Cancer Genetics and Cytogenetics 132 (2002) 136–140

0165-4608/02/$ – see front matter © 2002 Elsevier Science Inc. All rights reserved.PII: S0165-4608(01)00561-1

Complex t(X;18)(p11.2;q11.2) with a pericentric inversion of the X chromosome in an adolescent boy with synovial sarcoma

Susan Mathew

a,

*, James Dalton

a

, Shannon Riedley

a

, Sheri L. Spunt

b

, D. Ashley Hill

a

a

Department of Pathology, St. Jude Children’s Research Hospital, 332 North Lauderdale, Memphis, TN 38105-2794, USA

b

Department of Hematology-Oncology, St. Jude Children’s Research Hospital, 332 North Lauderdale, Memphis, TN 38105-2794, USA

Received 11 June 2001; received in revised form 13 July 2001; accepted 17 July 2001

Abstract

Synovial sarcoma is the most common nonrhabdomyosarcomatous soft-tissue sarcoma in children andyoung adults. It is characterized by the common t(X;18)(p11.2;q11.2) that results in the fusion of

SYT

onchromosome 18 to one of two closely related and adjacent genes on the X chromosome,

SSX1

or

SSX2

.Here we describe a poorly differentiated, monophasic synovial sarcoma in a 17-year-old adolescent boy.Hyperdiploidy, a t(X;18)(q13;q11), and other structural abnormalities were detected by conventional cyto-genetic analysis. Fluorescence in situ hybridization with the PAC probe RP3-519N18, which is specificfor the Xp11 region, resulted in a signal on the der(Xq), a finding consistent with a pericentric inversion ofthe X chromosome that resulted in a t(X;18)(p11.2;q11.2)inv(X)(p11.2q13). Real-time polymerase chainreaction using primer sets specific for

SYT-SSX1

and

SYT-SSX2

confirmed the presence of an

SYT-SSX1

fusion transcript. Our finding of this unique and complex translocation in synovial sarcoma demonstratesthe utility of molecular methods in confirming the diagnosis of synovial sarcoma. © 2002 Elsevier Sci-

ence Inc. All rights reserved.

1. Introduction

Synovial sarcoma accounts for 5% to 10% of soft-tissuesarcomas, most of which are found in young adults [1]. Twohistologically distinct types of tumors have been identified:a monophasic variant, which is composed solely of spindlecells; and a biphasic variant, which is composed of variousproportions of epithelial and spindle cells. Synovial sarco-mas are characterized by the recurrent, non-random t(X;18)(p11.2;q11.2) [2]. This translocation results in the fusionof the

SYT

gene on chromosome 18 with either the

SSX1

or

SSX2

gene on chromosome X [3]. The translocations andthe resultant

SYT-SSX

gene fusions are remarkably consis-tent and are present in more than 90% of all synovial sarco-mas [4,5]. This report describes a complex t(X;18) andother novel chromosomal abnormalities in a poorly differ-entiated, monophasic synovial sarcoma in an adolescentboy. We used fluorescence in situ hybridization (FISH) toidentify a pericentric inversion of the X chromosome andreal-time polymerase chain reaction (PCR) to detect an

SYT-SSX1

fusion in this tumor.

2. Case report

The patient is a 17-year-old boy who, at the time of theinitial examination, had a 5-month history of a swollen rightcheek. After an initial course of oral antibiotics failed to re-duce the swelling, a fine needle aspiration of the right cheekmass was performed. Review of the aspirate material indi-cated that the mass was a highly cellular spindle-cell neo-plasm, possibly either a malignant peripheral nerve sheathtumor or synovial sarcoma. The patient was referred to ourinstitution.

The patient’s past medical history was unremarkable.His family history was notable for an abdominal cancer ofuncertain origin in a maternal grandmother and post-meno-pausal breast cancer in a maternal great grandmother andgreat aunt. Physical examination showed a firm, mobile,and slightly tender mass within the right cheek. No signifi-cant cervical lymphadenopathy was detected. Results ofcomplete blood counts and serum chemistry analyses werenormal. Magnetic resonance imaging showed an enhancing,well-encapsulated lobular mass (3.3

�

4.0 cm) within thesoft tissues of the right cheek. Cervical lymph nodes werenot enlarged. A

99m

Technetium-bone scan demonstratedsubtle, diffuse increased avidity of the right maxilla at thesite of the primary tumor, but was otherwise unremarkable.Computed tomography of the chest showed three nodular

* Corresponding author. Tel.: 901-495-2597; fax: 901-495-3100.

