Czech Journal of FOOD SCIENCES

Werner Baltes Berlin, Germany

Reto Battaglia Gossau, Switzerland

Denise BaxterNutfield, UK

Tini van Boekel Wageningen, the Netherlands

Jiří Davídek Praha, Czech Republic

Petr DejmekLund, Sweden

Jan Drbohlav Praha, Czech Republic

Ibrahim ElmadfaWien, Austria

Jose A. Empis Lisboa, Portugal

Roger Fenwick Norwich, UK

Vladimír Filip Praha, Czech Republic

Stanislava Grosová Praha, Czech Republic

Anna HalászBudapest, Hungary

Czech Journal of FOOD SCIENCES(continuation of the journal Potravinářské vědy)

Volume 27 2009

Editorial Board

Jan Velíšek (Praha, Czech Republic) – Editor-in-Chief

Marcela Braunová (Praha, Czech Republic) – Executive Editor

Colin HamletHigh Wycombe, UK

Thomas HenleDresden, Germany

Marie Holasová Praha, Czech Republic

Jiřina Houšová Praha, Czech Republic

Ivo Ingr Brno, Czech Republic

Pavel JelenEdmonton, Canada

Heikki Kallio Turku, Finland

Norbert de Kimpe Gent, Belgium

Milan Kováč Bratislava, Slovak Republic

Halina Kozlowska Ołsztyn, Poland

Radomir LásztityBudapest, Hungary

Paul NesvadbaAberdeen, UK

Werner Pfannhauser Graz, Austria

Jan Pokorný Praha, Czech Republic

Jean-Luc le Quéré Dijon, France

Mojmír Rychtera Praha, Czech Republic

Ján Šajbidor Bratislava, Slovak Republic

Peter Schieberle Garching, Germany

Štefan Schmidt Bratislava, Slovak Republic

Peter Šimko Bratislava, Slovak Republic

Zeno Šimůnek Praha, Czech Republic

Ingrid SteinerWien, Austria

Da-Wen SunDublin, Ireland

Berhard Tauscher Karlsruhe, Germany

Bohumil Turek Praha, Czech Republic

Michal Voldřich Praha, Czech Republic

Wang JunHangzhou, China P R

Czech Journal of Food SciEncES

Submitting a paper to czech Journal of Food Sciences

Before preparing your submission, please read the Instructions to Contributors to Czech Journal of Food SciEncES that appear in every issue. These instructions are also available on the website http://agriculturejournals.cz/web/CJFS.htm.Papers are accepted for consideration on condition that you will accept and warrant the following conditions:• In consideration of the publication of your Article, you assign us with full title guarantee all rights of

copyright and related rights in your Article. So that there is no doubt, this assignment includes the right to publish the Article in all forms, including electronic and digital forms, for the full legal term of the copyright and any extension or renewals. You shall retain the right to use the substance of your paper in future works, including lectures, press releases and reviews, provided that you acknowledge its prior publication in the Journal.

• We shall prepare and publish your Article in our Journal. We reserve the right to make such editorial changes as may be necessary to make the Article suitable for publication; and we reserve the right not to proceed with publication for whatever reason. In such an instance, the copyright in the Article will revert to you.

• If the Article was prepared jointly with other authors, you warrant that you have been authorised by all co-authors to sign this Agreement on their behalf, and to agree on their behalf with the order of the names in the publication of the Article.

online Manuscript SubmissionAll manuscripts must be submitted to the journal website (http://agriculturejournals.cz/web/CJFS.htm). Authors are requested to submit the text, tables, and artwork to this web address. In an accompanying letter, authors should state that the manuscript, or parts of it, have not been and will not be submitted elsewhere for publication. It is to note that an editable file is required for production purposes, so please upload your text files as Word (.doc) files (pdf files will not be considered). Submissions are requested to include manuscript, tables (all as Word files – .doc), photos with high resolution (JPG, TIFF), and graphs (as Excel file), as well as any ancillary materials. Authors unable to submit an electronic version should contact by e-mail the Editorial Office. If the instructions to contributors are not observed, the editorial office will return the paper to the author without its reviewing

There are no page charges in Czech Journal of Food Sciences. Coloured photos may be published following an agreement, but this will be exclusively at the authors’ own cost. Both the dates of the receipt of the manuscript and of the acceptance by the editorial board for publishing will be indicated in the printed contribution. All contributions should be written in standard English. All manuscripts will be sent to the reviewers. The recommendations of reviewers are advisory to the Editor, who accepts full responsibility for decisions about manuscripts. When a revision is requested, the authors must return the revised manuscript promptly. Six months after the request for revision of an Article, the revised manuscript will be handled as a new submission. The proofs will be sent to the author as a pdf file wherever possible and should be returned within 48 hours of receipt, preferably by fax or e-mail.

The manuscript which does not comply exactly with the requirements of the instructions to contributors, the editorial office will not accept it for a consideration and will return it to the authors without reviewing.

contents

Review

Vranová J., Ciesarová Z.: Furan in food – a review .............................................................................................. 1

Original scientific paper

Pospiech M., Tremlová B., Renčová E., Randulová Z.: Immunohistochemical detection of soya protein – optimisation and verification of the method ............................................................................................. 11

Kopjar M., Piližota V., Tiban N.N., Šubarić D., Babić J., Ačkar Đ., Sajdl M.: Strawberry jams: influence of different pectins on colour and textural properties ............................................................................. 20

Požrl T., Kopjar M., Kurent I., Hribar J., Janeš A., Simčič M.: Phytate degradation during breadmaking: The influence of flour type and breadmaking procedures .............................................................. 29

Polák J., Mestek O., Koplík R., Šantrůček J., Komínková J., Kodíček M.: Trace elements species fractionation in rye flour and rye (Secale cereale L.) seedlings ............................................................................... 39

Chen X., Yang M., Sun Z., Liu W., Sun T., Meng H., Zhang H.: Molecular cloning and characterisation of alpha subunit of H+-ATPase in Lactobacillus casei Zhang .................................................................................. 49

Şanlibaba P., Akkoç N., Akçelik M.: Identification and characterisation of antimicrobial activity of nisin a produced by Lactococcus lactis subsp. lactis LL27 ................................................................................... 55

Klewicka E., Klewicki R.: In vitro fermentation of galactosyl derivatives of polyols by Lactobacillus strains .................................................................................................................................................................................. 65

Volume 27, 2009, No. 1Czech Journal of

FOOD SCIENCES

Amarowicz Rysyard (Ołszyn, Poland)Ares Gastón (Monteviedo, Uruguay)Augustin Jozef (Bratislava, Slovak Republic)Azqueta Amaia (Blindern, Norway)Bauer Fridrich (Bratislava, Slovak Republic)Baxter Denisa (Nutfield, UK)Benešová Eva (Prague, Czech Republic)Chen Quansheng (Zhenjiang, P. R. China)Chevalier-Lucia Dominique (Montpellier, France)Cejpek Karel (Prague, Czech Republic)Černý Ivan (Nitra, Slovak Republic)Čmolík Jiří (Prague, Czech Republic)Čurda Dušan (Prague, Czech Republic)Čurda Ladislav (Prague, Czech Republic)Davidek Tomas (Lausanne, Switzerland)Da-Wen Sun (Dublin, Ireland)De Kimpe Norbert (Gent, Belgium)Demnerová Kateřina (Prague, Czech Republic)Dobiáš Jaroslav (Prague, Czech Republic)Drašar Pavel (Prague, Czech Republic)Elmadfa Ibrahim (Wien, Austria)Empis Jose A. (Lisboa, Portugal)Erban Vladimír (Prague, Czech Republic)Fikselová Martina (Bratislava, Slovak Republic)Filip Vladimír (Prague, Czech Republic)Fukal Ladislav (Prague, Czech Republic)Gabrovská Dana (Prague, Czech Republic)Gennaro Maria Carla (Alessandria, Italy)Germinara Giacinto S. (Campobasso, Italy)Ghavidel Reihaneh Ahmadzadeh (Mysore, India) Govaris Alexandros (Karditsa, Greece)Grosová Stanislava (Prague, Czech Republic)Halász Anna (Budapest, Hungary)Hamlet Colin (High Wycombe, UK)Haros Monika (Burjassot, Spain)Hidalgo Francisco J. (Sevilla, Spain)Holasová Marie (Prague, Czech Republic)Horáčková Šárka (Prague, Czech Republic)Houška Milan (Prague, Czech Republic)Hromádková Zdena (Bratislava, Slovak Republic)Hrušková Marie (Prague, Czech Republic)Ingr Ivo (Brno, Czech Republic)Jelen Pavel (Edmonton, Canada)Jha S.N. (Ludhiana, India)Kadlec Pavel (Prague, Czech Republic)Kalač Pavel (České Budějovice, Czech Republic)Kapasakalidis Petros (Whiteknights, UK)Karpíšková Renata (Brno, Czech Republic)Karst Francis (Colmar, France)Kováč Gabriel (Košice, Slovenská republika)Koza Václav (Prague, Czech Republic)Kubec Roman (České Budějovice, Czech Republic)

Kubát Jaromír (Prague, Czech Republic)Kvasnička František (Prague, Czech Republic)Lachman Jaromír (Prague, Czech Republic)Macková Martina (Prague, Czech Republic)Malcata Xavier (Porto, Portugal)Míková Kamila (Prague, Czech Republic)Moravcová Jitka (Prague, Czech Republic)Nehring Stefan (Koblenz, Germany)Nowak Jacek (Poznań, Poland)Oomah Dave B. (Summerland, Canada)Ondroušek Stanislav (Prague, Czech Republic)Pázlarová Jarmila (Prague, Czech Republic)Pfannhauser Werner (Graz, Austria)Pipek Petr (Prague, Czech Republic)Pitter Pavel (Prague, Czech Republic) Plocharski Witold (Skierniewice, Poland)Pokorný Jan (Prague, Czech Republic)Pudil František (Prague, Czech Republic)Rauch Pavel (Prague, Czech Republic)Réblová Zuzana (Prague, Czech Republic)Riddellová Kateřina (Prague, Czech Republic)Riganakos Kyriakos A. (Ioannina, Greece)Rop Otakar (Zlín, Czech Republic)Rychtera Mojmír (Prague, Czech Republic)Sajbidor Jan (Bratislava, Slovak Republic)Šavel Jan (Prague, Czech Republic)Schmidt Štefan (Bratislava, Slovak Republic)Schulz Hartwig (Quedlinburg, Germany)Scibisz Iwona (Avignon, France)Serrano M. (Alicante, Spain)Šilhár Stanislav (Bratislava, Slovak Republic)Šimko Peter (Bratislava, Slovak Republic)Šimon Peter (Bratislava, Slovak Republic)Steiner Ingrid (Wien, Austria)Sulc Pavol (Bratislava, Slovak Republic)Šviráková Eva (Prague, Czech Republic)Synytsya Andrey (Prague, Czech Republic)Tauscher Berhard (Karlsruhe, Germany)Tawata Shinkichi (Okinawa, Japan)Terzyk Artur P. (Torun, Poland)Troszynska Agnieszka (Ołsztyn, Poland)Truong Van-Den (Raleigh, USA) Turek Bohumil (Prague, Czech Republic)Tuszyński Tadeausz (Krakow, Poland)Ugarčić-Hardi Žaneta (Osijek, Croatia)Valík Ľubomír (Bratislava, Slovak Republic)Velíšek Jan (Prague, Czech Republic)Veselá Mária (Brno, Czech Republic)Vodřich Michal (Prague, Czech Republic)Wang Jun (Hangzhou, P. R. China)Yaylayan Varoujan A. (Quebec, Canada)Yebra María Jesús (Valencia, Italy)

In 2008, the persons listed below served CJFS by refereeing one or more submitted manuscripts. Their contribution to the maintanance of the scientific standard of our journal is gratefully acknowledged. On behalf of the Editorial Board

we thank them all.

�

Czech J. Food Sci. Vol. 27, 2009, No. 1: 1–10

Furan in Food – a Review

Janka VRANOVÁ and Zuzana CIESAROVÁ

Food Research Institute, Bratislava, Slovak Republic

ABSTRACT

Vranová J., Ciesarová Z. (2009): Furan in food – a review. Czech J. Food Sci., 27: 1–10.

Furan and its derivatives were identified in a small number of heat-treated foods back in the 60’s and 70’s. In May 2004, US Food and Drug Administration published a report on the occurrence of parent furan in a number of ther-mally treated foods. Since furan has been classified as “possibly carcinogenic to human” by IARC, a great concern has been addressed to the analysis of this substance naturally-occurring in food. This paper gives a short overview on the mechanistic pathways of the parent furan formation in food by degradation of amino acids and/or reducing sugars, and oxidation of ascorbic acid and poly-unsaturated acids which can be induced by thermal or irradiation treatments; further, it deals with the metabolism and toxicology of furan as well as with the comparison of the methods of furan determination.

Keywords: furan; heat processing contaminants; headspace; solid-phase microextraction; mechanisms of furan formation

Furan is a colourless chemical (C4H4O) having a low molecular weight of 68 and a high volatility with the boiling point of 31°C (NTP 1993). Furan and its derivatives are naturally occurring compounds found at very low levels in many foods and drinks and they have been associated with the flavour of foods. These include commercially prepared foods as well as home made foods. Furans are a major class of compounds forming during the Maillard reactions and their presence in foods is well documented (Maga 1979).

However, the use of the general terminology may cause some confusion. It is important to note that the chemical compound, furan, is not the same as the dioxin-like family of furan compounds (poly-chlorinated dibenzofurans). The diagrams of the two compounds illustrate the difference (Figure 1).

While furan unit is a part of the polychlorinated dibenzofuran structure, the latter are very different compounds with completely different effects.

The parent compound, furan, is widely used as a solvent for resins and lacquers as well as for the preparation of organic compounds (e.g. tetrahy-drofuran) and pharmaceuticals (NTP 2001). After

Supported by the Ministry of Agriculture of the Slovak Republic (Project “Development of progressive methods for assurance of the process of continuous quality and safety enhancement in food production and control”; Contract 2253/2006-550 between the Ministry of Agriculture of the Slovak Republic and the Food Research Institute, Bratislava) and by the Slovak Research and Development Agency (Contract No. APVV 27-013404).

Figure 1. Comparison of diagrams of furan and polychlo-rinated dibenzofuran

furan polychlorinated dibenzofuran

�

Vol. 27, 2009, No. 1: 1–10 Czech J. Food Sci.

classifying furan as “possibly carcinogenic to hu-mans” (Group 2B) by the International Agency for Research on Cancer (IARC 1995), a great concern is given to the analysis of this substance naturally occurring in food. Furan induces tumours in ani-mal assays; the most remarkable is the induction of hepatic cholangiocarcinomas in rats and mice. Just recently, the US Food and Drug Administration (US FDA) published a report on the occurrence of furan in a number of foods that undergo thermal treatment, especially canned and jarred foods (US FDA 2004a). Very similar results were published by the researchers from the Swiss Federal Office of Public Health (Reinhard et al. 2004). Parent furan was identified in a small number of heat-treated foods, such as coffee, canned meat, bread, cooked chicken, sodium caseinate, hazelnuts, soy protein isolate, hydrolysed soy protein, rapeseed protein, fish protein concentrate, and caramel back in 60’s and 70’s (Stoffelsma et al. 1968; Pers-son & Von Sydow 1973; Maga 1979). Recently, the database of information on the occurrence of furan in food has been widened as the analytical

techniques capable of detecting extremely low levels of substances become increasingly more sensitive. Furan values for some foods on the Swiss Market are shown in Table 1 in accordance with the database mentioned being continuously completed.

ORigin And meChAniSTiC pAThwAyS OF The pARenT FuRAn FORmATiOn

Literature data indicate multiple sources of furan formation originating from (i) thermal degrada-tion/Maillard reaction reducing sugars, alone or in the presence of amino acids, (ii) thermal degrada-tion of certain amino acids, and thermal oxidation of (iii) ascorbic acid, (iv) poly-unsaturated fatty acids and (v) carotenoids (Yaylayan 2006). The primary source of furan in food is the thermal degradation of carbohydrates such as glucose, lactose, and fructose (Maga 1979). According to the US FDA, a variety of carbohydrate/amino acid mixtures or protein model systems (e.g. alanine, cysteine, casein) and vitamins (ascorbic acid,

Table 1. Furan concentrations found in some foods commodities on the Swiss Market (according to Reinhard et al. 2004 and Swiss Federal Office of Public Health)

Sample descriptionFuran value (PPB) Median

(PPB)Number

of samplesminimum maximum

Baby food in small glass jars 1 153 12 102

Fruit and vegetable juices for babies and young children 1 40 3 4

Coffee (drink) 13 146 74 9

Hot chocolate and malt beverage < 2 < 2 2

Canned or jarred vegetables < 2 12 3 15

Canned soups 19 43 2

Canned fruits < 1 6 2

Tin containing meat 4 4 1

Tin containing meat and pasta 14 14 1

Sugo, tomato and Chilli sauces < 4 39 6 13

Soy sauce, hydrolysed vegetable protein 18 91 50 7

Vegetables, fresh < 1 < 2 < 1 7

Bread and toast < 2 30 < 2 7

Whole milk UHT < 0.5 < 0.5 1

Plum beverage 6 6 1

Beetroot juice with fruit juices (organic) 1 1 1

Potato flakes for mashed potatoes (flakes, not prepared) < 5 < 5 1

�


dehydroascorbic acid, thiamin) have been used to generate furan in food. Becalski and Sea-man (2005) reported that furan can be formed through the oxidation of poly-unsaturated fatty acids (PUFA) at elevated temperatures while the addition of commercially available antioxidants (such as tocopherol acetate) reduced the formation of furan up to 70%. Perez and Yaylayan (2004) described the proposed pathways of the parent furan formation from amino acids, sugars, amino acid/sugar mixtures, and ascorbic acid. Figure 2 summarises the general pathways leading to the furan formation from these sources.

Furan formation through amino acid degradation

Amino acids such as serine or cysteine un-dergo the thermal degradat ion pro ducing furan without the need of any other source. Both of them are able to metabolise to acetal-dehyde and glycolaldehyde which react by a ldo l condensat ion pro duc ing a ldote t ro- se derivatives and, eventually, furan. On the other hand, alanine, threonine, and aspartic acid alone do not produce furan. These amino acids can generate only acetaldehyde and they require the

Figure 2. Proposed pathways of formation of parent furan from three main groups of sources, i.e. amino acids, car-bohydrates, and polyunsaturated fatty acids

SR = Strecker reactionMR = Maillard reactionLO = lipid oxidation (according to Perez

& Yaylayan 2004)

�


presence of reducing sugars, serine, or cysteine to produce glycolaldehyde (Figure 2) (Perez & Yaylayan 2004).

Furan formation through carbohydrate degradation

Under the roasting conditions in the absence of amino acids, furan was mainly formed from the intact sugar skeleton. Formic and acetic acids were identified as byproducts of the sugar degradation, indicating the split of C1 and/or C2 units from hexoses. The presence of alanine, threonine, or serine promoted the furan formation by recom-bination of C2 fragments, such as acetaldehyde and glycolaldehyde, which might originate from both sugars and amino acids. In the aqueous solu-tion, about a half of furan was generated by the recombination of the sugar fragments (Limacher et al. 2008).

There are four pathways (A, B, C, and D; Fig-ure 3) of carbohydrate degradation that can lead to the formation of aldotetrose derivatives and after eventual cyclisation can form furan (according to Perez & Yaylayan 2004).

Reducing hexoses undergo Maillard reactions in the presence of amino acids and generate reactive intermediates such as 1-deoxy- and 3-deoxyosones (pathways A and D). The 1-deoxyosone has to undergo alpha-dicarbonyl cleavage to produce aldotetrose (Weenen 1998). Aldotetrose is formed also by retro-aldol cleavage in the absence of amino acids (e.g. pathway B), however, to a lesser extent. The pathway C of Figure 3 shows the formation of 2-deoxy-3-keto-aldotetrose after a dehydratation reaction, followed by retro-aldol cleavage. Finally, 3-deoxyosone undergoes alpha-dicarbonyl cleav-age, followed by oxidation and decarboxylation to generate 2-deoxyaldotetrose (pathway D). All the aldotetrose derivatives can be easily converted into furan as shown in Figure 3 (Perez & Yay-layan 2004).

Pentose sugars such as ribose can also generate the parent furan but more so in the presence of amino acids. Similar to hexoses, pentoses can be converted into their 3-deoxyosone derivatives either through a reaction with amino acids or through dehydration at the C-3 hydroxyl group (Weenen 1998). The resulting intermediate can undergo alpha-dicarbonyl cleavage to produce 2-deoxyaldotetrose, a direct precursor of furan (Figure 3).

proposed pathway from ascorbic acid

Studies with 13C-labelled ascorbic acid indicated that furan comprises an intact C4 unit, mainly C-3 to C-6, generated by splitting off two C1 units, i.e. CO2 and formic acid. Possible intermediates are 2-deoxyaldoteroses, 2-furoic acid and 2-furalde-hyde, which are known as ascorbic acid degradation products. The mechanism of furan formation from ascorbic acid was validated based on the labelling pattern of furan and the identification of 13CO2 and H13COOH (Limacher et al. 2007).

Ascorbic acid can oxidise quickly to dehy-droascorbic acid and hydrolyse in food systems into 2, 3-diketogulonic acid (DKG) (Liao 1987). DKG is converted to aldotetrose and later to furan (Figure 3). Nevertheless , under mainly nonoxidative pyrolytic conditions, ascorbic acid cannot undergo oxidation to produce DKG. Instead of this , it can hydrolyse and undergo beta-elimination (Niemelä 1987) followed by decarboxylation to produce 3-deoxypentosulose (DP), and then follow the ribose pathway to generate furan (Figure 3). However, under dry-heating conditions, dehydroascorbic acid can cyclise and it exists the mainly in its hemiketal form, thus preventing the formation of furan (Perez & Yaylayan 2004).

Formation of furan following exposure to ionising radiation

All these proposed pathways of furan formation were studied in model systems using pyrolysis-GC-MS, which means that in these cases the effect of high temperature was observed. Only recently, Fan (2005a) reported that ionising radiation induced the formation of furan in apple and orange juices. Furan levels increased linearly as the radiation dose increased from 0 to 5 kGy. Furthermore, in the first 3 days of storage after the irradiation treatment, the furan levels continued to increase in both apple and orange juices. According to Fan (2005ab), the increase in furan during the earlier storage period may be due to the residual effect of irradiation. Irradiation exerts its effect through generation of primary radicals from radiolysis of water (Simic 1983). The primary radicals include hydrated electrons, hydrogen atoms, and hydroxyl radicals. The primary radicals then react with the food components to form secondary radicals. Most of the free radicals are very short-lived (sub-

�


seconds). However, some radicals and reactive compounds may be present for a much longer time (days). These stable radicals and reactive compounds may continue to induce the formation of furan (Fan 2005a).

Figure 3. Schematic formation of furan from hexoses (A, B, C, and D pathway), pentoses and ascorbic and dehydroascorbic acid (according to Perez & Yaylayan 2004 with some modification)

The effect of irradiation on furan formation in model systems was studied by the same author later (Fan 2005b). His results showed that irradia-tion induced the formation of furan from ascorbic acid, fructose, sucrose, and glucose. Compared

DKG = 2,3-diketogulonic acid[O] = oxidation[H] = reduction

�


to the thermal treatment (sterilisation), irradia-tion (5 kGy) of sugars and ascorbic acid produced similar amounts of furan.

meTABOLiSm And TOXiCOLOgy OF FuRAn

Experiments in animals showed that furan is rapidly and extensively absorbed from the intestine and the lung (Egle & Gochberg 1979; Burka et al. 1991). Due to its low polarity, furan can pass through biological membranes and enter various organs. 24 hours after oral gavage of [14C]-labelled furan to rats at a dose level of 8 mg/kg b.w., the recovery of radioactivity (expressed as furan equivalent) in nmol per g of tissue was: liver 307, kidney 60, large intestine 25, small intestine 13, stomach 6, blood 6, and lung 4, respectively. In total, 15% of the dose was recovered in these tissues (Burka et al. 1991). Seven days after the treatment, the radioactivity had almost returned to the limit of detection. After repeated dosing, the accumulation of radioactivity was found par-ticularly in liver and kidney.

Cis-2-butene-1,4-dial has been identified as a key reactive and cytotoxic metabolite of furan, and has been found to bind to proteins (Burka et al. 1991) and nucleosides (Byrns et al. 2002). This metabolite will be formed by oxidation of one of the double bonds of furan, possibly with the for-mation of an epoxide intermediate, followed by spontaneous rearrangement and ring opening. Both in vitro and in vivo studies show that metabolic activation by cytochrome P450 (CYP) enzymes is involved in furan-induced toxicity. Inhibition and induction experiments revealed that CYP2E1 is the major enzyme involved in furan biotransformation indicating that furan metabolism can be enhanced by pre-treatment of rats with acetone (induction of CYP2E1) but not with phenobarbital (induc-tion of CYP2B2 isozymes) (Kedderis et al. 1993). However, Kedderis and Held (1996) concluded that even the induction of hepatic CYP2E1 would not affect the rate of hepatic metabolism because the metabolic capacity of CYP2E1 for furan is so high that hepatic blood flow is the rate-limiting step in the elimination of the parent compound.

According to the toxicology and carcinogenesis studies of furan made by U.S. National Institutes of Health, furan is clearly carcinogenic to rats and mice, showing a dose-dependent increase in hepatocellular adenomas and carcinomas in both

sexes (NTP 1993). In rats, also a dose-dependent increase in mononuclear leukaemia was seen in both sexes and a very high incidence of cholan-giocarcinomas of the liver was present in both sexes, even at the lowest dose tested (2 mg/kg b.w.). The International Agency for Research on Cancer (IARC) of the WHO classified furan in 1995 as possibly carcinogenic for humans (IARC 1995).

AnALySiS OF FuRAn in FOOd

Headspace sampling is the most suitable method for the analysis of very volatile compounds (Tassan & Russell 1974; Yang & Peppard 1994). This is a relatively simple and well-proven methodology in which a food sample in liquid or slurry form is heated in a sealed vial to achieve equilibrium partition between the liquid phase and the gaseous headspace. The headspace gas is sampled and the vapour injected into a GC. The detection can be carried out by non-selective means such as FID or by mass spectrometry.

Due to its high volatility, furan may also be ana-lysed using a headspace gas chromatography-mass spectrometry (HS-GC-MS). A simple headspace method for the furan determination in food was developed by US FDA. Five gram test portions of semi-solid or solid foods are diluted with water, fortified with internal standard (d4-furan), and sealed in headspace vials. Similarly, ten gram test portions of liquid foods are fortified with d4-furan and sealed in headspace vials. Automated headspace sampling followed by gas chromatog-raphy/mass spectrometry (GC/MS) analysis is used to detect furan and d4-furan in selected-ion monitoring mode (SIM). Furan is quantified by using a standard additions curve, where the con-centration of furan in the fortified test portions is plotted versus the furan/d4-furan response factors using the following ions: m/z 68 and 39 for furan and m/z 72 and 42 for d4-furan (US FDA 2004b). The experts from the Swiss Federal Office of Public Health used a similar method, except that quantification of furan was achieved by using only the furan/d4-furan ratio, rather than the standard additions curve (Reinhard et al. 2004). Becalski and Seaman (2005) simplified the headspace method by using autosampler vials to minimise possible losses of the analyte by reduc-ing the number of transfer steps. In this approach, a 2 ml autosampler vial was used containing 1 g

�


of the sample instead of 10 ml vial with 5 g of the test portion (Becalski et al. 2005).

The headspace method has the advantage in that no sample purification is required and it can be automated for high sample throughput. The disadvantage is that the foodstuff is heated (ac-cording to FDA method at 80°C for a minimum of 30 min), meaning that furan might be formed during analysis. Senyuva and Goekmen (2005) recently described the formation of furan in un-processed foods including green coffee, tomato juice, and orange juice during HS-GC-MS analysis even under mild (40°C) thermal conditions. On the other hand, Castle and Crews (2005) reported that the temperature range of 40–60°C had no significant effect on the furan formation during headspace incubation.

The researchers from the National Food Proc-essors Association and Nestlé Research Centre developed and validated an analytical method using solid-phase micro-extraction (SPME) in combi-nation with GC-MS (Goldmann et al. 2005; Ho et al. 2005; Bianchi et al. 2006). SPME is a fibre coated with a liquid (polymer), a solid (sorbent), or a combination of both. The fibre coating removes the compounds from the sample by absorption in the case of liquid coatings or adsorption in the case of solid coatings. The SPME fibre is then inserted directly into the gas chromatograph for desorption and analysis.

Only recently, Märk et al. (2006) studied furan formation using three main furan precursors, i.e. ascorbic acid, Maillard precursors, and polyun-saturated lipids. For the identification and quan-tification of furan in the headspace, they used the coupling of proton transfer reaction mass spectrometry and gas chromatography-mass spectrometry (PTR-MS/GC-MS). Ascorbic acid showed the highest potential to generate furan, followed by glyceryl trilinoleate. The furan yields from ascorbic acid were lowered in an oxygen-free atmosphere (30%) or in the presence of reducing agents, indicating the important role of oxidation steps in the furan formation pathway.

Kuballa and Ruge (2005) published a compari-son of FDA-method (HS-GC-MS) and microdis-tillation-GC-MS. By this method, six headspace vials were distilled using an automated microdis-tiller into prepared vials with a cooled solution. An aliquot from each solution was sampled and injected into GC/MS system. The authors declared that this method can shorten the total time of

analysis (in comparison with FDA method) by parallel distillation of six samples. Furthermore, the analysis of complex matrices, i.e. coffee, is easier.

Considering pros and cons of all the approaches mentioned, a reliable simplified method for furan determination in foods based on headspace GC-MS technique was recently tried and validated for rou-tine application in the food control. The validation was performed by evaluating the following char-acteristics: accuracy, trueness, recovery, limit of detection, limit of quantification, operating range, and calibration. Uncertainty statements obtained in the validation process in the complex matrix represented by tomato ketchup (LOD = 0.9 ng/g; LOQ = 2.9 ng/g; recovery = 103, 107 and 115%, respectively; RSD = 4, 5 and 8%, respectively) confirm that the method mentioned is suitable for the determination of furan in this food matrix. The method was extended for the determination of furan in foods such as baby food, canned meat and vegetables, liquid seasoning, sauces, and cof-fee (Vranová et al. 2007).

eXpOSuRe ASSeSSmenT FOR FuRAn

In May 2004, the US Food and Drug Admin-istration (US FDA) published a report on the occurrence of furan in thermally treated food commodities (US FDA 2004a). According to this report and other ones discussing the acute and chronic toxicity of furan, European Food Safety Authority (EFSA) requested its Scientific Expert Panel on Contaminants in the Food Chain (CON-TAM) to establish an ad hoc Working Group to investigate further the issue. The Working Group was charged with the collection of information on the chemical furan, its formation, and measured concentrations of furan in various foods and food products. EFSA initiated also a meeting of the European Commission’s Committee of Experts on Environmental and Industrial Contaminants in Food. The first meeting took place in Brussels in October 2004, the second in May 2006. At both meetings the problems of the occurrence of furan in foods as well as analytical methodology for the determination of furan levels found in foods and food products were discussed.

