ORIGINAL ARTICLE

Cytogenetic comparison of heteromorphic and homomorphicsex chromosomes in Coccinia (Cucurbitaceae) points to sexchromosome turnover

Aretuza Sousa & Jörg Fuchs & Susanne S. Renner

Received: 11 January 2017 /Revised: 17 February 2017 /Accepted: 27 February 2017# Springer Science+Business Media Dordrecht 2017

Abstract Our understanding of the evolution of plantsex chromosomes is increasing rapidly due to high-throughput sequencing data and phylogenetic andmolecular-cytogenetic approaches that make it possibleto infer the evolutionary direction and steps leading fromhomomorphic to heteromorphic sex chromosomes. Here,we focus on four species of Coccinia, a genus of 25dioecious species, including Coccinia grandis, the spe-cies with the largest known plant Y chromosome. Basedon a phylogeny for the genus, we selected three speciesclose to C. grandis to test the distribution of eight repet-itive elements including two satellites, and several plastidand mitochondrial probes, that we had previously foundto have distinct accumulation patterns in the C. grandisgenome. Additionally, we determined C-values and per-formed immunostaining experiments with (peri-)centromere-specific antibodies on two species (for compar-ison with C. grandis). In spite of no microscopic chro-mosomal heteromorphism, single pairs of chromosomes

in male cells of all three species accumulate some of thevery same repeats that are enriched on the C. grandis Ychromosome, pointing to either old (previous) sex chro-mosomes or incipient (newly arising) ones, that is, to sexchromosome turnover. A 144-bp centromeric satelliterepeat (CgCent) that characterizes all C. grandis chro-mosomes except the Y is highly abundant in all centro-meric regions of the other species, indicating that thecentromeric sequence of the Y chromosome divergedvery recently.

Keywords Coccinia species . genome size . FISH .

histonemodification . repetitive DNA . plant sexchromosomes

AbbreviationsBAC Bacterial artificial chromosomeFISH Fluorescent in situ hybridizationPCR Polymerase chain reactionrDNA Ribosomal DNASDR Sex-determining region

Introduction

In flowering plants, morphologically distinct(heteromorphic) sex chromosomes are known from 19species in 4 families, while homomorphic sex chromo-somes are known from at least 20 species in 13 families,including both X/Yand Z/W systems (Ming et al. 2011;Charlesworth 2016). Their patchy phylogenetic

Chromosome ResDOI 10.1007/s10577-017-9555-y

Responsible Editor: Hans de Jong.

Electronic supplementary material The online version of thisarticle (doi:10.1007/s10577-017-9555-y) contains supplementarymaterial, which is available to authorized users.

A. Sousa (*) : S. S. Renner (*)Department of Biology, University of Munich (LMU),80638 Munich, Germanye-mail: aretuzasousa@gmail.come-mail: renner@lrz.uni-muenchen.de

J. FuchsLeibniz Institute of Plant Genetics and Crop Plant Research (IPK),Gatersleben, 06466 Stadt Seeland, Germany

distribution implies that most angiosperm sex chromo-some systems evolved independent of each other. Thefew systems for which densely sampled phylogenies areavailable further have shown that even species in thesame genus, such as Silene colpophylla and Silene otitis,which last shared a common ancestor 10–11 millionyears ago (Slancarova et al. 2013), have non-homologous sex chromosomes, the first in an XY sys-tem and the second in a ZW system (Mrackova et al.2008; Marais et al. 2011; Slancarova et al. 2013). Spe-cies with homomorphic sex chromosomes presumablyhave small sex-determining regions (SDRs), as inferredfor Vitis vinifera (Fechter et al. 2012; Picq et al. 2014),Populus trichocarpa and P. tremuloides (Geraldes et al.2015), Actinidia chinensis (Zhang et al. 2015), Caricapapaya (Wang et al. 2012; Lappin et al. 2015), andFragaria chiloensis (Tennessen et al. 2016). The sexchromosomes in these species may be between 18 and 2million years old (Wang et al. 2012; Picq et al. 2014;Geraldes et al. 2015; Lappin et al. 2015; Tennessen et al.2016), but most these estimates assume that the respec-tive sex chromosomes are as old as the genus or subge-nus to which the focal species belongs, which may be arisky assumption. The small SDRs of homomorphic sexchromosomes may result from occasional XY recombi-nation and from a high rate of turnover, meaning that sexchromosomes are replaced before they had time to de-cay (Tennessen et al. 2016). For example, the SDR ofP. trichocarpa sits on the subtelomeric region of chro-mosome 19 (Geraldes et al. 2015) and that ofP. tremuloides on the pericentromeric region of the samechromosome (Kersten et al. 2014), which suggestsrestructuring of the sex chromosomes in these closelyrelated species.

