Copyright © 2011, American Society for Microbiology and/or the

1

Characterization of a Feedback-Resistant Mevalonate Kinase from the Archaeon Methanosarcina 1

mazei 2

Yuliya A. Primak, Mai Du, Michael C. Miller, Derek H. Wells, Alex T. Nielsen, Walter Weyler, and 3

Zachary Q. Beck* 4

Genencor-A Danisco Division, 925 Page Mill Road, Palo Alto, California, 94304 USA 5

Running title: Characterization of a feedback-resistant M. mazei MVK 6

*Corresponding author. 7

Mailing address: 8

Genencor-A Danisco Division 9

925 Page Mill Road 10

Palo Alto, CA 94304 11

Phone (650) 846-4003 12

Fax (650) 845-6500 13

E-mail: [email protected] 14

15

Formatted: Numbering: Continuous

Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.05761-11 AEM Accepts, published online ahead of print on 9 September 2011

on March 26, 2018 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

2

ABSTRACT 16

The mevalonate pathway is utilized for the biosynthesis of isoprenoids in many bacterial, eukaryotic, 17

and archaeal organisms. Based on previous reports of its feedback inhibition, mevalonate kinase (MVK) 18

may play an important regulatory role in the biosynthesis of mevalonate pathway derived compounds. 19

Here we report the purification, kinetic characterization, and inhibition analysis of the MVK from the 20

archaeon Methanosarcina mazei. Inhibition of the M. mazei MVK by the following metabolites derived 21

from the mevalonate pathway was explored: dimethylallyl diphosphate (DMAPP), geranyl 22

pyrophosphate (GPP), farnesyl pyrophosphate (FPP), isopentenyl monophosphate (IP) and 23

diphosphomevalonate. M. mazei MVK was not inhibited by DMAPP, GPP, FPP, diphosphomevalonate 24

or IP, a proposed intermediate in an alternative isoprenoid pathway present in archaea. Our findings 25

suggest that the M. Mazei MVK represents a distinct class of mevalonate kinases that can be 26

differentiated from previously characterized MVKs based on its inhibition profile. 27


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

3

INTRODUCTION 28

Isoprenoids are a large and diverse class of compounds containing greater than 40,000 naturally 29

occurring terpenes and terpenoids (33). They encompass many classes of bioactive molecules including 30

carotenoids, steroid hormones, phytols, redox carriers, secondary metabolites, and pheromones that 31

make them commercially attractive for the production of compounds varying from pharmaceuticals to 32

biofuels (5, 15, 21, 23, 24). Currently, a number of groups are working on increasing the production of 33

terpenoid compounds for a variety of medicinal, agricultural, sustainable biofuel and biomaterial 34

applications (21, 23, 24, 33). All isoprenoids are biosynthesized from the five carbon precursors, 35

isopentenyl diphosphate (IPP) and its isomer dimethylallyl diphosphate (DMAPP). Two pathways for 36

the biosynthesis of these central metabolites have been described, the mevalonate pathway (28) and the 37

2-C-methyl-D-erythritol 4-phosphate (MEP) pathway (25). The mevalonate pathway is typically found 38

in animals, plants, and in many gram-positive bacteria, including Streptoccocus pneumoniae (17, 31, 39

32). Some enzymes of the mevalonate pathway have also been indentified in archaea, however, the 40

complete pathway has not been elucidated (27). The mevalonate pathway catalyzes the conversion of 41

three molecules of acetyl coenzyme A (CoA) to IPP and DMAPP. Briefly, two molecules of acetyl-CoA 42

undergo a Claisen condensation to form acetoacetyl-CoA, catalyzed by acetoacetyl-CoA thiolase. Next, 43

3-hydroxy-3-methylglutaryl-CoA synthase catalyzes an aldol reaction between acetoacetyl-CoA and 44

third molecule of acetyl-CoA. The conversion of HMG-CoA to mevalonate is subsequently catalyzed by 45

HMG-CoA reductase. Mevalonate kinase (MVK) and phosphomevalonate kinase (PMK) catalyze the 46

phosphorylation of the primary alcohol of mevalonate and the phosphate of phosphomevalonate, 47

respectively, to form diphosphomevalonate. The penultimate reaction in the pathway is the 48

phosphorylative decarboxylation of diphosphomevalonate catalyzed by the diphosphomevalonate 49

decarboxylase to yield IPP (10, 32). IPP isomerase (IDI) catalyzes the conversion of IPP to DMAPP 50

(Figure 1). 51


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

4

A distinguishing characteristic of archaeal organisms is that isoprenoids make up the major 52

component of their membrane lipids. By contrast, the lipids of eukaryotic and bacterial organisms are 53

primarily composed of fatty acids (6, 17, 20, 27). Studies of isoprenoid biosynthesis in archaea have 54

demonstrated that both acetate and mevalonate are precursors for IPP formation indicating that the 55

mevalonate pathway is involved in their biosynthesis (11, 17). Putative homologues of all mevalonate 56

pathway genes, excluding the diphosphomevalonate decarboxylase, have been identified in archaea by 57

genomic analysis (3, 7, 17, 19). In addition, putative isopentenyl monophosphate kinases have been 58

identified and characterized from archaea, suggesting the possible utilization of a modified mevalonate 59

pathway for the production of isoprenoids in archaea (8, 17) (Figure 1). 60

Eukaryotic, bacterial and archaeal organisms must ensure sufficient production of a variety of 61

isoprenoid compounds essential for the proper growth, signaling, transport and life cycle controls as 62

well as the prevention of the over-accumulation of potentially toxic products such as cholesterol (15, 63