Only a limited set of data on the occurrence of furan in various food categories as well as consump-tion data are available to date. According to this, the Scientific Panel on Contaminants in the Food

�


Chain EFSA decided to present in its reports the range of the estimated exposure rather than the average exposure (EFSA 2004). US FDA presented the range of furan concentrations in 273 baby food samples from not detectable to 112 ng/g (US FDA 2004a). Considering a consumption of 234 g/day of canned baby food (Kersting et al. 1998), this would result in an exposure of < 0.03 to 3.5 µg/kg b.w./day (assuming a body weight of 7.5 kg of a 6 month old baby, EC 1993). However, for a reliable exposure assessment definition, the occurrence data on furan in a wide spectrum of food commodities as well as toxicological studies are needed (Heppner 2006).

COnCLuSiOn

Furan and its derivatives are naturally occurring compounds found at very low levels in many foods and drinks; they have been associated with the fla-vour of foods. They are a major class of compounds forming during the Maillard reactions (Maga 1979). The formation of furan under pyrolytic con-ditions has been studied in simple model systems revealing more precursor classes, i.e., (i) ascorbic acid and related compounds; (ii) Maillard type systems containing amino acids and reducing sugars; (iii) lipid oxidation of unsaturated fatty acids or triglycerides; and (iv) carotenoids (Pe-rez & Yaylayan 2004; Becalski & Seaman 2005; Yaylayan 2006). Furthermore, the effect of ionising radiation on the furan formation in real (apple and orange juice) and model systems has been studied (Fan 2005a, b). Due to its high volatility, furan can be analysed using a headspace or SPME coupled with gas chromatography-mass spectrometry. Furan is rapidly and extensively absorbed from the intestine and the lung. It can pass through biological membranes and enter various organs (Burka et al.1991). Experiments have shown that furan is carcinogenic to rats and mice, showing a dose-dependent increase in hepa-tocellular adenomas and carcinomas in both sexes (NTP 1993). Furan has been classified as possibly carcinogenic for humans (IARC 1995). However, preliminary exposure data suggest that the levels of furan found in foods are well below the levels that would cause harmful effects. Until more is known, FDA recommends that consumers eat a balanced diet, choosing a variety of foods that are low in trans-fat and saturated fat, and rich in high-fibre grains, fruits, and vegetables (US FDA

2004c). Under the circumstances described previ-ously, the continuation of the research is desirable for achieving safer and healthier foods.

ReFeRenCeS

Becalski A., Seaman S. (2005): Furan precursors in food: A model study and development of a simple headspace method for determination of furan. Journal of AOAC International, 88: 102–106.

Becalski A., Forsyth D., Casey V., Lau P.Y., Pepper K., Seaman S. (2005): Development and validation of a headspace method for determination of furan in food. Food Additives and Contaminants, 229: 535–540.

Bianchi F., Careri M., Mangia A., Musci M. (2006): Development and validation of a solid phase micro-extraction-gas chromatography-mass spectrometry method for the determination of furan in baby-food. Journal of Chromatography A, 1102: 268–272.

Burka L.T., Washburn K.D., Irwin R.D. (1991): Dispo-sition of [14C]-furan in the male F344 rat. Journal of Toxicology and Environmental Health, 34: 245–257.

Byrns M.C., Predecki D.P., Peterson L.A. (2002): Characterization of nucleoside adducts of cis-2-bu-tene-1,4-dial, a reactive metabolite of furan. Chemical Research in Toxicology, 15: 373–379.

Castle L., Crews C. (2006): FURAN: Methods applied by CSL and formation and mitigation in food. Joint DG Sanco/EFSA/DG JRC workshop furan in food: Analyti-cal methods and brainstorming on the elements to be included in a database, 19. May, Brussels.

EC (European Community) (1993): Nutrient and energy intakes for the European Community, Reports of the Scientific Committee on Food (SCF). 31st Series. Office for Official Publications of the EC, Luxembourg.

EFSA (European Food Safety Authority) (2004): Report of the Scientific Panel on Contaminants in the Food Chain on provisional findings on furan in food. The EFSA Journal, 137: 1–20.

Egle J.L.J., Gochberg B.J. (1979): Respiratory reten-tion and acute toxicity of furan. American Industrial Hygiene Association Journal, 40: 310–314.

Fan X. (2005a): Impact of ionizing radiation and thermal treatments on furan levels in fruit juice. Journal of Food Science, 70: E409–E414.

Fan X. (2005b): Formation of furan from carbohydrates and ascorbic acid following exposure to ionizing radia-tion and thermal processing. Journal of Agricultural and Food Chemistry, 53: 7826–7831.

Goldmann T., Périsset A., Scanlan F., Stadler R.H. (2005): Rapid determination of furan in heated foodstuffs by isotope dilution solid phase micro-extrac-

�


tion-gas chromatography-mass spectrometry (SPME-GC-MS). Analyst, 130: 878–883.

Heppner C. (2006): Data needs for a risk assessment on furan. Joint DG Sanco/EFSA/DG JRC Workshop Furan in Food: Analytical methods and brainstorming on the elements to be included in a database. Brussels.

Ho I.P., Yoo S.J., Tefera S. (2005): Determination of furan levels in coffee using automated solid-phase microex-traction and gas chromatography/mass spectrometry. Journal of AOAC International, 88: 574–576.

IARC (International Agency for Research on Cancer) (1995): IARC Monographs on the Evaluation of Carci-nogenic Risks to Humans. Vol. 63: Dry Cleaning, Some Chlorinated Solvents and Other Industrial Chemicals. Lyon: 3194–3407.

Kedderis G.L., Carfagna M.A., Held S.D., Batra R., Murphy J.E., Gargas M.L. (1993): Kinetic analysis of furan biotransformation by F-344 rats in vivo and in vitro. Toxicology and Applied Pharmacology, 123: 274–282.

Kedderis G.L., Held S.D. (1996): Prediction of furan pharmacokinetics from hepatocyte studies: Comparison of bioactivation and hepatic dosimetry in rats, mice and humans. Toxicology and Applied Pharmacology, 140: 124–130.

Kersting M., Alexy U., Sichert-Hellert W., Manz F., Schoch G. (1998): Measured consumption of com-mercial infant food products in German infants: Re-sults from the DONALD study. Journal of Pediatric Gastroenterology and Nutrition, 27: 547–552.

Kuballa T., Ruge W. (2005): Untersuchungsmethoden zu Furangehalten in Kaffee. Deutscher Lebensmittel-chemikertag, Sept., Hamburg: 19–21.

Liao M.L., Seib P.A. (1987): Selected reactions of l-ascorbic acid related to foods. Food Technology, 41: 104–107, 111.

Limacher A., Kerler J., Conde-Petit B., Blank I. (2007): Formation of furan and methylfuran from ascorbic acid in model systems and food. Food Addi-tives and Contaminants, 24: 122–135.

Limacher A., Kerler J., Davidek T., Schmalzried F., Blank I. (2008): Formation of furan and methylfuran by Maillard-type reactions in model systems and food. Journal of Agricultural and Food Chemistry, 56: 3639–3647.

Maga J.A. (1979): Furan in foods. Critical Reviews in Food Science and Nutrition, 11: 35–400.

Märk J., Pollien P., Lindinger C., Blank I., Märk T. (2006): Quantitation of furan and methylfuran formed in different precursors systems by proton transfer reaction mass spectrometry. Journal of Agricultural and Food Chemistry, 54: 2786–2793.

NTP (National Toxicology Program) (1993): Toxicology and carcinogenesis studies of furan (CAS No. 110-00-9)

in F344/N rats and B6C3F1 mice (gavage studies). NTP Technical Report No. 402. U.S. Department of Health and Human Services, Public Health Service, National Institutes of Health, Research Triangle Park, NC.

NTP (National Toxicology Program) (2001): Furan. 9th Report on Carcinogens. U.S. Department of Health and Human Services, Public Health Service, National Institutes of Health, Research Triangle Park, NC.

Niemelä K. (1987): Oxidative and non-oxidative alkali-catalysed degradation of l-ascorbic acid. Journal of Chromatography A, 399: 235–243.

Perez L.C., Yaylayan V.A. (2004): Origin and mechanis-tic pathways of formation of the parent furan – A food toxicant. Journal of Agricultural and Food Chemistry, 52: 6830–6836.

Persson T., Von Sydow E. (1973): Aroma of canned beef: Gas chromatographic and mass spectrometric analysis of the volatiles. Journal of Food Science, 38: 377–385.

Reinhard H., Sager F., Zimmermann H., Zoller O. (2004): Furan in foods on the Swiss market – method and results. Mitteilungen aus Lebensmitteluntersuch- ung und Hygiene, 95: 532–535.

Senyuva H.Z., Goekmen, V. (2005): Analysis of fu-ran in foods. Is headspace sampling a fit-for-purpose technique? Food Additives and Contaminants, 22: 1198–1202.

Simic M.G. (1983): Radiation chemistry of water-soluble food components. In: Josephson E.S., Peterson M.S. (eds): Preservation of Food by Ionizing Radiation. Vol. 2. CRC Press, Boca Raton: 1–73.

Stoffelsma J., Sipma G., Kettenes D.K., Pypker J. (1968): Volatile components of roasted coffee. Journal of Agricultural and Food Chemistry, 16: 1000–1004.

Tassan C.G., Russell G.F. (1974): Sensory and gas chromatographic profiles of coffee beverage headspace volatiles entrained on porous polymers. Journal of Food Science, 39: 64.

US FDA (US Food and Drug Administration) (2004a): Exploratory Data on Furan in Food. Available at: http://www.cfsan.fda.gov/~dms/furandat.html

US FDA (US Food and Drug Administration) (2004b): Determination of Furan in Foods. Available at: http://www.cfsan.fda.gov/~dms/furan.html (updated June 2, 2005).

US FDA (US Food and Drug Administration) (2004c): Question and Answers on the Occurrence of Furan in Food. Available at: http://www.cfsan.fda.gov/~dms/furanqa.html

Vranová J., Bednáriková A., Ciesarová Z. (2007): In-house validation of a simple headspace gas chroma-tography-mass spectrometry method for determination

�0


of furan levels in food. Journal of Food and Nutrition Research, 46: 123–127.

Weenen H. (1998): Reactive intermediates and carbo-hydrate fragmentation in Maillard chemistry. Food Chemistry, 62: 39–401.

Yang X., Peppard T. (1994): Solid-phase microextraction for flavor analysis. Journal of Agricultural and Food Chemistry, 42: 1925–1930.

Corresponding author:

Ing. Zuzana Ciesarová, CSc., Výskumný ústav potravinársky, Priemyselná 4, P.O. Box 25, 824 75 Bratislava, Slovenská republikatel.: + 421 250 237 197, fax: + 421 255 571 417, e-mail: [email protected]

Yaylayan V.A. (2006): Precursors, formation and deter-mination of furan in food. Journal für Verbraucherschutz und Lebensmittelsicherheit, 1: 5–9.

Received for publication October 10, 2006Accepted after corrections November 11, 2008

11


Immunohistochemical Detection of Soya Protein – Optimisation and Verification of the Method

Matej POSPIECH2, Bohuslava TREMLOVÁ2, Eva RENČOVÁ1 and Zdeňka RANDULOVÁ2

1Veterinary Research Institute, Brno, Czech Republic; 2Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences, Brno, Czech Republic

Abstract

Pospiech M., Tremlová B., Renčová E., Randulová Z. (2009): Immunohistochemical detection of soya protein – optimisation and verification of the method. Czech J. Food Sci., 27: 11–19.

A functional immunohistochemical method for soya proteins detection was developed. The procedure is based on the avidin-biotin complex (ABC) method that attains sufficient sensitivity. The method was verified by the analysis of the model samples of different forms of soya additives containing various concentrations of soya isolate. The detection limit of soya present in the model samples was 0.5%. Different possibilities of the background staining were tested. The best results were obtained with the background staining according to Calleja. The results were confirmed by the accredited indirect ELISA method. The method allows the identification of various forms of soya proteins such as isolates, texturates, concentrates, and flour.

Keywords: plant proteins; identification; model samples

Supported by the Ministry of Agriculture of the Czech Republic (Projects No. 1B53004 and MZE 00027 16201) and Ministry of Education, Youth and Sports of the Czech Republic (Project No. MSM 6215712402).

The addition of plant ingredients to meat prod-ucts is a common practice today. The need for sensitive methods for plant protein detection is associated not only with the economic aspect (product adulteration), but also with a new sig-nificant aspect: the protection of the consumers’ health. That may be endangered owing to the fact that these additives are classified as allergens according to the Czech legislation (Amendment No.1 to Decree No.113/2005 Coll.). The European legislation (Directive 2003/89/EC of the Euro-pean Parliament and of the Council) demands the indication of allergenic ingredients present in packaged foodstuffs.

It is necessary to have available methods that allow the detection of these ingredients. The de-

tection of the plant protein ingredients is made more difficult by low concentrations used and by the conditions of the food production that can cause soya protein structure modification.

At present, immunochemical methods are com-monly used for the detection of soya in foodstuffs, and molecular biological methods have also been described (Meyer et al. 1996). Among immu-nochemical methods, ELISA is most commonly used. This is also suitable for the qualitative and quantitative assessment of soya proteins in dif-ferent food products (Strahle & Roth 1996). Recently, a liquid chromatography–tandem mass spectrometry method (LC MS) has been published for the detection of soya proteins (Leitner et al. 2006). However, microscopic methods should also

12


be mentioned; these are the oldest methods for the detection of the ingredients present in foodstuffs. The image analysis techniques can also be used nowadays for this purpose due to their simplicity and the fact that they allow for the differentiation and identification of the basic ingredients in food-stuffs by the evaluation of their microstructure and ultrastructure (Lücker et al. 2000). These are usually histochemical methods that are highly specific for a number of foodstuffs.

According to the literature data, different stain-ing techniques have been used for the detection of soya concentrates in meat products such as staining according to Bauer-Calleja, staining according to Grocott, or trichrom staining according to Charvat (Heckmann et al. 1992). However, it is difficult to recognise the presence of plant protein additives due to various shapes of different protein forms, mush-room-shaped, crescent-shaped, or circula. None of the above mentioned targeted staining procedures for plant protein additives is highly specific because these are largely based on the detection of secondary polysacharidic structures of soya cells. Soya protein is usually stained like the protein of the muscle fibres (Tremlová & Štarha 2002).

The use of different forms of soya protein in relatively small amounts can also complicate the assessment (Pedersen 1995). The diagnostic methods that are also used in other spheres are immunohistochemical methods, which associate the benefits of classical histochemical methods and highly sensitive immunological methods. The most often used methods are the following: di-rect method, indirect two-stage method, indirect three-stage method, peroxidase-antiperoxidase complex (PAP) method, and avidin-biotin complex (ABC) method (Lukaš et al. 1997). Boutten et al. (1999) described a quantitative detection of 0.05 to 5% soya presence in a liver paste by immunohistochemical technique based on PAP. One of the main advantages of this method is the direct detection of soya in histological preparations. However, this technique may also be valuable for the study of other proteins, e.g. collagen, and for the assessment of their concentrations and localisa-tions in the products, especially by the association of the immunohistochemical method and the image analysis system (Belloque et al. 2002). Besides others, immunohistochemical techniques are the following: highly sensitive indirect immunofluores-cence test allowing the detection of soya protein in salami from 0.1% (Heitmann 1987), immunodif-

fusion test, and immunoblotting Western Blot and Dot-blot (Belloque et al. 2002).

The purpose of the present study was to develop a method for immunohistochemical detection of soya protein and to test the method on model samples with the use of different forms of soya protein.

MAterIAl AnD MethODS

Preparation of model samples. Two groups of model samples were prepared from minced pork muscle together with soya protein. The first group (samples No. 1–5) contained increasing concentrations of soya isolate A – 0.5%, 1%, 2.5%, 5%, and 10%. The second group included model samples with the addition of different types of soya protein in the concentration of 2.5%. These were soya extract (B), isolates from several producers designated C and D, defatted soya flour (E), and textured protein (F). For the establishment of the time needed for the protein visualisation, purified soya isolate (G) without musculature was used.

Sample treatment and preparation. Samples (5 g) were fixed in 10% water solution of neutral formalin (RNDr. Jan Kulich, Ltd., Prague, Czech Republic) for 24 hours. After fixation, the samples were dewatered in ascending sequence of alcohol in the autotechnicon apparatus AT-4 and embed-ded into paraffin blocks in Paraplaste (RNDr. Jan Kulich, ltd., Prague, Czech Republic); these were cut to 4 µm sections on a rotation microtome (Mikrom HM 400, Carl Zeiss, Germany). The sections were spread on the water surface and mounted on slides SuperFrost plus (Menzel Gläser, Germany). Four paraffin blocks were prepared for each sample, from which 50 µm sections were cut. We examined eight sections at magnifications of 40× and 100× under a Nikon light microscope (Nikon-alphaphot-2 YS 2, Nikon Type 119, Japan).

The examination procedure. For the assess-ment of soya protein in the products, we chose the highly sensitive indirect three-stage avidin-biotin complex method. This is an amplification method that uses the high binding affinity between avidin and biotin for the detection of antibodies. In this method, the biotin-conjugated secondary antibody binds to the primary specific antibody. The next stage is the binding of avidin-biotin peroxidase complex to the secondary biotinated antibody that significantly amplifies the signal.

The procedure used in our laboratory was a modification of the PAP method (Boutten et

13


al. 1999) developed in collaboration with the In-stitute of Animal Physiology and Genetics of the Academy of Sciences of the Czech Republic in Brno. For each sample, one slide with four sections was prepared as the negative control where the primary antibody was replaced with the antibody diluent (DakoCytomation Antibody Diluent S0809, Glostrup, Denmark).

Establishment of the optimum time for the visualisation of conjugated enzyme. The es-tablishment of the optimum time needed for the visualisation is an important step in the immuno-histochemical detections. If the exposure time to the horse radish conjugated peroxidase is too short, the staining of antigen is insufficient. Vice versa, if the time is too long, the background is stained too intensively and thus it cannot be distinguished from the investigated antigen. For this purpose, we chose the model samples of minced pork contain-ing different kinds of soya additives. The negative control was prepared for each sample. We chose four values, i.e. 10 s, 3 min, 15 min, and 30 min, within the ranges declared by the manufacturer of the reagent diaminobenzidine (DAB). The result is based not only on the DAB exposure time, but also on the kind of samples. The best values were obtained after a 3-min exposure (Table 1).

Establishment of the optimum procedure for background staining. We combined the benefits of classical histochemistry (the whole preparation or target components are well stained) with specific immunohistochemistry to stain the background. We obtained preparations in which we could assess the ingredients commonly present in foodstuffs, based on the knowledge of histology, together with the components highlighted on the basis of antigen-antibody binding. It was necessary to find a staining procedure that allows the visualisation of the background structures, however, not at the expense of the visibility of the immunohisto-chemically highlighted structures. It was difficult

to find the best staining technique because vari-ous histochemical staining procedures exist and we had to proceed empirically. We used different conventional staining procedures (Hematoxylin-Eosin, Gill’s Hematoxylin, Gill’s Hematoxylin-Eosin, Calleja, Bauer-Calleja, Toulidin Blue, Methylene Blue, Alcian Green). The best results were ob-tained with the staining procedure according to Calleja (1897), resulting in the achievement of a good contrast between DAB chromogene and Calleja solution (Table 2).

The examination method. The following im-munohistochemical method for soya detection developed in our laboratory is based on ABC im-munohistochemical method (Lukaš et al. 1997)) and is more sensitive than the method applied by Boutten et al. (1999).

Sections were immersed in: (1) xylen (RNDr. Jan Kulich Ltd., Prague, Czech Republic) twice for 10 min; (2) absolute ethanol (Moravský Lihovar, Kojetín, Czech Republic) twice for 10 min, followed by 90% and subsequently by 70% aqueous ethanol (v/v) 10 min each bath; (3) tap water for 7 min; (4) distilled water for 7 min; (5) PBS – Phosphate Buffered Saline, 80 g/l NaCl (RNDr. Jan Kulich Ltd., Prague, Czech Republic), 2 g/l KCl, 2 g/l KH2PO4, 23.4 g/l Na2HPO4· 2 H2O, 0.16 g/l NaOH adjusted to pH 7.4; (6) citrate buffer 21 g/l C6H8O7, 9 g/l NaOH adjusted to pH 6 for 5 min at 650 W in a microwave; (6) PBS for 5 min; (7) 3% (v/v) H2O2 in PBS for 30 min and then (8) PBS twice for 5 minutes.

The sections were then incubated successively: (9) for 30 min at 25°C with 5% (v/v) powdered milk diluted in TBS (Dako TBS, Glostrup, Denmark); (10) for 12 h at 8°C with an anti-soya antibody diluted 1:500 with antibody diluent (DakoCytoma-tion ref. S0809, Glostrup, Denmark) and washed in PBS twice for 5 min; (11) for 30 min at 25°C with 25 μl per section of anti-rabbit biotinylated antibody (Vector Laboratories, PK 6101, Bur-lingtone, USA) containing 10 ml TBS, 3 drops

Table 1. Establishment of optimum time for visualisation of the conjugated enzyme

Sample No. Control 10 s 3 min 15 min 30 min

B – – + + +C – – + ++ ++D – – ++ + +E – – ++ ++ ++F – – ++ + –G – – + + +

14


of normal blocking serum stock, and 1 drop of biotinylated antibody stock, and washed in PBS twice for 5 min; (12) for 30 min at 25°C with 25 μl per section of ABC reagent (Vector Laboratories, PK 6101, Burlingtone, USA) containing 5 ml TBS, 2 drops of reagent A and 2 drops of reagent B, and washed in PBS for 5 minutes.

The antibody binding was visualised by incubation in 25 μl per section of 3,3'-diaminobenzidine (DAB) (DakoCytomation, Glostrup, Denmark) for 3 min, the reaction was stopped by washing in a water bath for 5 minutes. The background was visualised in Calleja bath for 5 min and washed in water bath and then in 96% aqueous (v/v) and finally absolute ethanol twice for 5 min each, and in xylene p.a. (RNDr. Jan Kulich, Ltd., Prague, Czech Republic) twice for 5 minutes. A drop of solacryl (RNDr. Jan Kulich, Ltd., Prague, Czech Republic) and a micro coverslip were laid onto each section.

The antibodies used. For comparison, we used polyclonal antibodies from two sources as primary antibodies:•Polyclonal self-made antibodies RASo 100/3

were obtained by immunisation of New Zealand White rabbits. Purified soya isolate was used as the immunogene. These antibodies were tested from the aspect of sensitivity and specificity by the counter-electrophoresis method. The antibodies are specific only for soya protein.

•Polyclonal antibodies purchased from Sigma-Aldrich Company (St. Louis, USA) were des-ignated as Anti-soya protein with 2519–1ml in concentration of 9.5 mg protein supplied as solution in 0.01M phosphate buffer with pH 7.4 and preserved with 15mM sodium azide. The antibodies were also obtained from rabbits us-ing purified soya proteins as antigens. They are primarily intended for soya assessment in

foodstuffs by the indirect ELISA and the indirect dot blot immunoassay methods. Confirmation ELISA method. The model sam-

ples were simultaneously immunochemically tested for the presence of soya proteins by the accred-ited indirect competitive ELISA method for the detection of soya proteins modified in our labora-tory (Accredited Laboratory registered with the Czech Institute for Accreditation (CIA) under No. 1354). The analysis was performed using an appropriate standard operating procedure SOP 1/03–03/A. ELISA was conducted utilising 100 μl well system with the application of solid-phase soya isolate antigen followed by the addition of the sample extracts and the polyclonal New Zealand White rabbits anti soya isolate antibody of own provenance and peroxidase-labelled anti-rabbit conjugated antibody and tetramethylbenzidine (TMB) substrate. The measurement of the final absorbance was realised at 450 nm. The detection limit of the semi-quantitative ELISA method was 0.5% of the weight of the added plant protein.

reSultS AnD DIScuSSIOn

testing of the method on model samples

The above mentioned method was tested on two groups of model samples. In the first group, where different concentrations of one kind of soya protein were used, soya was detected in all concentrations by immunohistochemical method with comparable results (Table 3 and Figure 1). Accordingly, the immunohistochemical method confirmed the cited literature data concerning the potential use of these methods (Boutten et al. 1999).

Due to the fact that different forms of soya protein can be found in the meat products (Coomaras-wamy & Flint 1973; Pipek 1998), samples were selected with the addition of different forms of soya protein used for the production of meat products as the second group of the model samples in the present study. In this group of the model samples, the targeted histochemical staining PAS-Calleja and Bauer-Calleja confirmed that it is possible to reveal soya flour and less sophisticated soya proteins by the detection of insolvable polysaccharide components, which is in accordance with a number of authors (Coomaraswamy & Flint 1973). The specificity of HE staining and staining according to Calleja showed to be low as also reported by Tremlová

Table 2. Evaluation of staining procedures

Staining procedure Results

Hematoxylin-Eosin +Gill’s Hematoxylin –Gill’s Hematoxylin-Eosin +Calleja +++Bauer-Calleja ++Toluidin Blue –Methylene Blue –Alcian Green –

15


Table 3. Comparison of immunohistochemical and immunochemical detections of soy protein in samples with dif-ferent concentrations of additive

Model sample No.

Soya additive – soya isolate A

Immunohistochemical detection ELISA detection

RASo 100/3 Anti-soya protein RASo 100/3 Anti-soya protein

1 0.5% + + + +2 1.0% + + + +

3 2.5% + + + +4 5.0% + + + +5 10.0% + + + +6 B + + + +7 C + + + +8 D + + + +9 E + + + +10 F + + + +11 G + + + +

B – pork meat and soya concentrate, C – pork meat and soya isolate, D- pork meat and soya isolate, E – pork meat and defatted soya flour, F – pork meat and soya texturate, G – pure soya isolate protein

and Štarha (2002). The detection must be therefore based on the knowledge of morphological structure of the soya protein if the size of the additive is suf-ficient for light microscopy (Horn 1987). Highlight-ing by the immunohistochemical methods does not depend upon the concurrent presence of other structures (polysaccharides), and the visualisation of soya protein due to highly specific primary antibody was obtained with all the forms of soya additives (Table 3 and Figures 2–7). Based on the preliminary examinations, it seems that the obtained contrast of this staining may be sufficient even for quantitative evaluation by the image analysis system.

comparison of the results with the confirmation method

The model samples were examined by a con-firmation accredited ELISA method of our own provenance that allowed the detection of the in-vestigated ingredients in concentrations lower than 0.5%. The results obtained by the immuno-histochemical method were in consensus with the ELISA method results (Table 3).

In the first group where different concentrations of one soya protein type (soya isolate) were used soya was successfully detected by histochemical examination in all samples. In the second group, soya was detected in all model samples contain-ing different types of soya additive (texturate,

concentrate, soya flour, isolate). It was confirmed that immunochemical methods can be used for the detection of different kinds and types of soya protein (Ravestein & Driedonks 1986; Yasu- moto et al. 1990).

cOncluSIOnS

The method developed in the present study proved to be reliable for the detection of soya present in model samples from the concentration of 0.5%. No false positivity occurred at higher concen-trations (10%). We obtained the best results after staining the background according to Calleja, for which the image analysis system can likely be used in the future. With other staining procedures, the contrast reached was not sufficient and a higher experience and erudition of a technician would be necessary. If the image analysis system were applied for the samples stained by this method, the interaction between the technician and the image analyser would have to be higher.

While performing histochemical detection of soya, largely based on the characteristic structure of soya protein, the fragments of soya protein are often neglected because they do not show the characteristic structure. On the contrary, when immunohistochemical examination is performed (that allows more accurate quantitative evaluation), all soya protein fragments with appropriate epitopes

16


Sam

ple

No.

Neg

ativ

e co

ntro

lR

ASo

100

/3Si

gma-

Ald

rich

1 (0

.5%

)

2 (1

%)

3 (2

.5%

)

17


Sam

ple

No.

Neg

ativ

e co

ntro

lR

ASo

100

/3Si

gma-

Ald

rich

4 (5

.0%

)

5 (1

0.0%

)

Figu

re 1

. C

onne

cted

with

Tab

le 3

(Soy

a is

olat

e)

18


Figure 2. Model sample No. 6-B (minced meat and soya concentrate). DAB chromogen and Calleja staining (mag-nification 25×)

Figure 3. Model sample No. 7-C (minced meat and soya isolate). DAB chromogen and Calleja staining (magnifi-cation 25×)

Figure 4. Model sample No. 8-D (minced meat and soya isolate). DAB chromogen and Calleja staining (magnifi-cation 25×)

Figure 5. Model sample No. 9-E (minced meat and soya flour). DAB chromogen and Calleja staining (magnifica-tion 25×)

Figure 6. Model sample No. 10-F (minced meat and soya texturate). DAB chromogen and Calleja staining (mag-nification 25×)

Figure 7. Model sample No. 11-G (minced meat and soya isolate). DAB chromogen and Calleja staining (magnifica-tion 25×)

19


are highlighted due to the high specificity of the method. In comparison with ELISA method, immu-nohistochemical method with the counterstaining of the background also allows the detection of other components present in the product (according to the staining used and based on histology knowledge), thereby obtaining a much wider range of results. It can appear as a great advantage, above all in food-stuffs with respect to the risk of adulteration.

After the examination of a matching group of the meat products from the market, it will be possible to offer this method to the testing laboratories and to apply it to the identification of another components present in the meat products.

r e f e r e n c e s

Anonymous: Amendment No. 1 to Decree No. 113/2005 Coll., on methods for labelling of foodstuffs and tobacco products. Collection of Acts: 1163–1176.

Anonymous: Directive 2003/89/EC of the European Parliament and of the Council of 10 November 2003 amending Directive 2000/13/EC as regards indica-tion of the ingredients present in foodstuffs. Ofiicial Journal L 308, 25/11/2003: 15–18.

Belloque J., Garcia M.C., Torre M., Marina M.L. (2002): Analysis of Soyabean proteins in meat prod-ucts: A review. Critical Reviews in Food Science and Nutrition, 42: 507–532.

Boutten B., Humbert C., Chelbi M., Durand P., Peyraud D. (1999): Quantification of soya proteins by association of immunohistochemistry and video image analysis. Food and Agricultural Immunology, 11: 51–59.

Calleja C. (1897): Método de tripla coloración con el car- mín litinado y el picrocarmín de índigo. Revista Tri-mestral Micrográfia, II: 100–104.

Coomaraswamy M., Flint O.F. (1973): The histo-chemical detection of soya “novel proteins” in com-minuted meat products. The Analyst, 98: 542–545.

Heckman T., Neuman B., Tschirdewah B., Bent- le W. (1992): Soya protein. Detection in raw salami and frankfurter-type sausages. Fleischwirtschaft, 72: 1423–1427.

Heitman J. (1987): Detection of soya protein in heat treated meat products by indirect immunofluores-cence. Fleischwirtschaft, 67: 62–622.

Horn D. (1987): Detection of plant protein preparations in meat products by histological examination method. Fleischwirtschaft, 67: 616–618.

Lücker E., Hildebrandt G., Horn D. (2000): Quality assurance by histological analysis of food. In: 41. Ar- beitstagung des Arbeitsgebietes „Lebensmittelhygie-ne“, Garmisch-Partenkirchen, Germany, 25.–28. 09. 2000: 588–592.

Leitner A., Castro-Rubio F., Marina M.L., Lindner W. (2006): Identification of marker proteins for the adulteration of meat products with soybean proteins multidimensional liquid chromatography-tandem mass spectrometry. Journal of Proteome Research., 5: 2424–2430.

Lukáš Z., Drapelová E., Feit J., Vojtěšek B. (1997): Immunohistochemical Methods in Biology and Bioptic Diagnosis. 1st Ed. Masaryk University Brno.

