Proc. Natl. Acad. Sci. USAVol. 93, pp. 1797-1802, March 1996Neurobiology

Correlation between kinetics and RNA splicing ofa-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptorsin neocortical neuronsBERTRAND LAMBOLEZ*t, NICOLE ROPERT*, DAVID PERRAIS*, JEAN ROSSIER*, AND SHAUL HESTRINt*Institut Alfred Fessard, Centre National de la Recherche Scientifique, 1 Avenue de la Terrasse, 91198 Gif-sur-Yvette, France; and tDepartment of Anatomy andNeurobiology, University of Tennessee Memphis, 855 Monroe Avenue, Memphis, TN 38163

Communicated by B. Sakmann, Max-Planck-Institut fur Medizinische Forschung, Heidelberg, Germany, October 30, 1995 (received for reviewAugust 2, 1995)

ABSTRACT In the cortex fast excitatory synaptic currentsonto excitatory pyramidal neurons and inhibitory nonpyramidalneurons are mediated by a-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors exhibiting cell-type-specificdifferences in their kinetic properties.AMPA receptors consist offour subunits (GluR1-4), each existing as two splice variants,flip and flop, which critically affect the desensitization proper-ties of receptors expressed in heterologous systems. Using singlecell reverse transcription PCR to analyze the mRNA ofAMPAreceptor subunits expressed in layers I-HI neocortical neurons,we find that 90%Y of the GluR1-4 in nonpyramidal neurons areflop variants, whereas 92% ofthe GluRl-4 in pyramidal neuronsare flip variants. We also find that nonpyramidal neuronspredominantly express GluRl mRNA (GluR1/GluRl-4 = 59%o),whereas pyramidal neurons contain mainly GluR2 mRNA(GluR2/GluR1-4 = 59%o). However, the neuron-type-specificsplicing is exhibited by all four AMPA receptor subunits. Wesuggest that the predominance ofthe flop variants contributes tothe faster and more extensive desensitization in nonpyramidalneurons, compared to pyramidal cells where flip variants aredominant. Alternative splicing ofAMPA receptors may play animportant role in regulating synaptic function in a cell-type-specific manner, without changing permeation properties.

Cortical neurons in superficial layers can be classified asregular spiking (RS) pyramidal cells and fast spiking (FS)nonpyramidal cells (1, 2). FS nonpyramidal neurons containy-aminobutyric acid and glutamic acid decarboxylase and arethought to be inhibitory interneurons (1, 3). Pyramidal neu-rons accumulate glutamate and are presumably the mainexcitatory neurons (4, 5). The fast excitatory synaptic trans-mission onto both cell types is mediated by a-amino-3-hydroxy-5-methylisoxasole-4-propionic acid (AMPA) recep-tors (6, 7). AMPA receptors desensitize faster and to a greaterextent in FS nonpyramidal cells than in RS pyramidal cells (8,9). Furthermore, AMPA receptors in layer IV FS nonpyra-midal neurons are more permeant to calcium than in layer Vpyramidal neurons (9) and layers 11/111 nonpyramidal neuronsexhibit larger single channel conductance than layers II/IIIpyramidal neurons (8). These findings suggest that structuraldifferences may underlie the functional differences amongAMPA receptors in cortical pyramidal and nonpyramidalneurons.AMPA receptors are multimeric assemblies of four subunits

GluR1-4 (reviewed in refs. 10 and 11). The expression of theGluR2 subunit in heterologous systems endows AMPA recep-tors with low Ca2+ permeability (12, 13). Further diversity isgenerated by alternative splicing, giving either flip or flopvariants of all subunits, and RNA editing (14-16). The kineticproperties of AMPA receptors depend on subunit composi-

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement" inaccordance with 18 U.S.C. §1734 solely to indicate this fact.

tion, alternative flip/flop splicing, and RNA editing (16-18).Expression of the flop variants of the GluR1-4 subunits resultsin receptors exhibiting a faster rate of desensitization com-pared to AMPA receptors containing the flip variants.The distribution of AMPA receptor subunits varies in

different central nervous system regions (11). Immunocyto-chemical techniques indicate that GluRl is preferentiallyexpressed in cortical interneurons and that GluR2 is stronglyexpressed in pyramidal neurons (7, 19, 20). Jonas et al. (9) havefound, using single cell reverse transcription (RT)-PCR, thatthe relative abundance of GluR2 in layer V pyramidal neuronswas higher than in layer IV nonpyramidal neurons.

Using the single cell RT-PCR analysis, it is possible tocharacterize the subunit composition of AMPA receptors inphysiologically identified cells (21, 22). In this paper, weinvestigate by single cell RT-PCR the subunits and splicevariants ofAMPA receptors expressed in identified pyramidaland nonpyramidal cortical neurons in layers I-III in order toexplain the different kinetics of desensitization found in thesecells. We found that the flip/flop ratio is higher in pyramidalneurons than in nonpyramidal neurons, suggesting that alter-native splicing may regulate synaptic function in these cells.

MATERIALS AND METHODSRecordings. Patch pipettes (3-5 Mfl) made from autoclaved

glass were filled with 8 ,ul of internal solution. Whole cellrecordings (23) were made from layers I-III neurons in acute300-,um-thick slices obtained from 10- to 17-day-old Wistarrats selected under visual control using an upright microscopewith Nomarski optics and infrared videomicroscopy. The cellcontent was harvested under visual control by application of agentle negative pressure in the pipette. In most cases, somecellular content was observed flowing into the patch pipette.Harvesting was interrupted as soon as the seal was lost. Thecontent of the pipette was then expelled into a test tube andRT was performed as described (21).Rapid Perfusion. Rapid application of glutamate (24) was

performed as described (8). The rate of solution exchange wasmeasured as an offset current using an open patch pipette. Thesolution exchanged with a rising/falling time (20-80%) of 200,us. Membrane potential was -70 mV and current traces weredigitized at 20 kHz.

