L, Koren, O, Loya, Y, Zilber-Rosenberg, I & Rosenberg, E 2006a, 'The Coral

Probiotic Hypothesis', Environmental Microbiology, vol. 8, no. 12, pp. 2068-2073.

Reshef, L, Koren, O, Loya, Y, Zilber‐Rosenberg, I & Rosenberg, E 2006b, 'The coral

probiotic hypothesis', Environmental Microbiology, vol. 8, no. 12, pp. 2068-2073.'

Richardson, L & Aronson, R 2002, 'Infectious diseases of reef corals,' Proceedings of the

Ninth International Coral Reef Symposium, Bali, 23-27 October 2000, 1225-1230.

Richardson, LL, Goldberg, WM, Kuta, KG, Aronson, RB, Smith, GW, Ritchie, KB, Halas,

JC, Feingold, JS & Miller, SL 1998, 'Florida's mystery coral-killer identified', Nature, vol.

392, no. 6676, pp. 557-558.

Richardson, LL 2003, 'Aurantimonas coralicida gen. nov., sp. nov., the causative agent

of white plague type II on Caribbean scleractinian corals', International Journal of

Systematic and Evolutionary Microbiology, vol. 53, no. 4, pp. 1115-1122.

Richmond, RH 1993, 'Coral reefs: present problems and future concerns resulting from

anthropogenic disturbance', American Zoologist, vol. 33, no. 6, pp. 524-536.

P a g e | 118

Rincón‐Rosales, R, Lloret, L, Ponce, E & Martínez‐Romero, E 2009, 'Rhizobia with

different symbiotic efficiencies nodulate Acaciella angustissima in Mexico, including

Sinorhizobium chiapanecum sp. nov. which has common symbiotic genes with

Sinorhizobium mexicanum', FEMS microbiology ecology, vol. 67, no. 1, pp. 103-117.

Ritchie, K & Smith, G 1998, 'Type II white-band disease', Rev Biol Trop, vol. 46, no.

suppl 5, pp. 199-203.

Ritchie, KB 2006, 'Regulation of microbial populations by coral surface mucus and

mucus-associated bacteria', Marine Ecology Progress Series, vol. 322, September 20,

2006, pp. 1-14.

Ritchie, KB, Dennis, J, McGrath, T & Smith, GW 1994, 'Bacteria associated with

bleached and nonbleached areas of Montastrea annularis,' Proc Symp Nat Hist

Bahamas, 75-80.

Ritchie, KB & Smith, GW 1995, 'Preferential carbon utilization by surface bacterial

communities from water mass, normal, and white-band diseased Acropora

cervicornis', Molecular Marine Biology and Biotechnology, vol. 4, no. 4, pp. 345-352.

Ritchie, KB & Smith, GW 2004, 'Microbial communities of coral surface

mucopolysaccharide layers', in Coral health and disease, Springer, pp. 259-264.

Richardson, L & Aronson, R 2002, 'Infectious diseases of reef corals,' Proceedings of the

Ninth International Coral Reef Symposium, Bali, 23-27 October 2000, 1225-1230.

Rohwer, F, Breitbart, M, Jara, J, Azam, F & Knowlton, N 2001, 'Diversity of bacteria

associated with the Caribbean coral Montastraea franksi', Coral Reefs, vol. 20, no. 1,

pp. 85-91.

P a g e | 118

Radjasa OK. &Sabdono A. 2003, ‘Screening of Secondary Metabolite-Producing

Bacteria associated with Corals using 16S rDNA Based Approach’, Journal of Coastal

Development, vol.7, no.1, pp. 11-19.

Rodríguez-Moya, J, Argandoña, M, Iglesias-Guerra, F, Nieto, JJ & Vargas, C 2013,

'Temperature-and salinity-decoupled overproduction of hydroxyectoine by

Chromohalobacter salexigens', Applied and environmental microbiology, vol. 79, no. 3,

pp. 1018-1023.

Rodriguez-Lanetty, M, Harii, S & Hoegh-Guldberg, O 2009, 'Early molecular responses

of coral larvae to hyperthermal stress', Molecular Ecology, vol. 18, no. 24, pp. 5101-

5114.

Rohwer, F, Breitbart, M, Jara, J, Azam, F & Knowlton, N 2001, 'Diversity of bacteria

associated with the Caribbean coral Montastraea franksi', Coral Reefs, vol. 20, no. 1,

pp. 85-91.

Rohwer, F & Kelley, S 2004, 'Culture-independent analyses of coral-associated

microbes', in Coral health and disease, Springer, pp. 265-277.

Rohwer, F, Segall, A, Steward, G, Seguritan, V, Breitbart, M, Wolven, F & Azam, F 2000,

'The complete genomic sequence of the marine phage Roseophage SIOI shares

homology with nonmarine phages', Limnology and Oceanography, vol. 45, no. 2, pp.