Meyer R., Chardonnes F., Hűbner P., Lűthy J. (1996). Polymerase chain reaction (PCR) in the quality and safety assurance of food: detection of soya in processed meat products. Zeitschrift fűr Lebensmittel-Untersu-chung und -Forschung, 203: 339–344.

Pedersen H. E. (1995): Application of soya protein-con-centrates in processed meat-products-experience from different countries. Fleischwirtschaft, 75: 1–6.

Pipek P. (1998): Technologie masa II. Karmelitánske nakladatelství v Kostelním Vydří, Praha: 158–159.

Ravestein P., Driedonks R.A. (1986): Quantitative im-munoassay for soya proteins in raw and sterilized meat products. Journal of Food Technology, 21: 19–32.

Strahle J., Roth M. (1996): Determination of soya-pro-tein by enzyme-linked immunosorbent assay (ELISA). Deutsche Lebensmittel-Rundschau, 92: 247–250.

Tremlová B., Štarha P. (2002): Evaluation of histo-logical methods for detection of plant ingredients in meat products with regard to the use of image analysis systems. In: 43. Arbeitstagung des Arbeitsgebietes „Lebensmittelhygiene“, Garmisch-Partenkirchen, Ger-many, 25.–25. 09. 2001: 838–842.

Yasumoto K., Sudo M., Suzuki T. (1990): Quantita-tion of soya protein by enzyme linked immunosorbent assay of its characteristic peptide. Journal of Food Science and Agriculture, 50: 377–389.

Received for publication December 21, 2007Accepted after corrections March 3, 2008


MVDr. Eva Renčová, Ph.D., Výzkumný ústav veterinárního lékařství, Hudcova 70, 621 00 Brno, Česká republikatel.: + 420 533 331 617, fax: + 420 541 211 229, e-mail: [email protected]

20


Strawberry Jams: Influence of Different Pectins on Colour and Textural Properties

Mirela KOPJAR, Vlasta PILIŽOTA, Nela Nedić TIBAN, Drago ŠUBARIĆ, Jurislav BABIĆ, Đurđica AČKAR and Maja SAJDL

Faculty of Food Technology, University of J. J. Strossmayer in Osijek, Osijek, Croatia

Abstract

Kopjar M., Piližota V., Tiban N.N., Šubarić D., Babić J., Ačkar Đ., Sajdl M. (2009): Strawberry jams: influence of different pectins on colour and textural properties. Czech J. Food Sci., 27: 20–28.

Colour and texture are very important quality properties of all foods. In this work, the influence was investigated of different types of pectin on colour and textural properties in strawberry jams and low-calorie strawberry jams con-taining fructose and aspartame or fructose syrup and aspartame. The highest anthocyanin content and total phenol content were detected in strawberry jam samples prepared with low methoxy amidated pectin. During storage, after 4 and 6 weeks at both storage temperatures, room temperature and 4°C, anthocyanin content and total phenol con-tent decreased. Also, free radical scavenging activity decreased during storage. As far as the texture parameters are concerned, namely firmness, consistency and cohesiveness, the highest values were found in strawberry jam samples prepared with high methoxyl pectin.

Keywords: pectin; strawberry jam; low-calorie strawberry jam; anthocyanins; texture

Low-calorie products were originally devel-oped for diabetics and people with specific health problems, and they were considerably expensive. Nowadays, consumers’ demand for low-calorie products has significantly risen in an attempt to alleviate the health problems, to reduce or stabilise the body weight, and to work within the frame of a healthier diet. The food industry has been con-fronted with a new challenge in order to satisfy the consumers; that is the development of low-calorie products with acceptable sensory characteristics and competitive prices, by preferably employing the conventional processing equipment and in agreement with the current strict legislation. The role of sugar substitutes in the successful manu-facture of these products is crucial (Sandrou & Arvanitoyannis 2000).

Pectin is primarily used in food industry as a gelling agent for jams, jellies, and other foods (El-Nawawi & Heinkel 1997). The degree of esterification (DE) gives the ratio of esterified galacturonic acid units to total galacturonic acid units in the molecule. This categorises pectins into two broad classes – low methoxyl (LM) with DE < 50%, and high methoxyl (HM) with DE > 50%. The LM pectin is obtained either enzymatically, in vivo, or by the controlled de-esterification of HM pectin in either acidic or alkaline conditions. Ammonia is sometimes used in the process, in-troducing some amide groups into the molecule and yielding ‘amidated’ pectin (Kratz 1995). The reduction of DE introduces dramatic changes in the functionality of HM and LM pectins. A com-bination of hydrogen bonding and hydrophobic

Supported by the Croatian Ministry of Science, Education and Sports (National Scientific Project No. 113-1130473-0340).

21


interactions are responsible for the gel forma-tion of HM pectin. The hydrophobicity can be enhanced by sugars which create the conditions of low water activity, thus promoting chain-chain rather than chain-solvent interactions (Morris et al. 1980; Oakenfull & Scott 1985). Acidity is also necessary to reduce the negative charges on the carboxyl groups, thus diminishing elec-trostatic chain repulsion. The gelation theory of HM pectin is not valid for LM pectin. Instead, LM pectin gelation is considered as the formation of a continuous network of ionic cross linkages via calcium bridges. These develop between the car-boxyl groups belonging to two different chains in close proximity (Walkinshaw & Arnott 1981; Kasapis 2002).

The effect of the pectin type on the jam colour has not been extensively studied. Although it has been suggested that pectin has a role in the colour degradation of the jam products (Lewis et al. 1995), this effect is not yet accurately known.

One of the most important parameters to which consumers are sensitive when selecting foods is the colour. Manufacturing and preservation processes often degrade the colour of food (Gimenez et al. 2001). The relatively rapid deterioration of the attractive red colour of freshly made strawberry preserves has been a persistent problem. Colour deterioration is due to at least three factors: the loss of red anthocyanin pigment, formation of brown pigments, and discoloration through fac-tors such as heavy metal contamination (Abers & Wrolstad 1979). Anthocyanins have a crucial role in the colour quality of many fresh and proc-essed fruits. They are a good source of natural antioxidants, however, they are quite unstable during processing and storage. The temperature, pH, oxygen, and water activity are considered to be important factors influencing their stability. During heating, degradation and polymerisation usually lead to their discoloration. It has been proven that some degradation products of an-thocyanins have the antioxidant capacity (Tsai & Huang 2004). Maillard reaction products have also been proven to be powerful as antiradical agents (Manzocco et al. 2001). The degradation of sucrose and anthocyanins during heating may affect both the colour and antioxidant capacity (Tsai et al. 2005).

Kopjar et al. (2007) investigated the influence of different pectins and their concentration on the colour and texture of raspberry jams and they

concluded that different pectins and their con-centrations affect the colour and texture. In this work, for the colour and texture investigation the lowest pectin concentration (0.3%) was chosen. Next to customary strawberry jams, low-calorie strawberry jams were prepared by the replacement of sugar with fructose + aspartame and fructose syrup + aspartame. Low-calorie strawberry jams were prepared with low methoxyl pectin and low methoxyl amidated (LMA) pectin since they are used for low-calorie product formulas.

MATerIAlS AnD MeThoDS

Materials. Strawberies were bought at a lo-cal market and were kept at –20°C before use. Pectins, HM (green ribbon), LM (purple ribbon), and LMA (purple ribbon D-075) were obtained from Obipectin, Switzerland. HM (green ribbon) is high methoxyl, low setting pectin (DE ~ 60%), while the other two pectins (LM and LMA) are low methoxyl pectins (DE < 50%), LMA pectin containing 25% of amidated groups. Potassium chloride, sodium acetate, fructose, hydrochloric acid, methanol, sodium carbonate, and Folin-Ciocalteu reagents were bought from Kemika, Croatia. 2,2-diphenyl-1-picryl-hydrazil (DPPH) was obtained from Fluka, Germany, aspartame from Nutrasweet, Switzerland, and fructose syrup from Baltragro, Russia.

Preparation of strawberry jams. Strawberries (400 g), sucrose (366 g) and pectins (1.8 g) were used for the jams preparation. Citric acid was used for adjusting pH values for proper gelatinisation of pectins. pH necessary for HM was 2.9–3.1, and for LM and LMA 2.8–3.3. Strawberries, larger part of sucrose and citric acid were mixed and cooked at 80°C. Pectin was mixed with part of sucrose and added at the final stage of the jam cooking. For customary jam preparation, all 3 pectins were used. Strawberry jams were cooked until the final product contained 67% of soluble solids (deter-mined by refractometer). The time of cooking was ~ 35 min. Low-calorie strawberry jams were prepared by the replacement of 30% of sucrose with a mixture of fructose and aspartame or a mixture of fructose syrup and aspartame. The ratio of fructose/aspartame and that of fructose syrup/aspartame were 1:1 (mass ratio) the sweet-ness of fructose, fructose syrup, and aspartame compared to that of sucrose having been taken into account. Pectins, LM and LMA, were used for the

22


preparation of low-calorie jams. These samples were cooked until the final product contained 39% of soluble solids (determined by refractometer). Time of cooking was ~ 20 min at 80°C.

Measurement of monomeric anthocyanins. The extraction of anthocyanins from strawberry jams was carried out with acidified methanol. The samples were held at 4°C over night and centrifuged for 10 min at 4000 rpm. The extracts were used for the determination of monomeric anthocyanins by pH-differential method. Total monomeric an-thocyanins were expressed as cyanidin-3-glucoside

(Giusti & Wrolstad 2001). The measurements were done in triplicates.

Determination of the total phenol content . After the isolation of the phenolic compounds by the extraction method described in the previous section, the concentration of total phenols was estimated by the Folin-Ciocalteau method, with absorbance monitoring at 765 nm (Ough & Ame- rine 1988). The spectrophotometric measurement was repeated two times with each extract and the average value was interpolated on the gallic acid calibration curve and expressed as g of gallic acid per kg of the sample.

Assay of 2,2-diphenyl-1-picrylhydrazyl radical scavenging activity. Free radical scavenging activ-ity of the strawberry jam samples was measured by 2,2-diphenyl-1-picryl-hydrazil (DPPH). 0.2 ml of the sample extract was diluted with methanol and 1 ml of DPPH solution (0.5mM) was added. After 30 min, the absorbance was measured at 517 nm. The percentage of the DPPH radical scavenging was calculated by the following equation:

Scavenging activity (%) = (1 – A1/A0) × 100

where: A0 – absorbance of the blank (methanol replacing the

extract)A1 – absorbance in the presence of the sample extract

Texture analysis. The texture analysis was per-formed directly in the jar at the ambient tempera-ture with a Texture analyser TA.XTplus (Stable Mycro System, United Kingdom), using back ex-trusion procedure. On the basis of the preliminary work, the instrument working parameters were determined with the test mode compression, pre-test speed at 1.0 mm/s, test speed at 1.0 mm/s, post-test speed at 10.0 mm/s, distance 10.0 mm, trigger force at 10.0 g and data acquisition rate at 200 pp. The data were analyzsd using Texture

expert Version 1.22 Software (Stable Micro Sys-tem, United Kingdom) to measure the firmness, consistency, and cohesiveness in the samples. The measurements were done in triplicates.

Storage of strawberry jam. Strawberry jam sam-ples were stored at room temperature and at 4°C, while low-calorie jams were stored at 4°C only. Both types of strawberry jams were analysed after the preparation and after storage. Strawberry jams were analysed after 2, 4, and 6 weeks of storage, while low-calorie strawberry jams were analysed after 2 and 4 weeks due to microbial decay.

reSulTS AnD DISCuSSIon

Content of anthocyanins

The anthocyanin content was measured in straw-berry jam samples and low-calorie strawberry jam samples. The results for anthocyanin content of customary strawberry jams and low-calorie straw-berry jams are shown in Tables 1 and 2. Customary jam samples had lower anthocyanin contents than low-calorie jam samples. This difference is due to different recipes and the process conditions that cause the degradation of anthocyanins. Antho- cynin pigments are very sensitive to temperature, and a combined time/temperature process can greatly reduce the content of pigments in the final product.

Storage temperature was the main factor that caused the anthocyanins loss. During storage, anthocyanin content decreased in both customary and low-calorie jams. The loss of anthocyanins in strawberry jams was higher when the samples were stored at room temperature than at 4°C.

After the preparation, the highest content of anthocyanins was found in the strawberry jam samples prepared with LMA pectin, while the samples prepared with HM pectin had the lowest content of anthocyanins. Low-calorie strawberry jam samples prepared with LMA pectin had a higher anthocynins content than those prepared with LM pectin. It can be seen in Table 1 that anthocyanin content depended on the degree of pectin esterification. A higher degree of pectin, esterification anthocynin content was lower in both customary and low-calorie jams. This trend remained during the storage of the samples at both storage temperatures.

This can be explained by interactions of anthocy-anins and pectin. Mazzaracchio et al. (2004)

23


observed that apple pectin with a high number of methoxyl groups did not seem to interact with anthocyanins or to have bathochromic or hypso-chromic effects. Pectin could also induce a slight increase in flavilium cation that is in equilibrium with the pseudobase at the same pH. In addition, a weak hydrophobic interaction effect between methoxyl groups of the B ring of these aglycones and the methoxyl groups of pectin could occur, these would be expelled and a weak co-pigmenta-tion effect would be induced (Mazzaracchio et al. 2004). Pectins esterified to a lower DE probably interact with anthocyanins more easily because they have fewer methoxyl groups. Hubbermann et al. (2006) detected that most of their tested hy-drocolloids resulted in only small changes in colour stability, except for sodium alginate which had a significantly stabilising influence on the redness of elderberry concentrate colour. However, during storage a tendency towards the stabilisation of redness was observed for pectin, corn starch, and sodium alginate in those samples. Since alginate and

pectin are polyuronic acids, their colour stabilising effect may be based on electrostatic interactions between the anthocyanin flavilium cation and the dissociated carboxylic groups of the colloids, in a similar manner as calcium ions are bound in pectin and alginate gels (Belitz & Grosch 1999). Due to this association, anthocyanins may be prevented from water attack, which leads in turn to colour stabilisation (Hubbermann et al. 2006).

The influence of different sugar replacements was also monitored. At the beginning and after two weeks of storage, the strawberry jam samples prepared with the mixture of fructose + aspartame had a higher anthocyanins content than the sam-ples prepared with the mixture of fructose syrup + aspartame. After 4 weeks of storage, the situation was reversed, the samples prepared with the mix-ture of fructose syrup + aspartame had a higher anthocyanins content. It is known that a high concentration of sugar in fruit preserves stabilises anthocyanins (Wrolstad et al. 1990). This effect could be explained by the fact that sugar addition

Table 1. Anthocyanins content (mg/kg) of strawberry jams stored at room temperature and 4°C

Samples After preparation After 2 weeks After 4 weeks After 6 weeks

Storage at room temperature

HM+s 140.44 ± 4.21 110.13 ± 4.32 69.29 ± 3.45 61.12 ± 4.12LM+s 147.78 ± 3.28 119.98 ± 3.24 83.49 ± 3.21 76.40 ± 5.11LMA+s 175.34 ± 5.31 130.76 ± 4.12 100.19 ± 5.12 89.99 ± 5.62

Storage at 4°C

HM+s 140.44 ± 4.21 131.50 ± 3.89 118.35 ± 4.87 111.21 ± 3.21LM+s 147.78 ± 3.28 138.60 ± 4.21 128.12 ± 5.01 123.63 ± 3.89LMA+s 175.34 ± 5.31 155.93 ± 4.58 139.67 ± 4.21 132.40 ± 4.87

Mean values ± standard deviationHM – high methoxyl pectin; LM – low methoxyl pectin; LMA – low methoxyl amidated pectin; s – sucrose

Table 2. Anthocyanins content (mg/kg) of low-calorie strawberry jams stored at 4°C

Samples After preparation After 2 weeks After 4 weeks

LM+s+f+a 260.50 ± 3.54 237.92 ± 4.35 179.32 ± 5.41LMA+s+f+a 277.20 ± 5.21 266.76 ± 5.41 227.94 ± 4.32LM+s+fs+a 248.81 ± 4.23 236.71 ± 3.28 192.04 ± 3.45LMA+s+fs+a 265.51 ± 4.89 250.97 ± 4.98 237.12 ± 5.21

Mean values ± standard deviationLM – low methoxyl pectin; LMA – low methoxyl amidated pectin; s – sucrose; f – fructose; fs – fructose syrup; a – aspartame

24


reduces water activity aw. Even low changes of the sugar concentration and water activity can affect the pigment stability. Rubinskiene et al. (2005) studied the influence of sucrose, fructose, and aspartame on the stability of the anthocyanins in black currant. The impacts of aspartame and sucrose were similar; thermostability was reduced when their concentration increased from 0% to 20%, while further increase of the concentration to 40% had a positive effect on the pigments stability. With the increase of the fructose concentration, the thermostability of pigments decreased linearly (Rubinskiene et al. 2005). The results reported earlier also showed that fructose, arabinose, lactose, and sorbose had greater effects on the anthocyanins degradation as compared with those obtained with additions of glucose, sucrose, and maltose (Elbe & Schwartz 1996). Since aspartame was present in a very low concentration, its positive effect on the degradation of anthocynins could not be noticed in this case. The addition of fructose and fructose syrup had a greater effect.

Total phenol content

Total phenol content was also determined in all samples (Tables 3 and 4). It can be noted that total phenol content of all strawberry jam samples followed the trend observed with anthocyanins content. Total phenol content was higher in the jam samples pre-pared with LMA pectins than in those prepared with HM pectin (Table 3). During storage, total phenol content decreased at both temperatures.

Free radical scavenging activity

During storage of the customary strawberry jam and low-calorie jam samples free radical scaveng-ing activity decreased due to the decrease of total phenol and anthocynin contents (Tables 5 and 6). The values for free radical scavenging activity of the customary strawberry jam samples stored at room temperature and at 4°C were similar. That can be explained by the fact that at 4°C the jam samples had a higher anthocyanin content while at

Table 3. Total phenols content (g/kg) of strawberry jams stored at room temperature and 4°C



HM+s 3.39 ± 0.17 1.99 ± 0.34 1.33 ± 0.39 0.79 ± 0.04LM+s 3.96 ± 0.28 2.46 ± 0.04 1.50 ± 0.05 0.98 ± 0.06LMA+s 4.24 ± 0.08 2.59 ± 0.08 1.59 ± 0.17 1.07 ± 0.05

Storage at 4°C

HM+s 3.39 ± 0.28 2.06 ± 0.38 1.08 ± 0.06 0.73 ± 0.02

LM+s 3.96 ± 0.15 2.26 ± 0.08 1.12 ± 0.09 0.97 ± 0.08

LMA+s 4.24 ± 0.31 2.56 ± 0.05 1.26 ± 0.37 1.02 ± 0.12


Table 4. Total phenol content (g/kg) of low-calorie strawberry jams stored at 4°C




25


room temperature the formation occurred of Mail-lard reaction products possessing the antioxidant activity. It has been proven that some degradation products of anthocyanins have the antioxidant capacity (Tsai & Huang 2004). Maillard reac-tion products were also proven to be powerful as antiradical agents (Manzocco et al. 2001).

Texture analysis

Texture parameters, namely firmness, consist-ency, and cohesiveness, were different between all the treatments (Tables 7–9). After the production, the strawberry jam samples prepared with HM pectin had significantly higher values for all tex-ture parameters investigated than those prepared with LM and LMA pectins. Also, the samples prepared with LM pectin had higher values of all texture parameters than did the samples with LMA pectin.

Both formulas (with of fructose + aspartame mixture and with fructose syrup + aspartame mixture) for the low-calorie strawberry jams with

the addition of LM pectin had significantly higher values, of the texture parameters investigated. Also, low-calorie strawberry jams with the mixture of fructose + aspartame had significantly higher values of firmness, consistency, and cohesiveness than, the jams prepared with the mixture of fructose syrup + aspartame using both pectin formulas.

The type of pectin that was used exhibited a sig-nificant influence on all parameters investigated, i.e. firmness, consistency, and cohesiveness. With an increase of the degree of esterification of the pectins used, a significant increase occurred of firmness, consistency, and cohesiveness in all strawberry jam samples.

During the storage at room temperature, the values of the texture parameters significantly in-creased in all samples investigated. In the samples stored at 4°C different trends occurred. After two weeks of storage, strawberry jams revealed a significant decrease in the values of firmness and consistency. After four and six weeks an increase of these values was observed as compared to the values found after two weeks of storage. The values

Table 5. Free radical scavenging activity (%) of strawberry jams stored at room temperature and 4°C



HM+s 90.94 ± 0.22 62.51 ± 0.31 43.56 ± 0.34 37.96 ± 0.26LM+s 90.94 ± 0.04 61.13 ± 0.93 42.79 ± 0.11 38.02 ± 0.06LMA+s 90.37 ± 0.40 62.16 ± 0.04 43.54 ± 0.54 38.42 ± 0.40

Storage at 4°C

HM+s 90.94 ± 0.22 57.5 ± 0.31 42.9 ± 0.17 37.02 ± 0.54LM+s 90.94 ± 0.04 58.9 ± 0.05 42.9 ± 0.17 36.72 ± 0.02LMA+s 90.37 ± 0.40 59.85 ± 1.02 40.69 ± 0.06 36.62 ± 0.31


Table 6. Free radical scavenging activity (%) of low-calorie strawberry jams stored at 4°C




26


Table 7. Texture parameters of strawberry jams stored at room temperature

Samples Firmness (g) Consistency (g s) Cohesiveness (g)

HM+s 0 206.54 ± 15.05 1951.69 ± 94.71 180.81 ± 15.54HM+s 2 228.90 ± 8.12 2016.24 ± 94.86 338.25 ± 12.59HM+s 4 240.84 ± 9.45 2177.34 ± 85.12 392.26 ± 11.45HM+s 6 251.93 ± 10.21 2349.68 ± 74.16 500.33 ± 12.65

LM+s 0 113.11 ± 10.12 735.38 ± 90.2 169.52 ± 12.59LM+s 2 121.29 ± 10.45 869.95 ± 82.54 200.05 ± 15.12LM+s 4 170.06 ± 12.15 916.17 ± 75.28 343.22 ± 13.41LM+s 6 184.09 ± 11.45 958.46 ± 58.99 366.52 ± 12.12

LMA+s 0 109.19 ± 11.21 720.32 ± 71.64 136.32 ± 16.41LMA+s 2 115.60 ± 12.58 816.42 ± 63.21 180.83 ± 14.54LMA+s 4 125.77 ± 9.12 914.13 ± 56.41 215.77 ± 12.53LMA+s 6 145.15 ± 9.47 1038.22 ± 54.23 236.82 ± 13.12

Mean values ± standard deviationHM – high methoxyl pectin; LM – low methoxyl pectin; LMA – low methoxyl amidated pectin; s – sucrose; 0 – after prepa-ration; 2 – after 2 weeks of storage; 4 – after 4 weeks of storage; 6 – after 6 weeks of storage

Table 8. Texture parameters of strawberry jams stored at 4 °C


HM+s 0 206.54 ± 15.05 1951.69 ± 94.71 180.81 ± 15.54HM+s 2 128.98 ± 10.14 859.44 ± 85.12 205.82 ± 14.21HM+s 4 143.90 ± 12.18 1030.46 ± 64.23 290.08 ± 11.52HM+s 6 175.76 ± 11.21 1329.05 ± 73.12 306.79 ± 12.34

LM+s 0 113.11 ± 10.12 735.38 ± 90.2 169.52 ± 12.59LM+s 2 78.33 ± 8.78 542.76 ± 89.12 211.52 ± 12.32LM+s 4 109.87 ± 9.45 664.99 ± 54.25 284.55 ± 14.24LM+s 6 134.49 ± 12.14 828.27 ± 45.45 292.56 ± 11.25

LMA+s 0 109.19 ± 11.21 720.32 ± 71.64 136.32 ± 16.41LMA+s 2 80.39 ± 9.41 541.89 ± 78.12 170.82 ± 14.21LMA+s 4 94.82 ± 10.54 554.57 ± 85.12 187.62 ± 13.12LMA+s 6 103.54 ± 12.54 647.53 ± 56.12 236.77 ± 12.45

Mean values ± standard deviationHM – high methoxyl pectin; LM – low methoxyl pectin; LMA – low methoxyl amidated pectin; s – sucrose; 0 – after prepa-ration; 2 – after 2 weeks of storage; 4 – after 4 weeks of storage; 6 – after 6 weeks of storage

ConCluSIonS

Since anthocyanins are highly unstable pigments, the effect was followed of different pectins on the retention of these pigments in customary straw-berry jams and low-calorie strawberry jams. The results obtained with the jams stored at different

of cohesiveness increased in all samples stored at 4°C. In low-calorie strawberry jams, such a trend was not observed. Those samples showed an in-crease in the values of all texture parameters.

The difference between the values of the texture parameters in strawberry jams is due to different mechanisms of the gel formation.

27


temperatures are in accordance with the previous reports on other food products (Spayd & Morris 1981; Withy et al. 1993; García-Viguera et al. 1998; Manzocco et al. 2001). During the stor-age of strawberry jam samples, the degradation of anthocynins occurred. The degradation was higher in the samples stored at room temperature. The types of pectin had different influence on the retention of anthocyanins. The higher was the degree of pectin esterification, the higher loss of anthocyanins was observed.

Total phenol content followed the values of an-thocyanin content. During storage at both tem-peratures, the room temperature and 4°C, a loss of total phenols was observed. Also, free radical scavenging activity decreased during the storage at both temperatures. The values of total phenol content and free radical scavenging activity in customary strawberry jam were similar at both storage temperatures probably due to the forma-tion of Maillard reaction products with antioxidant activity at the room temperature. At 4°C, the con-tribution to these similar values is probably due to as higher anthocyanin content in the samples.

The highest values of all textural parameters showed the samples prepared with HM pectin. During storage of strawberry jam samples at the room temperature, the firmness and consistency

values increased while in the samples stored at 4°C decrease occurred of those parameters. However after two further weeks of storage, an increase oc-curred of those values in comparison to the values found after two weeks of storage. Cohesiveness in strawberry jam samples at both temperatures increased during the storage time. Low-calorie jam samples did not show this trend. The values of the texture parameters increased in low-calorie jam samples during storage at 4°C. Low-calorie strawberry jams with LM pectin had higher val-ues of the texture parameters than the samples prepared with LMA pectin.

The formulation of jams, as of any other food products, is very important since the composition of the matrix strongly influence the quality proper-ties of the foods due to the interactions between the matrix constituents, as was shown in our work. Small modifications (addition of different pectins or partial replacement of sugar) of the food matrix composition greatly affect the quality of strawberry jams, probably due to changes in the interactions between the food matrix ingredients.

r e f e r e n c e s

Abers J.E., Wrolstad R.E. (1979): Causative factors of colour deterioration in strawberry preserves during

Table 9. Texture parameters of low-calorie strawberry jams stored at 4 °C


LM+s+f+a 0 175.67 ± 8.53 1031.41 ± 54.21 55.53 ± 8.45

LM+s+f+a 2 242.14 ± 9.12 1354.52 ± 52.12 78.66 ± 9.45

LM+s+f+a 4 253.52 ± 10.23 1438.08 ± 60.14 109.39 ± 8.39

LMA+s+f+a 0 161.62 ± 10.21 737.60 ± 54.39 35.51 ± 7.87

LMA+s+f+a 2 177.86 ± 9.45 766.74 ± 60.41 69.58 ± 8.54

LMA+s+f+a 4 181.77 ± 9.23 826.63 ± 58.21 103.14 ± 9.65

LM+s+fs+a 0 124.10 ± 11.24 616.21 ± 68.21 40.32 ± 7.21

LM+s+fs+a 2 194.23 ± 10.21 988.46 ± 61.21 70.98 ± 8.45

LM+s+fs+a 4 317.05 ± 11.21 1023.77 ± 81.45 130.87 ± 8.74

LMA+s+fs+a 0 113.60 ± 10.12 640.62 ± 54.21 34.98 ± 6.54

LMA+s+fs+a 2 123.07 ± 9.54 697.34 ± 59.45 66.55 ± 8.87

LMA+s+fs+a 4 144.09 ± 9.63 742.16 ± 69.24 100.73 ± 9.46

Mean values ± standard deviationLM – low methoxyl pectin; LMA – low methoxyl amidated pectin; s – sucrose; f – fructose; fs – fructose syrup; a – aspar-tame; 0 – after preparation; 2 – after 2 weeks of storage; 4 – after 4 weeks of storage

28


processing and storage. Journal of Food Science, 44: 75–79.

Belitz H.D., Grosch W. (1999): Food Chemistry. Springer, Berlin, Heidelberg, New York.

Elbe H., Schwartz E.J. (1996): Colorants. In: Food Chemistry. Marcel Dekker, Inc., New York: 651–718.

El-Nawawi S.A., Heinkel Y.A. (1997): Factors affecting gelation of high ester citrus pectin. Process Biochem-istry, 32: 381–385.

García-Viguera C., Zafrilla P., Artés F., Romero F., Abellán P., Tomás-Barberán F.A. (1998): Colour and anthocyanin stability of red raspberry jam. Journal of Science of Food and Agriculture, 78: 565–573.

Gimenez J., Kajda P., Margomenou L., Piggott J. R., Zabetakis I. (2001): A study on the colour and sensory attributes of high-hydrostatic-pressure jams as compared with traditional jams. Journal of the Science of Food and Agriculture, 81: 1228–1234.

Giusti M.M., Wrolstad R.E. (2001): Characteriza-tion and measurement of anthocyanins by UV-visible spectroscopy. In: Current Protocols in Food Ana-lytical Chemistry. John Wiley & Sons, Inc., New York: F1.2.1–F1.2.13.

Hubbermann E.M., Heins A ., Stőckmann H., Schwarz K. (2006): Influence of acids, salt, sugars and hydrocolloids on the colour stability of anthocy-anins rich blackcurrant and elderberry concentrates. European Food Research Technology, 223: 83–90.

Kasapis S. (2002): Viscoelasticity of oxidized starch/low methoxy pectin mixtures in the presence of glucose syrup. International Journal of Food Science and Tech-nology, 37: 403–413

Kopjar M., Piližota V., Nedić Tiban N., Šubarić D., Babić J., Ačkar Đ. (2007): Effect of different pectin addition and its concentration on colour and textural properties of raspberry jam. Deutche Lebensmittel-Rundschund, 103: 164–168.

Kratz R. (1995): Recent developments in pectin tech-nology: Instant-Pectins. In: Food Technology Interna-tional Europe. The Penrose Press: 35–38.

Lewis C.E., Walker J.R.L., Lancaster J.E. (1995): Ef-fect of polysaccharides on the colour of anthocyanins. Food Chemistry, 54: 315–319.

Manzocco L., Calligaris S., Mastrocola D., Nico-li M. C., Lerici C.R. (2001): Review of non-enzymatic browning and antioxidant capacity in processed foods. Trends in Food Science & Technology, 11: 340–346.

Mazzaracchio P., Pifferi P., Kindt M., Munyane- za A., Barbiroli G. (2004): Interactions between

anthocyanins and organic food molecules in model systems. International Journal of Food Science and Technology, 39: 53–59.

Morris E.R., Gidley M.J., Murray E.J., Powell D.A., Rees D.A. (1980): Characterisation of pectin gelation under conditions of low water activity by circular dichroism, competitive inhibition and mechanical properties. International Journal of Biological Mac-romolecules, 2: 327–330.

Oakenfull D.G., Scott A.G. (1985): Gelation of high methoxy pectins. Food Technology in Australia, 37: 156–158.

Ough C.S., Amerine M.A. (1988): Phenolic Compounds. Methods for Analysis of Musts and Wines. John Wiley & Sons, Inc., New York: 196–221.