E-mail address

: susan.mathew@stjude.org (S. Mathew).

S. Mathew et al. / Cancer Genetics and Cytogenetics 132 (2002) 136–140

137

densities in the right lung. Analysis of wedge biopsies ofthese lesions showed granulomatous inflammation and noevidence of malignancy.

A gross total resection of the tumor with total conservativeparotidectomy was subsequently performed. The excisionspecimen was a well-circumscribed mass (2.0

�

2.4

�

2.5 cm)located within the masseter muscle. Microscopic analysis ofsections showed a hypercellular spindle-cell neoplasm witha primarily fascicular growth pattern and abundant geo-graphic necrosis. Poorly differentiated focal areas of nuclearpalisading similar to that seen in malignant peripheral nervesheath tumors were present (Fig. 1). The mitotic count washigh (up to 46 mitotic figures per 10 high-power fields). Im-munohistochemical staining showed strong cytoplasmicpositivity for vimentin and focal strong reactivity for neuron-specific enolase. CD99 was positive in a membrane pattern.A stain for cytokeratin protein highlighted scattered tumorcells. Immunohistochemical staining did not detect epithelialmembrane antigen, CAM5.2, collagen type IV, S100 pro-tein, desmin, muscle-specific actin, or smooth muscle actin.The morphologic and immunohistochemical features wereconsistent with those of a poorly differentiated (high-grade)synovial sarcoma. The tumor extended to the margins of ex-cision. The AJCC stage was IIB [6]. The patient was treatedwith adjuvant radiation and chemotherapy and remains dis-ease-free, now 8 months from the initial diagnosis.

3. Materials and methods

3.1. Cytogenetic analysis

Briefly, fresh tumor tissue was minced, and the cellswere put into culture in RPMI-1640 medium (JRH Bio-

sciences, Lenexa, KS, USA) supplemented with 20% fetalbovine serum and antibiotics (10,000 U/ml penicillin and 10mg/ml streptomycin, Life Technologies, Rockville, MD,USA). The cells were harvested at passage 0 on day 7. Thecells were exposed to Colcemid (50 ng/mL, Life Technolo-gies) for 5 h, trypsinized, and incubated in hypotonic solu-tion for 30 min. The cells were subsequently fixed in metha-nol and acetic acid (dilution ratio, 3:1) and trypsin-banded.Chromosomes from 20 metaphase cells were analyzed, andkaryotypes were interpreted according to the guidelines ofthe ISCN [7].

3.2. Fluorescence in situ hybridization

Fluorescence in situ hybridization was performed by us-ing whole chromosome painting (WCP) probes for chromo-somes 1, 6, 7, 12, 13, 16, 19, and Y (Vysis, Downers Grove,IL, USA; Oncor, Gaithersburg, MD, USA; Cambio, Cam-bridge, UK; Roche Diagnostics, Indianapolis, IN, USA); theCEP XY and CEP 18 probes (Vysis); and the PAC probeRP3-519N18 (Research Genetics, Inc., Huntsville, AL,USA), which is specific for the Xp11 region. Slides werecounterstained with 4

�

,6-diamidino-2-phenylindole (DAPI).The images were captured by using the charge-coupled de-vice (CCD) camera and analyzed by the attached QuipsPathVysion imaging system (Applied Imaging, Santa Clara,CA, USA).

3.3. Synthesis of cDNA

RNA was extracted from snap frozen tumor tissue by us-ing standard methods (Purescript, Gentra Systems, Minne-apolis, MN, USA). Approximately 1

�

g of total RNA wasadded to a master mix (1

�

reverse transcriptase buffer, 5.5mM MgCl

2

, 500

�

M of each dNTP, 2.5

�

M of random hex-amer, 0.4 U/

�

l of RNase inhibitor, and 1.25 U/

�

l of Multi-Scribe reverse transcriptase; Taqman, PE Applied Biosys-tems, Forest City, CA, USA), and the mixture was thenincubated at room temperature for 10 min, at 48

�

C for 30min, and at 95

�

C for 5 min.

