DAIRY CATTLE PHYSIOLOGY DIVISION ICAR …...The study was also conducted at field level reared by farmers of Daradand Indri villages of Karnal. Recently calved cows free from clinical

INFLUENCE OF PROBIOTIC SUPPLEMENTATION ON ENDOCRINE AND METABOLIC CHANGES FOR FERTILITY IMPROVEMENT

IN REPEAT BREEDING KARAN FRIES (KF) COWS UNDER FARM AND FIELD CONDITIONS

THESIS SUBMITTED TO THE

ICAR-NATIONAL DAIRY RESEARCH INSTITUTE, KARNAL

(DEEMED UNIVERSITY)

IN PARTIAL FULFILMENT OF THE REQUIREMENT

FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY IN

ANIMAL PHYSIOLOGY

BY DANDAGE SHASHIKANT DAMODHAR

M.V.Sc.

DAIRY CATTLE PHYSIOLOGY DIVISION ICAR-NATIONAL DAIRY RESEARCH INSTITUTE

(DEEMED UNIVERCITY) KARNAL-132001 (HARYANA), INDIA

2015

Regn. No. 1090903

Dedicated

to my

Beloved Daughter

“PRANJAL”

ABSTRACT

The present investigation was conducted on Karan-Fries crossbred cattle reared at cattle yard, National Dairy Research Institute (NDRI) Karnal, Haryana, India. The study was also conducted at field level reared by farmers of Darad and Indri villages of Karnal. Recently calved cows free from clinical reproductive tract infection, clinical mastitis and any injury were selected from farm and field conditions. Animals were monitored up to three consecutive services. Pregnancy diagnosis by rectal palpation post 45-60 day after each service was done. Animals conceiving up to three services were considered as regular breeders (RgB) and those that did not conceive up to three services were considered as repeat breeders (RB). There after RB group of animals were divided into two groups (a) supplemented with fermented yeast culture (RB-S) (b) Non supplemented (RB-NS) under both farm and field condition. To RB-S group fermented yeast culture (Saccharomyces cerevisiae; Diamond XP) was supplemented with concentrate @ 12 gm/animal twice daily (5.3 × 105 CFU/g) during experimental period (21st - 40th week).The present study was taken up for finding relationship between plasma IGF-1, Hp, Lactofferin calcium, glucose and urea with respect to repeat breeding problem and availability of energy fuel to lactating dairy cows and also to evaluate the effect of systematic supplementation of fermented yeast culture in alleviating repeat breeding problem. In the present study in vitro effect of IGF-I on expression of Toll-like receptor-4 (TLR-4) and Fas gene in neutrophils was studied in RB group. In the present study concentration of plasma IGF-1, Lactofferin, glucose and calcium were significantly (P<0.001) greater in RgB group when compared with RB group under both farm and field conditions. Concentration of plasma Hp and urea were significantly(P<0.001) lower in RgB group when compared with RB group under both farm and field conditions. DMI, milk yield and body weight were higher in RgB group when compared with RB group under both farm and field conditions, but they were not significantly different. From 22nd week when probiotic (Fermented yeast culture) was supplemented concentration of plasma IGF-1 Lactofferin, glucose and calcium were significantly (P<0.001) greater in RB-S group when compared to RB-NS group under both farm and field conditions. Concentration of plasma Hp and urea were significantly (P<0.001) lower in RB-S group when compared with RB-NS group under both farm and field conditions. DMI, milk yield and body weight were higher in RB-S group, when compared with RB-NS group, but not significantly different under both farm and field conditions. After supplementation, conception rate was significantly (P<0.01) higher in RB-S group when compared to RB-NS group under both farm and field conditions.Relative expression of TLR-4 and Fas gene in blood neutrophils of RgB group was significantly greater (P<0.001) when compared with RB (In vitro IGF-1 supplemented) group. Differential plasma level of IGF-l, Lactoferrin and Haptoglobin were related with Repeat Breeding problem in crossbred Karan Fries cows under both farm and field conditions. Supplementation of fermented yeast culture to repeat breeding crossbred Karan Fries Cows resulted in providing necessary nutrient, improvement in nutrient utilization, rumen functionand production performance which in turn might have reduced repeat breeding problem in crossbred cows under farm and field conditions. Relative expression of TLR-4 and Fas gene in neutrophils may relate with repeat breeding problem in Karan Fries cows.

laLFkk ds {ksf=; ,oa xzkeh.k {ksf=; fLFkFkh ds varxZr dj.k Qzht xk;ksa esa tuu {kerk esa

lq/kkj gsrq vUrjLrzkoh rFkk p;kip; ifjorZuksa ij izfrtSfod laiqjd dk izek.k

lkjka'k

orZeku vè;;u ladV d.kZ fQzt xk;ksa ij fd;k x;k Fkk] tksfd i'kq'kkyk jk"Vªh; Ms;jh vuqlaèkku

laLFkku djuky] gfj;k.kk Hkkjr esa ikbZ xbZ FkhA orZeku vè;;u djuky ftys ds njkj ,oa banzh xk¡oksa esa

xzkeh.kksa okyh ifjfLFkfr;ksa es Hkh fd;k x;k fkkA uSnkfud iztuu iFk ds lØe.k uSnkfud Lrj dh lwtu

,oa pksV eqDr gky gh esa C;kgh xk;ksa dk i'kq'kkyk ,oa xzkeh.kksa ls p;u fd;k x;k FkkA i'kqvksa dh rhu

yxkrkj iztuu lsokvksa rd fuxjkuh dh xbZ FkhA izR;sd iztuu lsok ds 40&60 fnu ckn rd

xHkkZoLFkk dh tk¡p xqnk VVksyus dh fofèk }kjk dh xbZ FkhA i'kvksa ftUgksaus rhu iztuu lsok dh vofèk

ds nkSjku xHkkZèkkj.k dj fy;k Fkk] mUgssa fu;fer iztud ¼vkj-th-ch-½ rFkk ftUgksaus iztuu lsok ds

i'pkr~ Hkh xHkZèkkj.k ugha fd;k Fkk] mUgsa iqu% iztuu ¼vkj-ch-½ lewg esa ekuk x;k FkkA blds i'pkr~

vkj-ch- lewg okys i'kqvksa dks nks lewgkas ¼v½ fd.kfor [kehn] laofèkZr ¼vkj-ch-,l-½ ¼c½ fd.kfor [kehn

vlaofèkZr ¼vkj-ch-,u-,l-½ esa nksuksa i'kq'kkyk ,oa xzkeh.kk ifjfLFkfr;ksa esa ck¡Vk x;k FkkA vkj-ch-,l- lewg

ds fy, iz;ksxkRed vofèk ¼21osa ls 40osa g¶rs ds nkSjku½ fd.kfor [kehn laoèkZd ¼lWdjksekbfll lfoZlh,

Mk;e.M ,Dl-ih-½ fnu esa nks ckj 12 xzke izfr i'kq ¼5-3x105 lh-,Q-;w- izfr xzke½ fn;k x;k FkkA

orZeku vè;;u IykTek vkbZ-th-,Q-&1] ,p-ih- ySDVksQsfju] dSfY'k;e] Xywdkst ,oa ;wfj;k dk iqu%

iztud leL;k ,oa nqèkk: xk;ksa dh ÅtkZ miyCèkrk esa lEcUèkksa dks [kkstus ds fy, fn;k x;k FkkA blds

vykok orZeku vè;;u] fd.kfor [kehn laoèkZ iwjdrk dk iqu% iztud leL;k ds Åij izHkko tkuus ds

fy, Hkh fd;k x;k FkkA orZeku vè;;u esa bu foVªks vkbZ-th-,Q-&1 dk Vksy leku fjlsiVj ,oa Qkl

thu dh vfHkO;fDr ij izHkko dk Hkh vè;;u fd;k x;k FkkA IykTek vkbZ-th-,Q-&1 ySDVksQsfju]