27). Organisms manage these tasks through intricate regulation of isoprenoid producing pathways (15). 64

MVK was demonstrated to be an important regulatory point in the mevalonate pathway in both bacteria 65

(1, 2, 31) and eukaryotes (4, 9, 13, 16, 18). Previous to this study, the small molecule regulation of 66

MVKs could be divided into two classes. The first class is inhibited by metabolites downstream of the 67

diphosphomevalonate decarboxylase reaction (IPP, DMAPP, GPP, FPP and longer chain isoprenoids) 68

(9, 16, 18, 31). Regulation of a eukaryotic MVK isolated from pig liver was first reported by Dorsey and 69

Porter in 1968 (9). Their detailed kinetic analysis revealed significant feedback regulation of this 70

enzyme by GPP and FPP and to a lesser degree by DMAPP, IPP and PPi (9). Human MVK was 71

subsequently characterized and found to be inhibited by FPP, GPP, IPP, DMAPP, and geranylgeranyl 72

pyrophosphate (18, 22). Characterization of four plant MVKs and S. cerevisiae MVK by Gray in 1972 73

revealed that they are all inhibited by GPP, FPP, geranylgeranyl pyrophosphate and phytyl 74

pyrophosphate (16). In addition, two MVKs from gram positive cocci, Staphylococcus aureus and 75

Enterococcus faecalis, were found to be competitively inhibited by FPP with respect to ATP with a Ki 76

of 45 µM (31). 77


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

5

The second class of MVKs is inhibited by diphosphomevalonate but not by metabolites downstream 78

of the diphosphomevalonate decarboxylase. Interestingly, DMAPP, IPP, GPP and FPP were not 79

feedback inhibitors of the gram positive bacterium S. pneumoniae MVK at concentrations up to 12 µM, 80

however, diphosphomevalonate inhibited S. pneumoniae MVK at nM concentrations (2). 81

Here we report the overexpression, purification, kinetic analysis and inhibition studies of the mvk 82

gene product from the archaeon Methanosarcina mazei. The S. cerevisiae and S. pneumoniae MVKs 83

have been re-characterized in this study and serve as positive controls for the two known classes of 84

feedback regulated MVKs. Our findings demonstrate that unlike MVKs from S. cerevisiae and S. 85

pneumoniae, M. mazei MVK is not inhibited by known feedback-inhibitors of MVKs. A phylogenetic 86

tree of 29 MVK representatives from Archaea, Eukarya, and Bacteria indicates a clear evolutionary 87

separation of the mvk gene between these domains and leads to the hypothesis that these distinct 88

branches may utilize alternative regulation mechanisms (Figure 2). 89

Accordingly, we conclude that there are at least three classes of MVKs that can be differentiated 90

based on their inhibition profiles. 91

MATERIALS AND METHODS 92

Expression vectors, cell lines, and competent cells were purchased from Invitrogen (Carlsbad, CA). 93

Carbenicillin, kanamycin and chloramphenicol were obtained from Novagen (Gibbstown, NJ), IBI 94

scientific (Peosta, IA), and Calbiochem (Gibbstown, NJ) respectively. Isopropyl thiogalactoside (IPTG), 95

geranyl pyrophosphate (GPP), farnesyl pyrophosphate (FPP), isopentenyl monophosphate (IP), ATP, 96

phosphoenolpyruvate (PEP), NADH, magnesium chloride (MgCl2), sodium chloride (NaCl), Tris, 97

HEPES, dithiothreitol (DTT), DNaseI and lysozyme were purchased from Sigma (St. Louis, MO). 98

Dimethylallyl diphosphate (DMAPP) was obtained from Cayman Chemicals (Ann Arbor, MI). Lactate 99

dehydrogenase (LDH) was purchased from Calbiochem. Pyruvate kinase (PK) was purchased from MP 100

Biomedicals LLC (Solon, OH). Mevalonate solution was prepared from mevalonic acid which was 101


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

6

purified by Stereo Chemicals, Inc. (Newark, DE). All columns used in purification were obtained from 102

GE Healthcare (Piscataway, NJ). Purity was assessed by gel electropheresis using precast gels and 103

reagents purchased from Invitrogen. Kinetic studies were conducted using SpectraMax 190 platereader 104

from Molecular Devices (Sunnyvale, CA). Kinetic data were analyzed using Kaleidagraph 4.0 (Synergy 105

software). 106

Preparation of MVK expression strains. A synthetic gene encoding M. mazei MVK was designed 107

based on NP_633786 from Methanosarcina mazei Go1; synthesis and codon optimization was 108

performed by DNA 2.0. This gene was amplified by PCR using the following primer set (forward, 5’-109

CACCATGGTATCCTGTTCTGCG-3’; reverse, 5’-TTAATCTACTTTCAGACCTTGC-3’). The PCR 110

reaction cycles were: 94°C 2 min, 30× (94°C 30 sec, 55°C 30 sec, 68°C 75 sec), 72°C 7 min, 4°C 111

overnight. The 0.9 kb PCR product was cloned into the pET200D vector as per manufacturer’s 112

instructions. Transformants were selected on LA/Kan50 plates (Teknova) at 37°C. Plasmid was isolated, 113

sequence-verified and transformed into E. coli BL21(λDE3) pLysS cells as per manufacture’s protocol. 114