408-418.

Rohwer, F, Seguritan, V, Azam, F & Knowlton, N 2002, 'Diversity and distribution of

coral-associated bacteria', Marine Ecology Progr.ess Series, vol. 243, no. 1.

Rohwer, F & Thurber, RV 2009, 'Viruses manipulate the marine environment', Nature,

vol. 459, no. 7244, pp. 207-212.

P a g e | 118

Rosenberg, E & Ben-Haim, Y 2002, 'Microbial diseases of corals and global warming',


Rosenberg, E, Ben-Haim, Y, Toren, A, Banin, E, Kushmaro, A, Fine, M & Loya, Y 1999,

'Effect of temperature on bacterial bleaching of corals', Microbial ecology and

infectious disease. ASM Press, Washington, DC, pp. 242-254.

Rosenberg, E & Ben‐Haim, Y 2002, 'Microbial diseases of corals and global warming',

Environmental microbiology, vol. 4, no. 6, pp. 318-326.

Rosenberg, E & Falkovitz, L 2004, 'The Vibrio shiloi/Oculina patagonica model system

of coral bleaching', Annu. Rev. Microbiol., vol. 58, pp. 143-159.

Rosenberg, E, Koren, O, Reshef, L, Efrony, R & Zilber-Rosenberg, I 2007, 'The role of

microorganisms in coral health, disease and evolution', Nature Reviews Microbiology,

vol. 5, no. 5, pp. 355-362.

Rosenberg, E, Kushmaro, A, Kramarsky-Winter, E, Banin, E & Yossi, L 2008, 'The role of

microorganisms in coral bleaching', The ISME journal, vol. 3, no. 2, pp. 139-146.

Rua, CP, Trindade-Silva, AE, Appolinario, LR, Venas, TM, Garcia, GD, Carvalho, LS, Lima,

A, Kruger, R, Pereira, RC, Berlinck, RG, Valle, RA, Thompson, CC & Thompson, F 2014,

'Diversity and antimicrobial potential of culturable heterotrophic bacteria associated

with the endemic marine sponge Arenosclera brasiliensis', PeerJ, vol. 2, p. e419.

Rublee, PA, Lasker, HR, Gottfried, M & Roman, MR 1980, 'Production and bacterial

colonization of mucus from the soft coral Briarium asbestinum', Bulletin of Marine

Science, vol. 30, no. 4, pp. 888-893.

Rützler, K & Santavy, DL 1983, 'The black band disease of Atlantic reef corals', Marine

Ecology, vol. 4, no. 4, pp. 301-319.

P a g e | 118

Saiki, RK, Gelfand, DH, Stoffel, S, Scharf, SJ, Higuchi, R, Horn, GT, Mullis, KB & Erlich, HA

1988, 'Primer-directed enzymatic amplification of DNA with a thermostable DNA

polymerase', Science, vol. 239, no. 4839, pp. 487-491.

Sambrook, J, Fritsch, EF & Maniatis, T 1989, Molecular cloning, Cold spring harbor

laboratory press New York.

Sandaa, RA, Clokie, M & Mann, NH 2008, 'Photosynthetic genes in viral populations

with a large genomic size range from Norwegian coastal waters', FEMS microbiology

ecology, vol. 63, no. 1, pp. 2-11.

Santavy, D & Peters, E 1997, 'Microbial pests: coral disease in the Western Atlantic,'

Proc 8th Int Coral Reef Symp, 607-612.

Schnell, S, Assmus, S & Richardson, L 1996, 'Role of sulfate reducing bacteria in the

black band disease of corals', Abstr. Annu. Meet. VAAM (Ver. Allg. Angew. Mikrobiol.)

GBCH (Ges. Biol. Chem.). Elsevier, Cologne, Germany, p. 116.

Schwebel, D & Margaretha, P 2000, 'Photocycloaddition of 2H‐1‐Benzopyran‐3‐

carbonitriles and 2H‐1‐Benzothiopyran‐3‐carbonitriles to Alkenes and Alkenynes',

Helvetica Chimica Acta, vol. 83, no. 6, pp. 1168-1174.

Shannon-Weaver 1963, Mathematical theory of communication, University Illinois

Press.

Sharon, G & Rosenberg, E 2008, 'Bacterial growth on coral mucus', Current


Sharon, I, Tzahor, S, Williamson, S, Shmoish, M, Man-Aharonovich, D, Rusch, DB,

Yooseph, S, Zeidner, G, Golden, SS & Mackey, SR 2007, 'Viral photosynthetic reaction

P a g e | 118

center genes and transcripts in the marine environment', The ISME journal, vol. 1, no.

6, pp. 492-501.

Shashar, N, Cohen, Y, Loya, Y & Sar, N 1994, 'Nitrogen fixation(acetylene reduction) in

stony corals: Evidence for coral-bacteria interactions', Marine ecology progress series.