Most studies of homomorphic sex chromosomeshave focused on the construction of genetic maps insilico for the identification of X-Yor Z-W-linked homo-logues (Asparagus officinalis: Telgmann-Rauber et al.2007; Deng et al. 2012; Harkess et al. 2015; Sileneotites: Slancarova et al. 2013; A. chinensis: Fraseret al. 2009; Fragaria virginiana: Spigler et al. 2008;Tennessen et al. 2016; Populus hybrids: Yin et al. 2008;Pistacia vera: Kafkas et al. 2015). Such markers haverarely been tested in situ, except in homomorphic sexchromosomes of C. papaya (Zhang et al. 2008). Takingadvantage of 29 bacterial artificial chromosomes(BACs) developed to cover the papaya sex-determining region, Iovene et al. (2015) detected aminute heteromorphic region in pachytene meiotic

chromosomes of the distant papaya relativeVasconcellea parviflora, while some of the same BACsapplied in Jacaratia spinosa, another distant relative ofpapaya, were located at regions showing perfect pairingat the pachytene stage without any loop or sign ofheteromorphism.

Here, we analyze whether any Coccinia grandis Ychromosome-enriched sequences can be used to identify(potential) homomorphic sex chromosomes in its closerelatives. In C. grandis, the accumulation of repetitiveelements (as well as plastid and mitochondrial DNA) onthe Y chromosome causes a male/female difference of100 Mbp/2C (Sousa et al. 2013), which raises the ques-tion if the same elements are already abundant in relatedspecies (Piednoel et al. 2012). To date, there are noexperimental or other studies on the sex determinationsystem in any of the species of Coccinia other thanC. grandis. The latter species is native to tropical Africaand India and a member of a small, entirely dioeciousCucurbitaceae genus of 25 species (Holstein and Renner2011; Holstein 2015). So far, C. grandis is the onlyspecies in the genus known to have heteromorphic sexchromosomes. The Y chromosome is so large that themale C. grandis genome is 10% larger than the female(Sousa et al. 2013). The sex chromosomes ofC. grandisare about 3 Ma old (Holstein and Renner 2011) and areunusual among flowering plant sex chromosomes in theY being heterochromatic (Sousa et al. 2013, 2016).Using a phylogeny that includes most of the 25 speciesof Coccinia, we selected C. hirtella, C. sessilifolia, andC. trilobata as closely related to C. grandis and thenapplied molecular cytogenetic methods, as well as C-value comparisons of male and female genomes. Thequestions that we wanted to answer were as fol-lows: (i) what is the extent of variation in chro-mosome numbers and/or genome sizes amongclose relatives of C. grandis? (ii) Are potentialchromosome number deviations accompanied byvariations in the number of ribosomal DNA(rDNA) loci or the presence of interstitialtelomeric sequences? (iii) Do any chromosomepairs differentially accumulate repeats (a questionfor which we focused on those repeats accumulat-ed on the heteromorphic sex chromosomes ofC. grandis) or have an extended centromere-specific histone marker accumulation, as found inthe C. grandis Y chromosome? And (iv) is the144-bp-long centromere satellite that in C. grandishybridizes to the centromeres of all chromosomes

Sousa A. et al.

except the Y also detectable in other species ofCoccinia? Rapid divergence of sex chromosomecentromeres is known from primates in which theX chromosomes of closely related species candiffer in just their centromeric position (Venturaet al. 2001).

Materials and methods

Plant material

Tubers of C. hir te l la , C. sess i l i fo l ia , andC. trilobata, all of them dioecious climbers, werecollected by N. Holstein in Northeastern Tanzania,Africa, in 2009. In Munich, we are cultivating theseplants in the greenhouses of the Botanical Garden,and vouchers have been deposited in the herbariumof Munich (official acronym M; for voucher list, seeHolstein (2015; his Table 2)). Pistillate or staminateflowers were used to identify female or male plants.

