Containing an Ets-Binding Site and a CRE-Like Site

Vol. 13, No. 5MOLECULAR AND CELLULAR BIOLOGY, May 1993, p. 3027-30410270-7306/93/053027-15$02.00/0Copyright X 1993, American Society for Microbiology

Identification of a Novel Interleukin-6 Response ElementContaining an Ets-Binding Site and a CRE-Like Site

in the junB PromoterKOICHI NAKAJIMA, TAKESHI KUSAFUKA, TAKASHI TAKEDA, YOSHIO FUJITANI,

KAZUTO NAKAE, AND TOSHIO HIRANO*Division ofMolecular Oncology, Biomedical Research Center, Osaka University

Medical School, Suita, Osaka 565, JapanReceived 27 October 1992/Returned for modification 24 February 1993/Accepted 3 March 1993

Interleukin-6 (IL-6) activation of the immediate-early genejunB has been shown to require both a tyrosinekinase and an unknown 1-(5-isoquinolinesulfonyl)-2-methylpiperazine (H7)-sensitive pathway. Here we reportthe identification and characterization of an IL-6 immediate-early response element in the junB promoter(designated JRE-HL6) in HepG2 cells. The JRE-IL6 element, located at -149 to -124, contains two DNAmotifs, an Ets-binding site (EBS) (CAGGAAGC) and a CRE-like site (TGACGCGA). Functional studies usingvariously mutated JRE-IL6 elements showed that both motifs were necessary and sufficient for IL-6 responseof the promoter. The EBS of the JRE-EL6 element (JEBS) appears to bind a protein in the Ets family or arelated protein which could also form a major complex with the EBSs of the murine sarcoma virus longterminal repeat or human T-cell leukemia virus type 1 long terminal repeat. The CRE-like site appears toweakly bind multiple CREB-ATF family proteins. Despite the similarity in the structure between the JRE-IL6element and the polyomavirus enhancer PyPEA3, composed of an EBS and an API-binding site and known tobe activated by a variety of oncogene signals, JRE-IL6 could not be activated by activated Ha-Ras, Raf-1, or12-O-tetradecanoylphorbol-13-acetate. We show that IL-6 activates JRE-HL6 through an H7-sensitive pathwaythat does not involve protein kinase C, cyclic AMP-dependent kinase, Ca2 - or calmodulin-dependent kinases,Ras, Raf-1, or NF-IL6 (C/EBPO). The combination of JEBS and the CRE-like site appears to form the basisfor the selective and efficient response of JRE-IL6 to IL-6 signals, but not to signals generated by activatedHa-Ras, Raf-1, or protein kinase C.

Interleukin-6 (IL-6) is a multifunctional cytokine regulat-ing cell growth, differentiation, and cellular functions inmany cell lineages and may play a role in the pathogenesis ofa variety of diseases (for reviews, see references 32-34, 66,78). IL-6 induces immunoglobulin production in activated Bcells (35), T-cell activation, growth, and differentiation (79),macrophage differentiation (54,67), maturation ofmegakaryo-cytes (40), and neuronal differentiation in PC12 pheochro-mocytoma (65), and IL-6 stimulates production of acute-phase reactants in hepatocytes (2, 18). IL-6 is a growthfactor for myeloma and plasmacytoma cells (44, 58, 78) andmay play a role in the generation of plasma cell neoplasias(32, 70).

IL-6 exerts such multiple effects through the IL-6 receptor(IL-6R) complex, composed of an 80-kDa ligand-bindingsubunit (IL-6Ra) (88) and a 130-kDa signal-transducing andhigh-affinity-converting subunit (gp130) (28, 72). Both gpl3Oand IL-6Ra belong to the cytokine receptor superfamily (5,10). This family shares a number of highly conserved struc-tural features, including a WSXWS motif and four conservedcysteines. As is the case for IL-3R, granulocyte macrophagecolony-stimulating factor receptor and IL-SR complex,where a common 1 chain is utilized as a signal-transducingand affinity-converting subunit (45, 73), gp130 has beenrecently reported to function as a subunit of a high-affinityreceptor complex for both leukemia inhibitory factor andoncostatin M (19) and may generate intracellular signals forthese cytokines. Moreover, gpl3O has been demonstrated to

* Corresponding author.

be a signal-transducing subunit for a ciliary neurotrophicfactor receptor complex (39). These facts may explain a partof the mechanism of redundancy in cytokine functions. Theproximal portion (61 amino acids) of the gpl3O cytoplasmicdomain was recently shown to be sufficient to generateintracellular IL-6 signals to support proliferation of a murineIL-3-dependent pro-B-cell line which had been stably trans-fected with various truncated forms of gpl3O (56). Theexistence of conserved short stretches in the cytoplasmicdomains of gpl30, granulocyte colony-stimulating factorreceptor, leukemia inhibitory factor receptor, and othercytokine receptors of this family was demonstrated (17, 20,56). However, the mechanisms by which IL-6 exerts suchmultiple functions through receptor complexes remainlargely unknown. To investigate the basis of the diversifiedfunctions of gpl30-mediated signals, it is important to eluci-date the molecular mechanisms of IL-6 signal transductionpathways leading to programmed gene expression and even-tually causing cell proliferation or differentiation.We have been focusing on IL-6-induced early events in

both the cytoplasm and nucleus, which result in transcrip-tional activation of the IL-6-inducible immediate-earlygenes. It was demonstrated by Nakajima and Wall (57) thatIL-6 very rapidly induced tyrosine phosphorylation of p160and that both the tyrosine kinase activity and an unidentifiedH7-sensitive kinase distinct from protein kinase C (PKC),cyclic AMP-dependent kinase (PKA), cyclic GMP-depen-dent kinase, or Ca2+- or calmodulin (CM)-dependent ki-nases, were required for the subsequent transcriptionalactivation of IL-6-inducible immediate-early genes such asthejunB (64) and TIS11 (49) genes in a B-cell line. This result

3027

on April 16, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

3028 NAKAJIMA ET AL.

was subsequently confirmed in a myeloleukemic Ml cell line(50). The rather selective and rapid activation of the junBand TIS11 genes by IL-6 in a wide variety of cell lineages,including lymphoid, hematopoietic, and others (hepatomacells used in this study) prompted us to take advantage ofone of these genes, the junB gene, as a target gene for IL-6signals to further delineate the constituents of the IL-6 signaltransduction pathway through the receptor complex to thenucleus.Here we report the identification of an IL-6 immediate-

early response element in the junB promoter, designatedJRE-IL6, which contains an Ets-binding site (EBS) and aCRE-like site. We show that in an in vitro study the EBS ofthe JRE-IL6 element (JEBS) binds an Ets family protein ora very closely related protein which recognizes the GGAAcore motif. The CRE-like site appears to bind CREB-ATFfamily proteins. Both motifs are required for IL-6 respon-siveness of the junB promoter. Furthermore, we show thatthe combination of JEBS and the CRE-like site makes itpossible for JRE-IL6 to receive IL-6 signals efficiently andnot to receive other well-characterized signals, such as PKC,Ras, and Raf signals.

MATERIALS AND METHODS

Cells and transfection. A hepatoma cell line, HepG2, wasgrown in Dulbecco's modified Eagle's medium (DMEM)supplemented with 10% heat-inactivated fetal calf serum(FCS). For transfection experiments, cells were seeded at106 cells per 10-cm-diameter dish, and 24 h later, the cellswere transfected with DNA by the calcium phosphate co-precipitation technique (24). Typically, 8 ,ug of a plasmidcontaining the chloramphenicol acetyltransferase (CAT) re-porter gene, 3 jig of pEFLacZ (pEF-BOS [55] [a gift from S.Nagata] expression vector containing the lacZ gene encod-ing ,-galactosidase) as an internal control for transfectionefficiency and, in some experiments, the indicated amountsof various expression vectors were used. The total amountof DNA used for transfection was adjusted to 17 to 21 ,ugwith pTZ19R (Pharmacia) or control expression vectorslacking an insert DNA. Cells were incubated with the DNAcoprecipitate for 16 h, washed with phosphate-bufferedsaline (PBS), refed with complete medium or DMEM con-taining 0.1% FCS for 20 to 24 h, and either not stimulated orstimulated with human recombinant IL-6 (77) (AjinomotoCo, Ltd.), forskolin (FK) (Sigma), 12-O-tetradecanoylphor-bol-13-acetate (TPA) (Sigma), calcium ionophore A23187(Sigma), or TPA plus A23187 for 3 to 5 h. In some experi-ments, protein kinase inhibitor, 1-(5-isoquinolinesulfonyl)-2-methylpiperazine (H7 [29]) or N-(6-aminohexyl)-5-chloro-1-naphthalene sulfonamide (W7 [30]) (Seikagaku Kogyo) wasadded 15 min before IL-6 stimulation. Around 40 to 45 hafter transfection, cell monolayers were washed in PBS,collected in 100-,u portions of 0.25 M Tris HCl at pH 7.8,assayed for ,-galactosidase activity and then for CAT activ-ity (23), using adjusted amounts of cell lysates containingequal levels of 3-galactosidase activity to normalize thetransfection efficiency. CAT activity was quantified by liquidscintillation counting of excised sections of thin-layer chro-matographic plates and expressed as percent conversion of[14C]chloramphenicol to its acetylated derivatives.For PKC depletion experiments, HepG2 cells were treated

with 1 p,g ofTPA per ml or 0.1% dimethyl sulfoxide (DMSO)(control) for 40 h from immediately after transfection to justbefore stimulation with various stimulating reagents. Thestimulation periods were 45 min for RNA slot blot analysis

and 5 h for CAT assay. Total cytoplasmic RNA was pre-pared by the Nonidet P-40-proteinase K method, and RNAslot blot analysis was performed as described previously (57)with mouse junB cDNA (1.8-kb EcoRI fragment of p465.20,a gift from D. Nathans) and CHO-B cDNA (0.6-kb EcoRI-BamHI fragment, a gift from J. Darnell, Jr.).

Recombinant plasmids. A mouse junB gene with 6.5-kbupstream region was obtained by screening a mouse genomicDNA library with the junB cDNA, and a 2.8-kb upstreamregion was sequenced. A genomic fragment of 1.5-kb up-stream region and a part of the junB gene up to +235 wascloned into pBLCAT5 to make JB1500CAT5. pBLCAT5was derived from pBLCAT3 by removing a 267-bp EcolO9-NdeI fragment (69). A series of 5' deletion mutants(JB477CAT5, JB194CAT5, and JB87CAT5) were made bydeleting the upstream region to SmaI, PstI, and SacII sites,respectively, from the JB1500CAT5 construct. Blunt endswere generated and religated. To make the construct con-taining the minimal junB promoter fused to the CAT gene(the minimal junB promoter-CAT gene construct),JB42CAT5, a PvuII-PvuII fragment (from -42 to +136[-42/+136]) containing a TATA box was inserted at theBglII site (which had been filled with Klenow fragment) ofpBLCAT5. To generate p194/87TKCAT4, p194/42TKCAT4,and p87/42TKCAT4, a PstI-PvuII (-194/-42) fragment wassubcloned first into pSP73 (Promega) digested with PstI andPvuII, and then each of PstI-PvuII (-194/-42), PstI-SacII(-194/-87), and SacII-PvuII (-87/-42) fragments was ob-tained and transferred to pBLCAT4 containing the truncatedherpes simplex virus thymidine kinase promoter. The junBpromoter with a 3-kb upstream region was fused to the CATgene with the backbone of pSP72 (Promega) to makeJB3000WT.