Rubinskiene M., Viskelis P., Jasutiene I., Viskeliene, R., Bobinas C. (2005): Impact of various factors on the composition and stability of black currant anthocy-anins. Food Research International, 38: 867–871.

Sandrou D.K., Arvanitoyannis I.S. (2000): Low-fat/calorie foods: Current state and perspectives. Critical Review Food Science and Nutrition, 40: 427–447.

Spayd S.E., Morris J. R. (1981): Influence of immature fruits on strawberry jam quality and storage stability. Journal of Food Science, 46: 414–418.

Tsai P. J., Huang H. P. (2004): Effect of polymerization on the antioxidant capacity of anthocyanins in roselle. Food Research International, 37: 313–318.

Tsai P.J., Delva L., Yu T.Y., Huang Y.T, Dufossé L. (2005): Effect of sucrose on the anthocyanin and antioxidant capacity of mulberry extract during high temperature heating. Food Research International, 38: 1059–1065.

Walkinshaw M.D., Arnott S. (1981): Conformations and interactions of pectins II. Models for junction zones in pectinic acid and calcium pectate gels. Journal of Molecular Biology, 153: 1075–1085.

Withy L.M., Nguyen T. T., Wrolstad R.E., Heather- bell D.A. (1993): Storage changes in anthocyanin content of red raspberry juice concentrate. Journal of Food Science, 58: 190–192.

Wrolstad R.E., Skrede G., Lea P., Enersen G. (1990): Influence of sugar on anthocyanin pigment stability in frozen strawberries. Journal of Food Science, 55: 1064–1065, 1072.

Received for publication May 29, 2008Accepted after corrections December 11, 2008


Dr. Sc. Mirela Kopjar, Faculty of Food Technology, Franje Kuhača 18, P.O. Box 709, 31 000 Osijek, Croatiatel.: + 385 31 224 300, fax: + 385 31 207 115, e-mail: [email protected]

29


Phytate Degradation during Breadmaking: The Influence of Flour Type and Breadmaking Procedures

Tomaž Požrl1, Mirela KoPJar2, Irena KureNT3, Janez HrIbar1, anja JaNeš1 and Marjan SIMčIč1

1Department of Food Science and Technology, biotechnical Faculty, university of ljubljana Jamnikarjeva, ljubljana, Slovenia; 2Faculty of Food Technology, Franje Kuhača, osijek, Croatia; 3žITo Prehrambena industrija d.d., ljubljana, Slovenia

Abstract

Požrl T., Kopjar M., Kurent I., Hribar J., Janeš A., Simčič M. (2009): Phytate degradation during breadmaking: The influence of flour type and breadmaking procedures. Czech J. Food Sci., 27: 29–38.

Phytic acid has been considered to be an antinutrient due to its ability to bind minerals and proteins, either directly or indirectly, thus changing their solubility, functionality, absorption, and digestibility. In this study, the influence of the flour type (type 500, type 850, and whole meal flour) and three different breadmaking procedures (direct, indirect, and with sourdough addition) on phytic acid was investigated. The results showed that the flour type influenced the phytic acid content. The phytic acid contents of flour type 500, type 850, and whole meal flour was 0.4380, 0.5756, and 0.9460 g/100 g dm, respectively. The dough and bread prepared from flour with a higher phytic acid content also contained higher amount of phytic acid. During fermentation and baking, degradation of phytic acid occurred. Phytic acid was also influenced by pH. Samples of lower pH had a lower phytic acid content. Dough prepared from flour type 500 and type 850 with 10% addition of sourdough had especially low phytic acid contents, and the bread prepared from the respective dough contained no phytic acid at all.

Keywords: phytic acid; flour type; breadmaking procedure

Phytic acid (myo-inositol hexaphosphoric acid) is present in substantial quantities in a variety of plant foodstuffs. It is the predominant form of phosphorus in cereals, oil-seeds, and seeds of leguminous plants and as such is the major natural phosphorus source in animal feed (Ravindran et al. 1995; Zhou & Erdman 1995; Rickard & Thompson 1997). Phytic acid has often been considered as an antinutrient due to its ability to bind minerals and proteins, either directly or indirectly, and thus change their solubility, functionality, absorption, and digest-ibility (Rickard & Thompson 1997; Bilgiçli et al. 2006; Dewettinck et al. 2008; Frontela et al. 2008; Palacios et al. 2008a, b).

The cations of interest in this regard include zinc, iron, calcium, and copper (Harland & Harland 1980; Weaver & Kannan 2001; Abebe et al. 2007). Most phytic acid-mineral complexes are insoluble at physiological pH, which is the main cause of the poor bioavailability of the mineral complexes (Tamim & Angel 2003). The bioavail-ability of proteins, vitamins, and some minerals may be restricted when complexed with phytic acid. Tamim & Angel (2003) found that the order of stability of mineral-phytate complexes was Cu2+ > Zn2+ > Co2+ > Mn2+ > Fe2+ > Ca2+. The stability of the mineral complexes depends on the number of phosphate groups on the inositol ring. Weaker

30


complexes are formed with lower inositol phos-phates (Harland & Harland 1980). Phytases are enzymes that catalyse the degradation of phytate to lower inositol phosphates and free inorganic phosphorus, depending on the extent of the en-zyme activity (Pandey et al. 2001).

Some practical and relatively inexpensive pro-cedures such as soaking, germination, and fer-mentation are reported to reduce the phytic acid content of legumes (Cheryan 1980). In general, lower pH, a longer fermentation time, and a higher yeast addition result in a more intensive degrada-tion of phytic acid (Hesseltine 1979; Lasztity & Lasztity 1990). During baking of bread the degradation of phytic acid occurs due to the ac-tivation of the phytase present in flour and the high temperatures. Breadmaking is a multiphase procedure, and the most important phases are fermentation and baking. A high water content in the dough increases the hydrolysis of phytic acid (Türk & Sandberg 1992). The most important factor is the acidity of the dough. The optimal pH for phytase activity in wheat dough is 4.5, and the optimal temperature is 55°C (Fretzdorff & Brummer 1992). The rate of hydrolysis and the consequent decrease of the phytic acid content depend on the phytase activity, temperature, pH, water content, fermentation time, added enzymes, and other parameters (Türk & Sandberg 1992; Penella et al. 2008). The amount of hydrolysed phytic acid in different bread types varies between 13–100% (Lopez et al. 2001). The addition of yeast may increase the amount of hydrolysed phytic acid (Türk et al. 1996). Phytic acid hydrolysis is a consequence of the activity of phytase which is present in wheat and yeasts, and probably due to the presence of the microorganisms that are involved in dough fermentation (Giovanelli & Polo 1994).

A reduction of the phytate content can be achieved by adding exogenous phytate-degrad-ing enzymes (Türk & Sandberg 1992; Palacios et al. 2008a, b). Phytases are produced by a wide range of plants, bacteria, fungi, and yeasts (Pan-dey et al. 2001). Phytases from microbial sources are the most promising ones for the production on a commercial level. Many of them were proven to have good properties for their use as starters in the breadmaking process (Palacios et al. 2008b).

Many authors report that the addition of sour-dough and lactic acid bacteria with high phytate degrading activity during the breadmaking proc-

ess can reduce the phytic acid content in bread (Katina et al. 2005; Corsetti & Settanni 2007; Palacios et al. 2008a, b).

The objective of this study was to investigate the influence of different flour types (500, 850, and whole meal) and different breadmaking pro-cedures (direct, indirect, and with the addition of sourdough) on phytic acid degradation during the bread preparation.

MATerIAls AnD MeThoDs

Material. The basic material was soft wheat (hectolitre weight 82.02 kg/hl, 14% water content, 13,6% protein content, 34 ml Zeleny sedimenta-tion value), which was milled to flour type 500, type 850, and whole meal flour. The soft wheat milling process took place on a Bühler AG (Uzwil, Switzerland), commercial mill with the combina-tion of five-and eight roller mills after 18 h of conditioning (water content 15.5%). The yield of whole meal flour was 99% and that of flours 78% (55% flour type 500, 23% flour type 850). All three types of flour were prepared from the same wheat to avoid the influence of biodiversity on the wheat properties. From these three types of flour, bread was prepared by three different technologi-cal procedures. The lyophilised yeast Saf Instant (composition: Saccharomyces cerevisiae, rehydrat-ing agent) from S. I. Lesaffre (Marcq en Baroeul, France) and the lyophilised starter for sourdough La1 (composition: Pediococcus acidilacti, lactose support, Saccharomyces cerevisiae) from Lalle-mand S. A. (Blagnac Cedex, France) were used. Ash content, protein content, and falling number are presented in Table 1.

Breadmaking procedure. The ingredients for all bread samples were mixed in an Diosna SP 12 spiral mixer (Diosna Dierks & Söhne, GmbH, Osnabrück, Germany) for 6 min in 15 rpm bowl and a 105 rpm spiral velocity, and then for 3 min in 30 rpm bowl and at 210 rpm spiral velocity. After mixing, the dough rested in the mixer bowl for 20 minutes. It was then divided (500 g) and put in moulds for fermentation and baking. Fermentation took place in Gostol-Gopan fermentation cham-ber FK (Gostol-Gopan, Nova Gorica, Slovenia) at 76% relative humidity. For baking, a Miwe aero CS oven (Miwe Michael Wenz GmbH, Arnstein, Germany) was programmed as follows: 5 min at 230°C with steaming, than 20 min at 190°C, and 4 min at 200°C.

31


Sourdough was prepared from all three types of flour as follows: 1000 g of flour, 1500 g of water, and 1 g of lyophilised starter for sourdough were mixed and fermented for 20 h at a temperature of 32°C. The pH value of the sourdough was 3.8.

Direct breadmaking procedure. In the direct breadmaking procedure, the dough rested after mixing in the mixer bowl for 20 min and then fer-mented for 30 min in the fermentation chamber. In one experiment, the fermentation was conducted at 20°C, and in another at 30°C. The dough formula was the following: flour (1000 g), water (680 g), yeast (20 g), salt (25 g), and sugar (20 g). The dough temperature in the first experiment was 20°C and in the second 30°C. After mixing, fermentation and baking, samples for analyses were taken.

Indirect breadmaking procedure. The indirect breadmaking procedure was a procedure with pro-longed fermentation, where – after mixing – the dough rested in the mixer bowl for 20 min and fermented for 30 min in the fermentation chamber at 20°C. After mixing and a short fermentation, samples for analysis were taken. The prolonged fermentation in the first experiment lasted for 3 h and in the second for 6 h at 20°C. Every hour the dough was kneaded and samples for analysis were taken. The dough formula was the following: flour (2000 g), water (1340 g), yeast (40 g), salt (50 g), and sugar (40 g). The dough temperature was 20°C. After baking, samples for analysis were taken again.

Procedure with sourdough addition. The third breadmaking procedure involved the addition of 5% or 10% of sourdough to the dough. The dough formula was the following: flour (900 g if 10% of sourdough was added and 950 g if 5% of sourdough was added), sourdough (100 g if 10% of sourdough was added and 50 g if 5% of sourdough was added), water (680 g), yeast (20 g), salt (25 g), and sugar (20 g). After mixing, the dough rested in the mixer for 20 min and fermented for 30 min in the fermentation chamber at 20°C. The dough temperature was 20°C. After mixing, fermentation and baking, samples for analysis were taken.

Sampling. All samples for phytic acid determina-tion were frozen by submerging in liquid nitrogen, packed in PE bags, and stored in a freezer at –25°C for a week until analysis. The determination of dry matter and pH was conducted immediately after the baking and cooling of the bread. Dry matter, pH, and phytic acid content were determined in all samples (flour, dough, fermented dough, and baked bread, bread crust and crumb). Bread crust and crumb were taken as separate samples. Bread crust and crumb were separated with a sharp knife approximately 3 mm from the upper part of the mould type of bread on the border of the intensive brown colour change.

Determination of dry matter. Dry matter (dm) was determined indirectly according to Amtlichen Sammlung von Untersuchungsverfahren, Methode L 17.00–1 (1982). Most results are expressed on the dry matter basis.

Determination of pH. pH was determined by a potentiometric method, according to AOAC Official Method 943.02 (1995).

Determination of phytic acid content. Phytic acid was measured on an HP 8453 spectrophotom-eter using the colorimetric method according to Haugh and Lantzsch (1983) at 519 nm with slight modifications. The phytic acid in samples was extracted with a solution of HCl (0.4M) and precipitated with a solution of FeIII (ammonium iron (III) sulphate ·12 H2O).The results are ex-pressed as g phytic acid/100 g dry matter.

Statistical analyses. The data obtained in deter-mination of the dry matter content, pH, and phytic acid content were statistically analysed by means of the program package SAS/STAT (SAS Software. Vers. 8.01, 1999). The results were expresed as mean values of four replicates ± standard deviation. A multivariate analysis of variance (MANOVA) with the interaction by the GLM procedure was used. The means for the experimental groups were obtained using the Duncan procedure and were compared at 5% probability level. The relation-ships between pH values and PA contents were

Table 1. Ash and protein contents, Falling Number of flour types 500, 850 and whole meal flour

Type 500 Type 800 Whole flour

Ash/(dm) (%) 0.535 0.869 1.828

Protein content/(dm) (%) 12.4 12.8 13.6

Falling Number (s) 366 352 385

32


assessed by Pearson correlation coefficients, using the CORR procedure.

resulTs AnD DIscussIon

The phytic acid contents of flour types 500, 850, and whole meal flour were 0.4380 g/100 g dm, 0.5756 g/100 g dm, and 0.9460 g/100 g dm, re-spectively. Comparing the results for the phytic acid content of the flours with those of dough and bread prepared from the respective flours, it can be seen that dough and bread (Tables 2–4) prepared from flour with a higher phytic acid content also contained higher amounts of phytic acid, regard-less of the breadmaking procedure.

Direct breadmaking procedure

The direct breadmaking procedure was con-ducted at two fermentation temperatures, 20°C and 30°C. Table 2 presents the results obtained for dry matter content, pH, and phytic acid content in all samples (dough, dough after fermentation, bread crumb and crust) prepared from all three types of flour (type 500, 850, and whole meal flour) by the direct breadmaking procedure. The dry matter content of the samples investigated was the lowest in dough regardless of the flour type used at both fermentation temperatures. The highest dry matter content was found in bread crust, also regardless of the flour type and fermentation temperature. Fermentation temperature did not have so pro-nounced an influence on the dry matter content of dough, fermented dough and bread crumb as it had on bread crust. There was a significant dif-ference in the dry matter content between bread crust prepared with flour type 850 and whole meal flour at 20°C and 30°C. Bread crust prepared from flour type 500 had the same dry matter content (69.9%) regardless of the fermentation tempera-ture, 20°C or 30°C.

In the case of pH, the results it show that pH values were the highest in dough, then followed by dough after fermentation, the crumb of bread, and the lowest values were found in the crust regardless of the flour type used. Also, it can be seen that the type of flour had an influence on the pH of samples. The lowest pH values were in the samples prepared with flour type 500 while the highest values were in the samples prepared with whole meal flour when fermentation was conducted at 20°C. When fermentation was conducted at 30°C, the same

tendency was observed. The lowest pH values were found in the samples prepared with flour type 500 and the highest values in the samples prepared with whole meal flour. The temperature of fermentation had an influence on pH, and from the results it can be seen that the samples fermented at 20°C had a higher pH than those fermented at 30°C, regardless of the flour type.

The results presented in Table 2 reveal that the fermentation temperature influenced the phytic acid content since all samples prepared at 20°C had a higher phytic acid content than those prepared at 30°C. The type of flour used for the sample preparation had a very high influence on the phytic acid content. All samples prepared from flour type 500 had the lowest phytic acid content, while the samples prepared from whole meal flour had the highest phytic acid content. The highest phytic acid content was found in dough regardless of the fermentation temperature and flour type, followed by fermented dough, bread crumb, while the lowest phytic acid content was found in bread crust.

Indirect breadmaking procedure

The indirect breadmaking procedure is a process with prolonged fermentation. Fermentation was conducted at 20°C for 6 hours. The results for the dry matter content, pH, and phytic acid content in the samples made from all three types of flour (type 500, 850 and whole meal flour) prepared by the indirect breadmaking procedure at the fermen-tation temperature 20°C are presented in Table 3. The lowest dry matter content was found in dough, followed by fermented dough and bread crumb, and the highest dry matter content was found in bread crust regardless of the flour type used. The difference in the dry matter content during fermentation was also determined every hour for 6 hours. At the beginning (fermented dough after 1 h), the lowest dry matter content was found but during fermentation it increased, regardless of the flour type used, so it can be concluded that the fermentation time had an influence on the dry mat-ter content of fermented dough. The fermentation time of 3 or 6 h, did not influence the dry matter content of bread crumb, while it did influence the dry matter content of bread crust.

As to pH, dough had the highest pH value; dur-ing fermentation the pH decreased, and it also decreased after the baking of bread. The type of flour had a significant influence on the pH of

33


Table 2. Dry matter contents, pH, and phytic acid (PA) contents in samples made from three types of flour by the direct breadmaking procedure

ParametersFermentation temperature

(°C)Sample

FlourPFtype 500 type 850 whole meal

Dry matter (%)

20

dough 46.5 ± 0.093d,y 46.8 ± 0.102c,x 46.8 ± 0.004d,x 0.0003

fermented dough 46.7 ± 0.078c,z 47.1 ± 0.050c,y 47.2 ± 0.009c,x < 0.0001

bread crumb 47.6 ± 0.135b,y 47.9 ± 0.122b,x 47.9 ± 0.011b,x 0.0003

bread crust 69.9 ± 0.293a,x 70.7 ± 0.943a,x 69.9 ± 0.308a,x 0.1725

PS < 0.0001 < 0.0001 < 0.0001

30

dough 46.3 ± 0.096c,z 46.6 ± 0.136d,y 46.8 ± 0.131d,x 0.0013

fermented dough 46.6 ± 0.091c,z 46.9 ± 0.091c,y 47.2 ± 0.043c,x <0.0001

bread crumb 47.5 ± 0.101b,y 47.7 ± 0.050b,x 47.9 ± 0.186b,x 0.0050

bread crust 69.9 ± 0.406a,x 69.0 ± 0.307a,y 69.1 ± 0.098a,y 0.0079

PS < 0.0001 < 0.0001 < 0.0001

pH

20

dough 5.96 ± 0.013a,z 6.06 ± 0.005a,y 6.35 ± 0.005a,x < 0.0001

fermented dough 5.90 ± 0.008b,z 6.01 ± 0.006b,y 6.28 ± 0.005b,x < 0.0001

bread crumb 5.73 ± 0.005c,z 5.89 ± 0.006c,y 6.18 ± 0.006c,x < 0.0001

bread crust 5.67 ± 0.014d,z 5.82 ± 0.008d,y 6.14 ± 0.006d,x < 0.0001

pS < 0.0001 < 0.0001 < 0.0001

30

dough 5.94 ± 0.005a,z 6.03 ± 0.005a,y 6.31 ± 0.005a,x < 0.0001




PS < 0.0001 < 0.0001 < 0.0001

PA(g/100 g dm)

20

dough 0.44 ± 0.008a,z 0.58 ± 0.006a,y 0.95 ± 0.004a,x < 0.0001




PS < 0.0001 < 0.0001 < 0.0001

30

dough 0.41 ± 0.001a,z 0.55 ± 0.005a,y 0.91 ± 0.002a,x < 0.0001




PS < 0.0001 < 0.0001 < 0.0001

F – effect of flour type, S – effect of sampling; levels of significance: P ≤ 0.05 statistically significant, P ≤ 0.001 highly statisti-cally significant, P > 0.05 statistically not significant; x, y, zmeans with a different superscript within rows (effect of flour type) differ significantly (P ≤ 0.05); a, b, c, dmeans with a different superscript within columns (effect of sampling) differ significantly (P ≤ 0.05)

34


Table 3. Dry matter contents, pH, and phytic acid (PA) contents in samples made from three types of flour by the indirect breadmaking procedure

Parameters Sample Flour type 500 Flour type 850 Whole meal flour PF

Dry matter (%)

dough 46.5 ± 0.009f,z 46.6 ± 0.069h,y 4.7 ± 0.046g,x < 0.0001fermented dough – 1 h 46.8 ± 0.095e,y 46.9 ± 0.076g,x 47.0 ± 0.005f,x 0.0037 – 2 h 46.9 ± 0.092e,y 47.0 ± 0.062fg,x 47.1 ± 0.078f,x 0.0027 – 3 h 47.0 ± 0.008e,z 47.1 ± 0.078f,y 47.3 ± 0.055f,x 0.0002 – 4 h 47.2 ± 0.001d,z 47.3 ± 0.074e,y 47.7 ± 0.050e,x < 0.0001 – 5 h 47.5 ± 0.165c,x 47.9 ± 0,016c,x 47.7 ± 0.502de,x 0.3489 – 6 h 47.3 ± 0.201d,y 47.6 ± 0.050d,x 47.8 ± 0.146de,x 0.0055bread crumb – 3 h 47.6 ± 0.229c,y 47.9 ± 0.003c,x 48.60 ± 0.002cd,x 0.002 – 6 h 47.8 ± 0.264c,y 47.9 ± 0.007c,xy 48.1 ± 0.094c,x 0.0354 – 3 h 70.1 ± 0.151b,y 70.8 ± 0.183b,x 70.9 ± 0.175b,x < 0.0001 – 6 h 72.2 ± 0.209a,y 72.5 ± 0.134a,xy 72.5 ± 0.318a,x 0.0705

PS < 0.0001 < 0.0001 < 0.0001

pH

dough 5.96 ± 0,005a,z 6.05 ± 0.008a,y 6.35 ± 0.006a,x < 0.0001fermented dough – 1 h 5.90 ± 0,005b,z 6.01 ± 0.005b,y 6.29 ± 0.005b,x < 0.0001 – 2 h 5.82 ± 0,013c,z 5.97 ± 0.005c,y 6.22 ± 0.005c,x < 0.0001 – 3 h 5.75 ± 0,000d,z 5.94 ± 0.005d,y 6.18 ± 0.006d,x < 0.0001 – 4 h 5.71 ± 0,008e,z 5.86 ± 0.005e,y 6.12 ± 0.005e,x < 0.0001 – 5 h 5.68 ± 0,008f,z 5.83 ± 0.005f,y 6.10 ± 0.005f,x < 0.0001 – 6 h 5.62 ± 0,005h,z 5.78 ± 0.008h,y 6.08 ± 0.006g,x < 0.0001bread crumb – 3 h 5.66 ± 0,008g,z 5.80 ± 0.006g,y 6.07 ± 0.005g,a < 0.0001 – 6 h 5.60 ± 0,000i,z 5.74 ± 0.005i,y 6.01 ± 0.006i,x < 0.0001 – 3 h 5.61 ± 0,005i,z 5.78 ± 0.008h,y 6.02 ± 0.008h,x < 0.0001 – 6 h 5.58 ± 0,005j,z 5.71 ± 0.008j,y 5.98 ± 0.008j,x < 0.0001

PS < 0.0001 < 0.0001 < 0.0001

PA(g/100 g dm)

dough 0.43 ± 0.005a,z 0.57 ± 0.005a,y 0.94 ± 0.001a,x < 0.0001fermented dough – 1 h 0.37 ± 0.004b,z 0.52 ± 0.005b,y 0.88 ± 0.002b,x < 0.0001 – 2 h 0.30 ± 0.007c,z 0.44 ± 0.011c,y 0.81 ± 0.001c,x < 0.0001 – 3 h 0.25 ± 0.005d,z 0.40 ± 0.009d,y 0.75 ± 0.003d,x < 0.0001 – 4 h 0.18 ± 0.001e,z 0.35 ± 0.004e,y 0.69 ± 0.011e,x < 0.0001 – 5 h 0.14 ± 0.001f,z 0.32 ± 0.003f,y 0.65 ± 0.003f,x < 0.0001 – 6 h 0.10 ± 0.001g,z 0.27 ± 0.007g,y 0.60 ± 0.001h,x < 0.0001bread crumb – 3 h 0.10 ± 0.004g,z 0.27 ± 0.007g,y 0.61 ± 0.001g,x < 0.0001 – 6 h 0.07 ± 0.002h,z 0.20 ± 0.004h,y 0.53 ± 0.001i,x < 0.0001 – 3 h 0.02 ± 0.001i,z 0.07 ± 0.001i,y 0.21 ± 0.002j,x < 0.0001 – 6 h 0.01 ± 0.001i,z 0.07 ± 0.001i,y 0.18 ± 0.003k,x < 0.0001

PS < 0.0001 < 0.0001 < 0.0001

F – effect of flour type, S – effect of sampling; levels of significance: P ≤ 0.05 statistically significant, P ≤ 0.001 highly sta-tistically significant, P > 0.05 statistically not significant; x, y, zmeans with a different superscript within rows (effect of flour type) differ significantly (P ≤ 0.05); a,b,c,d,e,f,g,h,i,j,kmeans with a different superscript within columns (effect of sampling) differ significantly (P ≤ 0.05)

35


samples. The samples prepared from whole meal flour had the highest pH, while the sample prepared from flour type 500 had the lowest pH.

Dough had the highest phytic acid content. During 6-h fermentation, the phytic acid con-tent decreased in dough made from all types of flour. Bread crumb and especially bread crust had low phytic acid contents. The flour type had a very strong influence on the phytic acid content in all samples, from dough to bread. Flour type 500 samples had the lowest phytic acid contents, while those prepared from whole meal flour had the highest contents of phytic acid.

Breadmaking procedure with sourdough addition

Table 4 presents the results obtained for the third breadmaking procedure where sourdough (5% and 10%) was added. The fermentation temperature was 20°C and the samples were made of all three types of flour. The dry matter content was the lowest in the dough, followed by the fermented dough and bread crumb, and the highest dry content was in bread crust, regardless of sourdough addition. All samples with 10% of sourdough addition, except bread crust, had a higher dry matter content than those prepared with 5% sourdough addition. The bread crust made with 10% sourdough addition had a 2% lower dry matter content than that prepared with 5% sourdough addition. The flour type also influenced the dry matter content. With the samples prepared at 5% sourdough addition, the highest dry matter content was found in those prepared from whole meal flour, while the samples prepared with flour type 500 had the lowest dry matter content. The samples prepared with 10% sourdough addition did not have the same tendency. In this case, the samples prepared from whole meal flour had the lowest dry matter content, while those prepared from flour type 500 had the highest one. The only exception was bread crust.

pH was the highest in the dough and decreased with fermentation and baking, regardless of the sourdough addition. The samples with 10% of sourdough addition had a lower pH than those with 5% of sourdough addition. The flour type also influenced pH. Type 500 flour samples had the lowest pH, while those prepared from whole meal flour samples had the highest pH.

The highest content of phytic acid was found in dough, regardless of the bread type and sour-

dough addition. As was the case with the samples prepared by the direct and indirect breadmaking procedures, the same tendency could be observed with those prepared with sourdough addition. The samples prepared with flour type 500 had the low-est phytic acid content, while the highest phytic acid content was found in the samples prepared with whole meal flour. The addition of 10% of sourdough caused a very high decrease of phytic acid content in all samples. Interestingly, in some samples (fermented dough prepared from flour type 500, bread crumb and bread crust prepared from type 500 and type 850 flour) phytic acid was not detected at all.

comparison of breadmaking procedures

Comparing the dry matter contents of dough, fermented dough, and bread crumb prepared by all three breadmaking procedures investigated (direct, indirect, and with sourdough addition), it is obvious that the samples prepared with the addition of sourdough had a higher dry matter content than those prepared by the direct and indirect procedures. Interestingly, the bread crust prepared with the addition of sourdough had a much lower dry matter content than the bread crust of the samples prepared by the direct and indirect procedures.

pH in all samples prepared with the use of sour-dough addition had lower values than in the samples prepared by the direct and indirect procedures. pH was especially low when a higher amount of sourdough was added.

As to the phytic acid content, the samples pre-pared with the addition of sourdough had a lower content of it than the other samples. With 10% sourdough addition, phytic acid content signif-icantly decreased. The degradation of phytate during wheat bread making has been intensively investigated (Fretzdorff & Brummer 1992; Türk & Sandberg 1992). During the transformation of flour into dough and finally into bread, the phytate content decreases as a consequence of the activity of native phytase. The reduction of the phytate content during bread making depends on the phytase action, which in turn is influenced by several other factors, such as the degree of flour extraction, proofing time and temperature, acidity of the dough, yeast, enzymes added to the dough, and the presence of calcium salts (Türk & Sandberg 1992).

36


Table 4. Dry matter contents, pH, and phytic acid (PA) contents in samples made from three types of flour by the breadmaking procedure with the addition of sourdough

Parameters Addition of sourdough (%) Sample

FlourPFtype 500 type 850 whole meal

Dry matter (%)

5

dough 48.0 ± 0.099d,y 48.5 ± 0.081d,x 48.6 ± 0.007d,x < 0.0001

fermented dough 48.3 ± 0.113c,y 48.8 ± 0.002c,x 48.9 ± 0.004c,x < 0.0001

bread crumb 49.1 ± 0.091b,y 49.7 ± 0.005b,x 49.7 ± 0.053b,x < 0.0001

bread crust 66.3 ± 0.037a,z 66.3 ± 0.054a,y 66.7 ± 0.005a,x < 0.0001

PS < 0.0001 <0.0001 < 0.0001

10

dough 49.9 ± 0.021d,x 49.7 ± 0.004d,y 49.4 ± 0.004d,z < 0.0001

fermented dough 50.1 ± 0.003c,x 49.9 ± 0.002c,y 49.7 ± 0.049c,z < 0.0001

bread crumb 50.9 ± 0.025b,x 50.7 ± 0.089b,y 50.4 ± 0.003b,z < 0.0001

bread crust 64.2 ± 0.035a,y 64.2 ± 0.028a,y 64.6 ± 0.003a,x < 0.0001

PS < 0.0001 < 0.0001 < 0.0001

pH

5

dough 5.86 ± 0.008a,z 5.98 ± 0.013a,y 6.26 ± 0.005a,x < 0.0001




PS < 0.0001 < 0.0001 < 0.0001

10

dough 5.56 ± 0.010a,z 5.69 ± 0.005a,y 5.97 ± 0.005a,x < 0.0001




PS < 0.0001 < 0.0001 < 0.0001

PA(g/100 g dm)

5

dough 0.34 ± 0.008a,z 0.47 ± 0.015a,y 0.83 ± 0.007a,x < 0.0001




PS < 0.0001 < 0.0001 < 0.0001

10

dough 0.05 ± 0.009a,z 0.14 ± 0.006a,y 0.44 ± 0.007a,x < 0.0001


bread crumb 0.00 ± 0.000b,y 0.00 ± 0.000c,y 0.15 ± 0.007c,x < 0.0001

bread crust 0.00 ± 0.000b,y 0.00 ± 0.000c,y 0.03 ± 0.002d,x < 0.0001

PS < 0.0001 < 0.0001 < 0.0001

F – effect of flour type, S – effect of sampling; levels of significance: P ≤ 0.05 statistically significant, P ≤ 0.001 highly statisti-cally significant, P > 0.05 statistically not significant; x, y, zmeans with a different superscript within rows (effect of flour type) differ significantly (P ≤ 0.05); a, b, c, dmeans with a different superscript within columns (effect of sampling) differ significantly (P ≤ 0.05)

37


Fretzdorff and Brummer (1992) found that pH was the most important factor in reducing the content of phytic acid during bread making as phytic acid in doughs with pH 4.3 to 4.6 was more effec-tively reduced than in doughs with higher pH.