Oldendorf, vol. 111, no. 3, pp. 259-264.

Shick, J, Lesser, M, Dunlap, W, Stochaj, W, Chalker, B & Won, JW 1995, 'Depth-

dependent responses to solar ultraviolet radiation and oxidative stress in the

zooxanthellate coral Acropora microphthalma', Marine Biology, vol. 122, no. 1, pp. 41-

51.

Shick, J, LESSER, MP & JOKIEL, PL 1996, 'Effects of ultraviolet radiation on corals and

other coral reef organisms', Global Change Biology, vol. 2, no. 6, pp. 527-545.

Shnit-Orland, M, Sivan, A & Kushmaro, A 2012, 'Antibacterial activity of

Pseudoalteromonas in the coral holobiont', Microb Ecol, vol. 64, no. 4, Nov, pp. 851-9.

Shnit‐Orland, M & Kushmaro, A 2009, 'Coral mucus‐associated bacteria: a possible first

line of defense', FEMS microbiology ecology, vol. 67, no. 3, pp. 371-380.

Short, CM & Suttle, CA 2005, 'Nearly identical bacteriophage structural gene

sequences are widely distributed in both marine and freshwater environments',

Applied and environmental microbiology, vol. 71, no. 1, pp. 480-486.

Slattery, M, McClintock, JB & Heine, JN 1995, 'Chemical defenses in Antarctic soft

corals: evidence for antifouling compounds', Journal of Experimental Marine Biology

and Ecology, vol. 190, no. 1, pp. 61-77.

Smith, B & Wilson, JB 1996, 'A consumer's guide to evenness indices', Oikos, pp. 70-82.

P a g e | 118

Smith, GW, Ives, LD, Nagelkerken, IA & Ritchie, KB 1996, 'Caribbean sea-fan

mortalities',

Sneath, PH & Sokal, RR 1973, Numerical taxonomy. The principles and practice of

numerical classification.

Soffer, N, Zaneveld, J & Vega Thurber, R 2014, 'Phage-bacteria network analysis and its

implication for the understanding of coral disease', Environ Microbiol, Jul 8

Sørensen, T 1948, '{A method of establishing groups of equal amplitude in plant

sociology based on similarity of species and its application to analyses of the

vegetation on Danish commons}', Biol. skr., vol. 5, pp. 1-34.

Sorokin, YI 1973, 'On the feeding of some scleractinian corals with bacteria and

dissolved organic matter', Limnol Oceanogr, vol. 18, no. 3, pp. 380-385.

Sorokin, YI 1978, 'Microbial-production in coral-reef community', Archiv fur

Hydrobiologie, vol. 83, no. 3, pp. 281-323.

Soto-Rodriguez, S, Roque, A, Lizarraga-Partida, M, Guerra-Flores, A & Gomez-Gil, B

2003, 'Virulence of luminous vibrios to Artemia franciscana nauplii', Diseases of aquatic

organisms, vol. 53, no. 3, pp. 231-240.

Sullivan, MB, Coleman, ML, Quinlivan, V, Rosenkrantz, JE, DeFrancesco, AS, Tan, G, Fu,

R, Lee, JA, Waterbury, JB & Bielawski, JP 2008, 'Portal protein diversity and phage

ecology', Environmental microbiology, vol. 10, no. 10, pp. 2810-2823.

Sullivan, MB, Coleman, ML, Weigele, P, Rohwer, F & Chisholm, SW 2005, 'Three

Prochlorococcus cyanophage genomes: signature features and ecological

interpretations', PLoS biology, vol. 3, no. 5, p. e144.

P a g e | 118

Sullivan, MB, Krastins, B, Hughes, JL, Kelly, L, Chase, M, Sarracino, D & Chisholm, SW

2009, 'The genome and structural proteome of an ocean siphovirus: a new window

into the cyanobacterial ‘mobilome’', Environmental microbiology, vol. 11, no. 11, pp.

2935-2951.

Sullivan, MB, Lindell, D, Lee, JA, Thompson, LR, Bielawski, JP & Chisholm, SW 2006,

'Prevalence and evolution of core photosystem II genes in marine cyanobacterial

viruses and their hosts', PLoS biology, vol. 4, no. 8, p. e234.

Sunagawa, S, DeSantis, TZ, Piceno, YM, Brodie, EL, DeSalvo, MK, Voolstra, CR, Weil, E,

Andersen, GL & Medina, M 2009, 'Bacterial diversity and White Plague Disease-

associated community changes in the Caribbean coral Montastraea faveolata', ISME J,

vol. 3, no. 5, May, pp. 512-21.

