1

Construction of GFP Gene into Yeast Vector

Farhana Muhammad Yusoff (30158)

Resource Biotechnology

Faculty of Science and Technology

Universiti Malaysia Sarawak

ABSTRACT

The construction of Green Fluorescent Protein (GFP) gene into yeast vector is very important as it

can ensure the successful of expression of GFP gene in a yeast, Pichia pastoris. The construction of

this gene is integrated into pPICZ A vector which is yeast expression vector. The GFP gene that

will be constructed into yeast vector is due to the easy to be manipulated genetically and culture

than mammalian cells and can be grown to high cell densities compared to other expression system

that available. The technique used in this study is mainly about amplifying the gene by using

Polymerase Chain Reaction (PCR). The product was attempted to clone into pGEM-T and the

transformation process was done by using heat shock method. Instead of using pGEM-T cloning

method, the PCR product was subcloned directly into pPICZ A vector. The confirmation of

positive transformant which contain of pPICZ A/ GFP was done to ensure the successful of

construction of GFP gene into yeast vector by using colony PCR. This might be prior things in

order to continue the next step in recombinant DNA technology.

Key words: GFP, pPICZ A, pGEM-T

ABSTRAK

Pembentukan GFP gen ke dalam vektor yis adalah sangat penting kerana ia boleh memastikan

kejayaan ekspresi GFP gen dalam yis, Pichia pastoris. Pembentukan gen ini disepadukan dalam

pPICZ A vektor yang yis vektor telah diekspreskan. Gen GFP yang telah dibentuk ke dalam vektor

yis adalah disebabkan oleh manipulasi secara genetik terutamanya daripada sel mamalia dan

boleh berkembang kepada kepadatan sel tinggi berbanding dengan sistem ekspresi lain yang ada.

Teknik yang digunakan dalam kajian ini adalah memperbanyakkan gen dengan menggunakan

Polymerase Chain Reaction ( PCR ). Produk daripada PCR telah cuba untuk diklonkan ke dalam

pGEM –T vektor dan proses transformasi itu dilakukan dengan menggunakan kaedah kejutan

haba.Selain daripada itu, produk daripada PCR juga telah diklonkan terus ke dalam vektor pPICZ

A . Pengesahan transformant positif pPICZ A / GFP telah dilakukan untuk memastikan kejayaan

pembinaan GFP gen ke dalam vektor yis dengan menggunakan koloni PCR. Ini mungkin Antara

perkara utama yang perlu dilaksanakan untuk meneruskan langkah seterusnya dalam teknologi

DNA rekombinan.

Kata kunci: GFP, pPICZ A, pGEM-T

2

1.0 INTRODUCTION

Green Fluorescent Protein (GFP) gene that is mainly from jellyfish, Aequorea victoria has

becoming one of the most widely used reporter proteins. Recent application have been

found regarding the use of GFP gene which is the GFP genetically modified cats will aid

human and feline medical research. Based on several researches, scientists use genetically

modified animals that have been inserted with GFP gene for the study of HIV/ Aids (Jha,

2011). Therefore, there are many important reasons for choosing GFP gene in this project.

GFP is the protein of choice compared to other fluorescent proteins is due to its fluorescent

is more stable and species-independent. It also allows a simple detection under UV light

and can be monitored non-invasively in living cells (Kain et al., 1995).

In this project, the yeast expression system being used to produced recombinant

protein. Nowadays, the developments of Pichia expression, which is the yeast system that

was used in this project, had an impact on not only the expression levels, but also the

bioactivity of various heterologous proteins (Macauley-Patrick et al., 2005). There are

some advantages of yeast compare to mammalian and bacteria which is usually E. coli

expression system. Pichia pastoris that will be used is easier to be manipulated genetically

and culture than mammalian cells and can be grown to high cell densities. Due to the

eukaryotic type of cells, P. pastoris, can provide correctly folded recombinant proteins that

have undergone the post-translational modifications required for functionality. Based on

the research that has been made by the researchers, the P. pastoris system has strong

promoters to drive the expression of a foreign gene of interest. Hence, this will produce

large amount of the target protein with technical ease and low cost rather than most

eukaryotic systems (Daly and Hearn, 2005).

3

Obviously, the construction of GFP gene into yeast expression vector will provide a

platform to established P. pastoris expression system for production of other recombinant

protein. The construction will involve the amplification of GFP gene by PCR there are also

other methods which are cloning, ligation and transformation. The PCR will be used in this

research to amplify the desired gene. The PCR process is the process of amplification of

primer-mediated enzyme for specifically cloned or genomic DNA sequence (Innis,

Gelfand, Sninsky, and White, 1990). The construction of GFP gene into yeast vector

requires some important steps. The objective of this project is to construct GFP gene into

yeast vector which is P. pastoris, before the successful of the next step of recombinant

technology which is expression step. Most of the research made for GFP gene are basically

was constructed successfully into large and ever-growing number of species, for example

bacteria, fungi, plants, insects, and nematodes (Chalfie et al., 1994). However, in this

project, the construction will be made into P. pastoris, which is the yeast species.

