cut-1-like genes are present in the filarial nematodes, Brugia pahangi and Brugia malayi, and, as in other nematodes, code for components of the cuticle

Molecular and Biochemical Parasitology 101 (1999) 173–183

cut-1-like genes are present in the filarial nematodes, Brugiapahangi and Brugia malayi, and, as in other nematodes, code

for components of the cuticle�

Emma Lewis a, Sarah J. Hunter a, Laurence Tetley b, Claudia Pavia Nunes c,Paolo Bazzicalupo c, Eileen Devaney *

a Department of Veterinary Parasitology, Uni6ersity of Glasgow, Bearsden Road, Glasgow G61 1QH, UKb Integrated Microscopy Facility, Di6ision of Infection and Immunity, Joseph Black Building, Uni6ersity of Glasgow, Glasgow, UK

c International Institute of Genetics and Biophysics, CNR, 6ia Guglielmo Marconi 10, 80125 Naples, Italy

Received 7 December 1998; received in revised form 9 March 1999; accepted 22 March 1999

Abstract

A fragment of a cut-1 like gene from the filarial nematode Brugia pahangi (designated Bp-cut-1) was isolated byPCR from genomic DNA. The sequence was used to design primers for use in RT-PCR and resulted in the isolationof a cDNA fragment from larvae in the process of the L3–L4 moult. Screening of a B. malayi genomic libraryidentified a single clone, Bm-cut-1. Using primers designed from the Brugia sequences, semi-quantitative RT-PCR wascarried out on 11 different life cycle stages chosen to cover periods around the moult and inter-moult periods. Thisanalysis demonstrated that the cut-1 mRNA was most abundant preceding the moult, consistent with its function asa cuticular protein. Immuno-gold electron microscopy using an affinity purified antiserum raised to the highlyconserved region of Ascaris CUT-1 confirmed that the protein was restricted to a tight band in the median layer ofthe cuticle. Despite the fact that no transcripts could be detected in mature adult worms by RT-PCR, immuno-goldmicroscopy revealed staining of the microfilarial cuticle within the uterus of the adult female worm, suggesting thatother cut-1-like genes are present in Brugia. © 1999 Elsevier Science B.V. All rights reserved.

Keywords: Filarial nematode; Cuticlin; Cuticle

Abbre6iations: p.i., post-infection; RT-PCR, reverse transcriptase polymerase chain reaction.� Note: Nucleotide sequence data reported in this paper are available in the EMBL, GenBank™ and DDJB databases under the

accession numbers AJ012617 and AJ012618.* Corresponding author. Tel.: +44-141-330-6925 (5751); fax: +44-141-330-5603.E-mail address: [email protected] (E. Devaney)

0166-6851/99/$ - see front matter © 1999 Elsevier Science B.V. All rights reserved.

PII: S 0166 -6851 (99 )00070 -5

E. Lewis et al. / Molecular and Biochemical Parasitology 101 (1999) 173–183174

1. Introduction

The cuticlins are a family of proteins whichform the major insoluble residue of the nematodecuticle. Cuticlin was originally described by Fuji-moto and Kanaya [1] working with the parasiticnematode, Ascaris lumbricoides, as the insolubleresidue remaining after extensive solubilization ofthe cuticle in SDS and reducing agents. Sincethen, several other workers have reported similarcuticlin-like residues in other nematodes [2], butthe analysis of cuticlin has been complicated by itsinsoluble nature and by the fact that it comprisesa number of different proteins. The genes encod-ing two cuticlin-like proteins were serendipitouslyisolated from the free-living nematode Caenorhab-ditis elegans by screening a genomic DNA librarywith a 138 bp fragment coding for a region con-served between three vitelline membrane genes ofDrosophila melanogaster [3]. These cuticlin genes,the first to be described, were named cut-1 andcut-2 [4,5].

cut-1 encodes a secreted protein of 423 aminoacids which is specifically expressed in the dauerlarva of C. elegans where it is found in a ribbonlying beneath the alae [4,6]. In contrast cut-2 canbe detected in all life cycle stages of C. elegans,although its transcription is discontinuous, occur-ring prior to the moult, consistent with its local-ization to the cuticle [5]. CUT-2 contains anumber of repeats which are also found in struc-tural proteins of the cuticles or egg shells ofvarious insects. Both CUT-1 and CUT-2 are in-soluble once assembled in the cuticle and CUT-2can be cross-linked in vitro in a reaction catalysedby peroxidase which results in the formation ofdityrosine cross-linkages. The C. elegans Sequenc-ing Consortium has identified several genes whichshare homology to cut-1. Amongst these, the onewith strongest similarity to cut-1 is F22B5.3 (ac-cession no. Z50044) which we have named cut-3[7].