3.4. Probes, primers, and controls

The probe and primer sequences used for the real-timePCR analysis of

SYT-SSX1

and

SYT-SSX2

were designedwith the assistance of computer software (Primer Express,PE Applied Biosystems) to take advantage of the minimalregion of mismatch in the 3

�

sequence distal to the commonbreakpoint of

SSX1

and of

SSX2

. The

SSX1

and

SSX2

primershave five base pair differences while the

SSX1

and

SSX2

probes have four base pair differences. Both probe sequenceswere located internal to the primer pairs. The fluorescent probeswere labeled with FAM (6-carboxyfluorescein) as the reporterdye and TAMRA (6-carboxytetramethylrhodamine, PE AppliedBiosystems) as the quencher dye. The sequences and concentra-tions of primers and probe used in real-time PCR analysis of

SYT-SSX1

were as follows: 5

�

primer (5

�

CCACAGCCACCCCAGC3

�

), 300 nM; 3

�

primer (5

�

GTGCAGTTGTTTCCC

Fig. 1. Photomicrograph showing the tumor’s closely packed spindle cellsand their palisading appearance, which resembles that of a malignantperipheral nerve sheath tumor. Results of immunohistochemical studiesindicated that the tumor was a poorly differentiated synovial sarcoma.(Hematoxylin and eosin; Original magnification, �200).

138

S. Mathew et al. / Cancer Genetics and Cytogenetics 132 (2002) 136–140

ATCGT3

�

), 300 nM; and an

SYT

probe (5

�

AAAATGATTCGAAGGGAGTGTCAGAAGCAT3

�

), 100 nM. Thoseused in real-time PCR analysis of

SYT-SSX2

were as follows: 5

�

primer (5

�

CCACCACAGCCACCCC3

�

), 900 nM; 3

�

primer(5

�

GCACAGCTCTTTCCCATCAT3

�

), 50 nM; and an

SYT

probe (5

�

AAGGAAATGATTCGGAGGAAGTGCCAGA3

�

),100 nM. The presence of amplifiable DNA (and intactRNA) was confirmed by co-amplification of

GAPDH

duringthe real-time PCR assay in which a

GAPDH

5

�

primer(5

�

GAAGGTGAAGGTCGGAGTC3

�

), a 3

�

primer (5

�

CTTTAGGGTAGTGGTAGAAG3

�

), and probe (5

�

CCGACTCTTGCCCTTCGAAC3

�

) were used. Sequence confirmed

SYT-SSX1

and

SYT-SSX2

containing tumors were used aspositive controls. The negative tissue and reagent controlswere RNA from the human leukemic cell line HL60 [8] andwater, respectively.

3.5. Real-time PCR

The method of real-time PCR has been described previ-ously [9–12]. Amplification reactions for each primer setwere run separately using 10

�

l of the reverse transcriptionreactions added to the master mix (5

�

l of 10

�

TaqManbuffer [PE Applied Biosystems] to get a final concentration1

�

buffer, 5.5 mM MgCl

2

, 200

�

M dATP, 200

�

M dGTP,200

�

M dCTP, 400

�

M dUTP, 12.5

�

l of 20% glycerol,and 0.025 U/

�

l AmpliTaq Gold). All reactions were per-formed in a 7700 Sequence Detector (PE Applied Biosys-tems) with the following thermal cycling conditions: 30 s at95

�

C and 10 min at 95

�

C, 48 cycles at 95

�

C for 15 s and at60

�

C for 1 min.

4. Results

4.1. Cytogenetic analysis

Only 25% of the metaphase cells had a normal karyo-type. All of the abnormal metaphase cells had hyperdiploidchromosomes with many structural abnormalities. The t(X;18)(p11.2;q11.2) that is typical of synovial sarcoma was notfound by conventional cytogenetics; however, a variant t(X;18)(q13;q11) was seen. One abnormal clone was observedwith the following abnormalities: t(X;18),

�

Y,

�

2,

�

6q

�

,7p

�

,

�

8,

�

12,

�

12p

�

, 13q-,

�

14,

�

15, 16q

�

,

�

17,

�

18, 19q

�

,

�20, �21, �21, �22 (Fig. 2).

