Arab J. Biotech., Vol. 11, No. (2) July (2008): 253-262.

Comparison of alpha toxin gene among different types of Clostridium perfringens

(Received: 01.01.2008; Accepted: 12.01.2008)

M.M. Effat* and Y.A. Abdallah**

* Microbiology and Immunology Department National Research Centre, Giza, Egypt ** Veterinary Serum and Vaccine Research Institute, Abbassia, Egypt,

ABSTRACT

Alpha toxin is found to be produced by all types of Clostridium perfringens. The genes

encoding alpha toxin from the available five types of Clostridium perfringens [A I chicken strain), A (rabbit strain), B, C and D were PCR amplified using specific primers and the PCR products were examined on 1.5% (w/v) agarose gel and demonstrated the same bands comparable to the published alpha toxin gene. The PCR products of a toxin gene from the five types were separately sequenced and aligned with all published a toxin genes of Clostridium perfringens. Identities among all studied alpha toxin gene sequences and with the published ones were nearly 96-98%. There are no any significant differences among these nucleotide sequences. It is concluded that a toxin gem; sequences among different types of Clostridium perfringens are similar and highly conserved.

Key words: Clostridium perfringens, Alpha toxin, phospholipase C, DNA sequencing.

INTRODUCTION

lostridium perfringens, an anaerobic spore former rod is widely distributed in the environment and in

the intestines of humans, animals and some wildlife (Nillo, 1993). Clostridium perfringens type A (Alpha toxin producer) is common in the intestinal tract of chicks, soil, dust contaminated feed and liter (EL-Seedy, 1990). The Alpha toxin is the principal lethal toxin of Clostridium perfringens is a multifunctional phospholipase produced by nearly all isolates. The toxin is haemolytic, necrotizing and potently lethal. The hydrolytic action of the toxin on membrane phospholipids found in the erythrocytes, platelets, leukocytes, endothelial cells and muscle cells results in lysis or other forms of cytotoxicity (Songer 1996) . The alpha toxin gene (cpa) has been cloned and

sequenced and homologous genes have been found in other clostridia. (Leslie et. al., 1989). Phospholipases are enzymes that degrade phospholipids and their classification is based on the site of cleavage. Phospholipase C cleaves between glycerol and the phosphate moieties. Phospholipases are found in all types of cells and various subcellular locations within eukaryotic cells (Zubay, 1988). Phospholipases may exert a direct biological effect on an animal since they can destroy the cell membrane phospholipids resulting in both cytotoxic and haemolytic effect. Moreover, subhaemolytic doses of phospholipases are capable of degenerating mast cells leading to local changes in vascular permeability and elevation in blood kinins and development of anaphlactoid syndrome (Tizard et. al., 1978). Phospholipases, exotoxins are virulence factors that damage the host, they hydrolyse

C

M.M. Effat and Y.A. Abdallah

Arab J. Biotech., Vol. 11, No. (2) July (2008): 253-262.

254

phospholipids in the host cell membrane leading to its disruption and killing the host cells by lysing them and aiding the phagocytosed bacteria to escape the phagocytic vesicle and enter the host cell cytoplasm (Salyers and Whitt, 1994). The five types of Clostridium perfringens could not be differentiated reliably on the basis of cellular or colonial morphology, biochemical reactions or gas liquid chromatographic analyses of fatty and organic acids and products of metabolism. Alpha toxin of Clostridium perfringens a key virulence determinant was suggested to be a cause of necrotic enteritis in chickens .Analysis of alpha toxin of 25 chicken derived Clostridium perfringens strains demonstrated high homology to mammal derived strains rather than to the only avian Clostridium perfringens us alpha toxin sequence reported (Scot, et. al., 2004). Alpha toxin may be produced more by isolates from birds with necrotic enteritis than by isolates from normal birds (Hofshagen and Stenwig, 1992).