Sussman, M, Loya, Y, Fine, M & Rosenberg, E 2003, 'The marine fireworm Hermodice

carunculata is a winter reservoir and spring‐summer vector for the coral‐bleaching

pathogen Vibrio shiloi', Environmental Microbiology, vol. 5, no. 4, pp. 250-255.

Sussman, M, Willis, BL, Victor, S & Bourne, DG 2008, 'Coral pathogens identified for

white syndrome (WS) epizootics in the Indo-Pacific', PLoS One, vol. 3, no. 6, p. e2393.

Sutherland, KP, Porter, JW & Torres, C 2004, 'Disease and immunity in Caribbean and

Indo-Pacific zooxanthellate corals', Marine ecology progress series, vol. 266, pp. 265-

272.

Suttle, CA & Chen, F 1992, 'Mechanisms and rates of decay of marine viruses in

seawater', Applied and Environmental Microbiology, vol. 58, no. 11, pp. 3721-3729.

P a g e | 118

Szmant, A & Gassman, N 1990, 'The effects of prolonged “bleaching” on the tissue

biomass and reproduction of the reef coral Montastrea annularis', Coral reefs, vol. 8,

no. 4, pp. 217-224.

Takami, H, Kobata, K, Nagahama, T, Kobayashi, H, Inoue, A & Horikoshi, K 1999,

'Biodiversity in deep-sea sites located near the south part of Japan', Extremophiles, vol.

3, no. 2, pp. 97-102.

Teo, JW, Zhang, L-H & Poh, CL 2003, 'Cloning and characterization of a metalloprotease

from Vibrio harveyi strain AP6', Gene, vol. 303, pp. 147-156.

Thurber, RLV, Barott, KL, Hall, D, Liu, H, Rodriguez-Mueller, B, Desnues, C, Edwards, RA,

Haynes, M, Angly, FE & Wegley, L 2008, 'Metagenomic analysis indicates that stressors

induce production of herpes-like viruses in the coral Porites compressa', Proceedings of

the National Academy of Sciences, vol. 105, no. 47, pp. 18413-18418.

Toren, A, Landau, L, Kushmaro, A, Loya, Y & Rosenberg, E 1998, 'Effect of Temperature

on Adhesion ofVibrio Strain AK-1 to Oculina patagonica and on Coral Bleaching',

Applied and environmental microbiology, vol. 64, no. 4, pp. 1379-1384.

Tucker, KP, Parsons, R, Symonds, EM & Breitbart, M 2011, 'Diversity and distribution of

single-stranded DNA phages in the North Atlantic Ocean', ISME J, vol. 5, no. 5, May, pp.

822-30.

Vacelet, E & Thomassin, BA 1991, 'Microbial utilization of coral mucus in long term in

situ incubation over a coral reef', Hydrobiologia, vol. 211, no. 1, pp. 19-32.

Velho-Pereira, S & Furtado, I 2012, 'Antibacterial activity of halophilic bacterial bionts

from marine invertebrates of Mandapam-India', Indian journal of pharmaceutical

sciences, vol. 74, no. 4, p. 331.

P a g e | 118

Verdugo, P 1990, 'Goblet cells secretion and mucogenesis', Annual review of

physiology, vol. 52, no. 1, pp. 157-176.

Vidal-Dupiol, J, Ladrière, O, Destoumieux-Garzón, D, Sautière, P-E, Meistertzheim, A-L,

Tambutté, E, Tambutté, S, Duval, D, Fouré, L & Adjeroud, M 2011, 'Innate immune

responses of a scleractinian coral to vibriosis', Journal of Biological Chemistry, vol. 286,

no. 25, pp. 22688-22698.

Vob, U, Larrieu, A & Wells, DM 2013, 'From jellyfish to biosensors: the use of

fluorescent proteins in plants', International journal of developmental biology, vol. 57,

no. 6, pp. 525-533.

Walker, R, Powell, A & Seddon, B 1998, 'Bacillus isolates from the spermosphere of

peas and dwarf French beans with antifungal activity against Botrytis cinerea and

Pythium species', Journal of Applied Microbiology, vol. 84, no. 5, pp. 791-801.

Ward, JR, Kim, K & Harvell, C 2007, 'Temperature affects coral disease resistance and

pathogen growth', Marine Ecology Progress Series, vol. 329, pp. 115-121.

Wegley, L, Edwards, R, Rodriguez-Brito, B, Liu, H & Rohwer, F 2007, 'Metagenomic

analysis of the microbial community associated with the coral Porites astreoides',

Environ Microbiol, vol. 9, no. 11, Nov, pp. 2707-19.

Wegley, L, Yu, Y, Breitbart, M, Casas, V, Kline, DI & Rohwer, F 2004, 'Coral-associated

archaea', Marine Ecology Progress Series, vol. 273, pp. 89-96.