4.2. FISH analysis

Result of FISH using WCP probes indicated that theder(6) was due to a translocation involving chromosomes 1,6, and 19 (Fig. 3A), the der(7) was a der(7)t(6;7) (Fig. 3B),the der(12) was a der(12)t(12;13) (Fig. 3C), the der(13) wasa der(13)t(Y;13;?) (Fig. 3D), the der(16) was a der(16)t(Y;16;?) (Fig. 3E), and the der(19) was a der(19)t(6;19;?) (Fig.3F). FISH with the Vysis probe that is specific for the het-erochromatic region of Yq detected a deletion of a regionwithin the Y chromosome, whereas the Roche DiagnosticsWCP probe for chromosome Y detected an unbalanced

translocation of the Y chromosome that involved 13q and16q. The PAC RP3-519N18 probe, which is specific forXp11, hybridized to the der(Xq) (Fig. 3G); thus, this resultindicates a pericentric inversion of the X chromosome thatresulted in t(X;18)(p11.2;q11.2)inv(X)(p11.2q13). Al-though conventional cytogenetics found a t(X;18)(q13;q11)(Fig. 3H and 3I), the results of FISH experiments clearly in-dicated the pericentric inversion of the X chromosome thatresulted in the fusion of Xp11.2 region with the 18q11.2 re-gion. The presence of SYT-SSX1 fusion transcripts was con-firmed by real-time PCR (Fig. 4).

The results of the FISH and cytogenetic analyses re-vealed the final karyotype: 58, t(X;18)(Xpter→Xp11.2::Xq13 →Xp11.2::18q11 →18qter; 18pter →18q11::Xp11.2::Xq13 →Xqter),�Y,�2,�der(1;6)(6pter →6q14::19p or q→19p or q::6q15→6q21::1p11 →1qter), der(7)(6qter →6q12::7p15.3→7qter),�8,�12,�der(12)(13q?→::12p13→12qter),der(13)(13pter→13q11::Yp or q::13q? →13q?),�14,�15,der(16)(16pter→16q11.1::?::Yp or q), �17,�18,der(19)(19pter→19q13.4::6q?::19q13.1→19?q13.4::?),�20,�21,�21,�22[15]/46,XY[5].

5. Discussion

Although synovial sarcoma can usually be diagnosed onthe basis of results of routine pathologic examination,poorly differentiated tumors can be difficult to diagnose,even with the aid of immunohistochemical studies. Becauseof its remarkable consistency, the finding of a t(X;18)(p11.2;q11.2) or its resultant SYT-SSX gene fusion orboth is useful in substantiating a diagnosis of synovial sar-coma, especially in difficult cases.

In one-third of all synovial sarcomas, translocations in-volving Xp11 and 18q11 are the only cytogenetic abnormal-ity. In the remainder, several non-random, secondary nu-merical and structural abnormalities in addition to t(X;18)

Fig. 2. Karyotype showing multiple structural and numerical abnormalitiesof the G-banded chromosomes. Arrows indicate the extra chromosomesand breakpoints involved in the structural abnormalities.

S. Mathew et al. / Cancer Genetics and Cytogenetics 132 (2002) 136–140 139

have been described [13,14]. In addition, comparative ge-nomic hybridization has identified gains of 1q24�q31, 2p,8q, l2p, 12q14�q15, 12q23�qter, and 17q22�qter andlosses of 3p, 13q21�q31, 3cen�q23, and 10q21 [15].Gains of chromosomes 8 and 12 and losses affecting chro-mosome 13 have been described as the most importantchanges in the progression of synovial sarcoma, andmonophasic tumors are believed to have more numerousand complex genetic changes than biphasic tumors [15].

The patient in the current study had a poorly differenti-ated, monophasic tumor whose cells were hyperdiploid andcontained chromosomes with complex structural abnormali-ties. The Y chromosome was involved in two uncommon,unbalanced complex translocations, t(Y;13;?) and t(Y;16;?).The typical t(X;18)(p11.2;q11.2) was not identified by ini-tial cytogenetic analysis, despite the finding of an SYT-SSX1fusion by real-time RT-PCR; instead, a t(X;18)(q13;q11)was present. Fluorescence in situ hybridization analysis us-ing the Xp probe showed a signal on the Xq a finding thatsuggests that a pericentric inversion of the X chromosomeoccurred before the t(X;18).