Solutions. The bath solution contained 126 mM NaCl, 1.5mM KCl, 1.25 mM KH2PO4, 1.5 mM MgSO4, 2 mM CaCl2, 26mM NaHCO3, 10 mM glucose. Pipettes were filled withsolution containing 144 mM potassium gluconate, 3 mM

Abbreviations: FS, fast spiking; RS, regular spiking; AMPA, a-amino-3-hydroxy-5-methylisoxasole-4-propionic acid; RT, reverse transcrip-tion; fAHP, fast afterpotential.tTo whom reprint requests should be sent at present address: CentreNational de la Recherche Scientifique, Unite de Recherche Associ6e2054, Ecole Superieure de Physique et de Chimie Industrielles, 10 rueVauquelin, 75231 Paris cedex 5, France.

1797

Dow

nloa

ded

by g

uest

on

Mar

ch 5

, 202

1

1798 Neurobiology: Lambolez et al.

MgCl2, 10 mM Hepes, 0.5 mM EGTA (pH 7.2; 285/295mosm).GluR1-4 cDNA Amplification. The GluR1-4 cDNAs present

in the single cell RT reaction were amplified with the primerscommon to GluRl, -2, -3, and -4, (sense primer, CCTTTGGC-CTATGAGATCTGGATGTG; antisense primer, TCGTAC-CACCATTTGTTTTTCA) with 40 PCR cycles as described(21). In 50% of the harvested cells, the RT-PCR yielded amplifiedGluR1-4 cDNAs as seen by agarose gel electrophoresis of 10 ,ulof the reaction mixture. The absence of amplified products innegative samples was confirmed by 35 cycles of reamplification ina few cases. The product of positive samples was purified on a

1.5% low melting point agarose gel and saved for further analysis.Quantification of the GluRl-4 Relative Proportions. Ali-

quots (- 10 pg) of the purified product from the first PCR were

reamplified with the same set of primers, the antisense primerbeing 32P 5'-end labeled. Thirty-five cycles (94°C, 30 s; 49°C,30 s; 72°C, 45 s) were performed. The product of the secondPCR was then cut by Bgl I, Bsp1286I, Eco47III, or EcoRI,which selectively cut the GluRl, -2, -3 or -4 PCR fragment,respectively (see ref. 21 for details). The restriction reactionmixtures were then run on a 1.5% agarose gel, stained withethidium bromide, and photographed. The gel was then fixedfor 1 h at 4°C in 7% trichloroacetic acid (TCA), dried undervacuum, and submitted to PhosphorImaging analysis (Molec-ular Dynamics, Image Quant software). Since only the anti-sense primer was labeled, each restriction cut generated onlyone labeled restriction fragment. For each electrophoresislane, corresponding to a subunit-specific cut, the total countspresent in both the cut and the uncut band were measured bypeak integration and normalized to 100%. The percentage ofcounts present in the cut band thus represented the percentageof the corresponding subunit in the GluR1-4 amplified prod-ucts.

Quantification of the Flip/Flop Proportions of GluRl-4.Aliquots of the purified product of the first amplification weresubmitted to a second amplification with the following sets ofprimers: the sense primers were specific for either GluRl (Ri,GGACGAGACCAGACAACCAG at position 1717; position1 is the first nucleotide of the initiation codon), GluR2 (R2,TGAAGATGGAAGAGAAACACAAAG at position 1731),GluR3 (R3, ACCCACAAAGCCCTCCTG at position 1757),or GluR4 (R4, GAAGGACCCAGTGACCAGCC at position1747); the common antisense primer was that used for the firstamplification but was 32P 5'-end labeled. Thirty-five cycles(94°C, 30 s; 49°C, 30 s; 72°C, 45 s) were performed. Theproducts of these second amplifications (632, 639, 628, and 630bp for GluRl, -2, -3 and -4, respectively) were digested withenzymes specific for either the flip or the flop form, yieldingfragments of the following size: 568 and 64 bp for GluRl flipcut by Bfa I, 571 and 68 bp for GluR2 flop cut by Hpa I, 560and 68 bp for GluR3 flop cut by Hpa I, and 562 and 68 bpGluR4 flop cut by Hpa I (see ref. 22 for details).The restriction reactions were then run on a 2.3% agarose

gel, stained with ethidium bromide, and photographed. Theagarose gel was then fixed for 1 h at 4°C in 100% ethanol or

7% TCA, dried under vacuum, and submitted to Phosphorlm-aging analysis as described above. For each electrophoresislane, corresponding to a variant-specific cut, the total countspresent in both the cut and the uncut bands were measured bypeak integration and equaled 100%. The percentage of countspresent in the cut band thus represented the percentage of thecorresponding flip or flop variant for each subunit. Thepercentage of the complementary variant was calculated as-suming that flip plus flop variants represent 100%. For eachcell, these relative values were multiplied by the relative

amounts of the GluR1-4 subunits previously determined (seeabove) to obtain the relative proportions of the GluR1-4 flipor flop expressed (Table 1).