Molecular structure of Clostridium perfringens alpha toxin revealed two domain protein; amino terminal domain containing phospholipase C active site and non-toxic carboxyterminal domain a paralogue of lipid binding domains (Titball, et al., 1999).

Alpha toxin is produced by all types of Clostridium perfringens (Yoo et. al., 1997; Effat et. al., 2007). Genetic analysis of alpha toxin gene among different types of Clostridium perfringens is performed to check if it is conserved or not There is no any published article dealt with the study of DNA sequence among different types of this organism especially rabbit and chicken isolates of Clostridium perfringens type A. This study looked for the presence of any difference of the alpha toxin gene among different types of Clostridium perfringens.

MATERIALS AND METHODS

Five reference strains of Clostridium perfringens type A (Rabbit strain, Chicken strain); type B; type C; and type D used in this study, were provided by the Serum and Vaccine Research Institute, Abbassia, Egypt. Amplification of Alpha toxin gene among these 5 strains was performed using the following:

The primer nucleotide sequences for Alpha toxin gene and the melting temperature (Tm) for each primer are as follows:

Forward primer: 5' GTTGATAGCGC AGGACATGTTAAG 3' (Tm 61.0) Reverse primer: 5'CATGTAGTCATC TGTTCCAGCATC3' (Tm 61.0) Primers used in this study were designed according to (Yoo et. al., 1997) and obtained from Metabion International AG, Germany.

Qiagen master mix was used to amplify the gene and the PCR solutions are: 25µl master mix, 2.0 µl forward primer (10 pmol each µl), 2.0 µl reverse primer (10 pmol each µl), 11 µl distilled water and 10 µl template (heat blocked supernatant of each type of Clostridium perfringens. PCR protocol

The PCR thermal cycler was programmed for Clostridium perfringens as follows: Initial dentauration for 5 minutes at 94°C then 30 cycles each consists of dentauration at 94oC for one minute, annealing at 55°C for one minute and extension at 72°C for one minute. The cycles were followed by final extension for 10 minutes at 72°C. The Program was adjusted at 4°C (as pause for keeping PCR product refrigerated) after ending the cycles and the final elongation (Yoo et. al., 1997), 10 µl from each PCR product were mixed with 2 µl loading buffer and analyzed on 1.5 % (w/v) agarose gel in IX TBE buffer and run along with 6 µl of 100 bp

Alpha toxin gene in C. perfringens

Arab J. Biotech., Vol. 11, No. (2) July (2008): 253-262.

255

DNA ladder. Ethidium bromide was added to a final concentration 1:20,000 from a stock solution of 10 mg/ml (Maniatis et. al., 1982) the electric current volt was adjusted at 50. The gel was examined under UV transilluminator and the pictures were taken using normal digital Kodak camera.

RESULTS AND DISCUSSION

PCR amplification of alpha toxin gene Alpha toxin gene PCR amplification for

the available 5 types of Clostridium perfringens was performed using a specific set of primers. Bands of PCR products for

Clostridium perfringens types demonstrated the same as that published at nearly 402 bp (Yoo et. al., 1997). No nucleotide sequence differences inside the alpha toxin gene were detected and the gene seems conserved among the 5 types of Clostridium perfringens studied. It is concluded that all studied alpha toxin genes obtained by PCR amplification from the five types of Clostridium perfringens under study are the same. no significant difference in nucleotide sequence was seen and thus alpha toxin genes for the 5 studied types of that pathogens are highly conserved.

Fig.( 1): exhibits PCR product of alpha toxin gene of different types of C. perfringens, lane l:100 bp ladder, lane 2: C. perfringens type A Rabbit strain, lane 3: C. perfringens type A; chicken strain, lane 4: C. perfringens type B, lane5: C. perfringens type C, and lane 6: C. perfringens type D .

