Virus Research 136 (2008) 16–29

Contents lists available at ScienceDirect

Virus Research

journa l homepage: www.e lsev ier .com/ locate /v i rusres

Comparative genomics of serotype Asia 1 foot-and-mouth disease virusisolates from India sampled over the last two decades

Jajati K. Mohapatraa, Aniket Sanyala,∗, Divakar Hemadria, Chakradhar Tosha,1,

Subhajit Biswasa, Nick J. Knowlesb, Thaha J. Rasoola,2, Santanu K. Bandyopadhyaya,3,Bramhadev Pattnaika

a Project Directorate on Foot-and-Mouth Disease, Indian Veterinary Research Institute Campus, Mukteswar-Kumaon,Nainital 263138, Uttarakhand, India

GU24

mpar(FMD

tic se, evocificvariasom

ein clc site. A sin

b Institute for Animal Health, Pirbright Laboratory, Ash Road, Pirbright, Woking, Surrey

a r t i c l e i n f o

Article history:Received 17 January 2008Received in revised form 3 April 2008Accepted 11 April 2008Available online 3 June 2008

Keywords:FMD virusSerotype Asia 1Comparative genomics

a b s t r a c t

This study deals with a co1 foot-and-mouth diseasecine strains and seven exoat the entire coding regiondent from the lineage-spepolyprotein region to be inpositive selection of whichcontact residues, polyprotother serotypes. Antigeniextreme immune pressure

turing an extensive deletion atrecombination in natural evoluUTRs, VP1 and 3A could not begenomes of type Asia 1 virus ad

1. Introduction

Foot-and-mouth disease (FMD) is a highly contagious disease offarm livestock with serious economic implications in an endemiccountry like India. Foot-and-mouth disease virus (FMDV) is the pro-totype member of the Aphthovirus genus in the family Picornaviridae(VII report, ICTV (2000)). FMDV RNA replication is error-proneso that viral populations consist of mutant spectra (quasispecies)rather than a defined genomic sequence (Domingo et al., 2002).Notwithstanding the fact that FMDV is the first animal virus tobe discovered more than two centuries ago, the role of differentgenes/motifs, processes involved in fundamental virus biology anddisease pathogenesis are still inexplicable. Although full length

∗ Corresponding author. Tel.: +91 5942 286004; fax: +91 5942 286307.E-mail address: asanyal68@rediffmail.com (A. Sanyal).

1 Present address: High Security Animal Disease Laboratory, Indian VeterinaryResearch Institute, H.K. Farm, Anand Nagar, Bhopal 462021, Madhya Pradesh, India.

2 Present Address: Animal Production and Breeding, Krishi Bhavan, 110001 NewDelhi, India.

3 Present Address: 234A, Krishi Bhavan, 110001 New Delhi, India.

0168-1702/$ – see front matter © 2008 Elsevier B.V. All rights reserved.doi:10.1016/j.virusres.2008.04.010

0NF, United Kingdom

ative analysis of complete genome sequences of twenty-one serotype Asia) field viruses isolated over a period of two decades from India, two vac-

quences. The Indian viruses could be grouped in to three distinct lineageslving independently probably under differential selection pressure as evi-signatures identified. This comparison revealed 80% of amino acids at thent. Twenty-one residues in L, 3A and P1 region were identified to be undere are antigenically critical. Analysis at functionally crucial motifs, receptoreavage sites and at putative T-cell epitopes expands the knowledge beyondII in �B-�C loop of VP2 was highly unstable suggesting its exposure togle cross-over at the L proteinase region in an isolate from buffalo, also fea-

the 5′ untranslated region (UTR), reflects the role of intraserotypic genetiction. The likely biological relevance of deletions/insertions observed atdeduced. Altogether, a substantial amount of data raised on full length

ds value to the FMD virus genomics.© 2008 Elsevier B.V. All rights reserved.

genome sequence has been generated for a few isolates and vaccinestrains (Kanno et al., 2002; Pereda et al., 2002; Sanyal et al., 2004b)and a couple of comparative analyses involving complete genomesequences of 103 isolates representing all the seven serotypes(Carrillo et al., 2005) and few PanAsia strains (Mason et al., 2003b;Oem et al., 2004) are available, the data for type Asia 1 is scanty.Recently only two type Asia 1 outbreak strains from China havebeen sequenced at the complete genome level and compared withreference sequences (Li et al., 2007). In the comparative genomicsinvolving 103 sequences from all seven serotypes (Carrillo et al.,2005), only six isolates of serotype Asia 1 were included.

Therefore, the present study was aimed at generating com-plete genome sequences for a large number of type Asia 1 fieldviruses from India. This expansion of data base has been ofimmense help in understanding the phylogeny and trend of evo-lution of the virus at regions beyond the conventional structuralprotein coding region including frequency of genetic recombina-tion, in identifying amino acid residues under positive selectionand lineage-specific genetic signatures and in reflecting varia-tion at antigenic sites and functionally critical motifs involved inpathogenesis.

us Res

J.K. Mohapatra et al. / Vir

2. Materials and methods

2.1. RNA isolation, RT-PCR amplification, and sequencing of thecomplete genome

Serotype Asia 1 FMD viruses (n = 21) isolated from different partsof the country during 1986–2003 and available at the NationalRepository of the Project Directorate on FMD (PD FMD), India, in theform of infected cell culture antigen (Passage level 5 or 6) were usedin this study (Table 1). Genomic RNA was extracted from infectedcell culture supernatants using RNeasy Mini Kit (Qiagen, Germany)and reverse transcribed using MMuLV RT (Promega, USA) and oligod(T)15 primer. Then the cDNA corresponding to the entire viral RNAwas amplified in several different overlapping fragments using Hot-star PCR kit (Qiagen, Germany). The details of PCR and sequencingprimers used are depicted in Table 2. Cycle sequencing reactions ofgel-purified products were carried out using Cy5 labeled primersand fmol DNA cycle sequencing system (Promega, USA). Sequenceswere obtained from PCR amplicons without cloning, reflecting themajority of the population for each case, instead of single individu-

als. Sequence of the 5′ and 3′ ends and both sides of the poly (C) tractwere artificially included in the primers used for amplification.

2.2. Sequence analysis

Molecular sequences (nucleotide and amino acids) werealigned using Clustal W/X algorithm (Thompson et al., 1994,1997). The nucleotide sequence homology/divergence was deter-mined using DNASTAR program package (DNASTAR, Inc., USA).Transition–transversion ratio was estimated using TreePuzzle5.0 (Strimmer and von Haeseler, 1996). Nucleotide (nt) andamino acid (aa) divergence/homology were obtained usingClustalW. For statistical evaluation of heterogeneous selectionpressure at amino acid residues, CODEML (PAML3.14) was used(Yang, 1999; Yang et al., 2000). Analyses of codons and syn-onymous/nonsynonymous substitution ratios and phylogeneticanalysis was performed using MEGA v. 2.1 (Kumar et al., 2001).Tamura and Nei (1993) model of nucleotide substitution withgamma-distribution of among-site rate heterogeneity (with eightcategories) (termed as TrN + G model) available in MEGA was usedto construct the trees. The tree topologies were evaluated using

Table 1History of FMDV type Asia 1 viruses isolated in BHK-21 cells at 5th or 6th passage level

Sl. No. Isolate No. Date of Collection Place of Outbreak

1 IND 81/86 00/00/1986 Manipur2 IND 52/87 26/09/1986 Haryana3 IND 21/89 00/00/1989 Uttar Pradesh4 IND 116/90 00/00/1990 Haryana5 IND 13/91 21/09/1990 Maharashtra6 IND 247/92 06/03/1992 Maharashtra7 IND 47/93 17/02/1993 Uttar Pradesh8 IND 151/94 16/12/1993 Haryana9 IND 82/96 00/00/1996 Himachal Pradesh

10 IND 397/97 03/11/1994 Karnataka11 IND 101/99 07/01/1999 Haryana12 IND 334/00 22/07/2000 Assam13 IND 148/01 20/12/2000 Gujarat14 IND 354/01 28/09/2001 Assam15 IND 423/01 00/00/2001 Haryana16 IND 438/01 11/12/2001 Uttar Pradesh17 IND 37/02 00/00/2002 Andhra Pradesh18 IND 61/02 00/00/2002 Gujarat19 IND 139/02 27/02/2002 Bihar20 IND 182/02 16/01/2002 West Bengal21 IND 97/03 09/02/2002 Orissa

V, vaccinated; UV, unvaccinated; NA, not available.

earch 136 (2008) 16–29 17

10,000 replicates of the data set. Similarity plots and bootscanninganalysis by sliding window was performed as implemented inthe SimPlot, v. 2.5 package (Ray, 1999). The secondary struc-tures of the 3′ UTR and sequence between two alternate startcodons in L gene were obtained by submitting the relevantsequences to mfold program (v. 3.1), 2004, Washington University,available as an online server linked to M. Zuker’s home page(http://bioweb.pasteur.fr/seqanal/interfaces/mfold-simple.html)(Zuker et al., 1999). Transmembrane protein segment prediction at2B, 2C, 3A and 3C regions was carried out using Tmpred (Hofmannand Stoffel, 1993), Toppred (Von Heijne, 1992) and SPLIT 4.0 (Jureticet al., 1999).