Since the isolation of the cuticlin genes in C.elegans, cut-1 like genes have been identified inthe plant parasitic nematode, Meloidogyneartiella, Ma-cut-1 [8], and in the human parasite,A. lumbricoides, As-cut-1 [7]. Each of these genescontains a region of 262 amino acids of high

homology, referred to as the CUT-homology re-gion. The cuticlin genes in filarial nematodes haveproved particularly elusive, despite the fact thatthe cuticle of these nematodes clearly contains aninsoluble residue similar to the cuticlin residues ofother nematodes [9,10]. Filarial nematodes have acomplex life cycle involving both a mosquito vec-tor and the mammalian definitive host. In theseorganisms, the cuticle is adapted for the trans-cu-ticular uptake of nutrients [11], and has a lessrobust appearance than the cuticle in Ascaris spe-cies, for example [12]. In this paper we describethe cloning and characterisation of a cut-1 likecDNA fragment from the filarial nematode Brugiapahangi and homologues from B. malayi.

2. Materials and methods

2.1. Parasites

The parasite life cycle was maintained usingstandard methods [13] by cyclical passage throughmosquitoes (Aedes aegypti, Refm) and jirds (Meri-ones unguiculatus). Jirds were infected by the in-traperitoneal route with third stage larvae (L3)harvested from mosquitoes. At varying timespost-infection (p.i., defined in the text), parasiteswere recovered from the peritoneal cavity, washedextensively in Hank’s Balanced Salt Solution andfrozen in liquid nitrogen until required.

2.2. PCR on B. pahangi genomic DNA

Genomic DNA was isolated from approxi-mately 200 adult B. pahangi using standard meth-ods as described previously [14]. PCR was carriedout on 5 ng of genomic DNA using primers2AB5EXT (GATGGAGGACCAAGTGGG-CAG) and 2A3 MED (CATGTGCTTCTTG-GCCAGCC) designed from the cut-1 sequence ofA. lumbricoides [7]; these primers correspond re-spectively to aa 157–163 (DGGPSGQ) and to aa230–236 (MAGQEAH) of As-CUT-1.

PCR conditions were as follows: 95°C for 5 minfollowed by 30 cycles at 94°C for 1 min, 50°C for1 min, 72°C for 1 min with a final extension of

E. Lewis et al. / Molecular and Biochemical Parasitology 101 (1999) 173–183 175

72°C for 10 min. The resulting products weregel-purified, ligated into the TA vector pCRII(Invitrogen) and used to transform DH5a com-petent cells. Resulting colonies were screened byhybridization using 32P-labelled A. lumbricoidescut-1 as the probe. Inserts were sequenced onboth strands using the SequiTherm™ Long-ReadCycle Sequencing Kit (Cambio) and fluorescently-labelled T3 and T7 primers on an automatedsequencer (Li-cor).

2.3. Isolation of RNA and RT-PCR

RT-PCR was carried out on RNA isolatedfrom various life cycle stages of B. pahangi toobtain cDNA corresponding to the genomic PCRfragment. Parasites were recovered from infectedjirds at the following time points: days 3, 5, 7, 15,16 p.i., representing post-infective L3 and L4stages, day 28 p.i. (juvenile adults) and 3 monthsp.i., at which point the worms are sexually ma-ture. RNA was prepared using TriZol™ accord-ing to the manufacturer’s instructions (LifeTechnologies). Genomic DNA was removed fromthe RNA sample by treatment with DNaseI (LifeTechnologies). First strand cDNA was reversetranscribed from each RNA sample with 200 ngof oligo d(T) using SuperScript™II according tothe manufacturer’s recommendations (Life Tech-nologies). The resultant first strand cDNAs werestored at −20°C until required. Amplification byPCR was performed on 2 ml of 1in 20 dilution offirst strand cDNA using a variety of primersincluding the nematode SL1 primer and an oligo(dT) primer [15] in combination with Brugia-spe-cific primers based on the sequence of the ge-nomic PCR fragment or with a variety of primersbased on the A. lumbricoides sequence. The onlyprimer sets to give a reproducible product were aBrugia specific 5% primer (BR5/3): GATTCC-GAAACCGTTGATACCTTTTGCGC and theAscaris cut-1 3% primer described above(2A3MED).

2.4. Screening libraries to isolate cut-1 clones

A B. malayi genomic library in lgt11 (averageinsert size of 1.3kb) kindly provided by Dr F.