Table 1. Control for subunit and splice variant quantification

Absorbance* PIt Pit

R2/R3 0.20 0.31 0.251.00 1.38 1.215.00 5.24 8.25

R3/R2 0.20 0.17 0.191.00 0.96 1.095.00 4.37 5.62

R2i/R2o 0.20 0.22 0.131.00 1.11 1.105.00 4.85 4.81

R3i/R3o 0.20 0.19 0.151.00 0.68 0.935.00 5.49 5.76

*Measured before RT-PCR.tPhosphorlmaging measured after RT-PCR on 12.5 pg of RNA.*Phosphorimaging measured after RT-PCR on 250 fg of RNA.

Control for Ratio Quantification. We studied the ability ofthe RT-PCR and quantification procedure to maintain originalGluR1-4 flip and flop mRNA original ratios. We applied theprocedure used for single cells to mixtures of in vitro transcriptsof GluR2i, GluR2o, GluR3i, and GluR3o cloned cDNAs. Invitro transcriptions of the GluR2 flop (kind gift of P. H.Seeburg), GluR2 flip, GluR3 flip (kind gifts of N. Nakanishi),and GluR3 flop (kind gift of S. Heinemann) cDNA sequencescontained in the Bluescript plasmid were performed as de-scribed elsewhere (25) using T3 RNA polymerase, followed bya DNase I treatment to eliminate cDNA template. In vitrotranscripts of each clone were quantified byA26o measurementand their quality was controlled by agarose gel electrophoresis.The transcripts were mixed in three different proportions:R2/R3 = R2i/R2o = R3i/R3o = 1/5, 1, and 5. Of thesemixtures, 12.5 pg and 250 fg (1:50 dilution) were then submit-ted to RT-PCR as described above using the primers commonto GluR1-4, the antisense primer being 5' radiolabeled. Thethree 12.5-pg samples were subjected to 35 PCR cycles,whereas the three 250-fg samples were subjected to 40 cycles.The PCR products were then subjected to R2/R3 quantifica-tion by PhosphorImaging as described above. In parallel, thePCR products were purified on a 1.5% low melting pointagarose gel, and 10 pg of these purified products was subjectedto a second PCR (35 cycles) using either the R2-specific or theR3-specific sense primer and the labeled antisense primercommon to GluR1-4. The second PCR products were thensubmitted to flip/flop quantification by PhosphorImaging asdescribed above.

Table 1 shows that the original proportions of GluR2-3 flipand flop RNA ratios were maintained throughout the RT-PCR and quantification procedure for both dilutions of orig-inal RNAs (see also ref. 21 for R1/R2 ratios). Therefore, thepresent GluR1-4 flip and flop RT-PCR and quantificationgive reliable and reproducible results corresponding to originalmRNA ratios.

RESULTSAmong 25 layer I-III neurons for which the single cell RT-PCR of AMPA receptor subunits was performed, 10 wereidentified as RS pyramidal neurons and the remaining 15 wereidentified as FS nonpyramidal neurons. RS cells were notfound in layer 1.

Kinetics ofAMPA Responses in Layer I FS Neurons. Previousstudies have shown that the kinetics of AMPA receptors in FSnonpyramidal neurons in layers II-IV significantly differ fromthose found in RS pyramidal neurons (8, 9). Since we includedlayer I neurons in this study, we investigated the functionalproperties of their AMPA receptors using rapid application.Glutamate (1-10 mM) was applied to membrane patches excised

Proc. Natl. Acad. Sci. USA 93 (1996)

Dow

nloa

ded

by g

uest

on

Mar

ch 5

, 202

1

Proc. Natl. Acad. Sci. USA 93 (1996) 1799

from somata of layer I neurons (Fig. 1A). The responses to pulse(1 ms) and step applications exhibited an exponential decay withtime constants of 2.3 ± 0.7 and 4.5 ± 1.3 ms, respectively (mean+ SD; n = 6). The relatively fast rate of desensitization in layerI neurons is that previously found in FS nonpyramidal neurons inlayers II/III (8). Moreover, the rate of desensitization is muchfaster in layer I neurons than in layers II/III RS pyramidalneurons (Fig. 1C; decay time constant, 13.5 ± 4.6 ms; n = 7) uponstep application (see also ref. 8). Although nonpyramidal neuronsin layers I and II/III are heterogeneous (2), the fast rate ofdesensitization exhibited by these cells compared with pyramidalneurons may be the result of a common underlying mechanismdifferentiating AMPA receptors in nonpyramidal neurons fromthose found in pyramidal neurons in layers I-III.

Cell Identification. Neurons were selected as pyramidal ornonpyramidal cells according to their morphological charac-teristics under Nomarski optics. Pyramidal neurons had amajor apical dendrite oriented toward the pia and a triangularshaped soma (Fig. 1D). Nonpyramidal neurons had oval ormultipolar somata. Layer I neurons are GABAergic nonpy-ramidal neurons (26, 27) and their general appearance issimilar to nonpyramidal neurons in layers II/III (Fig. 1B) butdifferent from that of pyramidal neurons in layers II/III (Fig.1D).After obtaining a recording from a selected cell, its physi-

ological characteristics were identified by intracellular currentinjection. In RS cells (Fig. 2A), single spikes were followed bya fast afterpotential of small amplitude (fAHP; less than -4mV; mean, -0.88 mV), whereas in FS cells (Fig. 2C), singlespikes were followed by a much larger fAHP (larger than -7mV; mean, -15.6 mV). We found that the action potentialcharacteristics of layer I neurons are similar to those found inFS nonpyramidal neurons in layers II/III. In addition, RSpyramidal cells were identified by spike accommodation (Fig.2B) and by their low maximal frequency of discharge (mean,31 Hz) compared with nonpyramidal cells, which display littleaccommodation (Fig. 2D) and have a higher maximal fre-quency of discharge (mean, 84 Hz). In a plot of the fAHP