Xywdkst ,oa dSfY'k;e dh ek=k vkj-th-ch- lewg esa vkj-ch- lewg dh rqyuk esa nksuksa i'kq 'kkyk ,oa

xzkeh.k ifjfLFk;ksa esa egRoiw.kZ ¼ih<0-05½ :i esa T;knk ikbZ xbZ FkhA IykTek ,p-ih ,oa ;wfj;k dh ek=kk

vkj-th-ch- lewg esa vkj-ch- lewg dh rqyuk esa nksuksa xzkeh.k ,oa i'kq 'kkyk ifjfLFk;ksa esa egRoiw.kZ ¼ih<0-

05½ de FkhA Mh-,e-vkbZ-] nwèk mRikn ,oa 'kjhj Hkkj vkj-th- ch- lewg esa vkj-ch- lewg dh rqyuk esa

nksuksa xzkeh.k ,o i'kq 'kkyk ifjfLFkr;ksa esa T;knk ikbZ xbZA ijUrq ;s egRoiw.kZ :i ls fHkUu ugha FksA 22osa

g¶rs ds i'pkr~ tc izksckW;ksfVd ¼fd.kfor [kehn½ laoèkZu dh iwjdrk ds nkSjku IykTek] vkbZ-th-,Q- 1]

ySDVksQsfju] Xywdkst ,oa dSfY'k;e dh ek=k vkj-ch-,l- lewg esa vkj-ch-,u-,l- lewg dh rqyuk esa nksuksa

i'kq 'kkyk ,oa xzkeh.k ifjfLFkr;ksa esa T;knk ikbZ xbZ FkhA IykTek] ,p-ih- ,oa ;wfj;k dh ek=k vkj-ch-,l-

lewg esa vkj-ch-,u-,l- lewg dh rqyuk esa nksuksa ifjfLFkr;ksa esa egRoiw.kZ ¼ih<0-05½ :i ls de FkhA Mh-

,e-vkbZ-] nwèk mRikn ,oa i'kq Hkkj] vkj-ch-,l- lewg esa vkj-ch-,u-,l- lewg dh rqyuk esa nksuksa

ifjfLFkfr;ksa i'kq 'kkyk ,oa xzkeh.k ifjfLFkfr;ksa esa T;knk Fkh] ijUrq egRoiw.kZ :i esa fHkUu ugha FkhA

iwjdrk ds i'pkr~] nksukas xzkeh.k ,oa i'kq 'kkyk ifjfLFkfr;ksa esa xHkkZèkku dh nj egRoiw.kZ :i esa vkj-ch-

lewg esa vkj-ch-,u-,l- dh rqyuk esa T;knk FkhA Vh-,y-vkj- 4 ,oa Qkl thu dh vfHkO;fDr vkj-ch-

lewg dh U;wVªksfQyl dksf'kdkvksa esa vkj-ch- ¼vkbZ-th-,Q- 1 iwjd bu foVªks½ lewg esa dkQh T;knk FkhA

fHkUu IykTek] vkbZ-th-,Q- 1] ySDVksQsfju ,oa gS¶VksXyksfcu dk ek=k ladV d.kZ fQzt i'kqvksa esa nksuksa

xzkeh.k ,ao i'kq 'kkyk ifjfLFkfr;ksa ls lacafèkr FkkA iqu% iztud ladj xk;ksa esa fd.kfor [kehn laoèkZu dh

iwjdrk vko';d iks"k.k] iks"k.k mi;ksx esa csgrjh p;&ip; dk;Z ,oa mRiknu izn'kZu esa lqèkkj djrk gSA

U;wVkjksfQyl esa Vh-,Q-vkj- 4 ,oa Qkl ,e-vkj-,u-,- dh lacafèkr vfHkO;fDr d.kZ Qzkbt xk;ksa esa iqu%

iztuu leL;k ls lacafèkr gks ldrh FkhA

CONTENTS

Chapter No.

Title Page No.

1 INTRODUCTION 1-4

2 RIVIEW OF LITERATURE 5-28

2.1 Yeast culture (Saccharomyces cerevisiae) 6

2.1.1 Mode of action of Yeast and its effects on

performance of animals 7

2.1.1.1 Mode of action of yeast in the rumen: 8

2.1.1.2 Effect of Saccharomyces cerevisiae on Rumen

fermentation pattern

10

2.1.1.3 Effect of Saccharomyces cerevisiae on Milk Yield: 11

2.1.1.4 Effect of Saccharomyces cerevisiae on Dry Matter

Intake (DMI)

11

2.1.1.5 Effect of Saccharomyces cerevisiaeon Body Weight 12

2.2 Insulin Like Growth Factors-1 (IGF-1) 12

2.2.1 IGF-l in female reproduction 13

2.3 Haptoglobin (Hp) 15

2.3.1 Biological functions of Haptoglobin (Hp) 16

2.4 Lactoferrin 17

2.5 Blood profile and reproduction 18

2.5.1 Plasma calcium 18

2.5.2 Plasma glucose 19

2.5.3 Plasma urea 20

2.6 Neutrophils 21

2.6.1 Apotosis of neutrophils 22

2.7 Fas gene 24

2.7.1 Mechanisms of neutrophil apoptosis activated by

death receptors (Fas)

24

2.8 Toll-like receptor-4 (TLR-4) 26

2.8.1 Expression of TLR-4 Gene in different cells. 27

2.8.2 Neutrophils and TLR-4 Gene 28

Chapter No.

Title Page No.

3 MATERIALS AND METHODS 29-45

3.1 Location of the study areas and climate 29

3.2 Selection and grouping of experimental animals 29

3.3 Chemicals, glassware and plastic ware 30

3.4 Collection of blood samples 30

3.5 Feed provided under farm and field conditions. 30

3.6 Estimation of feed intake 31

3.6.1 Analysis of feed and fodder samples 31

3.7 Recording of body weight 31

3.8 Recording of milk yield 31

3.9 Estimation of plasma parameters 32

3.9.2 Estimation of blood plasma Lactoferrin 32

3.9.3 Estimation of blood plasma Insulin-like growth factor-

1 (IGF-1)

32

3.9.4 Estimation of blood plasma calcium 32

3.9.5 Estimation of blood urea 33

3.9.6 Estimation of blood glucose 35

3.10 IN VITRO STUDY 36

3.10.1 Chemicals for In Vitro study 36

3.10.2 Chemicals for gene expression studies 36

3.10.3 Separation and enumeration of Neutrophils 37

3.10.4 Determination of number of viable cells 38

3.11 IN VITRO EXPERIMENT 39

3.11.1 Preparation of reagents and glassware for RNA

isolation

40

3.11.2 Quality and quantity of RNA 40

3.11.3 RNA extraction from blood PMN Cells 40

3.11.4 Quality checking of RNA by agarose gel

electrophoresis

41

3.11.5 Quantification of RNA 42

3.11.6 Protocol For first strand cDNA synthesis: 42

Chapter No.

Title Page No.

3.11.7 Primers 43

3.11.8 Reaction mixture for real-time PCR 44

3.11.9 Statistical analysis of relative target gene expression 45

3.12 Statistical analysis 45

4 RESULTS AND DISCUSSION 46-85

4.1 Insulin-Like Growth Factor-1 (IGF-1) 46

4.1.1 Concentration of plasma Insulin-like growth factor-1 (ng/ml) in RgB and RB groups under farm conditions.

46

4.1.2 Concentration of plasma Insulin-like growth factor-1

(ng/ml) in RB-S and RB-NS groups under farm

conditions.

47


(ng/ml) in RgB and RB groups under field conditions.