The mvk gene from S. cerevisiae, containing NdeI restriction site, was amplified by PCR from yeast 115

chromosomal DNA using the primer set (forward, 5’-116

CAGCAGCAGCATATGTCATTACCGTTCTTAACTTC-3’; reverse, 5’- 117

CAGCAGCAGCATATGGCCTATCGCAAATTAGCTTATG-3’). The PCR reaction cycled as follows: 118

95°C 2 min, 29× (95°C 20 sec, 55°C 20 sec, 72°C 21 sec), 72°C 3 min, 4°C overnight. The 1.4 kb 119

products were purified using QIAquick® Gel Extraction kit (Qiagen), treated with shrimp alkaline 120

phosphatase and NdeI, ligated overnight to the pET-16b (Invitrogen) vector harboring a hexahistidine 121

tag, and transformed into chemically competent TOP10 cells as per manufacturer’s protocol. Plasmids 122

from transformants were purified via QIAprep® spin Miniprep kit (Qiagen) and the insert sequenced 123

using T7 primers (forward, 5’-TAATACGACTCACTATAGGG-3’; reverse, 5’- 124

GCTAGTTATTGCTCAGCGG -3’). Verified clones were transformed into E. coli BL21(λDE3) pLysS 125

cells as per manufacture’s protocol. 126


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

7

S. pneumoniae DNA region coding for MVK was amplified by PCR from ATCC strain #BAA-255D-127

5 using gene specific primers (forward, 5’-CACCATGACAAAAAAAGTTGGTGTCGGTCAGGCAC-128

3’; reverse, 5’-CTGTCACAGGCTCTCTATCCATGTCTGAAC-3’). The PCR reaction cycles were as 129

follows: 95°C 4 min, 5× (95°C 20 sec, 52°C 20 sec, 72°C 30 sec), 25× (95°C 20 sec, 55°C 20 sec, 72°C 130

30 sec), 72°C 10 min, 4°C overnight. The 0.9 kb fragment was TOPO-cloned into the pET200D-TOPO 131

expression vector, and transformed into chemically competent E. coli TOP10 cells according to the 132

manufacturer’s recommended protocol. Colonies were screened by PCR, using (T7 forward, 5’-133

TAATACGACTCACTATAGGG-3’; reverse, 5’- CTGTCACAGGCTCTCTATCCATGTCTGAAC -134

3’) primers. Positive plasmids were purified via QIAprep® spin Miniprep kit (Qiagen) and transformed 135

into chemically competent E. coli BL21 Star (λDE3) cells for expression analysis. 136

Expression and purification of recombinant MVKs from M. mazei, S. cerevisiae, and S. 137

pneumoniae. 138

Cells containing the M. mazei MVK expression plasmid were grown in Terrific broth (26) supplemented 139

with 50 mg/L kanamycin and 30 mg/L chloramphenicol and were induced overnight with the addition 140

of 0.5 mM IPTG. Cells containing the MVK expression plasmids were grown in Luria-Bertani broth 141

(26) supplemented with 50 mg/L carbenicillin and 30 mg/L chrolamphenicol for expression of S. 142

cerevisiae MVK or 50 mg/L kanamycin for expression of S. pneumoniae MVK and were induced 143

overnight with the addition of 0.2 mM IPTG at an OD600 of ~0.4-0.6. All cells were harvested by 144

centrifugation at 10,000xg for 10 minutes and resuspended in 0.05 M sodium phosphate, 0.3 M sodium 145

chloride, 0.02 M imidazole (pH 8.0) buffer containing lysozyme and DNaseI. Resuspended cells were 146

lysed by repeated passes through a French Pressure cell at 20,000 psi. Cell lysates were clarified by 147

ultracentrifugation at 229,000×g for one hour. The supernatants were loaded onto a HiTrap IMAC HP 148

column charged with nickel sulfate and equilibrated with 0.05 M sodium phosphate, 0.3 M sodium 149

chloride, 0.02 M imidazole (pH 8.0). Enzymes were isolated using a linear gradient from 0.02 to 0.5 M 150

of imidazole. Fractions containing MVK were identified using SDS-PAGE (Invitrogen), pooled and 151

desalted into 0.05 M HEPES, 0.05 M sodium chloride (pH 7.4) with 1 mM DTT using a Hi Prep 26/10 152


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

8

desalting column. MVK from S. cerevisiae was further purified over an anion exchange HiTrap Q HP 153

column. The column was washed with 0.05 M Tris, 0.05 M sodium chloride (pH 7.6) with 1 mM DTT 154

and eluted with a 0.05 – 1.0 M sodium chloride gradient. Fractions containing MVK were desalted into 155

0.05 M HEPES, 0.05 M sodium chloride (pH 7.4) containing 1 mM DTT. The purity of all three 156

enzymes was greater than 95% as judged by SDS-PAGE and coomassie staining. The proteins were 157

optically quantitated at 280 nm using the following conversion factors: 0.343 OD/mg/mL for M. mazei 158

MVK, 0.597 OD/mg/mL for S. cerevisiae MVK, and 0.516 OD/mg/mL for S. pneumoniae MVK. These 159

values were obtained using the ExPASy ProtParam tool (14). 160

Expression and purification of recombinant PMK enzyme from S. cerevisiae. The S. cerevisiae 161