Perler, New England BioLabs, and a B. pahangicDNA library constructed from RNA isolatedfrom day 3 p.i. L3 and prepared by RT-PCRusing SL-1 and oligo d(T) [15] were screened withthe 32P-labelled B. pahangi cut-1 genomic DNAfragment. Each library was plated out andscreened in duplicate by hybridization at highstringency (65°C, washed to 0.2×SSC, 0.1%SDS). Positive plaques were taken through tosecondary and tertiary screens using standardmethods [16]. At each stage positive plaques werechecked for cuticlin identity by PCR amplificationusing cut-1 specific primers.

2.5. Semi-quantitati6e RT-PCR

Semi-quantitative RT-PCR was carried out inorder to determine the time points at which thecut-1 mRNA was expressed during the Brugia lifecycle. Expression levels were compared to a con-stitutive 60S ribosomal protein gene of B. pahangi(accession number X91066, Bp-rpp-1). TotalRNA was isolated from worms harvested fromthe jird at various time points post-infection (days3, 5, 7, 9, 12, 18, 19, 20, 21 and 28 p.i. and adultworms). These time points represent both themoult and inter-moult periods (see Section 3 fordetails). RNA from each sample was quantifiedby analysis on ethidium bromide stained gels.First strand cDNA was reverse transcribed fromeach RNA sample as described above. Amplifica-tion by PCR was performed on 2 ml of a 1 in 20dilution of first strand cDNA using Brugia-spe-cific cut-1 primers, BR5/2 (ACCATTGGC-CAACCAGTTTATCACAAATGG) and 2A3-MED (CATGTGCTTCTTGGCCAGCC) de-signed to span an intron, so that amplified cDNA(180 bp) could be distinguished from contaminat-ing genomic DNA (330 bp). The ribosomalprotein primers NR3 (GAGGAACAAGAA-GAAGGAAGAGCC) and R1 (GCATTGTTCT-CAAATAGAGC) were also designed to span anintron (cDNA 370 bp, genomic DNA 580bp) [17].

Preliminary experiments were carried out todefine PCR conditions in which the reagents werenot limiting. The conditions selected for the semi-quantitative RT-PCR were as follows: 95°C for 5min followed by 23 cycles at 94°C for 1 min, 55°C


for 1 min, 72°C for 3 min with a final extension of72°C for 10 min. PCR products were analysed on2% agarose gels, Southern blotted, and probedwith radiolabelled cDNA fragments correspond-ing to Bp-cut-1 or to the cDNA for the ribosomalprotein. After autoradiography, bands corre-sponding to amplified cDNA products were cutout of the membrane and counted in scintillant.The relative abundance of the cut-1 transcript wasexpressed as a ratio of the signal to the ribosomalprotein mRNA [18].

2.6. Affinity purification of antiserum andimmunolocalisation

A fragment of the A. lumbricoides CUT-1protein was produced in E. coli as a recombinantprotein using vector pT7.7. The recombinantprotein, which corresponds to most of the thirdexon of As-CUT-1 (from aa 210 to 321) waspurified from inclusion bodies by electroelutionfrom the appropriate band after SDS-PAGE sep-aration, and used for immunization of a rabbit.Specific antibodies were affinity purified by bind-ing to an E. coli maltose binding protein fusionwith the same exon 3 fragment of As-CUT-1. Theaffinity purified antibodies were used in im-munolocalisation experiments with sections ofvarious life cycle stages of B. pahangi.

B. pahangi L3 (6 days p.i), adult parasites ormicrofilariae were processed for immuno-gold la-belling by fixation in freshly prepared 4% (w/v)p-formaldehyde, 0.1% glutaraldehyde in phos-phate-buffered saline (PBS), pH 7.4 at 4°C for 30min. Larvae were concentrated to a loose pelletand embedded in low temperature gelling agaroseat 37°C, then brought to 4°C. Parasites were coldprocessed through an increasing series of alcoholconcentrations (modified from Ref. [19]), theninfiltrated with increasing concentrations of LRresin and ethanol at −20°C, followed by 100%resin for 8 h at 20°C overnight. Parasites weretransferred to gelatine capsules in fresh resin andpolymerized at 20°C under 365nm indirect UVlight for 2 days. Ultrathin sections were collectedonto 300 mesh nickel grids and immunostainingwas performed essentially as described [20]. Sec-tions were blocked and conditioned using 0.2 M

glycine and 1% acetylated BSA (Aurion) in PBSfor 30 min each, followed by incubation for 30min in affinity purified antibody diluted 1:10 inPBS/1% acetylated BSA. Bound antibody wasdetected by incubation for 30 min in goat anti-rabbit antibody/10 nm gold conjugate (Aurion)diluted 1:10 in the same buffer. Sections werebriefly counterstained in 0.5% uranyl acetate andimages examined and recorded using a Zeiss 902EFTEM.