The following Asia 1 sequences (accession numbers in paren-theses) were taken from GenBank and included in the analysis:PAK/1/54 (AY593795); ISR/3/63 (AY593796); 3Kimron iso 61 (anattenuated vaccine strain derived from an Israeli outbreak virus,probably ISR/1/57) (AY593797); LEB/83 (AY593798; AY593799;AY593800); YNBS/China/58 (AY390432); Indian vaccine strainsIND 63/72 (NC004915) and IND 491/97 (AY687334) and a serotypeO sequence, i.e., O UK/2001 (AY593836) as an outgroup for tree

construction.

3. Results and discussion

In Asia 1 field isolates, the length of the complete genomes bar-ring the poly (C) tract and including artificial ‘A’ residues (9 in no.)incorporated in the primer corresponding to the poly (A) tail rangedfrom 8088 to 8171 nucleotides. Variability in the genome sizes weredue to deletion/insertions observed in the UTRs (Fig. 1A), VP1 and3A (Fig. 1B) regions.

3.1. Phylogenetic analysis

Phylogenetic analyses for molecular epidemiological surveil-lance based on 1D region of Asia 1 field isolates, have identifiedthe existence of two genetic lineages in India (Mohapatra et al.,2002, 2004). Within the widely circulating lineage VI, a divergentgroup with more than 10% nt divergence at 1D region that is respon-sible for most of the studied outbreaks since 2001 has also beenidentified (Sanyal et al., 2004a).

Host Species Vaccination Status GenBank Accession No.

Bovine NA DQ989306Bubaline NA DQ989313Bubaline NA DQ989316Bovine V DQ989305Ovine UV DQ989312Bovine UV DQ989307Bovine UV DQ989315Bovine UV DQ989303Bovine NA DQ989309Bovine V DQ989308Bovine UV DQ989310Bovine NA DQ989304Bubaline NA DQ989317Bovine NA DQ989314Bovine NA DQ989319Bovine UV DQ989321Bubaline NA DQ989311Bovine NA DQ989318Bovine NA DQ989322Bovine UV DQ989320Bovine UV DQ989323

18 J.K. Mohapatra et al. / Virus Research 136 (2008) 16–29

Table 2Details of deoxyoligonucleotide primers used in this study

Designation Sequence (5′ → 3′) Locationc and polarity Reference

SF1Fa,b TTGAAAGGGGGCGCTAGGGTC SFUTR1 (+) Toja et al. (1999)SF370Ra CGGTAAAACTTAGGGGGGATGAAAGGCGGGCGCCGGGTG SFUTR370 (−) Sanyal et al. (2004a,b)SF370Rsb CGGTAAAACTTAGGGGGGATG SFUTR370 (−) Sanyal et al. (2004a,b)LF1Fa CCCCCCTAAGTTTTACCGTCGTTCCCG LFUTR1 (+) Sanyal et al. (2004a,b)MG39a GGTGGTGAGGATGCGGTCTTC 1B51 (−) George (2000)DH13b TGTAGACCCAGTCGAAG L217 (−) Sanyal et al. (2004a,b)LFUTR598Rb AGCCCCAGTCCCCTTCTCAG LFUTR598 (−) Biswas et al. (2005)L01Fa,b GTGCCCCAGTTTAAAAAGCTT LFUTR633 (+) Roberts and Belsham (1995)NK61a,b GACATGTCCTCCTGCATCTG 2B77 (−) Knowles and Samuel (1995)MG1D180a ATGCAGATCCCCTCACACACGCTG 1D157(+) This study1C505a,b TACACTGCTTCTGACGTGGC 1C502 (+) Knowles and Samuel (1995)DH1b AACAACTACTACATGCA 1A67 (+) Sabarinath (2001)MG45b GGCAACATGGTGACCACAGACCC 1C34 (+) Gurumurthy (2000)MG41b GTAGGTGTTGGACATGTGCCCCGC 1C267 (−) Gurumurthy (2000)NK72b GAAGGGCCCAGGGTTGGACTC 2B6 (−) Knowles and Samuel (1995)NK72Fb GAGTCCAACCCTGGGCCCTTC 2A34 (+) Sanyal et al. (2004a,b)2B325b GACTCGCTCTCCAGTCTCTTT 2B325 (+) Sanyal et al. (2004a,b)MG32b TGTCTCCGTGGCAAATCCGGCCA 2C319 (+) George (2000)3D26Rb ACATCTCTGGTGTCAACAATCAACCCCTCGTG 3D26 (−) Sanyal et al. (2004a,b)3D331Rb AGGCGCGGTGTCTGGCTCCAT 3D351 (−) George (2000)3D786Rb GCGGAACACCTCCTCAAACAT 3D786 (−) George (2000)CTLV2b TGATCTGTAGCTTGGTATCT 3D1371 (−) Pattnaik et al. (1997)3D1081a,b GGCCAAACCATCACTCCAGCTGA 3D1081 (+) George (2000)3C552Fb GGCAATGGAGTTGGATACTGCTC 3C553 (+) This study1D128Rb GTGAGTTTCACAAACCTGTC 1D128 (−) This studyMG58a GGTCGAGACCATTTGGGCAAAGTA 2C540 (−) George (2000)MG5a GTCCGGATCCATGCCCTTCTTTTTCTCC 2B1 (+) George (2000)L463Ra ACCTCCRACGGGTGGTACGC L463 (+) George (2000)MG7a AGCAGGATCCATGCTCAAAGCACGT 2C1 (+) George (2000)MG8a AGAAGCGGCCGCTCACTGCTTGAAGATCGG 2C954 (−) George (2000)MG33a,b ATGCAACAAGATATGTTTAAGCC 2C835 (+) George (2000)CTLV10a CATCGACAATGCGAGTCTTGCC 3D547 (−) Pattnaik et al. (1997)MG15a ACCAGGATCCATGGGGTTGATCGTTGAC 3D1 (+) George (2000)MG16a ACATGCGGCCGCTTATGCGTCACCGCACAC 3D1410 (−) George (2000)

a Primers used for PCR amplification of the complete genome.b Primers used for sequencing of the complete genome.c Location is given as per the sequence of IND 63/72.

Table 3Lineage-specific signature nucleotides in the untranslated regions of serotype Asia 1 FMD virus isolates from India

Genome region Location of change Consensus nt. residue Lineage specific change Signature for lineage

5′UTR S-Fragment 22 U C Lineage V-A129 G U208 C A

35 G A Lineage VI-B141 C U197 U C334 C U

5′UTR L-Fragment 26 G U Lineage V-A109 U C125 A G170 U A259 U A260 U G465 C A

345 U A Lineage VI-B670 G A689 C U695 U G713 U C

3′-UTR 53 U C Lineage V-A68 C G73 G C

J.K. Mohapatra et al. / Virus Research 136 (2008) 16–29 19

Fig. 1. (A) FMDV type Asia 1 UTR alignment. Underlined positions are tolerant to deletion/positions, single letter nucleotides are invariant. The established motifs identified previFMDV Asia 1 viruses. Amino acid residues are shown by single letter codes and variable po

Phylogenetic analysis was carried out at the entire coding region(Fig. 2), at different primary cleavage products (L, P1, P2 and P3)and at individual genetic regions and UTRs separately. The treesdisplayed similar overall topology as observed at 1D region excepta few shifts at non-structural and UTR-based trees for lineage VIisolates (figures not shown). The neighbor-joining (N-J) tree basedon 1D region segregated all sequence entries into six lineages (fig-ure not shown) as supported by high bootstrap confidence levels.A criterion of more than 0.12 nt substitution per site at 1D regionwas followed for lineage distinction and the designations are asper a previous report (Sanyal et al., 2004a). Isolates from Indiawere distributed into three different temporal groups in the entirecoding region-based tree. Lineage V-A accommodated one of thevaccine strains and three isolates, while V-B consisted of two olderisolates from Israel. Genetically lineage VI was the most hetero-geneous as evident from the branch lengths in N-J tree and couldbe divided into five sub-clusters (VI-A to VI-E) further. Lineage VI-B

insertion. Nts. in bold indicate primers used for amplification. Dot indicates variableously are shown as bold italicized. (B) Amino acid alignment for coding region ofsitions are underlined. Positions that could accept insertions/deletions are in bold.

encompassed all viruses of the divergent group. Hence analysis of ntsequence of not only VP1, but the entire genome has suggested thatthey are sufficiently divergent to be assigned to a separate subgroupwithin lineage VI. Though group-specific changes were noticed atboth non-coding (Table 3) and coding regions (Table 4) for thisdivergent group, to pinpoint precisely the genetic determinants forits extra fitness leading to recent emergence requires further inves-tigation by reverse genetics approach. Isolate IND 47/93 of lineageVI was placed as the closest neighbor to this divergent group andno other isolate from 1993 to 2000 could group in the divergentgroup. Although it will be erroneous to predict this as the ances-tor considering the random selection of samples, we assume thatrelated viruses of this group did exist in the field before. LineageVII comprised only a single older virus (IND 52/87) and at genomelevel, possessed many signatures which are exclusive to it. This iso-late, is perhaps a mutant that had an abrupt origin, lost its fitnesssubsequently and might have entered an evolutionary cul-de-sac.

20 J.K. Mohapatra et al. / Virus Research 136 (2008) 16–29

n (L–3

Fig. 2. Neighbor-joining tree depicting lineage distribution at complete coding regiofrom [1000] re-samples. Vaccine strain sequences are underlined.