48


(ng/ml) in RB-S and RB-NS groups under field

conditions.

49

4.2 Haptoglobin (Hp) 51

4.2.1 Concentration of plasma haptoglobin (ng/ml) in RgB

and RB groups under farm Conditions.

51

4.2.2 Concentration of plasma haptoglobin (ng/ml) in RB-S

and RB-NS groups under farm conditions.

52

4.2.3 Concentration of plasma haptoglobin (ng/ml) in RgB

and RB groups under field conditions.

53

4.2.4 Concentration of plasma haptoglobin (ng/ml) in RB-S

and RB-NS groups under field conditions.

54

4.3 Lactoferrin (LF) 56

4.3.1 Concentration of plasma lactoferrin(ng/ml) in RgB

and RB groups under farm conditions.

56

4.3.2 Concentration of plasma lactoferrin(ng/ml) in RB-S and RB-NS groups under farm conditions.

57

4.3.3 Concentration of plasma lactoferrin (ng/ml) in RgB

and RB groups under field conditions.

58

Chapter No.

Title Page No.

4.3.4 Concentration of plasma lactoferrin (ng/ml) in RB-S


59

4.4 Glucose 60

4.4.1 Concentration of plasma glucose (mg/dl) in RgB and

RB groups under farm conditions.

60

4.4.2 Concentration of plasma Glucose (mg/dl) in RB-S


61

4.4.3 Concentration of Plasma glucose (mg/dl) in RgB and

RB groups under field conditions.

62

4.4.4 Concentration of plasma glucose (mg/dl) in RB-S


63

4.5 Urea 64

4.5.1 Concentration of plasma urea (mg/dl) in RgB and RB

groups under farm conditions.

64

4.5.2 Concentration of plasma urea (mg/dl) in RB-S and

RB-NS groups under farm conditions.

65

4.5.3 Concentration of plasma urea (mg/dl) in RgB and RB

groups under field conditions.

66

4.5.4 Concentration of plasma urea (mg/dl) in RB-S and

RB-NS groups under field conditions.

67

4.6 Calcium 68

4.6.1 Concentration of plasma calcium (mg/dl) in RgB and

RB groups under farm conditions.

68

4.6.2 Concentration of plasma calcium (mg/dl) in RB-S


69

4.6.3 Concentration of plasma calcium (mg/dl) in RgB and

RB groups under field conditions.

70

4.6.4 Concentration of plasma calcium (mg/dl) in RB-S and RB-NS groups under field conditions.

71

4.7 Dry matter intake (DMI) 72

4.7.1 Dry matter intake (Kg/day) in RgB and RB KF groups

under farm conditions.

72

Chapter No.

Title Page No.

4.7.2 Dry matter intake (Kg/day) in RB-S and RB-NS

groups under farm conditions.

73

4.7.3 Dry matter intake (Kg/day) in RgB and RB groups

under field conditions.

73

4.7.4 Dry matter intake (Kg/day) in RB-S and RB-NS

groups under field conditions.

74

4.8 Milk yield 75

4.8.1 Milk yield (Kg/day) in RgB and RB groups under

farm conditions.

75

4.8.2 Milk yield (Kg/day) in RB-S and RB-NS groups under

farm conditions.

76

4.8.3 Milk yield (Kg/day) in RgB and RB groups under field

conditions.

76

4.8.4 Milk yield (Kg/day) in RB-S and RB-NS groups under

field conditions.

77

4.9 Body weight 78

4.9.1 Body weight (Kg) in RgB and RB groups under farm

conditions.

78

4.9.2 Body weight (Kg) in RB-S and RB-NS groups under

farm conditions.

79

4.9.3 Body weight (Kg) in RgB and RB groups under field

conditions.

79

4.9.4 Body weight (Kg) in RB-S and RB-NS groups under

field conditions.

80

4.10 Conception rate 81

4.10.1 Conception rate in RgBand RB groups under farm

conditions.

81

4.10.2 Conception rate in RB-S and RB-NSgroups under

farm conditions.

81

4.10.3 Conception rate in RgB and RB groups under field

conditions.

82

Chapter No.

Title Page No.

4.10.4 Conception rate in RB-S and RB-NS groups under

field conditions.

82

4.11 In Vitro Study 83

4.11.1 Relative expression of TLR-4 mRNA in neutrophils of

RB, RB (In vitro IGF-1 supplemented) and RgB

group.

83

4.11.2 Relative expression of Fas mRNA in neutrophils of

RB, RB (In vitro IGF-1 supplemented) and RgB

group.

83

5 SUMMARY AND CONCLUSIONS 86-92

6 BIBLIOGRAPHY i-xxvi

LIST OF TABLES

Table No. Titte After

page 3.1 Details of experimental animals under farm conditions. 30 3.2 Details of experimentals animal under field conditions. 30

3.3 Composition of concentrate feed supplemented to animal. 30 3.4 Protocol for the estimation of plasma glucose. 36 3.5 Composition of RPMI -1640 medium. 36 3.6 Details of primers of target and housekeeping genes. 42

3.7 Reaction mixture for Real-Time PCR. 43 3.8 Reaction programme for real time PCR. 43

4.1 Concentration of plasma IGF-1(ng/ml) in RgB and RB groups under

farm conditions. 47

4.2 Concentration of plasma IGF-1(ng/ml) in RB-S and RB-NS groups

under farm conditions. 48

4.3 Concentration of plasma IGF-1(ng/ml) in RgB and RB groups under

field conditions. 48

4.4 Concentration of plasma IGF-1(ng/ml) in RB-S and RB-NS groups

under field conditions. 49

4.5 Concentration of plasma Hp(ng/ml) in RgB and RB groups under

farm conditions. 51

4.6 Concentration of plasma Hp (ng/ml) in RB-S and RB-NS groups


4.7 Concentration of plasma Hp (ng/ml) in RgB and RB groups under


4.8 Concentration of plasma Hp (ng/ml) in RB-S and RB-NS groups


4.9 Concentration of plasma Lactoferrin(ng/ml) in RgB and RB groups


4.10 Concentration of plasma Lactoferrin (ng/ml) in RB-S and RB-NS

groups under farm conditions. 57

4.11 Concentration of plasma Lactoferrin (ng/ml) in RgB and RB groups

under field conditions.

58


page 4.12 Concentration of plasma Lactoferrin (ng/ml) in RB-S and RB-NS

groups under field conditions. 59

4.13 Concentration of Plasma Glucose (mg/dl) in RgB and RB groups


4.14 Concentration of Plasma Glucose (mg/dl) in RB-S and RB-NS

groups under farm conditions. 62

4.15 Concentration of Plasma Glucose (mg/dl) in RgB and RB groups


4.16 Concentration of Plasma Glucose (mg/dl) in RB-S and RB-NS


4.17 Concentration of Plasma Urea (mg/dl) in RgB and RB groups under

farm conditions. 65

4.18 Concentration of Plasma Urea (mg/dl) in RB-S and RB-NS groups


4.19 Concentration of Plasma Urea (mg/dl) in RgB and RB groups under


4.20 Concentration of Plasma Urea (mg/dl) in RB-S and RB-NS groups


4.21 Concentration of Plasma Calcium in RgB and RB groups under farm

conditions. 69

4.22 Concentration of Plasma Calcium in RB-S and RB-NS groups under

farm conditions. 70

4.23 Concentration of Plasma Calcium (mg/dl) in RgB and RB groups


4.24 Concentration of Plasma Calcium (mg/dl) in RB-S and RB-NS


4.25 Dry Matter Intake (Kg/day) RgB and RB groups under farm

conditions. 72

4.26 Dry Matter Intake (Kg/day) in RB-S and RB-NS groups under farm

conditions. 73

4.27 Dry Matter Intake (Kg/day) RgB and RB groups under field

conditions. 74

4.28 Dry Matter Intake (Kg/day) in RB-S and RB-NS groups under field

conditions. 74


page 4.29 Milk Yield (Kg/day) of RgB and RB groups under farm conditions. 75

4.30 Milk Yield (Kg/day) of RB-S and RB-NS groups under farm

conditions. 76

4.31 Milk Yield (Kg/day) of RgB and RB groups under field conditions. 77

4.32 Milk Yield (Kg/day) of RB-S and RB-NS groups under field

conditions. 77

4.33 Body Weight (Kg) of RgB and RB groups under farm conditions. 79 4.34 Body Weight (Kg) of RB-S and RB-NS groups under farm conditions. 79