A ilZII :IZIII B

20 ms

C D

FIG. 1. Kinetics of AMPA receptors in layer I neuronal somata.(A) Responses of an excised membrane patch from a layer I neuron topulse (1 ms) and step applications of glutamate (10 mM). Fastest decaycorresponds to the pulse application. Time course of the glutamateapplication is indicated diagrammatically above the traces. (B) LayerI neuron visualized by infrared DiC optics at a single focal plane. (C)Responses of an excised patch from a layer II/III pyramidal neuron to1 ms and step application of 10 mM glutamate. Fastest decay corre-sponds to the pulse application. (D) Layer II/III pyramidal neuron.Note the prominent apical dendrite oriented toward the pial surface.(A and C) Membrane potential was -70 mV. Amplitudes of theresponses were normalized (A and C) to facilitate comparison of theirtime courses. Traces are averages of four responses each. Pial surfaceis on top. [Bar (B and D) = 20 t,m.]

RS pyramidal cellPCR 707

FS non pyramidal cellPCR 736

A

2Oms 2nms

E

NI

Ca)

140 -

120100806040200--30

40Oms 40Oms

. RS Cell oFScell

-20 -10 0 10

AHP amplitude (mV)

FIG. 2. Functional characteristics of RS and FS cells. Voltagerecordings of RS (A and B) and FS (C and D) cells following injectionof short (100 ms; A and C) and long (1 s; B and D) hyperpolarizing(-50 pA) and depolarizing current pulses. First spike was followed bya fAHP with a maximal amplitude measured from the spike thresholdindicated by dashed line at the bottom of the spikes in A and C. ThefAHP was small in RS cells (A) and larger in FS cells. Maximalfrequency of discharge was found by injection of a long (1 s) depo-larizing current pulse of increasing intensity until spike inactivationappeared (B and D). It was measured between the 10th and 11thspikes. Maximal frequency was correlated with the amplitude of thefAHP in RS cells (solid squares) and FS cells (open squares), whichform two distinct groups of neurons when these two parameters areconsidered (E).

amplitude against the maximal frequency of discharge, RS andFS cells form two nonoverlapping groups (Fig. 2E).GluRl-4 Subunit Identification and Ratio Quantification.

We showed that the GluR1-4 flip and flop mRNA ratiosdetermined by the single cell RT-PCR and quantificationprocedure correspond to mRNA ratios in the original samples(see Materials and Methods and Table 1). Thus, the resultsobtained from the single cells closely correlate with theirrespective original AMPA receptor subunit mRNA ratios.

After identification of the neurons, the cellular content ofeach cell was collected into the patch pipette and used toinvestigate the GluR1-4 flip and flop combinations expressedby RT-PCR. The same procedure applied to extracellularmedium in the slice yielded negative results (n = 3). Examplesof the complete analysis of the GluR1-4 flip and flop pro-portions, as performed for each cell, are given in Fig. 3 for aRS cell and a FS cell. Cell 707 was identified as a RS pyramidalneuron, and cell 736 was identified as a FS nonpyramidalneuron.The relative proportions of GluR1-4 were quantified after

a radioactive second PCR using the primers pair common toall subunits (Fig. 3 Upper).The GluR1-4 subunits were cut with subunit-specific re-

striction enzymes and their relative abundance was visualizedby ethidium bromide staining after agarose gel electrophoresis.

* nr7 %ioll V%-j %olI

u 0-a

0a 0

nn 0

0: m

a

Neurobiology: Lambolez et al.

Dow

nloa

ded

by g

uest

on

Mar

ch 5

, 202

1

1800 Neurobiology: Lambolez et al.

RS 707 - FS 736,-.-.Ri-4 ~

P. 1.

U-

FIG. 3. Quantification of GluR1-4 flip/flop subunits. RS cell 707(Left) and FS cell 736 (Right). External panels show ethidium bromide-stained gel electrophoresis of GluR1-4 cDNA fragments amplifiedusing a radioactive antisense primer and cut with restriction enzymes.Each lane is numbered according to the subunit cut. Position of the603-bp band of the molecular weight marker (DX HaeIII ((F) isindicated on the right by a bar. Central panels show superimposedPhosphorImaging profiles (P.I.) of the respective gels. Since only one

primer was radioactive, each lane shows two labeled bands: the uncutcDNA and one of the two restriction fragments. Each profile corre-

sponds to a subunit-specific lane (green, GluRI; red, GluR2; blue,GluR3; black, GluR4). Vertical axis is distance of migration (samescale as in corresponding gels). Horizontal axis is number of counts.(Upper) GluR1-4 proportions in RS cell 707 (Left) and in FS cell 736(Right). GluR1-4 cDNA fragments were coamplified and cut withsubunit-specific restriction enzymes. In each lane, uncut fragment is750 bp and corresponds to the GluR1-4 cDNAs resistant to theenzyme. Two smaller bands correspond to fragment of subunit cut byits specific enzyme. Positions of uncut and cut bands are indicated.Note that the most intense bands are GluR2 for RS neuron 707 andGluRl for FS neuron 736. In the superimposed PhosphorImagingprofiles of the same gels, note the proportion of GluR2 (red), high inRS cell 707 and low in FS neuron 736. (Lower) Flip/flop proportionsof GluR1-4 subunits expressed in RS cell 707 (Left) and in FS cell 736(Right). Subunit-specific amplification was performed followed byrestriction with splice variant-specific enzymes. Each lane is numberedaccording to the subunit amplified with i or o standing for flip- or