FISH probes and conditions

Arabidopsis-type telomeres and 5S and 45S rDNA siteswere visualized according to Sousa et al. (2013), withthe addition of an ethanol series of 70-90-100%, 2 mineach, after the final washes. To analyze the distributionof repetitive and organellar DNA, we relied on a seriesof probes specific for C. grandis (Sousa et al. 2016).Purified PCR products were labeled with digoxigenin-11-dUTP (Roche) by nick translation. We also designeda probe for a likely homeologous chromosome pair inC. hirtella, C. sessilifolia, C. trilobata, and C. grandis,which we named Coccinia autosome 1 (CocA1,KY402258). This probe was obtained after observationof the hybridization signals of the satellite CL97, whichin C. grandis labeled the Y chromosome along itslength as well as the subterminal region of one chro-mosome pair and the pericentromeric regions of allchromosomes. In male nuclei of the other three spe-cies, CL97 always labeled only one chromosome pair.After sequencing PCR products of CL97 of C. grandisand C. sessilifolia males, we detected 82% identityamong sequences and developed primers (R:GGTGGAAGGTCGGAATGAAG; F: TGCTTGGGCGAGAGTAGTAC) to amplify the region of themonomer shared among these species. These primersand DNA of C. sessilifolia males were used to

generate CocA1, and its purified PCR product waslabeled with digoxigenin-11-dUTP (Roche) by nicktranslation. Fluorescence in situ hybridization, imagecapture, and editing were performed as Sousa et al.(2016).

Chromosome preparation for FISH

Root tips of C. hirtella and C. sessilifolia were collectedfrom potted plants and pretreated in 70 ppm of cyclo-heximide (Roth) in 2 mM 8-hydroxyquinoline for 5 h at18 °C to obtain higher numbers of metaphase cells(Tlaskal 1980). Root tips were fixed in freshly prepared3:1 (v/v) ethanol/glacial acetic acid at room temperaturefor 2 h, transferred to 70% ethanol, kept at room tem-perature overnight, and afterwards stored at −20 °C untiluse. Cell suspensions for dropping were obtained fol-lowing the protocol of Aliyeva-Schnorr et al. (2015)with minor modifications as in the study by Sousaet al. (2016). To make meiotic slides of C. trilobata,we used the squashing technique as described in Sousaet al. (2013).

Immunofluorescence

Immunostaining experiments were carried out onC. hirtella and C. sessilifolia. Root tips were pretreatedas previously described, followed by steps of fixation inparaformaldehyde, enzymatic digestion, and washes asin the study by Sousa et al. (2016). The followingpr imary ant ibodies were used: rabbi t ant i -phosphorylated histone H2AThr120 (diluted 1:150)and monoclonal mouse anti-phosphorylated H3Ser10(diluted 1: 500, Abcam). Cy3-conjugated anti-rabbitIgG (Dianova) and FITC-conjugated anti-mouse IgG(Dianova) were used as secondary antibodies (Houbenet al. 1999; Demidov et al. 2014). Finally, preparationswere counterstained with 4 ′ ,6-diamidino-2-phenylindole hydrochloride (DAPI) mounted inVectashield (Vector).

Genome size measurement

Nuclei were isolated from young leaves of one male andthree female individuals of C. sessilifolia, two maleindividuals of C. hirtella, and one male of C. trilobataand flow cytometrically measured as described by Sou-sa et al. (2013). Each individual was measured at leastfour times using Glycine max, cv. Cina 5202 ‘Voran’

Heteromorphic and homomorphic sex chromosomes

(IPK genebank accession number SOJA 392;2C = 2.23 pg; Borchert et al. 2007) as internal referencestandard. The absolute DNA amounts were calculatedbased on the values of the G1 peak means.

Results

Cytology, genome sizes, telomeres, rDNA, repetitiveDNA, and centromere immunostaining

The chromosome numbers of C. hirtella andC. sessilifolia are 2n = 24 (confirming lightmicroscopy counts of Holstein 2015) and that ofC. trilobata is 2n = 20 (Table 1). Of the remainingspecies so far counted, Coccinia grandiflora has2n = 24 and Coccinia rehmannii 2n = 20 (Holstein2015). Genome sizes are shown in Table 1; the specieswith the lowest chromosome number, C. trilobata, hasthe largest genome (1.263 pg/2C). Telomere signalsare restricted to chromosome ends (Fig. S1a, d, g, j),and the presence of only one 5S locus, located at thesubterminal region of a chromosome pair, is conservedamong species (Fig. S1b, e, h, k). Coccinia hirtellaand C. sessilifolia each have three loci of 45S rDNA(Fig. S1c, f, i), while C. grandis and C. trilobata eachhave two (Fig. S1l).

As seen in the molecular phylogeny (from Holsteinand Renner 2011; our Fig. S2), C. hirtella andC. sessilifolia are closest to each other, followed byC. grandis, with C. trilobata sister to all three. Fromprobes developed for C. grandis based on high-throughput sequence data (Sousa et al. 2016), we

selected eight repetitive sequences including two satel-lites and several plastid and mitochondrial probes (nextsection) for the experiments presented here. Seven of theeight repeats were previously found to accumulate onthe Y chromosome and the last one at the centromeres inC. grandis (Sousa et al. 2016).