Synthetic oligonucleotides and minimal promoter-CAT geneconstructs. The synthesized oligonucleotides, positions, andsequences were as follows: Jl (-194/-169), 5'-GCCGCGCAGAGCCACCCGGCTCGTGGI-3'; J2 (-178/-154), 5'-GCGGCTCGTGGCCGCTGTlTTACAAGGI-3'; J3 (-163/-139),5'-GTTTACAAGGACACGCGCTTCCTGAI-3'; J4 (-149/-124), 5'-GCGCTGCCTGACAGTGACGCGAGCCGI-3'; J5(- 134/-109), 5'-GACGCGAGCCGCCTCCTCCCCTTCCCI-3'; J6 (-118/-94), 5'-jTCCCCGTGCCCCACGCTCTAGGAGGGI-3'; J7 (-103/-79), 5'--iTCTAGGAGGGGGCCGCGGGGGCCTGI-3'; DJ4, 5'-GCGCTGCCTGACAGTGAI-3'; J4M1, 5'-GCGCGACCTGACAGTGACGCGAGCCGI-3';J4M2, 5'-GCGCTTCCTGGCTGTGACGCGAGCCGI-3';J4M3, 5'-GCGCTTCCTGACAGTGAGGAGAGCCGT-3';J4M4, 5'-GGCGCTlCCTGACAGGTACGCGTGCCGI-3'; JEBS-VIPCRE, 5'-GCGCTTCCTGACAGTGACGTCGTTTGT-3'; JEBS-ENKCRE2, 5'-GCGCGTCCTGACAGTGACGCAGGCCGT-3'; JEBS-COLAP1, 5'-GCGCTTCCTGACAGTGACTCATGCCTGT-3'; and PEA3-AP1, 5'-GiTCGACTGTGCTCAGTTAGTCACTTGCTCGAI-3'. Complementary oli-gonucleotides were made so that there was a PstI restrictionsite at the 5' end and a XbaI site at the 3' end, respectively.The underlined bases at both ends were added to get thosesites. These oligonucleotides were phosphorylated at 5'ends, annealed, and ligated with JB42CAT5, the minimaljunB promoter-CAT gene construct, or with spCAT contain-ing a minimal junB promoter and the CAT gene in pSP72.The oligonucleotides used as probes or competitors and

their sequences were as follows: somatostatin CRE, 5'-AGCTTGTGACGTCAGAGAGAG-3' and 3'-ACACTGCAGTCTCTCTCCTAG-5'; collagenase TRE, 5'-AGClTlGATGAGTCAGCCG-3' and 3'-ACTACTCAGTCGGCCTAG-5'; hemo-pexin A site, 5'-AGCTlTTGCGTGATGTAATCAGCG-3'

MOL. CELL. BIOL.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

A NOVEL IL-6 RESPONSE ELEMENT IN THE junB PROMOTER 3029

and 3'-AACGCACTACATTAGTCGCCTAG-5'; J4ets2, 5'-CGGCGCTlCCTGAACGGTACCCGTGCCG-3' and 3'-CGCGAAGGACTITGCCATGGGCACGGCGCG-5'; J4etsl,5'-CGGCGCTT'CCTGTACGGTACCCGTGCCG-3' and 3'-CGCGAAGGACATGCCATGGGCACGGCGCG-5'; strome-lysin EBSs 5'-GATCGCAGGAAGCATTTCCTGG-3' and 3'-CGTCCTTCGTAAAGGACCCTAG-5'; murine sarcoma vi-rus (MSV) long terminal repeat (LTR) EBS, 5'-CGGCGCGC'TTCCGCTCTCCGAG-3' and 3'-CGCGCGAAGGCGAGAGGCTCGCG-5'; and human T-cell leukemia virustype 1 (HTLV1) LTR EBS, 5'-CGACCCAlTTCCTCCCCATGTlTTG-3' and 3'-TGGGTAAAGGAGGGGTACAAACGCG-5'.

Site-directed mutagenesis by PCR. Mutations were intro-duced at the JEBS site or the CRE-like site of the JRE-IL6element in the context of the intact junB promoter with a3-kb upstream region by the method of overlap extensiontechnique using polymerase chain reaction (PCR) (36). Theprimers used for mutations are as follows: for Ml, 5'-l-T-lACAAGGACACGCGCGACCTG-3' and 5'-CAGGTCGCGCGTGTCCTTGTAAA-3'; for M5, 5'-TTCCTGACAGGiIACGCGAG-3' and 5'-CTCGCGTACCTGTCAGGAA-3'; for5' primer, 5'-CTTGTACAATAGGTACCTGAGC-3'; andfor 3' primer, 5'-1Tll CTCTCCCTCCGTGGTAC-3'. Theunderlined bases are the mutated ones. After the PCRproducts were subcloned into pBSKS+ (Stratagene), thesequences of the PCR products were verified by DNAsequencing with a commercially available kit (Pharmacia).The PCR products were digested with KpnI and HindIII, andinserted at the proper position of JB3000WT to makeJB3000M1 and JB3000M5.

Expression vectors. The expression vectors used were asfollows: pSVEJ6.6 (71) (a gift from Y. Kondoh), containinga 6.6-kb sequence of activated c-Ha-ras (Ha-rasval12) in thepSV2neo plasmid; pCORAF (42, 53) (a gift from K.Toyoshima, T. Akiyama, and Y. Takai), containing anactivated form of c-raft cDNA in the plasmid vectorpCOMlu, which was derived from the Harvey sarcoma virussequence; pCMV-NF-IL6 (1), containing a NF-IL6 (C/EBP3) cDNA under the control of the cytomegaloviruspromoter; RSV-KCREB (80) (a gift from R. D. Cone),containing a dominant repressor form of CREB (KCREB)cDNA under the control of the Rous sarcoma virus LTR inthe pRc/RSV vector (Invitrogen); and RSV-RafC4 (7), con-taining a partial c-raf cDNA encoding the amino-terminal257 amino acids of Raf-1, which was shown to act as adominant negative Raf protein blocking endogenous Rafactivity, and RSV-RafC4pml7, expressing a mutant form ofRafC4 (cysteine to serine at position 168) and used as acontrol, both of which were gifts from U. Rapp.

Electrophoretic mobility shift assays (EMSAs). Nuclearextracts were prepared from unstimulated and stimulatedHepG2 cells by the methods described by Dignam et al. (14).Oligonucleotides were labeled by filling in 5' extensions withKlenow enzyme by using a-32P-labeled dCTP. Nuclear ex-tract (6 ,ug) was incubated in a final volume of 15 p.l (10 mMTris HCl [pH 7.5], 50 mM NaCl, 5% glycerol, 1 mMdithiothreitol, 1 mM EDTA, 1 mM spermidine, 100 ,ug ofpoly(dI-dC) poly(dI-dC) per ml) with each probe (10,000cpm; 0.5 to 1 ng) for 30 min at room temperature. Incompetition analysis, extracts were incubated with the indi-cated molar excess of cold oligonucleotides for 5 min prior tothe addition of the labeled oligonucleotides. The reactionproducts were fractionated on a 4.5% nondenaturing poly-acrylamide gel in 0.25x TBE (lx TBE is 0.13 M Tris base,0.12 M boric acid, and 2.0 mM EDTA [pH 8.8]).

Methylation interference assay. An oligonucleotide formethylation interference experiments was made to include ahigh-affinity JEBS from the J4etsl oligonucleotide and alsocontain unrelated sequences to obtain oligonucleotides ofsufficient length. The two sequences of this oligonucleotideare as follows: 5'-GGGCGCCGTITJTGCCCATGCGCGCTTCCTGTACGGTACCCGTGCCG-3' and 3'-GCGGCAAAACGGGTACGCGCGAAGGACATGCCATGGGCACGGC-5'. The oligonucleotide labeled with Klenow fragment byusing [32P]dCTP was incubated with dimethylsulfate at afinal concentration of 0.05 M for 5 min at room temperature.The resulting oligonucleotide was used in an EMSA bindingreaction that contained 2 x 105 cpm of radiolabeled methy-lated oligonucleotide, 50 ,ug of HepG2 nuclear protein, and 2,ug of poly(dI-dC) poly(dI-dC) in a final reaction volume of50 p,l. The products were separated by electrophoresis in a4.5% nondenaturing polyacrylamide gel. Following autora-diography, the bound and free probes were excised andeluted from gel slices by electroelution and organic extrac-tion. The recovered DNA was cleaved with 1 M piperidineat 90°C for 30 min prior to polyacrylamide gel electrophore-sis on a standard 10% polyacrylamide DNA sequencing gel.An equal number of counts was loaded into each lane of thegel.

RESULTS

Identification of an IL-6 immediate-early response elementin thejunB promoter (JRE-EL6). To resolve the IL-6 signalsactivating junB transcription, we used hepatoma cell lineHepG2 in this study, since HepG2 cells showed the patternand kinetics of IL-6-induced immediate-early gene expres-sion (unpublished observation) similar to those of the IL-6-stimulated B-cell hybridoma, MH60BSF2 cells, and theHepG2 cell line was an easily transfectable one of theIL-6-responsive cell lines we examined, which includedseveral myeloma cell lines and myeloleukemic cell line Ml.To search for IL-6-responsive cis-acting DNA control

element(s) in the 5'-flanking region and promoter of themouse junB gene, we prepared a series of 5' deletionconstructs of the junB 5'-flanking region and promoter withplasmid pBLCAT5 (41) and transfected these constructs intoHepG2 cells. We stimulated the transfected cells with IL-6for 3 to 6 h and assessed each construct for the basalpromoter activity and IL-6 responsiveness. As shown in Fig.1, JB194CAT5 containing a 5' upstream region up to -194had full basal activity and full IL-6 responsiveness compa-rable with those of JB1500CAT5 and JB477CAT5 with a1.5-kb upstream region and an upstream region to -477,respectively. Deletion from -194 to -87 severely reducedIL-6 responsiveness and significantly reduced basal pro-moter activity. Further deletion of 5' upstream region up to-42 and deletion of the downstream region from +242 to+135 severely reduced the basal activity of the junB pro-moter. These results indicated that IL-6 response element(s)resided in the region between -194 and -87 upstream of thejunB cap site. The basal activity of the junB promoter isprobably determined by both sequences within the 194-bpupstream region and an element in the untranslated region,since deletion of only the untranslated region to +35 greatlyreduced the promoter activity (data not shown).To test whether the -194/-87 DNA region alone has the

ability to render a heterologous minimal promoter respon-sive to IL-6, we assayed the IL-6 responsiveness of threeCAT constructs containing either the -194/-42, -194/-87,or -87/-42 DNA fragment inserted upstream of the minimal

VOL. 13, 1993


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


Xhol-1.5kb

-1.5kbJB1500CAT5

JB 477 CAT5

JB 194 CAT5

JB 87 CAT5

SiaISmal-477

CRE-likeEts GC CAAT TATA

mm -

I I IPstI Sacil Pvull-194 -87 -42

Pvull+136

+242

-477

-194

-87

Small

.242Basal IL-6Activity Response

(fold induction)

11 4.2

15 4.3

15 4.4

4.7 1.9

-42 +136JB 42 CAT5

p1 94/42TKCAT4

p87/42TKCAT4

-194 -42TK CAT ( pBLCAT4)

-87 -42 TK CAT ( pBLCAT4 )

-194 -87p194/87TKCAT4 TK CAT ( pBLCAT4)

FIG. 1. An IL-6 response element(s) resides in the -194/-87 region of the junB promoter. At the top is an extended map of the junBpromoter with the locations of various DNA motifs including the TATA box, CAAT box, GC-rich region (GC) (-97 to -81), EBS (Ets), andCRE-like site. Deletion mutants of the mouse junB promoter or DNA fragments of the promoter, shown schematically, were fused to thepromoterless CAT gene of pBLCAT5 or to the minimal thymidine kinase promoter linked to the CAT gene, respectively. To analyze basalpromoter activity and IL-6 responsiveness, HepG2 cells were transfected with 8 jig of plasmid DNA and 3 jig of pEFLacZ. Cells weremaintained in medium containing 10% FCS for 36 to 40 h and stimulated with 100 ng of IL-6 per ml for 3 h, and CAT enzyme activity wasdetermined. Basal promoter activity is the CAT activity relative to that of JB42CAT5, which is defined as 1.0. The IL-6 response (foldinduction) is the ratio of CAT enzyme activity in IL-6-stimulated cells to that in unstimulated cells. The values are averages of fourindependent experiments with standard deviations of less than 20% of each value.