The correlation between pH and phytic acid content can be made. The results showed that the samples with higher pH had higher phytic acid contents, so it can be concluded that phytic acid content depends on the pH of the sample. A very high correlation was found between the pH value and phytic acid content (r = 0.93, P < 0.0001). In all samples with a lower pH, phytic acid content was also lower. The influence of lower pH could be observed especially when sourdough was added. With a low (5%) addition of sourdough, the de-crease of phytic acid content in dough was up to 0.10 g/100 g dm, and with a higher (10%) addition of sourdough even a higher decrease occurred of phytic acid content in dough, up to 0.50 g/100 g dm according to the flour type tested. Bread mak-ing with the addition of sourdough may result in more suitable pH conditions for the degradation of phytate by endogenous phytases, and the sour-dough may also be a source of microbial phytases. Lopez et al. (2001) found that the phytate content was more efficiently reduced in wheat sourdough bread (62%) as compared to yeast fermented bread (38%). Furthermore, prolonged fermentation with sourdough increased acidification and led to an improved solubility of magnesium and phospho-rus. Reale et al. (2004) also found an increased degradation of phytic acid in sourdough wheat bread made with the use of a long fermentation time as compared to yeast fermented bread using a short fermentation time.

Leenhardt et al. (2005) also showed that a slight acidification to pH 5.5 of bread dough by either sourdough or lactic acid addition promoted a significant phytate breakdown.

conclusIon

In this study, phytic acid degradation was inves-tigated in the dependence on the flour type (500, 850, whole meal flour) and different bread making procedures (direct, indirect, and with sourdough addition). During breadmaking, the degradation of phytic acid occurred, its level depending on the initial phytic acid content. The flour type influenced the phytic acid content. The highest phytic acid content was found in the samples prepared from

whole meal flour, while those prepared from flour type 500 had the lowest content of it. pH had a significant influence on phytic acid degradation. The samples with lower pH had lower phytic acid contents, which was especially noticeable in the samples prepared with sourdough addition. The fermentation temperature in the direct breadmaking procedure also influenced the phytic acid content. When a higher (30°C) fermentation temperature was used, the phytic acid content was lower. The amount of the added sourdough also influenced the phytic acid content. The higher addition of sourdough resulted in a lower phytic acid content.

r e f e r e n c e s

Abebe Y., Bogale A., Hambidge K.M., Stoecker B.J., Bailey K., Gibson R.S. (2007): Phytate, zinc, iron and calcium content of selected raw and prepared foods consumed in rural Sidama, Southern Ethiopia, and implications for bioavailability. Journal of Food Composition and Analysis, 20: 161–168.

Amtlichen Sammlung von Untersuchungsverfahren nach 35 LMGB, Methode L 17.00–1 (1982): Bestimmung des Trocknungsverlustes in Brot einschliesslich Kleinge-bäck aus Brotteigen. Beuth Verlag, Berlin.

AOAC Official Method 943.02. pH of Flour, Potentiomet-ric Method (1995): In: Cunniff P. (ed.): Official Meth-ods of Analysis of AOAC International. Vol. 2. 16th Ed. Gaithersburg, AOAC International, Chapter 32: 11.

Bilgiçli N., Elgün A., Türker S. (2006): Effects of vari-ous phytase sources on phytic acid content, mineral extractability and protein digestibility of tharana. Food chemistry, 98: 329–337.

Cheryan M. (1980): Phytic acid interaction in food system. Critical Review of Food Science and Nutri-tion, 13: 287–334.

Corsetti A., Settanni L. (2007): Lactobacilli in sour-dough fermentation. Food Research International, 40: 539–558.

Dewettinck K., Van Bockstaele F., Kühne B., van de Walle D., Courtens T.M., Gellynck X. (2008): Nutritional value of bread: Influence of processing, food interaction and consumer perception. Journal of Cereal Science, 48: 243–257.

Fretzdorff B., Brummer J.M. (1992): Reduction of phytic acid during breadmaking of whole-meal breads. Cereal Chemistry, 69: 266–270.

Frontela C., Garcıa-Alonso F.J., Ros G., Martınez C. (2008): Phytic acid and inositol phosphates in raw flours and infant cereals: The effect of processing. Journal of Food Composition and Analysis, 21: 343–350.

38


Giovanelli G., Polo R. (1994): Formation of fermenta-tion products and reduction in phytic acid in wheat and rye flour breadmaking. Italian Journal of Food Science, 1: 71–83, 89.

Harland B.F., Harland J. (1980): Fermentative reduc-tion of phytate in rye, white and whole wheat breads. Cereal Chemistry, 57: 226–229.

Haug W., Lantzch H.J. (1983): Sensitive method for the rapid determination of phytate in cereals and cereal products. Journal of Science Food and Agriculture, 34: 1423–1426.

Hesseltine C.W. (1979): Some important fermented foods of Mid-Asia, the Crumb East and Africa. Journal of American Oil Chemists’ Society, 56: 367–374.

Katina K., Arendt E., Liukkonen K.H., Autio K., Flander L., Poutanen K. (2005): Potential of sour-dough for healthier cereal products. Trends in Food Science & Technology, 16: 104–112.

Lasztity R., Lasztity L. (1990): Phytic acid in cereal technology. In: Advances in Cereal Science and Tech-nology. American Association of Cereal Chemists Publishers, St. Paul: 309–371.

Leenhardt F., Levrat-Verny M.A., Chanliaud E., Rémésy C. (2005): Moderate decrease of pH by sour-dough fermentation is sufficient to reduce phytate content of whole wheat flour through endogenous phytase activity. Journal of Agricultural and Food Chemistry, 53: 98–102.

Lopez H.W., Krespine V., Guy C., Messager A., De-migne C., Remesy C. (2001): Prolonged fermentation of whole wheat sourdough reduces phytate level and increases soluble magnesium. Journal of Agricultural and Food Chemistry, 49: 2657–2662.

Palacios M.C., Haros M., Sanz Y., Rosell C.M. (2008a): Selection of lactic acid bacteria with high phytate degrading activity for application in whole wheat breadmaking. LWT-Food Science and Technol-ogy, 41: 82–92.

Palacios M.C., Haros M., Rosell C.M., Sanz Y. (2008b): Selection of phytate-degrading human bi-fidobacteria and application in whole wheat dough fermentation. Food Microbiolog, 25: 169–176.

Pandey A., Szakacs G., Soccol C., Rodriguez-Leon J., Soccol V. (2001): Production, purification and properties of microbial phytases. Bioresource Tech-nology, 77: 203–214.

Penella J.M., Collar C. (2008): Effect of wheat bran and enzyme addition on dough functional perform-ance and phytic acid levels in bread. Journal of Cereal Science, 48: 715–721.

Ravindran V., Bryden W.L., Kornegay E.T. (1995): Phytates: occurrence, bioavailability and implications in poultry nutrition. Poultry and Avian Biology Review, 6: 125–143.

Reale A., Mannina L., Tremonte P., Sobolev A.P., Succi M., Sorrentino E., Coppola R. (2004): Phytate degradation by lactic acid bacteria and yeasts during the wholemeal dough fermentation: a 31P NMR study. Journal of Agricultural and Food Chemistry, 52: 6300–6305.

Rickard E.S., Thompson L.U. (1997): Interactions and effects of phytic acid. In: Antinutrients and Phy-tochemicals in Foods. American Chemical Society, Washington.

Tamim N.M., Angel R. (2003): Phytate phosphorus hydrolysis as influenced by dietary calcium and micro-mineral source in broiler diets. Journal of Agricultural and Food Chemistry, 51: 4687–4693.

Türk M., Carlsson N.G., Sandberg A.S. (1996): Re-duction in the levels of phytate during wholemeal bread making; effect of yeast and wheat phytases. Journal of Cereal Science, 23: 257–264.

Türk M., Sandberg A.S. (1992): Phytate degradation during breadmaking: Effect of phytase addition. Jour-nal of Cereal Science, 15: 281–294.

Weaver C.M., Kannan S. (2001): Phytate and min-eral bioavailability. In: Reddy N.R. Sathe S.K.: Food Phytates. CRC Press, Boca Raton: 211–223.

Zhou J.R., Erdman, J.W. (1995): Phytic acid in health and disease. Critical Review of Food Science and Nu-trition, 35: 495–508.

Received for publication July 28, 2008Accepted after corrections January 8, 2008


M. Sc. Food. Tech Tomaž Požrl, University of Ljubljana Jamnikarjeva, Biotechnical Faculty, Department of Food Science and Technology, Jamnikarjeva 101, 1000 Ljubljana, Slovenia tel./fax: + 386 142 311 61, e-mail: [email protected]

39


Trace Elements Species Fractionation in Rye Flour and Rye (Secale cereale L.) Seedlings

Jan Polák1, oto MeStek1, Richard koPlík2, Jiří ŠaNtRůček3, Jana koMíNkoVá1 and Milan kodíček3

1department of analytical Chemistry, Faculty of engineering, 2department of Food Chemistry and analysis and 3department of Biochemistry and Microbiology, Faculty

of Food and Biochemical technology, Institute of Chemical technology in Prague, Prague, Czech Republic

Abstract

Polák J., Mestek O., Koplík R., Šantrůček J., Komínková J., Kodíček M. (2009): Trace elements species fractionation in rye flour and rye (Secale cereale L.) seedlings. Czech J. Food Sci., 27: 39–48.

The fractionation of Cd, Cu, Mo, Ni, and Zn species in extracts of rye (cv. Fernando) seedlings (grown up in both standard and Cd2+-enriched medium) and rye flour was performed by SEC/ICP−MS method. The majority of Cu, Zn, and Ni in all samples were bound in the 1–2 kDa fraction. Molybdenum occurred in all samples in the fraction of 3 kDa. During five days of cultivation in a solution of 30 µmol/l Cd2+, the plants accumulated as much as 5 mg/kg fresh matter of Cd, but its soluble portion represented only 12–15%. The prevailing portion of Cd complexes was contained in the fraction of 3 kDa, while the minor part occurred in the fraction of 20 kDa. The speciation of elevated Cd in plants differs from that of other metals present at a physiological level. The metal-rich fractions of the extracts of all samples (i.e. those of 1–2 kDa) were refined by immobilised metal affinity chromatography. The isolated ligands of trace elements were peptides rich in dicarboxylic aminoacids.

Keywords: rye; metal; speciation; trace elements; MALDI-MS; ICP-MS; IMAC

Supported by the Ministry of Education, Youth and Sports of the Czech Republic (Projects No. MSM 6046137307 – trace element analyses and No. MSM 6046137305 – ligands isolation and characterisation).

In Europe, especially in its northern part, rye represents a crop of a long tradition. It has been used for bread and other foodstuff production. Its consumption for human nutrition reaches millions of tons per year. Besides of carbohydrates, proteins and some vitamins, rye is also an important source of minerals and trace elements, e.g. consumption of 100 g of rye bread (one slice) can cover as much as 30% of the recommended daily intake of zinc (Lind-hauer & Dreisoerner 2003). Whole rye grain

contains approx. 4–6 mg/kg of Cu, 13–45 mg/kg of Zn, 0.5 mg/kg of Mo, and 0.2–2.7 mg/kg of Ni, respectively (Souci et al. 2000). However, the determination of the total content of trace ele-ments in food commodities does not provide fully relevant information for nutritional or toxicologi-cal evaluation as the effects of both essential and toxic elements contained in food depend on their chemical forms (Fraústo da Silva & Williams 2001). The element speciation analysis represents

40


the way how to access information on the structure and properties of metal-binding (or metalloid-binding) compounds (Ebdon et al. 2001).

Plant metallothioneins (MTs) and phytochelatins (PCs) are considered as important metal-binding compounds in the plant materials (Kotrba et al. 1999). Whereas metallothioneins are proteins or polypeptides of molecular weight of 5–20 kDa, phytochelatins represent mostly oligopeptides whose molecular weights range approx. between 0.5 and 2 kDa. These compounds are synthesised by plants or some microorganisms if they are exposed to increased concentrations of some toxic (Cd, Pb, As, Ag) or even essential (Zn, Cu) elements. Another stress factors can also induce the production of these compounds. It is supposed that the metal-binding compounds protect the plant against toxic effects of metals (Cobbett 2000), maintain the concentrations of elements in cytoplasm at acceptable levels, provide a pool for the storage of metal ions, and affect the activi-ties of metalloenzymes (Thumann et al. 1991). Other compounds such as organic acids (citric, malic, oxalic etc.), inositolphosphates, phenolic compounds, heterocycles, and amino acids are also involved in the binding of metals in plants. However, PCs belong to frequently investigated plant ligands. A number of papers concerning the analysis of PC-metal complexes have been published recently (see e.g. Kneer & Zenk 1997; Leopold & Günther 1997; Vachina et al . 1999, 2000; Chassaigne et al. 2001; Montes-Bayón et al. 2004). Although these papers are invaluable for the understanding of the stressed plants metabolism and the mechanisms of met-als detoxification, they do not provide sufficient information on the speciation of elements (espe-cially essential elements) in food commodities. There is a lack of data concerning the chemical structure of biological ligands of metals in ma-ture plants and namely in their parts utilised for the production of foodstuffs . Among the recently appeared papers dealing with cereals and/or cereal based foods, some articles can be mentioned focused on the selenium speciation in wheat flour (Diaz Huerta et al. 2003), effect of selenate supplementation on various kinds of cereals (Stadlober et al. 2001), changes in the chemical form of selenium during bread pro-duction (Bryszewska et al. 2005), and arsenic speciation in rice (Heitkemper et al. 2001) and infant food (Vela & Heitkemper 2004).

Our previous experiments proved that soluble low molecular binding compounds of Cu, Zn, and other metals in buckwheat, amaranth (Mestek et al. 2007a), and rape (Mestek et al. 2007b) are rich in dicarboxylic amino acids and do not contain PCs. In the present work an analogous approach to the element species fractionation based on size exclu-sion chromatography – inductively coupled plasma mass spectrometry was applied for the analysis of rye flour and tissues of rye plants cultivated hydroponically both in normal fertiliser solution and in cadmium-enriched one. The fractions of low molecular mass compounds were purified by immobilisd metal affinity chromatography (IMAC) and analysed by MALDI-MS. Moreover, amino acid compositions of these purified frac-tions were determined.

MATERIAL AND METHOD

Instruments. The ICP-MS measurements were done using the Elan 6000 spectrometer (Per-kin-Elmer/Sciex, Norwalk, USA) equipped with Meinhard nebuliser, a cyclonic spray chamber, and Gilson 212 peristaltic pump. The sample decomposition was performed in the UniClever microwave decomposition unit (Plazmatronika-Service, Wroclaw, Poland). Acidity of the buffer solutions was measured by pH 03 instrument (Labio, Prague, Czech Republic). The HPLC ap-paratus used for the sample fractionation by on-line SEC/ICP-MS coupling consisted of a Varian Inert 9012 high pressure pump (Varian, Walnut Creek, USA), two Rheodyne 9010 injectors placed before and beyond the column. Both Superdex 75 HR 10/30 column (Amersham Pharmacia Biotech, Uppsala, Sweden, dimensions 300 × 10 mm, opti-mum fractionation range 3–70 kDa) and Fractogel EMD Bio SEC (dimensions 600 × 16 mm, optimum fractionation range 5–1000 kDa, Merck) columns were applied. Preparative scale size exclusion chromatography utilising the Fractogel column was used for the target sample fraction isolation. The apparatus consisted of a LCP 4020 high-pressure pump (Ecom, Prague, Czech Republic), an injector Rheodyne 9010 equipped with 2 ml PEEK sample loop, and Fractogel EMD Bio SEC column. The samples were freeze-dried using Alpha 1-2 LD instrument (Martin Christ, Oste- rode am Harz, Germany). MALDI-MS analyses were performed on Biflex IV (Bruker Daltonics, Bremen, Germany).

41


Reagents. Nitric acid used for the sample de-composition was of Suprapur® Grade (Merck, Darmstadt, Germany). Cd, Cu, Mo, Ni, Zn, and Rh stock solutions of 1000 mg/l (all Merck, Darmstadt, Germany) were used for the preparation of the calibration solutions and internal standard solu-tions. The mobile phase for the chromatographic separation and the extractant was prepared from tris(hydroxymethyl)aminomethane (Tris) (Fluka, Neu-Ulm, Germany) buffered by hydrochloric acid (Suprapur® Grade, Merck). Another materials and reagents used during the isolation of the metal binding peptides involved Chelex 100 chelating ion exchange resin (Merck), Sephadex G15 gel (Pharmacia), acetonitrile, 2,5-dihydroxybenzoic acid, trifluoracetic acid (all Fluka), and dithio- threitol (DTT) (Merck). De-ionised water (Millipore, Bedford, USA) was used for the preparation of all solutions used during the analyses. The fertiliser solution contained 8.0 g Ca(NO3)2, 2.0 g KH2PO4, 2.0 g KNO3, 2.0 g MgSO4·7 H2O, 1.0 g KCl, and 0.1 g FeSO4·7 H2O per liter (all reagents were of analyti-cal grade and were obtained from Penta, Chrudim, Czech Republic). CdSO4·4 H2O used during rye cultivation was also obtained from Penta.

Samples and sample extract preparation . Wholemeal rye flour was obtained from a retail store. Its proximate composition was 11.1% of moisture, 1.2% of ash, 7% of protein, and 1.4% of fat. The analyses having been accomplished ac-cording to the standard methods (Kirk & Sawyer 1991). Rye seeds (cv. Fernando) were obtained from Selekta a.s. (Prague, Czech Republic). Two batches of seeds were sown on filtration paper sheets and the seedlings were cultivated for seven days in the solution of the mineral fertiliser described above. Than the solution in one batch was enriched by 30 µmol/l CdSO4; the samples originated from this batch will be called “Cd enriched”. The second batch served as the control sample. After further five days of cultivation, the leaves were separated from the roots and both parts of plants were care-fully washed with distilled water. The samples were stored at –18°C until the analyses.

10 g of leaves, 7 g of roots (previously crushed in an agate mortar), or 2 g of flour were extracted with 50 ml of 0.02 mol/l Tris-HCl buffer solution (pH 7.5) by 1-h shaking in a polypropylene flask. Then the mixtures were centrifuged (20 000 g, 4°C, 20 min). The buffer solution was previously purified by passing through a column packed with Chelex 100 resin in NH4

+ form.

Analytical methods

determination of total content of elements. Solid samples (1 g of roots and leaves or 0.5 g of flour) or extracts (10 ml) were decomposed by pressu-rised microwave digestion in PTFE vessels with 3 ml HNO3 for 10 minutes. The sample digests were transferred to 50 ml calibrated flasks and Rh solution (internal standard) was added to obtain final concentration of 50 µg/l. The determination of elements was done by ICP-MS technique with external calibration (details can be found e.g. in Koplík et al. 2002).

SeC/ICP-MS analyses . Buffer solution of 0.02 mol/l Tris-HCl (pH 7.5) served as the mo-bile phase, the flow rates were 0.5 ml/min and 2 ml/min for Superdex 75 column and Fractogel column, respectively. The sample extracts were injected onto the SEC column by the Rheodyne 9025 injector with 100 or 2000 µl PEEK sample loop, respectively. In the case of analytical scale chromatography, the quantification was carried out by post-column injection of the calibration solution using the second injector equipped with 500 µl sample loop. The flow of effluent was de-livered to the nebuliser of ICP-MS, the duration of SEC/ICP-MS analysis was 50 min while the chromatograms consisted of 1000 steps of 3 s each (for details of the procedure see Mestek et al. 2002).

Isolation of metal binding compounds. The se-lected metal-bearing fractions of the sample ex-tracts were isolated by preparative scale SEC (for conditions see above). The volume of each collected fraction was 6 ml; two independent separation runs were performed in order to combine both portions together. The chelating compounds were then refined by immobilised metal affinity chroma-tography (IMAC) technique using their adsorption on Chelex-100 in a Cu2+ form placed in a 1 ml PE column. The sample flow was 0.5 ml/min. The adsorbed ligands were eluted with 0.3 mol/l am-monia solution; the final volume of the eluate was 6 ml. Then 1 ml of the antioxidant solution (0.2% DTT) was added and after 20 min of incubation at 20°C, the mixture was freeze-dried. The details of the procedure were described in the previous article (Mestek et al. 2007a).

MaldI-MS analyses. The isolated compounds were dissolved in 0.1% trifluoracetic acid and desalted by ZipTip with fixed C18 reverse phase (Millipore). 2,5-dihydroxybenzoic acid was used

42


as a matrix and the measurement was carried out in a positive mode.

analyses of amino acids. In the case of the sam-ple preparation for amino acids determination, the addition of antioxidant was omitted and the sample was desalted by gel filtration on Sephadex G15 column (dimension 250 × 10 mm) using water as the mobile phase (flow rate 1 ml/min). After performic acid treatment and hydrolysis with HCl, the mixture was analysed by ion exchange chromatography with ninhydrin post-column deri-vatisation and spectrophotometric detection.

RESuLTS AND DIScuSSION

Trace elements extraction and fractionation

Table 1 shows total contents of Cd, Cu, Ni, Mo, and Zn in the analysed samples of rye flour, the individual parts of cultivated rye seedlings, and rye seeds serving for sowing. The contents of Cu, Ni, Mo, and Zn found in rye flour and seeds agree well with the published data (Souci et al. 2000). As to

the contents of Cu, Zn, and Mo in the seedling parts (leaves and roots), the cadmium-enriched samples were of similar composition as the corresponding control samples. On the other hand, more Ni was retained in the roots of cadmium-enriched plants resulting in a drop of Ni content in the leaves of the Cd-enriched plants in comparison with the control sample. Trace elements present in the leaves and roots originated from the seeds and the fertiliser solution as well. The content of Cd in Cd-enriched plants exceeded more than 100 times that in the control samples. Cadmium distribution between the leaves and roots was uniform. It is obvious that during a quite short period of the exposition to cadmium, the rye plant accumulated a large amount of it. Table 2 summarises the amounts and proportions of the elements soluble in 0.02 mol/l Tris-HCl (pH 7.5) buffer solution. A majority of Cd accumulated in the plant material was transferred into the insoluble form, while only a minor part of Cd (12–15%) remained in soluble forms (both in the leaves and roots). The high level of Cd did not affect the solubility of other elements except

Table 1. Total contents (mg/kg of wet matter) of trace elements in analysed samples

Element Flour*Rye leaves** Rye roots**

Rye seeds***Cd-enriched control Cd-enriched control

Cd 0.011 (0.001) 4.7 (0.3) 0.013 (0.003) 5.1 (0.7) 0.057 (0.020) 0.008

Cu 3.02 (0.20) 1.06 (0.06) 1.04 (0.06) 4.95 (0.97) 5.64(0.97) 2.79

Ni 0.058 (0.008) 0.30 (0.06) 0.72 (0.06) 3.58 (0.71) 2.36 (0.71) 0.16

Mo 0.59 (0.04) 0.50 (0.02) 0.47 (0.02) 0.33 (0.05) 0.36 (0.05) 0.45

Zn 24.1 (1.6) 10.5 (1.1) 10.8 (1.1) 49.3 (4.2) 52.3 (4.2) 22.1

Moisture 0.11 0.93 0.93 0.89 0.89 0.10

Mean of *six, **four or ***two determinations; values in brackets represent expanded uncertainty k = 2

Table 2. Total contents of elements in extracts (buffer 0.02 mol/l Tris. pH 7.5)

Element FlourRye leaves Rye roots

Cd-enriched control Cd-enriched control

Cd 0.005 (45%) 0.7 (15%) 0.003 (23%) 0.6 (12%) 0.003 (5%)

Cu 1.54 (51%) 0.53 (50%) 0.70 (68%) 1.73 (35%) 1.51 (27%)

Ni 0.027 (46%) 0.15 (54%) 0.66 (90%) 0.46 (13%) 0.52 (22%)

Mo 0.38 (65%) 0.25 (49%) 0.24 (50%) 0.12 (36%) 0.16 (44%)

Zn 8.4 (35%) 6.3 (60%) 6.4 (59%) 8.1 (16%) 9.6 (18%)

Results (mean of two) are given in mg/kg of wet matter. The relative value is related to the total content (see Table 1)

43


for Cu and Ni in the leaves: there their solubility decreased.

The extracts of the plant materials and rye flour were submitted to on-line SEC/ICP-MS analyses. The distribution of the elements among individual chromatographic fractions was not the same for all the types of samples analysed (Figures 1–3). Never-theless, the chromatograms exhibit some regularity. In the extract of the control sample leaves, all Ni and Zn and a majority of Cu were concentrated in the low-molecular weight fraction (1–2 kDa, tR = 32–33 min). Molybdenum was bound in the fraction of a somewhat higher apparent molecular weight (approx. 3 kDa, tR = 30–31 min). A minor part of Cu

was also bound in the medium-molecular weight region (20 kDa, tR= 23 min).

The fractionation of these elements in the Cd-enriched leaves was similar to that in the control sample. Only a part of Zn accompanied Cd, which was bound in the compounds of apparent molecular weight of approx. 3 kDa (tR = 31 min) representing the major Cd fraction. A minor part of Cd content occurred in the medium-molecular weight region of 20 kDa (tR = 23 min).

As concerns the root extracts of both samples, all Mo was bound in the fractions of apparent molecular weight of approx. 3 kDa (tR = 30 min) and the majority of Cu and Zn were bound in

Figure 1. SEC profiles of elements in extract of rye flour

Figure 2. SEC profiles of elements in extract of rye leaves (A) Cd-enriched, (B) control

ICP-

MS

sign

al (c

ps ×

103 )

15

10

5

0 10 15 20 25 30 35 40Time (min)

10 15 20 25 30 35 40Time (min)

10 15 20 25 30 35 40Time (min)

ICP-

MS

sign

al (c

ps ×

103 )

50

40

30

20

10

0

Zn

Mo

Ni

cu

cd

(A) (B)50

40

30

20

10

0

ZnMoNi

cu

cd

Zn

Mo

Ni

cu

44


the 1–2 kDa fraction (tR = 32 min). Only minor amounts of Cu and Zn were bound in the fraction of apparent molecular weight of approx. 3–5 kDa (tR = 29 min). The fractionation of Ni species in the extracts of roots differed from that in the leaves extracts. Besides a fraction of apparent molecular weight of approx 1–2 kDa (tR = 32 min), fractions of higher (3–5 kDa, tR = 29 min) and lower appar-ent molecular weighs (< 1 kDa, tR = 34–35 min) were also detected. ICP-MS signal of Cd in the extract of Cd-enriched roots was weak; a bulk of soluble Cd was present in ionic species and/or labile complexes. However, two fractions of ap-parent molecular weights of 3 kDa (tR = 29 min) and 20 kDa (tR = 22 min) could be recognised.

In the flour extract, all Ni and a majority of Cu and Zn were bound in a low-molecular weight region of 1–2 kDa (tR = 32 min), only a minor part

of Zn species could be found in the fraction of ap-parent molecular weight of approx. 3–5 kDa (tR = 29 min), and a minor part of Cu was contained in a wide zone corresponding to apparent molecular weight of 50–100 kDa (tR = 15–20 min). The frac-tionation of Mo species did not differ from that in the seedlings extracts; all Mo was concentrated in the fraction of apparent molecular weight of 3 kDa (tR = 30 min).

The total contents of elements passing the chro-matographic column were ascertained as well (Table 3). The element recovery of the chroma-tographic analysis indicates the percentage of stable complexes of the particular elements, i.e. complexes which are not affected by extraction and by chromatographic analysis. The portion of an element eluted in a volume highly exceeding the total volume of the column corresponds to free

Figure 3. SEC profiles of elements in extract of rye roots (A) Cd-enriched, (B) control

Table 3. The proportion of elements passing SEC column

Element FlourRye leaves Rye roots


Cd n.d. 0.55 (76%) n.d. 0.15 (25%) n.d.

Cu 1.43 (93%) 0.49 (92%) 0.51 (73%) 0.85 (49%) 1.17 (78%)

Ni 0.023 (85%) 0.04 (29%) 0.05 (8%) 0.36 (79%) 0.24 (47%)

Mo 0.35 (91%) 0.21 (86%) 0.17 (73%) 0.11 (90%) 0.16 (100%)

Zn 3.8 (45%) 3.6 (58%) 1.4 (22%) 1.4 (17%) 0.55 (6%)

Results (mean of two) are given in mg/kg of wet matter. The relative value is related to the extractable content (Table 2); n.d. – not detected

10 15 20 25 30 35 40Time (min)

20

10

010 15 20 25 30 35 40

Time (min)

ICP-

MS

sign

al (c

ps ×

103 )

(A) (B)

20

10

0

Zn

Mo

Ni

cu

cd

Zn

Mo

Ni

cu

cu

45


metal ions and/or labile complexes. These species are retarded on the column via non-size exclu-sion effects such as adsorption or ion-exchange (Koplík et al. 2002).

The portion of stable complexes of Cd in the extract of Cd-enriched leaves highly exceeded those in the extracts of Cd-enriched roots (76% vs. 25%, respectively). In the case the of leaves, the elevated level of Cd was accompanied also by an increased amount of stable complexes of Cu and Ni. This was probably caused by a higher production of ligands in the cells of Cd-exposed plants.

The proportions of stable complexes of Cu, Mo and Ni in the rye flour extract were very high (85–93%) and exceeded those in the extract of seedlings tissues. The proportion of Zn stable complexes reached only 45%, however, and it also exceeded those in the seedlings tissues.

The flour extract was submitted to further inves-tigation by on-line preparative scale SEC/ICP-MS hyphenation using Fractogel column. During these experiments, sulphur and phosphorus were also monitored as the constituents of the possible lig-ands of trace elements (cysteine-rich peptides

Table 4 Relative contents of amino acids* (% mol/mol) in refined low-molecular weight fraction of sample extracts

Amino acid Rye flour P-S subsfraction

Rye flour metal subfraction

Rye leaves Rye roots


Cys 13 6 4

CM Cys** 10 5

Asp + Asn 19 38 15 17 17 16

Thr 4 4 5 4

Ser 4 12 9 10 11

Glu + Gln 24 23 14 17 19 17

Gly 16 8 20 16 15 15

Ala 5 4 7 8 7 6

Val 4 4 4

Leu 5

Lys 6 6 16 4

Pro 5 5 4

* the contents of other not reported amino acids were below 4%; **S-carboxymethylcysteine

Figure 4. Detail of low-molecular region of SEC profiles of elements in extract of rye flour, Fractogel column. Chromatograms of Ni and Zn copy chro-matogram of Cu

30 35 40 45 50Time (min)

ICP-

MS

sign

al (c

ps ×

103 )

200

160

120

80

40

0

P

cu MoS

46


and phytates). The column was found to be able to separatethe species of phosphorus and sulphur and those of copper, nickel, and zinc present in the low-molecular weight region, however, this separation was poor (Figure 4).

characterisation of the binding partners of metals

The low molecular weight fractions of the ex-tracts of all samples analysed were isolated using preparative scale SEC and, after purification by im-mobilised metal affinity chromatography (IMAC) on Chelex 100 resin in a Cu2+ form (Mestek et al. 2007a, b), were submitted to further analyses. Only the fractions rich in Cu, Ni, and Zn, but not the Cd-containing fractions, were analysed in the seedlings extracts. In the rye flour extract, two sub-fractions were collected and subsequently proceeded with: the sub-fraction rich in S and P and that rich in the metals (Figure 4). The chelat-ing compounds isolated from each sample were

analysed for amino acids composition and some of them also by MALDI-MS.