flop-specific cut. Restriction cuts generated a large fragment close tothe uncut size [see lane 1i (Left) or 3o and 4o (Right) where they forma doublet with the uncut fragment], and a small fragment. Only theuncut and the small restriction fragments were labeled in each lane. Inthe PhosphorImaging profiles of the gels, superimposed traces havebeen slightly shifted for better visualization. The 1i profile (where cutis flip in contrast with the other subunits) was inverted along thevertical axis to superimpose the splice variant-specific peaks as indi-cated at the center of the figure (flip or flop). Note the predominanceof flip in RS cell 707 and of flop in FS cell 736.

As estimated from the intensities of the bands, the mostabundantly expressed subunit in RS cell 707 (Fig. 3 Upper Left)was GluR2, whereas it was GluRl in FS neuron 736 (Fig. 3Upper Right).PhosphorImager profiles of each subunit-specific lane ob-

tained from the same gel were used for quantification of theGluR1-4 proportions. These profiles are shown superimposed inFig. 3 (Upper, internal panels). Since only the antisense primerwas labeled, only one of the two subunit-specific restrictionfragments stained by ethidium bromide was labeled. For eachelectrophoresis lane, corresponding to a subunit-specific cut, thetotal counts present in both the cut and the uncut bands were

measured by peak integration and equaled 100%. The percentageof counts present in the cut band thus represented the percentageof the corresponding subunit in the GluR1-4 amplified products.The results obtained for GluRl, -2, -3, and -4 were, respectively,11%, 72%,21%, and 2% in RS cell 707 and 53%,11%,26%, and4% in FS cell 736. These results are consistent with intensities ofethidium bromide staining.

Alternative Splicing Ratio Quantification. The flip/flopproportions for each subunit expressed in individual cells wereanalyzed in a second step. After second PCRs using primersspecific for each subunit found in the cell, each of the resultingproducts was cut by a splice variant specific enzyme. Theresults obtained for RS cell 707 and FS cell 736 are shown inFig. 3 (Lower).The results of the splice variant-specific restriction cuts were

visualized after agarose gel electrophoresis (Fig. 3, externalpanels). Lanes 1i (GluRl-flip) show that cell 707 had bothGluRl flip (cut) and flop (uncut), whereas cell 736 only hadGluR1 flop. Lanes 2o, 3o, and 4o (GluR2, -3, and -4 flop) showthat cell 707 was flip (uncut) for GluR2, -3, and -4 and cell 736was GluR2 flop (cut) and GluR3 and -4 flip/flop.The PhosphorImager profiles of each subunit-specific lane

obtained from the same gel were used to quantify the flip/flopratios for each subunit (Fig. 3 Lower, internal panels). To givea clearer pattern, the profile corresponding to GluRl (wherecut is flip in contrast with the other subunits) was invertedalong the vertical axis (distance of migration) so that the floppeaks were superimposed for all subunits. The percentage ofcounts present in the cut band represented the percentage ofthe corresponding splice variant in the subunit-specific prod-uct. Quantification of these profiles for RS cell 707 and FS cell736 gave the following values: GluRl flip, 38.5% and 0%;GluR2 flop, 0% and 100%; GluR3 flop, 0% and 41.3%; GluR4flop, 0% and 52.7%. These values are consistent with obser-vations of ethidium bromide staining. The flip/flop percent-ages obtained for each subunit were then expressed as per-centages of the total of all subunits found in the cell. Theseresults are summarized in Table 2 together with those obtainedthe same way for the other 9 RS neurons and 14 FS neurons.

In RS cells, GluR2 was the major subunit expressed, exceptin cells 727 and 738 where GluR3 was the only subunit found.The mean GluR2/GluR1, -3, -4 ratio was 1.28. Furthermore,the flip variant of each subunit was predominant in all the cells,except in cells 637 and 707 where GluR2 and GluRl, respec-tively, were more flop than flip. The mean flip/(flip+flop)ratio was 0.92. The mean percentage of the subunits found inRS pyramidal neurons is plotted in Fig. 4A where the pre-dominance of GluR2 over GluRl, -3, -4 and of flip over flopappears. Even in three cells where a single subunit wasdetected, it was flip. In FS nonpyramidal neurons, GluRl waspredominant in 9 of the 15 cells, GluR2 was predominant in 4,and GluR3 was predominant in 2 (Table 2). The meanGluR2/GluR1, -3, -4 ratio was 0.28. All FS neurons, except cell711, were mostly flop regardless of the subunits expressed. Themean flip/(flip+flop) ratio was 0.10. This pattern was quitedifferent from that found in RS cells, as shown by the plot ofthe mean proportion of the subunits found in FS cells (Fig. 4B).Here, GluRl was the most expressed subunit, and the flopvariants were predominant over the flip. In the six cells where asingle subunit was detected, it was only of the flop form. AmongFS cells, eight were from layer I; they did not exhibit a distinctivepattern of GluR1-4 expression compared to the remaining sevenFS cells recorded in layers 11/111. The mean fractions of flop andGluR2 subunits in layer I neurons were 0.92 ± 0.31 and 0.18 +0.21, respectively (n = 8), whereas in layer 11/III nonpyramidalneurons the mean fractions of flop and GluR2 subunits were 0.96+ 0.08 and 0.28 + 0.42, respectively (n = 7).