thymidine kinase promoter-CAT gene construct (pBLCAT4).As shown in Fig. 1, IL-6 activated p194/87TKCAT4 andp194/42TKCAT4, but not p87/42TKCAT4, indicating thatthe presence of an element(s) between -194 and -87 wasneeded for IL-6 responsiveness in HepG2 cells. Moreover,this result showed that the -87/-42 fragment containing aGC-rich region, a CAAT box, and an inverted repeat (12)was not involved in IL-6 responsiveness in HepG2 cells.To map the IL-6 response element(s) precisely in the

region between -194 and -87, we made seven sets of 25-bpoligonucleotides with 10-bp sequences overlapping neigh-boring oligonucleotides to cover from -194 to -79 andinserted each of these elements upstream of the minimaljunB promoter of JB42CAT5 (Fig. 2). Of these seven mini-maljunB promoter-CAT gene constructs with the respectivesynthetic oligonucleotide (Jl to J7CAT5 [Fig. 2]), onlyJ4CAT5 containing an oligonucleotide corresponding to the-149/-124 region of the junB promoter responded to IL-6even more than JB194CAT5 did (Fig. 2), probably becauseof the low basal promoter activity of JB42CAT5. We desig-nated this region JRE-IL6 for junB response element forIL-6.The CAT activity of J4CAT5-transfected HepG2 cells

increased very rapidly in response to IL-6 and reachednear-maximal levels within 3 h after IL-6 stimulation (Fig. 3).This IL-6-induced rapid transcriptional activation of theCAT gene driven by the minimal junB promoter with theJRE-IL6 element was consistent with IL-6-induced rapid

transcriptional activation of the junB gene in MH60BSF2cells (57) and HepG2 cells (unpublished observation).Two distinct DNA motifs, a putative EBS and a CRE-like

site in the JRE-IL6 region were required for IL-6 responsive-ness of both the minimal and intactjunB promoters. We foundthat the JRE-IL6 region contained at least two transcriptionfactor-binding motifs: (i) an EBS (designated JEBS; CAGGAAGC) perfectly matched to the consensus sequence forthe Ets-1- and Ets-2-binding site [C(C/A)GGA(A/T)G(C/T)(43, 83)] and (ii) a CRE-like sequence (TGACGCGA) con-taining a TGACG motif (16). To investigate which part of theJ4 region is responsible for IL-6 responsiveness, we testedthe five different J4 CAT5 mutants, as illustrated in Fig. 4A,for IL-6 responsiveness. IL-6 did not activate DJ4 containingthe first 17 bp of the wild type. J4M1 with a mutated JEBS,J4M3 and J4M4, both of which had a mutated CRE-likesequence at different sites, did not show significant IL-6responsiveness. J4M2 with mutations between the two DNAmotifs leaving the two motifs intact responded to IL-6 nearlyas well as J4, although the basal promoter activity of J4M2CAT5 was significantly less than that of J4 CAT5, suggestingthat the flanking region between the two DNA motifs mayaffect the activity of JRE-IL6. These results indicated thatboth DNA motifs were required for IL-6 responsiveness.To assess the roles of the two DNA motifs in the JRE-IL6

region in the intact junB promoter, we introduced twodifferent mutations at JRE-IL6 in the intact junB upstreamregion to -3 kb with a PCR method. One mutant junB

1.0 1.7

2.7

0.9

3.2

MOL. CELL. BIOL.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

A NOVEL IL-6 RESPONSE ELEMENT IN THE junB PROMOTER

-194JB 194 CAT 5

+242

IL-6 Response3normalized

fold induction}3.5

JB 42.CAT 5

Jl CAT 5 -194 -169

J2 CAT 5

J3 CAT 5

J4 CAT 5

J5 CAT 5

J6 CAT 5

-178 -154

-163 -139

-149 -124

-134 -109

1.0

1.0

1.0

1.5

8.6

1.3

-118 -940.6

J7CAT5 -103 - 1.4FIG. 2. An IL-6 response element is mapped between -149 and -124 of the junB promoter. Seven sets of 25-bp oligonucleotides with

10-bp sequences overlapping neighboring oligonucleotides were inserted upstream of the minimal junB promoter linked to the CAT gene ofpBLCAT5 (JB42CAT5). Each of the various CAT gene constructs was assessed for IL-6 responsiveness, as described in the legend to Fig.1. IL-6 responsiveness was expressed in fold induction, which was normalized by dividing the IL-6 response of each CAT gene construct bythat of the JB42CAT5 (around 1.5-fold). The values are averages of three independent experiments with very similar results.

promoter-CAT gene construct, JB3000M1CAT, had a mu-tated JEBS, and the other, JB3000M5CAT, had a mutatedCRE-like site. As shown in Fig. 4B, both mutations severelyreduced the IL-6 inducibility of the intact junB promoter bymore than 90% and reduced the basal promoter activity byaround 40%. These results indicated that the two DNAmotifs in JRE-IL6 were the critical determinants in the junBpromoter with a 3-kb 5'-flanking region for IL-6 responsive-ness and partially contributed to the basal junB promoteractivity in HepG2 cells.

11-6 signals activating the JRE-EL6 region. A variety ofsignals generated by growth factors, reagents activatingPKC or PKA, and activated forms of oncogenes, such asactivated Ha-ras and v-src, have been reported to inducejunB expression in many different cell types (3, 4, 68). Inaddition to IL-6, TPA induced junB mRNA expression byaround 10-fold in HepG2 cells (Fig. 5B). We examined whatkind of signals could activate JRE-IL6 in HepG2 cells andwhat kind of signals could be involved in IL-6 signalsactivating this element. For this purpose, instead of J4CAT5,we used 3xJ4spCAT, containing three repeats of head-to-head, tail-to-tail ligated J4 oligonucleotides upstream of theminimal junB promoter-CAT gene construct with the back-bone of pSP72 (spCAT), since we found that spCAT by itselfdid not respond to IL-6 at all (data not shown). HepG2 cellstransfected with the 3xJ4spCAT reporter gene were eithernot stimulated or stimulated for 5 h with TPA (50 and 200ng/ml), A23187 (1.0 ,uM), TPA (200 ng/ml) plus A23187 (1.0,uM), FK (20 ,uM), or IL-6 (100 ng/ml). As shown in Fig. 5A,neither TPA, A23187, nor TPA plus A23187 significantly

activated JRE-IL6. FK induced 3xJ4spCAT expression by5- to 10-fold, while IL-6 induced reporter gene expression by10- to 20-fold. Other concentrations of TPA (1 to 200 ng/ml)and A23187 (0.1 to 1.0 ,uM) were also tested with similarresults (data not shown). These results suggested that JRE-IL6 could be a target for both PKA signal and IL-6 signal,but not for PKC- or Ca2+-mediated signals.We also studied the role of PKC in IL-6 signals using

HepG2 cells that had been treated with 1 ,ug of TPA per mlfor 40 h to deplete PKC activity. As shown in Fig. 5B, thistreatment effectively inhibited the TPA-inducedjunB mRNAexpression, confirming the effectiveness of this treatment,but had no effect on IL-6-induced junB mRNA expression.The TPA-treated cells showed levels of IL-6- and FK-induced JRE-IL6-driven CAT expression similar to those inthe control DMSO-treated cells (Fig. SB). These resultsindicated that PKC was not involved in IL-6 signals activat-ing JRE-IL6. In addition, together with the result showingthat TPA does not activate the various junB promoter-CATgene constructs in HepG2 cells (data not shown), the dataalso suggest that activated PKC inducesjunB mRNA expres-sion through activation of other unidentified cis element(s).To distinguish between IL-6 and PKA signals, we used

3xJ4spCAT, 3xJ4M1spCAT, and 3xJ4M4spCAT, whichhad three repeats of J4, J4M1, and J4M4, respectively (Fig.SC). In contrast to IL-6 signals that require both JEBS andthe CRE-like site as target sites, FK activated 3xJ4M1 witha mutated JEBS as effectively as 3xJ4, but not 3xJ4M4defective in the CRE-like site, indicating that the CRE-likesite of JRE-IL6 is a sufficient target site for PKA signal. To

VOL. 13, 1993 3031

- 42 +136CAT


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


AIL-6 stimulation

- 1h 3h 6h 1Oh

J4 CAT5

B

-° 20

C

10

2-.0 10

cE

c-Raf-1, 5 xHpxATKCAT for NF-IL6) and stimulated trans-fected cells with IL-6 for 5 h. Exogenously expressedNF-IL6 had very little activity on 3xJ4spCAT (less than1.5-fold [Fig. 6A]), while this NF-IL6 construct increasedhemopexin A site (NF-IL6-binding site)-driven CAT expres-sion by more than 70-fold under the same conditions (datanot shown). The exogenous expression of the activatedHa-Ras or activated c-Raf-1 did not have significant effectson the JRE-IL6-driven CAT expression and did not alter theIL-6 response of JRE-IL6. The activated Ha-Ras and c-Raf-1used here were active in reproducibly stimulating transcrip-tion from a reporter gene with three repeats of the oligonu-cleotide (82) containing PEA3 and PEAl (AP1) motifs of the

A IL-

-149 Ets-binding site CRE-like -124J4 GCGCTTCCTGACAGTGACGCGAGCCG

I I I Ii I III I I I I I I

nIIA , , , , I II I

Il.f A I

0 lh 2h 3h 6h 10hFIG. 3. IL-6 rapidly activates transcription from the IL-6 re-

sponse element. (A) HepG2 cells transfected with J4CAT5 wereeither not stimulated (-) or stimulated with 100 ng of IL-6 per ml forthe indicated times. A typical CAT assay from four independentexperiments is shown. (B) Kinetic changes in CAT enzyme activityexpressed as percentages of acetylated chloramphenicol (percentconversion) are shown. Data are averages of at least three indepen-dent experiments. The standard deviation of each point is less than20% of each value.

examine whether PKA activates the CRE-like site throughCREB-ATF1 or similar proteins, we used an expressionvector (RSV-KCREB [80]) encoding a CREB mutant(KCREB) lacking DNA-binding activity, known to act as anegative dominant CREB by dimerizing and alleviating theDNA-binding activities of endogenous CREB-ATF1 andCREM. Cotransfected RSV-KCREB severely impaired FK-induced JRE-IL6 activation but had no effect on IL-6 acti-vation of the element. These results show that IL-6 and PKAsignals have different target sites and act on different tran-scription factors.We next examined the effect of protein kinase inhibitor H7

and an inhibitor for Ca2+- or CM-dependent kinases, W7, onIL-6 induced JRE-IL6 activation. As shown in Fig. 5D,IL-6-induced activation of JRE-IL6 element was inhibited byH7 at concentrations similar to those effective in inhibitingIL-6-induced junB mRNA expression in MH60BSF2 cells(57) and HepG2 cells (data not shown). The inhibitory effectof H7 was not due to toxicity inhibiting general transcription,since 12-h treatment of cells with 40 ,uM H7 did not affect thebasal level of CAT activity from 3xJ4spCAT (data notshown). W7 had no inhibitory effects, even at 40 ,uM. Theseresults were fully consistent with the previous characteriza-tion of IL-6 signals activating immediate-early genes (50, 57).Next we examined whether Ras, Raf-1 (63), or NF-IL6

(also called C/EBP,B, IL-6DBP, and LAP) (1, 8, 13, 61) wasinvolved in IL-6 signals activating the JRE-IL6 element. Wecotransfected expression constructs encoding either acti-vated Ha-Ras (71), activated c-Raf-1 (42, 53), or NF-IL6 (1)along with the 3xJ4spCAT or relevant control CAT geneconstructs (3xPEA3AP1spCAT for activated Ha-Ras or

J4 Ml

J4 M2

J4 M3

J4 M4

B

= 4

0c3I-

02

01

0

G-T |1 T l

II I______ ___ ___ _

I G -A - i_ _

6 ResponseNormalizedfold Induction

6.1

1.0

1.3

4.5

1.7

-T 1.0

JB3000WT JB3000M1 JB3000M5FIG. 4. The two DNA motifs (a putative EBS and a CRE-like

site) of the JRE-IL6 region are necessary and sufficient for IL-6responsiveness of the junB promoter. (A) Each of the truncated(DJ4) and mutated (J4M1, J4M2, J4M3, and J4M4) versions of theJRE-IL6 region illustrated was inserted upstream of the junBpromoter of JB42CAT5 and assessed for IL-6 responsiveness inHepG2 cells after stimulation with 100 ng of IL-6 per ml for 3 h. IL-6responsiveness of each construct was expressed as normalized foldinduction, as described in the legend to Fig. 2. Results are averagesof three independent experiments. (B) The roles of the two DNAmotifs were assessed in the intact junB promoter with a 3-kbupstream region. JB3000M1CAT and JB3000M5CAT contain muta-tions at the JEBS site (CGCTTCCTG to CGCGACCTG) and at theCRE-like site (TGACGCGA to GTACGCGA) of JRE-IL6, respec-tively, in the otherwise intact junB promoter with the 3-kb 5'-flanking region linked to the CAT gene in the backbone of pSP72.HepG2 cells transfected with 8 p1g of either JB3000WTCAT(JB3000WT), JB3000M1CAT (JB3000M1), or JB3000M5CAT(JB3000M5), and 3 p,g of pEFLacZ were either not stimulated (0) orstimulated with 100 ng of IL-6 per ml (M) for 5 h, and IL-6responsiveness of each construct was assessed. Results are ex-pressed as relative CAT activity. Data are averages of three inde-pendent experiments, with standard deviations indicated by bars.