DNA region coding for the PMK protein was amplified by PCR using gene specific primers (forward, 162

5’-CACCTCAGAGTTGAGAGCCTTCAGTGC-3’; reverse, 5’-163

GAATTCTGCATGCAGCTACCTTAAG-3’), TOPO-cloned into the pET200D-TOPO expression 164

vector (Invitrogen), and transformed into chemically competent E. coli TOP10 cells according to the 165

manufacturer’s recommended protocol. Colonies were screened by PCR using T7 forward (5’-166

TAATACGACTCACTATAGGG-3’) and gene specific reverse (5’-167

GAATTCTGCATGCAGCTACCTTAAG-3’) primer, positive plasmids were purified via QIAprep® 168

spin Miniprep kit (Qiagen) and transformed into chemically competent E. coli BL21(λDE3) cells for 169

expression analysis. Cells containing the PMK expression plasmid were grown in Terrific broth 170

supplemented with 50 mg/L kanamycin. The culture was induced with 0.2 mM IPTG at an OD600 of 171

0.9 and harvested by centrifugation after 6 hours at 30°C. Purification of PMK involved nickel affinity 172

and anion exchange chromatography and followed the same protocol as described above for S. 173

cerevisiae MVK. The purity was greater than 95% as judged by SDS-PAGE and coomassie staining. 174

The protein was optically quantitated at 280 nm using a conversion factor of 1.099 OD/mg/mL. 175

Native molecular mass determination. The native molecular masses of the MVKs and PMK were 176

determined by size-exclusion chromatography using Superdex 200 10/300 GL column. The column was 177

equilibrated using the following seven molecular standards with masses ranging from 6.5 kDa to 669 178


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

9

kDa: aprotinin (6.5 kDa), ribonuclease A (13.7 kDa), carbonic anhydrase (29 kDa), ovalbumin (43 179

kDa), conalbumin (75 kDa), aldolase (158 kDa), and thyroglobulin (669 kDa). The column void volume 180

was calculated using the elution volume of Blue Dextran 2000. Column equilibration and sample runs 181

were performed in 50 mM HEPES, 150 mM NaCl (pH 7.4) buffer containing 1 mM DTT at room 182

temperature. The masses of M. mazei, S. cerevisiae and S. pneumoniae MVKs, as well as S. cerevisiae 183

PMK were calculated using the linear fit to the plot of log-masses versus elution volume obtained for 184

the molecular standards. 185

Enzyme activity and inhibition by DMAPP, GPP and FPP. The catalytic activities of the MVKs 186

were measured using a modified spectrophotometric assay that couples ADP formation to pyruvate 187

synthesis and reduction to lactate (13). The initial rate of disappearance of NADH serves as a measure 188

of phosphorylation of mevalonate by MVK. The assays were performed in triplicate in a 96-well plate 189

(Costar catalog #9017) format, at 30ºC. Each 100 μl reaction contained 0.4 mM PEP, 0.05 mM DTT, 190

0.32 mM NADH, 10 mM MgCl2, 2 units of LDH and 2 units of PK in 50 mM Tris, 50 mM NaCl (pH 191

7.6). 192

The Michaelis constant, KM-Mev, for MVK from M. mazei and S. pneumoniae were determined at a 193

saturating concentration of ATP (5 mM) and with mevalonate concentrations ranging from 0.005 mM to 194

5 mM. The reaction was initiated with the addition of 80 nM (0.25 µg) of purified M. mazei or 60 nM 195

(0.21 µg) of S. pneumoniae MVK. The KM-ATP for these MVKs was similarly determined, using 196

saturating concentrations of mevalonate (1.25 mM) and ATP concentrations ranging from 0.005 mM to 197

5 mM. KM values for S. cerevisiae MVK were determined using the same procedure with the following 198

exceptions: substrate concentrations ranged from 0.039 mM to 5 mM, and the reaction was initiated by 199

adding 10 nM (50.1 ng) of purified S. cerevisiae MVK. Absorbance changes associated with the amount 200

of NADH oxidized to NAD+ were monitored continuously at 340 nm and plotted against time to 201

determine the rate of the MVK coupled reactions. Protein inhibition studies were performed in 202

quadruplicate by adding terpenyl diphosphates (DMAPP, GPP, FPP and diphosphomevalonate) at 203


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

10

various concentrations to the reaction mix. The inhibition studies of M. mazei MVK also included 204

studies with isopentenyl monophosphate. 205

Inhibition of MVKs by diphosphomevalonate. The inhibition of three MVKs by 206

diphosphomevalonate was investigated using a spectrophotometric pyruvate kinase and lactate 207

dehydrogenase coupled assay, as previously described (2). This approach couples two reactions of the 208

mevalonate pathway, the initial phosphorylation of mevalonate by MVK and the subsequent conversion 209

of phosphomevalonate to diphosphomevalonate by PMK. Reactions contained 100 mM Tris-HCl, 100 210

mM NaCl, 1 mM DTT, 10 mM MgCl2, 5 mM ATP, 2.5 mM NADH, 4 mM PEP, 10 U of LDH, 10 U of 211

PK and 1 mM mevalonate. Initially, MVK was added to the reaction mixture and the depletion of 212