Delineation of genetic groups among Indian isolates did not cor-relate with geographical origin within the country which may beexplained in part by the absence of restriction on movement oflivestock and endemic nature of the disease. Lineage-specific sig-natures bolster the notion that distinct selective pressure existsfor different lineages and they are evolving independent of eachother. The other three lineages (lineage I, III and IV) were formedexclusively by exotic isolates from Pakistan, Lebanon and China,respectively, confirming the genetic distinctness of the Indian iso-lates.

3.2. Nucleotide sequence and secondary structure analysis atuntranslated regions

3.2.1. 5′ UTR short fragment (S-UTR)The length of S-UTR varied from 366 to 371 nucleotides (nt)

(Fig. 1A). The short fragment was the most variable when comparedto the large fragment of the 5′ UTR or the 3′ UTR (Table 5). As the sec-ondary structure at this region of Asia 1 virus was not available, theminimum-free-energy and most thermodynamically stable struc-tures predicted here resembled that for the O/TAW/2/99 (Mason et

D) of Asia 1 viruses. Values at nodes indicate the level of bootstrap support deduced

al., 2003b). Overall structure consisted of a long stem loop with vari-able number of short unpaired regions within the stem (data notshown). Considerable sequence heterogeneity observed along theentire length of S-fragment did not get reflected in the secondarystructure, probably because of compensatory mutations.

3.2.2. 5′ UTR large fragment (L-UTR)Isolates of lineage V-A had 667 nt long L-UTR, while it was 709

to 711 nt for lineage VI except IND 37/02, featuring an extensivedeletion of 88 nt (position 30 to 117), where the length was 626 nt(Fig. 1A). Relative to the alignment, 43 nt (from position 31 to 74)were missing in lineage V-A viruses, indicating that the two lineageswere distinct even at the primary sequence length. A difference inthe number of probable pseudoknots (PKs) also existed betweenlineages, where Lineage V-A and lineage VI had 3 and 4 PKs, respec-tively. IND 37/02, an isolate from buffalo, revealed only two intactPKs as observed earlier for a type C virus (Escarmis et al., 1995).Interestingly, variation in the number and redundancy of PKs hadno perceptible effect on virus replication in BHK-21 cells. The stem1 of PK IV was completely conserved, concordant with the compar-ison made with all serotypes (Feng et al., 2004). The higher degree

J.K. Mohapatra et al. / Virus Research 136 (2008) 16–29 21

Table 4Lineage-specific signature amino acids in the complete coding region of serotype Asia 1 FMD virus isolates from India

Genome region Location of change Majority aa residue Lineage specific change Signature for lineage

L 12 H Y Lineage V-A14 L I19 T A20 L R21 F L27 G E

180 F1A 77 S1B 74 A

91 Y172 A

1C 130 T134 D219 Q

1D 24 T50 T85 P

101 Q146 M155 G196 Q93 S

146 M2B 38 S3B 45 V3C 200 L

201 K3D 68 E

74 F

of conservation of PK IV and the fact that no natural isolate lackingthis structure could be detected emphasize the existence of certainstructural/functional constraint on this region.

Taking G218 of domain-1 as the extreme 5′ boundary andU697 of the polypyrimidine tract as the 3′ extremity of the IRES,type Asia 1 was found to have IRES of 480 nt. Among the fivedomains of IRES, domain 3 showed maximum variability. The[A240AACA244] motif in domain-1, known to act as cre (Mason etal., 2002), the motif U304UUC307 in domain 2, essential for bind-ing of the polypyrimidine tract-binding protein (Luz and Beck,1991), G428NRA431, R449AAA452 and A484CCC487 motifs in domain 3,which are essential for the proper functioning of the IRES (Lopez deQuinto and Martinez-Salas, 1997), A-rich bulge (A648AAAAGCU655)in domain 4 were found totally conserved (Fig. 1A). The sequences[A585GGUAAC591] and [C602GGGAUCUGAGA613] in domain 4 cru-cial for binding of eukaryotic initiation factors, eIF-4B and eIF-4G(Rust et al., 1999; Saleh et al., 2001) were found conserved in all

Table 5Summary of nucleotide sequence variability in the serotype Asia 1 FMD virus genomes

Genome region No. of nt. positions aligned No. of invariant nt. % Invaria

5′S-UTR 373 194 525′L-UTR 714 468 663′-UTR 112 62 55ORF 6987 4856 69.5L 603 361 591A 255 173 671B 654 453 691C 657 460 701D 633 380 602A 48 33 682B 462 343 742C 954 700 733A 459 320 693B 213 147 693C 639 465 723D 1410 1021 72

YT Lineage V-AS Lineage V-AFKE Lineage V-AEES Lineage V-AISHLNHS Lineage VIMT Lineage V-AA Lineage V-AQ Lineage V-A

RA Lineage V-AY

but five and one isolates, respectively. The tertiary structural ele-ment (A651AGCUUCUACGCCUGAAUAG670) in FMDV O/SKR/2000,complementary to the 3′ end of 18S rRNA downstream of IRES isthought to be playing a role in guiding the ribosome to the viralRNA downstream of IRES (Hagenbuchle et al., 1978; Kweon et al.,2002). In type Asia 1, the aforesaid sequence was found to acceptchanges at positions 653, 655, 660, 666 and 670.

Mutagenesis studies carried out with infectious clone of FMDVO1K had shown that the pyrimidine-rich sequence preceding thestart codon was most sensitive in that conversion of single pyrim-idine residue to purine decreased translation efficiency drastically(Kuhn et al., 1990). In contrast, mutation of the entire polypyrim-idine tract of Ectropis obliqua picorna-like virus (EoPV) IRES withpurine residues has suggested it is not crucial to IRES function,although contributes to maximal IRES activity (Lu et al., 2006).Among the field isolates under study, a polypyrimidine tract in truesense was observed in all the viruses except lineage VI-B, which

nt nt. Nt. substitutions/site Ts/Tv ratio Maximum pairwise nt.divergence (%)

0.126 3.34 ± 0.40 22.60.07 4.06 ± 0.48 11.70.075 2.32 ± 0.55 21.60.09 5.19 ± 0.15 11.70.14 4.98 ± 0.37 20.30.11 5.80 ± 0.76 17.10.11 5.21 ± 1.10 17.70.11 3.38 ± 0.19 17.40.13 3.85 ± 0.34 22.60.08 4.57 ± 1.53 23.50.06 4.51 ± 0.59 10.40.07 5.31 ± 0.45 10.90.08 5.44 ± 0.77 13.50.07 4.23 ± 0.77 11.90.07 5.28 ± 0.57 11.10.07 5.94 ± 0.40 9.7

us Res

22 J.K. Mohapatra et al. / Vir

exhibited a group-specific transversion (U695 → G) within this tractas reported by us before (Biswas et al., 2005). It was intriguing toobserve that such purine substitutions in the polypyrimidine tracthad no impact on viral multiplication as evident from the infectioustitres (6.0–7.5 log10TCID50/ml), although translation efficiency wasnot directly measured. Hence, we presume that if at all the mutationmight have impaired translation efficiency, the observed virus titrescould be the result of some compensatory changes modulatingother steps in the virus life cycle. Downstream of the polypyrim-idine tract a variable region of 16–17 nt length existed ahead ofthe first start codon. Nineteen out of 21 nt in domain 5 were con-served in type Asia 1 making it the most stable domain in theIRES.

3.2.3. 3′ UTRThe length of the 3′ UTR, barring poly (A) tail varied from 93 to

95 nt and a double stem-loop (Y shaped) structure was predictedfor type Asia 1 (Fig. 3A) as for chinese isolates (Li et al., 2007).The termination codon TA/GA was followed by a conserved hepta-nucleotide sequence (UCCCUCA, except in IND 82/96 where the firstU is replaced by C) and a variable region of 25 nt (Position 11–35)as reported before (Martinez-Salas et al., 1985) in 3′ UTR of otherserotypes.

3.3. Nucleotide and deduced amino acid sequence analysis atpolyprotein coding region with reference to functionally criticalmotifs

The nucleotide and amino acid variability at all individual pro-tein regions are summarized in Tables 5 and 6. The positions alignedare equal to the length of the respective proteins in all isolatesexcept a codon deletion in 1D and 3A for lineage V-A and lineageVII isolates, respectively. Maximum pairwise nt and aa divergenceamong the sequences were 11.7% and 5.8% at the polyprotein codingregion. A total number of 2329 aa positions were aligned (Fig. 1B)with 80% invariant positions. The percentage of positions acceptinga single alternate aa and multiple aa replacements were 15% and4%, respectively.