The Ty3/Gypsy/Athila element CL9 in C. grandisaccumulates on both arms of the Y (Fig. 1i, m). InC. trilobata, this element has subtelomeric positions,but one chromosome pair in male cells of C. hirtelladistinctly accumulates CL9 (Fig. 1e, arrows; Table 2).The Ty1/Copia/Angela element CL10 in C. grandis pro-vides a marker for the identification of the Y chromatindomain in interphase nuclei (Fig. 1j), while in the otherthree species, it is distributed mostly pericentromerically(Fig. 1b, f, b; also Figs. S1f and S3b for C. grandis). TheTy3/Gypsy/Ogre/Tat element CL19 is scattered on allchromosomes (Fig. 1c, g, o; Fig. S3c, g for C. grandis).Signals of a long interspersed nuclear element (LINE)CL44 are mostly restricted to the pericentromeric regions(Fig. 1d, h, p; Fig. S1d, h: in C. grandis), except in onechromosome pair of maleC. trilobata (Fig. 1l, p; Table 2)where this sequence is highly enriched. Interestingly, thischromosome pair also accumulates CL10 (Fig. 1n, p,arrow). The Ty3/Gypsy/Chromovirus element CL86 isenriched on one chromosome pair of male C. trilobata(Fig. 2j, arrow), on a few chromosomes of C. sessilifolia(Figs. 2a and S4a), and two chromosomes of maleC. hirtella (Fig. 2d, arrows) that also accumulate CL97(Table 2). The repetitive element CL260, which is abun-dant in C. grandis (Fig. 2i), accumulates on two chromo-somes of male C. sessilifolia (compare Fig. 2c, arrows)that also accumulate CL97 (compare Fig. 2b, c, arrows).Lastly, CL1, a 144-bp-long satellite that is extremelyabundant in all C. grandis centromeres except that ofthe Y chromosome (Fig. S5c), is abundant inC. sessilifolia males and females and C. hirtella males(Fig. S5a, b) and sometimes spreads over thepericentromeric region, occasionally covering entirearms. In C. trilobata, signals were more apparent atinterphase nuclei than at chromosomes in prophase I ofmeiosis, where we detected weak signals in only somebivalents (data not shown).

Immunostaining with antibodies against the his-tone modifications H2AThr120ph and H3Ser10phrevealed signals on the (peri-)centromeric regionsof all chromosomes of C. sessili folia andC. hirtella (Figs. S6a–d and S7), but only the Ychromosome of C. grandis showed an extended,

Table 1 Chromosome numbers (2n) and DNA content of maleand female Coccinia plants

Species 2n DNA content(pg/2C)

SD

C. grandisa Male 24 0.943 0.005

Female 0.849 0.005

C. hirtella Male 24 0.988 0.044

C. sessilifolia Male 24 0.984 0.005

Female 0.998 0.004

C. trilobata Male 20 1.263 0.004

SD standard deviationa Values from Sousa et al. (2013)

Sousa A. et al.

unusual distr ibut ion of H2AThr120ph andH3Ser10ph markers (Fig. S6e, f).

Mitochondrial and plastid sequences in the nucleargenomes

InC. grandis, our mitochondrial probe hybridizedmost-ly on the Y chromosome (Fig. 3i), while inC. sessilifolia, C. hirtella, and C. trilobata (Fig. 3c, f,l), i t yielded strong diffuse signals on most

chromosomes, especially surrounding the centromeres.The plastid small single-copy (SSC) and inverted repeat(IR) regions are abundantly accumulated on all chromo-somes of C. grandis (Fig. 3g, h). Among the other threespecies, onlyC. sessilifolia showed strong hybridizationsignals for both regions on most chromosomes, espe-cially in male cells, sometimes covering an entire arm(Fig. 3a, b), while in C. hirtella, only the SSC regionyielded a strong signal (compare Fig. 3a, b, d, e) and inC. trilobata only the IR region (compare Fig. 3j, k).