Weigele, PR, Pope, WH, Pedulla, ML, Houtz, JM, Smith, AL, Conway, JF, King, J, Hatfull,

GF, Lawrence, JG & Hendrix, RW 2007, 'Genomic and structural analysis of Syn9, a

P a g e | 118

cyanophage infecting marine Prochlorococcus and Synechococcus', Environmental


Weil, E, Smith, G & Gil-Agudelo, DL 2006, 'Status and progress in coral reef disease

research', Diseases of Aquatic Organisms, vol. 69, no. 1, pp. 1-7.

Weinbauer, MG & Rassoulzadegan, F 2004, 'Are viruses driving microbial diversification

and diversity?', Environmental microbiology, vol. 6, no. 1, pp. 1-11.

Weisenborn, F, Brown, W & Meyers, E 1984, 'Antibiotic kristenin from Bacillus subtilis

ATCC 31340 useful as against Gram-positive bacteria', Unlisted-Drug, vol. 36, p. 9Q.

Weld, RJ, Butts, C & Heinemann, JA 2004, 'Models of phage growth and their

applicability to phage therapy', Journal of theoretical biology, vol. 227, no. 1, pp. 1-11.

Wiese, J, Thiel, V, Nagel, K, Staufenberger, T & Imhoff, JF 2009, 'Diversity of antibiotic-

active bacteria associated with the brown alga Laminaria saccharina from the Baltic

Sea', Marine Biotechnology, vol. 11, no. 2, pp. 287-300.

Wild, C, Huettel, M, Klueter, A, Kremb, SG, Rasheed, MY & Jørgensen, BB 2004a, 'Coral

mucus functions as an energy carrier and particle trap in the reef ecosystem', Nature,

vol. 428, no. 6978, pp. 66-70.

Wild, C, Rasheed, M, Werner, U, Franke, U, Johnstone, R & Huettel, M 2004b,

'Degradation and mineralization of coral mucus in reef environments', Marine ecology.

Progress series, vol. 267, pp. 159-171.

Wilhelm, SW & Suttle, CA 1999, 'Viruses and Nutrient Cycles in the Sea Viruses play

critical roles in the structure and function of aquatic food webs', Bioscience, vol. 49, no.

10, pp. 781-788.

P a g e | 118

Wilkinson, C & Network, GCRM 2008, Status of coral reefs of the world: 2008, Global

Coral Reef Monitoring Network Townsville.

Wilkinson, CR 1999, 'Global and local threats to coral reef functioning and existence:

review and predictions', Marine and Freshwater Research, vol. 50, no. 8, pp. 867-878.

Wilkinson, CR & Buddemeier, RW 1994, Global Climate Change and Coral Reefs:

Implications for People and Reefs: Report of the UNEP-IOC-ASPEI-IUCN Global Task

Team on the Implications of Climate Change on Coral Reefs, IUCN.

Williamson, SJ, Rusch, DB, Yooseph, S, Halpern, AL, Heidelberg, KB, Glass, JI, Andrews-

Pfannkoch, C, Fadrosh, D, Miller, CS & Sutton, G 2008, 'The Sorcerer II Global Ocean

Sampling Expedition: metagenomic characterization of viruses within aquatic microbial

samples', PloS one, vol. 3, no. 1, p. e1456.

Wilson W., Dale A., Davy, J & Davy, S 2005, 'An enemy within? Observations of virus-

like particles in reef corals', Coral Reefs, vol. 24, no. 1, pp. 145-148.

Wommack, KE & Colwell, RR 2000, 'Virioplankton: viruses in aquatic ecosystems',

Microbiology and molecular biology reviews, vol. 64, no. 1, pp. 69-114.

Wu, Z, Milton, D, Nybom, P, Sjö, A & Magnusson, K-E 1996, Vibrio cholerae

hemagglutinin/protease (HA/protease) causes morphological changes in cultured

epithelial cells and perturbs their paracellular barrier function', Microbial

pathogenesis, vol. 21, no. 2, pp. 111-123.

Yokouchi, H, Fukuoka, Y, Mukoyama, D, Calugay, R, Takeyama, H & Matsunaga, T 2006,

'Whole-metagenome amplification of a microbial community associated with

P a g e | 118

scleractinian coral by multiple displacement amplification using phi29 polymerase',

Environ Microbiol, vol. 8, no. 7, Jul, pp. 1155-63.

Yonge, CM 1940, The biology of reef-building corals, British Museum (Natural History).

Yoshizawa, S, Wada, M, Kita-Tsukamoto, K, Ikemoto, E, Yokota, A & Kogure, K 2009,

'Vibrio azureus sp. nov., a luminous marine bacterium isolated from seawater', Int J

Syst Evol Microbiol, vol. 59, no. Pt 7, Jul, pp. 1645-9.