3.3.1. L proteinase

The aa residues of the catalytic triad of Lpro, i.e., C51, H148 and

D164 (Roberts and Belsham, 1995), residues thought to be involvedin substrate binding and cleavage of eIF4G cellular factor (Guarneet al., 1998) viz. T55, H109, H138 and E147 (Piccone et al., 1995), wereconserved in all the viruses compared. A residue involved in Lpro

autocatalysis (Piccone et al., 1995), E76, was found to be conservedin 80% of the isolates. A lot of sequence variability was observed atthe C-terminus and between the two start codons, which may beinvolved in preferential start codon recognition perhaps by inter-acting with regulatory factors (Van Rensberg et al., 2002). A totalof 50 nt positions (78%) in the first 84 nt were tolerating muta-tions against 192 positions (37%) in the Lb region and 60% of theN-terminus 28 residues against 28% of the Lb residues could toler-ate aa replacements. A cysteine residue at position 6 was the onlyinvariant residue at the N-terminal hypervariable region. The sec-ondary structures between the two start codons in all isolates werepredicted to form stable double hairpin structures except three iso-lates belonging to lineage VI and VII, where a single long hairpin wasobserved at minimum-free-energy level (Fig. 3B and C). Althoughthe significance of this structural deviation is not clear, but boththese intervening stable stem-loop patterns probably bring the twostart codons into proximity which might dictate their subsequentselective recognition for translation of two different Lpro species.

earch 136 (2008) 16–29

3.3.2. Structural proteinsThe S73 euroasiatic signature in VP4 (Carrillo et al., 2005),

residues predicted to be important in 1A-1B cleavage (Basavappaet al., 1994), V32, T33 and Y36 (in the 22–36 conserved motif) andL83, P144 and H145 in VP2, G39, F41 and A50 (in the 45–53 motif,LDVAEACPT) in VP3 and P186 in the motif R(M/I)KRA(E/D)TYCPR(from position 177 to 187) in VP1, and histidine residues at posi-tions 21, 87, 145, 157 and 174 in VP2 that mediate H-bonding at1B/1C interphase (Carrillo et al., 2005) were conserved. In addition,three more His residues at 65, 77 and 209 in VP2 and at positions84, 107 and 143 in VP3 were conserved in Asia 1, suggesting that thecritical function of these residues may be contextual. N-termini offive VP3 molecules constitute the �-annulus. Fifty three N-terminusresidues of VP3, including P4 (involved in binding to 3C protease)and C7 (for disulfide bonding between VP3 N-termini) were foundto be conserved barring only five variable positions.

3.3.3. 2AFMDV 2A is an 18-aa peptide which induces modification of

cellular translation machinery resulting in its release. The motifDVEXNPG required for encephalomyocarditis virus 2A activity(Donnelly et al., 1997) was found conserved in type Asia 1 too.

3.3.4. 2BWe predicted a transmembrane domain from position 113 to 138

in 2B region which was conserved with only three positions show-ing replacements with similar polarity aa, supporting the conceptthat 2B is an integral membrane protein and perhaps localizes toER-derived vesicles (Tesar and Marquardt, 1989).

3.3.5. 2CIn spite of the fact that FMDV 2C localizes to membrane asso-

ciated virus replicating complexes (Tesar and Marquardt, 1989),we could not predict any transmembrane helix in 2C region. Theputative ATP/GTP binding domains predicted at positions 110–116(GKSGQGK), at 160–163 (DDLG) and at 243–246 (NKLD) (Dever etal., 1987) were conserved.

3.3.6. 3A3A protein was found to be a highly variable non-structural

protein with only 71% invariant aa positions. The C-terminalhydrophobic domain of 3A was found to be highly variable as

reported before (Biswas et al., 2006). Deletions in 3A protein pref-erentially lie in 70–110 and 130–150 regions (Knowles et al., 2001).Here an 18 aa deletion (residues 85–103) was observed in 3Kim-ron iso 61; this coincided with deletions of 19 and 20 aa previouslyobserved with artificially attenuated (egg passaged) FMD virusesO1 Campos and C3 Resende, respectively (Giraudo et al., 1990). Asimilar, but shorter (10 aa), deletion was also reported in the sameposition for “pig-adapted” FMD O viruses of the CATHAY topotype(Beard and Mason, 2000; Knowles et al., 2001). The Asia 1 3Kimroniso 61 virus was produced by passage (n ≈ 39) of an Israeli field virusthrough embryonated chicken eggs (Komarov and Goldsmit, 1959).A single deletion (Q149) was seen in the buffalo isolate IND 52/87,although this did not overlap with other deletions that affect hostspecificity and attenuation phenotype. Lack of proper documenta-tion of that particular outbreak deprives us of drawing any preciousconclusion at present regarding the pathogenic potential of thisvirus in other host species. Other characteristic changes uniqueto IND 52/87 at 3A were D88 → N, N112 → S, L114 → Q, S117 → N,G118 → S, S120 → A, K144 → E and E148 → R. In compliance with theprevious prediction of transmembrane domain at residues 60–76(Knowles et al., 2001), we also predicted a similar domain fromposition 58 to 78.

J.K. Mohapatra et al. / Virus Research 136 (2008) 16–29 23

Fig. 3. Predicted RNA secondary structures for serotype Asia 1 viruses. (A) 3′ UTR of IND 334/00. (B) Region between the first two start codons in Lpro in IND 151/94. (C)Alternate structure for the region between the first two start codons in Lpro in IND 101/99.

us Res

24 J.K. Mohapatra et al. / Vir

3.3.7. 3BAmong all three copies of VPg, 3B3 was found to be least vari-

able favouring the previous finding that this isoform is essentialfor viability of the virus (Pacheco et al., 2003). The C-termini weremore variable in each copy and no variation in copy number wasobserved. This is notable as an engineered virus carrying singlecopy of VPg has been found to have reduced replication efficiencyin homologous cell system (Mason et al., 2003a). The Y3 residuethought to be involved in uridylation (Paul et al., 1998) of VPg wasconserved in all the copies, besides four more residues viz. G1, P2,G4 and P5.

3.3.8. 3C3C proteinase is involved in most of the viral precursor pro-

tein cleavage and was found to be intolerant to alterations at manypositions, likely due to structural/functional constraints. Residuesforming catalytic triad (H46, D84 and C163), residue responsible forsubstrate binding (H181) and those involved in proper protein fold-ing D84 and Y136 (Grubman et al., 1995) were 100% conserved.We predicted a conserved transmembrane domain at aa position22–44.

3.3.9. 3DA total of eight motifs important in formation of the core struc-

ture of the polymerase for other picornaviruses have been proposed(Koonin, 1991). Out of these, motif IV (239–249), V (P297SG299), VI(Y336GDD339) and VII (F385LKR388), five critical residues that main-tain functional integrity of the polymerase viz. D165 in motif I, S298and N307 in motif V and G337 and D338 in motif VI, besides D245 andG295 and the nucleotide triphosphate binding residues, G337, D338and D339 (Xiang et al., 1998) were conserved in type Asia 1.

3.4. Polyprotein cleavage site variability

The polyprotein cleavage sites (Carrillo et al., 2005) accepteda few more changes. The cleavage site sequences in this analy-sis are KRLK↓GAG for L/1A, ALLA↓DKK for 1A/1B, PSKE↓GIV for1B/1C, AR(R/Q)(Q/E) ↓TTT for 1C/1D, PEKQ↓(V/M/AT/L/D)(L/M)Nfor 1D/2A, (S/P)NPG↓PFF for 2A/2B, AE(K/R)Q↓L(K/R)A for 2B/2C,IFKQ↓IS(I/V) for 2C/3A, P(Q/H)(A/V)E↓GPY for 3A/3B, I(V/I)TE↓SGAfor 3B/3C and P(H/Q)HE↓GLI for 3C/3D junctions. At 3B1/3B2 and3B2/3B3 junctions an invariant E↓GPY motif was found.

3.5. Variations at T cell epitopes predicted for other serotypes

A previously identified heterotypic swine and bovine T cell epi-tope (position 20–35) in VP4 was found to be conserved in typeAsia 1 except S20 → G and M34 → I changes in lone isolates. T-cell epitopes predicted at stretches 48–68, 114–132 and 179–187in VP2 (Perez Filgueira et al., 2000) showed variations and thatpredicted at position 21–35 in 3A (Blanco et al., 2001) showedE24 → D change in five of the isolates. Probably this change in 3Afrom an acidic to another acidic aa will not affect the peptidechemistry significantly and hence this stretch is more likely to bea T-cell epitope in type Asia 1 as well. The T-cell epitopes pre-dicted for C-S8 virus at 13–23 and at 39–53 in VPg (Blanco et al.,2001) were variable in case of Asia 1 isolates, although many ofthe substitutions were of similar polarity or charge. Among thefive T-cell epitopes predicted in 3C protein, 51–75, 91–110 and191–210 stretches were more variable in type Asia 1, but 121–150and 161–180 regions showed one change at each stretch of conser-vative nature. So the last two regions in 3C are likely T-cell epitopecandidates in type Asia 1. The likely T-cell epitopes predicted heremerely based on sequence conservation at structural proteins, 3A

earch 136 (2008) 16–29

and 3C needs further confirmation for their exploitation in vaccineresearch.