Fig. 1 a–p Distribution of repeats in species of Coccinia usingfluorescence in situ hybridization. Compare Table 2 for probenames; an asterisk stands for Ty3/gypsy/ and a section sign standsfor Ty1/copia/. Results forC. grandis are from Sousa et al. (2016).Arrows inC. grandis point to its Y chromosome, while in the other

species, they point to chromosomes or bivalents that have accu-mulated certain repeats (discussed in the text). The sex of eachkaryotype is indicated in the upper right-hand corner. Bars corre-spond to 5 μm

Heteromorphic and homomorphic sex chromosomes

Discussion

We applied fluorescent in situ hybridization (FISH) inthree close relatives of C. grandis, the only species ofCoccinia with heteromorphic sex chromosomes, to testif any of them would show an accumulation of therepeats and/or plastid and mitochondrial sequences thatwe had previously found to accumulate on theC. grandis Y chromosome (Sousa et al. 2016). In noneof the three species did we detect a single chromosomewith unique repeat accumulation (the potential Y chro-mosome), but our dual-probe FISH analyses revealedstrong accumulation of repeats on single chromosomepairs in male nuclei of all three species (CL10, CL97,CL260 in C. sessilifolia; CL9, CL86, CL97 inC. hirtella; CL10, CL44, CL86, CL97 in C. trilobata).The accumulation of the very same repeats that areenriched on the C. grandis on single pairs of chromo-somes in the related dioecious species points to eitherold (previous) sex chromosomes or incipient (newlyarising) ones, that is, to sex chromosome turnover.However, only C. sessilifolia exhibited sex differences,with females, but not males, accumulating the gypsy/chromovirus element CL86. Based on their relativephylogenetic proximity to C. grandis (Fig. S2), we

expected that C. hirtella and C. sessilifolia would cyto-genetically resemble C. grandis, while C. trilobatamight have a more divergent karyotype. Indeed,C. trilobata turned out to have a lower chromosomenumber and larger genome size, but in the accumulationof repetitive elements, it showed no consistent differ-ences from the other three species.

As found in many other angiosperms (e.g.,Oyama et al. 2008; Chung et al. 2012; Pelliceret al. 2014; Rockinger et al. 2016; this study),chromosome number is unrelated to genome size,and the species with the lower chromosome num-ber (2n = 20 instead of 24), C. trilobata, has thelargest genome size (Table 1). Interstitial telomererepeats (ITRs) have been used as footprints of(evolutionarily recent) chromosome rearrange-ments, such as fusions in angiosperms and gym-nosperms (Fuchs et al. 1995; Sousa et al. 2013;Sousa and Renner 2015; Rockinger et al. 2016),although their absence does not preclude rear-rangement events. In the species studied here, alltelomere signals were restricted to chromosomeends, and no interstitial telomeric signals weredetected in C. trilobata, which however had fewer45S rDNA loci, perhaps because of chromosome

Table 2 Repeat clusters selected for fluorescence in situ hybridization (FISH), with their numbering from the RepeatExplorer pipeline,which was used to name them

Clusters Annotation Y–C. grandis Chromosome pair in

C. sess. C. hirt. C. tri.

CL1 Centromere satellite – * * *

CL9 Ty3/gypsy/Athila * – * –

CL10 Ty1/copia/Angela * * – *

CL19 Ty3/gypsy/Ogre/Tat * – – –

CL44 LINE * – – *

CL86 Ty3/gypsy/chromovirus * – * *

CL97 Satellite * * * *

CL260 Unclassified * *

Plastid and mitochondrial probes

Plastid IR_Cg * – – *

Plastid SSC_Cg * – – –

CL173 Mitochondria seq. * – – –

An asterisk (*) indicates that FISH signals accumulated on the Y chromosome ofC. grandis and also on a chromosome pair in the respectivespecies

LINE long interspersed nuclear element, IR inverted repeat, SSC small single copy, Cg Coccinia grandis, C. sess. C. sessilifolia, C. hirt C.hirtella, C. tri. C. trilobata

Sousa A. et al.

rearrangements that resulted in its lower chromo-some number.

Chloroplast probes were as abundant inC. sessilifolia genomes as in C. grandis (Fig. 3),while in C. hirtella and C. trilobata, one of theplastid regions (IR or SSC) was less abundant. Thisnon-phylogenetic distribution (also of the mitochon-drial signals) points to a random transfer of organellarDNA to the nucleus. Genomic studies suggest thatsuch transfer is a continuous process and variableamong and even within species, depending on thenuclear genome size, level of polyploidy, number ofplastids per cell, and number of genomes per plastid

(Bock and Timmis 2008: review). In tobacco, theplastid-to-nuclear gene transfer differs even amongcells of a tissue (Bock and Timmis 2008). In Rumexacetosa, both the Y1 and Y2 chromosomes haveaccumulated plastid DNA; in Silene latifolia, piecesof the IR region are found on the Y chromosome andpieces of the SSC region in the centromere(Kejnovsky et al. 2006; Steflova et al. 2014), but inCoccinia, plastid sequences are present on most chro-mosomes (Sousa et al. 2016; this study). All theseresults confirm the independent degree of insertionsof organellar DNA into the nuclear genome of plantspecies.