TTTAGCTTTGCGACGAAGAAACACAGTATAAAATAAACAGCAGGTTGCAAAACTAATGAGGCTTTTT

ATACTGATATCTTAAAAAACAAAGATTTTAATGCATGGTCAAAAGAATATGCAAGAGGTTTTGCTAA

AACAGGAAAATCAATATACTATAGTCATGCTAGCATGAGTCATAGTTGGGATGATTGGGATTATGCA

GCAAAGGTAACTTTAGCTAACTCTCAAAAAGGAACAGCGGGATATATTTATAGATTCTTACACGATG

TATCAGAGGGTAATGATCCATCAGTTGGAAAGAATGTAAAAGAACTAGTAGCTTACATATCAACTAG

TGGTGAGAAAGATGCTGGAACAGATGACTACATGTATTTTGG

Fig. (2): Nucleotide sequence of alpha toxin gene of C. perfringens type A chicken strain.

402

500 400 300 200

100

bp

M.M. Effat and Y.A. Abdallah

Arab J. Biotech., Vol. 11, No. (2) July (2008): 253-262.

256

Query 361 GACTACATGTATTTTGG 377

| | | | | | | | | | | | | | | |

Sbjct 49266 GACTACATGTATTTTGG 49282

Fig. (3): Alignment of the a toxin gene of C. perfringens type A chicken strain with all published a toxin gene of C. perfringens especially C. perfringens ATCC 13124. Identities = 370/377 (98%)

TTTRGACTTTGCAGAGCAAGAAAGAACAGTATAAAATAAACACAGCAGGTTGCAAAACTAATGACGA TTTTTATGCTGATATCTTAAAAAACAAAGATTTTAATCGCATGGTCAAAAGA ATATGCAAGAGGTTTT

GCTAAAACAGGGAAATCAATATACTATAGTCATGCTAGCATGAGTCATAGTTGGGATGATFGGGATT

ATGCAGCAAAGGTAACTCTAGCTAACTCTCAAAAAGGAACAGCGGGATATATTTATAGATTCTTACA

CGATGTATCAGAGGGTAATGATCCATCAGTTGGAAAGAATGTAAAAGAACTAGTAGCTTACATATCA

ACTAGTGGTGAAAAAGATGCTGGAACAGATGACTACATGATTTTA

Fig.(4): Nucleotide sequence of Alpha toxin gene of C. perfringens type A rabbit strain.

Alpha toxin gene in C. perfringens

Arab J. Biotech., Vol. 11, No. (2) July (2008): 253-262.

257

Fig. (5): Alignment of a toxin gene of C. perfringens type A Rabbit strain with all published a toxin gene of C perfringens especially Clostridium perfringens ATCC 13124. Identities = (97%).

M.M. Effat and Y.A. Abdallah

Arab J. Biotech., Vol. 11, No. (2) July (2008): 253-262.

258

TTTGGCTTITGCGAGGAAGAAAGACCOTATAAAATAAACACAGCAGGTTGCAAAACTAATGAGGCTTTTT

ATACTGATATCTTAAAAAACAAAGATTTTAATGCATGGTCAAAAGAATATG CAAGAGGTTTTGCTAAAAC

AGGAAAATCAATATACTATAGTCATGCTAGCATGAGTCATAGTTGGGATGATTGGGATTATGCAGCAAAG

GTAACTTTAGCTAACTCTCAAAAAGGAACAGCGGGATATATTTATAGATTCTTACACGATGTATCAGAGGG

TAATGATCCATCAGTTGGAAAGAATGTAAAAGAACTAGTAGCTTACATATC AACTAGTGGTGAGAAAGAT

GCTGGAACAGATGACTACATGT

Fig. (6): Nucleotide sequence of Alpha toxin gene of C. perfringens type B.

Fig. (7): Alignment of a toxin gene of C. perfringens type B with all published a toxin gene of C. perfringens especially C, perfringens ATCC 13124 Identities = 367 / 372 (98 %).

Alpha toxin gene in C. perfringens

Arab J. Biotech., Vol. 11, No. (2) July (2008): 253-262.