MOL. CELL. BIOL.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


Control

(-) TPA IL-6_WA _

TPA-treated(-) TPA IL-6

4mJunB

CHO-B

=._

01

._g-CD

c:t

50 200(- L-TPA - J t FK IL-6

A23187TPA+A231 87

- a, - - - -

20

- FK IL-6 - FK IL-6

D

0L-4-

0

I-F-

C)

3J4 3J4M1 3J4M4 3J4 3J4 0 5 10 20 40 20 40 PM+ + 7- LW _

pRc/RSV KCREB HFIG. 5. The JRE-IL6 region is activated by IL-6 through an H7-sensitive kinase (pathway) distinct from PKA, PKC, Ca2- or

CM-dependent kinases. (A) Effects of various activators on JRE-IL6-driven CAT expression. HepG2 cells were transfected with 8 ,ug of aminimaljunB promoter-CAT gene construct with three repeats of J4 (JRE-IL6) oligonucleotides (3xJ4spCAT) and 3 ,g of pEFLacZ. At 36to 40 h posttransfection, the cells were either not stimulated or stimulated with TPA (50 or 200 ng/mI), A23187 (1.0 FLM), TPA (200 ng/ml) plusA231187 (1.0 ,uM), FK (20 AM), or IL-6 (100 ng/ml) for 5 h. Data from more than three experiments are expressed in relative CAT activities,with standard deviations indicated by bars. (B) PKC is not involved in IL-6 signals activating the JRE-IL6 region. (Top) RNA slot blot analysisof the IL-6- and TPA-induced junB mRNA expression in HepG2 cells treated with TPA (1 ,g/ml) or DMSO (0.1% [control]) for 40 h andmRNA levels of the housekeeping CHO-B gene were monitored for internal control. (Bottom) HepG2 cells were transfected with 8 p,g of3xJ4spCAT and 3 ,g of pEFLacZ. Half of the cultures were treated with TPA (1 p,g/ml), and the other half were treated with solvent alone(DMSO at a final concentration of 0.1% [control]) for 40 h. The TPA- or DMSO-treated (control) cells were assessed for IL-6 (100 ng/ml) andFK (20 FLM) responsiveness as described above. (C) IL-6 signals and FK signals activate the JRE-IL6 region using different target sites anddifferent transcription factors. HepG2 cells were transfected with 8 jig of minimal junB promoter-CAT gene constructs (spCAT) containingthree repeats of either J4, 3xJ4spCAT (3J4), J4M1 (3J4M1), or J4M4 (3J4M4), and 36 to 40 h later, the cells were either not stimulated (0),or stimulated with IL-6 (100 ng/ml) (U) or FK (20 p,M) (E) for 5 h. The effect of a negative dominant form of CREB (KCREB) on FK- andIL-6-induced activation of JRE-IL6 was analyzed by cotransfecting 8 p,g of 3xJ4spCAT with 10 pg of the KCREB expression vector(RSV-KCREB) or 10 ,g of the pRC/RSV control plasmid. Cells were stimulated at 36 to 40 h posttransfection as described above. IL-6 andFK responses of each CAT construct are expressed as fold induction as described in the legend to Fig. 1. Data are averages of more than fourexperiments, with standard deviations indicated by bars. (D) Effects of H7 and W7 on IL-6-activated transcription from JRE-IL6. H7 or W7at indicated concentrations were added to HepG2 cells transfected with 3xJ4spCAT 15 min prior to 5-h IL-6 stimulation (100 ng/ml). CATactivities in the inhibitor-treated and IL-6-stimulated cells were expressed as percentages of the values in control IL-6-stimulated cells(indicated as 0). Data are averages of three independent experiments, with standard deviations indicated as bars.

a domain of the polyomavirus Py enhancer (3 xPEA3-APlspCAT) (Fig. 6C), although high levels of endogenousRaf-1 activity in HepG2 cells (7) resulted in high basalactivity and low inducibility of the 3 xPEA3-APl-drivenCAT. Thus, IL-6 activated JRE-IL6, even in the presence ofhigh levels of Ras or Raf activity. The lack of involvement ofRaf in the IL-6 signals activating the junB promoter was

further confirmed by using a vector expressing the dominantnegative form of Raf-1. We cotransfected expression vectorscontaining the dominant negative Raf-1 (RafC4 [7]) and itscontrol (RafC4pml7 [7]) into HepG2 cells with the 3xJ4spCAT reporter gene or the junB promoter-CAT geneconstruct JB3000CAT and stimulated with IL-6 for 5 h. Thedominant negative expression vector did not block IL-6

A B

20

I_

0

(U)

(U

cr.

C

c0._

C

0LL

VOL. 13, 1993


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


A B C

> U

(C)

, 100

03xJ4spCAT

IL-6 - - - -Ha-ras +Raf-1

ml.+ +

c0*_

C.)

0l-

75LL

1-

0._

*_0

0E03xJ4spCAT

(-) Raf RafC4 C4pml7

03xPEA3APlspCAT

Ha-ras - - + - + - +Raf-1 - + -Raf-C4 ++

NF-IL6 + Raf-C4pml7 + +FIG. 6. Ras, Raf-1, and NF-1L6 are not involved in IL-6 signals leading to JRE-IL6 activation. (A) The effects of activated Ras, Raf-1, and

NF-IL6 on the activity of IL-6-stimulated or unstimulated JRE-IL6 are shown. HepG2 cells were cotransfected with 8 ,ug of the 3xJ4spCATreporter gene, 3 ,ug of pEFLacZ, and 5 jig of either NF-IL6 expression vector CMVNF-IL6, activated Ha-Ras expression vector pSVEJ6.6,activated c-Raf-1 expression vector pCORAF, or control plasmid. After 16 h, the transfected cells were refed with medium containing either10 or 0.1% FCS for 22 to 24 h and either not stimulated or stimulated with 100 ng of IL-6 per ml for 5 h. The levels of JRE-IL6-driven CATexpression are shown as relative CAT activity. Since both 10% and 0.1% FCS gave essentially the same results regarding the effect ofactivated Ras or activated Raf-1 on JRE-IL6 activity (see Fig. 9), only the results obtained with 10% FCS are shown. (B) Effects of dominantnegative Raf-1 (Raf-C4) on IL-6-induced activation of the JRE-IL6. HepG2 cells were cotransfected with 8 ,g of the 3xJ4spCAT reportergene, 3 jig of pEFLacZ, and 5 ,ug of either the dominant negative Raf-1 expression vector (Raf-C4) or its control expression vector(Raf-C4pml7). After 16 h, the transfected cells were refed with medium containing 10% FCS for 22 to 24 h and either not stimulated orstimulated with 100 ng of IL-6 per ml for 5 h. The fold increases in the levels of JRE-IL6-driven CAT expression of IL-6-stimulated cells overthose of unstimulated cells are shown. Data are averages of three experiments, with standard deviations indicated as bars. (C) HepG2 cellswere cotransfected with 8 ,ug of 3xPEA3-AP1spCAT, 3 Fg of pEFLacZ, and 5 ,ug of pSVEJ6.6, pCORAF, RSV-RafC4, RSV-RafC4pml7,or control plasmid as indicated, and 16 h later, the transfected cells were washed and maintained in medium containing 0.1% FCS for 26 to28 h. Between 42 and 44 h posttransfection, cells were harvested, and CAT activity was determined. Relative CAT activity is shown, wherethe CAT activity of 3xJ4spCAT was assumed to be 1.0 in the same experimental conditions.

induction of JRE-IL6-driven CAT expression (Fig. 6B) orjunB promoter activity (data not shown), whereas Raf-C4repressed the Ha-Ras-induced 3 xPEA3AP1-driven CAT ex-pression and basal levels of the CAT expression in HepG2cells (Fig. 6C). Taken together, these results strongly sug-gest that neither Ras nor Raf was involved in IL-6 signalsactivating junB transcription.

Characteristics of JEBS- and CRE-like site-binding pro-teins. We examined the binding of nuclear factors in HepG2cells to the JRE-IL6 region by EMSAs. For this purpose, weused an end-labeled oligonucleotide J4 probe containing theJRE-IL6 region or mutated J4 probe containing a JEBS andmutated flanking regions (called J4etsl or J4ets2). Multipleprotein-DNA complexes were detected (Fig. 7A, lane 1,indicated by the bracket) when J4 probe and nuclear extractsfrom HepG2 cells stimulated with IL-6 for 20 min were used.The binding of these proteins could be abolished by excessunlabeled oligonucleotides (Fig. 7A, lanes 2 to 4).To investigate the binding sites and binding specificities of

the multiple complexes, we studied competition between J4probe and either J4M1, J4M2, J4M3, or J4M4 (as in Fig. 4A)or oligonucleotides containing somatostatin CRE, collage-nase TRE, or hemopexin A site (NF-IL6-binding site). Thebinding site for most of the complexes was found to be theCRE-like site of JRE-IL6, since both the J4M1 and J4M2oligonucleotides competed with J4 probe for binding to mostof multiple proteins (Fig. 7A, lanes 5 to 7 and 8 to 10), butneither J4M3 (Fig. 7A, lanes 11 to 13) nor J4M4 (data notshown) with mutations at the CRE-like site did. The oligo-

nucleotide containing somatostatin CRE was a better com-petitor than J4, while the oligonucleotides containing colla-genase TRE or hemopexin A site did not compete well (Fig.7A, lanes 14 to 20), suggesting that the CRE-like site ofJRE-IL6 binds protein complexes that have higher affinitiesto the symmetric CRE of somatostatin than to the atypicalCRE of JRE-IL6. These proteins are most likely CREB-ATFfamily proteins (22, 27, 38, 51). Another complex indicatedby two asterisks in Fig. 7A was likely a protein binding to theintermediate site between JEBS and CRE-like site, since thecomplex exhibited strong competition with J4M1 and J4M3but not with J4M2 or the somatostatin CRE-containingoligonucleotides (Fig. 7A, lanes 8 to 10 and 14 to 16). Thiscomplex appeared to be functionally irrelevant from thefunctional study on IL-6 responsiveness of J4 mutantsshown in Fig. 4A, although this point remains to be clarified.A faint band remaining after the removal of most of themultiple complexes by the excess amount of J4M1 oligonu-cleotides might correspond to the JEBS-binding protein.Nonspecific DNA-protein complexes were indicated in Fig.7A by an asterisk.To demonstrate the protein binding to the JEBS in IL-6-

stimulated HepG2 nuclear extracts, we used two types ofJ4ets oligonucleotides, J4etsl and J4ets2, with differentmutations at the flanking region of JEBS. We also usedvarious oligonucleotides containing EBSs in the MSV LTR(25) (MSV -53/-34), HTLV1 LTR (6), and the humanstromelysin promoter (83) as probes or competitors. Thesesequences of the EBSs of their oligonucleotides are illus-

MOL. CELL. BIOL.