NADH was monitored at 386 nm. After all of the mevalonate was converted to phosphomevalonate, S. 213

cerevisiae PMK was added to the mixture to catalyze the reaction from phosphomevalonate to 214

diphosphomevalonate. To test for feedback inhibition of the MVK by diphosphomevalonate, both PMK 215

and MVK were added simultaneously to the reaction mixture. Inhibition of M. mazei MVK by 216

diphosphomevalonate was evaluated using 1.7 µM MVK and 2 µM PMK. Inhibition studies of S. 217

cerevisiae and S. pneumoniae MVKs by diphosphomevalonate utilized 0.1 µM MVK and 1 µM PMK, 218

and 1 µM MVK and 2 µM PMK, respectively. 219

Phylogenetic analysis of MVK. Sequences of MVK from a range of different organisms were 220

retrieved and aligned using ClustalW multiple sequence alignment (30). A rooted phylogenetic tree 221

(phenogram) was derived using the program DrawGram (12). 222

RESULTS 223

Characterization of mevalonate kinases (MVKs). Three MVKs, M. mazei, S. cerevisiae, and S. 224

pneumoniae, as well as PMK from S. cerevisiae were expressed in E. coli, extracted and purified using 225

affinity chromatography to > 95% apparent homogeneity. The apparent masses of the MVKs and PMK 226

were determined by gel filtration to be: 78 kDa for M. mazei MVK, 97 kDa for S. cerevisiae MVK, 72 227


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

11

kDa for S. pneumoniae MVK, and 47 kDa for PMK. The calculated molecular masses using the amino 228

acid sequence are 35.5 kDa, 51 kDa, 39 kDa, and 53 kDa for M. mazei, S. cerevisiae, S. pneumoniae 229

MVKs and S. cerevisiae PMK, respectively. This suggests that the MVKs tested form dimers and S. 230

cerevisiae PMK is a monomer in solution. 231

The rates of mevalonate phosphorylation by the archaeal, eukaryotic and bacterial MVKs were 232

monitored (2). Kinetic constants were evaluated for each enzyme with respect to ATP (KMapp-ATP) and 233

mevalonate (KMapp-Mev) using the Michaelis-Menten equation (Table 1). Of the three enzymes assayed 234

M. mazei MVK had the slowest turnover (kcat) at 30°C of 4.3 s-1. S. cerevisiae MVK had a kcat nearly 235

four times faster than that of M. mazei MVK. However, M. mazei MVK had the lowest apparent KM of 236

68 µM, S. cerevisiae and S. pneumoniae MVKs had apparent KM values of 131 and 236 µM, 237

respectively. 238

M. mazei MVK is not inhibited by DMAPP, GPP, FPP or IP. Potential inhibition of the M. mazei 239

MVK by the downstream products (DMAPP, GPP, and FPP) of the mevalonate pathway was evaluated. 240

The catalytic activity of M. mazei MVK was not inhibited by 5 mM DMAPP, 100 µM GPP, or 100 µM 241

FPP. The archaeal mevalonate pathway has been postulated to contain an IP kinase that catalyzes the 242

formation of IPP, therefore, we examined the inhibition of M. mazei MVK by isopentenyl 243

monophosphate (IP) (17). Our experiments demonstrated that M. mazei MVK is not inhibited by 244

concentrations of IP up to 100 µM. 245

S. cerevisiae MVK is inhibited by DMAPP, GPP and FPP: products of the mevalonate 246

pathway. The MVK from yeast was reported to be inhibited by GPP, FPP, geranylgeranyl 247

pyrophosphate and phytyl pyrophosphate (16, 29) and serves as a positive control for a class of MVKs 248

that are inhibited by intermediates downstream of diphosphomevalonate decarboxylase. In this study the 249

inhibition of S. cerevisiae MVK was probed with the isoprenoid precursors, DMAPP, GPP and FPP. 250

Our results demonstrate that DMAPP, GPP and FPP are competitive inhibitors of S. cerevisiae MVK 251

with respect to ATP and uncompetitive inhibitors with respect to mevalonate. The inhibition constants 252

(Kis) of DMAPP, GPP and FPP for the S. cerevisiae MVK with respect to ATP were 34 ± 17 µM 253


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

12

(DMAPP), 0.25 ± 0.09 µM (GPP) and 0.13 ± 0.08 µM (FPP). The Kis of DMAPP, GPP and FPP for S. 254

cerevisiae MVK with respect to mevalonate were 389 ± 25 µM (DMAPP), 1.8 ± 0.4 µM (GPP) and 1.9 255

± 0.6 µM (FPP). The inhibition constants are summarized in Table 1. 256

Similar to M. mazei MVK, the S. pneumoniae MVK was previously demonstrated to be uninhibited 257

by DMAPP, GPP and FPP at concentrations up to 12 μM (2). Significantly, greater concentrations of 258

these metabolites may be encountered during metabolic engineering of terpenoid pathways; therefore, 259

we assayed the inhibition of S. pneumoniae MVK using 5 mM DMAPP, 100 µM GPP and 100 µM FPP 260

and confirmed that the S. pneumoniae MVK is not inhibited at these concentrations. 261

Inhibition of MVK by diphosphomevalonate. The effect of diphosphomevalonate on the rate of 262