Although complex and cryptic translocations are notcommonly associated with synovial sarcoma, cryptic, com-

plex translocations that involve more than two chromo-somes have been reported, but these translocations alwaysinclude Xp11 and 18q11 [16–18]. In one study, spectralkaryotyping using multicolor painting probes showed thatthe unidentified extra material on the short arm of chromo-some X was the result of a balanced t(X;18) [19]. In anotherpatient, whose tumor cells’ karyotype was apparently nor-mal, a cryptic masked t(X;18) was identified by FISH andRT-PCR [20]. A small fragment from the Xp region (YACOATL1) was found on chromosome arm 18q. Also, a partof the centromeric probe from the X chromosome hybrid-ized to a region next to the centromere of chromosome 18.Our findings and those of Geurts van Kessel et al. [20] sug-gest that two consecutive steps are needed for the formationof this type of translocation. In our case, a pericentric inver-sion of the Xp11.2 region preceded the (X;18) translocation.The pericentric inversion of the X chromosome was fol-lowed by the fusion of the Xp11.2 region to 18q11.2, whichresulted in the SYT-SSX1 fusion. These types of cryptictranslocations are observed not only in synovial sarcomabut also in other malignancies.

In summary, this report describes a unique complextranslocation that resulted in a typical SYT-SSX1 fusion ina poorly differentiated, monophasic synovial sarcoma andhighlights the utility of FISH and real-time RT-PCR in de-lineating complex and cryptic chromosomal rearrange-ments that are not detected by conventional cytogeneticmethods.

Acknowledgments

Supported by grant CA-20180 and Cancer Center CoreGrant CA-21765 from the National Cancer Institute and by theAmerican Lebanese Syrian Associated Charities (ALSAC).

Fig. 3. G-banding and FISH analyses of abnormal chromosomes. The spe-cific chromosomes involved in the translocations are indicated to the left ofthe G-banded chromosomes. A combination of probe sets was used foreach FISH experiment. Yellow signals indicate the combination of hybrid-izing biotin- and digoxigenin-labeled probes, whereas green and the redsignals represent the hybridizing probes labeled with biotin and digoxige-nin, respectively. (A) The der(6) resulting from the complex translocationof chromosomes 1, 6, and 19. The image in the left panel shows the resultsof FISH using WCP probes for chromosomes 6 (yellow) and 19 (red). Theright panel shows the result of FISH with WCP probes for chromosome 1(yellow). (B) The der(7) that results from the translocation between chro-mosomes 6 (yellow) and 7 (green). (C) The der(12), with the translocationof chromosome 13 (red). (D) The der(13), after FISH with the WCP probefor chromosome 13 (red, left panel) and the WCP probe for the Y chromo-some (red, right panel). (E) The der(16) that resulted from the translocationbetween chromosome 16 (green, left panel) and an unidentified chromo-some (blue). The der(16) was also involved in a translocation of Y chromo-some (red, right panel). (F) Fluorescence in situ hybridization analysis ofthe der(19) (red) revealed an insertion of chromosome 6 (yellow) and anunidentified region at the q terminal (blue). (G) PAC RP3–519N18, whichis normally located on Xp11, hybridized to the der(Xq), a result suggestingan inversion of the X chromosome. (H) The CEP X probe hybridized to theder(X). (I) The CEP 18 probe hybridized to the der(18). The results in (H)and (I) indicate that these two chromosomes are involved in the t(X;18).

Fig. 4. Real-time PCR analysis. Results of real-time PCR using an SYT-SSX1–specific primer and probe set are shown in graphical form. Theexponential curves represent the accumulation of SYT-SSX1 fusion prod-ucts with each PCR cycle. Results are considered to be positive when thecurves have an exponential shape and cross the threshold before 48 cyclesare completed. Yellow, SYT-SSX1 control; red, patient sample; blue, HL60cell line; green, SYT-SSX2 control.

140 S. Mathew et al. / Cancer Genetics and Cytogenetics 132 (2002) 136–140

References

[1] Enzinger FM, Weiss SW. Soft tissue tumors. 3rd ed. St. Louis, MO:Mosby, 1995. p. 757–86.

[2] Limon J, Dal Cin P, Sandberg AA. Translocations involving the Xchromosome in solid tumors: presentation of two sarcomas with t(X;18)(q13;p11). Cancer Genet Cytogenet 1986;23:87–91.

[3] Crew AJ, Clark J, Fisher C, Gill S, Grimer R, Chand A, Shipley J,Gusterson BA, Cooper CS. Fusion of SYT to two genes SSX1 andSSX2, encoding proteins with homology to the Kruppel-associatedbox in human synovial sarcoma. EMBO J 1995;14:2333–40.