Table 4 summarises the amino acid composi-tions of the refined fractions of low-molecular chelating compounds isolated from the individual samples. The ligands isolated from the metal sub-fraction of flour were rich in Asx and Glx, while the content of Cys was low (possibly as a conse-quence of the poor chromatographic resolution from the S-P sub-fraction). Besides Asx, the S-P sub-fraction involved high portions of Cys, Glx and Gly. Its amino acid composition was close to that of PCs. The ligands isolated from both extracts of leaves (Cd-enriched and control) were very similar. The dominant components were Asx, Glx, and Gly again, however, other amino acids (Ser, Ala and Lys) were also present. The ligands isolated from the root extracts exhibited the most complex composition: in addition to the above mentioned amino acids, a less frequent amino acid carboxymethylcysteine was found in the roots. Carboxymethylcysteine content was increased in

Figure 5. MALDI MS spectra (M-H+) of low-molecular refined weight fraction of rye flour (A) and Cd-contaminated rye leaves (B)

3000

2500

2000

1500

1000

500

0500 1000 1500 2000

m/z

Inte

nsity

4000

3000

2000

1000

0500 1000 1500 2000

Inte

nsity

(A)

(B)

47


the cadmium-enriched sample. However, Asx, Glx, and Gly were the main constituents. Dicarboxylic amino acids prevailed in the ligands isolated from all types of samples, however, it is obvious that composition of the ligands was modified during the transport from the roots to the seeds. This was also confirmed by MALDI-MS. Examples of the spectra of the ligands isolated from low-molecular weight fractions of rye flour (metal-rich sub-fraction) and Cd-enriched rye leaves are shown in Figure 5. The spectrum of the rye flour sample contained a dominant peak correspond-ing to molecular weight of 1752 Da and several minor peaks of compounds of molecular weights 1627, 1371, and 1005 Da. On the other hand, the spectrum of the ligands isolated from rye leaves contained compounds of lower molecular weights ranging between 638 and 1500 Da.

cONcLuSIONS

The element species fractionation in an extract of rye flour showed quite a similar pattern as did the analysis of the extracts of amaranth, buckwheat, and soybean flours, legume seeds, and rapeseeds (Koplík et al. 2002; Mestek et al. 2002, 2007a, b). Particularly, dominant low-molecular weight fractions of Cu and Zn (1–2 kDa) and Mo (3 kDa) were typical for most of these samples.

As the rye plant tissues (roots and leaves) are concerned, some similarity of the trace element species pattern with that of rye flour is obvious. The cultivation of rye plants in an artificially Cd-contaminated solution resulted in the accu-mulation of approx. 5 mg/kg (wet weight basis) of Cd in both roots and leaves as compared with < 0.1 mg/kg in the control samples. The majority of the accumulated Cd remained insoluble in the alkaline (pH 7.5) buffer. While most of the soluble Cd in Cd-enriched roots was represented by ionic species and/or labile Cd complexes, cadmium in Cd-enriched leaves was mostly bound in sta-ble chelates of the apparent M of 3 kDa. In spite of a negligible effect of Cd accumulation on the chromatographic profiles of other trace elements, some quantitative differences could be recognised. The patterns of stable chelates of Zn and Ni in both leaves and roots extracts were substantially increased in the Cd-enriched samples as compared to control ones.

The ligands of trace elements isolated from metal-rich low-molecular weight (1–2 kDa) sub-fraction

of rye flour by IMAC technique were peptides rich in Gly and dicarboxylic amino acids. The molecular weight of any of the components of this sample, as measured by MALDI-MS, did not correspond to phytochelatins (PCs). Therefore, PCs probably did not participate in metal binding in the soluble parts of mature seeds. However, the amino acid composition of the adjacent chromatographic sub-fraction resembled to that of PCs. As the metal-rich sub-fraction was free of phosphorus, the presence of phytic acid-metal compounds in low-molecular soluble fraction of rye flour is out of question.

REFERENcES

Bryszewska M.A., Ambroziak W., Diowksz A., Bax-ter M.J., Langford N.J., Lewis D.J. (2005): Changes in the chemical form of selenium observed during the manufacture of a selenium-enriched sourdough bread for use in a human nutrition study. Food Additives and Contaminants, 22: 135–140.

Chassaigne H., Vacchina V., Kutchan T.M., Zenk M.H. (2001): Identification of phytochelatin-related peptides in maize seedlings exposed to cadmium and obtained enzymatically in vitro. Phytochemistry, 56: 657–668.

Cobbett C.S. (2000): Phytochelatin biosynthesis and function in heavy-metal detoxification. Current Opinion in Plant Bioogy, 3: 211–216.

Diaz Huerta V., Hinojosa Reyes L., Marchante-Gayón J.M., Fernández Sánchez M.L., Sanz-Medel A. (2003): Total determination and quantitative specia-tion analysis of selenium in yeast and wheat flour by isotope dilution analysis ICP-MS. Journal of Analytical Atomic Spectrometry, 18: 1243–1247.

Ebdon L., Pitts L., Cornelis R., Crews H., Donard O.F.X., Quevauviller P. (eds) (2001): Trace Element Speciation for Environment, Food and Health. The Royal Society of Chemistry, Cambridge.

Fraústo da Silva J.R.R., Williams R.J.P. (2001): The Biological Chemistry of the Elements: The Inorganic Chemistry of Life. Oxford University Press, Oxford.

Heitkemper D.T., Vela N.P., Stewart K.R., Westphal C.S. (2001): Determination of total and speciated arsenic in rice by ion chromatography and inductively coupled plasma mass spectrometry. Journal of Analytical Atomic Spectrometry, 16: 299–306.

Kirk R.S., Sawyer R. (1991): Pearson’s Composition and Analysis of Foods. 9th Ed. Longman Scientific & Technical, Harlow.

Kneer R., Zenk M.H. (1997): The formation of Cd-phytochelatin complexes in plant cell cultures. Phytochem-istry, 44: 69–74.

48


Koplík R., Pavelková H., Cincibuchová J., Mestek O., Kvasnička F., Suchánek M. (2002): Fractionation of phosphorus and trace elements species in soybean flour and common white bean seeds by size exclusion chromatography-inductively coupled plasma mass spectrometry. Journal of Chromatography B, 770: 261–273.

Kotrba P., Macek T., Ruml T. (1999): Heavy metal-binding peptides and proteins in plants. A review. Collection of Czechoslovak Chemical Communications, 64: 1057–1086.

Leopold I., Günther D. (1997): Investigation of the binding properties of heavy-metal-peptide complexes in plant cell cultures using HPLC-ICP-MS. Fresenius Journal of Analytical Chemistry, 359: 364–370.

Lindhauer M.G., Dreisoerner J. (2003): Rye. In: Cabal-lero L.C., Trugo P.M., Finglas P.M. (eds): Encyclo-pedia of Food Science and Nutrition. 2nd Ed. Academic Press, Elsevier, Amsterdam.

Mestek O., Komínková J., Koplík R., Borková M., Suchánek M. (2002): Quantification of copper and zinc species fractions in legume seeds extracts by SEC/ICP-MS: validation and uncertainty estimation. Talanta, 57: 1133–1142.

Mestek O., Polák J., Juříček M., Karvánková P., Kop- lík R., Šantrůček J., Kodíček M. (2007a): Trace ele-ments distribution and species fractionation in Brassica napus plant. Applied Organometallic Chemistry, 21: 468–474.

Mestek O., Polák J., Koplík R., Komínková J., Šantrůček J., Kodíček M. (2007b): Analysis of ele-ments species fractions in pseudo-cereals by SEC/ICP-MS and MALDI-MS. European Food Research and Technology, 225: 895–904.

Montes-Bayón M., Meija J., LeDuc D.L., Terry N., Caruso J.A., Sanz-Medel A. (2004): HPLC-ICP-MS and ESI-Q-TOF analysis of biomolecules induced in Brassica juncea during arsenic accumulation. Journal of Analytical Atomic Spectrometry, 19: 153–158.

Souci S.W., Fachmann W., Kraut H., Scherz H., Senser F. (2000): Food Composition and Nutrition Tables. 6th Ed. Medpharm, Stuttgart and CRC Press, Boca Raton.

Stadlober M., Sager M., Irgolic K.J. (2001): Effects of selenate supplemented fertilisation on the selenium level of cereals – identification and quantification of selenium compounds by HPLC-ICP-MS. Food Chem-istry, 73: 357–366.

Thumann J., Grill E., Winnacker E.L., Zenk M.H. (1991): Reactivation of metal-requiring apoenzymes by phytochelatin metal-complexes. FEBS Letter, 284: 66–69.

Vacchina V., Chassaigne H., Oven M., Zenk M.H., Lobinski R. (1999): Characterisation and determination of phytochelatins in plant extracts by electrospray tan-dem mass spectrometry. Analyst, 124: 1425–1430.

Vacchina V., Lobinski R., Oven M., Zenk M.H. (2000): Signal identification in size-exclusion HPLC-ICP-MS chromatograms of plant extracts by electrospray tandem mass spectrometry (ES MS/MS). Journal of Analytical Atomic Spectrometry, 15: 529–534.

Vela N.P., Heitkemper D.T. (2004): Total arsenic de-termination and speciation in infant food products by ion chromatography-inductively coupled plasma-mass spectrometry. Journal of AOAC International, 87: 244–252.

Received for publication February 22, 2008Accepted after corrections January 5, 2009


Doc. ing. Oto Mestek, CSc., Vysoká škola chemicko-technologická v Praze, Fakulta chemické technologie, Ústav analytické chemie, Technická 5, 166 28 Praha 6, Česká republikatel.: + 420 220 444 264, fax: + 420 220 444 058, e-mail: [email protected]

49


Molecular Cloning and Characterisation of Alpha Subunit of H+-ATPase in Lactobacillus casei Zhang

Xia CheN1, Mei YANG1, Zhihong SUN1, Wenjun LIU1, Tiansong SUN,1 he MeNG2 and heping ZhANG1

1Key Laboratory of Dairy Biotechnology and engineering, Ministry of education, Inner Mongolia Agricultural University, huhhot, P.R.China; 2School of Agriculture

and Biology, Shanghai Jiao Tong University, Shanghai, P.R.China

Abstract

Chen X., Yang M., Sun Z., Liu W., Sun T., Meng H., Zhang H. (2009): Molecular cloning and characterisation of alpha subunit of H+-ATPase in Lactobacillus casei Zhang. Czech J. Food Sci., 27: 49–54.

The acid tolerance is an important property of Lactic acid bacteria as potential probiotics. H+-ATPase is considered a key gene in several bacteria with the ability of acid tolerance. We cloned and sequenced the full length cDNA of alpha subunit of H+-ATPase gene in Lactobacillus casei Zhang, which had been isolated from traditional home-made koumiss in Inner Mongolia of China. The results showed that the respective cDNA sequence is composed of 1530 nucleotides and codes a putative protein including 509 amino acids. In addition, we also reconstructed the phylogenic trees for H+-ATPase gene based on amino acids sequences of diverse strains of Lactic acid bacteria.

Keywords: H+-ATPase; clone; sequence; Lactobacillus casei Zhang; phylogenic trees

Supported by Natural Science Foundation of China (Grants No. 30560097, 30660135 and 30760156), Hi-tech Research and Development Program of China (863 Program) (Grants No. 2006AA10Z345 and 2007AA10Z353) and New Century Excellent Talent (NCET) Planning of Education Ministry of China.

Lactic acid bacteria and other probiotic micro-organisms have many documented health effects, so some of them are considered as probiotics which are defined as live microbial food supplements that benefit the health of consumers by maintaining or im-proving their intestinal microbial balance (Salminen et al. 1996; Fuller 1989). Moreover, the research on lactobacilli becomes more and more interesting because of their possible role in the maintenance of gastrointestinal health (Bengmark et al. 1998). Lactobacillus casei Zhang is a novel potential probi-otic which was isolated from the traditional Koumiss

widely used in traditional Mongolian medicine in Inner Mongolia of China (Zhang et al. 2006). This strain exhibits favourable probiotic properties such as acid tolerance, bile resistance, cholesterol-removing ability and GI colonisation ability (Wu et al. 2005; Xu et al. 2006; Zhang et al. 2006). Moreover, Yun found hypocholesterolemic effect in this strain resulting from its ability to bind and assimilate cholesterol and to suppress the reabsorption of bile acids into the enterohepatic circulation (Yun et al. 2006). Zhang found with this strain the regulating function of the cell immunity, the humoural immunity, and

50


the intestinal mucous local immunity to mouse (Zhang et al. 2006b).

Acid tolerance and tolerance to human gastric juice are considered as important properties in the selection of a preferable probiotic strain (Saarela et al. 2000). Studies on the physiol-ogy of oral streptococci have led to the view that the cell membrane plays major roles in acid-base regulation. These roles include the extrusion of protons through the membrane and exclusion of the environmental protons (Bender et al. 1986). Yokota et al. (1995) reported that the acid tol-erance of Lactococcus lactis subsp. lactis, which is used as a starter culture in the dairy industry, depends on the action of cell membrane-bound H+-ATPase. Miwa et al. (1997) found that the H+-ATPase activity of ruminal acid-tolerant bacteria was higher than that of nonacid-tolerant bacteria, and its activity increased when the bacteria were incubated under acidic conditions. In 2000, Miwa et al. (2000) also found that H+-ATPase has a key role in the acid tolerance of Streptococcus bovis. In 2004, Matsumoto suggested that it is necessary for bacteria to increase H+-ATPase activity quickly and discharge H+ in order to maintain a constant intracellular pH. The acid-intolerant strains are damaged under acidic conditions since their H+-ATPase activity cannot be increased, while acid-tolerant strains are less affected and more able to survive because of the rapid increase in their H+-ATPase activity (Matsumoto et al. 2004).

In order to evaluate this strain much more clearly by genomic extent and determine the association between the H+-ATPase gene and acid tolerance in Lactobacillus casei Zhang, the α subunit of H+-ATPase in Lactobacillus casei Zhang was cloned and characterised.

MATeriAl And MeTHodS

Strains and culture media. Lactobacillus casei Zhang was obtained from the Key Laboratory of Dairy Biotechnology and Engineering Ministry of Education, Inner Mongolia Agricultural University, China. This strain can survive in acid conditions at pH 3.5 and is considered as a potential probiotic. Lactobacillus casei Zhang was cultivated in MRS broth without shaking at 37°C.

RNA isolation. The total RNA was extracted using Trizol reagent (Invitrogen, USA) according to the manufacturer’s recommendations from an overnight culture of Lactobacillus casei Zhang.

The RNA concentration was then adjusted to 100 ng/µl by the Biophotometer (Eppendorf, Ger-many) and stored at –70°C until the use.

RT-PCR. Using RNA PCR Kit (AMV) Ver. 3.0 (TaKaRa, Japan), reverse transcriptions (RT) were performed with 10 µl reaction volume including 3 µl total RNA(100 ng/µl), 1 µl 10 × RT buffer, 2 µl 25 mmol/l MgCl2, 1 µl dNTP Mixture, 0.25 µl RNase Inhibitor (40 U/µl), 0.5 µl AMV Reverse Transcriptase XL (5 U/µl), 0.5 µl Oligo dT-Adap-tor Primer (2.5 pmol/µl), and 1.75 µl RNase Free dH2O. The RT reaction conditions were as follows: 30°C for 10 min, 42°C for 30 min, 99°C for 5 min, and 5°C for 5 minutes.

The primers were designed according to the se-quence of H+-ATPase in Lactobacillus casei ATCC334 (GenBank accession numbers: NC_008526). The primers were as follows: forward 5'-AGCACCGTT-TCGATAAGA-3', reverse 5'-TGGTCGATGCGAT CTTGC-3'. The 25 µl PCR reaction mixture was composed of 0.2 µl Taq polymerase (5 U/µl, Taka-ra Tokyo, Japan), 2.5 µl 10 × PCR Buffer (with-out Mg2+), 2 µl dNTP (2.5mM each), 2 µl MgCl2 (25mM), 0.2 µl forward primer (50pM), 0.2 µl reverse primer (50pM), 1 µl cDNA products and 17.4 µl ddH2O. The reaction conditions were as follows: 97°C for 5 min, 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles, and then 72°C for 10 min, 4°C for 30 minutes.

Molecular cloning and sequencing. The PCR product of Lactobacillus casei Zhang was sepa-rated from 1% agarose gel electrophoresis using a Huashun Gel Extraction Kit (Huashun, China). The extracted PCR product was combined with pMD 18-T Vector (Takara, Japan) and cloned. The recombined vector was identified using restriction enzyme digestion with Hind III and BamH I (Takara, Japan) followed by 1% agarose gel electrophoresis, and then the vector was sub-sequently used for sequencing.

Characteristic analysis. The α subunit of H+-ATPase gene sequence was entered into the Ed-itSeq program of the DNASTAR software package to search the largest open reading frame (ORF) and was further translated into amino acid sequences using the standard genetic code.

The alignments of amino acid sequences of the cloned α subunit of H+-ATPase and other rep-resentatives of Lactic acid bacteria α subunit of H+-ATPase were used to generate phylogenic trees. Phylogenic trees were constructed utilising DNA-MAN software (Ver. 4.0).

51


reSulTS

Sequence of α subunit of H+-ATPase in Lactobacillus casei Zhang

After RT-PCR and sequencing for confirmation, the cDNA sequence of α subunit of H+-ATPase was obtained. The cDNA sequence is composed of 1530 bp, and all the nucleotides are ORF. The ORF can be putatively composed of 509 amino acids and the translation start codon (ATG) and stop codon (TAA) were clear and emphasised by boxed (Fig-ure 1). The gene sequence had already been available in GenBank (accession number EU370975).

Homology analysis

To understand the sequence character of α subunit of H+-ATPase gene, the sequences of CDS and amino acids of some Lactobacillus α subunit of H+-ATPase were compared (Table 1). Then, the phylogenic tree was constructed by DNAMAN software, and is shown in Figure 2. From the table and figure, we can see that the cloned α subunit of H+-ATPase gene belongs to the group of Lacto-bacillus α subunit of H+-ATPase. The α subunit of H+-ATPase gene is conserved in Lactobacillus, and is highly conserved in Lactobacillus casei.

diSCuSSion

We identified the full-length cDNA sequences of α subunit of H+-ATPase in Lactobacillus casei

Table 1. Comparison of α subunit of H+-ATPase of Lactobacillus casei Zhang with those of other lactobacilli

Species GenBank accession No. Length (bp)

Nucleotide identity (%)

Amino acid identity (%)

Lb. casei ATCC334 NC_008526 1530 99.74 100.00

Lb. plantarum WCFS1 NC_004567 1515 71.11 78.98

Lb. johnsonii NCC 533 NC_005362 1512 69.48 78.39

Lb. gasseri ATCC 33323 NC_008530 1521 69.59 77.54

Lb. helveticus DPC4571 NC_010080 1512 70.26 79.57

Lb. acidophilus NCFM NC_006814 1512 69.42 78.98

Lb. brevis ATCC367 NC_008497 1542 69.71 74.66

Lb. delbrueckii ATCC11842 NC_008054 1512 69.54 77.80

Lb. reuteri 100-23 NZ_APZZ00000000 1530 68.69 75.64

Lb. sakei subsp. sakei 23K NC_007576 1536 72.34 81.02

Lb. salivarius UCC118 NC_007929 1512 71.24 78.59

Zhang. The results were confirmed by sequenc-ing and sequence analysis. The cDNA sequence consists of 1530 nucleotides, and all the nucle-otides are ORF which yields a protein of 509 amino acids.

Proton-translocation ATPase (F1F0 complex) commonly synthesises ATP in the plasma mem-branes of bacteria, mitochondria, and chloroplasts. The complete nucleotide sequence of the ATPase genes of escherichia coli was determined (Walker et al. 1984). The genes for all eight subunits of the complex reside in a common operon and are tran-scribed into a single mRNA in bacteria (Gibson et al. 1978; Jones et al. 1983). A hierarchy was shown wherein pH optima for the enzymes were established for S. sanguis, S. salivarius, S. mutans, and Lb. casei, of approximately 7.5, 7.0, 6.0, and 5.0, respectively (Bender et al. 1986). The analysis of these data showed that the lower the pH at which the ATPase can function, the more competitive the organism as the end-products of metabolism build up. The central role of ATPase is also seen in the enteric bacteria, with which it was shown that the acid-tolerance response (ATR) does not occur in cells that are defective in the F-ATPase (Foster & Hall 1991). Consequently, it may be presumed that ATPase function is probably a major general component of acid tolerance in bacteria.

Extensive information is now available on bacte-rial genes that encode the subunits of F-ATPase. The structure of F1F0-ATPase complexes from different sources are very similar and consist of

52


Figure 1. Nucleotide sequence and putative amino acid sequence of α subunit of H+-ATPase in Lactobacillus casei Zhang

1 ATGAGCATCAAGACTGAGGAAATCAGTTCTCTGATCAAAAAACAACTTGAAGGATATCAG 1 M S I K T E E I S S L I K K Q L E G Y Q

61 GACGATTTGGCGGCTGAAGAAGTCGGCACTGTGACTTACATCGGTGATGGGATCGCACGT 21 D D L A A E E V G T V T Y I G D G I A R

121 GCGACTGGGCTGGAAAATGCCATGGCCAACGAATTGCTCCAATTTAGCAACGGCTCATAC 41 A T G L E N A M A N E L L Q F S N G S Y

181 GGGATGGCGTTAAACCTTGAAACGAACGATGTCGGGATCATTATCTTAGGTGACTTCGAT 61 G M A L N L E T N D V G I I I L G D F D

241 GAGATTCGCGAAGGCGACCAAGTGAAACGCACTGGCCGAATCATGGAAGTTCCTGTCGGG 81 E I R E G D Q V K R T G R I M E V P V G

301 GATGCCATGATCGGGCGAGTTGTCAATTCTTTGGGTCAGCCGGTCGACGGTTTAGGCGCG 101 D A M I G R V V N S L G Q P V D G L G A

361 ATTAAGACGGATAAAACCCGTCCGATCGAGTTTAAGGCGCCAGGTGTTATGCAACGCAAA 121 I K T D K T R P I E F K A P G V M Q R K

421 TCCGTATCAGAACCGTTACAAACCGGTTTGAAAGCGATTGATGCGCTGGTACCGATTGGC 141 S V S E P L Q T G L K A I D A L V P I G

481 CGTGGTCAGCGTGAGTTGATCATTGGTGACCGGAAAACCGGGAAAACATCAATTGCGATT 161 R G Q R E L I I G D R K T G K T S I A I

541 GATACCATTTTGAACCAAAAAGATCAAAACATGATCTGTGTGTACGTTGCGATTGGGCAA 181 D T I L N Q K D Q N M I C V Y V A I G Q

601 AAGGACAGTACGGTTCGAGCTCAAGTTGAAACGTTGAAAAAATATGGTGCGATGGATTAT 201 K D S T V R A Q V E T L K K Y G A M D Y

661 ACCATCGTGCTGACTGCTGGCCCATCTGAACCTGCACCAATGCTGTATATCGCGCCTTAT 221 T I V L T A G P S E P A P M L Y I A P Y

721 GCCGGTGCAGCGATGGGTGAAGAGTTCATGTATAACGGCAAGCACGTCTTGATCGTGTAT 241 A G A A M G E E F M Y N G K H V L I V Y

781 GATGATTTGAGCAAACAGGCAACCTCATATCGTGAGCTGTCCTTGCTGCTCCGTCGTCCG 261 D D L S K Q A T S Y R E L S L L L R R P

841 CCTGGTCGTGAAGCCTATCCTGGGGATATTTTCTATACCCACAGTCGCTTGTTGGAACGC 281 P G R E A Y P G D I F Y T H S R L L E R

901 GCTGCTAAATTGAGTGATAAACTCGGCGGCGGTTCTATGACGGCGTTGCCGGTTATTGAA 301 A A K L S D K L G G G S M T A L P V I E

961 ACTCAGGCAGGCGATATTTCCGCGTACATCCCGACTAACGTTATTTCTATCACGGATGGT 321 T Q A G D I S A Y I P T N V I S I T D G

1021 CAGATCTTCTTACAAAGCGATCTGTTCTATGCGGGTACACGTCCAGCCATTGATGCCGGT 341 Q I F L Q S D L F Y A G T R P A I D A G

1081 GCTTCTGTTTCCCGTGTTGGTGGTGATGCGCAGGTCAAGGCGATGAAGAAAGTTGCCGGG 361 A S V S R V G G D A Q V K A M K K V A G

1141 ACATTGCGGTTGGATCTGGCATCCTTCCGTGAACTGGAAGCCTTCACGCAATTTGGTTCT 381 T L R L D L A S F R E L E A F T Q F G S

1201 GATTTGGATGCAGCAACGCAAGCTAAGTTGAATCGTGGTCGCCGAACGGTTGAAGTGCTG 401 D L D A A T Q A K L N R G R R T V E V L

1261 AAGCAGCCTGTTCACAAACCGTTACCGGTTGAAAAGCAGGTTATCATTCTTTACGCATTA 421 K Q P V H K P L P V E K Q V I I L Y A L

1321 ACCCATGGCTTCCTTGATCCAATTCCGATTGAAGACATTACTCGCTTCCAAGATGAACTG 441 T H G F L D P I P I E D I T R F Q D E L

1381 TTTGATTTCTTCGATAGCAATGCAGCTGATTTGCTCAAGCAGATTCGTGACACCGGTAAT 461 F D F F D S N A A D L L K Q I R D T G N

1441 TTACCGGATACCGATAAACTTGATGCACAAATCAAGGCTTTTGCCGGCGGATTCCAAACG 481 L P D T D K L D A Q I K A F A G G F Q T

1501 AGTAAACAACTTGCTGCAGCGAAAGACTAA 501 S K Q L A A A K D *

1 ATGAGCATCAAGACTGAGGAAATCAGTTCTCTGATCAAAAAACAACTTGAAGGATATCAG 1 M S I K T E E I S S L I K K Q L E G Y Q

61 GACGATTTGGCGGCTGAAGAAGTCGGCACTGTGACTTACATCGGTGATGGGATCGCACGT 21 D D L A A E E V G T V T Y I G D G I A R

121 GCGACTGGGCTGGAAAATGCCATGGCCAACGAATTGCTCCAATTTAGCAACGGCTCATAC 41 A T G L E N A M A N E L L Q F S N G S Y

181 GGGATGGCGTTAAACCTTGAAACGAACGATGTCGGGATCATTATCTTAGGTGACTTCGAT 61 G M A L N L E T N D V G I I I L G D F D

241 GAGATTCGCGAAGGCGACCAAGTGAAACGCACTGGCCGAATCATGGAAGTTCCTGTCGGG 81 E I R E G D Q V K R T G R I M E V P V G

301 GATGCCATGATCGGGCGAGTTGTCAATTCTTTGGGTCAGCCGGTCGACGGTTTAGGCGCG 101 D A M I G R V V N S L G Q P V D G L G A

361 ATTAAGACGGATAAAACCCGTCCGATCGAGTTTAAGGCGCCAGGTGTTATGCAACGCAAA 121 I K T D K T R P I E F K A P G V M Q R K

421 TCCGTATCAGAACCGTTACAAACCGGTTTGAAAGCGATTGATGCGCTGGTACCGATTGGC 141 S V S E P L Q T G L K A I D A L V P I G

481 CGTGGTCAGCGTGAGTTGATCATTGGTGACCGGAAAACCGGGAAAACATCAATTGCGATT 161 R G Q R E L I I G D R K T G K T S I A I

541 GATACCATTTTGAACCAAAAAGATCAAAACATGATCTGTGTGTACGTTGCGATTGGGCAA 181 D T I L N Q K D Q N M I C V Y V A I G Q

601 AAGGACAGTACGGTTCGAGCTCAAGTTGAAACGTTGAAAAAATATGGTGCGATGGATTAT 201 K D S T V R A Q V E T L K K Y G A M D Y

661 ACCATCGTGCTGACTGCTGGCCCATCTGAACCTGCACCAATGCTGTATATCGCGCCTTAT 221 T I V L T A G P S E P A P M L Y I A P Y

721 GCCGGTGCAGCGATGGGTGAAGAGTTCATGTATAACGGCAAGCACGTCTTGATCGTGTAT 241 A G A A M G E E F M Y N G K H V L I V Y

781 GATGATTTGAGCAAACAGGCAACCTCATATCGTGAGCTGTCCTTGCTGCTCCGTCGTCCG 261 D D L S K Q A T S Y R E L S L L L R R P

841 CCTGGTCGTGAAGCCTATCCTGGGGATATTTTCTATACCCACAGTCGCTTGTTGGAACGC 281 P G R E A Y P G D I F Y T H S R L L E R

901 GCTGCTAAATTGAGTGATAAACTCGGCGGCGGTTCTATGACGGCGTTGCCGGTTATTGAA 301 A A K L S D K L G G G S M T A L P V I E

961 ACTCAGGCAGGCGATATTTCCGCGTACATCCCGACTAACGTTATTTCTATCACGGATGGT 321 T Q A G D I S A Y I P T N V I S I T D G

1021 CAGATCTTCTTACAAAGCGATCTGTTCTATGCGGGTACACGTCCAGCCATTGATGCCGGT 341 Q I F L Q S D L F Y A G T R P A I D A G

1081 GCTTCTGTTTCCCGTGTTGGTGGTGATGCGCAGGTCAAGGCGATGAAGAAAGTTGCCGGG 361 A S V S R V G G D A Q V K A M K K V A G

1141 ACATTGCGGTTGGATCTGGCATCCTTCCGTGAACTGGAAGCCTTCACGCAATTTGGTTCT 381 T L R L D L A S F R E L E A F T Q F G S

1201 GATTTGGATGCAGCAACGCAAGCTAAGTTGAATCGTGGTCGCCGAACGGTTGAAGTGCTG 401 D L D A A T Q A K L N R G R R T V E V L

1261 AAGCAGCCTGTTCACAAACCGTTACCGGTTGAAAAGCAGGTTATCATTCTTTACGCATTA 421 K Q P V H K P L P V E K Q V I I L Y A L

1321 ACCCATGGCTTCCTTGATCCAATTCCGATTGAAGACATTACTCGCTTCCAAGATGAACTG 441 T H G F L D P I P I E D I T R F Q D E L

1381 TTTGATTTCTTCGATAGCAATGCAGCTGATTTGCTCAAGCAGATTCGTGACACCGGTAAT 461 F D F F D S N A A D L L K Q I R D T G N

1441 TTACCGGATACCGATAAACTTGATGCACAAATCAAGGCTTTTGCCGGCGGATTCCAAACG 481 L P D T D K L D A Q I K A F A G G F Q T

1501 AGTAAACAACTTGCTGCAGCGAAAGACTAA 501 S K Q L A A A K D *

53


two parts: a membrane integral part, F0, which forms a proton channel, and a soluble part, F1, which contains the catalytic site for ATP hydrolysis (Koebmann et al. 2000). In general, the subunits in the cytoplasmic F1 domain (consisting of the δ, α, γ, β, and ε subunits) showed a far higher level of homology as compared with the membrane-bound F0 domain (consisting of the a, c, and b subunits) (Quivey et al. 2001).