3.6. Recombination analysis

The phenomenon of recombination between closely relatedstrains at the 3′ end half of the genome encoding the non-structuralproteins has already been established (Cooper et al., 1978; Giraudoet al., 1987; King, 1988; Krebs and Marquardt, 1993; Li et al., 2007).Though uncommon, the evidence of recombination in the capsid-coding region has also been reported in FMD virus (Haydon etal., 2004; Tosh et al., 2002). Here, the incongruities observed intree topology, constructed at individual non-structural protein cod-ing regions and UTRs owing to inconsistent grouping of certainlineage VI isolates hint towards intra-lineage recombination. A sus-pected recombinant, IND 37/02 (between parents IND 13/91 andIND 101/99) could be recognized on the basis of variation in itsgrouping position at 5′ UTR and L protease-based trees (data notshown) and further by similarity plot and bootscan analysis asimplemented in SimPlot 2.5 software (Ray, 1999). The recombina-torial breakpoint could be identified tentatively at 150 nt positionof L protease. In the region spanning 1–250 nt (112 nt of the 3′ endof 5′ UTR and 138 nt of the 5′ end of L) along the alignment of715 nt, the number of phylogenetic informative sites supportingIND 13/91 origin was 10:2:2 (with IND 13/91, IND 101/99 and IND151/94, respectively). Similarly, from 251 to 715 nt (465 nt of L)the number of informative sites supporting IND 101/99 origin was3:20:1 (with IND 13/91, IND 101/99 and IND 151/94, respectively).To support further the SimPlot results (Fig. 4A and B), phylogenetictrees were constructed for two genomic fragments correspondingto nt position 1–250 and 251–715 (Fig. 4C). In both trees, the group-ing of the predicted recombinant isolate with each of the parent wassupported by 99–100% bootstrap values. Interestingly, this recom-binant has buffalo as its host of origin and had a large deletion of88 nt in its large fragment of 5′ UTR leading to disruption of 2 PKs.

At the structural protein coding region, no such mosaic patterncould be identified, which has got importance in an endemic coun-try where multiple lineages of different serotypes co-circulate andthat can lead to formation of antigenic hybrids (Tosh et al., 2002). Soit implies that recombination events in the structural region of typeAsia 1 are relatively infrequent and phylogenetic analysis at thisregion maintains lineage-specific monophyly and recombinationhot spots lie in the non-structural regions.

3.7. Analysis of diversifying selection

Notably, the non-structural proteins L, 3A and 3B exhibitedvariability comparable to that of the structural proteins (Table 6)suggesting that these proteins are the most likely candidates forthe presence of sites experiencing adaptive evolution besides thestructural proteins. M1a (nearly neutral), M2a (positive selection),M7 (�) and M8 (� and �) models of codon substitution in CODEMLprogram were used for identifying sites under positive selection asper the recommendation of the author (Yang, 1999) and the resultsof the selection analysis are shown in Table 7.

For Lpro region, the average ω ratio for all sites varied from 0.102to 0.122 among all the four models compared, indicating a strongpurifying selection. Three sites (aa positions 19, 23 and 26) wereidentified to be under positive selection (ω = 1.53) with 81–93%posterior probabilities. More importantly all the three residuesidentified here are located in the hypervariable region between thetwo alternate initiation codons. For the 3A and 3B sequences, thetwo models (M2a and M8) that allow for positive selection did notperform better compared to their respective null models M1a andM7. However, model M8 identified three sites at residue positions

J.K. Mohapatra et al. / Virus Research 136 (2008) 16–29 25

Tab

le6

Sum

mar

yof

vari

abil

ity

inth

eam

ino

acid

sequ

ence

ofen

tire

cod

ing

regi

onin

sero

typ

eA

sia

1FM

Dvi

rus

Gen

ome

regi

onN

o.of

aap

osit

ion

sal

ign

ed

No.

ofin

vari

ant

aa%

Inva

rian

taa

Subs

titu

tion

sSy

n/N

onsy

nd

N/d

SPo

siti

ons

un

der

one

alte

rnat

eaa

rep

lace

men

t(%

)

Posi

tion

su

nd

erm

ult

iple

aare

pla

cem

ent

(%)

Max

imu

mp

airw

ise

aad

iver

gen

ce(%

)

Syn

Non

syn

OR

F23

2918

8280

619.

199

.79

6.2

0.06

342

(15%

)10

4(4

%)

5.8

L20

113

366

77.9

517

.34

4.4

90.

0841

(21%

)26

(12%

)15

.91A

8570

8229

.61.

8216

.26

0.02

12(1

4%)

3(3

%)

7.4

1B21

818

685

69.9

9.3

7.5

0.05

25(1

2%)

7(3

%)

6.7

1C21

918

383

79.9

9.3

8.6

0.04

30(1

4%)

6(2

%)

8.7

1D21

114

166

69.8

17.5

23.

980.

1143

(21%

)27

(12%

)15

.92A

1612

753.

670.

3311

.12

0.04

4(2

5%)

0(0

%)

13.7

2B15

413

386

28.3

23.

278.

660.

0416

(10%

)5

(3%

)5.

42C

318

273

8573

.12

6.93

10.5

50.

0338

(12%

)7

(2%

)5.

93A

153

110

7130

.87

6.6

4.6

80.

0833

(22%

)10

(6%

)13

3B71

5273

10.9

22.

973.

670.

1119

(27%

)0

(0%

)10

.63C

213

191

8950

.16

4.6

10.9

0.03

21(1

0%)

1(0

.4%

)5.

43D

470

398

8499

.65

10.0

89.

880.

0460

(13%

)12

(2%

)5.

3

Fig. 4. Recombination analysis of type Asia 1 FMD isolate IND 37/02, using SimPlot2.5 software. (A) Similarity plot of IND 37/02 in comparison with the two heterogenicparents, IND 13/91 (red) and IND 101/99 (blue) and IND 151/94 (green) as an out-group. The x-axis indicates nt. positions along the alignment and y-axis denotes thepercent similarity. (B) Bootscan plot of IND 37/02 supporting the clustering of IND37/02 with the parent isolates as in (A). y-Axis indicates the % of bootstrap valuesthat support the clustering of IND 37/02 with the parent isolates. (C) Neighbor-joining trees of the regions flanking the cross-over point, indicating the discordantbranching pattern of IND 37/02 (boxed). Nucleotide positions used in the alignmentsare shown above each tree. Percentage bootstrap values for the nodes carrying the

suspected recombinant are shown. Bars indicate nucleotide substitutions per site.

133, 144 and 146 with lower posterior probabilities (60–67%) in 3Adataset. These three positions, although identified with less convic-tion, by virtue of their location in the C-terminal third of 3A, whichis generally tolerant to deletions and probably contributes to viru-lence and host spectrum consequent upon point mutations, meritattention. Considering the plasticity of FMD virus genomes andtheir exposure to diverse ecological milieu prevailing in the coun-try with wide spectrum of susceptible host species, such strongpurifying selection looks surprising.

For the P1 sequences, using a Bayesian approach, nine sites (VP2:56, 100 and 131; VP3: 106 and VP1: 57, 95, 150, 154 and 209)were predicted to be under positive selection by both the mod-els M2a and M8. Additional six sites, VP3: 130 and 137 and VP1:109, 138, 140 and 155 were only predicted under M8 with poste-rior probabilities of 55–69%, and not confirmed in model M2a. Onlyrelatively few (∼2.4%) sites in the P1 region were undergoing diver-sifying selection with fewer showing higher posterior probabilityvalues. Of the sites found to be under positive selection, the highlysignificant ones (P > 0.9) were identified at positions 56, 100 and

26 J.K. Mohapatra et al. / Virus Research 136 (2008) 16–29

Table 7Parameter estimates and sites identified to be under positive selection for FMDV type Asia 1

Data set/model �, log likelihood Parameter estimates Positively selected sitesa

LM1a: −3467.46 ω = 0.122 NoneM2a: −3467.46 p0 = 0.932, ω0 = 0.058

p1 = 0.068, ω1 = 1.0p2 = 0.0, ω = 1.0 19A, 23S and 26Q

M7: � −3457.86 p = 0.270, q = 2.262 Not allowedM8: � and � −3454.28 p0 = 0.984, p = 0.358, q = 3.812

(p1 = 0.016), ω = 1.53 19A, 23S and 26Q

P1M1a: neutral −12698.34, 0.111 p0 = 0.928, ω0 = 0.043 Not allowed

p1 = 0.072, ω1 = 1M2a: selection −12698.34, 0.119 p0 = 0.928, ω0 = 0.043 VP2: 56T, 100Y, 131E

p1 = 0.051, ω1 = 1 VP3: 106Np2 = 0.021, ω = 1 VP1: 57S, 95D, 150Q, 154N, 209V

M7: � −12680.22, 0.096 p = 0.166, q = 1.480 Not allowedM8: � and � −12668.59, 0.094 p0 = 0.98, p = 0.23, q = 2.773 VP2: 56T, 100Y, 131E

(p1 = 0.019), ω = 1.26 VP3: 106N, 130E, 137RVP1: 57S, 95D, 109Q, 138Q, 140T

p0 =p1 =p0 =p1 =p2 =p = 0p0 =(p1 =

p0 =p1 =p0 =p1 =p2 =p = 13p0 =(p1 =

entifie

3AM1a: neutral −2106.80, 0.137

M2a: selection −2106.80, 0.137

M7: � −2105.21, 0.118M8: � and � −2105.07, 0.122

3BM1a: neutral −919.51, 0.117

M2a: selection −919.51, 0.117

M7: � −919.50, 0.117M8: � and � −919.50, 0.117

a Positively selected sites (numbering with reference to IND 63/72 sequence) idwithin 70–95% are in plain text and below 70% and above 50 are in italics.