Zeng, Z, Qian, L, Cao, L, Tan, H, Huang, Y, Xue, X, Shen, Y & Zhou, S 2008, 'Virtual

screening for novel quorum sensing inhibitors to eradicate biofilm formation of

Pseudomonas aeruginosa', Applied microbiology and biotechnology, vol. 79, no. 1, pp.

119-126.

Zheng, L, Chen, H, Han, X, Lin, W & Yan, X 2005, 'Antimicrobial screening and active

compound isolation from marine bacterium NJ6-3-1 associated with the sponge

Hymeniacidon perleve', World Journal of Microbiology and Biotechnology, vol. 21, no.

2, pp. 201-206.

Zhong, Y, Chen, F, Wilhelm, SW, Poorvin, L & Hodson, RE 2002, 'Phylogenetic Diversity

of Marine Cyanophage Isolates and Natural Virus Communities as Revealed by

Sequences of Viral Capsid Assembly Protein Gene g20', Applied and Environmental

Microbiology, vol. 68, no. 4, pp. 1576-1584.

State of Reefs , May 1995. Available from: <

http://www.ncdc.noaa.gov/paleo/outreach/coral/sor/sor_contents.html#toc >. [9 July

2014].

WTW Xylem Brand. Available from: <http://www.wtw.de/en/home.html >. [10 August

2014].

P a g e | 118

LI-COR Environmental Home. Available from:

<http://www.licor.com/env/products/gas_analysis/LI-820/features.html >. [9 July

2014].

UK Ocean Acidification Research Programme. Available from: <

http://www.oceanacidification.org.uk>. [5 July 2014].

http://www.licor.com/env/products/gas_analysis/LI-820/features.html

P a g e | 118

APPENDIX

Table 1: 16S rRNA gene sequence analysis of bacterial cultures from Trachyphyllia

geoffroyi based on BLAST analysis.

Species Closest match Identities %/bp Phylogenetic division

Trachyphyllia

geoffroyi.

WEEK 1(1)

Vibrio rotiferianus

[KC534191]

97%/1420bp GammaProteobacteriaia

Trachyphyllia

geoffroyi

WEEK 1(12)

Vibrio alginolyticus

[KC734518]


Trachyphyllia

geoffroyi

WEEK 1(13)

Pseudoalteromonas

piscicida [FJ457196]


Trachyphyllia

geoffroyi

WEEK 1(9)

Pseudoalteromonas

flavipulchra

[JQ409375]

91%./1338bp GammaProteobacteriaia

Trachyphyllia

geoffroyi

WEEK 2(3)

Vibrio

parahaemolyticus

[JF432066]


Trachyphyllia

geoffroyi

WEEK 2(4)


[JN188406]


Trachyphyllia

geoffroyi

Vibrio

parahaemolyticus


P a g e | 118

WEEK 2(9) [DQ991216]

Trachyphyllia

geoffroyi

WEEK 3(1)

Vibrio communis

[JQ663883]


Trachyphyllia

geoffroyi

WEEK 3(10)

Lysinibacillus

fusiformis

[JF343177]


Trachyphyllia

geoffroyi

WEEK 3(2)

Vibrio owensii

[GQ281105]


Trachyphyllia

geoffroyi

WEEK 3(3)

Vibrio harveyi

[DQ995246]


Trachyphyllia

geoffroyi

WEEK 3(5)A

Vibrio communis

[HQ161734]


Trachyphyllia

geoffroyi

WEEK 3(6)

Vibrio

parahaemolyticus

[JN188419]


Trachyphyllia

geoffroyi

WEEK 4(1)

Chromahaobacter

salaxigen

[GU397381]


Trachyphyllia

geoffroyi

WEEK 4(6)

Vibrio coralliitycus

[NR117892]


P a g e | 118

Trachyphyllia

geoffroyi

WEEK 5(1)

Lysinibacillus

boronitolerans

[FJI74646]

99%/1045bp Bacilli

Trachyphyllia

geoffroyi

WEEK 5(11)

Vibrio sp. Persian

[KC765089]

99%/1443bp

GammaProteobacteriaia

Trachyphyllia

geoffroyi

WEEK 5(15)

Vibrio owensii

[JX280419]


Trachyphyllia

geoffroyi

WEEK 5(17)

Pseudomonas

plecoglossicida

[EU594553]


Trachyphyllia

geoffroyi

WEEK 5(18)

Pseudomonas

plecoglossicida

[KF358256]


Trachyphyllia

geoffroyi

WEEK 5(20)

Lysinibacillus

fusiformis

[KC775773]

99%/1457bp Bacilli

Trachyphyllia

geoffroyi

WEEK 5(21)

Lysinibacillus

fusiformis

[KF916674]

98%/1445bp Bacilli

Trachyphyllia

geoffroyi

WEEK 5(9)


[FJ61355]

99%/908bp Bacilli

P a g e | 118

Trachyphyllia

geoffroyi

WEEK 7(2)