Lactobacillus casei Zhang is a natural lactobacil-lus that was isolated from traditional home-made koumiss (Zhang et al. 2006a), while Lactobacil-lus casei ATCC334 was isolated from emmental cheese. Moreover, a comparative sequence analysis of the genes encoding 16S rRNA of Lactobacillus casei ATCC334 and Lactobacillus casei Zhang had the same 16S rRNA sequence with homology of 100% (Wang et al. 2008). However, when we checked the physiological and biochemical char-acteristics of these two strains, we found that Lb. casei ATCC334 can ferment rhamnose, melibiose, raffinose, and lactose, but Lb. casei Zhang can not. As we have described before, Lactobacillus casei Zhang is a potential probiotics, which can survive in artificial gastric juice. Moreover, the phylogenic tree can illustrate the relations between various

Lactobacillus species. From the tree we can find that the sequences of α subunit of H+-ATPase of various Lactobacillus species are conserved. Moreover, Lb. acidophilus NCFM and Lb. helveticus DPC4571, Lb. gasseri ATCC33323 and Lb. johnsonii NCC533 are highly similar. Lb. casei ATCC334 proved not to have so highly conserved species. However, from the above results, we can see that α subunit of H+-ATPase in Lactobacillus casei is amazingly highly conserved, even if they come from different sources and countries. Thus the molecular cloning and characterisation of α subunit of H+-ATPase in Lactobacillus casei Zhang makes it possible for further research to identify the association of the H+-ATPase gene with acid tolerance.

r e f e r e n c e s

Bengmark S., Larsson K., Molin G. (1998): Ecologi-cal control of the gastrointestinal tract. The role of probiotic flora. Gut, 42: 2–7.

Bender G.R., Sutton S.V., Marquis R.E. (1986): Acid tolerance, proton permeabilities, and membrane ATPases of oral streptococci. Infection and Immunity, 53: 331–338.

Figure 2. Homology tree of amino acid sequence of α subunit of H+-ATPase in some lactobacilli. The percent numbers represent identical degree

Lb. acidophilus NCFM

Lb. helveticus DPC4571

Lb. gasseri ATCC 33323

Lb. johnsonii NCC 533

Lb. delbrueckii ATCC11842

Lb. sakei subsp. sakei 23K

Lb. salivarius UCC118

Lb. brevis ATCC367

Lb. plantarum WCFS1

Lb. reuteri 100-23

Lb. casei Zhang

Lb. casei ATCC334

100 95 90 85 80 75 70 (%)

100%

95%

92%

80%

74%

73%

76%

76%

71%

72% 71%

54


Foster J.W., Hall H.K. (1991): Inducible pH homeostasis and the acid tolerance response of Salmonella typhil- murium. Journal of Bacteriology, 173: 5129–5135.

Fuller R. (1989): Probiotics in man and animals. Journal of Applied Bacteriology, 66: 365–378.

Gibson F., Downie J.A., Cox G.B., Radik J. (1978): Mu-induced polarity in the unc operon of escherichia coli. Journal of Bacteriology, 134: 728–736.

Jones H.M., Brajkovich C.M., Gunsalus R.P. (1983): In vivo 5’ terminus and length of the mRNA for the pro-ton-translocationg ATPase (unc) operon of escherichia coli. Journal of Bacteriology, 155: 1279–1287.

Koebman B.J., Nilsson D., Kuipers O.P., Jensen P.R. (2000): The membrane-bound H+-ATPase complex is essential for growth of Lactococcus lactis. Journal of Bacteriology, 182: 4738–4743.

Matsumoto M., Hifumi O., Yoshimi B. (2004): H+-ATPase activity in Bifidobacterium with special reference to acid tolerance. International Journal of Food Micro-biology, 93: 109–113.

Miwa T., Esaki H., Umemori J., Hino T. (1997): Activity of H+-ATPase in ruminal bacteria with special refer-ence to acid tolerance. Applied and Environmental Microbiology, 63: 2155–2158.

Miwa T., Abe T., Fukuda S., Ohkawara S., Hino T. (2000): Effect of reduced H+-ATPase activity on acid tolerance in Streptococcus bovis mutants. Anaerobe, 6: 197–203.

Quivey R.G., Kuhnert W.L., Hahn K. (2001): Genetics of acid adaptation in oral streptococci. Critical Re-views on Oral Biology and Medicine, 12: 301–314.

Salminen S., Isolauri E., Salminen E. (1996): Clinical uses of probiotics for stabilizing the gut mucosal bar-rier; successful strains and future challenges. Antonie van Leeuwenhoek, 70: 347–358.

Saarela M., Mogensen G., Fonden R., Matto J., Mattila-Sandholm T. (2000): Probiotic bacteria: safety, functional and technological properties. Journal of Biotechnology, 84: 197–215.

Walker J.E., Saraste M., Gay N.J. (1984): The unc operon. Nucleotide sequence, regulation and structure of ATP-synthase. Biochimica et Biophysica Acta, 768: 164–200

Wang J., Chen X., Liu W., Yang M., Caicike A., Zhang H. et al. (2008): Identification of Lactobacillus from koumiss by conventional and molecular methods. European Food Research and Technology, 227: 1555–1561.

Wu R., Zhang H., Menghebilige (2005): 16S rDNA sequence and cluster analysis of Lb. casei Zhang and ZL 12–1 isolated from koumiss. China Dairy Industry, 33: 4–9.

Xu J., Yun Y., Zhang W., Shao Y., Menghe B., Zhang H. (2006): Fermentation properties of 4 strains of Lactobacillus casei isolated from traditionally home-made koumiss in Inner Mongolia of China. China Dairy Industry, 34: 23–27.

Yokota A., Amachi S., Ishii S., Tomita F. (1995): Acid sensitivity of a mutant of Lactococcus lactis subsp. lactis C2 with reduced membrane-bound ATPase activity. Bioscience Biotechnology, and Biochemistry, 59: 2004–2007.

Yun Y., Wang L.P., Zhan H.P., Chen Y.F., Menghe-bilige (2006): Effect of administration of Lactobacil-lus casei Zhang on serum lipids and fecal steroids in hypercholesterolemic rats. Journal of Microbiology, 33: 60–64.

Zhang H., Menghe B., Wang J., Sun T., Xu J., Wang L., Yun Y., Wu R. (2006a): Assessment of potential pro-biotic properties of L. casei Zhang strain isolated from traditionally home-made koumiss in Inner Mongolia of China. China Dairy Industry, 34: 4–10.

Zhang H., Zhang Q., Menghe B., Ren G. (2006b): Ef-fect of oral administration of L. casei Zhang on T-lym- phocyte subclass, serum IgG and intestinal mucous SIgA of mouse. China Dairy Industry, 34: 4–8.

Received for publication July 26, 2008

Corresponding Authors:

Prof. Heping Zhang, Key Laboratory of Dairy Biotechnology and Engineering, Ministry of Education, Inner Mongolia Agricultural University, P. R. Chinatel.: + 86 471 431 99 40, fax: + 86 471 430 01 22, e-mail: [email protected]. He Meng, School of Agriculture and Biology, Shanghai Jiao Tong University, P. R.Chinatel.: + 86 21 342 045 38, fax: + 86 21 342 041 07, e-mail: [email protected]

55


Identification and Characterisation of Antimicrobial Activity of Nisin A Produced by Lactococcus lactis subsp. lactis LL27

Pınar ŞANLIBABA1, Nefise AKKOÇ2 and Mustafa AKÇELIK2

1Kalecik High School, Ankara University, Kalecik, Ankara, Turkey; 2Department of Biology, Faculty of Science, Ankara University, Tandoğan, Ankara, Turkey

Abstract

Şanlibaba P., Akkoç N., Akçelik M. (2009): Identification and characterisation of antimicrobial activity of nisin A produced by Lactococcus lactis subsp. lactis LL27. Czech J. Food Sci., 27: 55–64.

In this study, bacteriocin producing lactococcal strains were isolated from Turkish raw milk samples. Among these isolates, LL27 had the highest inhibition activity against Gram-positive indicator strains, and was selected for further analyses. DNA sequencing of 16S ribosomal RNA gene demonstrated that the isolate was Lactococcus lactis subsp. lactis. The gene encoding the bacteriocin in this strain was found to be identical to that of nisin A using direct PCR sequence methods. The bacteriocin was completely inactivated by α-chymotrypsin and proteinase K and partially inactivated by lipase and α-amylase. pH and heat stability characteristics were found to be identical with those of the control nisin. The inhibitory activity of the bacteriocin produced by LL27 was also evaluated against Gram-negative bacteria in combination with heat and freezing treatments. The results obviously showed that the production level of nisin of the Lc. lactis LL27 had a significant inhibitory effect on the pathogenic Gram-negative strains with the heating and freezing processes which are commonly used in the food processing.

Keywords: nisin A; Lactococcus lactis; sublethal injury; heating; freezing

Supported by the grant from Ankara University, Turkey, BİYEP program with the project entitled “Enhancing of Nisin Production Ability in Lactococcus lactis subsp. lactis”.

Lactic acid bacteria (LAB) have been used for centuries in the fermentation of foods, not only for flavour and texture, but also due to their ability to prevent the growth of pathogenic microorgan-isms (McAulife et al. 2001). The interest in the application of microorganisms and their metabo-lites for the prevention of food spoilage and the extension of shelf life of foods has increased during the last decade. Along with lactic acid, the roles of other metabolites such as bacterial growth inhibitors (e.g. hydrogen peroxide, acetic acid, acetoin, and diacetyl) have been demonstrated. However, the leading role in the explanation of the antagonism of lactic acid bacteria is assigned

to specific antimicrobial substances of a protein nature, bacteriocins. Many bacteriocins produced by LAB inhibit not only the closely related spe-cies but also the growth of food borne pathogens, such as Listeria monocytogenes and food spoilage bacteria (Cintas et al. 1995; Cleveland et al. 2001). Out of the bacteriocins produced by LAB, nisin has been the most extensively studied. It is active against Gram-positive bacteria and is iden-tified as four types (nisin A, Z, Q, U) that differ in both amino acid compositions and biological activities (Cleveland et al. 2001; Zendo et al. 2003; Wirawan et al. 2006). Nisin sensitivity to α-chymotrypsin, its heat stability at low pH and

56


non-toxic nature has promoted its industrial use. Thus far, nisin is the only bacteriocin to have found a widespread application in the food industry. It is permitted as a food additive in at least 46 coun-tries, particularly for the inhibition of Clostridium species in processed cheese, dairy products, and canned products (Delves-Broughton 1990).

Nisin exhibits a broad spectrum of inhibitory activity against Gram-positive bacteria including their spore forms (Delves-Broughton 1990). However, it is not generally active against Gram-negative bacteria, yeasts and fungi due to their outer membrane permeability barrier. The altera-tion of this barrier by a chelator or some physical treatments leads to an induced sensitivity against nisin (Kalchayanand et al. 1992; Boziaris et al. 1998; Boziaris & Adams 2000). Induced sensitiv-ity to nisin has been accomplished by the use of chelating agents, e.g. EDTA, as well as a heat shock or freezing and acid treatments (Kalchayanand et al. 1992). Therefore, using nisin producers in the fermented food production processes includ-ing heat and freezing applications has a great importance for inactivating the Gram-negative pathogenic strains (Elliason & Tatini 1999).

Although nisin has been approved as a food pre-servative by Food and Drug Administration (FDA), the low rate production by the producer strains has restricted its application in the fermentation systems. Therefore, the isolation and characterisa-tion of new strains having a high production ability has been the main subject in this respect. The first nisin producers were isolated from and identified in fermented milk products, but since then they have been isolated from various dairy products (Mitra et al. 2005), traditional fermented vegetables (Olasupo et al. 1999), fermented meat products (Choi et al. 2000), river water (Zendo et al. 2003), and human milk (Beasley & Saris 2004).

In this paper, we report a new bacteriocin pro-ducing lactococcal strain isolated from cow milk samples that were collected from different prov-inces of Turkey. The antimicrobial spectrum and the biochemical characteristics of the bacteriocin produced by this strain were determited. After amplification of and sequencing the respective structural gene, the type of this bacteriocin was assigned to Nisin A. Also, the antimicrobial activity of nisin against Gram-negative strains, particularly Escherichus coli and Salmonella typhimurium, were evaluated under sublethal stress conditions such as heating and freezing.

MATERIAL AND METHODS

Bacterial strains and culture media. The lacto-coccal strains Lc. lactis subsp. lactis LL27 and Lc. lactis SIK83 (reference strain) were grown in M17 medium (GM17) at 30°C. The indicator strains used for the inhibitory activity tests of Lc. lactis subsp. lactis LL27 bacteriocin were obtained from Laboratory of Microbial Gene Technology NHL (As, Norway) and Culture Collection of Science Faculty of Ankara University, Lc. innocua, Pedio-coccus pentosaceus, Enterecoccus sp. and the other Lactococcus sp. strains were grown in GM17 broth at 30°C. Lactobacillus sp. strains were grown in de Man-Rogosa-Sharpe medium (Oxoid, UK) at 37°C. Bacillus cereus, Staphylococcus carnosus, St. aureus, Pseudomonas fluorescens, S. typhimu-rium and E. coli were grown in Luria Bertani broth (LB) at 37°C. Bacterial stocks were stored at –80°C in their respective broths supplemented with 20% glycerol.

Isolation and identification of bacteriocin producing strains. Totally 102 cow milk samples were collected from 7 individual regions (Marmara, Aegean, Mediterranean, Central Anatolia, Black Sea, Eastern Anatolia, Southeast Anatolia) of Tur-key. Lc. lactis strains were isolated by inoculating the samples on to NRCLA medium (Harrıgan & McCance 1966). The isolates, with bacteriocin production phenotypes were selected on the ba-sis of their inhibitory spectrum and identified by their colony morphology, Gram-staining, cell morphology, and by 16S rDNA homology using a pair of bacteria-specific universal primers; forward 5'-AGA GTT TGA TCC TGG CTC AG-3' and reverse 5'-CCG TCA ATT CCT TTG AGT TT-3' (Beasley & Saris 2004).

Detection of antimicrobial activity. The anti-microbial activity was evaluated as described by Van Belkum et al. (1989). The bacteriocin-pro-ducing Lactococcus isolates were grown overnight at 30°C in M17 broth supplemented with glucose (GM17), by using sterile toothpicks the strains were transferred to GM17 plates. After incubating overnight, a layer of 5 ml of soft GM17 agar (0.5% agar) containing 100 µl of the indicator strain was poured on to the surface. The colonies were examined for inhibition zones after overnight incubation at 30°C.

Nisin activity was assayed by the critical-dilution method (Daba et al. 1993). The sensitive indicator Lbc. plantarum LMG2003 strain was chosen to assay

57


the activity. The supernatant of the producer strain was serially diluted two fold in 125 µl volumes of dH2O (pH 2.5) after treating with catalase. Then 5 µl of each dilution was dropped on to the plates containing 5 ml of soft GM17 agar, the plates hav-ing been inoculated with the sensitive indicator strain. The activity was calculated using the formula (1000 × 5–1) × D–1, where D is the highest dilution that allowed no growth of the indicator organism after 18 h of incubation.

Effects of heat, enzymes, and pH on bacteriocin activity. To determine the effect of pH on the bacteriocin activity, cell free culture supernatants (CFCS) of the isolates were adjusted to pH values of 2 to 11 by using 6 mol/l NaOH or HCl. The samples were assayed for the activity with the bacteriocin sensitive strain of Lbc. plantarum LMG2003. Lc. lactis subsp. lactis SIK83 was used as the posi-tive control, being a nisin producer. The samples treated with proteinase K before pH adjusting were also tested against the same indicator to avoid the possible pH inhibition.

To evaluate the effect of heat on the bacteriocin activity, CFCS were heated at 100°C for 5, 10, 15, and 20 min, and at 121°C for 15 minutes. CFCS were also treated with the following enzymes at the final concentration of 1 mg/ml of trypsin (pH 7, Merck, Germany), α-chymotrypsin (pH 7, type II), proteinase K (pH 7), lipase (pH 7), α-amylase (pH 7,) and lyzozyme (pH 7) (all Sigma, USA). Following the incubation at 37°C for 2 h, the enzyme activities were determined by heating at 100°C for 5 minutes. The untreated samples were used as the controls (Franz et al. 1997). After the heat or enzyme treatments the remain-ing bacteriocin activity was determined by well-diffusion assay.

DNA extraction, polymerase chain reaction (PCR), and DNA sequencing. Genomic DNA was extracted by the method of Engelke et al. (1992). The PCR analysis was carried out with a volume of 50 µl mixture in a DNA thermocycler (Techne A512, Great Britain). The procedure consisted of 30 cycles of 94°C for 45 s, 52.5°C for 45 s, and 72°C for 1 minute. The primers for the nisin genes comprised the following nucleotide sequences; 5'-ATG AGT ACA AAA GAT TTT AAC TTG-3' and 5'-ATT TGC TTA CGT GAA TAA TAC AA-3'.

The amplified PCR products were harvested from agarose gel and purified with gel extraction and PCR purification kits (Promega, USA). The purified product was sequenced with an autoread

sequencing kit in the ABI PRISM377 DNA se-quencer (Perkin Elmer, USA).

Plasmid isolation and conjugation. Plasmid DNA was isolated by the method of Anderson and McKay (1983). The plasmid DNA samples were subjected to electrophoresis in 0.7% agarose gels.

The conjugation procedure was adopted from Gasson and Davies (1980). The recipient and donor strains were grown in GM17 broth at 30ºC for 18 hours. For the recipient strain Lc. lactis MG1363 strain, erythromycin (5 µl/ml) was added to this medium. Two ml of the donor and 3 ml of the recipient culture (both 10–4 diluted) were mixed and the cells were collected on sterile membrane filters (0.45 µm Sartorius, Germany). The filters containing the recipient and donor cells were placed on GM17 agar plates, supplemented with 0.5% (w/w) glucose, and kept at 30°C for 18 hours. The filters were then taken of the GM17 agar plates and washed in 1 ml of sterile Ringer solution to suspend the cells. Serial dilutions were made (up to 10–8) and from each dilution the aliquots were spread on to fast slow differential agar plates containing antibiotics which were subsequently incubated at 30°C for 48 hours. The conjugation frequency was determined according to the ratio of the number of transconjugants per ml to the number of donor per ml. The stabilities of the nisin production phenotype in the LL27 and its transconjugants were determined after 70 genera-tions according to the method proposed by Pıcon et al. (2005).

Heating and freezing stress and nisin treatment. To determine the susceptibility of Gram-negative cells (E. coli and S. typhimurium) to the produced nisin concentrations of 500 and 1000 IU/ml with heating and freezing, cell suspensions in peptone water were treated using the method proposed by Kalchayanand et al. (1992). The cells from 10 ml broth of each strain were harvested by centrifuga-tion and resuspended in 0.1% sterile peptone water to a cell concentration of 105–106 CFU/ml. The experiment was carried out with three replicas and two parallels for each replica. Three sets of samples of each strain (E. coli and S. typhimu-rium) were prepared as follows; one with 0.9 ml cell suspension and 0.1 ml sterile water, two with 0.9 ml cell suspension and 0.1 ml nisin prepara-tion. The final concentration of nisin was 500 and 1000 IU/ml, respectively. Three tubes were heated at 55°C for 10 min and then cooled immediately in

58


water (4°C). Three ones with similar treatments were frozen at –20°C for 2 h and 24 h and then thawed rapidly. All 9 samples were enumerated for the colony forming units (CFU) by preparing serial dilutions in peptone water and by plating in duplicate for each dilution on LB agar and in-cubated at 37°C for 48 hours.

Nisin produced by Lc. lactis subsp. lactis LL27 was prepared from the cultures by the method developed by Yang et al. (1992). Briefly, pH of the broth culture was adjusted to 6.0 and the cells were harvested by centrifugation at 6000 RPM for 15 minutes. The cells with the adsorbed nisin were resuspended in 100 mmol/l saline at pH 2 to release nisin. The cells were then removed by centrifugation and the nisin containing supernatant was dialysed, freeze dried, and resuspended to the desired potency.

Statistical analysis. A one-way analysis of vari-ance (ANOVA) along with the Tukey and Hsu MCB (Multiple comparisons with the best) comparisons was carried out using the MINITAB 14.0 (Minitab Inc. State College, PA) to determine the significance effect of nisin under different heating and freezing stresses. Three repetitions of each inactivation assay were performed. For each condition, the standard deviations were calculated by converting the CFU/ml to log10, and the significance levels were set as P < 0.05 and P < 0.001.

RESULTS AND DISCUSSION

Isolation and identification of bacteriocin-producing lactic acid bacteria

Sixteen lactococci isolated from 102 cow milk samples were found to produce inhibition zones against the indicator strains of Lbc. plantarum LMG2003 and Lbc. sake NCDO2714. The culture supernatants of these isolates were tested for an-timicrobial activity against Gram-positive and Gram-negative bacteria. Only three (LL27, LL57, LL90) of them were found to secrete bacteriocins into the culture broth. Among these isolates, LL27 had the broadest spectrum of inhibitory activity (Table 1). This isolate was a Gram-positive, catalase negative coccus. Based on these characteristics and the identity of this strain by 16S rDNA analysis, it was confirmed that LL27 has 99% homology to Lc. lactis subsp. lactis (data not shown).

Microorganisms are the major cause of food related diseases and spoilage in the production and storage of food and beverages. Antibiot-

ics and food preservatives are generally used to combat these microorganisms. However, due to the potential danger of the antibiotic resistant bacteria and the demand by the consumers for purer and safer foods, there is a growing interest to replace these substances by natural products that are easily degraded and are harmless to the individuals and the environment. In this respect, a novel approach, using bacteriocins or bacteriocin producing strains is a convenient strategy to con-trol the undesirable microflora in foods. Bacteri-ocin production is widespread among lactic acid bacteria, especially in Lc. lactis, which are often assumed to be mainly associated with milk and dairy products (Rodriguez et al. 2000). In this study, a new bacteriocin producer strain has been isolated from cow milk obtained from different provinces of Turkey. Based on the results of 16S rDNA sequencing and phenotypic tests, LL27 was confirmed to be Lc. lactis subsp. lactis. Our find-ings that approximately 1% of cow milk samples contain nisin-producing bacteria are consistent with previous reports (Mitra et al. 2005).

Characterisation of bacteriocin

The inhibitory spectrum of the bacteriocin pro-duced by Lc. lactis subsp. lactis LL27 is presented in Table 1. Strain LL27 was found to show the inhibitory activity at different levels to 17 out of 23 indicator bacteria tested in this study. No inhibitory activity could be detected against Lc.

Figure 1. Inhibition zones of nisin produced by LL27 strain after treatment with different enzymes

59


lactis subsp. lactis SIK83, Lc. lactis subsp. lactis LMG2088, S. aureus LMG3027, E. coli LMG3083 (ETEC), S. typhimurium SL1344, and P. fluorescens PI. Nisin producing Lc. lactis SIK83 was used as an experimental control and showed an inhibitory spectrum identical to LL27.

The effects of enzymes, pH, and heat treatments on the activity of the bacteriocin produced by LL27 are presented in Table 2. Protease sensitivity assay demonstrated that the antimicrobial substance pro-duced by LL27 is a bacteriocin-like substance since its inhibitory activity was completely eliminated by the treatment with proteinase K and α-chymo-trypsin. The activity was, however, not affected

by other proteases including trypsin, pepsin, and non-protease enzymes including catalase and lysozyme. When lipase and α-amylase were applied, 50% and 87.5% of its activity was lost, respectively (Table 2 and Figure 1), which was not observed in the case of nisin produced by the reference strain of SIK83. The bacteriocin was found to be active over a wide pH range between 2 and 11. At the pH between 2 and 4, the activity was much higher than at neutral and basic pH values. 50–87.5% activity decreases were obtained from pH 9 to 11. The bacteriocin was completely stable under the heat treatment at 100°C for 5, 10, 15, and 20 min-utes. However, the activity decreased by 97% on

Table 1. Inhibitory spectrum of bacteriocins produced by the strains Lactococcus lactis subsp. lactis LL27 and SIK83

StrainSensitivity*

LL27 SIK83

Lc. lactis subsp. lactis SIK83 (Nisin producer) NZ NZ

Lc. lactis subsp. lactis IL1403 (Nisin sensitive) +++ +++

Lc. lactis subsp. lactis 105 (Lacticin producer) ++ ++

Lc. lactis subsp. lactis LMG2908 ++ ++

Lc. lactis subsp. lactis T1 + +

Lc. lactis subsp. lactis 731 (Lacticin 3147 producer) + ++

Lc. lactis subsp. lactis 2 (Lacticin 3147 producer) ++ ++

Lc. lactis subsp. lactis LMG2912 (Lacticin 3147 producer) + ++

Lc. lactis subsp. lactis JC 17 (Lacticin 481 producer) +++ +++

Lc. lactis subsp. lactis LMG2132 (Lactococcin producer) ++ ++

Lc. lactis subsp. lactis LMG2088 (Lactococcin G producer) NZ NZ

Lbc. sakei NCDO2714 (Nisin sensitive) +++ +++

Lbc. plantarum LMG2003 +++ +++

Ent. faecalis LMG 2708 (Nisin sensitive) +++ ++

Ent. faecalis NCDO581 ++ +++

P. pentosaceus LMG2001 (Pediocin producer) +++ +++

L. innocua LMG 2813 (Nisin sensitive) +++ +++

St. carnosus LMG2709 ++ +++

St. aureus LMG3027 NZ ++

B. cereus LMG2732 ++ ++

S. typhimurium SL1344 NZ NZ

E. coli LMG 3083 (ETEC) NZ NZ

P. fluorescens P1 NZ NZ

*Inhibition zone: + = 1–5 mm; ++ = 6–10 mm; +++ = 11 mm and over diameter of inhibition zone, NZ = no zone

60


Figure 2. (a) Nisin gene amplification using specific prim-ers: lane 1 – negative control, lane 2 – amplification from plasmid extracts of the LL27 strain, lane 3 – o’rangerular marker (fermentas) 1500, 1400, 1300, 1200, 1100, 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100 bp, lane 4 – am-plification from genomic DNA of the LL27 strain; (b) the plasmid profile of the LL27 strain: lane 1 – supercoiled marker (Sigma, USA) 16.2, 14.1, 12.2, 10.2, 8.0, 7.2, 6.0, 5.0, 4.0, 2.9, 2.1 kb, lane 2 – plasmids of the LL27 strain

(a) 1 2 3 4 (b) 1 2

applying the sterilisation temperature (121°C for 15 min) in accordance with the nisin produced by the control strain Lc. lactis SIK83. Based on these results, it appeared that Lc. lactis subsp. lactis LL27 produced a nisin-like bacteriocin.

To prove that the bacteriocin produced by Lc. lac-tis subsp. lactis LL27 was nisin, PCR analysis was performed using the published sequences of the nisin structural gene (Dodd et al. 1990). Two primers complementary to the sequences occurring proximal to 5' and 3' ends of the nisin A structural gene were used to amplify the nisin gene from the genomic DNA of LL27 and Lc. lactis SIK83. A

179 bp fragment was amplified from the genomic DNA of LL27 (Figure 2a), which was identical to that amplified from the nisin-producing strain of Lc. lactis SIK83. The amplified PCR product of Lc. lactis LL27 was subsequently sequenced using both strands as shown in Figure 3. These results indicated that the sequences were 100% identical to those of nisin A, in which instead of asparagine (AAT), histidine (CAT) residue is located at posi-tion 27 of the nisin peptide

The antimicrobial substance produced by Lc. lactis subsp. lactis LL27 strain had similar pH sensitivity and heat insensitivity patterns to nisin. However, the most distinctive property of the LL27 bacteriocin was its susceptibility to α-amylase and lipase, which was not seen in the case of nisin from the reference strain. Although, by definition, all bacteriocins are protein based, some have been

Table 2. Effect of enzymes, heat treatments, and pH on bacteriocin activity (IU/ml)

Strain LL27 SIK83

Control 3 200 6 400

Enzymes

Trypsin 3 200 6 400

α-chymotrypsin 0 0

Proteinase-K 0 0

Pepsin 3 200 3 200

α-amylase 400 6 400

Lipase 1 600 6 400

Catalase 3 200 6 400

Lysozyme 3 200 6 400

Heat

100oC for 5 min 3 200 6 400

100oC for 10 min 3 200 6 400

100oC for 15 min 3 200 6 400

100oC for 20 min 3 200 6 400

121°C for 15 min 100 100

pH

2 6 400 12 800

3 6 400 12 800

4 6 400 12 800

5 3 200 6 400

6 3 200 6 400

7 3 200 6 400

8 3 200 6 400

9 1 600 3 200

10 800 1 600

11 400 800

61


reported to consist of combinations of different proteins or proteins together with lipid or carbohy-drate residues (Nes & Johnsborg 2004). As with the nisin-producing reference strain, the bacteri-ocin from LL27 strain exhibited a broad spectrum of antimicrobial activity (Table 1). However, a slight difference was observed in the inhibition of St. aureus LMG3027, which was inhibited by the nisin-producing reference strain contrary to LL27 strain. In addition, Lc. lactis subsp. lactis LL27 showed a higher inhibition activity against E. faecalis LMG2708, whereas the nisin-produc-ing strain (SIK83) had a higher activity against Lc. lactis subsp. lactis 731, Lc. lactis subsp. lac-tis LMG2912, S. carnosus LMG2709, E. faecalis NCDO581. In the literature such difference in inhibitory spectra has generally been attributed to other products of LAB such as organic acids, hy-drogen peroxide, diacetyl, and inhibitory enzymes (Nes & Johnsborg 2004). Due to the differences in biochemical activities between the bacteriocins of LL27 and SIK83 strains, the sequence of the structural gene was determined. The existence of histidine at position 27 in the nisin structure showed that the bacteriocin produced by LL27 strain is identical to nisin A.

The genetic nature of nisin production by strain LL27

In order to determine whether the nisin pro-duction ability in LL27 strain is chromosomally or plasmid DNA encoded, a PCR assay was ap-plied by using the primers specific in the nisin A structural gene. By analysing the extracts of ge-nomic and plasmid DNAs of LL27 separately, a 179 bp product was obtained from genomic DNA indicating that the nisin production genes were located on the chromosomal DNA (Figure 2a). The examination of the plasmids content of the LL27 strain revealed that it has 10 distinct plasmids with molecular weights varying from 2.1 to 33.1 kb (Figure 2b). As a consequence of the conjugation trials, the nisin production genes were transferred to the erythromycin resistant strain of Lc. lactis MG1363 with a frequency of 2 × 10–3 per donor cell. All nisin-producing transconjugants were found to be plasmid free, indicating that the nisin determinants were transferred by a chromosomally located conjugative transposon. Additionally, the nisin production level of the donor strain LL27 cannot be exceeded by the three different transcon-

jugants, which were able to produce 800–1600 IU nisin/ml. The stability of the nisin production by LL27 strain was determined as 90% with the transconjugants as 50% in average.

Studies have shown that the nisin production genes are either located on the conjugative plasmids (Horn et al. 1991; Akçelik et al. 2006) or linked with conjugative transposons on the chromosome (Rauch & de Vos 1992). In this study, the pro-duction of nisin A by LL27 strain was found to be located on a conjugative transposon residing in the chromosome. The conjugative nature of the production facilitates the relations with genetic manipulations, providing developments in indus-trial starter cultures and bringing an economical gain in the fermentation industry. However, Picon et al. (2005) claimed that at least 50% stability is required for any traits of the starter cultures for them to be efficient at the industrial level after 70 generations. Under this circumstance, the stabil-ity of the nisin production in the transconjugants has indicated that LL27 strain can be used as a potential donor to improve the starter culture properties even in spite of the low production of transcojugants compared to LL27 producer.