Therefore, the objectives of this study are:

1. to amplify the GFP gene by using PCR method

2. to clone the GFP gene into pPICZ vector

3. to extract plasmid of positive transformant

4. to confirm the insertion by using colony PCR

4

2.0 LITERATURE REVIEW

2.1 Green Fluorescent Protein (GFP)

Green Fluorescent Protein (GFP) is amazingly becoming useful for studying living cells,

and recently, scientists are making it even more useful. Scientist using GFP to create

biosensors for example is for molecular machines that can detect the levels of ions or Ph,

then the report is done by fluorescing. There is one example of fluorescent protein which is

β-glucuronidase (GUS) gene that also has been used widely. The transformed tissue can be

identified histochemically, but it is a destructive test and not suitable for assaying the

primary transformats. However, GFP gene shares none of these problems (Haseloff, 1999).

The GFP was found by Osamu Shimomura, one of the professors at the Priceton

University, USA during a visit to US Pacific coast for a vacation in the late 1960’s. He

collected some specimen of Aequorea victoria and was known to glow with bluish colour

that can turn green. The size of the GFP is a relatively small which about the half of the

size of serum albumin and also the half of the size of haemoglobin in the blood stream

(Ward, 2009). The gene contains 238 amino acids and the residues 65 to 67 (Ser-Tyr-Gly)

in the sequence of GFP will spontaneously form the fluorescent chromophore p-

hydroxybenzylideneimidazolinone. The chromophore is resulting from the process of

spontaneous cyclization and oxidation of the residues. It also needs the native protein fold

for both formation and fluorescence emission (Ormo et al., 1996). Besides, the GFP is in

barrel structure to keep the chromophore away from solvents. Thus, the GFP are able to

fluorescing under almost any conditions (King and May, n. d.). Figure 1 shows the

structure of GFP gene.

5

Figure 2.1: The chemical structure of the GFP gene (Prashera, Eckenrodeb, Wardc, Prendergastd, &

Cormierb, 1992).

The first function of GFP was discovered in the 1970’s by Morin and Hastings

which was to turn the bioluminescence flash of jellyfish, hydroids, and sea pansies from

blue to green. After that time, there are a lot of functions has been found. In science

research, the GFP gene is used widely in scientific research because GFP is the only

fluorescent protein which is the only coloured protein that can be transfer genetically into

other cells, tissues, organs, and organisms after the gene transplant. In fact, many other

proteins have colours and fluorescence, but none of them can be cloned. They only can just

being inserted, through single gene into another organism. Hence, the unique GFP gene is

used widely rather than any other gene. By using GFP gene, scientist and researchers can

watch what is happening in cells in real time. This is done by monitoring a non-invasive,

non-toxicfluorescent marker for GFP. Before the findings of GFP, scientist usually kills the

organisms, preserve them, and stain them in toxic chemicals to see what is happening

6

inside the cells and tissues. Now, the ways of research have been upgraded by the use of

GFP gene as it can report the development and details of cellular metabolism in cells that

are still living. GFP makes the whole organism which is every cell in the body becoming

green-fluorescent. The GFP gene also can be linked to the cellular control factor which is

called the promoters. There is an example of research in Columbia University which is on

the nerve growth of round worm. In the research, the GFP have been linked to the

promoter for nerve growth. Thus, the Columbia scientists can study on what triggers others

cells to grow into nerves. Based on the study, the nerves begin to grow when the cells

begin to glow green (Ward, 2009). According to Zupan, Trobec, Gaberc-Porekar and

Menart (2004), the fused GFP to the N- or C- terminus of proteins, GFP can be used to

express their intracellular location and arrangement. It also is to determine the level of

gene expression due to GFP fluorescence and to study the transportation and secretory

processes that happen in the cell.

2.2 The Yeast Expression Vector

The vector used for this project is yeast vector which is P. pastoris. The yeast is a

methylotrophic yeast species and it also is widely used for the production of recombinant

protein (Cregg et al., 2009). P. pastoris is chosen because of its capability of

accomplishing post-translational modifications that will be result to the proper folding of

numerous foreign proteins. In recent research, there are only a few reported cases of

protein expression in the form of insoluble particles (Sreekrishna et al., 1988). Compare to

other yeast vector, P. pastoris is known as an excellent expression host. There is also a

promoter which is derived from alcohol oxidase I (AOX1) gene from P. pastoris that is

very unique to suite the control of expression for foreign gene. The type of yeast vector

used in this project is pPICZ expression vector. Basically, a yeast, P. pastoris, is a single-

7

celled microorganism which can manipulate and culture in easy way. However, the nature

of yeast is, they are also a eukaryote and able to do many post-translational modifications

that usually performed by higher eukaryotic cells. Moreover, P. pastoris system can

generally being easier, faster, and less expensive to use rather than expression systems that

comes from higher eukaryotes like mammalian tissue culture or insects cell systems. This

is because the higher eukaryotes systems usually give higher expression levels.

8

3.0 MATERIALS AND METHODS

3.1 Materials

Low Salt LB medium with Zeocin and pPICZ vector was obtained from Invitrogen, and

pGEM-T Easy vector was obtained from Promega. GFP gene in the plasmid of pAGS/GFP

and E. coli XL1Blue competent cell was obtained from Department of Molecular Biology

UNIMAS. The extraction of plasmid materials; Solution I (50 mM Glucose, 1.8 M Formic

Acid, 25 mM Tris-HCl pH8), Solution II (0.2 N NaOH, 1% SDS), Solution III (3 M KAc,

10 mM EDTA pH8) was used for plasmid extraction. Agarose gel,

phenol/chloroform/isoamyl alcohol, T4 DNA ligase, T4 DNA Ligase buffer, water,

nuclease-free, phosphorylated linkers was used during ligation process.