MVK reactions was analyzed using pyruvate kinase and lactate dehydrogenase coupling system, as 263

previously described (2). Briefly, addition of mevalonate to the reaction mixture containing MVK 264

resulted in the quantitative conversion of the substrate to phosphomevalonate. Subsequent addition of 265

PMK resulted in conversion of phosphomevalonate to diphosphomevalonate. To demonstrate feedback 266

inhibition both MVK and PMK were added at the initiation of the assay. Inhibition of MVK was 267

indicated if the rate of mevalonate conversion to phosphomevalonate and diphosphomevalonate were 268

significantly decreased compared to the assays performed by sequential addition of MVK and PMK. In 269

our studies, when S. cerevisiae PMK and M. mazei MVK were present at the initiation of the reaction, 270

the mevalonate was completely converted into diphosphomevalonate (Figure 3B). The same result was 271

obtained when S. cerevisiae MVK was assayed with PMK (Figure 3A), demonstrating that neither M. 272

mazei nor S. cerevisiae MVK are inhibited by diphosphomevalonate. However, when S. pneumoniae 273

MVK and PMK were present at the initiation of the reaction, the velocity of mevalonate conversion 274

significantly decreased (Figure 3C), verifying the inhibition of S. pneumoniae MVK by 275

diphosphomevalonate (2). 276

DISCUSSION 277


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

13

These studies demonstrate that at least three classes of MVKs can be distinguished based on their 278

inhibition profiles (Figure 4). Unlike previously reported MVKs, the MVK of the archaeon M. mazei 279

was not inhibited by DMAPP, GPP, FPP, diphosphomevalonate, or IP, a proposed intermediate of the 280

mevalonate pathway in archaea (17). The MVK of S. cerevisiae was also not inhibited by 281

diphosphomevalonate accumulation in our studies, but was inhibited by DMAPP, GPP and FPP, 282

analogous to the human enzyme. Furthermore, inhibition of S. pneumoniae MVK was probed using 100 283

µM GPP and FPP, and 5 mM DMAPP, but no significant inhibition of enzyme activity was observed. 284

We hypothesize that MVKs may have evolved with different regulation mechanisms to accommodate 285

their specific utilization of isoprenoids (17, 20, 27). A phylogenetic tree of the MVKs from Bacteria, 286

Archaea, and Eukarya was constructed to assess the similarity between MVKs from the three domains 287

of life (Figure 2). Interestingly, the 29 MVKs that were surveyed clearly separated into three classes, 288

suggesting vertical transfer of the mvk gene. It should be noted that the MVK of the thermostable 289

archaeon Methanocaldococcus jannaschii has been studied by Huang et. al. and was found to be 290

inhibited by micromolar concentrations of GPP, FPP and IPP metabolites (19). However, the MVKs 291

from M. mazei and M. jannaschii are distantly related with 32% amino acid sequence identity, and 292

occupy different branches of the archaeal dendrogram (Figure 2). The specific activity of the M. 293

jannaschii MVK at an optimum temperature of 70-75°C was reported to be 387 µmol/min/mg. 294

Approximately 25% of the maximal activity was observed at 30°C, the temperature at which our studies 295

were conducted (19).The specific activity of M. mazei MVK we report is more than 20 times less than 296

the specific activity of M. jannaschii MVK at 30°C . The regulation of these enzymes seems widespread 297

and, therefore, likely important for maintaining properly functioning cells. Further studies are necessary 298

to determine if MVKs that are not inhibited by metabolites may be regulated at the transcriptional, 299

translational or post-translational level, or if the low catalytic efficiency of this enzyme may be 300

important for regulation. 301


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

14

REFERENCES

1. Andreassi II, J. L., Bilder, P. W., Vetting, M. W., Roderick, S. L., and Leyh, T. S. 2007.

Crystal structure of the Streptococcus pneumoniae mevalonate kinase in complex with

diphosphomevalonate. Protein Sci. 16:983-989.

2. Andreassi, J. L., Dabovic, K., and Leyh, T. S. 2004. Streptococcus pneumoniae isoprenoid

biosynthesis is downregulated by diphosphomevalonate: an antimicrobial target. Biochemistry

43:16461-16466.

3. Barkley, S. J., Desai, S. B., and Poulter, C. D. 2004. Type II isopentenyl diphosphate

isomerase from Synechocystis sp, strain PCC 6803. J. Bacteriol. 186:8156-8158.

4. Beytia, E., Dorsey, J. K., Marr, J., Cleland, W. W., and Porter, J. W. 1970. Purification and

mechanism of action of hog liver mevalonic kinase. J. Biol. Chem. 245:5450-5458.

5. Bohlmann, J., and Keeling, C. I. 2008. Terpenoid biomaterials. Plant J. 54:656-669.

6. Boucher, Y., Kamekura, M., and Doolittle, W. F. 2004. Origins and evolution of isoprenoid

lipid biosynthesis in archaea. Mol. Microbiol. 52:515-527.

7. Bult, C. J., White, O., Olsen, G. J., Zhou, L., Fleischmann, R. D., Sutton, G. G., Blake, J.

A., FitzGerald, L. M., Clayton, R. A., Gocayne, J. D., Kerlavage, A. R., Dougherty, B. A.,

Tomb, J., Adams, M. D., Reich, C. I., Overbeek, R., Kirkness, E. F., Weinstock, K. G.,

Merrick, J. M., Glodek, A., Scott, J. L., Geoghagen, N. S. M., Weidman, J. F., Fuhrmann,

J. L., Nguyen, D., Utterback, T. R., Kelley, J. M., Peterson, J. D., Sadow, P. W., Hanna, M.

C., Cotton, M. D., Roberts, K. M., Hurst, M. A., Kaine, B. P., Borodovsky, M., Klenk, H.,

Fraser, C. M., Smith, H. O., Woese, C. R., and Venter, J. C. 1996. Complete genome

sequence of the Methanogenic archaeon, Methanococcus jannaschii. Science 273:1058-1073.