Bacillus subtilis

[HQ684005]

99%/1464bp Bacilli

Trachyphyllia

geoffroyi

WEEK 1(7)

Bacillus cereus

[KF841622],

99%/1420bp Bacilli

Trachyphyllia

geoffroyi

WEEK 7(5)

Bacillus cereus

[K376341]

100%/1042bp Bacilli

Trachyphyllia

geoffroyi

WEEK 8(11)

Chromahaobacter

salaxigen [KJ676975]


Trachyphyllia

geoffroyi

WEEK C3(16)

Vibrio communis

[JQ663883]


Trachyphyllia

geoffroyi

WEEK 8(1)

Bacillus cereus

[JN944764]

97%/1402bp Bacilli

Trachyphyllia

geoffroyi

WEEK 8(2)

Oceanobacillus sp.

[KC433666]

88%/883bp Bacilli

Trachyphyllia

geoffroyi

WEEK 8(4)

Bacillus cereus

[JQ311944]

95%/759bp Bacilli

Trachyphyllia

geoffroyi

Vibrio harveyi

[HM008704]


P a g e | 118

WEEK 8(5)

Trachyphyllia

geoffroyi

WEEK 5(14)

Vibrio owensii

[HQ908697]


Trachyphyllia

geoffroyi

WEEK 4(8)

Vibrio owensii

[HQ908697]


P a g e | 118

Table 2: 16S rRNA gene sequence analysis of bacterial cultures from Euphyllia

ancora., based on BLAST analysis

Species Closest match %/bp Phylogenetic division

Euphyllia ancora

WEEK 1(3)

Vibrio

parahaemolyticus

[JN188419]

97%/1448bp GammaProteobacteria

Euphyllia

ancoraWEEK 1(6)

Lysinibacillus

sphaericus [JX286700]

99%/1186bp Bacilli

Euphyllia

ancoraWEEK 1(7)

Vibrio proteolyticus

[AF513463]


Euphyllia ancora.

WEEK 1(8)

Lysinibacillus

fusiformis [JX286689]

99%/1273bp Bacilli

Euphyllia

ancoraWEEK

2(10)

Lysinibacillus

fusiformis [HM101171]

99%/1471bp Bacilli

Euphyllia ancora.

WEEK 2(2)

Bacillus cereus

[EU621383]

100%/1273bp Bacilli

Euphyllia

ancoraWEEK

2(5)A

Lysinibacillus

fusiformis [FJ973545]

99%/1460bp Bacilli

Euphyllia

ancoraWEEK

3(1)A

Vibrio owensii

[HQ908697]


Euphyllia

ancoraWEEK

Vibrio azureus 99%/1431bp GammaProteobacteria

P a g e | 118

3(15) [JN188419]

Euphyllia

ancoraWEEK

3(3)A

Vibrio shilonii

[NR118242]


Euphyllia

ancoraWEEK

3(6)A

Vibrio harveyi

[FJ161275]


Euphyllia

ancoraWEEK

4(10)

Vibrio coralliilyticus

[NR028014]


Euphyllia

ancoraWEEK 4(4)

Photobacterium

rosenbergii

[HQ449973]


Euphyllia

ancoraWEEK 4(7)

Bacillus firmus

[JN700106]

100%/1410bp Bacilli

Euphyllia

ancoraWEEK

5(17)

Vibrio harveyi

[FJ161275]


Euphyllia

ancoraWEEK 4(9)

Vibrio coralliilyticus

[JQ307093]


Euphyllia

ancoraWEEK 5(1)

Vibrio owensii

[JX2804419]


Euphyllia

ancoraWEEK

5(12)

Shewanella haliotis

[KF500918]


P a g e | 118

Euphyllia

ancoraWEEK

5(15)


[KC734518]


Euphyllia

ancoraWEEK

5(16)

Vibrio communis

[HQ161734]


Euphyllia

ancoraWEEK

5(20)

Vibrio

communis[JQ663883]


Euphyllia

ancoraWEEK

5(23)

Vibrio owensii

[HQ908673]


Euphyllia

ancoraWEEK

5(24)

Shewanella haliotis

[KF500918]


Euphyllia

ancoraWEEK 5(6)

Vibrio campbellii

[KC534273]


Euphyllia

ancoraWEEK 5(8)

Shewanella sp.