3.2 Method

3.2.1 Competent Cell Preparation

The culture containing 5 ml Luria broth with 5 µl of 50 mg/ml ampicillin and a single

colony or thawed frozen glycerol stock of Escherichia coli strain XL1Blue were grown

overnight at 37°C with shaking at 250 rpm. The culture was transferred to Erlenmeyer

flask that contains 50 ml of pre-warmed Luria broth media without the presence of any

antibiotics. The culture was allowed to grow again at 37°C with shaking at 250 rpm until

the OD of 600 reached the reading between, 0.45 to 0.5. The flask was put on ice for 20

minutes and centrifugation was performed at 3500 rpm for 5 minutes at 4°C in a cooled

McCartney bottles. The supernatant was removed and the cells were re-suspended in a 12.5

ml iced-cold 100 mM CaCl₂. Centrifugation was performed for 5 minutes at 3500 rpm.

Incubation on ice for 1 hour also was performed (Sambrook, Fritsch, and Maniatis, 1989).

9

3.2.2 Plasmid Extraction

The overnight bacterial culture was transferred into a 2 ml microcentrifuge tube and was

centrifuged for 2 min at 8000 rpm. The supernatant was removed and re-centrifuged the

pellet for 1 min. Any traces of liquid media were removed from the tube. The cell pellet

was re-suspended by using 100 μl of Solution I by vortexing about 10 seconds and was

kept on ice. Solution II was added about 100 μl into the cell suspension and was mixed

gently by inverting 10X. The tube was left at room temperature for exact 5 min. Solution

III then was added into the tube and mix by inverting 10X. The solution was centrifuged at

10000 rpm for 5 min. The supernatant was transferred carefully by pipetting into a 1.5 ml

microcentrifuge tube. The DNA was precipitated by adding 2 volumes of cold absolute

ethanol and the tube was inverted at least 10X. Centrifugate at 13000 rpm for 5 minutes.

The pellet was washed with 500 μl of 70% ethanol and was re-centrifuged again at 13000

rpm for 2 min. The pellet was air dried and re-suspended the pellet in 50 μl of ultrapure

water. The 5 μl plasmid DNA was checked or determined by Agarose Gel Electrophoresis

(AGE). A 1% agarose gel was used and AGE was performed at 105 V for 30 min.

3.2.3 Purification of Extraction Product

An equal volume of phenol/chloroform/isoamyl alcohol was added to the DNA solution to

be purified in a 1.5-ml microcentrifuge tube and was vortex vigorously 10 seconds as well

as centrifuged for 15 seconds at room temperature. The top part which was the aqueous

phase containing the DNA was removed carefully by using a 200 µl pipette and was

transferred to a new tube. About 1/10 volume of 3M sodium acetate, pH 5.2, was added to

the solution of DNA and was mixed by vortexing briefly or by flicking the tube several

times with a finger. About 2 to 2.5 volume (calculated after salt addition) of ice-cold 100%

10

ethanol was added and then was mixed by vortexing and place in crushed dry ice for 5 min

or longer. It was spin for 5 min in a fixed-angle microcentrifuge at high speed and the

supernatant was removed. About 1 ml of room temperature 70% ethanol was added. The

tube was inverted several times and was centrifuged back. The supernatant was removed.

Air was allowed to dry for 15 minutes. DNA pellet was resuspended in 100 µl of ultrapure

water.

3.2.4 Polymerase Chain Reaction

Before applying PCR process, the primer for the GFP gene was designed. After the

forward and reverse primer was designed, the process was preceded to PCR. The PCR

amplification, the specific PCR primers were chose to prime the nucleic acid template to

make the polymerase to be attached to it. This is the first step for the duplications of the

template (Mackay, 2013). The protocol of PCR is based on PCR Master Mix by Promega.

The PCR was performed after all reactions were prepared, 1 X reaction mix was allowed,

when the DNA template was added. The amplification process was performed by

following the cycling profile which is: 94ºC for 5 minutes, 35 cycles at 94ºC for 30

minutes, and lastly, 72ºC for 10 minutes in 1 cycle. The reaction product was visualised by

using agarose gel electrophoresis and the product was stained with ethidium bromide.

3.2.5 Gel Extraction of PCR Product

The bigger AGE well was performed and the 50 µl was loaded into each well. The gel slice

containing the DNA fragment was excised by using a clean scalpel or razor blade. The gel

was cut as close as possible to minimize the gel volume. The gel slice was placed into pre-

weighed 1.5 ml tube and weighed back. The weight of the gel slice was recorded. This step

of gel extraction was done by using GeneJET Gel Purification Kit by Thermo Scientific.

11

Then, 1:1 volume of Binding Buffer was added to the gel slice (volume: weight). The gel

mixture was incubated at 50-60˚C for 10 minutes or until the gel slice was completely

dissolved. The tube was mixed by inversion every few minutes to facilitate the melting

process. The gel was make sure completely dissolved. The gel mixture was vortex briefly

before loading on the column. Up to 800 µl of the solubilised gel solution was transferred

to the GeneJET purification column, then it was centrifuged for 1 minute. The flow-

through was discarded and the column was placed back into the same collection tube. The

Wash Buffer of 700 µl was added to the GeneJET purification column. It was centrifuged

for 1 minute. The flow-through was discarded and placed back into the same collection

tube. The empty GeneJET purification column was centrifuged for an additional 1 minute

to completely remove residual wash buffer. The GeneJET purification column was

transferred into a clean 1.5 ml microcentrifuge tube. Elution Buffer of 50 µl was added to

the center of the purification column membrane for 1 minute. The GeneJET purification

column was discarded and the purified DNA product was stored at -20˚C.