4.35 Body Weight (Kg) of RgB and RB groups under field conditions. 79 4.36 Body Weight (Kg) of RB-S and RB-S groups under field conditions. 80

4.37 Conception rate of RgB and RB groups under farm conditions 81 4.38 Conception rate of RB-S and RB-NS groups under farm conditions. 81 4.39 Conception rate of RgB and RB groups under field conditions. 82 4.40 Conception rate of RB-S and RB-NS groups under field conditions. 82 4.41 Correlation coefficient of plasma parameters in RgB and RB groups

under farm conditions 82

4.42 Correlation coefficient of plasma parameters in RB-S and RB-NS

groups under farm conditions 82

4.43 Correlation coefficient of plasma parameters in RgB and RB groups

under field conditions 82

4.44 Correlation coefficient of plasma parameters in RB-S and RB-NS

groups under field conditions 82

4.45 Relative expression of TLR-4 and Fas mRNA in neutrophils of RB,

RB (In vitro IGF-1 supplemented) and RgB group. 83

LIST OF FIGURES Figure

No. Title of Figures After

page 2.1 Mode of action of live yeast in ruminants 8

2.2 Mechanism of fermented yeast culture in bacterial growth and

activity

10

2.3 Apoptosis signaling through death receptors 26

3.1 Standard curve for plasma IGF-1 32

3.2 Standard curve for plasma Hp 32

3.3 RT-PCR amplified products of TLR-4, Fas and House keeping

genes on agarose gel 3%

42

3.4 Amplification curve TLR-4 44

3.5 Amplification curve Fas 44

4.1 Concentration of plasma IGF-1 in RgB and during pre and post

supplementation period in RB-S and RB-NS groups under farm

conditions

49

4.2 Concentration of plasma IGF-1 in RgB and during pre and post

supplementation period in RB-S and RB-NS groups under field

conditions

49

4.3 Concentration of plasma Hp in RgB and during pre and post


conditions

54

4.4 Concentration of plasma Hp in RgB and during pre and post


conditions

54

4.5 Concentration of plasma lactoferrin in RgB and during pre and post


conditions

59

4.6 Concentration of plasma lactoferrin in RgB and during pre and post


conditions

59

4.7 Concentration of plasma glucose in RgB and during pre and post


conditions

63

4.8 Concentration of plasma glucose in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions

63

Figure No.

Title of Figures After page

4.9 Concentration of plasma urea in RgB and during pre and post


conditions

67

4.10 Concentration of plasma urea in RgB and during pre and post


conditions

67

4.11 Concentration of plasma calcium in RgB and during pre and post


conditions

71

4.12 Concentration of plasma calcium in RgB and during pre and post


conditions

71

4.13 DMI in RgB and during pre and post supplementation period in

RB-S and RB-NS groups under farm conditions

74

4.14 DMI in RgB and during pre and post supplementation period in

RB-S and RB-NS groups under field conditions

74

4.15 Milk yield in RgB and during pre and post supplementation period

in RB-S and RB-NS groups under farm conditions

77

4.16 Milk yield in RgB and during pre and post supplementation period

in RB-S and RB-NS groups under field conditions

77

4.17 Body weight in RgB and RB groups under farm conditions 80

4.18 Body weight in RB-S and RB-NS groups under farm conditions 80

4.19 Body weight in RgB and RB groups under field conditions 80

4.20 Body weight in RB-S and RB-NS groups under field conditions 80

4.21 Relative expression of TLR-4 and Fas mRNA in neutrophils of RB,

RB (In vitro IGF-1 supplemented) and RgB group.

83

LIST OF THE PICTURE

Picture No. Title After

page

3.1 RB-S animal under Darad village conditions 30

3.2 RB-S animal under Darad village conditions 30

5.1 Calf born of RB-S animal under Darad village conditions 82

5.2 Calf born of RB-S animal under Darad village conditions 82

LIST OF ABBREVIATIONS % = Percent

µg = Microgram

µl = Microlitre

µmol = Micromol

@ = at the rate of

°C = Degree centigrade

µg = microgram

BCS = Body condition score

BUN = Blood urea nitrogen

BW = Body weight

Ca = Calcium

DFM = Direct Fed microbials

DM = Dry matter

DMEM = Dulbecco’s modified Eagle’s medium

DMI = Dry matter intake

EDTA = Ethyelene Diamine Tetra-acetic Acid

EtBr = Ethidium Bromide

FCS = Foetal calf serum

g = Gram

h = Hour

KF = Karan Fries

Kg = Kilogram

mg = Milligram

mm = Millimeter

mmol = Milimole

MY = Milk yield

PCR = Polymerase Chain Reaction

RB = Repeat Breeder

RB-NS = Non Supplemented Repeat Breeder

RB-S = Supplemented Repeat Breeder

RgB = Regular Breeder

v/v = Volume by volume

w/v = Weight by volume

SE = Standard error

SEM = Standard error of mean

TLR-4 = Toll Like Receptor-4

FDA = Food and Drug Administration

YC = Yeast Culture

VFA = Volatile fatty acids

IGF-1 = Insulin Like Growth Factors -1

IGFBPs = IGF binding proteins

NSILA = non-suppressible insulin-like activity

Da = Dalton

GH = Growth Hormone

LH = Luteinizing Hormone

APP = Acute phase protein

Hp = Haptoglobin

LF = Lactoferrin

NK = Natural Killer

GnRH = Gonadotropin Releasing Hormone

TNF = Tumor necrosis factor

NGF = Nerve growth factor

FasL = Fas ligand

DD = Death domain

FADD = Fas-associated death domain-containing protein

DED = Death effector domain’

DISC = Death inducing signalling complex’

TRADDs = TNFR-associated death domain-containing proteins

TRAF2 = TNFR-associated factor-2

RIP = Receptor-interacting protein

LPS = Lipopolysaccharide

APC = Antigen-presenting cells

PMN = Polymorph nuclear neutrophils

PAMPs = Pathogen-associated molecular patterns

LRR = Leucine rich repeats

TIR = Interleucine receptor

IL8 = Interleukin-8

NDRI = National Dairy Research Institute

CFU = Colonies Forming Unit

AI = Artificial Insimination

NRC = Natinal Research Council

ELISA = Enzyme-link Immunosorbent Assay

TCA = Trichloroacetic acid

OD = Optical Density

TAE = Tris Acetate buffer

DPBS = Dulbecco’s phosphate buffer solution:

EtBr = Ethidium bromide

DEPC = Diethylpyrocarbonate

DPBS = Dulbecco’s Phosphate Buffer Saline

GAPDH = Glyceraldehydes 3-phosphate dehydrogenase ()

FCS = Fital Calf Serum

RNA = Ribonucleic Acid

DNA = Deoxyribonucleic Acid

UV = Ultra Violate

CD = Cluster of differentiation

Cp = Crossing point

CHAPTER –1

INTRODUCTION

INTRODUCTION

Optimum production of high quality milk is the core objective of dairy

sector. Introduction of cross breeding (the fastest method of improving animal

productivity) has certainly improved the milk production, but the issues and

challenges of cross breeding as per Indian conditions have remained largely

unsolved. Relative contribution of milk production by crossbred cattle to the total

milk production in the country is increasing steadily. However, in spite of higher

productivity, crossbred cattle are more prone to environmental stress. Their

performance is affected by high temperature, poor feeding and susceptibility to

diseases (Rao et al., 1995) making them a liability for the resource poor rural

farmer. Variation exists among studies on the overall incidence of mastitis,

retention of placenta (ROP), metritis, endometritis, pyometra and repeat

breeding. Crossbred cattle are more vulnarable to reproductive problem when

compared with the indigenous breed. The depressed immune status of

crossbred cattle due to harsh Indian climatic condition is one of the major

hurdles limiting its productivity. Hence, they require extra manage mental

practice in terms of feeding, housing and clinical aid to meet the high production.