[KC335140]


Euphyllia

ancoraWEEK 6(3)

Bacillus cereus

[JX317637]

99%/1448bp Bacilli

Euphyllia

ancoraWEEK

C2(4)

Vibrio harveyi

[FJ161275]


Euphyllia

ancoraWEEK

Vibrio azureus 99%/1455bp GammaProteobacteria

P a g e | 118

C3(3) [JQ663884]

Euphyllia

ancoraWEEK

C3(6)

Vibrio neocalledonicus

[KJ841877]


Euphyllia

ancoraWEEK 8(2)


[FJ897722]

96%/1425bp Bacilli

Euphyllia

ancoraWEEK 4(2)

Vibrio owensii [FJ5062] 99%/1464bp GammaProteobacteria

Euphyllia

ancoraWEEK 4(8)

Photobacterium

leiognathi[FJ240417]


Euphyllia

ancoraWEEK 4(3)

Photobacterium

leiognathi [AB680576]


Euphyllia

ancoraWEEK 4(5)

Pseudomoalteromonas

rubra [JQ409378]


Euphyllia

ancoraWEEK

4(16)A

Vibrio mediterranei

[HF541959]


Euphyllia

ancoraWEEK 8(6)

Bacillus cereus

[KF591117]

95%/1438bp Bacilli

Euphyllia

ancoraWEEK

8(13)

Vibrio owensii

[AB719181]


P a g e | 118

Table 3: 16S rRNA gene sequence analysis of bacterial cultures from Corallimorphs

sp., based on BLAST analysis.

Species Closest match Identities %/bp Phylogenetic division

Corralimorphs

sp. WEEK 1(1)

Vibrio harveyi

[GQ249053]


Corralimorphs

sp. WEEK 1(2)

Vibrio rotiferianus

[KC534191]


Corralimorphs

sp. WEEK 1(6)

Vibrio harveyi

[DQ995240


Corralimorphs

sp. WEEK 1(8)

Vibrio brasiliensis

[JF721971]


Corralimorphs

sp. WEEK 2(2)


[JN188403]


Corralimorphs

sp. WEEK 2(4)

Vibrio

parahaemolyticus

[JF432066],


Corralimorphs

sp. WEEK 2(5)

Vibrio

azureus[JQ663884]


Corralimorphs

sp. WEEK 2(7)

Lysinibacillus

fusiformis [JN416567]

99%/1455bp Bacilli

Corralimorphs

sp. WEEK

3(10)


[JN188406]


P a g e | 118

Corralimorphs

sp. WEEK

3(11)


[KC734518]


Corralimorphs

sp. WEEK

4(10)

Vibrio

parahaemolyticus

[KC210812]


Corralimorphs

sp. WEEK 4(2)

Photobacterium

leiognathi [FJ240415]


Corralimorphs

sp. WEEK 4(3)

Vibrio owensii

[JX280419]


Corralimorphs

sp. WEEK 4(4)

Vibrio harveyi

[GQ203111]


Corralimorphs

sp. WEEK

5(10)

Vibrio harveyi

[DQ995246]


Corralimorphs

sp. WEEK

5(12)

Bacillus sphaericus

[DQ923492]

99%/1427bp Bacilli

Corralimorphs

sp. WEEK

5(13)

Lysinibacillus

fusiformis

[HQ829830]

99%/1048bp Bacilli

Corralimorphs

sp. WEEK

5(15)

Pseudoalteromonas

prydensis

[HM583997]


Corralimorphs Vibrio owensii 99%/1463bp GammaProteobacteriaia

P a g e | 118

sp. WEEK 5(2) [HQ908694]

Corralimorphs

sp. WEEK 5(6)

Vibrio harveyi

[K700304]


Corralimorphs

sp. WEEK 6(2)

Lysinibacillus

fusiformis [AB732972]

99%/1458bp Bacilli

Corralimorphs

sp. WEEK 6(8)

Pseudomonas

plecoglossicida

[KF358256]


Corralimorphs

sp. WEEK

C2(2)

Vibrio communis

[HQ161744]


Corralimorphs

sp. WEEK 2(1)


[EU249987]


Corralimorphs

sp. WEEK 7(4)

Bacillus cereus

[HQ670590]

99%738/bp Bacilli

Corralimorphs

sp. WEEK 7(9)

Desulfovibrio vulgaris

[KC462187]


Corralimorphs

sp. WEEK

8(14)

Bacillus thuriengiensis

[FJ897722]


Corralimorphs

sp. WEEK 8(2)

Pseudoalteromonas

prydensis

[HM584031]


Corralimorphs

sp. WEEK 8(5)

Vibrio harveyi

[KJ00304]


P a g e | 118

Corralimorphs

sp. WEEK 8(1)

Lysinibacillus

fusiformis [JN012077]

99%/1458bp Bacilli

Corralimorphs

sp. WEEK 8(3)

Vibrio harveyi

[KJ00304]


Corralimorphs

sp. WEEK 8(6)

Lysinibacillus

fusiformis

[KM817206]

100%/1506bp Bacilli

Corralimorphs

sp. WEEK 8(9)

Vibrio owensii

[HQ908687]


Corralimorphs

sp. WEEK

8(10)

Lysinibacillus

sphaericus [FJ844477]

100%/1286bp Bacilli

Documents

Community analysis of coral mucus-associated bacteria and