3.2.6 Ligation of pGEM-T and pAGS/GFP gene

Table 3.2.6: The ligation mixture of pGEM-T and pAGS/GFP gene

Ligation for pGEM-T vector Standard

Reaction

Positive

Control

Negative

Control

2X Rapid Ligation Buffer, T4 DNA

Ligase

5 µl 5 µl 5 µl

PGEM-T Easy Vector 1 µl 1 µl 1 µl

PCR Product 3 µl - -

Control Insert DNA - 2 µl -

T4 DNA Ligase 1 µl 1 µl 1 µl

Deionised water to a final volume of 10 µl 10 µl 10 µl

The reactions were mixed by pipetting. The reactions were incubated 1 hour at room

temperature. Alternatively, the reactions were incubated overnight at 4˚C.

12

3.2.7 Cloning of PCR product into pGEM-T Vector

The cloning of the PCR product into pGEM-T vector was lead to the formation of

fragment that consists of pGEM-T/ pAGS/GFP gene. The ligation reaction was set up with

the sample contained of 5 µl of 2X rapid ligation buffer, 1 µl of pGME-T vector, 3 µl of

insert DNA restricted with EcoRI and 1 µl of T4 DNA ligase. The total volume of the

mixtures was about 10 µl per sample. All the reactions were mixed by pipetting gently.

The 1.5 ml of autoclaved Eppendorf tubes was used for ligations. The mixtures were kept

in refrigerator (4ºC) and incubated overnight.

3.2.8 Transformation of pGEM-T/pAGS/GFP Gene in E. coli competent cells

The transformation process was done by using heat shock method based on the

Sambrook’s method of transformation. Before the process is done, the shaker was

preheated 37ºC as well as the water bath to exactly 42ºC. The ligation reaction mixture was

removed from the refrigerator and equilibrates to room temperature for 1 minute. Each

ligation of 2 ml was added to the bottom of a sterile 5 ml Falcon round-bottomed tube that

has been pre-cooled on ice. XLIBlue competent cell was removed from freezer and was

placed in a 50% ice/deionised water bath for 5 minutes. The mixture was mixed by flicking

gently. Competent cells for about 50 ml was added to the Falcon round-bottomed tubes on

ice using wide-bore pipette tips and was pipetted gently. Then, it was left on ice for 20

minutes. The cells were heat shocked for exactly 45 seconds at 42ºC in a water bath. The

cells was returned to ice for 2 minutes. SOC media was added to each transformation and

was mixed by flicking gently. The tubes were closed completely to make it airtight. The

tubes were put in an incubator-shaker at 37ºC for 90 minutes. After 60 minutes, LB with

ampicillin plates were put in 37ºC incubator oven inverted with lids off to dry for 30

13

minutes. After the plates are dry and the transformations have been incubated for 90

minutes in the shaker, it was taken to a laminar flow hood. A sterile pipette tip was used;

the transformation cultures were added and spread onto the LB with ampicillin plates. This

was performed for about 4 plates per sample. The plates was sealed with parafilm strip and

placed in a 37ºC dry oven for overnight (Sambrook, Fritsch, and Maniatis, 1987).

3.2.9 Blue/White Screening

The white colony was picked about 5 colonies and subcultured. The subculture was

incubated overnight and the extraction of plasmid was done as in 3.2.2.

3.2.10 Restriction Enzyme Digestion

The specific Restriction Enzyme was selected to digest the plasmid. The double digestion

of restriction enzyme was used to cut both GFP gene and PPICZ A vector at the same

reaction tube. The appropriate reaction buffer for enzymes was used. Plasmid, Restriction

Enzyme, buffer and dH2O was combined in a microcentrifuge tube. The combination was

mixed gently by pipetting. The tube was incubated at appropriate temperature which is

37ºC for 1 hour.

3.2.11 Gel purification

Gel purification was done as in 3.2.5 method.

3.2.12 Ligation of pPICZ A and GFP gene

The enzyme that was used for the ligation of pPICZ and GFP gene is T4 DNA ligase. The

protocol that was used is based on the Fermentas protocol for T4 DNA ligase. The

following reaction mixtures were as followed:

14

Table 3.2.12: List of reaction mixture for 1:4 ration of 30 µl.

pPICZ A vector 5 µl

GFP gene (insert) 20 µl

10X T4 DNA Ligase buffer 3 µl

T4 DNA Ligase 2 µl

Total Volume 30 µl

The mixture was mixed thoroughly and spins. Then, it was incubated for 1 hour at 22ºC.

The heat was inactivated at 65ºC for 10 minutes or at 70ºC for 5 minutes (Linker ligation,

2013).

3.2.13 Transformation of pPICZ A and GFP gene into E. coli competent cells

The transformation was done as in 3.2.6 method.

3.2.14 Confirmation of positive transformants by using colony PCR

The confirmation of successful transformants was done by picking 8-10 small colonies in

the plates that contain transformants of pPICZ A/GFP gene. The colonies was streak in the

plates before put into PCR tubes. The PCR protocols was done as in 3.2.4.