Fig. 2 a–l Distribution of repeats in species of Coccinia usingfluorescence in situ hybridization. Compare Table 2 for probenames; the asterisk stands for Ty3/gypsy/. Results for C. grandisare from Sousa et al. (2016). Arrows in C. grandis point to its Y

chromosome, while in the other species, they point to chromo-somes or bivalents that have accumulated certain repeats(discussed in the text). The sex of each karyotype is indicated inthe upper right-hand corner. Bars correspond to 5 μm

Heteromorphic and homomorphic sex chromosomes

Centromeres

Centromeres are often composed of tandem repeats, butrelatively few of these repeats have been characterized(Nagaki et al. 2009, Han et al. 2009), among them thoseof two species with heteromorphic sex chromosomes,S. latifolia and C. grandis. In both, the Y chromosomecentromeres appear to be different from those of the Xand the autosomes (Cermak et al. 2008; Sousa et al.2016). The satellite CgCent (CL1), which labels the

centromeres of all C. grandis chromosomes exceptthose of Y chromosomes, also labeled all centromeresof C. sessilifolia and C. hirtella (weak signals wereobserved in some bivalents of C. trilobata). Immuno-staining with antibodies against two cell cycle-regulatedhistone modifications revealed signals on the(peri-)centromeric regions of all chromosomes ofC. sessilifolia and C. hirtella, but no signal expansionthroughout chromosome arms as observed on the Ychromosome of C. grandis.

Fig. 3 Distribution of plastid and mitochondrial sequences inmitotic and meiotic metaphase chromosomes of Cocciniasessilifolia (a–c), C. hirtella (d–f), and C. trilobata (j–l). Resultsfor C. grandis (g–i) are from Sousa et al. (2016). Arrows inC. grandis point to its Y chromosome, while in the other species,

they point to chromosomes or bivalents that have accumulatedcertain repeats. Compare Table 2 for probe names; IR stands forinverted repeat and SSC for small single copy region. The sex ofeach karyotype is indicated in the upper right-hand corner. Barscorrespond to 5 μm

Sousa A. et al.

Conclusions

This cytogenetic comparison of three dioecious speciesclosely related to a species with hugely differentiatedheteromorphic sex chromosomes revealed that malenuclei of the three species indeed accumulate on a singlepair of chromosomes some of the same repeats that areaccumulated on the C. grandis Y chromosome(Table 2). This suggests the turnover of sex chromo-somes. However, only C. sessilifolia exhibited sex dif-ferences in repeat accumulation.

Acknowledgements We thankMartina Silber for help in the lab,Andreas Houben and two anonymous reviewers for comments onthe manuscript, and the German Science Foundation for funding(DFG RE-603/19-1).

References

Aliyeva-Schnorr L, Ma L, Houben A (2015) A fast air-drydropping chromosome preparation method suitable forFISH in plants. JoVE 106:e53470

Bock R, Timmis JN (2008) Reconstructing evolution: gene trans-fer from plastids to the nucleus. BioEssays 30:556–566

Borchert T, Fuchs J,Winkelmann T, HoheA (2007)Variable DNAcontent of Cyclamen persicum regenerated via somatic em-bryogenesis: rethinking the concept of long-term callus andsuspension cultures. Plant Cell Tissue Organ Cult 90:255–263

Cermak T, Kubat Z, Hobza R, Koblizkova A,Widmer A,Macas J,Vyskot B, Kejnovsky E (2008) Survey of repetitive se-quences in Silene latifolia with respect to their distributionon sex chromosomes. Chromosom Res 16:961–976

Charlesworth D (2016) Plant sex chromosomes. Annu Rev PlantBiol 67:397–420

Chung KS, Hipp AL, Roalson EH (2012) Chromosome numberevolves independently of genome size in a clade withnonlocalized centromeres (Carex: Cyperaceae). Evolution66:2708–2722

Demidov D, Schubert V, Kumke K,Weiss O, Karimi-Ashtiyani R,Buttlar J, Heckmann S, Wanner G, Dong Q, Han F, HoubenA (2014) Anti-phosphorylated histone H2AThr120: a univer-sal microscopic marker for centromeric chromatin of mono-and holocentric plant species. Cytogenet Genome Res 143:150–156