3. Results

3.1. Obtaining a genomic PCR fragment of B.pahangi cut-1

PCR on B. pahangi genomic DNA usingprimers designed from the A. lumbricoides se-quence resulted in the amplification of a 358 bpfragment (Bp-cut-1), which was confirmed to be aB. pahangi homologue of cut-1 by sequence analy-sis. The fragment is 74.7% identical to the corre-sponding Ascaris fragment and 71.3% identical tothe corresponding fragment of C. elegans cut-1.Virtually all the differences between the threefragments are in the third codon position and theamino acid similarities across this stretch of thethree nematode CUT-1 sequences are conse-quently very high (91% identity with A. lumbri-coides and 96% identity with C. elegans). TheBrugia gene contains a 150 bp intron which is notpresent in the other two nematode species.

3.2. Isolating a B. pahangi cDNA fragment

RT-PCR was carried out on RNA isolatedfrom a variety of life cycle stages using combina-tions of SL1, oligo (dT) and cuticlin primers. Theonly combination of primers to consistently yielda cDNA fragment were BR5/3 and 2A3MED onday 7 p.i. cDNA. A 150 bp fragment was am-plified, gel-purified and cloned into the TA vector.Sequence analysis confirmed that the cDNA andgenomic DNA fragments were identical. Attemptswere then made to obtain a larger fragment ofcDNA using various combinations of SL1, cut-1specific primers and oligo (dT) on cDNA pre-


pared from day 7 p.i. larvae. This approach failedto yield any additional cDNA sequence using allcombinations of primers.

3.3. Screening libraries to obtain additional cut-1sequence

In an attempt to obtain a longer fragment of acut-1 like gene, 2×105 plaques from the splicedleader B. pahangi day 3 p.i. L3 library [15] werescreened in duplicate with the 32P-labelled ge-nomic PCR fragment; no positive clones wereidentified from this library. A B. malayi genomiclibrary was then screened in duplicate with the32P-labelled genomic PCR fragment, from whichtwo positive clones were obtained. Sequence anal-ysis demonstrated that both clones were identical.These clones were 637 bp in length and coveredthe highly conserved region of cut-1 and defineBm-cut-1. Two introns were present in these

clones. The first intron, although not present inCe-cut-1 or cut-3, is present in Ma-cut-1 andAs-cut-1. The second intron is in the same posi-tion as that in the B. pahangi genomic PCRfragment but is absent from the other cut genes.The coding region of Bm-cut-1 corresponds tothat of Bp-cut-1 with a 97.5% identity in trans-lated amino acid sequence. Fig. 1 shows the align-ment of the translated amino acid sequences ofthe B. malayi and the B. pahangi genomic cloneswith A. lumbricoides cut-1. During the course ofthis work, three sequences with homology to cut-1were deposited in the B. malayi genome sequenc-ing data base (http://helios.bto.ed.ac.uk/mbx/fgn/filgen1.html). The conceptual translation of twoof these sequences, deriving from cDNA librariesfrom day 6 and day 9 p.i. L3, are named Bm-cut-2 (accession no. AA841200, ML Blaxter, unpub-lished) and Bm-cut-3 (accession no. AA585626,SA Williams, unpublished), and are also shown in

Fig. 1. Alignment of CUT-1 homologues from Brugia species and Ascaris. Alignment of the translated amino acid sequences of thecoding sequence of the B. malayi genomic clone (accession number AJ012617), the B. pahangi genomic clone (accession numberAJ012618), A. lumbricoides cut-1 (accession number U73005), and two of the cut-1-like sequences from the B. malayi genomesequencing project, Bm-cut-2, from the day 6 p.i. L3 library (accession number AA841200) and Bm-cut-3 from the day 9 p.i. L3library (accession number AA585626). Cysteine residues are shown in bold; arrows indicate the position of introns, where known;double arrow indicates the position of the Brugia-specific intron in both species.


Fig. 2. Expression pattern of B. pahangi cut-1 by RT-PCR at various stages throughout the life cycle. The graph shows the ratioof the expression of Bp-cut-1 mRNA to that of the Bp-rpp-1, expressed in arbitrary units on the y axis. RNA was isolated fromparasites at days 3, 5, 7, 9, 12, 18, 19, 20, 21, 28 p.i. and from adult worms, first strand cDNA synthesized and amplified usingprimers specific for Bp-cut-1 and Bp-rpp-1. PCR products were blotted and probed as described in Section 2, and hybridizing bandscut out and counted in a scintillation counter.

Fig. 1. The genomic Bm-cut-1 sequence overlapsfor only 48 bases with Bm-cut-2 and although thesequence is completely conserved at the aminoacid level, the presence of several third basechanges between the two indicates that the Bm-cut-2 cDNA corresponds to a different gene. TheBm-cut-3 clone does not overlap at all with theBm-cut-1 genomic sequence. Further sequence in-formation would be required to elucidate the rela-tionship between these two clones.