259

TTGACTTTGCGAGGAAGAAGACCAGTATAAAATAAACACAGCAGGTTGCAAAACTAATGAGGATTTTTAT

GCTGATATCTTAAAAAACAAAGATTTTAATGCATGGTCAAAAGAATATGCA AGAGGTTTTGCTAAAACAG

GGAAATCAATATACTATAGTCATGCTAGCATGAGTCATAGTTGGGATGATTGGGATTATGCAGCAAAGGT

AACTCTAGCTAACTCTCAAAAAGGAACAGCGGGATATATTTATAGATTCTTACACGATGTATCAGAGGGTA

ATGATCCATCAGTTGGAAAGAATGTAAAAGAACTAGTAGCTTACATATCAA CTAGTGGTGAAAAAGATGC

TGGAACAGATGACTACATGCCCCC

Fig. (8): Nucleotide sequence of Alpha toxin gene of C. perfringens type C.

Fig. (9): Alignment of a toxin gene of C. perfringens type C strain with all published a toxin gene of C. perfringens especially C. perfringens ATCC 13124 Identities = 362/373 (97%).

M.M. Effat and Y.A. Abdallah

Arab J. Biotech., Vol. 11, No. (2) July (2008): 253-262.

260

TGGACTTTTGCAGAGGAAAGAAAAGACAGTATAAAATAAACACAGCAGGTT GCAAAACTAATGAGGATTT

TTATGCTGATATCTTAAAAAACAAGGATTTTAATGCATGGTCAAAAGAATA TGCAAGAGGTTTTGCTAAAA

CAGGAAAATCAATATACTATAGTCATGCTAGCATGAGTCATAGTTGGGATGATTGGGACTATGCAGCAAA

GGTAACTCTAGCTAACTCTCGAAAAGGGAACAGCAGGATATATTTATAGATTCTTACACGATGTATCAGAG

GGTAATGATCCATCAGTTGGAAAGAATGTAAAAGAACTAGTAGCTTACATA TCAACTAGTGGTGAAAAAG

ATGCTGGAACAGATGACTACATGATATTTT

Fig.(10): Nucleotide sequence of Alpha toxin gene of C. perfringens type D.

Fig. (11): Alignment of a toxin gene of C. perfringens type D with all published a toxin gene of C. perfringens especially C. perfringens ATCC 13124 Identities = 370 / 381 (97 %).

Nucleotide sequence and alignment Alpha toxin, a necrotizing toxin

commonly produced by all five strains of C perfringens, is believed to be a major factor

responsible for the organism tissue pathology and has been suggested to be a key virulence determinant and predominant product of C. perfringens type A (Yoo et al., 1997; Scott et.

Alpha toxin gene in C. perfringens

Arab J. Biotech., Vol. 11, No. (2) July (2008): 253-262.

261

al., 2004). Previous studies revealed that alpha toxin gene is found in all types of Clostridium perfringens (Effat et. al, 2007). However, no articles are found dealt with studying the nucleotide sequences among different types of Clostridium perfringens. The present studies demonstrated the nucleotide sequence among different types and different strains in the same type (A rabbit and chicken strains). Similar to the present results (Scott et. al, 2004) found that on applying sequencing for alpha toxin of 25 chickens derived C. perfringens, demonstrated high homology to mammal derived strains rather than to the only avian derived strain (Figs).

REFERENCES

Effat, M. M.; Abdallah, Y. A.; Soheir, M. F.

and Rady, M. M. (2007).Characterization of Clostridium perfringens field isolates, implicated in necrotic enteritis outbreaks on broiler farms in Cairo, by multiplex PCR. African Journal of Microbiology Research (3): 29-32.

El-Seedy, F. (1990). Studies on necrotic enteritis in chickens Vet. Med. J. Giza, 38: 407-417.

Holshagen, M. and H. Stenwig (1992). Toxin production by Clostridium perfringens isolated from broiler chickens and capercallies (Tetrao urogallus) with and without necrotizing enteritis. Avian Diseases, 36: 837-843

Leslie, D.; Fairweather, N; Pickard, D; Dougan, G and Kehoe, M. (1989). Phospholipase C and haemolytic activities of C. perfringens alpha toxin cloned in Escherichia coli: sequence and homology with Bacillus cereus phospholipase C. Mol. Microbiol. (3):383-392.