8. Chen, M., and Poulter, C. D. 2010. Characterization of thermophilic archaeal isopentenyl

phosphate kinases. Biochemistry 49:207-217.


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

15

9. Dorsey, J. K., and Porter, J. W. 1968. The inhibition of mevalonic kinase by geranyl and

farnesyl pyrophosphates. J. Biol. Chem. 243:4667-4670.

10. Doun, S. S., Burgner II, J. W., Briggs, S. D., and Rodwell, V. W. 2005. Enterococcus faecalis

phosphomevalonate kinase. Protein Sci. 14:1134-1139.

11. Ekiel, I., Smith, I. C. P., and Sprott, G. D. 1983. Biosynthetic pathway in Methanospirillum

hungatei as determined by 13C nuclear magnetic resonance. J. Bacteriol. 156:316-326.

12. Felsenstein, J. 1989. PHYLIP - Phylogeny inference package (Version 3.2). Cladistics 5:164-

166.

13. Fu, Z., Voynova, N. E., Herdendorf, T. J., Miziorko, H. M., and Kim, J. P. 2008.

Biochemical and structural basis for feedback inhibition of mevalonate kinase and isoprenoid

metabolism. Biochemistry 47:3715-3724.

14. Gasteiger, E., Hoogland, C., Gattiker, A., Duvaud, S., Wilkins, M. R., Appel, R. D.,

Bairoch, A. 2005. Protein identification and analysis tools on the ExPASy server, p. 571-607 In

J. M. Walker (ed.), Proteomics Protoc. Handb. Humana Press.

15. Goldstein, J. L., and Brown, M. S. 1990. Regulation of the mevalonate pathway. Nature

343:425-430.

16. Gray, J. C., and Kekwick, R. G. O. 1972. The Inhibition of Plant Mevalonate Kinase

Preparations by Prenyl Pyrophosphates. Biochim. Biophys. Acta 279:290-296.

17. Grochowski, L. L., Xu, H., and White, R. H. 2006. Methanocaldococcus jannaschii uses a

modified mevalonate pathway for biosynthesis of isopentenyl diphosphate. J. Bacteriol.

188:3192-3198.

18. Hinson, D. D., Chambliss, K. L., Toth, M. J., Tanaka, R. D., and Gibson, K. M. 1997. Post-

translational regulation of mevalonate kinase by intermediates of the cholesterol and nonsterol

isoprene biosynthetic pathway. J. Lipid Res. 38:2216-2223.


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

16

19. Huang, K., Scott, A. I., and Bennett, G. N. 1999. Overexpression, purification, and

characterization of the thermostable mevalonate kinase from Methanococcus jannaschii. Protein

Expression Purif. 17:33-40.

20. Koga, Y., and Morii, H. 2007. Biosynthesis of ether-type polar lipids in archaea and

evolutionary considerations. Microbiol. Mol. Biol. Rev. 71:97-120.

21. Martin, V. J. J., Pitera, D. J., Withers, S. T., Newman, J. D., and Keasling, J. D. 2003.

Engineering a mevalonate pathway in Escherichia coli for production of terpenoids. Nat.

Biotechnol. 21:796-802.

22. Potter, D., Wojnar, J. M., Narasimhan, C., and Miziorko, H. M. 1997. Identification and

functional characterization of an active-site lysine in mevalonate kinase. J. Biol.l Chem.

272:5741-5746.

23. Roberts, S. C. 2007. Production and engineering of terpenoids in plant cell culture. Nat. Chem.

Biol. 3:387-395.

24. Rohdich, F., Bacher, A., and Eisenreich, W. 2005. Isoprenoid biosynthetic pathways as anti-

infective drug targets. Biochem. Soc. Trans. 33:785-791.

25. Rohmer, M., Knani, M., Simonin, P., Sutter, B., and Sahm, H. 1993. Isoprenoid biosynthesis

in bacteria: a novel pathway for the early steps leading to isopentenyl diphosphate. Biochemistry

295:517-524.

26. Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989. Molecular cloning: a laboratory manual,

2nd ed, vol. 3. Cold Spring Harbor Laboratory Press, New York.

27. Smit, A., and Mushegian, A. 2000. Biosynthesis of isoprenoids via mevalonate in Archaea: the

lost pathway. Genome Res.:1468-1484.

28. Spurgeon, S. L., and Porter, J. W. 1981. Biosynthesis of Isoprenoid Compounds, vol. 1. John

Wiley and Sons, New York.

29. Tchen, T. T. 1958. Mevalonic kinase: purification and properties. J. Biol. Chem. 233:1100-

1103.


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

17

30. Thompson, J. D., Higgins, D. G., and Gibson, T. J. 1994. CLUSTAL W: improving the

sensitivity of progressive multiple sequence alignment through sequence weighting, position-

specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.