3.4. Semi-quantitati6e RT-PCR

The relative abundance of Bp-cut-1 transcriptsthroughout the mammalian stages of the parasitelife cycle was assessed in relation to that of aconstitutively expressed ribosomal protein gene[15,17]. This analysis was carried out at elevendifferent time points, chosen to cover both theperiods around a moult and the inter-moult peri-ods. The full time course was repeated on twoseparate occasions with reproducible results. Theresults presented in Fig. 2 show the abundance ofcut-1 transcripts relative to the Bp-rpp-1. Twopeaks of expression were observed, the first pre-ceding the L3–L4 moult at day 7 p.i. and thesecond, and larger peak, preceding the L4-adult

moult, at days 18–21 p.i.. In the case of B.pahangi in the jird [21] and in the cat [22], theL3–L4 moult is relatively well-synchronized, oc-curring for both male and female worms at be-tween 7 and 9 days p.i. of the mammalian host.The final L4-adult moult is less synchronous:males moult between 19 and 23 days p.i, whilstfemales moult between 25 and 30 days p.i. [21].By day 28 p.i., at which time all the worms arejuvenile adults, the relative abundance of Bp-cut-1mRNA was extremely low, and no signal wasobtained using Bp-cut-1 primers on adult cDNA.

3.5. Immunolocalization of Bp-CUT-1

The RT-PCR analysis demonstrated that Bp-cut-1 was maximally transcribed around the pe-riod of the moult, consistent with a proposedcuticular localization. To formally demonstratethat CUT-1 is a cuticular component in Brugia,the protein was localized using an affinity-purifiedantibody raised to the highly conserved region ofAs-CUT-1. This analysis clearly demonstratedthat CUT-1 epitopes were localised to the medianlayer of the cuticle. Fig. 3, panel a, shows a day 6p.i. larva in the process of the L3–L4 moult. Boththe old L3 cuticle (oc) and the highly folded new


cuticle (nc) of the L4 are clearly visible. The goldparticles are restricted to a defined band in the oldL3 cuticle while in the L4 cuticle, the gold islocalized to a layer beneath the folds of the newlysynthesized cuticle. The cells of the hypodermis(the presumed site of synthesis of most cuticularcomponents) are not stained at day 6 p.i., pre-sumably reflecting the precise temporal regulationof CUT-1 synthesis. The cuticle of the microfilar-iae is much thinner than in later larval stages, butlabelling of mature, peritoneal-derived microfilar-iae demonstrates a similar localization of CUT-1

epitopes to the inner layers of the cuticle (Fig. 3b),as in other larval stages. No labelling was ob-served in the microfilarial sheath (sh). Althoughall attempts to identify a cut-1 transcript in adultworms had proved fruitless, it was interesting tonote that the CUT-1 antiserum reacted with com-ponents in the cuticle of the microfilariae develop-ing in utero (Fig. 3c). This staining was onlyobserved with relatively mature microfilariae; em-bryos at earlier stages of development did notreact with the antibody. This result probably re-lates to the timing of cuticle deposition in the

Fig. 3. Immuno-electron micrographs showing the distribution of CUT-1 epitopes in B. pahangi at different stages of development.Panel a, day 6 p.i. larvae undergoing the L3–L4 moult; panel b, mature microfilaria derived from the peritoneal cavity of an infectedjird; panel c, immature microfilaria in utero; panel d, adult female and panel e, adult male. Worms were processed using the lowtemperature embedding protocol described in Section 2. Sections were stained with the affinity purified rabbit anti-ASCUT-1 at a1:10 dilution. The distribution of bound antibody was revealed using 10 nm anti-rabbit gold conjugate.


developing microfilariae. In adult females andmales, gold labelling was restricted to a discreteband in the median layer of the cuticle (Fig. 3dand e, respectively).

4. Discussion

In this paper, we report the isolation of anumber of fragments of cuticlin genes from Bru-gia species. However, a full length cDNA was notobtained, presumably reflecting the fact that Bp-cut-1 is discontinuously transcribed throughoutthe life cycle at a relatively low level. Althoughthe mRNA could be detected by RT-PCR inworms preparing to moult, attempts to obtain asignal on northern blots with poly (A+) RNAisolated from day 19 p.i. worms were not success-ful (data not shown), despite the fact that thecut-1 mRNA appeared to be relatively abundantin this life cycle stage by RT-PCR.