15

4.0 RESULTS AND DISCUSSION

4.1 The primer design for PCR

The construction strategy was designated to ensure the successful of construction of GFP

gene into pPICZ. The GFP gene was design to be inserted into multiple cloning sites in the

pPICZ vector. In the multiple cloning sites, there are C-terminal peptide which contains c-

myc epitope and a polyhistidine (6xHis) tag. The C-terminal peptide is where the

expression of recombinant protein occurs. There is some cloning consideration of that has

been done before construct the GFP gene into the pPICZ vector. For better initiation of

translation, the insert contain an initiation ATG codon as part of a yeast consensus

sequence (Romanos et al., 1992). In this project, the yeast consensus sequence that has

been chosen is provided below. The ATG initiation codon is shown underlined.

(G/A)NNATGG

For the expression of the gene as a recombinant fusion protein, the clone was designed and

must be frame with the C-terminal peptide containing the c-myc epitope and the

polyhistidine tag. On the other option, if the expression of the gene without the C-terminal

peptide, the stop codon was included.

After all the consideration was done, the design of the specific primer for GFP gene

was conducted. The first step of primer design was conducted after getting the GFP

sequence. The primer was designed 20 nucleotides before the start codon which is ATG

codon. Before designing the primer for PCR, the site of restriction enzyme from pPICZ

and GFP gene sequence were identified. The restriction enzyme site in GFP gene was

identified by using NEBcutter, (n. d.) in the internet, while the restriction enzyme site for

pPICZ was identified by using the map in Invitrogen manual. The selection of restriction

16

enzyme in the GFP gene must be the same to the restriction enzyme site in the sequence of

the pPICZ vector. The restriction enzymes that were chosen are Not1 and Xho1. The Xho1

was designed at the upstream of the gene inside the forward primer while Not1 was

designed at the downstream of the gene inside the reverse primer.

Figure 4.1.1: The restriction enzyme site available in GFP gene sequence by using NEBcutter

tool. Adapted from

http://tools.neb.com/NEBcutter2/cutshow.php?name=75615b0d-.

17

Figure 4.1.2: The summary of pPICZ features.

18

Figure 4.1.3: The multiple cloning site of pPICZ A with the restriction enzyme sites that have

been chosen highlighted in the box which are Xho1 and Not1.

The ligation will produced pPICZ/GFP. The restriction enzyme site that was found in both

vector and GFP gene are:

Xho1 : 5’-CTCGAG-3’

Not1 : 5’-GCGGCCGC-3’

19

After all the consideration and possible design that was made, the forward and reverse

primers for the GFP gene are as below. Xho1 was located at the forward primer while Not1

was at reverse primer. The location of restriction enzymes for forward and reverse primers

is highlighted in red as follows:

Forward primer:

5’- ATCTCGAGATGTGGAACGCCTGCGCC -3’

Reverse primer:

5’- TAGCGGCCGCGCAAACTCCAGTAACA - 3’

The consideration made by determining the restriction site that has only one site in both

vector and GFP gene. This is to make sure the restriction enzyme cut only in one site for

both vector and gene. The restriction enzyme site for gene and vector must be the same for

both gene and vector. This is to ensure the gene can be ligated at the same restriction

enzyme site at the vector.

In the forward primer, there is a recommendation that it is better to use Kozak translation

initiation sequence for pPICZ A vector. This is also one example of a yeast consensus

sequence. This Kozak’s sequence is thought to have two to three effect of the efficiency for

the translation initiation. The ATG initiation codon is:

(G/A)NNATGG

The initiation ATG codon as a part of yeast consensus sequence was underlined. The

insertion of ATG codon is for the proper initiation of translation (Romanos et al., 1992).

However, in the forward primer that was designed, there is no Kozak’s translation

20

initiation sequence. This is due to the alteration of amino acids happen if there is the

insertion of the sequence. The underlined base pair below shows the defective part of the

alteration of amino acids produced.

Forward primer:

5’- AT CTC GAG ATG TGG AAC GCC TGC GCC -3’

The formula for the sequence should be guanine,G, but it has been changed to become

thymine, T since the addition of guanine in the sequence will produce different class of

amino acids. Thus, it might alter the production of protein. The TGG codon will produced

tryptophan, meanwhile the GGG codon will produced glycine.

4.2 Transformation of pPICZ A vector and pAGS/GFP gene

The concentration of pure vector used must be more than 10 ng/µl for the best

transformation to occur. The transformation for both pPICZ A and pAGS/GFP gene was

done by using E. Coli XL1Blue competent cells. The competent cells must be stored at -

80˚C to preserve the cells since the competent cells is fragile and easy to rupture. The

preservation method for the competent cells is needed because the cells provide the

benefits of economy of effort especially in preparation and the reproducibility of results.

The calcium-treated of the competent cells which is frozen and stored at -80˚C shows good

competence after thawing (Morrison, 1977). The method was done by using heat shock

method. The heat shock duration is only 45 seconds. This is the crucial step in

transformation. However, the heat shock duration is different depends on strain of

competent cells used. Competent cells are very sensitive towards any temperature changes.

The thawing process still needs to be done on ice. The process of transformation need to be

done immediately when the cells already being thawed. Due to the sensitivity of the

competent cells, the transformation with the cells need to be treated gently and handled

21

with care. The competent cells that need to be refreezing will result in a significant drop in

transformation efficiency (NextGen Sciences, 2005).

Figure 4.2: The colony of the overnight transformants on LB low salt plate.