-

Proc. Natl. Acad. Sci. USA 93 (1996)

Dow

nloa

ded

by g

uest

on

Mar

ch 5

, 202

1

Proc. Natl. Acad. Sci. USA 93 (1996) 1801

Table 2. Subunit composition of AMPA receptors of RSpyramidal neurons and FS nonpyramidal neurons

GluRl GluR2 GluR3 GluR4

Flip Flop Flip Flop Flip Flop Flip Flop% % % % % % % %

RS cell637 34 0 28 45 0 0 0 0704 0 0 57 0 0 0 53 0707 4 7 72 0 21 0 2 0708 22 0 64 0 22 0 0 0715 2 0 99 0 0 0 0 0724 0 0 58 29 24 0 0 0727 0 0 0 0 100 0 0 0733 72 0 39 0 0 0 0 0737 0 0 100 0 0 0 0 0738 0 0 0 0 100 0 0 0

Mean 13 1 52 7 27 0 6 0SD 22 2 34 15 38 16

FS cell682 0 100 0 0 0 0 0 0695 0 100 0 0 0 0 0 0698 0 100 0 0 0 0 0 0700 0 0 0 0 7 93 0 0710 0 58 0 0 2 63 0 0711 30 11 10 0 18 0 20 6713 0 86 0 0 2 33 0 0720 0 28 0 47 2 0 6 27723 0 0 0 100 0 0 0 0726 0 23 7 82 0 0 0 0731 0 100 0 0 0 0 0 0732 18 31 1 48 3 0 1 1736 0 53 0 11 15 11 2 2743 5 40 4 37 1 25 1 1744 0 100 0 0 0 0 0 0

Mean 4 55 1 22 3 15 2 2SD 8 38 3 32 5 27 5 7

Percentages of all subunits were obtained after quantification byPhosphorImaging. It must be noted that the GluR1-4 flip and floppercentages do not add up to 100% (mean, 106% for RS cells and104% for FS cells) presumably due to a nonuniform backgroundresulting from nonincorporated labeled primers migrating in front ofelectrophoresis. Over a total of 25 cells, 9 were positive for one, 4 fortwo, 6 for three, 2 for five, 2 for six, 1 for seven, and 1 for eight subunits.Mean number of subunits per cell is 2.9. This mean number is 2.3 forRS cells and 3.3 for FS cells. RS pyramidal cells: GluR2/GluR1, -3, -4= 1.28, flip/flip+flop = 0.92; flip+flop, GluR1 = 14%, GluR2 =59%, GluR3 = 27%, GluR4 = 6%. FS nonpyramidal cells: GluR2/GluRl, -3, -4 = 0.28, flip/flip+flop = 0.10; flip+flop, GluRl = 59%,GluR2 = 23%, GluR3 = 18%, GluR4 = 4%.

DISCUSSIONOur main finding is that in RS pyramidal neurons of layerII/III 92% of GluR1-4 mRNAs are flip variants, whereas inFS nonpyramidal neurons of layers I and II/III, 90% ofGluR1-4 mRNAs are flop variants. It has been demonstratedusing recombinant receptors that, for a given subunit compo-sition, expression of flop variants increases the rate and extentof desensitization (16-18). These findings suggest that alter-native splicing is involved in generating the differences foundin the kinetics of native AMPA receptors independently ofpermeation properties.Comparison Between Native and Recombinant AMPA Re-

ceptors. In expression systems, the kinetic parameters ofrecombinant AMPA receptor response to glutamate are ex-quisitely controled by GluR1-4 subunit proportion, alternativesplicing, and nuclear RNA R/G editing (16-18). Comparisonof native and recombinant receptors cannot result in a perfectmatch due to the large number of different recombinant

a)

C

0)C.)C-a)ca.

A60

50

40

30

20

10

0

RS cells B60

50

40

30

20

10

Rl R2 R3 R40

FS cells

= flip

[ flopI

Rl R2 R3 R4

FIG. 4. Histograms of GluR1-4 flip/flop relative proportions inRS pyramidal neurons and FS nonpyramidal neurons. Mean relativeproportions of GluR1-4 subunits are shown for the 10 RS cells (A) and15 FS cells (B) listed in Table 2. GluR2 is the dominant subunit in theRS cells, whereas FS cells contain mainly GluRl. Average percentagesof flip and flop subunits are indicated by hatched and open bars,respectively. In RS cells, flip variants of all subunits are stronglydominant, whereas in FS cells flop variants of all subunits aredominant.

AMPA receptors that can be assembled and to posttransla-tional modifications.

In RS pyramidal neurons, we found mainly GluR2 flip(52%), together with 27% GluR3 flip, 13% GluRl flip, andsmall amounts of other subunits. The slow desensitization timeconstant we measured (13.5 ms; see also refs. 8 and 9) is closeto the range found for recombinant GluRl flip/GluR2 flip orGluR3 flip/GluR2 flip heteromers (4.9-10.7 ms; see refs.16-18). Furthermore, the significant steady state responseobserved in RS neurons (figure 3 in ref. 8; figure 1 in ref. 9)is also observed in GluR2 flip containing recombinant recep-tors (figure 3 in ref. 14; figure 2 in ref. 18). We found that layerII/III pyramidal cells express high levels of GluR2 (59%),previously shown to correlate with the low calcium perme-ability of AMPA receptors in layer V pyramidal neurons (9).