[4] Sreekantaiah C, Ladanyi M, Rodriguez E, Chaganti RS. Chromo-somal aberrations in soft tissue tumors. Relevance to diagnosis, classi-fication and molecular mechanisms. Am J Pathol 1994;144:1121–34.

[5] Antonescu CR, Kawai A, Leung DH, Lonardo F, Woodruff JM, Hea-ley JH, Ladanyi M. Strong association of SYT-SSX fusion type andmorphologic epithelial differentiation in synovial sarcoma. DiagnMol Pathol 2000;9:1–8.

[6] American Joint Committee on Cancer. AJCC cancer staging manual.5th ed. Philadelphia: Lippincott-Raven, 1997.

[7] ISCN. An international system for human cytogenetic nomenclature.Mitelman F, editor. S. Karger: Basel, 1995.

[8] Gallagher R, Collins S, Trujillo J, McCredie K, Ahearn M, Tsai S,Metzgar R, Aulakh G, Ting R, Ruscetti F, Gallo R. Characterizationof the continuous, differentiating myeloid cell line (HL-60) from apatient with acute promyelocytic leukemia. Blood 1979;54:713–33.

[9] Holland PM, Abramson RD, Watson R, Gelfand DH. Detection ofspecific polymerase chain reaction product by utilizing the 5�- - - -3�

exonuclease activity of Thermus aquaticus DNA polymerase. ProcNatl Acad Sci USA 1991;88:7276–80.

[10] Livak KJ, Flood SJ, Marmaro J, Giusti W, Deetz K. Oligonucleotideswith fluorescent dyes at opposite ends provide a quenched probe sys-tem useful for detecting PCR product and nucleic acid hybridization.PCR Methods Appl 1995;4:357–62.

[11] Higuchi R, Fockler C, Dollinger G, Watson R. Kinetic PCR analysis:real-time monitoring of DNA amplification reactions. Biotechnology(NY) 1993;11:1026–30.

[12] Higuchi R, Dollinger G, Walsh PS, Griffith R. Simultaneous amplifi-cation and detection of specific DNA sequences. Biotechnology (NY)1992;10:413–17.

[13] Mandahl N. Cytogenetics and molecular genetics of bone and soft tis-sue tumors. Adv Cancer Res 1996;69:65–9.

[14] Limon J, Mrozek K, Mandahl N, Nedoszytko B, Verhest A, Rys J,Niezabitowski A, Babinska M, Nosek H, Ochalek T, Kopacz A,Willen H, Rydholm A, Heim S, Mitelman F. Cytogenetics of synovialsarcoma: Presentation of ten new cases and review of the literature.Genes Chromosomes Cancer 1991;3:338–45.

[15] Szymanska J, Serra M, Skytting B, Larsson O, Virolainen M, Aker-man M, Tarkkanen, M, Huuhtanen R, Picci P, Bacchini P, Asko-Sel-javaara S, Elomaa I, Knuutila S. Genetic imbalances in 67 synovialsarcomas evaluated by comparative genomic hybridization. GenesChromosomes Cancer 1998;23:213–19.

[16] Turc-Carel C, Dal Cin P, Limon J, Rao U, Li FP, Corson JM, ZimmermanR, Parry DM, Cowan JM, Sandberg AA. Involvement of chromosome Xin primary cytogenetic change in human neoplasia: nonrandom transloca-tions in synovial sarcoma. Proc Natl Acad Sci USA 1987;84:1981–5.

[17] Wang-Wuu S, Soukup SW, Lange BJ. Another synovial sarcomawith t(X;18). Cancer Genet Cytogenet 1987;29:179–81.

[18] Chen O, Ladanyi M, Li F, Jhanwar SC. Cytogenetic and immunohis-tochemical characterization of synovial sarcoma. Cancer Genet Cyto-genet 1989;41:270.

[19] Cohen IJ, Issakov J, Avigad S, Stark B, Meller I, Zaizov R, Bar-Am I.Synovial sarcoma of bone delineated by spectral karyotyping. Lancet1997;350:1679–80.

[20] Geurts van Kessel A, de Bruijn D, Hermsen L, Janssen I, dos SantosNR, Willems R, Makkus L, Schreuder H, Veth R. Masked t(X;18)(p11;q11) in a biphasic synovial sarcoma revealed by FISH andRT-PCR. Genes Chromosomes Cancer 1998;23:198–201.