AN^


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


A BProbe J4 Probe J4etsl J4ets2 MSV

Competitor J4 J4M1 J4M2 J4M3 CRE TRE HpxA Competitor J4 + +

Amount 15 60 24015 60 24015 60 240 15 60 24015 60 24015 60 15 60 J4M: - - - -

**-Fv_- *d S

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

DProbe: J4etsl

Competitor: - J4 J4etsl J4ets2

Amount: 15 60 24015 60 240 15 60 240

1 2 3 4 5 6 7 8 9 10 11 12

Probe: J4

Nuclear protein: IL-6

0 20 2h

Competitor: J4M1 MSV LTR HTLV1LTR STM

Amount: 15 60 24015 60 240 15 60 240 15 60 240

Els-binding site ( EBS)

JEBS (J4) GTCAGGAACGCJ4etsl TACAGGAAGCGCJ4ets2 TTCAIGGAA1GCGCMSV LTR GAGCGGAAGCGHTLV1 LTR GGG A:GGAAA TGStromelysin 1 CC TG

2 GC GA CA

J4M1 GTCAGGTGGCGC

1 2 3 4 5 6

FIG. 7. JRE-IL6 binds multiple protein complexes with a specificity similar to those of CREB-ATF family proteins at the CRE-like siteand an Ets family protein or a protein with a specificity similar to the Ets family proteins at EBS. (A) EMSAs of JRE-IL6-binding proteins.Nuclear extracts from HepG2 cells stimulated with IL-6 (100 ng/ml) for 20 min either were not incubated or incubated with the indicated molarexcess of cold J4 competitors (J4, J4M1, J4M2, or J4M3) or other competitors described below for 5 min, followed by incubation with labeledJ4 probes. The oligonucleotides used as competitors other than J4 series are as follows: CRE (som), a CRE site from the somatostatinpromoter; TRE (col), a TRE site from the collagenase promoter; and HpxA, an NF-IL6/IL-6DBP-binding site from the hemopexin Apromoter. The positions of the CRE-like site-binding protein-DNA complexes are indicated by the bracket. The protein-DNA complexindicated by two asterisks appeared to be that bound to the intermediate site between EBS and the CRE-like site. The band indicated by an

asterisk has nonspecific complexes determined by competition analysis. (B and C) Comparison of factor binding to the EBS in J4, MSV LTR,HTLV1 LTR, and the stromelysin promoter. (B) IL-6-stimulated HepG2 nuclear extracts were analyzed by EMSAs for binding to the J4etsl(lanes 1 to 3), J4ets2 (lanes 4 to 6), MSV LTR (lanes 7 to 9), and HTLV1 LTR (lanes 10 to 12) probes in the absence (lanes 1, 4, 7, and 10)or presence of 120-fold molar excess of unlabeled J4 (lanes 2, 5, 8, and 11) or J4M1 (lanes 3, 6, 9, and 12) competitor oligonucleotide. Theposition of specifically formed protein-DNA complexes is indicated by the arrow. Other bands were not constantly observed or abolished withJ4M1. (C) Competition analysis of factor that binds to the J4etsl probe was performed in the presence of the indicated molar excess of thevarious oligonucleotides, including the J4, J4etsl, J4ets2, and J4M1 oligonucleotides and the MSV LTR-, HTLV1 LTR-, and stromelysinpromoter EBS (STM)-containing oligonucleotides. Only the specific complexes are shown. In the lower panel, EBS sequences used here are

illustrated. (D) Nuclear extracts from HepG2 cells that were either not stimulated (lanes 1 and 4) or stimulated with IL-6 (100 ng/ml) for 20min (20') (lanes 2 and 5) or 2 h (lanes 3 and 6) were incubated with labeled J4 (lanes 1 to 3) or labeled J4etsl (lanes 4 to 6) oligonucleotide.Protein-DNA complexes were separated in 0.25x TBE. The positions of specifically bound protein-DNA complexes were indicated by thebracket and arrow. The protein-DNA complexes indicated by the asterisk were nonspecific.

trated in Fig. 7C. The band indicated by an arrow was a

specifically bound DNA-protein complex which was inhib-ited with 120-fold excess amount of J4, but not with the sameamount of J4M1 (Fig. 7B). The intensity of protein complexformed with J4etsl probe was severalfold higher than thatformed with J4ets2 probe (compare lanes 1 and 4 in Fig. 7B).Two other probes, MSV LTR and HTLV1 LTR, formed a

single complex with different intensities, which comigratedwith the J4ets protein complex and exhibited strong compe-tition with J4, but not with J4M1 (Fig. 7B, lanes 7 to 12).We studied the specificities and affinities of the factors that

bound to both J4etsl and J4ets2 using J4, J4etsl, J4ets2,

J4M1 and the EBSs in the MSV and HTLV1 LTRs and in thestromelysin promoter as competitors. As shown in Fig. 7C,J4, J4etsl, and J4ets2 oligonucleotides and the MSV LTREBS-, HTLV1 LTR EBS-, and stromelysin EBS-containingoligonucleotides exhibited competition with J4etsl probesfor the binding activity, but J4M1 did not. Among thesecompetitors, J4etsl and MSV LTR EBS had the highestaffinities for the binding activity. The J4 and J4ets2 oligonu-cleotides and the HTLV1 LTR EBS- and stromelysin EBS-containing oligonucleotides competed with J4etsl for thebinding activity in similar manners, and their affinities for theJEBS-binding protein were estimated to be around fivefold

/LTR HTLV1LTR

CJ4elsl

IL-6

0 20' 2h

E WWbWC-1'I-

VOL. 13, 1993


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


a0

G

G

G

T

A

C

C

G

T

A

C

A

G

G

A

A

G

C

G

C

A

G

0G

a)a) no E.0.-oO CL01) 0

SiLL (n

IF

9.*'

FIG. 8. Methylation interference analysis of the JEBS-bindingprotein complex. Partially methylated, radiolabeled oligonucleotidecontaining a JEBS with short sequence of flanking regions wasincubated with HepG2 nuclear proteins. Bound and free probeswere separated by electrophoresis on a 4.5% nondenaturing poly-acrylamide gel and cleaved with piperidine. The JEBS sequence andthe mutated flanking region (indicated by the straight line at the leftof sequence) is shown at the left of the gel (the 3' end of thesequence is at the bottom). The putative EBS (JEBS) is boxed. Thetwo G residues protected from cleavage by JEBS-binding proteinare indicated (0).

lower than those of J4etsl and MSV LTR EBS. Identicalresults were obtained when competition studies were per-formed with the J4ets2 oligonucleotide as the probe and withthe same set of competitors (data not shown). These cross-competition studies of the EBS-binding proteins in HepG2nuclear proteins showed that the same or very similarproteins bound to JEBS and EBSs in the MSV LTR, HTLV1LTR, and the stromelysin promoter with different affinities.The data suggest that the JEBS-binding protein could be a

member of the Ets family or a protein with a specificity verysimilar to those of Ets family proteins. With regard to thenature of DNA binding of the JEBS-binding proteins and theCRE-like site-binding proteins, these data suggest that theJEBS-binding protein may bind to JEBS independently ofthe CRE-like site-binding proteins, since in the competitionstudies with J4 and J4ets2 (Fig. 7C) or DJ4 (data not shown)lacking the CRE-like site, there were no differences in thecompetitor efficiencies. Next we examined whether IL-6stimulation caused changes in the binding activity to JRE-IL6. The intensities of the multiple protein complexes withthe CRE-like site and of the JEBS-protein complex did notchange with IL-6 stimulation (Fig. 7D, lanes 1 to 3 and 4 to6).

Further support for the notion that the JEBS-bindingprotein is a member of the Ets oncogene-encoded proteinfamily or a closely related protein was obtained from meth-ylation interference experiments using an oligonucleotidecontaining JEBS and a mutated flanking region and HepG2nuclear proteins. As shown in Fig. 8, methylation of the twoG residues at the core of JEBS prevented binding of theJEBS-binding protein. Methylation of these same core resi-dues has been shown to prevent binding of Ets-1 to the MSV

(25) or HTLV1 (21) LTR and binding of PU.1 to the PU boxin the simian virus 40 enhancer (46).The JEBS and CRE-like site combination can be activated

by IL-6. From the functional studies and in vitro DNA-protein binding experiments described above, it is likely thatan Ets family protein or a protein with a specificity verysimilar to those of Ets proteins cooperates with a proteincomplex bound to the CRE-like site in activating the junBpromoter in response to IL-6. In contrast to the cases oftranscription through the combination of a PEA3 site (anEts-binding site) and an AP1 site in the polyomavirus en-hancer and in the collagenase promoter, which can beactivated by many different oncogene products includingRas and Raf, serum growth factors, and TPA (26, 82, 84),JRE-IL6 was not activated by TPA, activated Ha-Ras, oractivated c-Raf-1 in HepG2 cells (Fig. 5 to 7 and 9).To investigate the basis of this functional difference be-

tween the two response elements, we made chimeric ele-ments composed of JEBS and either VIPCRE (a vasoactiveintestinal peptide CRE site), ENKCRE2 (a proenkephalinCRE2 site), or COLAP1 (a collagenase AP1 site). We alsocompared the abilities of these chimeric elements insertedupstream of the minimaljunB promoter spCAT to respond tovarious stimuli. We also included the combination of a PEA3site and an AP1 site taken from the polyomavirus enhancer.These CAT gene constructs, in some experiments togetherwith activated Ras or Raf-1 expression vector, were trans-fected into HepG2 cells, and those cells were cultured in thepresence of 0.1% FCS for 20 h and either not stimulated orstimulated with IL-6, FK, or TPA for 5 h. As shown in Fig.9, IL-6 efficiently activated JRE-IL6. IL-6 also activatedJEBS-VIPCRE and JEBS-ENKCRE2, both of which hadaround 30-fold-higher basal activities than that of the JRE-IL6. IL-6, however, did not activate JEBS-COLAP1 orPEA3-AP1. JEBS-COLAP1 and PEA3-AP1 had the highestbasal activities. Conversely, TPA, activated Ha-Ras, oractivated Raf-1 stimulated JEBS-COLAP1 as well as PEA3-AP1, but not JRE-IL6. FK activated the elements containingthe CRE-like site, and the VIPCRE and the ENKCRE2sites, those elements having a TGACG motif in common.These results showed that IL-6 efficiently stimulated thespecific combination of JEBS and the asymmetricjunB CREsite (TGACGCGA), but IL-6 did not stimulate the EBS andAPi-binding site combination.

DISCUSSION

IL-6 stimulates junB transcription by activating the JRE-IL6 element in thejunB promoter through a novel 117-sensitivesignal transduction pathway. In this study, we have identifiedan IL-6 immediate-early response element in the junB pro-moter, named JRE-IL6, in HepG2 cells. We have elucidatedthe IL-6 signals acting on JRE-IL6, characterized the DNA-binding proteins complexing with the element, and shownthe basis of the selective responsiveness of this element.JRE-IL6 was composed of two distinct DNA motifs, an

EBS (JEBS) (CAGGAAGC) and a CRE-like site (TGACGCGA). In the mutation study, we demonstrated that thetwo DNA motifs in JRE-IL6 were necessary and sufficientfor IL-6 responsiveness both in the minimal junB promoterand in the intactjunB promoter with 3-kb upstream region inHepG2 cells.On the basis of the results of functional properties of

JRE-IL6, we concluded that IL-6 stimulatedjunB transcrip-tion by activating JRE-1L6 through a novel H7-sensitivesignal transduction pathway distinct from pathways involv-

MOL. CELL. BIOL.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


- 42 +136junB

3xJRE-IL6(JEBS-CRE-like) ; GCGCTTCCTGACAG[TGACGICGAGCCG3xJEBS-VIPCRE; GCGCTTCCTGACAGITGACGCTTTG3xJEBS-ENKCRE2; GCGCTTCCTGACAGTGACGICAGGCCG

Relative CAT activity

(-) IL-6 FK TPA Ha-Ras Raf-1

1 21 7.5 1.0 1.0 1.0

23 82 60 37 N.D. N.D.