One colony was picked and grown overnight for the purpose of extraction the

plasmid.

4.3 Extraction of plasmid

Both plasmid pPICZ A and pAGS/GFP were successfully isolated by using alkaline lysis

method. This method requires the use of Solution I, Solution II and Solution III. The use of

Solution I or known as alkaline lysis step is to break down the cell wall of the bacteria. The

other alternative that can be used for the alkaline lysis is the use of RNase. RNase is used

to degrade the RNA in the cells. The function of alkaline lysis is to homogenize the cell as

well as to give the single cell suspension. Solution I contain glucose, Tris-HCl (pH 8.0)

and EDTA. The glucose is to maintain the osmotic pressure while doing the alkaline lysis.

22

The Tris-HCl is buffering the cells at the pH of 8.0. Hence, the Tris buffer helps to

maintain the pH at a constant level (Rothe & Heisler, 1986). Meanwhile, the EDTA is used

to bind with the lipid bilayer to make the cell envelope become weak. After the cell lysis,

EDTA will act to limit the DNA degradation by binding the magnesium ions to the DNA.

The Solution I also need to be store in 4˚C. In addition, TE buffer contains TRIS and

EDTA (DNA Isolation and Analysis, n.d.). This buffer solution helps to suppress the

degradation of DNA at an optimum pH (Open Wet Ware, 2013).

In addition, there is also the use of Solution II. Solution II is used to lysis the cells.

It contains sodium dodecyl sulphate (SDS) detergent and sodium hydroxide (NaOH). SDS

detergent is to dissolve the lipid components in the cell membrane as well as the cellular

proteins. Meanwhile, NaOH is used to denature the chromosomal and plasmid DNA into

single strands. After the used of Solution II, there is also the used of Solution III. The

KoAC which is in the Solution III is to precipitate the SDS from the solution. Thus, it can

trap the tangled chromosomal DNA. After the centrifugation was done, the KoAC become

white which is become the pellet. The function of acetic acid is to bring the pH to neutral

and makes the DNA strand become denature. The chromosomal strands will become

partially hybridised tangle. The remaining components in the solution after the adding

Solution III are plasmid DNA, small fragments of chromosomal DNA and also RNA. The

pH and the concentration of Tris-Cl and EDTA is crucial for the successful of the

extraction.

The extraction was done with the standard protocols of Sambrook, (1987) in sterile

condition. The overnight culture was harvest 2 times to increase the concentration of the

pellet that contains culture’s DNA. The pellet formed at the bottom of the 1.5 mL

microcentrifuge tube need to be dried properly before adding TE buffer. The pellet was

23

resuspended with TE buffer rather than ultrapure water. TE buffer can solubilize the DNA

and protect it from degradation. The DNA nucleases is supposed to be less active at certain

pH values, but pH 8.0 can safely be used to store the DNA (Aitken, 2012). The elution part

is the crucial one when it comes to decide the volume of the TE buffer that need to be

added. The volume of TE buffer is depends on the size of the pellet formed at the bottom

of the microcentrifuge tube. The small size of the pellet, 15-20 µl of TE buffer is

preferable. If the pellet formed is large, the elution of TE buffer is preferred around 30-50

µl. After adding TE buffer, it is recommended to incubate the pellet 30 minutes to 1 hour

before determine the band by doing Agarose Gel Electrophoresis. This is to ensure the

pellet which is the plasmid is properly conserved by the TE buffer. The AGE was done

with 100 volts of electric current and the duration of running the AGE is between 25-30

minutes depending of the size of the agarose well and the size of the agarose itself. There is

the use of ethidium bromide which is the traditionally used for visualising DNA molecules

within the gel. The used of ethidium bromide has mutagenic effect. The used of ethidium

bromide must be handle with double gloves protection to avoid contamination to the skin.

4.4 Purification of the Extraction Products

The using of RNase for the purification is to degrade the RNA in the extraction products.

The sodium acetate is to neutralise the result in renaturation of plasmid. The

phenol/chloroform/isoamyl alcohol is used in the proportion of 25:24:1 to remove all the

protein and lipid contamination. Phenol inhibits nucleases effectively (Howard &

Whitcombe, 1995). Besides that, phenol also helps in preparing DNA low in protein

contamination without the need for a large number of chloroform use (Howard &

Whitcombe, 1995). The function of highest speed of centrifugation is to ensure the

removal of phenol/chloroform/isoamyl alcohol completely because phenol can inhibit most

24

of the enzymatic reaction in the cells. The cold absolute ethanol is needed to remove salt in

the sample before adding 70% ethanol. 70% ethanol is used to eliminate unwanted salt

residue and organic molecules (Shrey & Coon, 1998). After the adding of 70% ethanol, the

centrifugation can be done twice to make the pellet of the plasmid at the bottom of the

microcentrifuge tube. In purification process, the pellet is avoided to be too dry to avoid

the difficulties in dissolving the pellet with TE buffer. The volume of TE buffer that was

added was still depends on the size of the pellet formed.

Figure 4.4.1 : Agarose gel (1.0%) electrophoresis of gene extraction. First lane:1 kb ladder (Vivantis), lane

1: other sample, lane 2-3: pAGS/GFP extraction samples.

The shape of the band is U-shaped since the extraction done is the vector. U-shaped

formed is due to the superhelical form of the DNA that was extracted.