A further obstacle to obtaining the full lengthgene was the fact that Bp-cut-1 does not appearto be trans-spliced by SL-1. Numerous experi-ments using the SL-1 primer in combination withother primers on a variety of life cycle stagesfailed to reveal a product. In these experiments, apositive control (SL-1 and a 3% primer specific forB. pahangi cytidine deaminase cDNA [23]), wasused to confirm the competence of the cDNA as atemplate. Furthermore when the products of anSL-1/oligo (dT) PCR reaction were probed with32P-labelled B. pahangi cut-1 fragments, no hy-bridization was obtained. Attempts to isolate acDNA from SL-1 libraries were similarly unsuc-cessful. Trans-splicing is not conserved amongstthe cuticlin genes: while Ce-cut-1 is trans-spliced[4], Ce-cut-2 [5] and Ma-cut-1 [8] are not. ForAs-cut-1 the situation is more complex: althoughthe mRNA was originally found to be trans-spliced [7], in the life cycle stages in which tran-scription of the gene is maximal (L1-L2), themRNA is not trans-spliced (Timinouni, PaviaNunes and Bazzicalupo, unpublished).

The analysis of the steady state transcript pat-tern throughout the mammalian stages of theBrugia life cycle demonstrated peaks of abun-dance prior to each moult, with no signal de-

tectable in the adult parasite. The expression ofthe cut-1 mRNA is consistent with the expectedpattern for a cuticular component. In these exper-iments, the abundance of cut-1 mRNA was ex-pressed relative to Bp-rpp-1, which has beenextensively characterised in this laboratory and isknown to be expressed in all life cycle stagesexamined to date [17,23]. The results of the RT-PCR analysis do not give an absolute measure ofthe abundance of cut-1 mRNA, but rather give arelative abundance with respect to a constitutivelyexpressed mRNA.

Previous ultrastructural studies on the timing ofthe L3–L4 moult in B. pahangi demonstrated thatthe new cuticle was first observed at days 5–6 p.i.,with some larvae having completed the moult asearly as day 6 while others were still in the processof moulting [21]. Maximal signals in the RT-PCRanalysis were obtained with parasites at day 7 p.i.and at days 18–21 p.i.. It is interesting to notethat two of the three cut-1-like sequences in theB. malayi genome sequencing project are fromparasites in the process of undergoing the L3–L4moult. The fact that the transcript abundancepeaks at the onset of the L4-adult moult supportsthe idea of a tight regulation between transcrip-tion and translation of the Bp-cut-1 gene, and itsincorporation into the newly-synthesised adult cu-ticle. The greater abundance of the transcript atthe later moult is likely a reflection of the need forthe adult cuticle to be thicker and more resistantthan the larval cuticles. The adult worms can livestably in the mammalian host for up to 5 years[24], at least in part due to the properties of thecuticle. In numerous experiments, no signal wasever obtained from adult cDNA by RT-PCR. Asthe cuticle has already been assembled, it is per-haps not unexpected that Bp-cut-1 transcriptscannot be detected in the adult worm cDNA.However, the longevity of the adult worms wouldimply that there might be at least minimalturnover of the cuticular proteins during their lifespan. Presumably this occurs at such a low ratethat it cannot be detected by the RT-PCR methoddescribed here. Previous studies on the growth ofB. pahangi during the L3 to L4 inter-moult periodsuggested that the increase in length of the wormwas achieved without an increase in surface area


of the worm, i.e. by a gradual unfolding of thehighly folded new cuticle [21]

Similar results have been reported for the syn-thesis of cuticular collagens in the adult B.malayi. Selkirk et al. [25] showed that maximalsynthesis of cuticular collagens occurred in theinter-moult period with extremely low levels ofsynthesis in adult male worms. Continued colla-gen synthesis in adult female worms (as detectedby the uptake of 3H glycine) was thought toreflect synthesis of the microfilarial cuticle. Anal-ysis of the transcription pattern of cut-1 mR-NAs in other nematodes demonstrates that mostof these homologues are transcribed to coincidewith cuticle synthesis. For example, in C. ele-gans, cut-2 was shown to be transcribed justbefore the L1–L2 moult [5], while in M. artiella,the cut-1 homologue is transcribed at high levelsin the egg, at the L1–L2 moult, and at lowerlevels in the (infective) J2 larvae and in theadult male, while no signal is detected in theadult female [26]. The cut-1 gene of C. elegansis expressed only in the dauer larvae [4] support-ing the hypothesis that the role of the productencoded by cut-1 is to contribute to the resis-tance and durability of the nematode cuticle. InA. lumbricoides, CUT-1 protein is made withinthe egg, at the time of the L1–L2 moult, whenthe L2 cuticle is being synthesised [27]. As is thecase for the J2 stage in Meloidogyne, the L2 inthe egg is the infective stage of Ascaris, and thestage which must pass outside the vertebratehost.