Reproductive performance of dairy cattle is a major concern in both

organized and unorganized dairy farming. Reproductive performance is one of

the important factors determining the profitability of the dairy farmers. This can

be achieved by resuming postpartum ovarian cycle within 30 days; conception in

less than 90 days, with an average calving interval of one year. Fertility of animal

is lower in present scenario than the one that existed one or few decades earlier.

Gordon (2005) reported that decline in calving rate to first service is declining

significantly by 0.7-0.9% per year. Repeat breeding is one of the major

problems in dairy cattle that affects fertility and in turn incurs great economic loss

to farmers. The repeat breeding cow is one that has clinically normal

reproductive tract with regular oestrous cycles and has been bred two or more

times to a fertile bull but has failed to conceive (Roberts, 1971). Incidence of

repeat breeding in cows in various countries ranges from 10 to 18% (Kimura et

al., 1987). The incidence of repeat breeding in India has been reported to range

from 5.5 to 33.33 % in cattle and from 6 to 30 % in buffaloes (Saxena, 2004).

Haptoglobin (Hp) is one of the most specific acute phase protein which is

stimulated by inflammatory mediator and responds to an initial reaction of

infection, inflammation or trauma in animal. Hp acute phase response is coupled

with an increase in the release of pituitary adrenal and sympathetic hormones

and also as a result of increased activity of stress axis (Carroll, 2008). Hp

seemed to be promising marker of health status by reflecting broad spectrum of

ongoing clinical and sub clinical diseases (Petersen et al., 2004). Differential Hp

concentration in plasma could act as a useful indicator for identifying cattle with

reproductive problems like anestrous and repeat breeding. Lactoferrin (LF) has

been identified as having important role in innate immune responses. Among its

varied role, LF has been reported to have anti-bacterial, anti-fungal, anti-tumor,

anti-inflammatory and immunomodulatory properties. LF plays crucial role in iron

sequestration from bacteria, thus limiting bacterial proliferation (Valenti and

Antonini, 2005). IGF-1 is an important hormonal signal that influences

reproductive events such as stimulation of cell mitogenesis, hormonal production

and embryo development. It has been reported that higher concentration of

blood plasma IGF-I in early post partum stage is important for early resumption

of cyclicity and establishment of pregnancy (Flood et al., 1993). Increased blood

urea level leads to decreased uterine pH, and reduced conception rate in cattle

(Elrod and Butler, 1993). Plasma urea nitrogen and milk urea nitrogen

concentration > 19 mg/dL were associated with approximately a 20 percentage

decrease in pregnancy rate in lactating dairy cattle (Butler et al., 1996). Plasma

glucose concentration is good indicator of energy balance. Pregnancy rate was

higher among cows with greater plasma glucose concentration (Fahey et al.,

2002). Plasma glucose level at first insemination was significantly lower in cows

that failed to conceive (Plym-Forshell et al.,1991). Calcium plays an important

role in gonadotropic regulation of ovarian steriodogenesis. During infection,

neutrophils are exposed, often simultaneously to variety of stimuli that can

differentially modulate the antimicrobial activity of this cell. Blood neutrophils are

extremely short-lived cells that are programmed for rapid apoptosis after

differentiation in bone marrow. Fas is a major death receptor that stimulates

apoptosis in circulating neutrophils (Simon, 2003). Blood plasma IGF-1,

Lactoferrin and Haptoglobin (Hp) are indicators as well as modulators of stress

2

and mild infections. Their differential level in plasma may correlate with repeat

breeding problem in crossbred Karan Fries cows.

The term probiotic (a Greek word meaning for life) was first coined by

Parker (1974). The World Health Organization defines probiotics as “live

microorganisms, which, when administered in adequate amounts, confer health

benefits on the host.” Interest in the use of direct-fed microbials as feed

supplements for high producing dairy cows has increased markedly in recent

years. A commonly used direct-fed microbial is the yeast Saccharomyces

cerevisiae. Improvements in Dry Matter Intake (DMI), digestibility of nutrients,

milk production and milk components have been reported when cows were fed

yeast i.e. Saccharomyces cerevisiae(SC). Yeast culture is thought to be best

utilized by the animals under stress. Barling (2014) reported that during stress,

animals may have other nutrient requirements to overcome the condition of

stress.

At present, there is no scientific research information available on the

effect of Saccharomyces cerevisiae supplementation on reproductive

performance in crossbred cows under tropical conditions. However most of the

research has been done on Dry Matter Intake (DMI), digestibility of nutrients,

growth rate, milk production and milk components parameters in dairy cattle.

Little information is available on plasma level of IGF-l, Lactoferrin, Haptoglobin,

with respect to fertility and also, on influence of Saccharomyces cerevisiae

supplementation in repeat breeding crossbred Karan Fries cows under tropical

conditions. Report is not available on direct in vitro effect of IGF-I on expression

of Toll-like receptor-4 (TLR-4) and Fas gene in neutrophils of repeat breeding

crossbred Karan Fries Cows. Keeping these points in view, in the present study

was taken up for finding relationship between IGF-1 Hp lactofferin with respect to

repeat breeding problem and availability of energy fuel to lactating dairy cows. It

was also to see the effect of systematic supplementation of fermented yeast

culture (Saccharomyces cerevisiae) along with concentrate @ 12 g/animal twice

daily on improvement of reproductive performance of RB KF cows. Therefore,

the present study was taken up with the following objectives;

1. To study the relationship between the blood parameters and reproductive

performance of post partum KF cows under farm and field conditions.

3

2. Effect of probiotic (Saccharomyces cerevisiae) supplementation on blood

parameters in repeat breeding KF cows under farm and field conditions.

3. In vitro effect of IGF-I on differential expression of Toll-like receptor-4 and

Fas gene in blood neutrophils of supplemented and non supplemented

repeat breeding KF cows.

4

CHAPTER –2

REVIEW OF LITERATURE

REVIEW OF LITERATURE

The fertility of dairy herds has declined throughout the world in recent

years (McDougall, 2006; Royal et al., 2000; Lucy, 2001). The reason for this

decline include change in climate, stress, nutrient deficiency, increased milk

production, intensified genetic selection, and the uterine health of cows (Lucy,

2001). The repeat breeding cow is one that has clinically normal reproductive

tract with regular estrous cycles and has been bred two or more times to a fertile

bull but has failed to conceive (Roberts, 1971). The economic losses associated

with RB cows are considerable: increased veterinary expenses, insemination

costs, reduced productivity and losses due to involuntary culling. Incidence of

repeat breeding in cows in various countries ranged from 10 to 18% (Kimura et

al., 1987; Gustafsson and Emanuelson 2002). The incidence of repeat breeding

in India has been reported to range from 5.5 to 33.33 % in cattle and from 6 to

30 % in buffaloes (Saxena, 2004). Reproductive problems have been the

primary cause of culling in animal husbandry for many years (Coleman et al.,

1985 and Opsomer et al., 2000).