131 of VP2 and 57 and 95 of VP1. It is to emphasize that residuesat VP2 56 and 131 had a posterior probability of 97% and 99.8%,respectively and residue 131 was also identified to be under posi-tive selection in FMDV type A (Tosh et al., 2003). The lower positive

selection pressure could be due to the episodic nature of positiveselection events, occurring against a background of strong purify-ing selection that influences many evolutionary paths of the virus.All the sites identified here have revealed multiple aa replacementsin field isolates. In endemic country, it is expected that low level ofantibody be maintained in the population. Hence, it is likely thatthe viruses circulating in the field are under immune pressure atsome stage of their evolutionary path and antibody-binding sitesare more likely to be undergoing positive selection due to immunepressure. Additional residues, besides the known antigenically crit-ical ones, where positive selection is operational could be playingan important role in the protein three-dimensional structures andmaintenance of overall antigenic sites of the virus. So any substitu-tion occurring at these residues resulting in immune escape cannotbe overruled.

3.8. Antigenic sites and cell attachment ligands

Of late, significant evidence for aa residues critical to the neu-tralizing antigenic sites of FMD virus type Asia 1 have come up(Manoj Kumar et al., 2004; Marquardt et al., 2000; Sanyal et al.,

150Q, 154N, 155R, 209V

0.920, ω0 = 0.06 Not allowed0.08, ω1 = 10.92, ω0 = 0.06 None0.009, ω1 = 10.071, ω = 1.237, q = 1.70 Not allowed0.960, p = 0.380, q = 3.91 133K, 144K and 146A0.04), ω = 1

1, ω0 = 0.117 Not allowed0.0, ω1 = 11, ω0 = 0.117 None0.0, ω1 = 10.0, ω = 1.206, q = 99 Not allowed

1, p = 13.206, q = 99 None0.0), ω = 1

d under Models M2a and M8; sites with posterior probabilities ≥0.95 are in bold,

1997, 2003) and four independent antigenic sites (I, II, IV in VP1,VP2, and VP3, respectively and site V located at C-terminus of VP3)have been mapped (Grazioli et al., 2004). To validate these find-ings further, we analyzed the variations occurring at these sites in

type Asia 1 field isolates circulating under partial immune pressureeither because of previous infection or ongoing vaccination. R142,flanking the cell attachment ‘RGD’ motif critical to site I in the largeand flexible �G-�H loop in VP1 was changed to G/S/M in a few iso-lates, but none simulated the change observed for the mutant, i.e.,R142 → Q. One of the MAR mutants against site I showed an addi-tional change at A121 → G (Grazioli et al., 2004), which was alsofound in one of the isolates (IND 81/86). Site II corresponding tothe �B-�C loop in VP2 involved multiple aa positions (viz. 67, 72,74, 77, 79) and mutants showed three simultaneous changes each.In this study, a pattern of three simultaneous changes as observedwith the mutants was not found with any of the isolates. At posi-tions, H79 → Y/C, N72 → D and A74 → S, substitutions were seen inthe field isolates. The substitution from A74 → S did not correspondto that observed in the mutant, but nevertheless was a signature forthe entire lineage V-A. One of the site II mutants incurred additionalchanges at VP1 48 and 207. In isolates of present study although VP1E207 was perfectly conserved, position 48 could accept three differ-ent (T/I/A) replacements. Site IV mapped to 58 or 59 residues of VP3within the B-B knob was found to be structurally related to the siteII as they lie close to each other on the capsid surface, around the

us Res

J.K. Mohapatra et al. / Vir

threefold axes of symmetry (Kitson et al., 1990) and a few mutantsfor site IV also revealed changes at VP2 67 and 77 residues. In thisstudy, G58 and E59 were observed except an E59 → D change as inthe mutant in only a single exotic sequence, but associated changesat site II were not seen. VP3 218, the residue critical to site V showeda variation R218 → Q akin to the mutants in a few isolates. Only iso-late, IND 52/87, belonging to the thought-to-be extinct lineage VII,sustained mutations at positions critical to both site I and site V,adding to its uniqueness further. Considering the replacements infield viruses at critical residues identified for antigenic sites, wesupport the significance of residues R142 for site I in VP1, N72, A74and H79 for site II in VP2, E59 for site IV in VP3 and R218 for site Vin VP3. Polyclonal serum resistant complete variants showed cer-tain consistent changes (Manoj Kumar et al., 2004) apart from thoseobserved in the site analysis study (Grazioli et al., 2004). The identi-fied positions at VP2 G82, S131, VP3 A8, V9, V66 and VP1 E202 and R152also showed variations among isolates of present study alike thevariants. Here site IV followed by site I are found to be geneticallymost stable even in a comparison of chronologically distant andgeographically separated data set indicating some level of struc-tural or functional constraints behind such limited variations. SiteII might be invoking bulk of the immune response as the majority ofthe isolates showed aa substitutions in the critical positions. Thissite was formerly proven to be as important as site 1 in terms ofimmunodominance and protection in heterohybridoma studies fortype O (Barnett et al., 1998).

Between the two cell surface receptors utilized by FMDV to gainentry into the cells (Jackson et al., 1996), the viruses of the presentstudy are expected to utilize predominantly the heparan sulfatemoiety as they have been adapted in BHK-21 cells (Sa-Carvalho etal., 1997). The integrin binding ligand ‘RGD’ tripeptide motif wasconserved throughout except single changes in ISR/3/63 (RGE) and3Kimron iso 61(HGD). R56 in VP3 and R135 in VP2 thought to becritical contact residues for heparan sulfate binding as in O1 BFS1860 and A10 Argentina/61 FMDV structural analysis (Fry et al.,1999) were 100% conserved even in two exotic isolates that havealtered RGD motifs. Although the crystallographic structure is notelucidated, high degree of conservation of these residues tempt usto postulate that this virus can utilize cell surface heparan sulfateto gain entry into the cells and the above residues are crucial inmaintaining the ligand structure.

To sum up, Indian isolates cluster into three lineages not only at1D but also at the entire polyprotein coding region and are distinctfrom the exotic sequences. These lineages are evolving indepen-

dently probably under differential selection pressure, evident fromthe lineage-specific signatures obtained at the entire genome leveland the similar grouping pattern observed irrespective of geneticregions. The secondary structures predicted here for the regionbetween two start codons in Lpro in type Asia 1 do match with thosepredicted for other serotypes except a deviation observed in fewisolates. A single event (IND 37/02) of suspected genetic recombi-nation at the Lpro is suggestive enough of the notorious evolutionprocess of this virus. Interestingly, only this virus has an extensivedeletion of 88 nucleotides in the 5′ UTR disrupting two PKs. Trans-membrane domains predicted for 2B, 2C, 3A and 3C indicate theirmembrane associated localization in type Asia 1 as well. The bio-logical significance of an amino acid deletion at C-terminal regionof 3A in an isolate from buffalo remains to be studied. Out of 21residues experiencing positive selection in 3A, L and P1 region,those identified at neutralizing antigenic sites and variations atthose sites in field isolates open new vistas in the understandingof antigenic complexity of this serotype in an endemic situation.Antigenic site II was most heterogeneous in proof of its volatilityat the face of immune pressure, where as site IV was most stable.These data therefore enrich our understanding of type Asia 1 FMD

earch 136 (2008) 16–29 27

virus genomics, evolution, antigenicity and biology in an endemicscenario.

Acknowledgements

We are thankful to Indian Council of Agricultural Research forproviding necessary facilities to carry out this work. J.K.M. thanksCouncil for Scientific and Industrial Research for providing SeniorResearch Fellowship for his Doctoral Degree.

References

Barnett, P.V., Samuel, A.R., Pullen, L., Ansell, D., Butcher, R.N., Parkhouse, R.M.E.,1998. Monoclonal antibodies against type O1 serotype of foot-and-mouth dis-ease virus, from a natural bovine host, recognize similar antigenic feature tothose defined by the mouse. J. Gen. Virol. 79, 1687–1697.

Basavappa, R., Syed, R., Flore, O., Icenogle, J.P., Filman, D.J., 1994. Role and mechanismof the maturation cleavage of VP0 in poliovirus assembly: structure of the emptycapsid assembly intermediate at 2.9 A resolution. Protein Sci. 3, 1651–1669.

Beard, C.W., Mason, P.W., 2000. Genetic determinants of altered virulence of Tai-wanese foot-and-mouth disease virus. J. Virol. 74, 987–991.

Biswas, S., Sanyal, A., Hemadri, D., Tosh, C., Mohapatra, J.K., Manoj Kumar, R.,Bandyopadhyay, S.K., 2005. Genetic comparison of large fragment of the 5′

untranslated region among foot-and-mouth disease viruses with special ref-erence to serotype Asia 1. Arch. Virol. 150, 2217–2239.

Biswas, S., Sanyal, A., Hemadri, D., Tosh, C., Mohapatra, J.K., Manoj Kumar, R.,Bandyopadhyay, S.K., 2006. Sequence analysis of the non-structural 3A and 3Cprotein-coding regions of foot-and-mouth disease virus serotype Asia 1 fieldisolates from an endemic country. Vet. Microbiol. 116, 187–193.

Blanco, E., Garcia-Briones, M., Sanz-Parra, A., Gomes, P., De Oliveira, E., Valero, M.L.,Andreu, D., Ley, V., Sobrino, F., 2001. Identification of T-cell epitopes in non-structural proteins of foot-and-mouth disease virus. J. Virol. 75, 3164–3174.

Carrillo, C., Tulman, E.R., Delhon, G., Lu, Z., Carreno, A., Vagnozzi, A., Kutish, G.F., Rock,D.L., 2005. Comparative genomics of foot-and-mouth disease virus. J. Virol. 79,6487–6504.