The immunolocalization of CUT-1 epitopes inB. pahangi confirmed its cuticular localization inthe life cycle stages examined. In day 6 p.i. L3and adult parasites the labelling was restrictedto a tight band in the median layer of the cuti-cle, with little or no label in other parts of thecuticle. There was no evidence in any life cyclestage of labelling at the worm surface suggestingthat cuticlin is not surface exposed.

Microfilariae developing in the uterus of theadult female worm also expressed epitopesrecognised by the antibody, despite the fact thatRT-PCR failed to amplify a transcript fromadult worms. This implies that, as in C. elegans,there may be at least one other cut-1 like gene

in the Brugia genome, perhaps specific to theembryonic stages, whose product cross-reactswith the anti-CUT-1 antibodies, but which isnot sufficiently homologous to Bp-cut-1 to bedetected in screens based on nucleic acid homol-ogy. Southern blot analysis of B. pahangi ge-nomic DNA with cut-1 probes suggests that thecuticlins constitute a small multi-gene family inB. pahangi (data not shown). Furthermore, theB. malayi genome sequencing project containsthree sequences showing significant homology tothe cuticlins (SA Williams, unpublished and MLBlaxter, unpublished [28]) and which may be-long to different genes. Two are expressed in theL3 around the time of the L3–L4 moult, andare reported in Fig. 1. The third sequence,which derives from an adult female library, mayrepresent the embryonic homologue of cut-1. Inaddition, the Onchocerca 6ol6ulus database con-tains \25 cDNA clones showing good homol-ogy to cut-1 and corresponding to at least twogenes.

The expression of CUT-1 by the developingmicrofilariae appeared to be temporally regu-lated, as no labelling was observed in immaturemicrofilariae at the distal ends of the uterus.However, as the microfilariae mature, and beginto synthesise the cuticle, CUT-1 labelling wasobserved. Both CUT-1 and CUT-2 from C. ele-gans contain repeat sequences, which were alsofound in a microfilarial sheath protein, shp2,from Brugia spp and Litomosoides carinii [29].The antiserum used in the present study wasraised against a fragment of As-CUT-1 whichdoes not contain this repeat region, and in ourimmuno-localisation experiments, labelling of themicrofilariae was restricted to the cuticle andwas not observed in the sheath.

In conclusion, we have described a number ofcuticlin gene fragments from the filarial ne-matode Brugia which encode cut-1 like genes.The pattern of transcription of the B. pahangimRNA was consistent with a cuticular localisa-tion, and this was confirmed by immunogoldelectron microscopy. Further studies are re-quired to obtain a full length cDNA and toidentify other members of the cuticlin gene fam-ily in filarial nematodes.


Acknowledgements

This study was supported by a grant from theEEC program STD-3, contract CT92-0096-I, andby a grant from the Leverhulme Trust. ED wassupported by a Wellcome University Award dur-ing the course of this work. We would like tothank the following: Dr Joyce Moore for helpfuldiscussions, Dr Iain Johnstone for advice on theRT-PCR, Dr Fiona Thompson for help with se-quence analysis, Margaret Mullin and ColinChapman for excellent technical assistance andDr Francine Perler, New England BioLabs forprovision of the B. malayi genomic library.

References

[1] Fujimoto D, Kanaya S. Cuticlin: a non-collagen struc-tural protein from Ascaris cuticle. Biochem Biophys1973;157:1–6.

[2] Betschart B, Marti S, Glaser M. Antibodies against thecuticlin of Ascaris suum cross-react with epicuticularstructures of filarial parasites. Acta Trop 1990;47:255–68.

[3] Gigliotti S, Graziani F, De Ponti L, Rafti F, Manzi A,Lavorgna G, Gargiulo G, Malva C. Sex-, tissue- andstage-specific expression of a vitelline membrane proteingene from region 32 of the second chromosome ofDrosphila melanogaster. Dev Genet 1988;10:33–41.

[4] Sebastiano M, Lassandro F, Bazzicalupo P. cut-1 a C.elegans gene coding for a dauer-specific non-collagenouscomponent of the cuticle. Dev Biol 1991;146:519–30.

[5] Lassandro F, Sebastiano M, Zei F, Bazzicalupo P. Therole of dityrosine formation in the cross-linking of cut-2, the product of a second cuticlin gene of C. elegans.Mol Biochem Parasitol 1994;65:147–59.

[6] Ristoratore F, Cermola M, Nola M, Bazzicalupo P, Fa-vre R. Ultrastructural immunolocalization of cut-1 andcut-2 antigenic sites in the cuticles of the nematode C.elegans. Submicrosc Cytol Pathol 1994;26:437–43.

[7] Timinouni M, Bazzicalupo P. cut-1-like genes of As-caris lumbricoides. Gene 1997;193:81–7.