Efficiency of livestock production is closely related to feeding practices of

the animals. Feed additives especially probiotics have shown to increase nutrient

utilization and improvement in the productivity of ruminants. As a whole,

probiotics offer an alternate source of enhancing feed utilization and animal

productivity in a better way.

The term probiotic (a Greek word meaning for life) was first coined by

Parker (1974), who described it as “the organisms and substances that

contribute to intestinal microbial balance”. Later, Fuller (1989) redefined it as a

“live microbial feed supplement that beneficially affects the host animal by

improving its microflora”. Later on US Food and Drug Administration (FDA) in

1989 used the term “Direct Fed microbials (DFM)”. The joint expert panel of the

Food and Agricultural Organization of the United Nations and the WHO defined

these as “Live Microorganisms” which when administered in adequate amount

confer a health benefit on the host (Krehbiel et al., 2003)

Probiotics and yeast culture have many benefits when added to a diet.

They stimulate desirable microbial growth in the rumen and stabilize the rumen

pH. ruminal fermentation and end product production can be altered. Increase in

nutrient flow postruminally, nutrient digestibility, and the alleviation of stress

through enhanced immune response are other benefits of DFM (Yoon and Stern,

1996).

Yeast supplementation in the diet caused a significantly higher digestibility

of nutrients and increased production of carboxy methyl cellulose activity in the

rumen (Maurya et al., 1993 and Garg, 2008). Feeding of Saccharomyces

cerevisae for the improvement in digestibility and production of the animals was

demonstrated by Kamra et al. (1996), Prahalada et al. (2002) and Garg (2008).

Body weight and feed conversion ratio increased significantly. Increased

production of total VFA, ratio of acetate to propionate, especially 4 hr post

feeding and in vitro dry matter digestibility was reported in sheep (Garg, 2008).

The feeding of Saccharomyces cerevisae also significantly improved bacterial

count and volatile fatty acids production in rumen liquor and enhanced the

digestibility of nutrients in sheep (Rao et al., 2001).When fed to cattle, yeast

cultures have been shown to stimulate cellulolytic bacteria in the rumen, improve

fiber digestion, and stabilize rumen pH (Rossi et al., 2006).

2.1 YEAST CULTURE (Saccharomyces cerevisiae)

The most common YC used in ruminant diets is Saccharomyces cerevisiae.

Saccharomyces cerevisiae, the yeast cultures, are considered as a promising

probiotic for efficient nutrient utilization in ruminants leading to improvement in

animal productivity. The genus Saccharomyces has 16 species, including

Saccharomyces cerevisiae is described in the literature as containing

biotherapeutic agents. Saccharomyces cerevisiae is a species of budding yeast, a

single celled organism with a short generation time (doubling time 1.5–2 hours at

30 °C). All strains can utilize ammonia and urea as the sole nitrogen source, but

cannot utilize nitrate since they lack the ability to reduce them to ammonium ions.

They can also utilize most amino acids, small peptides and nitrogen bases as a

nitrogen source. Histidine, glycine, cystine and lysine are, however, not readily

6

utilized. S. cerevisiae is unique organism that has the ability to survive in gastric

acidity and are not adversely affected or inhibited by antibiotics. They do not

appear to alter or adversely affect the normal flora of the GI tract and can be

consumed with normal probiotic bacteria (Elmer and McFarland 2001). A yeast

culture (YC) is a yeast-fermented feed additive that contains both live and dead

yeast cells, the culture media the yeast cells were grown on, and the metabolic

byproducts produced by the yeast cells during fermentation (Linn and Raeth-

Knight 2006). In the dairy industry, these products were first used in cow rations to

increase dry matter intake during the transition period or periods of stress (Garrett,

2000). Cellulolytic bacteria in the rumen are stimulated by YC. Fiber digestion in

calves and cows is improved by adding YC to the diet.

Yeast also provides growth factors, such as malate and vitamins, which

stimulate lactate utilizing bacteria, which helps stabilize rumen pH preventing risk

of acidosis (Rossi et al., 2006). Yeast does not grow in rumen fluid but retains

metabolic activity and viability (Newbold et al., 1996).

2.1.1 Mode of action of yeast and its effects on performance of animals:

In ruminants the mode of action and beneficial effects of yeast as microbial

feed additive on the performance of animals were summarized by Kamra and

Pathak (2005) as:

• Increases the palatability of feed (Glutamic acid produced by yeast is

responsible for improvement in the taste of feed stuffs and a pleasant

odour).

• Stimulation of rumen microbes and enhanced microbial protein synthesis in

the rumen.

• pH stabilization in the rumen, viable yeast acts as a modulator of rumen pH.

• Oxygen scavenging from the rumen.

• Supply of vitamins and minerals to fiber degrading microbes.

• Reduced ammonia nitrogen in rumen liquor. This can be either due to a

reduced degradation of dietary protein, or due to an enhanced use of

ammonia by bacteria resulting in an enhanced production of microbial

protein or both.

7

• Increase rate of fiber digestion (thus directly affecting gut fill) and the rate of

digesta flow.

• Improves bacterial count and VFA in rumen liquor, decreases the ratio of

acetic to propionic acid, mainly due to higher production of propionic acid.

• Higher production of carboxymethyl cellulose activity in rumen liquor.

• Better ruminal digestion, metabolism and improved nutrient utilization.

• An increase in feed conversion efficiency and live weight gain in growing

animals.

• Improved milk production in dairy animals.

• The protection of young animals against enteropathic disorders such as

diarrhoea by inhibiting the colonization of coliform bacteria in the gut.

The mode of action of live yeast in ruminants were studied by Dawson et al.

(1990). The overall mode of action of live yeast is illustrated briefly in Figure 2.2.

2.1.1.1 Mode of action of yeast in the rumen:

Yeast cells are unable to develop in a durable manner in the ruminal milieu,

so that they have to be fed every day. However, they can stay alive in the rumen

upto about 30 hours. Several modes of action have been demonstrated. Yeast

respiratory activity lowers the redox potential. Because main ruminal

microorganisms are strictly anaerobic, this protects anaerobic rumen bacteria from

damage by O2, increases the number of cellulolytic bacteria (Dawson et al., 1990)

and improves ruminal digestion. Moreover, yeast action can utilize part of free

sugar in the rumen and limit a fermentation shift due to rapid degradation of these

compounds.

Only live yeast can use ruminal sugars and oxygen. Saccharomyces

cerevisiae can carry some metabolites that are useful for ruminal microorganisms.

Yeast cultures contain B vitamins, amino acids and organic acids, particularly

malate, which stimulates growth of ruminal bacteria that digest cellulose (Callaway

and Martin, 1997 and Kowalik et al., 2011). Malate has been shown to be a potent

growth promotor for lactate-fermenting bacteria in-vitro (Nisbet and Martin 1991),

but is not sufficient to increase the number of ruminal bacteria in-vivo. It was

8

Figure. 2.1 Mode of action of live yeast in ruminants.

Altered microbial protein synthesis

Increase

Decrease ammonia Altered amino acid profile

Live yeast

Increase feed intake

Improve

Stimulation of rumen microbes

Production response

Moderate

Altered VFA production

Decrease lactic

Decrease

suggested that addition of Yea-sacc to the rumen increased the number of

cellulolytic bacteria possibly by assisting hydrogen transfer (Williams and Lyons,

1988). Further, yeast culture provides soluble growth factors that stimulate growth

of ruminal bacteria that utilize lactate and digest cellulose.

(1) Oxygen scavenger:

Live yeast use oxygen to metabolize sugars and small oligosaccharides

solubilized from feed particles and produce peptides and amino acids as end

products which are used by the bacteria in the vicinity of yeast. Removal of

oxygen improves anaerobiosis in the microenvironment of solid feed particals and

provide better conditions for the growth of cellulolytic bacteria (Jouany, 2001).