5200 bp 5793 bp

Ladder 1 2 3

25

Figure 4.4.2 : Agarose gel (1.0%) electrophoresis of plasmid extraction. First lane:1 kb ladder (Promega),

lane 1-2: The pPICZ A extraction and purification results.

2500 bp 3300 bp

Ladder 1 2

26

4.5 Amplification of GFP gene by PCR

. Figure 4.5: Agarose gel (1.0%) electrophoresis of amplified plasmid using PCR. The results with amplicons

indicate plasmids containing insert. Last lane: 1 kb ladder (Promega), lane 1-6: GFP gene PCR samples.

The PCR condition was optimized for amplification of GFP gene. The optimized annealing

temperature was set at 52 ˚C. The annealing temperature was determined and calculated by

considering the CG content of the primer. The gel purification was done by using GeneJET

Gel Extraction kit by Thermo Scientific. The gel was purified to recover the PCR product.

750 bp 693 bp

1 2 3 4 5 6 7 Ladder 8 9

27

4.6 Ligation of pGEM-T and GFP gene

The ligation was done overnight to increase the efficiency of the ligation process. The

vector used was pGEM-T Easy vector. This step is to enhance the efficiency of GFP gene

to ligate with the pPICZ A vector.

4.7 Transformation of pGEM-T/GFP gene and blue/white screening

There is no band after doing AGE for the extraction products of transformation of pGEM-

T/GFP. It might be because of the competent cells used in the transformation is ruptured

due to the vigorous pipetting. The competent cells are so fragile and must handle with care.

The first trial of transformation of pGEM-T/GFP gene is failed might be due to the

exceeding duration of heat shock step which is done for 2 minutes. The standard protocol

recommended only 45 seconds is needed for the heat shock step. The prolonged of the heat

shock duration might break down the competent cells. Besides, the duration of incubation

in ice after the heat shock step was also being prolonged up to 10 minutes. The standard

protocols recommended were only 2 minutes in ice. The cells might be too long in the ice

and it is not a suitable condition for the cells after having heat shock step. The

transformation of the pGEM-T/GFP was done with positive and negative controls. The

plating of the pGEM-T/GFP gene was done in LAIX plate for the blue/white screening.

28

Figure 4.8.2: The positive control of the transformation which were all white colonies.

Figure 4.8.3: The negative control of the transformation with only two blue colonies that have no insert.

The positive transformants are grown in white colony as expected instead of negative

control of the transformant. The negative transformant plate should be all blue colony

rather than white due to the absence of the insert in the vector. There are only two colonies

that were in blue for the negative colony. This might because of the poor efficiency of the

ligation and transformation process due to the problems of techniques used as well as the

inefficient of competent cells. Instead of poor transformation efficiency, it also might be

29

because of the competent cells used for the transformation. The competent cells that were

used was already put outside -80˚C overnight which was stored at -20˚C. The competence

ability is strictly based on the stored temperature. The competent cells only can be stored

outside -80˚C for 1 hour. Exceeding the period may result in poor efficiency of the

competency of the cells.

The blue/white screening can be done for this transformation due to the presence of

LacZ gene in the pGEM-T vector. The transformant is cultured in a medium called X-gal.

There are two essential components in the X-gal which are ampicillin, that prevents the

growth of any bacterium that has not successfully received the gene which is ampicillin-

resistance from the plasmid and the other one is the substrate for β-galactosidase. The

bacteria that have the foreign gene that was inserted in it will not hydrolyze the lactose and

will produce the white colony. Meanwhile, if the gene has the original LacZ gene, the cells

will hydrolyzed the X-gal and produced blue-colored compound that will make the colony

become blue (Tortora, Funke, & Case, 2010). In this process, there are also two genes to

complete the process of screening for determination of the host bacterium that already

being inserted with plasmid DNA (Tortora, Funke, & Case, 2010).

4.8 Restriction Enzyme Digestion

The restriction enzyme used for the restriction enzyme digestion was Not1 and Xho1.

30

4.9 Transformation of PPICZ A/ GFP gene into E. coli competent cells

Figure 4.9.1: The transformants of pPICZ A/GFP grown on LB low salt with Zeocin.

Figure 4.9.2: The plate of negative control showed the absence of colonies.

31

There are a few colonies formed on the plate of LA low salt with Zeocin. Confirmation

was done to determine the form of pPICZ A/GFP ligation in the E. coli competent cells.

4.10 Confirmation of pPICZ A/GFP by using PCR colony

Figure 4.10: Agarose gel (1.0%) electrophoresis of confirmation for GFP gene after the construction

into pPICZ A. Lane 1-5: GFP gene.

The size obtained shown indicate the original size of the GFP gene which is 693 bp. The

presence of the band indicates the successful of the ligation and transformation of the

pPICZ A/GFP into the E. coli competent cells. Thus, the construction of the GFP gene into

yeast vector which is pPICZ A vector was successful. The lane that was not bright might

be due to the low concentration of the plasmid during ligation.

1000 bp

500 bp 693 bp

1 2 3 4 5 Ladder

32

5.0 CONCLUSION AND RECOMMENDATION

As a conclusion, the construction of GFP gene into pPICZ A which was the yeast vector

was successful. The subcloned method by using restriction enzyme digestion method is

more preferable instead of using pGEM-T method of transformation. Thus, it is

recommended that the further study should be done in the stage of the recombinant

technology which is expression level.