Cooper, P.D., Agol, V.I., Bachrach, H.L., Brown, F., Ghendan, Y., Giggs, A.L., Gillespie, J.H.,Lonberg-Holm, K., Mandel, B., Melnick, J.L., Mohanty, S.B., Povey, R.C., Rueckert,R.R., Schaffer, F.L., Tyrrell, D.A.J., 1978. Picornaviridae: second report. Intervirol-ogy 10, 165–180.

Dever, T.E., Glynias, M.J., Merrick, W.C., 1987. GTP-binding domain: three consensussequence elements with distinct spacing. Proc. Natl. Acad. Sci. 84, 1814–1818.

Domingo, E., Baranowski, E., Escarmis, C., Sobrino, F., 2002. Foot-and-mouth diseasevirus. Comp. Immunol. Microbiol. Infect. Dis. 25, 297–308.

Donnelly, M.L., Gani, D., Flint, M., Monaghan, S., Ryan, M.D., 1997. The cleavageactivities of aphthovirus and cardiovirus 2A proteins. J. Gen. Virol. 78, 13–21.

Escarmis, C., Dopazo, J., Davila, M., Palma, E.L., Domingo, E., 1995. Large deletions inthe 5′-untranslated region of foot-and mouth disease virus of serotype C. Virus.Res. 35, 155–167.

Feng, Q., Yu, H., Liu, Y., He, C., Hu, J., Sang, H., Ding, N., Ding, M., Fung, Y.W., Lau, L.,Yu, A.C., Chen, J., 2004. Genome comparison of a novel foot-and-mouth diseasevirus with other FMDV strains. Biochem. Biophys. Res. Commun. 323, 254–263.

Fry, E., Lea, S.M., Jackson, T., Newman, J.W.I., Ellard, F.M., Blakemore, W.E., Abu-Ghazaleh, R., Samuel, A., King, A.M.Q., Stuart, D.I., 1999. The structure and

function of a foot and mouth disease virus–oligosaccharide receptor complex.EMBO J. 18, 543–554.

George, M., 2000. Molecular cloning and expression of the nonstructural proteinsof foot-and-mouth disease virus serotype Asia 1. Ph.D. Thesis submitted to theDeemed University, Indian Veterinary Research Institute, Izatnagar/Mukteswar,Uttar Pradesh, India.

Giraudo, A.T., Beck, E., Strebel, K., de Mello, P.A., La Torre, J.L., Scodeller, E.A.,Bergmann, I.E., 1990. Identification of a nucleotide deletion in parts of polypep-tide 3A in two independent attenuated aphthovirus strains. Virology 177,780–783.

Giraudo, A.T., Sagedahl, A., Bergmann, I.E., La Torre, J.L., Scodeller, E.A., 1987. Iso-lation and characterization of recombinants between attenuated and virulentaphthovirus strains. J. Virol. 61, 419–425.

Grazioli, S., Francesca Fallacara, F., Brocchi, E., 2004. Mapping of neutralising siteson FMD virus type Asia 1 and relationships with sites. Rpt. Sess. Res. Gp. Stand.Tech. Comm. Eur. Comm. Control of FMD (FAO), Crete (Greece), Appendix 44, pp.277–287.

Grubman, M.J., Zellner, M., Bablanian, G., Mason, P.W., Piccone, M.E., 1995. Identifi-cation of the active-site residues of the 3C proteinase of foot-and-mouth diseasevirus. Virology 213, 581–589.

Guarne, A., Tormo, J., Kirchweger, R., Pfistermueller, D., Fita, I., Skern, T., 1998. Struc-ture of the foot-and-mouth disease virus leader protease: a papain-like foldadapted for self-processing and eIF4G recognition. EMBO J. 17, 7469–7479.

Gurumurthy, C.B., 2000. Antigenic sites of foot-and mouth disease virus type Asia1. Ph.D. Thesis submitted to the Deemed University, IVRI, Izatnagar/Mukteswar,India.

Hagenbuchle, O., Santer, M., Steitz, J.A., 1978. Conservation of the primary structureat the 3′end of 18S rRNA from eucaryotic cells. Cell 13, 551–563.

us Res

28 J.K. Mohapatra et al. / Vir

Haydon, D.T., Bastos, A.D.S., Awadalla, P., 2004. Low linkage disequilibrium indicativeof recombination in foot-and-mouth disease virus gene sequence alignments. J.Gen. Virol. 85, 1095–1100.

Hofmann, K., Stoffel, W., 1993. TMBase, a database of membrane spanning proteinsegments. Biol. Chem. Hoppe-Seyler 347, 166.

International Committee on Taxonomy of Viruses (ICTV), Van Regenmortel, M.H.V.,International Union of Microbiological Societies, Virology Division, 2000. Fam-ily: Picornaviridae. Virus Taxonomy: Classification and Nomenclature of Viruses.Seventh report of the International Committee on Taxonomy of Viruses. Aca-demic Press, Inc., San Diego, CA, pp. 657–678.

Jackson, T., Ellard, F.M., Ghazaleh, R.A., Brookes, S.M., Blakemore, W.E., Corteyn, A.H.,Stuart, D.I., Newman, J.W., King, A.M., 1996. Efficient infection of cells in cultureby type O foot-and-mouth disease virus requires binding to cell surface heparansulfate. J. Virol. 70, 5282–5287.

Juretic, D., Jeroncic, A., Zucic, D., 1999. Sequence analysis of membrane proteins withthe web server SPLIT. Croat. Chem. Acta 72, 975–997.

Kanno, T., Yamakawa, M., Yosida, K., Sakamoto, K., 2002. The complete nucleotidesequence of the PanAsia strain of foot-and-mouth disease virus isolated in Japan.Virus Genes 25, 119–125.

King, A.M.Q., 1988. Recombination in positive strand RNA viruses. In: Domingo, E.,Holland, J.J., Ahlquist, P. (Eds.), RNA Genetics vol. 2. CRC Press, Boca Raton, FL,pp. 149–165.

Kitson, J.D.A., McCahon, D., Belsham, G.J., 1990. Sequence analysis of monoclonalantibody resistant mutants of type O foot and mouth disease virus: evidence forthe involvement of the three surface exposed capsid proteins in four antigenicsites. Virology 179, 26–34.

Knowles, N.J., Davies, P.R., Henry, T., O’Donnell, V., Pacheco, J.M., Mason, P.W., 2001.Emergence in Asia of foot-and-mouth disease viruses with altered host range:characterization of alterations in the 3A protein. J. Virol. 75, 1551–1556.

Knowles, N.J., Samuel, A.R., 1995. Polymerase chain reaction amplification and cyclesequencing of the 1D (VP1) gene of foot-and-mouth disease viruses. Rpt. Sess.Res. Gp. Stand. Tech. Comm. Eur. Comm. Control of FMD (FAO), Vienna, Austria,September 1994, pp. 45–53.

Komarov, A., Goldsmit, L., 1959. Avianized modified foot and mouth disease viruses.In: Paper presented at the International Farmers Convention, Israel, 1959, pp.333–353.

Koonin, E.V., 1991. The phylogeny of RNA-dependent RNA polymerases of positive-strand RNA viruses. J. Gen. Virol. 72, 2197–2206.

Krebs, O., Marquardt, O., 1993. Identification and characterization of foot-and-mouthdisease virus O1 Burgwedel 1987 as an intertypic recombinant. J. Gen. Virol. 73,613–619.

Kuhn, R., Norbert, L., Beck, E., 1990. Functional analysis of the internal translationinitiation site of foot-and-mouth disease virus. J. Virol. 64, 4625–4631.

Kumar, S., Tamura, K., Jakobsen, I.B., Nei, M., 2001. MEGA2: Molecular EvolutionaryGenetics Analysis software. Arizona State University, Tempe, AZ, USA.

Kweon, C.H., Ko, Y.J., Kim, W.I., Kwon, B.J., Hyun, B.H., Sohn, H.J., Choi, K.S., Shin, J.H.,2002. Molecular characterization of foot-and-mouth disease virus O/SKR/2000.Virus Res. 90, 15–22.

Li, D., Shang, Y.J., Liu, Z.X., Liu, X.T., Cai, X.P., 2007. Molecular relationships betweentype Asia 1 new strain from China and type O Panasia strains of foot-and-mouth-disease virus. Virus Genes 35, 273–279.

Lopez de Quinto, S., Martinez-Salas, E., 1997. Conserved structural motifs located indistal loops of aphthovirus internal ribosome entry site domain 3 are requiredfor internal initiation of translation. J. Virol. 71, 4171–4175.

Lu, J., Zhang, J., Wang, X., Jiang, H., Liu, C., Hu, Y., 2006. In vitro and in vivo iden-tification of structural and sequence elements in the 5′ untranslated region ofEctropis oblique picorna-like virus required for internal initiation. J. Gen. Virol.

87, 3667–3677.

Luz, N., Beck, E., 1991. Interaction of a cellular 57-kDa protein with the inter-nal translation initiation site of foot-and-mouth disease virus. J. Virol. 65,6486–6494.

Manoj Kumar, R., Sanyal, A., Hemadri, D., Tosh, C., Mohapatra, J.K., Bandyopadhyay,S.K., 2004. Characterization of foot-and-mouth disease serotype Asia 1 virusesgrown in the presence of polyclonal antisera in serology and nucleotide sequenceanalysis. Arch. Virol. 149, 1801–1814.