30 75 115 34 N.D. N.D.

3xJEBS-COLAP1; GCGCTTCCTGACAGTGACTCATGCCTG 100 120 95 255 310 210

3xPolyoma Virus Enhancer(PEA-AP1); TCGAGGAAGTGACTAACTGAGCACAGTCGA

FIG. 9. The EBS (JEBS) and CRE-like site combination is needed to receive IL-6 signals efficiently but not to receive TPA, Ha-Ras, andRaf-1 signals. The JRE-IL6 element, the various chimeric response elements, and PEA3-AP1 from the polyomavirus enhancer, illustratedhere, were assessed for responsiveness to IL-6, FK, TPA, activated Ha-Ras, and activated Raf-1. HepG2 cells were cotransfected with 8 ,ugof each of the various CAT constructs and 3 p.g ofpEFLacZ with or without 5 ,g of pSVEJ6.6 or pCORAF. Transfected cells were maintainedin medium containing 0.1% FCS and either not stimulated (-) or stimulated with IL-6 (100 ng/ml), FK (20 ,M), or TPA (200 ng/ml) for 5 h.The responsiveness of the various elements to IL-6, FK, TPA, Ha-Ras, or Raf-1 is shown as relative CAT activity, with the CAT activity ofthe 3xJ4spCAT (shown as 3xJRE-IL6) in unstimulated HepG2 cells was assumed to be 1.0. N.D., not determined. The response elementsused were as follows: VIPCRE, a CRE site from the VIP (vasoactive intestinal peptide) promoter; ENKCRE2, a CRE2 site from theproenkephalin promoter; and COLAP1, an APl-binding site from the collagenase promoter. Data are averages of three independentexperiments. Each standard deviation is within 15% of the value.

ing PKC, PKA, Ca2+- or CM-dependent kinases, Ras,c-Raf-1, or NF-IL6. This characterization of IL-6 signalsfurther extended the previous findings on IL-6 signals lead-ing to transcriptional activation of both thejunB gene and theTIS11 gene in a B-cell line (57). In the study using quiescentNIH 3T3 cells in which IL-6 inducedjunB and TISI1 mRNAexpression, we obtained very similar results showing thatboth IL-6 and FK stimulated the JRE-IL6 element but thatTPA, serum, and the activated form of Ha-Ras or c-Raf-1 didnot (unpublished observation). The latter result is in agree-ment with the results of Apel et al. (3), who showed thatneither v-ras, v-raf, serum, or phorbol ester activated themousejunB promoter-CAT gene construct containing 4.5 kbof the 5'-flanking sequence, in addition to the identificationof a region at TATAA box of thejunB promoter responsiblefor v-src responsiveness. Thus, the unusual IL-6 signalsactivating junB expression may be operating in many celllineages.

In addition to the uninvolvement of Ras or Raf in the IL-6signals, it is also unlikely that MAP kinases play some role inthe IL-6 signals leading to junB expression, because of thefollowing: (i) we could not detect significant changes in MAPkinase activity in unstimulated and IL-6-stimulated HepG2cell lysates (unpublished data), and (ii) neither stimulation ofPKC2 nor activated form of Ha-Ras or c-Raf-1, locatedupstream of MAP kinases (47, 48, 59, 74, 86) activatedJRE-IL6 in HepG2 cells as well as in NIH 3T3 cells(uppublished observation). Moreover, neither activated Ha-Ras nor activated c-Raf-1 altered IL-6-induced JRE-IL6activity. Thus, the IL-6 signaling pathway characterizedhere is very different from those regulated by phorbol ester,by growth factors such as epidermal growth factor, platelet-derived growth factor, and nerve growth factor (9) or byoncogenes such as ras and raf. The identification of anH7-sensitive kinase or pathway will be necessary to unravelthis novel pathway.JRE-IL6 is a novel IL-6 immediate-early response element.

IL-6 response elements have been characterized so far inregulatory regions of a large set of genes encoding the

acute-phase proteins. These genes are considered to beregulated by tissue-specific (liver-specific) transcription fac-tors and IL-6- and/or IL-1-inducible transcription factors(76). Two types of IL-6 response elements have been iden-tified. Type I elements found in the CRP, hemopexin A,haptoglobin genes have consensus sequence T(T/G)NNGNAAT and have been shown to be binding sites for thefactor called NF-IL6, IL-6DBP, LAP, or C/EBPI (1, 8, 13,61), whose binding activity is induced by IL-6 (52, 60). TypeII elements found in the fibrinogen, a2 macroglobulin, andal acid glycoprotein genes have consensus sequence CTGGGAA and the IL-6 response elements in the promoter of rata2 macroglobulin gene were shown to be responsive to IL-6in HepG2 cells (37). Hocke et al. (37) also showed thatIL-6-induced formation of the IL-6 response element-proteincomplex required ongoing protein synthesis.JRE-IL6 is different from previously characterized IL-6

response elements. It is important that the JRE-IL6 mediatesthe immediate-early response to IL-6 and does not requireprotein synthesis to be activated by IL-6 (unpublished ob-servation). The binding activities of JRE-IL6-binding pro-teins were present without IL-6 stimulation and did notchange following IL-6 stimulation. Oligonucleotides contain-ing a hemopexin A site did not compete with the J4etslprobe for the binding activity to JEBS (data not shown) orwith the J4 probe for multiple protein complexes bound tothe CRE-like site. Moreover, NF-IL6 did not activate JRE-IL6. Finally, JRE-IL6 has no sequence similarity with typeII IL-6 response element (CTGGGAA). Taking these resultstogether, we conclude that JRE-IL6 is a novel IL-6 immedi-ate-early response element.The combination of an Ets or related protein and CRE-like

site-binding proteins is likely to be involved in the activation ofthejunB promoter by IL-6. The functional studies and the invitro DNA-protein binding studies on the JRE-IL6 using aseries of mutated JRE-IL6 showed that there was a verystrong correlation between the binding activities of HepG2nuclear extracts to JEBS and the CRE-like site of JRE-IL6and the functional activities of JRE-IL6 in response to IL-6

VOL. 13, 1993


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


signals. The functional studies on JRE-IL6 (Fig. 4 to 6 and 9)and the chimeric elements (Fig. 9) suggested that the com-bination of JEBS and the CRE-like element is important forefficient activation of the junB promoter by IL-6. In otherwords, it is likely that both the JEBS-binding protein and theCRE-like site-binding proteins are important and should bebound to the JRE-IL6 site simultaneously. However, we didnot see the presence of a slowly retarded band generated bythe simultaneous binding of proteins at the single J4 probe inEMSAs using crude HepG2 nuclear extracts. This phenom-enon most likely resulted from the weak and apparentindependent binding of both types of proteins (Fig. 7A andB). This finding does not rule out the possibility that theJEBS-binding protein interacts with the CRE-like site-bind-ing proteins, possibly through other proteins making proteincomplexes on JRE-IL6. Regarding the independent bindingand functional cooperativity between DNA-binding pro-teins, Wasylyk et al. (82) and Gutman and Wasylyk (26)reported that in the polyomavirus enhancer and the collag-enase promoter, PEA3 and AP1 bind independently to DNAbut act synergistically to achieve maximal induction oftranscription by TPA and several oncogenes.The JEBS site (TCAGGAAGC) resembles the Ets-1- and

Ets-2-binding sites of the human stromelysin promoter(GCAGGAAGC and CCAGGAAAT), polyomavirus enhancerPyPEA3 (GCAGGAAGT), MSV LTR (AGCGGAAGC), andHTLV1 LTR (GGAGGAAATG). Several lines of evidencesuggested that the DNA-binding protein bound to JEBS wasa member of the Ets family or a closely related protein. First,the protein had a specificity very similar to those of Etsfamily proteins, especially Ets-1 and Ets-2. Second, theprotein came into direct contact with JEBS at two G residuesof the core GGAA motif, like Ets-1 or PU.1 (21, 25, 46).Third, a mutation changing T to A at position -3 (relative tothe first G residue) (see the results of EMSAs with J4etsl andJ4ets2 probes in Fig. 7B and C) dramatically increased thebinding activity without changing the specificity. The samephenomenon was reported for the recombinant Ets-1 andEts-2 binding to Ets-1-binding sites (87). Fourth, from cross-competition study, the same protein appeared to form amajor protein-DNA complex with JEBS and EBSs from theMSV and HTLV1 LTRs.The CRE-like site of the JRE-IL6 element probably binds

CREB-ATF family proteins but does not bind AP-1 well,since factors binding to the J4 probe at the CRE-like sitewere very efficiently inhibited by the oligonucleotide con-taining somatostatin CRE, but not collagenase TRE. Con-sistent with this observation, the mobilities of the multiplebands detected by J4 probes were very similar to those ofcomplexes bound to the somatostatin CRE oligonucleotideand a little faster than those of complexes bound to thecollagenase TRE oligonucleotide (unpublished observation).This binding specificity of the CRE-like site is in agreementwith the fact that JRE-IL6 is also activated by FK, but notby TPA or activated Ha-Ras or Raf-1. However, the inten-sities of multiple complexes detected by the J4 probe weremuch weaker than those of protein-DNA complexes de-tected by the somatostatin CRE probe (unpublished obser-vation). This low affinity for CRE-binding proteins is mostlikely due to the fact that the CRE-like site contains only anasymmetric TGACG motif. The CRE-like site of JRE-IL6 issimilar to the CRE site of the tyrosine aminotransferase gene(85), in that both CRE sites have asymmetric and weakbinding sites (TGACG) and very low basal activity with highinducibility by PKA. More intriguingly, JRE-IL6 gives muchhigher inducibility by IL-6 than other chimeric elements

containing JEBS and a different CRE, such as VIPCRE andENKCRE2. From functional studies using the mutatedCRE-like site (J4M3, J4M4, and J4M5) and chimeric ele-ments, this asymmetric TGACG motif appears to be impor-tant for IL-6 to stimulate JRE-IL6 efficiently. Of the CREB-ATF family proteins, we have shown that CREB-ATF1 or aclosely related protein capable of forming a heterodimer withCREB was not involved in IL-6 signals but involved inFK-induced activation of JRE-IL6 (Fig. SC). Other membersof this family are currently being tested for their possibleinvolvement in IL-6 signals.

In support of the notion that an Ets family protein andmembers of CREB-ATF family may bind to and activate theJRE-IL6 element in response to IL-6 signals, we haverecently found that JRE-IL6 can be a real target for the Etsfamily and the CREB-ATF family in both in vitro DNA-protein binding studies (EMSA) and in vivo functionalstudies using transfection experiments. We have observedthat CREB and GABPa proteins synthesized in reticulocytelysates bound to the J4 and J4etsl probes, respectively (datanot shown) and that exogenously expressed CREB, CRE-BP1, and Ets2 enhanced the basal activity of JRE-IL6 when3xJ4spCAT was used as a reporter gene (data not shown).

Thus, the combination of DNA-binding proteins acting onthe JRE-IL6 element would be another case showing coop-erativity in function and/or DNA binding between membersof the Ets family and other DNA-binding proteins, as exem-plified by Ets-1- or Ets-2-AP1 (81), GABPa-GABP, (75),Ets-2-c-Myb (15), PU.1-B cell-specific nuclear factor (62),and p62T F_SRF (11, 31). Since the DNA-binding proteinsbinding to JRE-IL6 and involved in the IL-6 signal transduc-tion pathways are not yet determined, we cannot elucidatethe nature of binding of the JRE-IL6-binding proteins andthe mechanisms by which both DNA motifs functionallycooperate. In addition, we cannot rule out the possibilitythat unidentified JRE-IL6-binding proteins which are notdetected in our in vitro binding studies may receive IL-6signals.

Considering that IL-6 induces junB expression in a widerange of cell lineages including B-cell lines, HepG2, NIH3T3, and PC12, the constituents of the novel IL-6 signaltransduction pathway from surface receptor to transcriptionfactors should be rather ubiquitous. IL-6 may activate otherIL-6-inducible genes in similar manners by activating thecomplex of EBS-binding protein and other transcriptionfactors.