(2) Supply of growth factors:

Role of fermented yeast culture in bacterial growth and activity given by Girard

(1996) is illustrated briefly in Figure 2.1.

(3) pH stabilization:

Yeast increase lactate utilization. Yeast is a source of dicarboxylic acid and

malic acid which is utilized by S. cerevisiae to produce propionate from lactate. S.

cerevisiae HD4 showed 3.8 fold more uptake of lactic acid in presence of yeast

(Nisbet and Martin, 1991).

(4) Stimulation of rumen microbes:

Oxygen uptake, supply of growth factors and pH stabilization

synergistically act for stimulation of rumen microbes. YC have also directly

stimulated rumen fungi, which may improve fiber digestion (Chaucheryas et al.,

1995; Gattass et al., 2008; Soccol et al., 2010). They increased the number of

rumen protozoa and neutral detergent fiber digestion in steers fed straw-based

diets (Plata et al., 1994).

(5) Microbial protein synthesis:

Reduction in rumen NH3-N concentration

Increase incorporation of NH3 into microbial protein

Improved amino acid profile of duodenal digesta. (Methionine and Lysine)

9

Erasmus et al. (1992) reported 10 % reduction in rumen ammonia

concentration and 9.4 % more NAN at duodenum by YC supplementation. Putnam

et al. (1997) reported improved methionine from 13.5 to 14.5 % and Lysine from

4.5 to 5.8% in total essential amino acids in duodenal digesta by supplementation

of 10 g YC /day.

2.1.1.2 Effect of Saccharomyces cerevisiae on rumen fermentation pattern:

Rumen pH:

A pH in this optimum range must occur for the establishment and survival

of a diverse and stable population of microorganisms. Establishment of microbial

populations in the rumen appears to follow a pattern with regards to substrates

available and ruminal pH. Ruminal pH is controlled by multiple factors including

relative concentration of bases, acids, and buffers (Owens et al., 1998). The

primary base in the rumen is NH3, with lactate being the primary acid and

bicarbonate and phosphate acting as major buffers.

Ruminal ammonia:

A decrease in NH3 concentration is attributed to ruminal microbial

proliferation, due to the increase of microbial use of available NH3. Beharka et al.

(1998) reported a decrease in NH3 concentrations in Holstein bull calves, fed

either a finely ground or unground diet consisting of chopped hay and rolled grain.

Their results indicated an increased incorporation of NH3 nitrogen into microbial

protein.

Volatile fatty acids:

The development of the rumen is primarily chemical being influenced by

volatile fatty acids (VFA) metabolism and absorption in the rumen. These VFA are

produced by naturally occurring microbes in the rumen. The major VFA produced

are acetic, propionic, butyric, and valeric acids. These end products of microbial

fermentation are absorbed and metabolized by the rumen epithelium. Stimulatory

effects of VFA on the developing rumen are not equal. Butyrate is the most

stimulatory, followed by propionate (Laborde, 2008).

10

Figure 2.2 Mechanism of fermented yeast culture in bacterial growth and activity

Metabolically active yeast cells

Short chain peptides

Stationary phase of bacteria

Protein synthesis in bacteria

Transitition to exponential growth

Increases bacterial growth and activity

Metabolic trigger

2.1.1.3 Effect of Saccharomyces cerevisiae on milk yield:

There are controversial results of Saccharomyces cerevisiae

supplementation on milk yield and composition of milk of cows.

Number of study shows that supplementation of Saccharomyces cerevisiae

significantly increases the milk yield and composition of milk of cows in early

lactation period (Sune and Muhlbach, 1998; Iwanska et al., 1999; Robinson and

Garrett, 1999).

Several studies (Piva et al., 1993; Dann et al., 2000; Majdoub-mathiuothi et

al., 2009) have demonstrated that supplementation of Saccharomyces cerevisae

had non significant effect on milk yield or milk composition in mid or late lactation

period of dairy cows.

Arambel and Kent (1990); Piva et al., (1993); Robinson (1997).They had

demonstrated significant effect on milk yield or milk composition of dairy cows

when Saccharomyces cerevisae was supplemented in early lactation or

peripartum period.

There are controversial results of Saccharomyces cerevisiae supplementation on milk yield and composition of milk of cows.

2.1.1.4 Effect of Saccharomyces cerevisiae on Dry Matter Intake (DMI):

Several research finding showed that significant improvement in DMI on

systematic supplementation of Yeast i.e. Saccharomyces cerevisiae in crossbred

cows during peripartum period or early lactation (Williams et al., 1991; Wohlt et al.,

1991; Dann et al., 2000).

Number of studies show non significant changes in DMI on systematic

supplementation of Saccharomyces cerevisiae in crossbred cows during mid or

late lactation (Arambel and Kent, 1990 and Soder and Holden, 1999).

Supplementation of Saccharomyces cerevisiae during stress to cattle

increases feed intake and nutrient availability to overcome the stress. Therefore

yeast culture is thought to be best utilized by animals under stress (Phillips and

von Tungelin, 1984 and Barling, 2014)

11

2.1.1.5 Effect of Saccharomyces cerevisiae on body weight:

Markusfeld et al. (1997) failed to observe any relationship between body

weight at calving and first service conception rate in crossbred cows.

Zhang et al. (2000) reported that the body weight gain was 1% higher in

the crossed bred cows group supplemented with Saccharomyces cerevisiae

than that of the controls but it was not-significant.

Addition of yeast cell suspension (Saccharomyces cerevisiae) in feed

crossbred cattle calves had increased body weight gain significantly (Prahalada et

al., 2002 and Anandlaxmi et al., 2012).

Anandlaxmi et al. (2013) reported that supplementation of Saccharomyces

cerevisiae to crossbred cows with anoestrous problem increases feed intake and

brought the animals into cyclicity early.

2.2 INSULIN LIKE GROWTH FACTOR-1 (IGF-1)

Insulin-like growth factor-1 was first identified by Salmon and Daughaday

(1956, 1957), and designated ‘sulphation factor’ due to their ability to incorporate

sulphate into rat cartilage in vitro. They were also known as NSILA (non-

suppressible insulin-like activity) I and II. A decade later, the terms sulphation

factor and NSILA were replaced by the term ‘somatomedin’ (Daughaday et al.,

1972) and subsequently they were renamed ‘insulin-like growth factor I and II’

due to their structural similarity with insulin and their growth-promoting activities

(Rinderknecht and Humbel, 1976a, 1976b).

Insulin-like growth factor-1 is one of two ligands of the IGF family (Hwa et

al., 1999 and Spicer 2004), is a small peptide consisting of 70 amino acids with a

molecular weight of 7649 Da (Laron, 2001). The established components of the

IGF system also include two receptors, six high-affinity IGF binding proteins

(IGFBPs) and IGFBP proteases (Giudice 1995; Hwa et al. 1999; Spicer 2004).

Furthermore, another group of low affinity binding proteins known as IGFBP-

related proteins (IGFBP-rPs) belongs to the IGF family. Its primary action is

mediated by binding to its specific receptor, the Insulin-like growth factor-1

receptor, abbreviated as "IGF-Ir", present on many cell types in many tissues.

Binding to the IGF-Ir, a receptor tyrosine kinase, initiates intracellular signalling.

12

IGF-1is produced mainly by liver but also produced in many other organs

(Zulu et al., 2002). Growth Hormone (GH) is dominant endocrine influence on

liver production and circulating concentrations of IGF-1which is 100 %

dependant with lower concentration in hypopituitary states and elevated

concentrations in condition of GH excess. Once released from the liver IGF-1has

endocrine functions, travelling via blood to act on distant tissues including those

of reproductive tract (Wathes 2008). Low level of IGF-1 and Lactoferrin reflect

lower immune status of repeat breeding groups when compared compared with

regular breeder groups (Nickerson, 1989; Oliver and Sordillo 1989).