[8] De Luca F, De Giorgi C, Lamberti F. Cuticlin geneorganization in Meloidogyne artiella. In: Lamberti F,De Giorgi C, Bird DM, editors. Advances in MolecularPlant Nematology. New York: Plenum Press, 1997:85–9.

[9] Betschart B, Rudin W, Weiss N. The isolation and im-munogenicity of the cuticle of Dipetalonema 6iteae (Fi-larioidea). Zeits fur Parasit 1985;71:87–95.

[10] Devaney E, Betschart B, Rudin W. The analysis of the30 kDa antigen of Brugia pahangi and its interactionwith the cuticle: a short review. Acta Trop

1990;47:365–72.[11] Howells R, Chen C. Brugia pahangi : feeding and nutri-

ent up-take in vitro and in vivo. Exp Parasitol1981;51:42–8.

[12] Rogers R, Denham DA, Nelson GS. Studies with Bru-gia pahangi 5. Structure of the cuticle. J Helminthol1974;48:113–7.

[13] Devaney E, Jecock RM. The expression of the Mr

30000 antigen in the third stage larvae of Brugia pa-hangi. Parasit Immunol 1991;13:75–87.

[14] Thompson FJ, Martin SAM, Devaney E. Brugia pa-hangi : Characterisation of a small heat shock proteincDNA clone. Exp Parasitol 1996;83:259–66.

[15] Martin SAM, Thompson FJ, Devaney E. The construc-tion of spliced-leader cDNA libraries from the filarialnematode B. pahangi. Mol Biochem Parasitol1995;70:241–5.

[16] Sambrook J, Frisch EF, Manniatis R. MolecularCloning: A Laboratory Manual. Cold Spring Harbour:Cold Spring Harbour Laboratory Press, 1989.

[17] Hunter SJ, Martin SAM, Thompson FJ, Tetley L, De-vaney E. The isolation of differentially expressed cDNAclones from the filarial nematode Brugia pahangi. Para-sitology (in press).

[18] Johnstone IL, Barry JD. Temporal reiteration of a pre-cise gene expression pattern during nematode develop-ment. EMBO J 1996;15:3633–9.

[19] Bannister LH, Kent AP. In: Hyde JE, editor. Molecularparasitology protocols. Totowa, NJ: Hamana Press,1992.

[20] Griffiths G. Fine structure immunocytochemistry.Heidelberg: Springer Verlag, 1993.

[21] Howells RE, Blainey LJ. The moulting process and thephenomenon of intermoult growth in the filarial ne-matode Brugia pahangi. Parasitology 1983;87:493–505.

[22] Schacher JF. Developmental studies of B. pahangi inthe final host. J Parasitol 1962;48:692–706.

[23] Martin SAM, Hunter SJ, Thompson FJ, Devaney E.Stage-specific gene expression in the post-infective L3 ofthe filarial nematode, Brugia pahangi. Mol BiochemParasitol 1996;79:109–12.

[24] Vanamail P, Ramaiah KD, Das PK, Grenfell BT,Bundy DAP. Estimation of the fecund life-span ofWuchereria bancrofti in an endemic area. Trans R SocTrop Med Hyg 1996;90:119–21.

[25] Selkirk ME, Neilsen C, Kelly C, Partono F, Sayers G,Maizels RM. Identification, synthesis and immunogenic-ity of cuticular collagens from the filarial nematodes B.malayi and B. pahangi. Mol Biochem Parasitol1989;32:229–46.

[26] De Giorgi C, De Luca F, Di Vito M, Lamberti F.Modulation of expression at the level of splicing of cut-1 RNA in the infective second stage juvenile of theplant parasitic nematode Meloidogyne artiella. Mol GenGenetics 1997;253:589–98.


[27] Favre R, Cermola C, Pavia Nunes C, Hermann R, MullerM, Bazzicalupo P. Immuno-cross-reactivity of CUT-1and cuticlin epitopes between Ascaris lumbricoides,Caenorhabditis elegans and Heterohabditis. J Struct Biol1998;123:1–7.

[28] Blaxter ML, Raghavan R, Ghosh I, Guiliano D, Lu W,Williams SA, Slatko B, Scott AL. Genes expressed in

Brugia malayi infective third stage larvae. Mol BiochemParasitol 1996;77:77–93.

[29] Hirzmann J, Schnaufer A, Hintz M, Conraths F, Stirm S,Zahner H, Hobom G. Brugia spp and Litomosoidescarinii : Identification of a covalently cross-linked microfi-larial sheath matrix protein (shp2). Mol Biochem Para-sitol 1995;70:95–106.

.

Documents

cut-1-like genes are present in the filarial nematodes, Brugia pahangi and Brugia malayi, and, as in other nematodes, code for components of the cuticle