ACKNOWLEDGMENTS

We thank R. Masuda and N. Masuda for excellent secretarialassistance.

This study was supported in part by Grants-in-Aid for ScientificResearch from the Ministry of Education Science and Culture inJapan and the Special Coordination Fund of the Science andTechnology Agency of the Japanese government; funds from theMitsubishi Foundation, the Naito Foundation, and the MochidaMemorial Foundation for Medical and Pharmaceutical Research inJapan; and a research grant from the Princess Takamatsu CancerResearch Fund.

REFERENCES1. Akira, S., H. Isshiki, T. Sugita, 0. Tanabe, S. Kinoshita, Y.

Nishio, T. Nakajima, T. Hirano, and T. Kishimoto. 1990. Anuclear factor for IL-6 expression (NF-IL6) is a member of aC/EBP family. EMBO J. 9:1897-1906.

2. Andus, T., T. Geiger, T. Hirano, H. Northoff, U. Ganter, J.Bauer, T. Kishimoto, and P. C. Heinrich. 1987. Recombinanthuman B cell stimulatory factor 2 (BSF-2/IFNP12) regulates

MOL. CELL. BIOL.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


b-fibrinogen and albumin mRNA levels in Fao-9 cells. FEBSLett. 221:18-22.

3. Apel, I., C.-L. Yu, T. Wang, C. Dobry, M. E. Van Antwerp, R.Jove, and E. V. Prochownik. 1992. Regulation ofjunB gene byv-src. Mol. Cell. Biol. 12:3356-3364.

4. Bartel, D. P., M. Sheng, L. F. Lau, and M. E. Greenberg. 1989.Growth factors and membrane depolarization activate distinctprograms of early gene expression: dissociation of fos and juninduction. Genes Dev. 3:304-313.

5. Bazan, J. F. 1989. A novel family of growth factor receptors: acommon binding domain in the growth hormone, prolactin,erythropoietin and IL-6 receptors, and the p75 IL-2 receptorb-chain. Biochem. Biophys. Commun. 164:788-795.

6. Bosselut, R., J. F. Duvall, A. Gegonne, M. Bailly, A. Hemar, J.Brady, and J. Ghysdael. 1990. The product of the c-ets-1proto-oncogene and the related Ets2 protein act as transcrip-tional activators of the long terminal repeat of human T cellleukemia virus HTLV-1. EMBO J. 9:3137-3144.

7. Bruder, J. T., G. Heidecker, and U. R. Rapp. 1992. Serum-,TPA-, and Ras-induced expression from AP-1/Ets-driven pro-moters requires Raf-1 kinase. Genes Dev. 6:545-556.

8. Cao, Z., R. M. Umek, and S. L. McKnight. 1991. Regulatedexpression of three CIEBP isoforms during adipose conversionof 3T3-L1 cells. Genes Dev. 5:1538-1552.

9. Chao, M. V. 1992. Growth factor signaling: where is thespecificity? Cell 68:995-997.

10. Cosman, D., S. D. Lyman, R. L. Idzera, M. P. Beckmann, L. S.Park, R. G. Goodwin, and C. J. March. 1990. A new cytokinereceptor superfamily. Trends Biochem. Sci. 15:265-270.

11. Dalton, S., and R. Treisman. 1992. Characterization of SAP-1, aprotein recruited by serum response factor to the c-fos serumresponse element. Cell 68:597-612.

12. De Groot, R. P., J. Auwerx, M. Karperien, B. Staels, and W.Kruijer. 1991. Activation of junB by PKC and PKA signaltransduction through a novel cis-acting element. Nucleic AcidsRes. 19:775-781.

13. Descombes, P., M. Chojkier, S. Lichtsteiner, E. Falvey, and U.Schibler. 1990. LAP, a novel member of the C/EBP gene family,encodes a liver-enriched transcriptional activator protein.Genes Dev. 4:1541-1551.

14. Dignam, J. D., R. M. Lebowitz, and R. G. Roeder. 1983.Accurate transcription initiation by RNA polymerase II in asoluble extract from isolated mammalian nuclei. Nucleic AcidsRes. 11:1475-1489.

15. Dudek, H., R. V. Tantravahi, V. N. Rao, E. S. P. Reddy, andE. P. Reddy. 1992. Myb and Ets proteins cooperate in transcrip-tional activation of the mim-1 promoter. Proc. Natl. Acad. Sci.USA 89:1291-1295.

16. Fink, J. S., M. Verhave, S. Kasper, T. Tsukada, G. Mandel, andR. H. Goodman. 1988. The CGTCA sequence motif is essentialfor biological activity of the vasoactive intestinal peptide genecAMP-regulated enhancer. Proc. Natl. Acad. Sci. USA 85:6662-6666.

17. Fukunaga, R., E. Ishizaki-Lkeda, C.-X. Pan, Y. Seto, and S.Nagata. 1991. Functional domains of the granulocyte colony-stimulating factor receptor. EMBO J. 10:2855-2865.

18. Gauldie, J., C. Richards, D. Harnish, P. Lansdorp, and H.Baumann. 1987. Interferon P2/B-cell stimulatory factor 2 sharesidentity with monocyte-derived hepatocyte-stimulating factorand regulates the major acute phase protein response in livercells. Proc. Natl. Acad. Sci. USA 84:7251-7255.

19. Gearing, D. P., M. R. Comeau, D. J. Friend, S. D. Gimpel, C. J.Thut, J. McGourty, K. K. Brasher, J. A. King, S. Gillis, B.Mosley, S. F. Ziegler, and D. Cosman. 1992. The IL-6 signaltransducer, gp130: an oncostatin M receptor and affinity con-verter for the LIF receptor. Science 255:1434-1437.

20. Gearing, D. P., C. J. Thut, T. VandenBos, S. D. Gimpel, P. B.Delaney, J. King, V. Price, D. Cosman, and M. P. Beckmann.1991. Leukemia inhibitory factor receptor is structurally relatedto the IL-6 signal transducer, gpl30. EMBO J. 10:2839-2848.

21. Gitlin, S. D., R. Bosselut, A. Gegonne, J. Ghysdael, and J. N.Brady. 1991. Sequence-specific interaction of the Etsl proteinwith the long terminal repeat of the human T-lymphocyte virus

type I. J. Virol. 65:5513-5523.22. Gonzalez, G. A., K. K. Yamamoto, W. H. Fischer, D. Karr, P.

Menzel, W. Biggs Ill, W. W. Vale, and M. R. Montminy. 1989.A cluster of phosphorylation sites on the cyclic AMP-regulatednuclear factor CREB predicted by its sequence. Nature (Lon-don) 337:749-752.

23. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982.Recombinant genomes which express chloramphenicol acetyl-transferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051.

24. Graham, F. L., and A. J. van der Eb. 1973. A new technique forthe assay of infectivity of human adenovirus 5. Virology 52:456-467.

25. Gunther, C. V., J. A. Nye, R. S. Bryner, and B. J. Graves. 1990.Sequence-specific DNA binding of the proto-oncoprotein ets-1defines a transcriptional activator sequence within the longterminal repeat of the Moloney murine sarcoma virus. GenesDev. 4:667-679.

26. Gutman, A., and B. Wasylyk 1990. The collagenase genepromoter contains a TPA and oncogene-responsive unit encom-passing the PEA3 and AP-1 binding sites. EMBO J. 9:2241-2246.

27. Hai, T.-Y., F. Liu, W. J. Coukos, and M. R. Green. 1989.Transcription factor ATF cDNA clones: an extensive family ofleucine zipper proteins able to selectively form DNA bindingheterodimers. Genes Dev. 3:2083-2090.

28. Hibi, M., M. Murakami, M. Saito, T. Hirano, T. Taga, and T.Kishimoto. 1990. Molecular cloning and expression of an IL-6signal transducer, gpl30. Cell 63:1149-1157.

29. Hidaka, H., M. Inagaki, S. Kawamoto, and Y. Sasaki. 1984.Isoquinoline sulfonate, novel and potent inhibitors of cyclicnucleotide dependent protein kinase and protein kinase C.Biochemistry J. 23:5036-5041.

30. Hidaka, H., Y. Sasaki, T. Tanaka, T. Endo, S. Ohno, Y. Fuji,and T. Nagata. 1981. N-(6-Aminohexyl)-5-chloronaphthalene-sulfonamide, a calmodulin antagonist, inhibits cell proliferation.Proc. Natl. Acad. Sci. USA 78:4354-4357.

31. Hipskind, R. A., V. N. Rao, C. G. F. Mueller, E. S. P. Reddy,and A. Nordheim. 1991. Ets-related protein Elk-1 is homologousto the c-fos regulatory factor p62TC". Nature (London) 354:531-534.

32. Hirano, T. 1991. Interleukin 6 (IL-6) and its receptor: their rolein plasma cell neoplasias. Int. J. Cell Cloning 9:166-184.

33. Hirano, T. 1992. The biology of interleukin 6. Chem. Immunol.51:153-180.

34. Hirano, T., and T. Kishimoto. 1990. Interleukin 6 (IL-6). Peptidegrowth factors and their receptors, p. 633-665. Springer-Verlag,Berlin.

35. Hirano, T., K. Yasukawa, H. Harada, T. Taga, Y. Watanabe, T.Matsuda, S. Kashiwamura, K. Nakajima, K. Koyama, A. Iwa-matsu, S. Tsunasawa, F. Sakiyama, H. Matsui, Y. Takahara, T.Taniguchi, and T. Kishimoto. 1986. Complementary DNA for anovel human interleukin (BSF-2) that induces B lymphocytes toproduce immunoglobulin. Nature (London) 324:73-76.

36. Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R.Pease. 1989. Site-directed mutagenesis by overlap extensionusing the polymerase chain reaction. Gene 77:51-59.

37. Hocke, G., D. Barry, and G. H. Fey. 1992. Synergistic action ofinterleukin-6 and glucocorticoids is mediated by the interleu-kin-6 response element of the rat a2 macroglobulin gene. Mol.Cell. Biol. 12:2282-2294.

38. Hoeller, J. P., T. E. Meyer, Y. Yun, J. L. Jameson, and J. F.Habener. 1988. Cyclic AMP-responsive DNA-binding protein:structure based on a cloned placental cDNA. Science 242:1430-1433.

39. Ip, N. Y., S. H. Nye, T. G. Boulton, S. Davis, T. Taga, Y. Li,S. J. Birren, K. Yasukawa, T. Kishimoto, D. J. Anderson, N.Stahl, and G. D. Yancopoulos. 1992. CNTF and LIF act onneuronal cells via shared signaling pathways that involve theIL-6 signal transducing receptor component gpl30. Cell 69:1121-1132.

40. Ishibashi, T., H. Kimura, T. Uchida, S. Kariyone, P. Friese, andS. A. Burstein. 1989. Human interleukin 6 is a direct promoter ofmaturation of megakaryocytes in vitro. Proc. Natl. Acad. Sci.

VOL. 13, 1993


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


USA 86:5953-5957.41. Jonat, C., U. Rahmsdorf, M. Buscher, A. Schonthal, H. J.

Rahmsdorf, and P. Herrlich. 1990. Antitumor promoter andantiinflammation: down-regulation of AP-1 (Fos/Jun) activity byglucocorticoid hormone. Cell 62:1189-1204.

42. Kaibuchi, K., Y. Fukumoto, N. Oku, Y. Hori, T. Yamamoto, K.Toyoshima, and Y. Takai. 1989. Activation of the serum re-sponse element by the activated c-raf-1 protein in a mannerindependent of protein kinase C. J. Biol. Chem. 264:20855-20858.

43. Karim, F. D., L. D. Urness, C. S. Thummel, M. J. Klemsz, S. R.McKercher, A. Celada, C. Van Beveren, R. A. Maki, C. V.Gunther, J. A. Nye, and B. J. Graves. 1990. The ETS-domain: anew DNA-binding motif that recognizes a purine-rich core DNAsequence. Genes Dev. 4:1451-1453.