Deng CL, Qin RY, Wang NN, Cao Y, Gao J, Gao WJ, Lu LD(2012) Karyotype of asparagus by physical mapping of 45Sand 5S rDNA by FISH. J Genet 91:209–212

Fechter I, Hausmann L, Daum M, Sörensen TR, Viehöver P,Weisshaar B, Töpfer R (2012) Candidate genes within a143 kb region of the flower sex locus in Vitis. Mol GenGenomics 287:247–259

Fraser LG, Tsang GK, Datson PM, De Silva HN, Harvey CF, GillGP, Crowhurst RN, McNeilage NA (2009) A gene-rich link-age map in the dioecious species Actinidia chinensis

(kiwifruit) reveals putative X/Y sex-determining chromo-somes. BMC Genomics 10:102

Fuchs J, Brandes A, Schubert I (1995) Telomere sequence local-ization and karyotype evolution in higher plants. P1 SystEvol 196:227–241

Geraldes A, Hefer CA, CapronA, Kolosova N,Martinez-Nuñez F,Soolanayakanahally RY, Stanton B, Guy RD, Mansfield SD,Douglas CJ, Cronk QC (2015) Recent Y chromosome diver-gence despite ancient origin of dioecy in poplars (Populus).Mol Ecol 24:3243–3256

Han Y, Zhang Z, Liu C, Liu J, Huang S, Jiang J, Jina W (2009)Centromere repositioning in cucurbit species: Implication ofthe genomic impact from centromere activation and inacti-vation. Proc Natl Acad Sci USA 106:14937–14941

Harkess A, Mercati F, Shan HY, Sunseri F, Falavigna A, Leebens-Mack J (2015) Sex-biased gene expression in dioeciousgarden asparagus (Asparagus officinalis). New Phytol 207:883–892

Holstein N (2015) Monograph of Coccinia (Cucurbitaceae).PhytoKeys 54:1–166

Holstein N, Renner SS (2011) A dated phylogeny and collectionrecords reveal repeated biome shifts in the African genusCoccinia (Cucurbitaceae). BMC Evol Biol 11:28

Houben A, Wako T, Furushima-Shimogawara R, Presting G,Künzel G, Schubert I, Fukui K (1999) The cell cycle depen-dent phosphorylation of histone H3 is correlated with thecondensation of plant mitotic chromosomes. Plant J 18:675–679

Iovene M, Yu Q, Ming R, Jiang J (2015) Evidence for emergenceof sex-determining gene(s) in a centromeric region inVasconcellea parviflora. Genetics 199:413–421

Kafkas S, Khodaeiaminjan M, Güney M, Kafkas E (2015)Identification of sex-linked SNP markers using RAD se-quencing suggests ZW/ZZ sex determination in Pistacia veraL. BMC Genomics 16:98

Kejnovsky E, Kubat Z, Hobza R, Lengerova M, Sato S, Tabata S,Fukui K, Matsunaga S, Vyskot B (2006) Accumulation ofchloroplast DNA sequences on the Y chromosome of Silenelatifolia. Genetica 128:167–175

Kersten B, Pakull B, Groppe K, Lueneburg J, Fladung M (2014)The sex-linked region in Populus tremuloides Turesson 141corresponds to a pericentromeric region of about two millionbase pairs on P. trichocarpa chromosome 19. Plant Biol 16:411–418

Lappin FM, Medert CM, Hawkins KK (2015) A polymorphicpseudoautosomal boundary in the Carica papaya sex chro-mosomes. Mol Gen Genomics 290:1511–1522

Marais GA, Forrest A, Kamau E (2011) Multiple nuclear genephylogenetic analysis of the evolution of dioecy and sexchromosomes in the genus Silene. PLoS One 6:e21915

Ming R, Bendahmane A, Renner SS (2011) Sex chromosomes inland plants. Ann Rev Plant Biol 62:485–514

Mrackova M, Nicolas M, Hobza R (2008) Independent origin ofsex chromosomes in two species of the genus Silene.Genetics 79:1129–1133

Nagaki K,Walling J, Hirsch C, Jiang J,MurataM (2009) Structureand evolution of plant centromeres. In: Ugarkovic D (ed)Centromere. Structure and evolution. Progress in molecularand subcellular biology, vol 48. Springer, Berlin, pp 154–179

Heteromorphic and homomorphic sex chromosomes

Oyama RK, Clauss MJ, Formanová N (2008) The shrunkengenome of Arabidopsis thaliana. Plant Syst Evol 273:257–271