33

References

Aitken, A. (2012). TE buffer (Tris-EDTA buffer). Retrieved from

http://www.nhm.ac.uk/resources-rx/files/te-buffer_aug12-118648.pdf.

Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and

Struhl, K. (2002). Short protocols in molecular biology: a compendium methods

from Current protocols in molecular biology (5th

ed.). Canada: John Wiley & Sons,

Inc.

Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W., and Prasher D. C. (1994).

Greenfluorescent protein as a marker for gene expression. Science, 263(5142), 802-

805.

Cregg, J. M., Tolstorukov, I., Kusari, A., Sunga, J., Madden, K., and Chappell, T. (2009).

Expression in the yeast Pichia pastoris. Methods Enzymol, 463, 169-189.

Daly, R., and Hearn, M. T. (2005). Expression of heterologous proteins in Pichia pastoris:

a useful experimental tool in protein engineering and production. Journal

Molecular Recognition, 18(2), 119-138.

DNA isolation and analysis. (n.d.). Retrieved March 7, 2013 from

http://www.emcp.com/product_catalog/resourcefile.php?ID=3219

Haseloff, J. (1999). Imaging living cell. Cambridge, UK: Springer Berlin Heidelberg.

Howard, J., & Whitcombe, D. M. (1995). Diagnostic bacterial protocols. United States of

America: Humana Press Inc

Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J. (1990). PCR protocols. A

guide to methods and applications. San Diego, CA: Academic.

Jha, A. (2011). Glow cat: fluorescent green felines could help study of HIV. The Guardian.

Kain, S. R., Adams, M., Kondepudi, A., Yang, T. T., Ward, W. W., and Kitts, P. (1995).

Green fluorescent protein as a reporter of gene-expression and protein localization.

Biotechniques, 19, 650-655.

King, T., and May, P. (n.d.). Green fluorescent protein. Retrieved September 28, 2013,

from http://www.chm.bris.ac.uk/motm/GFP/GFPh.htm.

Linker ligation. (2013). Retrieved October 15, 2013, from

http://www.thermoscientificbio.com/uploadedFiles/Resources/linker-ligation.pdf.

Macauley-Patrick, S., Fazenda, M. L., McNeil, B., and Harvey, L. M. (2005).

Heterologous protein production using the Pichia pastoris expression system.

Yeast, 22(4), 249-270.

34

Mackay, M. (2013). PCR down under. Retrieved September 29, 2013, from

http://www.uq.edu.au/vdu/PDU_PCRPrimers.htm.

Morrison, D. A. (1977). Transformation in Escherichia coli: cryogenic preservation of

competent cells. Journal of Bacteriology, 132(1), 349-351.

NEBcutter. (n. d.). Retrieved December 16, 2013, from

http://tools.neb.com/NEBcutter2/cutshow.php?name=75615b0d-.

NextGen Sciences. (2005). Retrieved from

http://wolfson.huji.ac.il/expression/procedures/bacterial/competent_cells%20_guid

e_v3.pdf.

Open Wet Ware. (2013). TE. Retrieved from http://openwetware.org/wiki/TE_buffer.

Ormo, M., Cubitt, A. B., Kallio, K., Gross, L. A., Tsien, R. Y., and Remington, J. (1996).

Crystal structure of the Aequorea victoria green fluorescent protein. Science,

273(5280), 1392-1395.

Prasher, D. C., Eckenrodeb, V. K., Wardc, W. W., Prendergastd, F. G., and Cormierb, M.

J. (1992). Primary structure of the Aequorea victoria green-fluorescent protein.

Gene, 111, 229-233.

Ravichandran, M. (n.d.). Retrieved October 14, 2013, from

www.ppsk.usm.my/lecturers/mravi/PDF.

Romanos, M. A ., Scorer, C. A., and Perret, J. (1992). Foreign gene expression in yeast: A

review. Yeast, 8, 423-488.

Rothe, K.F., & Heisler, N. (1986). Distribution of tris buffer between intracellular and

extracellular space as a function of plama pH in the rat, Acta Anaesthesiologica

Scandinavica, 30(2), 111-115.

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1987). Molecular cloning: A laboratory

manual (2nd ed.). New York: Cold Spring Harbor Laboratory Press.

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular cloning. A laboratory

manual (2nd ed.). USA: Cold Spring Harbor Laboratory Press.

Shrey, A., & Coon, C. (1998). Phenol-Chloroform Isoamyl Alcohol DNA extraction.

Retrieved from

http://ccoon.myweb.usf.edu/ecoimmunology.org/PCI_extraction.html.

Sreekrishna, K., Potenz, R. H., Cruze, J. A., McCombie, W. R., Parker, K. A., Nelles, L.,

… Wood, P. J. (1988). High level expression of heterologous proteins in

methylotrophic yeast Pichia pastoris. Basic Microbiol, 28, 265-278.

Tortora, G. J., Funke, B. R., & Case, C. L. (2010). Microbiology an introduction (10th

ed.). San Francisco: Pearson International Edition.

35

Ward, W. (2009). History of GFP and GFP antibodies. Retrieved September 24, 2013,

from http://www.brighterideasinc.com/proteins-antibodies/history-of-gfp-and-gfp-

antibodies/.

Zupan, A. L., Trobec, S., Gaberc-Porekar, V., and Menart, V. (2004). High expression of

green fluorescent protein in Pichia pastoris leads to formation of fluorescent

particles. Biotechnology, 109, 115-122.

36