44. Kawano, M., T. Hirano, T. Matsuda, Y. Horii, K. Iwato, H.Asaoku, B. Tang, 0. Tanabe, H. Tanaka, A. Kuramoto, and T.Kishimoto. 1988. Autocrine generation and requirement of BSF-2/IL-6 for human multiple myelomas. Nature (London) 332:83-85.

45. Kitamura, D., N. Sato, K. Arai, and A. Miyajima. 1991. Expres-sion cloning of the human IL-3 receptor cDNA reveals a sharedb subunit for human IL-3 and GM-CSF receptor. Cell 66:1165-1174.

46. Klemsz, M. J., S. C. McKercher, A. Celada, C. Van Beveren,and R. A. Maki. 1990. The macrophage and B cell-specifictranscription factor PU.1 is related to the ets oncogene. Cell61:113-124.

47. Kyriakis, J. M., H. App, X.-F. Zhang, P. Banerjee, D. Brauti-gan, U. R. Rapp, and J. Avruch. 1992. Raf-1 activates MAPkinase-kinase. Nature (London) 358:417-421.

48. Leevers, S. J., and C. J. Marshall. 1992. Activation of extracel-lular signal-regulated kinase, ERK2, by p2lras oncoprotein.EMBO J. 11:569-574.

49. Lim, R. W., B. C. Varnum, and H. R. Herschman. 1987. Cloningof tetradecanoyl phorbol ester-induced "primary response"sequences and their expression in density-arrested Swiss 3T3cells and a TPA nonproliferative variant. Oncogene 1:263-270.

50. Lord, K. A., A. Abdollahi, S. M. Thomas, M. DeMarco, J. S.Brugge, B. Hoffmann-Liebermann, and D. A. Liebermann. 1991.Leukemia inhibitory factor and interleukin-6 trigger the sameimmediate early response, including tyrosine phosphorylation,upon induction of myeloid leukemia differentiation. Mol. Cell.Biol. 11:4371-4379.

51. Maekawa, T., H. Sakura, C. Kanei-Ishii, T. Sudo, T. Yoshimura,J. Fujisawa, M. Yoshida, and S. Ishii. 1989. Leucine zipperstructure of the protein CRE-BP1 binding to the cyclic AMPresponse element in brain. EMBO J. 8:2023-2028.

52. Majello, B., R. Arcone, C. Toniatti, and G. Ciliberto. 1990.Constitutive and IL-6-induced nuclear factors that interact withthe human C-reactive protein promoter. EMBO J. 9:457-465.

53. Mitsunobu, F., M. Fukul, T. Oda, T. Yamamoto, and K.Toyoshima. 1989. A mechanism of c-raf-1 activation: fusion ofthe lipocortin II amino-terminal sequence with the c-raf-1 kinasedomain. Oncogene 4:437-442.

54. Miyaura, C., K. Onozaki, Y. Akiyama, T. Taniyama, T. Hirano,T. Kishimoto, and T. Suda. 1988. Recombinant human IL-6(B-cell stimulatory factor 2) is a potent inducer of differentiationof myeloid leukemia cells (Ml). FEBS Lett. 234:17-21.

55. Mizushima, S., and S. Nagata. 1990. pEF-BOS, a powerfulmammalian expression vector. Nucleic Acids Res. 18:5322.

56. Murakami, M., M. Narazaki, M. Hibi, H. Yawata, K. Ya-sukawa, M. Hamaguchi, T. Taga, and T. Kishimoto. 1991.Critical cytoplasmic region of the interleukin 6 signal transducergpl30 is conserved in the cytokine receptor family. Proc. Natl.Acad. Sci. USA 88:11349-11353.

57. Nakajima, K., and R. Wall. 1991. Interleukin-6 signals activat-ing junB and TIS11 gene transcription in a B-cell hybridoma.Mol. Cell. Biol. 11:1409-1418.

58. Nordan, R. P., and M. Potter. 1986. A macrophage-derivedfactor required by plasmacytomas for survival and proliferationin vitro. Science 233:566-569.

59. Nori, M., G. L'Allemain, and M. J. Weber. 1992. Regulation of

tetradecanoyl phorbol acetate-induced responses in NIH 3T3cells by GAP, the GTPase-activating protein associated withp2lcras. Mol. Cell. Biol. 12:936-945.

60. Poli, V., and R. Cortese. 1989. Interleukin 6 induces a liverspecific nuclear protein that binds to the promoter of acutephase genes. Proc. Natl. Acad. Sci. USA 86:8202-8206.

61. Poli, V., F. P. Mancini, and R. Cortese. 1990. IL-6DBP, anuclear protein involved in interleukin-6 signal transduction,defines a new family of leucine zipper proteins related toC/EBP. Cell 63:643-653.

62. Pongubala, J. M. R., S. Nagulapalli, M. J. Klemsz, S. R.McKercher, R. A. Maki, and M. L. Atchison. 1992. PU.1recruits a second nuclear factor to a site important for immuno-globulin K 3' enhancer activity. Mol. Cell. Biol. 12:368-378.

63. Rapp, U. R., M. D. Goldsborough, G. E. Mark, T. I. Bonner, J.Groffen, F. H. Reynolds, and J. R. Stephenson. 1983. Structureand biological activity of raf-1, a unique oncogene transducedby a retrovirus. Proc. Natl. Acad. Sci. USA 80:4218-4222.

64. Ryder, K., L. F. Lau, and D. Nathans. 1988. A gene activated bygrowth factors is related to the oncogene v-jun. Proc. Natl.Acad. Sci. USA 85:1487-1491.

65. Satoh, T., S. Nakamura, T. Taga, T. Matsuda, T. Hirano, T.Kishimoto, and Y. Kaziro. 1988. Induction of neuronal differen-tiation in PC12 cells by B-cell stimulatory factor 2/interleukin-6.Mol. Cell. Biol. 8:3546-3549.

66. Sehgal, P. B., G. Grienger, and G. Tosato (ed.). 1989. Regulationof the acute phase and immune responses: interleukin-6. Ann.N.Y. Acad. Sci. 557:1-583.

67. Shabo, Y., J. Lotem, M. Rubinstein, S. C. Clark, S. F. Wolf, R.Kamen, and L. Sachs. 1988. The myeloid blood cell differentia-tion-inducing protein MGI-2A is interleukin 6. Blood 72:2070-2073.

68. Sistonen, L., E. Holtta, T. P. Makela, J. Kesid-Oja, and K. Alitalo.1989. The cellular response to induction of the p2lc-Ha-ras oncopro-tein includes stimulation ofjun gene expression. EMBO J. 8:815-822.

69. Stein, B., H. J. Rahmsdorf, A. Steffen, M. Litfin, and P.Herrlich. 1989. UV-induced DNA damage is an intermediatestep in UV-induced expression of human immunodeficiencyvirus type 1, collagenase, c-fos, and metallothionein. Mol. Cell.Biol. 9:5169-5181.

70. Suematsu, S., T. Matsusaka, T. Matsuda, S. Ohno, J. Miyazaki,K. Yamamura, T. Hirano, and T. Kishimoto. 1992. Generationof transplantable plasmacytomas with t(12;15) in IL-6 transgenicmice. Proc. Natl. Acad. Sci. USA 89:232-235.

71. Tabin, C. J., S. M. Bradley, C. I. Bargmann, R A. Weinberg,A. G. Papageorge, E. M. Scolnick, R. Dhar, D. R. Lowy, andE. H. Chang. 1982. Mechanism of activation of a humanoncogene. Nature (London) 300:143-149.

72. Taga, T., M. Hibi, Y. Hirata, K. Yamasaki, K. Yasukawa, T.Matsuda, T. Hirano, and T. Kishimoto. 1989. Interleukin-6triggers the association of its receptor with a possible signaltransducer, gpl30. Cell 58:573-581.

73. Tavernier, J., R. Devos, S. Cornelis, T. Tuypens, J. Van derHeyden, W. Fiers, and G. Plaetinck. 1991.. A human high affinityinterleukin-5 receptor (IL5R) is composed of an IL5-specific achain and a b chain shared with the receptor for GM-CSF. Cell66:1175-1184.

74. Thomas, S. M., M. DeMarco, G. D'Arcangelo, S. Halegoua, andJ. S. Brugge. 1992. Ras is essential for nerve growth factor- andphorbol ester-induced tyrosine phosphorylation of MAP ki-nases. Cell 68:1031-1040.

75. Thompson, C. C., T. A. Brown, and S. L. McKnight. 1991.Convergence of Ets- and Notch-related structural motifs in aheteromeric DNA binding complex. Science 253:762-768.

76. Toniatti, C., A. Demartis, P. Monaci, A. Nicosia, and G. Cili-berto. 1990. Synergistic trans-activation of the human C-reac-tive protein promoter by transcription factor HNF-1 binding attwo distinct sites. EMBO J. 9:4467-4475.

77. Tonouchi, N., N. Oouchi, N. Kashima, M. Kawai, K. Nagase, A.Okano, H. Matsui, K. Yamada, T. Hirano, and T. Kishimoto.1988. High-level expression of human BSF-2/IL-6 cDNA inEscherichia coli using a new type of expression-preparation

MOL. CELL. BIOL.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


system. J. Biochem. 104:30-34.78. Van Damme, J., G. Opdenakker, R. J. Simpson, M. R. Rubira,

S. Cayphas, A. VMnk, A. Billiau, and J. Van Snick. 1987.Identification of the human 26-kDa protein, interferon 02 (IFNp2), as a B cell hybridoma/plasmacytoma growth factor inducedby interleukin 1 and tumor necrosis factor. J. Exp. Med.165:914-919.

79. Van Snick, J. 1990. Interleukin-6: an overview. Annu. Rev.Immunol. 8:253-278.

80. Walton, K. M., R. P. Rehfuss, J. C. Chrivia, J. E. Lochner, andR. H. Goodman. 1992. A dominant repressor of CREB activityinhibits the cAMP-mediated induction of the somatostatin pro-moter in vivo. Mol. Endocrinol. 6:647-655.

81. Wasylyk, B., C. Wasylyk, P. Flores, A. Begue, D. Leprince, andD. Stehelin. 1990. The c-ets proto-oncogenes encode transcrip-tion factors that cooperate with c-Fos and c-Jun for transcrip-tional activation. Nature (London) 346:191-193.

82. Wasylyk, C., P. Flores, A. Gutman, and B. Wasylyk 1989. PEA3is a nuclear target for transcription activation by non-nuclearoncogenes. EMBO J. 11:3371-3378.

83. Wasylyk, C., A. Gutman, R. Nicholson, and B. Wasylyk 1991.

The c-Ets oncoprotein activates the stromelysin promoterthrough the same elements as several non-nuclear oncoproteins.EMBO J. 10:1127-1134.

84. Wasylyk, C., J. L. Imler, and B. Wasylyk. 1988. Transformingbut not immortalizing oncogenes activate the transcription fac-tor PEAL. EMBO J. 7:2475-2483.

85. Weih, F., A. F. Stewart, M. Boshart, D. Nitsch, and G. Schultz.1990. In vivo monitoring of a cAMP-stimulated DNA-bindingactivity. Genes Dev. 4:1437-1449.

86. Wood, K., C. Sarnecki, T. M. Roberts, and J. Blenis. 1992. rasmediates nerve growth factor receptor modulation of threesignal-transducing protein kinases: MAP kinase, Raf-1, andRSK. Cell 68:1041-1050.

87. Woods, D. B., J. Ghysdael, and M. J. Owen. 1992. Identificationof nucleotide preferences in DNA sequences recognized specif-ically by c-Ets-1 protein. Nucleic Acids Res. 20:699-704.

88. Yamasaki, K., T. Taga, Y. Hirata, H. Yawata, Y. Kawanishi, B.Seed, T. Taniguchi, T. Hirano, and T. Kishimoto. 1988. Cloningand expression of the human interleukin-6 (BSF-2/IFNP2) re-ceptor. Science 241:825-828.

VOL. 13, 1993


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Documents

Containing an Ets-Binding Site and a CRE-Like Site