In FS nonpyramidal neurons, we have found 55% GluRlflop, 22% GluR2 flop, and 15% GluR3 flop and small amountsof other subunits. The desensitization time constant ofAMPAreceptors in FS nonpyramidal neurons (4.3 ms; see also refs.8 and 9) is in the range of those measured on recombinanthomomeric GluRl flop, GluR3 flop or heteromeric GluRl-flop/GluR2-flop, GluR3-flop/GluR2-flop (1.1-3.7 ms seerefs. 17 and 18). GluRl flop as the major constituent ofAMPAreceptors in FS nonpyramidal neurons is correlated with therelatively high calcium permeability observed in these cells (9).It can be hypothesized that the variable levels of GluR2 seenin the individual nonpyramidal cells (present study and refs. 9and 22) reflect regulation of the calcium permeability ofAMPA receptors in these cells. Low levels of GluR2 or of flipforms expressed in nonpyramidal neurons may also underliethe relatively large single-channel conductance found in theseneurons (8, 22, 28, 29).

In conclusion, native receptors and recombinant receptorshave similar subunit-dependent functional properties. We thussuggest that subunit composition and alternative splicing con-tribute to differences in desensitization existing among theseneurons.

Functional Implications. In both RS pyramidal and FSnonpyramidal cortical neurons the desensitization time con-stants of AMPA receptors are slower than the excitatorypostsynaptic current (EPSC) decay time constants (8) as foundat other excitatory synapses (refs. 30-32; reviewed in ref. 33).These findings suggest that glutamate is rapidly removed fromthe synaptic cleft (34) and that the EPSC kinetics reflectchannel closing rather than desensitization. However, whentransmitter release occurs at multiple sites or when diffusion

Neurobiology: Lambolez et al.

Dow

nloa

ded

by g

uest

on

Mar

ch 5

, 202

1

1802 Neurobiology: Lambolez et al.

barriers delay transmitter clearance, desensitization couldcontribute to the EPSC decay (35, 36).

Brief glutamate application, mimicking synaptic input, pro-duces significant desensitization and reduces the response to asecond application (8, 30, 37). The properties of AMPAreceptors in cortical neurons suggest that during repetitivefiring of presynaptic neurons desensitization could diminishpostsynaptic response preferentially in nonpyramidal neurons.Nevertheless, paired pulse excitatory postsynaptic potentialdepression in pyramidal cells and facilitation in nonpyramidalneurons have been observed (38, 39). The role of AMPAreceptor desensitization under these conditions has not beenstudied.Recent data suggest that single channel parameters can

contribute to response amplitude fluctuation at individualsynaptic sites (9,40-42). The contribution of desensitization toflop receptor response is significant from the beginning ofglutamate application in contrast to flip receptors (18). As aconsequence, the summation of individual flop receptor-channel responses has a lower probability of occurring thanthat for flip receptors. Therefore, it is expected that channelgating would contribute more significantly to quantal variancein FS nonpyramidal neurons than in RS pyramidal neurons. Inaddition, for a similar quantal conductance it is expected thatthe larger single channel conductance of AMPA receptors innonpyramidal neurons would further increase quantal vari-ance in these cells.

Conclusion. Taken together, our results suggest thatAMPAreceptor kinetics in cortical neurons is partly determined byflip/flop RNA splicing. In a similar study comparing other celltypes, Geiger et al. (43) correlate slow kinetics with theabundance of GluR2, mainly in its flip form, and fast kineticswith GluR4. In the present study, the abundance of GluR2(59%) or of GluR2 flip (52%) in layers II/III RS pyramidalcells also correlates with slow kinetics. However, the fastkinetics observed in layers I/II/III FS nonpyramidal cellscannot be explained by their GluR4 content (4%), which is lessthan in RS pyramidal cells (6%). It has been shown in aheterologous expression system that GluR2 in its flip formaffects the kinetics ofAMPA receptors even when it is not themajor subunit. Nonpyramidal neurons significantly expressGluR2; thus, it is likely that splice variants of GluR2 and othersubunits contribute to the faster kinetics displayed by AMPAreceptors in these cells.We conclude that specific subunit composition and alter-

native splicing contribute to functional differences amongnative AMPA receptors in cortical RS pyramidal and FSnonpyramidal neurons. Given that subunit composition regu-lates both calcium permeability and kinetics, the role offlip/flop splicing may be to allow regulation of AMPA recep-tor kinetics without a corresponding change in permeationproperties.

The authors wish to thank Jean Paul Bouillot for his assistance withphotography, G6rard Sadoc for the conception of the electrophysio-logical acquisition and analysis software, and Yves Daubenton for hishelp with the Phosphorlmager. This work was supported by NationalInstitutes of Health Grant EY09120 (S.H.), Human Frontier ScienceProgram Organization (RG 85-94), and the European Community(Grant BI02-CT-93-0243).

1.

2.3.

4.5.6.

McCormick, D. A., Connors, B. W., Lighthall, J. W. & Prince,D. A. (1985) J. Neurophysiol. 54, 782-806.Kawaguchi, Y. (1995) J. Neurosci. 15, 2638-2655.Fairen, A., DeFelipe, J. & Regidor, J. (1984) in Cerebral Cortex,eds. Peters, A. & Jones, E. G. (Plenum, New York), pp. 201-253.Baughman, R. W. & Gilbert, C. D. (1981)J. Neurosci. 1, 427-439.Fonnum, F. (1984) J. Neurochem. 42, 1-11.Nicoll, R. A., Malenka, R. C. & Kauer, J. A. (1990) Physiol. Rev.70, 513-565.