Pellicer J, Kelly LJ, Leitch IJ, Zomlefer WB, Fay MF (2014) Auniverse of dwarfs and giants: genome size and chromosomeevolution in the monocot family Melanthiaceae. New Phytol201:1484–1497

Picq S, Santoni S, Lacombe T, Latreille M, Weber A, Ardisson M,Ivorra S, Maghradze D, Arroyo-Garcia R, Chatelet P, This P,Terral JF, Bacilieri R (2014) A small XY chromosomalregion explains sex determination in wild dioeciousV. vinifera and the reversal to hermaphroditism in domesti-cated grapevines. BMC Plant Biol 14:229

Piednoel M, Aberer AJ, Schneeweiss GM, Macas J, Novak P,Gundlach H, Temsch EM, Renner SS (2012) Next-generation sequencing reveals the impact of repetitive DNAin phylogenetical ly closely related genomes ofOrobanchaceae. Mol Biol Evol 29:3601–3611

Rockinger A, Sousa A, Carvalho FA, Renner SS (2016)Chromosome number reduction in the sister clade ofCarica papaya with concomitant genome size doubling.Amer J Bot 103:1–7

Slancarova V, Zdanska J, Janousek B, Talianova M, Zschach C,Zluvova J, Siroky J, Kovacova V, Blavet H, Danihelka J,Oxelman B, Widmer A, Vyskot B (2013) Evolution of sexdetermination systems with heterogametic males and femalesin Silene. Evolution 67:3669–3677

Sousa A, Renner SS (2015) Interstitial telomere-like repeats in themonocot family Araceae. Bot J Linn Soc 177:15–26

Sousa A, Fuchs J, Renner SS (2013) Molecular cytogenetics(FISH, GISH) of Coccinia grandis: a ca. 3 myr-old speciesof Cucurbitaceae with the largest Y/autosome divergence inflowering plants. Cytogenet Genome Res 139:107–118

Sousa A, Bellot S, Fuchs J, Houben A, Renner SS (2016) Analysisof transposable elements and organellar DNA in male andfemale genomes of a species with a huge Y chromosomereveals distinct Y centromeres. Plant J 88:387–396

Spigler RB, Lewers KS, Main DS, Ashman T-L (2008) Geneticmapping of sex determination in a wild strawberry, Fragaria

virginiana, reveals earliest form of sex chromosome.Heredity 101:507–517

Steflova P, Hobza R, Vyskot B, Kejnovsky E (2014) Strongaccumulation of chloroplast DNA in the Y chromosomes ofRumex acetosa and Silene latifolia. Cytogenet Genome Res142:59–65

Telgmann-Rauber A, Jamsari A, Kinney MS, Pires JC, Jung C(2007) Genetic and physical maps around the sex-determining M-locus of the dioecious plant asparagus. MolGen Genomics 278:221–234

Tennessen JA, Govindarajulu R, Liston A, Ashman T-L (2016)Homomorphic ZW chromosomes in a wild strawberry showdistinctive recombination heterogeneity but a small sex-determining region. New Phytol 211:1412–1423

Tlaskal J (1980) Combined cycloheximide and 8-hydroxyquinoline pretreatment for study of plant chromo-somes. Stain Tech 54:313–319

Ventura M, Archidiacono N, Rocchi M (2001) Centromere emer-gence in evolution. Gen Res 11:595–599

Wang J, Na JK, Yu Q, Gschwend AR, Han J, Zeng F, Aryal R,VanBuren R, Murray JE, Zhang W, Navajas-Pérez R, FeltusFA, Lemke C, Tong EJ, Chen C, Wai CM, Singh R, WangML, Min XJ, Alam M, Charlesworth D, Moore PH, Jiang J,Paterson AH, Ming R (2012) Sequencing papaya X and Yhchromosomes reveals molecular basis of incipient sex chro-mosome evolution. Proc Natl Acad Sci U S A 109:13710–13715

Yin T, Difazio SP, Gunter LE, Zhang X, Sewell MM, WoolbrightSA, Allan GJ, Kelleher CT, Douglas CJ, Wang M, TuskanGA (2008) Genome structure and emerging evidence of anincipient sex chromosome in Populus. Genome Res 18:422–430

Zhang W, Wang X, Yu Q, Ming R, Jiang J (2008) DNA methyl-ation and heterochromatinization in the male-specific regionof the primitive Y chromosome of papaya. Genome Res 18:1938–1943

Zhang Q, Liu C, Liu Y, VanBuren R, Yao X, Zhong C, Huang H(2015) High-density interspecific genetic maps of kiwifruitand the identification of sex-specific markers. DNA Res 22:367–375

Sousa A. et al.