Effect of the produced nisin on Gram-negative strains under heating

and freezing treatments

A number of physical treatments (heating and freezing) were applied to overcome the penetration of nisin produced by LL27 into two Gram-negative bacteria, E. coli and S. typhimurium, which were assigned to be insensitive through the antimicrobial activity assays. Figure 4 show the effect of nisin on the bacterial population with three types of thermal shock; heating at 55°C for 10 min, freezing at –20°C for 2 h and 24 h, respectively, followed by thawing. All three physical treatments reduced the viable cell number, however, when nisin was present in the medium during these treatments, a dose dependent increase in lethality was observed in most cases (Figure 4). After the heat treatment at 55°C for 10 min, the amount of E. coli was reduced, by 1.39 log CFU/ml and 2.92 log CFU/ml in the presence of 500 IU nisin/ml and 1000 IU nisin/ml, respectively. Nisin was found to affect more this strain in the freezing treatments. Accordingly, –20°C for 2 h and 24 h reduced E. coli population by 2.94 and 5.08 log CFU/ml, respectively, with 500 IU nisin/ml. However, when the exposure

62


amount of nisin was increased to 1000 IU/ml, higher reductions (3.94 and 5.52 log CFU/ml) were yielded. While the 500 IU/ml concentration was found to be significant at the level of P < 0.005, 1000 IU/ml showed a more significant level (P < 0.001) on the viable cell reduction effect with each of the stress treatments.

S. typhimurium strain was found less sensitive to nisin than E. coli strain, under heating and freez-ing treatments. While heating at 55°C for 10 min with 500 IU nisin/ml reduced (1.47 log CFU/ml) the viability of S. typhimurium cells significantly (P < 0.05) in accordance with the control group without nisin, increasing the amount of nisin to 1000 IU/ml at the same heating treatment resulted in 3.34 log CFU/ml viable cell reduction (P < 0.001). Furthermore, the treatment by –20°C freezing and thawing in the presence of 500 IU nisin/ml

reduced the population of S. typhimurium cells by about 0.78 log CFU/ml (P > 0.05) after 2 h and 2.91 log CFU/ml (P < 0.05) after 24 h of incuba-tion. Nevertheless, 1000 IU nisin/ml reduced the population of S. typhimurium cells more signifi-cantly (P < 0.001) at the level of 3.46 and 3.58 log CFU/ml, respectively.

Apart from these results, E. coli cells were found to be significantly (P < 0.05) more sensitive than S. typhimurium cells in the stress treatments with both of 500 and 1000 IU/ml except heating at 55°C for 10 minutes. Additionally, the highest lethality (P < 0.05) was observed for both E. coli and S. typhimurium strains, when the treatment at –20°C for 24 h was applied in the presence of 500 and 1000 IU nisin/ml.

The stress treatments used with 500 and 1000 IU nisin/ml affected the viability of E. coli and S. ty-

Figure 3. Nucleotide sequence and deduced amino acid sequence of the nisA gene isolated

from L. lactis subsp. lactis LL27. the amino acid sequence is shown below the coding

sequence. The nucleotide in the nisA sequence that differs with that in the nisZ gene sequence

is in bold and italic. Stop codon is shown by asterisk

1 ATG AGT ACA AAA GAT TTT AAC TTG GAT TTG Met Ser Thr Lys Asp Phe Asn Leu Asp Leu

30 GTA TCT GTT TCG AAG AAA GAT TCA GGT GCA Val Ser Val Ser Lys Lys Asp Ser Gly Ala

60 TCA CCA CGC ATT ACA AGT ATT TCG CTA TGT Ser Pro Arg Ile Thr Ser Ile Ser Leu Cys

90 ACA CCC GGT TGT AAA ACA GGA GCT CTG ATG

Thr Pro Gly Cys Lys Thr Gly Ala Leu Met

120 GGT TGT AAC ATG AAA ACA GCA ACT TGT CAT Gly Cys Asn Met Lys Thr Ala Thr Cys His

150 TGT AGT ATT CAC GTA AGC AAA TAA

Cys Ser Ile His Val Ser Lys *

Figure 3. Nucleotide sequence and deduced amino acid sequence of the nisA gene isolated from Lc. lactis subsp. lactis LL27: the amino acid sequence is shown below the coding se-quence: the nucleotide in the nisA sequence that differs with that in the nisZ gene sequence is in bold and codon is shown by asterisk

Figure 4. The effect of stress treatments and the presence of nisin on inactivation of Gram-negative (a) E. coli and (b) S. typhimurium without nisin

Significantly (P < 0.05): *more sensitive than S. typhimurium except 55°C for 10 min heating; §different at lethality with both 500 and 1000 IU nisin/ml; ±different from control group without nisin; †different from control group without nisin

1

30

60

90

120

150

(a) (b)6

4

2

0

6

4

2

0

Popu

latio

n re

duct

ion

(CFU

/ml)

55°C for 10 min –20°C for 2 h –20°C for 24 h§ 55°C for 10 min –20°C for 2 h –20°C for 24 h§

†† ††

†

†

±

±

±

±±

±

***

*

**

∎ nisin ∎ 500 IU nisin/ml□ 1000 IU nisin/ml

63


phimurium cells to different extents. These reduc-tions were found significant at the levels of P < 0.05 and P < 0.001 (Figure 4) when compared to the controls without nisin. In earlier studies, similar reductions were reported which ranged between log 2.1 to 5 for Salmonella and log 1.5 to 3.5 for E. coli using higher nisin concentrations (> 2000 IU/ml) (Kalchayanand et al. 1992; Boziaris & Adams 2000). This implies that the sensitivity of the in-jured cells is not increased by higher amounts of nisin. Likewise, Boziaris et al. (1998) stated that concentrations of nisin higher than 1500 IU/ml did not have any significant additional effects on S. enteritidis PT4. Consequently, the presence of low amounts of nisin during food processing treatments that impose stress on Gram-negative bacteria could increase the lethality of the proc-ess, enhancing both microbiological safety and stability of food. Especially, the combination of nisin and freezing/heating applications involved in food producing processes may be contributed to the hurdle technology against Gram-negative pathogen and spoilage bacteria.

CONCLUSION

The incorporation of the bacteriocin-producing lactococci in foods provides an attractive alterna-tive to the addition of purified bacteriocin. The new LL27 strain has important characteristics to be a suitable starter culture in respect to its moderate nisin production ability together with the conju-gative property while showing inhibitory activity of its bacteriocin against Gram-negative strains under different heating and freezing treatments which have often been used in food processes. Furthermore, the origin from unprocessed cow milk indicates that LL27 strain may be potentially a natural isolate. Likewise the demand on using commercial starter cultures within the developing dairy industy has resulted to loose entire natural microflora which may comprise versatile starter cultures. In this view, the other starter features of LL27 should be investigated for gaining new starter cultures.

R e f r e n c e s

Akçelik O., Tukel Ç., Özcengiz G., Akçelik M. (2006): Characterization of bacteriocins from two Lactococcus lactis subsp. lactis isolates. Molecular Nutrition and Food Research, 50: 306–313.

Anderson D.G., McKay L.L. (1983): A simple and rapid method for isolating large plasmid DNA from lactic streptococci. Applied and Environmental Microbiol-ogy, 46: 549–552.

Beasley S.S., Saris P.E.J. (2004): Nisin producing Lac-tococcus lactis isolated from human milk. Applied and Environmental Microbiology, 70: 5051–5053.

Boziaris I.S., Humpheson L., Adams M.R. (1998): Effect of nisin on heat injury and inactivation of Sal-monella enteritidis PT4. International Journal of Food Microbiology, 43: 7–13 .

Boziaris I.S., Adams M.R. (2000): Transient sensitivity to nisin in cold shocked Gram negatives. Letters in Applied Microbiology, 31: 233–237.

Choi H.-J., Cheigh C.-I., Kim S.-B., Pyun Y.-R. (2000): Production of nisin like bacteriocin by Lactococcus lactis subsp. lactis A164 isolated from kimchi. Journal of Applied Microbiology, 88: 563–571.

Cintas L.M., Rodriquez J.M., Fernandez M.F., Slet-ten K., Nes I.F., Hernandez P.E., Holo H. (1995): Isolation and characterization of pediocin L50, a new bacteriocin from Pediococcus acidilactici with a broad inhibitory spectrum. Applied and Environmental Microbiology, 61: 2643–2648.

Cleveland J., Montville T.J., Nes I.F., Chikindas M.L. (2001): Bacteriocins safe natural antimicrobials for food preservation. International Journal of Food Microbiology, 71: 1–20.

Daba H., Lacroix C., Huang J., Simard R.E. (1993): Influence of growth conditions on production and activity of mesenterocin 5 by a strain of Lueconostoc mesenteroides. Applied Microbiology and Biotechnol-ogy, 39:166–173.

Delves-Broughton J. (1990): Nisin and its uses as a food preservative. Food Technology, 44: 100–117.

Dodd H.M., Horn N., Gasson M.J. (1990): Analysis of the genetic determinant for the production of peptide antibiotic nisin. Journal of General Microbiology, 136: 555–566.

Elliason D.J., Tatini S.R. (1999): Enhanced inactiva-tion of Salmonella Typhimurium and verotoxigenic Escherichia coli by nisin at 6–5°C. Food Microbiology, 16: 257–267.

Engelke G., Gutowski-Eckel Z., Hammelmann M., Entian K.D. (1992): Biosynthesis of the lanthibiotic nisin; genomic organization and membrane localiza-tion of the nisB protein. Applied and Environmental Microbiology, 58: 3730–3743.

Franz C.M.A.P., Du Toit M., von Holy A, Schillinger U., Holzapfel W.H. (1997): Production of nisin-like bacteriocins by Lactococcus lactis strains isolated from vegetables. Journal of Basic Microbiology, 3: 187–196.

64


Gasson M.J., Davies F.L. (1980): High frequency con-jugation associated with streptococcus lactis donor cell aggregation. Journal of Bacteriology, 143: 1260–1264.

Harrigan F.W., McCance E.M. (1966): Laboratory Methods in Microbiology. Academic Press, London, New York: 285.

Horn N., Swindell S., Dodd H., Gasson M. (1991): Nisin biosynthesis genes are encoded by a novel con-jugative transposon. Molecular and General Genetics, 228: 129–135.

Kalchayanand N., Hanlin M.B., Ray B. (1992): Sub-lethal injury makes Gram negative and resistant Gram positive bacteria sensitive to the bacteriocins, pediocin AcH and nisin. Letters in Applied Microbiology, 15: 239–243.

McAulife O., Ross R.P., Hill C. (2001): Lantibiotics: structure, biosynthesis and mode of action. FEMS Miccrobiology Reviews, 25: 285–308.

Mitra S., Chskrabartty P.K., Biswas S.R. (2005): Production and characterization of nisin-like peptide produced by a strain of Lactococcus lactis isolated from fermented milk. Current Microbiology, 51: 183–187.

Nes I.N., Johnsborg O. (2004): Exploration of an-timicrobial potential in LAB by genomics. Current Opinion in Biotechnology, 15: 100–104.

Olasupo N.A., Schillinger U., Narbad A., Dodd H., Holzapfel W.H. (1999): Occurrence of nisin Z pro-duction in Lactococcus lactis BFE 1500 isolated from Wara, a traditional Nigerian cheese product. Interna-tional Journal of Food Microbiology, 53: 141–153.

Picon A., de Torres B., Gaya P., Nunez M. (2005): Cheese making with Lactococcus lactis strain express-

ing a mutant oligopeptide binding protein as a starter results in a different peptide profile. International Journal of Food Microbiology, 104: 299–307.

Rauch P.J.G., de Vos M.W. (1992): Characterization of the novel nisin-sucrose conjugative transposon Tn5276 and its insertion in Lactococcus lactis. Journal of Bacteriology, 174: 1280–1287.

Rodriguez E., Gonzalez B., Gaya P., Nunez M., Me-dina M. (2000): Diversity of bacteriocins produced by lactic acid bacteria isolated from raw milk. Interna-tional Dairy Journal, 10: 7–15.

van Belkum M.J., Hayema B.J., Geis A., Kok J., Ve- nema G. (1989): Cloning of two bacteriocin genes from a lactococcal bacteriocin plasmid. Applied and Environmental Microbiology, 55: 1187–1191.

Wirawan R.E., Klesse N.A., Jack R.W., Tagg J.R. (2006): Molecular and genetic characterization of a novel nisin variant produced by Streptococcus uberis. Applied and Environmental Microbiology, 72: 1148–1156.

Yang R., Johnson M.C., Ray B. (1992): Novel method to extract large amounts of bacteriocins from lactic acid bacteria. Applied and Environmental Microbiol-ogy, 58: 3355–3359.

Zendo T., Fukao M., Ueda K., Higuchi T., Nakayama J., Sonomoto K. (2003): Identification of the lanti-biotic nisin Q, a new natural nisin variant produced by Lactococcus lactis 61-14 isolated from a river in Japan. Bioscience, Biotechnology and Biochemistry, 67: 1616–1619.

Received for publication September 8, 2008 Accepted after corrections February 7, 2008

Corresponding author.

Prof. Dr. Mustafa Akcelik, University of Ankara, Faculty of Science, Department of Biology, Tandogan, 06100 Ankara/Turkeytel.: + 90 312 212 67 20 ext. 1119; fax: + 90 312 223 23 95; e-mail: [email protected]

65


In Vitro Fermentation of Galactosyl Derivatives of Polyols by Lactobacillus Strains

Elżbieta KLEWICKA1 and Robert KLEWICKI2

1Institute of Fermentation Technology and Microbiology and 2Institute of Chemical Technology of Food, Faculty of Biotechnology and Food Sciences, Technical University

of Łódź, Łódź, Poland

Abstract

Klewicka E., Klewicki R. (2009): In vitro fermentation of galactosyl derivatives of polyols by Lacto-bacillus strains. Czech J. Food Sci., 27: 65–70.

Probiotic lactic acid bacteria belonging to the species Lactobacillus casei, Lb. paracasei, and Lb. acidophilus were cultivated in the presence of galactosyl derivatives of erythritol, xylitol, and sorbitol, as well as the polyols themselves: erythritol, xylitol, sorbitol, lactitol, and glucose as a reference. After 48-h incubation, the profile of the main metabolic products (lactic and acetic acids) and the amount of the studied bacteria biomass were determined. It was found that none of the bacteria studied metabolised erythritol or xylitol. In the presence of these compounds, no increase of metabolic activity of the lactic fermentation bacteria was observed. On the other hand, the Lactobacillus sp. bacteria effectively utilised galactosyl derivatives of polyols. The bacteria growth in the presence of gal-polyols was comparable to their growth on glucose, while the fermentation profile was determined by the carbon source used.

Keywords: polyols; prebiotics; Lactobacillus; growth response

Lactic acid bacteria belonging to the genus Lactobacillus are one of the predominant groups populating the human alimentary tract, and in particular the large intestine. The presence in the intestine of Lactobacillus strains with probiotic properties is related to the positive health effects induced by these bacteria (Gibson & Roberfroid 1995; Moura et al. 2007). Nevertheless, the induc-tion of the probiotic effect is only possible with an appropriately high level of multiplication of these bacteria in the intestine. It is well-known that probiotic bacteria consumed in the form of food or as dietary supplements must overcome drastic conditions prevalent in the initial section of the alimentary tract before they reach the int-estinal lumen. Thus, optimum or even stimulating conditions for the growth of these bacteria in the intestine should be created. Among the stimulators

of probiotic lactic bacteria are prebiotics, i.e. sac-charide compounds not at all or poorly digested by the human organism (Manning & Gibson 2004). On reaching the intestine, the above-mentioned substances can become carbohydrate nutrients for the bacteria of the genus Lactobacillus and Bifidobacterium. In functional foods, the most frequently used prebiotics are fructooligosac-charides (FOS), galactooligosaccharides (GOS), maltooligiosaccharides (MOS), xylooligosaccha-rides (XOS), soya oligosaccharides, and lactulose (Douglas & Sanders 2008). Galactosyl derivatives of polyols are a group of compounds not digested by the enzymes of the human digestive system. On reaching the intestine, they can stimulate the growth of the beneficial intestinal microflora. The aim of our study was to assess the growth ability of the selected probiotic cultures of Lactobacillus sp.

66


and to determine their fermentation profile in the presence of galactosyl derivatives of polyols.

MAteriAlS AnD MethoDS

Bacterial strains and growth conditions. The strains of lactic bacteria with probiotic proper-ties of the genus Lactobacillus that were used in the studies are shown in Table 1. All the strains were obtained from the Collection of Industrial Microorganisms of the Institute of Fermentation Technology and Microbiology LOCK 105. Lacto-bacillus bacteria were stored in the form of frozen permanents. The bacteria strains were activated by a two-fold passage on the standard MRS medium (prepared using reagents from Merck) at 37°C in the presence of CO2 (5%, v/v) for 48 hours. The inocu-lum was prepared by centrifuging (12 000 rpm) of the 24-h cultivation of the Lactobacillus bacteria; the sediment was suspended in physiological salt and adjusted to a density of 108 CFU/ml.

The experiments were done using modified MRS medium (without glucose). Instead of glucose, (1%, w/v), polyols (erythritol, xylitol, sorbitol, lactitol), or galactosylopolyols (gal-xylitol, gal-erythritol, gal-sorbitol) were added to the liquid MRS medium. The MRS medium was sterilised for 15 min at 12°C. After cooling, it was inocu-lated with Lactobacillus sp. in an amount of 1% (v/v) of the inoculum prepared. The incubation was carried out for 24 h at 37°C in the presence of CO2 (5%, v/v).

The growth of the genus Lactobacillus bacteria was determined in the MRS (Merck) medium solidified with 1.5% agar using the standard plate method. After the inoculation, the bacteria were incubated for 48 h at 37°C in the presence of CO2 (5%, v/v) and the colonies were counted. The ex-periments were carried out in triplicates. The results were given in CFU/ml.

Lactic and acetic acids assay. The total con-tent of lactic and acetic acids was assayed by the enzymatic method with the use of the Boehringer Mannheim Biochemica (Germany) enzymatic tests according to the procedure presented.

Production and structure of galactosyl de-rivatives of polyols. The production of galactosyl derivatives of polyols used in the studies was car-ried out according to the procedure described by Klewicki and Klewicka (2004).

reSultS AnD DiScuSSion

In the studies, bacteria belonging to three species were used: Lactobacillus acidophilus, Lactobacillus casei, and Lactobacillus paracasei – two cultures of each species. The selection of particular strains for the studies on the fermentation ability of the galactosyl derivatives of polyols was based both on their high antagonistic activity investigated in the presence of these derivatives in relation to the bacteria belonging to the family Enterobacte-riaceae (Klewicka & Libudzisz 2001; Klewicki & Klewicka 2004), and on the studies of anti-fungal properties of lactic fermentation bacteria in the presence of polyols (Klewicka 2007). The antagonistic activity of lactic fermentation bac-teria results from their fermentative metabolism of saccharides.

These bacteria metabolise saccharides and their derivatives through homofermentation, heterofermentation, and mixed acid fermentation. Lactic acid, acetic acid, and other metabolites such as ethanol, formate, and CO2 are the final metabolic products. A mixture of lactic and acetic acids can be formed through the homofermentative pathway in the case of a limited amount of saccharides in the growth medium, a decrease in pH, or a change in temperature. In such a case, the homofermen-tative pathway of pyruvate conversions is different

Table 1. Lactobacillus strains used in the study

Species Strain code Source

Lactobacillus acidophilus LOCK 0927

dairy productLOCK 0933

Lactobacillus caseiLOCK 0908

faecesLOCK 0910

Lactobacillus paracaseiLOCK 0919

faecesLOCK 0922

67


0.0

4.0

8.0

12.0

GE E GX X GS S L Glu

Log N (C

FU/m

l)

0.0

4.0

8.0

12.0

Acetic acid, lactic acid (g/l)Log N lactic acid acetic acid

0.0

4.0

8.0

12.0


LogN (C

FU/m

l)

0.0

4.0

8.0

12.0

Acetic acid, lactic acid (g/l)

0.0

4.0

8.0

12.0


Log N (C

FU/m

l)

0.0

4.0

8.0

12.0


0.0

4.0

8.0

12.0


Log N (C

FU/m

l)

0.0

4.0

8.0

12.0


0.0

4.0

8.0

12.0


Log N (C

FU/m

l)

0.0

4.0

8.0

12.0


0.0

4.0

8.0

12.0


Log N (C

FU/m

l)

0.0

4.0

8.0

12.0


Figure 1. The growth of Lactobacillus strains on gal-xylitol (GX), xylitol (X), gal-erythritol (GE), erythritol (E), gal-sorbitol (GS), sorbitol (S), lactitol (L), and glucose (Glu) as a control at 1% carbohydrate substrate concentration after 24 hours: (A) Lactobacillus casei 0908; (B) Lactobacillus casei 0910; (C) Lactobacillus paracasei 0919; (D) Lactobacillus paracasei 0922; (E) Lactobacillus acidophilus 0927; (F) Lactobacillus acidophilus 0933

(A)

(B)

(C)

(D)

(E)

(F)

Log

N (C

FU/m

l) Lo

g N

(CFU

/ml)

Log

N (C

FU/m

l) Lo

g N

(CFU

/ml)

Log

N (C

FU/m

l) Lo

g N

(CFU

/ml)

Ace

tic a

cid,

lact

ic a

dic

Ace

tic a

cid,

lact

ic a

dic

Ace

tic a

cid,

lact

ic a

dic

Ace

tic a

cid,

lact

ic a

dic

Ace

tic a

cid,

lact

ic a

dic

Ace

tic

acid

, lac

tic

adic

(g

/l)

(g

/l)

(g

/l)

(g/

l)

(g/l

)

(g/l

)

68


– pyruvate is transformed into lactic acid, formate, CO2, and acetylCoA which in turn is transformed into acetic acid and ethanol (Hofvendahl & Hanh-Hagerdal 2000). In the case of classical homofermentation, glucose is transformed into lactic acid (Embden-Meyerhof-Parnas pathway) (Axelsson 1993).

On the other hand, lactic acid, acetic acid, etha-nol, and CO2 are the transformation products of glucose by lactic bacteria of heterofermenta-tive metabolism, which makes use of the phos-phoketolase pathway for this purpose (Kandler 1983). In the analysis of the acidic products of glucose metabolism, it was found that the strains Lactobacillus casei and Lactobacillus paracasei demonstrate the metabolic character of typical het-erofermentation (according to their classification) (Axelsson 1993; De Vuyst & Neysens 2005). In the presence of glucose, these bacteria (used as a control sample) form a mixture of lactic and acetic acids in the amounts of (depending on the strain) 6.7 to 9.1 g/l and 2.1 to 4.5 g/l, respectively (Figure 1A–D). In the presence of polyols and their galactosyl derivatives in the growth medium, the strains Lb. casei and Lb. paracasei also form a mixture of these acids. However, depending on the polyol used and its galactosyl derivative, the concentrations and the reciprocal proportions of these products are varied. The most effective synthesis of lactic acid by these cultures giving the amount of 4.9 to 6.6 g/l took place when gal-sorbitol was used for all the cultures of Lb. casei and Lb. paracasei and sorbitol itself in the case of the strains Lb. casei 0910 and Lb. paracasei 0919, where the concentration of lactic acid was 7.0 g/l and 4.8 g/l, respectively. On the other hand, acetic acid in significant quantities was synthesised by only one strain, Lb. casei 0908, in an amount of 4.5 g/l in the presence of gal-sorbitol, and 3.8 g/l after sorbitol was used as the sole source of carbon. The growth of the bacteria in the presence of gal-sorbitol and sorbitol is comparable (8.6–9.5 log units) to the reference sample – glucose (7.5–9.7 log units). In the presence of lactitol, the growth of bacterial cells is comparable to or slightly lower than that of the reference sample (depending on the strain). However, in the samples containing lactitol, a significantly smaller amount of organic acids than that in the control sample was observed with definite predominance of lactic acid over acetic acid. The quantities of lactic acid ranged from 3.0 g/l to 4.1 g/l depending on the strain,

Lb. casei or Lb. paracasei. The concentrations of acetic acid synthesised by this group of strains in the presence of lactitol ranged from 0.0 to 2.0 g/l. In the presence of erythritol and xylitol as a source of carbon in the cultivation medium, the bacteria of the species Lb. casei and Lb. paracasei did not show the ability of growth (the level shown in the diagram is the inoculation level) or the synthesis of acidic metabolites. The situation was different when the bacteria grew in the presence of the galactosyl derivatives of erythritol and xylitol (gal-erythritol and gal-xylitol). The bacteria growth ranging from 8.7 to 9.7 log units was found, which was comparable to the growth of these bacteria on glucose. In the presence of gal-erythritol, the strains Lb. casei 0908 and Lb. casei 0910 produced a predominant amount of lactic acid: strain 0908 – 3.7 g/l and strain 0910 – 6.1 g/l. Acetic acid was synthesised by both strains in the amount of about 0.7 g/l. In the presence of gal-xylitol the cultures of Lb. casei, despite the abundant growth of bacte-rial cells, were characterised by a low acidifying activity resulting in low concentrations of lactic and acetic acids (compared to other gal-polyol derivatives studied). The strain Lb. casei 0908 gave equal concentrations of lactic and acetic acids, in an amount of about 2.0 g/l, while the strain Lb. casei 0910 in the presence of gal-xylitol synthesised only lactic acid, in an amount of 3.0 g/l.

The studied strains Lb. acidophilus 0927 and Lb. acidophilus 0933 demonstrated in the presence of gal-polyols a growth ability related to the amount of biomass in the control sample containing glucose (Figures 1E–F). However, after using only polyols in the MRS medium, a growth comparable to the control sample was found in the case of sorbitol and lactitol. The bacteria Lb. acidophilus were not capable to grow in the presence of erythritol and xylitol as sole sources of carbon. The strain Lb. acidophilus 0927, in the presence of both galactosyl derivatives of polyols and glucose, demonstrates homofermentative metabolism. It synthesises lactic acid in a predominant amount and acetic acid in trace amounts (Figure 1E). Sorbitol and lactitol are polyols that can be utilised by the above-mentioned strain for the synthesis of organic acids. While in the presence of lactitol it demonstrates homofer-mentation with a typical set of metabolites: lactic acid (3.4 g/l) with or without minimal amount of acetic acid (0.05 g/l) in the presence of sorbitol, only acetic acid (in an amount of 4.6 g/l) can be identified in metabolic products. Presumably, in

69


the presence of sorbitol as the source of carbon, the metabolism process proceeds by mixed acid fermentation described by Hofvendahl and Hanh-Hagerdal (2000).

The strain Lb. acidophilus 0933 is capable of growing and metabolising gal-erythritol, gal-xylitol, gal-sorbitol, sorbitol, and lactitol (Figure 1F). In the case of gal-erythritol, gal-xylitol, and lactitol, a typical homofermentative metabolism was ob-served, where lactic acid amount (2.5–4.8 g/l) was predominant as compared to the slight quantity of acetic acid among acidic metabolites. However, in the presence of gal-sorbitol, sorbitol, and glucose (control), a mixture of organic acids was found. With gal-sorbitol, the amount of lactic acid was 8.6 g/l, whereas that of acetic acid was 3.9 g/l. The presence of sorbitol or glucose in the growth medium of the bacteria Lb. acidophilus 0933 in-duced equal amounts of lactic acid and acetic acid of about 2.0 g/l with sorbitol and 6.0 g/l with glucose. In this case, mixed acid fermentation is also involved.

The studied lactic fermentation bacteria belong-ing to two metabolic types – homofermentation and heterofermentation – are capable of utilising galactosyl derivatives of polyols as the source of carbon. These are effectively transformed into acidic products of metabolism (lactic acid and acetic acid). Based on the results obtained, it has been found that the type of carbon source deter-mines the type of metabolism, and consequently, the composition of acidic products.

Lactitol is a synthetic compound with prebi-otic properties documented (Crittenden 1999; Sarella et al. 2003). In lactitol, bonds between galactose and sorbitol of type β-1,4 were identified, while in galactosyl derivatives of polyols, bonds of type β-1,1, β-1,2, β-1,3 and β-1,6 were found (Kle-wicki & Klewicka 2004). The lactic acid bacteria studied effectively utilise gal-polyols; hence, they are capable of hydrolysing the above-mentioned bonds through an enzymatic pathway in order to cleave galactose. Galactose is the saccharide that is utilised by the bacteria studied as the first one when gal-polyols are decomposed.

concluSionS

Galactosyl derivatives of polyols such as erythri-tol, xylitol, and sorbitol are metabolised by lactic fermentation bacteria to lactic acid, a mixture of lactic and acetic acid, and even to acetic acid

only. The composition of the final products of metabolism is determined both by the source of carbon metabolised and the individual abilities and preferences of particular lactic bacteria cul-tures. The gal-polyols used in the studies can be referred to as modern prebiotics stimulating both the growth and acidifying activity of the bacteria of the genus Lactobacillus.

r e f e r e n c e s

Axelsson L.T. (1993): Lactic acid bacteria: clasifica-tion and physiology. In: Salminen S., von Wright A. (eds): Lactic Acid Bacteria. Marcel Dekker, New York:.1–63.

Crittenden R.G. (1999): Prebiotics. In: Tannock G.W. (ed.): Probiotics: A Critical Review. Horizon Scientific Press, Wymondham: 141–156.

De Vuyst L., Neysens P. (2005): The sourdough micro-flora: biodiversity and metabolic interactions. Trends in Food Science and Technology, 16: 43–56.

Douglas L.C., Sanders M.E. (2008): Probiotics and prebiotics in dietetics practice. Journal of the Ameri-can Dietetic Association, 108: 510–521.

Gibson G.R., Roberfroid M.B. (1995): Dietary modula-tion of the human colonic microbiota – introducing the concept of prebiotics. Journal of Nutrition, 125: 1401–1412.

Hofvendahl K., Hanh-Hagerdal B. (2000): Factors affecting the fermentative lactic acid production from renewable resources. Enzyme and Microbial Technol-ogy, 26: 87–107.

Kandler O. (1983): Carbohydrate metabolism in lactic acid bacteria. Antonie van Leeuwenhoek, 49: 209–224.

Klewicka E. (2007): Antifungal activity of lactic acid bacteria of genus Lactobacillus sp. in the presence of polyols. Acta Alimentaria Hungarica, 36: 495–499.

Klewicki R., Klewicka E. (2004): Antagonistic activity of lactic acid bacteria as probiotics against selected bacteria of the Enterobacteriaceae family in the pre-sence of polyols and their galactosyl derivatives. Bio-technology Letters, 26: 317–320.

Klewicka E., Libudzisz Z. (2001): Antagonistic activity of Lactobacillus acidophilus bacteria toward selected food-contaminating bacteria. Polish Journal of Food and Nutrition Science, 13/54: 169–174.

Manning T.S., Gibson G.R. (2004): Prebiotics. Best Practice & Research in Clinical Gastroenterology, 18: 287–298.

Moura P., Barata R., Carvalheiro F., Girio F., Loureiro-Dias M.C., Esteves M.P. (2007): In vitro

70



PhD Elżbieta Klewicka, Technical University of Łódź, Faculty of Biotechnology and Food Sciences, Institute of Technology Fermentation and Microbiology, ul. Wólczańska 171/173, 90-924 Łódź, Polandtel.: + 48 42 631 34 86, fax.: +48 42 636 59 76, e-mail: [email protected]

fermentation of xylo-oligosaccharides from corn cobs autohydrolysis by Bifidobacterium and Lacto-bacillus strains. LWT-Food Science Technology, 40: 963–972.

Saarella M., Hallamaa K., Mattila-Sandholm Matto T.J. (2003): The effect of lactulose lactitol and

lactobionic acid on the functional and technologi-cal properties of potentially probiotic Lactobacillus strains. International Dairy Journal, 13: 291–302.

Received for publication October 9, 2008Accepted after corrections February 5, 2009

Documents

Czech Journal of FOOD SCIENCES