7. Petralia, R. S. & Wenthold, R. J. (1992) J. Comp. Neurol. 318,329-354.

8. Hestrin, S. (1993) Neuron 11, 1083-1091.9. Jonas, P., Racca, C., Sakmann, B., Seeburg, P. H. & Monyer, H.

(1994) Neuron 12, 1281-1289.10. Wisden, W. & Seeburg, P. H. (1993) Curr. Opin. Neurobiol. 3,

291-298.11. Hollmann, M. & Heinemann, S. (1994) Annu. Rev. Neurosci. 17,

31-108.12. Hollmann, M., Hartley, M. & Heinemann, S. (1991) Science 252,

851-853.13. Burnashev, N., Monyer, H., Seeburg, P. H. & Sakmann, B. (1992)

Neuron 8, 189-198.14. Sommer, B., Keinanen, K., Verdoorn, T. A., Wisden, W., Bur-

nashev, N., Herb, A., Kohler, M., Takagi, T., Sakmann, B. &Seeburg, P. H. (1990) Science 249, 1580-1585.

15. Sommer, B., Kohler, M., Sprengel, R. & Seeburg, P. H. (1991)Cell 67, 11-19.

16. Lomeli, H., Mosbacher, J., Melcher, T., Hoger, T., Geiger,J. R. P., Kuner, T., Monyer, H., Higuchi, M., Bach, A. & Seeburg,P. H. (1994) Science 266, 1709-1713.

17. Partin, K. M., Patneau, D. K. & Mayer, M. L. (1994) Mol.Pharmacol. 46, 129-138.

18. Mosbacher, J., Schoepfer, R., Monyer, H., Burnashev, N., See-burg, P. H. & Ruppersberg, J. P. (1994) Science 266, 1059-1062.

19. Martin, L. J., Blackstone, C. D., Levey, A. I., Huganir, R. L. &Price, D. L. (1993) Neuroscience 53, 327-358.

20. Vickers, J. C., Huntley, G. W., Edwards, A. M., Moran, T.,Rogers, S. W., Heinemann, S. F. & Morrison, J. H. (1993) J.Neurosci. 13, 2982-2992.

21. Lambolez, B., Audinat, E., Bochet, P., Crepel, F. & Rossier, J.(1992) Neuron 9, 247-258.

22. Bochet, P., Audinat, E., Lambolez, B., Crepel, F., Rossier, J.,Iino, M., Tsuzuki, K. & Ozawa, S. (1994) Neuron 12, 383-388.

23. Edwards, F. A., Konnerth, A., Sakmann, B. & Takahashi, T.(1989) Pflugers Arch. 414, 600-612.

24. Franke, C., Hatt, H. & Dudel, J. (1987) Neurosci. Lett. 77,199-204.

25. Lambolez, B., Curutchet, P., Stinnakre, J., Bregestovski, P.,Rossier, J. & Prado de Carvalho, L. (1991) Neurosci. Lett. 118,69-72.

26. Ramon y Cajal, S. (1995) Histology of the Nervous System ofManand Vertebrates (Oxford Univ. Press, New York).

27. Gabbot, P. L.A. & Somogyi, P. (1986) Exp. Brain Res. 61,323-331.

28. Ozawa, S., Iino, M. & Tsuzuki, K. (1991) J. Neurophysiol. 66,2-11.

29. Livsey, C. T., Costa, E. & Vicini, S. (1993) J. Neurosci. 13,5324-5333.

30. Colquhoun, D., Jonas, P. & Sakmann, B. (1992) J. Physiol. 458,261-287.

31. Raman, I. M., Zhang, S. & Trussell, L. 0. (1994) J. Neurosci. 14,4998-5010.

32. Silver, R. A., Colquhoun, D., Cull-Candy, S. G. & Edmonds, B.(1994) J. Physiol. 476P, 67P.

33. Jonas, P. & Spruston, N. (1994) Curr. Opin. Neurobiol. 4,366-372.

34. Clements, J. D., Lester, R. A. J., Tong, G., Jahr, C. E. & West-brook, G. L. (1992) Science 258, 1498-1501.

35. Trussell, L. O., Zhang, S. & Raman, I. M. (1993) Neuron 10,1185-1196.

36. Barbour, B., Keller, B. U., Llano, I. & Marty, A. (1994) Neuron12, 1331-1343.

37. Hestrin, S. (1992) Neuron 9, 991-999.38. Thomson, A. M. & West, D. C. (1993) Neuroscience 54,329-346.39. Thomson, A. M., Deuchars, J. & West, D. C. (1993) Neuroscience

54, 347-360.40. Faber, D. S., Young, W. S., Legendre, P. & Korn, H. (1992)

Science 258, 1494-1498.41. Jonas, P., Major, G. & Sakmann, B. (1993) J. Physiol. 472,

615-663.42. Kullmann, D. M. (1993) Proc. R. Soc. London B 253, 107-116.43. Geiger, J. R. P., Melcher, T., Koh, D. S., Sakmann, B., Seeburg,

P. H., Jonas, P. & Monyer, H. (1995) Neuron 15, 193-204.

Proc. Natl. Acad. Sci. USA 93 (1996)

Dow

nloa

ded

by g

uest

on

Mar

ch 5

, 202

1