31. Voynova, N. E., Rios, S. E., and Miziorko, H. M. 2003. Staphylococcus aureus mevalonate

kinase: isolation and characterization of an enzyme of the isoprenoid biosynthetic pathway. J.

Bacteriol. 186:61-67.

32. Wilding, E. I., Brown, J. R., Bryant, A. P., Chalker, A. F., Holmes, D. J., Ingraham, K. A.,

Iordanescu, S., So, C. Y., Rosenberg, M., and Gwynn, M. N. 2000. Identification, evolution,

and essentiality of the mevalonate pathway for isopentenyl diphosphate biosynthesis in gram-

positive cocci. J. Bacteriol. 182:4319-4327.

33. Withers, A. T., and Keasling, J. D. 2007. Biosynthesis and engineering of isoprenoid small

molecules. Appl. Microbiol. Biotechnol. 73:980-990.


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

18

Table 1. Kinetic characterization of MVKs S. cerevisiae MVK S. pneumoniae MVK M. mazei MVK

KMapp-Mev (µM) a 131 ± 8 236 ± 14 68 ± 4

KMapp-ATP (µM) a 650 ± 72 372 ± 9 464 ± 12

kcat (s-1) a 38 ± 5 11 ± 4 4.3 ± 0.2

Ki-(DPM) b NDc Inhibitedf NDc

Ki-Mev (DMAPP) (µM) b 389 ± 25e > 5,000 > 5,000

Ki-ATP (DMAPP) (µM) b 34 ± 17d > 5,000 > 5,000

Ki-Mev (GPP) (µM) b 1.8 ± 0.4e > 100 > 100

Ki-ATP (GPP) (µM) b 0.25 ± 0.09d > 100 > 100

Ki-Mev (FPP) (µM) b 1.9 ± 0.6e > 100 > 100

Ki-ATP (FPP) (µM) b 0.13 ± 0.08 d > 100 > 100

Ki-(IP) b

NAg NAg NDc

aKMapp and kcat values were determined by fitting the Michaelis-Menten equation to the data with Kaleidagraph (Synergy Software). Error values represent one standard deviation of three replicates. bKi values were determined by fitting the Lineweaver-Burk equation to the data. Error values represent one standard deviation of four replicates. cNot determined (ND) no inhibition detected. dCompetitive inhibition. eUncompetitive inhibition. fS. pneumoniae MVK is inhibited by diphosphomevalonate (DPM) but not quantifiable in this assay. gNot applicable (NA).

302


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

19

FIGURE LEGENDS 303

Figure 1. The mevalonate pathway. The proposed modified pathway for the production of isoprenoids in 304

archaea organisms is illustrated in the box (17). 305

Figure 2. Phylogenetic tree for MVKs from the mevalonate pathway of Eukarya, Archaea and Bacteria. 306

Figure 3. The conversion of mevalonate to phosphomevalonate catalyzed by S. cerevisiae (A), M. mazei 307

(B) and S. pneumoniae (C) MVKs was monitored in the presence and absence of S. cerevisiae PMK. 308

The rate of conversion of mevalonate to phosphomevalonate and subsequently to diphosphomevalonate 309

was detected indirectly, by the oxidation of NADH, at 386 nm. Reactions that were initiated by the 310

simultaneous addition of MVK and PMK are indicated by (i) on each graph. Reactions that were 311

initiated with MVK in the absence of PMK are indicated by (ii) in each graph. Reactions were allowed 312

to proceed until mevalonate was completely converted to phosphomevalonate. PMK was then added to 313

the reaction mixture at (iii) to complete conversion to diphosphomevalonate. Reactions contained the 314

following components: 100 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 10 mM MgCl2, 5 mM ATP, 2.5 315

mM NADH, 4 mM PEP, 10 U of LDH, 10 U of PK, 1 mM mevalonate, (A) 0.1 µM S. cerevisiae MVK 316

and 1 µM S. cerevisiae PMK, (B) 1.7 µM M. mazei MVK and 2 µM S. cerevisiae PMK, (C) 1 µM S. 317

pneumoniae MVK and 2 µM S. cerevisiae PMK. 318

Figure 4. Diagram of the regulation of MVKs from S. pneumoniae, S. cerevisiae and M. mazei by the 319

intermediates of the mevalonate pathway. Schematic of the mevalonate pathway in S. cerevisiae, S. 320

pneumoniae, and M. mazei with enzymes MVK, PMK, diphosphomevalonate decarboxylase (MVD, 321

unidentified in archaea), IDI and farnesyl diphosphate synthase (FPPS), and their corresponding 322

intermediates, phosphomevalonate (PM), diphosphomevalonate (DPM), IPP, DMAPP, GPP, and FPP. 323

Inhibition studies were performed with DMAPP, GPP, FPP, DPM and isopentenyl monophosphate (IP). 324

S. pneumoniae MVK is inhibited by DPM, whereas S. cerevisiae MVK is inhibited by DMAPP, GPP 325

and FPP. M. mazei MVK is not inhibited by DMAPP, GPP, FPP, or DPM. Inhibition of M. mazei MVK 326


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

20

was also tested with IP, the proposed intermediate of an alternative archaeal mevalonate pathway 327

involving a putative phosphomevalonate decarboxylase and isopentenyl monophosphate kinase (IPK). 328

IP did not inhibit M. mazei MVK in our studies. 329


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Documents

Copyright © 2011, American Society for Microbiology and/or the