Marquardt, O., Rahman, M.M., Freiberg, B., 2000. Genetic and antigenic variance offoot-and-mouth disease virus type Asia 1. Arch. Virol. 145, 149–157.

Martinez-Salas, E., Ortin, J., Domingo, E., 1985. Sequence of the viral replicase genefrom foot-and-mouth disease virus C1-Santa Pau (C-S8). Gene 35, 55–61.

Mason, P.W., Bezborodova, S.V., Henry, T.M., 2002. Identification and characteriza-tion of a cis-acting replication element (cre) adjacent to the internal ribosomeentry site of foot-and-mouth disease virus. J. Virol. 76, 9686–9694.

Mason, P.W., Grubman, M.J., Baxt, B., 2003a. Molecular basis of pathogenesis ofFMDV. Virus Res. 91, 9–32.

Mason, P.W., Pacheco, J.M., Zhao, Q.Z., Knowles, N.J., 2003b. Comparisons of thecomplete genomes of Asian, African and European isolates of a recent foot-and-mouth disease virus type O pandemic strain (PanAsia). J. Gen. Virol. 84,1583–1593.

Mohapatra, J.K., Sanyal, A., Hemadri, D., Tosh, C., Sabarinath, G.P., Manoj Kumar,R., Venkataramanan, R., Bandyopadhyay, S.K., 2004. Sequence variability in thestructural protein-encoding region of foot-and-mouth disease virus serotypeAsia 1field isolates. Res. Vet. Sci. 77, 153–161.

Mohapatra, J.K., Sanyal, A., Hemadri, D., Tosh, C., Sabarinath, G.P., Venkataramanan,R., 2002. Sequence and phylogenetic analysis of the L and VP1 genes of foot-and-mouth disease virus serotype Asia 1. Virus Res. 87, 107–118.

earch 136 (2008) 16–29

Oem, J.K., Lee, K.N., Cho, I.S., Kye, S.J., Park, J.H., Joo, Y.S., 2004. Comparisonand analysis of the complete nucleotide sequence of foot-and-mouth diseaseviruses from animals in Korea and other PanAsia strains. Virus Genes 29, 63–71.

Pacheco, J.M., Henry, T.M., O’Donnell, V.K., Gregory, J.B., Mason, P.W., 2003. Role ofnonstructural proteins 3A and 3B in host range and pathogenicity of foot-and-mouth disease virus. J. Virol. 77, 13017–13027.

Pattnaik, B., Sanyal, A., George, M., Tosh, C., Hemadri, D., Venkataramanan, R., 1997.Evaluation of primers for PCR amplification of RNA polymerase gene sequencesof foot-and-mouth disease virus. Acta Virol. 41, 333–336.

Paul, A.V., van Boom, J.H., Filippov, D., Wimmer, E., 1998. Protein-primed RNA syn-thesis by purified poliovirus RNA polymerase. Nature 393, 280–284.

Pereda, A.J., Konig, G.A., Chimeno Zoth, S.A., Borca, M., Palma, E.L., Piccone, M.E.,2002. Full length nucleotide sequence of foot-and-mouth disease virus strainO1 Campos/Bra/58. Arch. Virol. 147, 2225–2230.

Perez Filgueira, M., Wigdorovitz, A., Romera, A., Zamorano, P., Borca, M.V., Sadir, A.M.,2000. Detection and characterization of functional T-cell epitopes on the struc-tural proteins VP2, VP3, and VP4 of foot and mouth disease virus O1 Campos.Virology 271, 234–239.

Piccone, M.E., Rieder, E., Mason, P.W., Grubman, M.J., 1995. The foot-and-mouth dis-ease virus leader proteinase gene is not required for viral replication. J. Virol. 69,5376–5382.

Ray, S.C., 1999. SimPlot for Windows 95, version 2.5. Distributed by the author(www.med.jhu.edu/deptmed/sray/download).

Roberts, P.J., Belsham, G., 1995. Identification of critical amino acids within thefoot-and-mouth disease virus leader protein, a cysteine protease. Virology 213,140–160.

Rust, C.R., Ochs, K., Meyer, K., Beck, E., Niepmann, M., 1999. Interaction of eukaryoticinitiation factor eIF4B with the internal ribosome entry site of foot and mouthdisease virus is independent of polypyrimidine tract-binding protein. J. Virol.73, 6111–6113.

Sabarinath, G.P., 2001. Comparison of nucleotide sequence of structural proteinencoding (P1) region of foot-and-mouth disease virus serotype O isolates.M.V.Sc. Thesis Submitted to Deemed University, Indian Veterinary ResearchInstitute, Izatnagar/Mukteswar, UP, India.

Sa-Carvalho, D., Rieder, E., Baxt, B., Rodarte, R., Tanuri, A., Mason, P.W., 1997. Tissueculture adaptation of foot-and-mouth disease virus selects viruses that bind toheparin and are attenuated in cattle. J. Virol. 71, 5115–5123.

Saleh, L., Rust, C.R., Fullkrug, R., Beck, E., Bassili, G., Ochs, K., Niepman, M.,2001. Functional interaction of translation initiation factor eIF-4G with thefoot-and-mouth disease virus internal ribosome entry site. J. Gen. Virol. 82,757–763.

Sanyal, A., Gurumurthy, C.B., Venkataramanan, R., Hemadri, D., Tosh, C., 2003. Anti-genic characterization of Foot and mouth disease virus serotype Asia 1 fieldisolates using polyclonal and monoclonal antibodies. Vet. Microbiol. 93, 1–11.

Sanyal, A., Hemadri, D., Tosh, C., Bandyopadhyay, S.K., 2004a. Emergence of a novelsubgroup within the widely circulating lineage of Foot-and-Mouth Disease virusserotype Asia 1 in India. Res. Vet. Sci. 76, 151–156.

Sanyal, A., Mohapatra, J.K., Manoj Kumar, R., Biswas, S., Hemadri, D., Tosh, C., Sabar-inath, G.P., Gupta, S.K., Mittal, M., Giridharan, P., Bandyopadhyay, S.K., 2004b.Complete nucleotide sequence analysis of a vaccine strain (IND491/97) and afield isolate of foot-and-mouth disease virus serotype Asia 1 with an insertionin VP1 genomic region. Acta Virol. 48, 65–72.

Sanyal, A., Venkataramanan, R., Pattnaik, B., 1997. Antigenic features of foot-and-mouth disease virus serotype Asia 1 as revealed by monoclonal antibodies andneutralization-escape mutants. Virus Res. 50, 107–117.

Strimmer, K., von Haeseler, A., 1996. Quartet Puzzling: a quartet maximum likelihoodmethod for reconstructing tree topologies. Mol. Biol. Evol. 13, 964–969.

Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide substitution inthe control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol.Evol. 10, 512–526.

Tesar, M., Marquardt, O., 1989. Serological probes for some foot-and-mouth diseasevirus nonstructural proteins. Virus Genes 3, 29–44.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. TheClustal X windows interface: flexible strategies for multiple sequence alignmentaided by quality analysis tools. Nucleic Acids Res. 24, 4876–4882.

Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensi-tivity of progressive multiple sequence alignment through sequence weighting,positions-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22,4673–4680.

Toja, M., Escarmis, C., Domingo, E., 1999. Genomic nucleotide sequence of a foot-and-mouth disease virus clone and its persistent derivatives. Implications forthe evolution of viral quasispecies during a persistent infection. Virus Res. 64,161–172.

Tosh, C., Hemadri, D., Sanyal, A., 2002. Evidence of recombination in the capsid-coding region of type A foot-and-mouth disease virus. J. Gen. Virol. 83,2455–2460.

Tosh, C., Hemadri, D., Sanyal, A., Bandyopadyay, S.K., 2003. Genetic and antigenicanalysis of two recently circulating genotypes of type A foot-and-mouth diseasevirus in India: evidence for positive selection in the capsid-coding genes. Arch.Virol. 148, 853–869.

Van Rensberg, H., Haydon, D., Joubert, F., Bastos, A., Heath, L., Nel, L., 2002. Geneticheterogeneity in the foot-and-mouth disease virus Leader and 3C proteinases.Gene 289, 19–29.

J.K. Mohapatra et al. / Virus Res

Von Heijne, G., 1992. Membrane protein structure prediction: hydrophobicity anal-ysis and the “positive inside” rule. J. Mol. Biol. 225, 487–494.

Xiang, W., Cuconati, A., Hope, D., Kirkegaard, K., Wimmer, E., 1998. Complete proteinlinkage map of poliovirus P3 proteins: interaction of polymerase 3Dpol with VPgand with genetic variants of 3AB. J. Virol. 72, 6732–6741.

Yang, Z., 1999. Plylogenetic analysis by maximum likelihood (PAML) (http://abacus.gene.ucl.ac.uk/software/paml.html). University College London, London.

earch 136 (2008) 16–29 29

Yang, Z., Nielsen, R., Goldman, N., Pedersen, A.M.K., 2000. Codon substitution mod-els for heterogeneous selection pressure at amino acid sites. Genetics 155,431–449.

Zuker, M., Mathews, D.H., Turner, D.H., 1999. Algorithms and thermodynamics forRNA secondary structure prediction. In: Barciszewski, J., Clark, B.F.C. (Eds.), APractical Guide in RNA Biochemistry and Biotechnology. Kluwer Academic Pub-lishers, NATO ASI Series.