Maniatis, T.; Fritsch, E.F., and Sambrook, J. (1982). Molecular cloning; a laboratory Manual Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Nillo, L.(1993): Enterotoxemic Clostridium perfringens in pp. 114-123 in Gyles CL, Thoen CO, (Ed.) pathogenesis of bacterial infections in animals. Iowa State University, Ames.

Salyers, A. A., and Whitt, D. D. (1994):Virulence factors that damage the host. In pp.47 - 62 in Chapter 4;Bacterial pathogenesis, A molecular approach. ASM press Washington D.C., USA

Scott, A.S.; Aaron, B.I.; Julian, I.R., and Robert, J.M. (2004):Highly conserved alpha toxin sequences of avian isolates of Clostridium perfringens Journal of Clinical Microbiology, 42(3): 1345-1347.

Songer, J.G. (1996). Clostridial enteric diseases of domestic animals. Clinical Microbiology Reviews 9(2): 216-234.

Titball, R.W.; Naylor, C.E., and Basak, A.K. (1999):The Clostridium perfringens Alpha toxin. Anaerobe, 5: 51-64.

Tizard, I; Neilesen, K.H.; Seed, J.R. and Hall, J.E. (1978). Biologically active production from African Trypanosomes. Microbiol. Re. 42 (4): 661-681.

YOO, H. S.; Sang, U.; Kyoung, Y.P., and Yonk, H. P. (1997). Molecular typing and epidemiological survey of prevalence of Clostridium perfringens types by multiplex PCR. J. Clinical Microbiology, 35(1): 228-232.

Zubay, G. (1988). Phospholipases Biochemistry (3rd ed) W.M.C. Brown publishers, Columbia University.

M.M. Effat and Y.A. Abdallah

Arab J. Biotech., Vol. 11, No. (2) July (2008): 253-262.

262

�א��ص�א����� �

�� �����������������و���ن���ن����א��א���و����د�وמ������� ��ز�א� �

**و ياسر أحمد عبد اهللا* محمد محمد عفت الجيزة– الدقي – المركز القومي للبحوث –قسم الميكرو بيولوجي والمناعة *

القاهرة– العباسية –معهد بحوث األمصال واللقاحات البيطرية **

���� ا�� � � �� �� � ���م ������� �� ��آ����������م ‘��ات ا�����"������ام $�"# ��"�ات �%�� و�, ه*( ا��را�' �& ا ا���5و�"' )د ( و/"�ع ) ج ( و/"�ع ) ب ( و/�ع ا���5ول �� ا��وا��)أ ( ا���5ول �� ا�را/3 و/�ع ) أ ( ������� �� وه, /�ع �"; ا����آ"� � �"� وا��" � ا��"�:�ل ا�9 �"� ا�"�وا�� � <�و �"& ��"< ا$�A"ر ا��5"�ات �� "� �و % 1.5 ا@�"روز �"< �"& �"=

�ام ا�AدBت ا���� ' ا���%="=' %��� >�����ة ا����Aا� . >"�� &"� &"E ت ا��"� �; ��Fا�"� ا���"��� 3" ��� >" �G� ="�� �ا /" �"� �' � >�����ة ا����Aر ا�A�$ا‘ �� '��= �ت ا������< ا����5; ����� H�/رF� &� و اوح �"�"�� <�J"� 'A�/ �ا���5ات ا����5 ' وو�

� ""٩٨ - % �٩٦ % ,""� '���, ��Fا�""� ا�� �""ت ا��""=��' �""� ا��5""�ات ا��""��%�""�و@ ���""� ا$""�Rف �""�ه�ي �"" � ا���� ""3 ا��� ' .ا��را�' و� �ت ا���5ات ا����5