In a variety of species (including farm animals, humans, and laboratory

animals) higher concentrations of blood IGF-1 are found in young, well

nourished, healthy individuals (Jones and Clemmons, 1995). Animals that are

old, diseased, or mal-nourished have low blood IGF-1 concentrations that reflect

a compromised state of tissue, organ, and cell function (Jones and Clemmons

1995; McNall et al., 1995). The changes in blood IGF-1 can be directly linked to

changes in growth hormone receptor expression or growth hormone receptor

second messenger systems in liver.

2.2.1 IGF-1 in female reproduction

Insulin-like growth factor-1 decreased in postpartum cattle when energy

requirements exceeded nutrient intake (Beam and Butler, 1999). Cattle in poor

body condition or cows failing to increase body condition during lactation also

have low blood IGF-1 (Wathes, 2008).

Several studies have established a correlation between blood IGF-

1concentrations of postpartum cattle and reproductive function. Thatcher et al.

(1996) Anand Laxmi et al. (2013) reported that anestrus dairy cows had lower

blood IGF-1compared with dairy cows that initiated estrous cyclicity earlier

during the postpartum period. A similar relationship was reported for beef cattle;

postpartum anestrus cows had lower IGF-1 compared with cyclic cows (Roberts

et al., 1997). Blood IGF-1 was was positively correlated with follicular fluid IGF-1

because the majority of IGF-1 in follicular fluid is derived from blood

(Leeuwenberg et al., 1996). Therefore, endocrine IGF-1under somatotropic

control influences ovarian function through it’s contribution to follicular fluid IGF-

13

1. According to the somatomedin hypothesis, nutritionally induced changes in

liver IGF-1 secretion have a direct effect on the ovary through the endocrine

actions of IGF-I. An association between IGF-1and ovulation in postpartum dairy

cows has been established, but a causative relationship should not be

extrapolated from these correlation studies.

Insulin-like growth factor-I and gonadotropins are synergistic for growth

and differentiation of the follicle (Adashi,1998; Giudice, 1992; Spicer and

Echternkamp, 1995). Follicular growth and steroidogenesis in postpartum cattle,

therefore, should be correlated with greater LH secretion as well as greater

blood IGF-1concentration. A positive correlation between LH pulsatility and

ovarian follicular development has been established for postpartum cows (Beam

and Butler, 1999). Likewise, positive correlation between plasma estradiol and

serum IGF-1 was found during the first post partum follicular wave (Beam and

Butler 1999). Postpartum ovarian function probably depends on both LH

pulsatility and blood IGF-1concentrations. The independent contribution of each

hormone to normal function is difficult to establish, however, because both LH

pulsatility and blood IGF-1concentrations increase during the postpartum period

when nutrient and feed intake of animal is improved.

IGF-1, a potent stimulator of cellular proliferation, differentiation and

development, regulates granulosa cell steroidogenesis and apoptosis during

follicular development as well as having acute anabolic effects on protein and

carbohydrate metabolism (Jones and Clemmons 1995; Hossner et al., 1997).

IGF-l plays a central role in these interactions with respect to both

steroidogenesis and survival responses (Adashi and Roban 1992; Giudice 1992;

Armstrong and Webb 1997). The most important role of IGF1 appears to be

reliant on its ability to synergize with gonadotrophins and to amplify their

steroidogenic output (Urban et al., 1990 and Balasubramanian et al., 1997).

There are, differences in these responses with respect to different species

(deMoura et al., 1997; Chung et al., 1998; Devoto et al., 1999; Mamluk et al.,

1999; Silverman et al., 1999), cows are mono ovulatory species. At regular

intervals during the bovine oestrous cycle, a group of small antral follicles grow

rapidly from about 1 to 5 mm in size. Growth during this phase is dependent on

gonadotrophin secretion, follicular function and also influenced by a variety of

14

growth factors. Among these, IGF1 and insulin are of key importance in the cow

as they can link follicular growth and steroid production with the metabolic status

of the animal (Spicer and Echternkamp, 1995; Wathes et al., 2003). In

ruminants, the major source of IGF-l in follicular fluid is the circulatory IGF-l

(Funston et al., 1996 and Perks et al., 1999) and there is substantial evidence

that follicular maturation is compromised when cows are in negative energy

balance and circulating concentrations of IGF-l and/or insulin are reduced

(Wathes et al., 2003).The IGF-1receptor has been localized in bovine oocytes,

cumulus cells, and in both granulosa and theca cells (Nuttinck et al., 2004; Sudo

et al., 2007). Wathes (2008) reported delays or failure of conception in post

partum dairy cows are associated with reduced IGF-1concentrations and either

higher or lower urea values.

2.3 HAPTOGLOBIN (Hp)

Acute phase protein (APP) refer to group hepatic glycoprotein which are

stimulated by inflammatory mediators and respond to an initial reaction of

infection or trauma in the animals. Hp is one of the most specific APP in cattle

(Alsemgeest et al., 1994; Salonen et al., 1996).

Haptoglobin is an α2-globulin with a molecular weight approximately 125

Da. It has a four chain structure, (αβ)2, linked by disulfide bonds (Putnam, 1975).

It was first described as a proteinaeous substance with the ability to increase the

stability of the peroxidase activity of hemoglobin at low pH (Polonovski and Jayle

1939). It has a four chain structure, (αβ)2, linked by disulfide bonds. Bovine Hp

was found to consist of monomers of 16 to 23 kDa (α-chains) and 35 to 40 kDa

(β-chains) (Eckersall and Conner 1990 and Morimatsu et al., 1991) and to exist

as a polymer in association with albumin with a molecular weight above 1000 Da

in cattle serum (Eckersall and Conner, 1990). A macromolecular protein in

bovine acute phase serum with a molecular weight of 1000 to 2000 Da has been

isolated and characterized as Hp (Morimatsu et al., 1991). This protein is present

at a basal level (≤200 ng/ml) in normal bovine serum. Large and heterogenous

molecular sizes with different degrees of polymerisation have also been reported

(Morimatsu et al., 1992).

15

2.3.1 Biological functions of haptoglobin (Hp)

The acute phase response (APP) is thought to be part of a general

defense response towards tissue injury (Gauldie et al., 1989). It is generally

accepted that the acute phase response induced fever and slow-wave sleep is in

some way beneficial to an organism under physical stress (Kluger et al., 1975).

A number of the common APP (i.e. those that are acute phase proteins in most

species) are likely to participate directly in the protection of the host. Conner and

Eckersall (1988) reported that Hp concentration may increase up to 100 fold

within 24 hrs of induced localized inflammation in cattle.

Numerous functions of Hp have been proposed, but the primary function

of Hp is to prevent the loss of iron by the formation of very stable complexes with

free hemoglobin in the blood (Keene and Jandl, 1965 and Putnam, 1975).

Hp is thus believed to have a bacteriostatic effect by restricting the

availability of iron necessary for bacterial growth (Eaton et al., 1982). For

example, human Hp was shown to inhibit the growth of Streptococcus pyogenes

in vitro (Delange et al., 1998). Hp has also been associated with bacterial

contamination of the uterus and delayed uterine involution (Sheldon et al., 2001).

A number of investigations indicate the ability of Hp as specific markers of

clinical and subclinical infections, to discriminate between acute and chronic

disease and for prognostic purposes, since the duration and magnitude of the

response reflect the severity of the disease and the effect of treatment (Skinner

et al., 1991; Horadagoda et al., 1999; Hultén et al., 1999; Petersen et al., 2002;

Hultén and Demmers, 2002; Lauritzen et al., 2003).

However, others have reported that Hp concentrations remain low in

acute postpartum metritis and high concentrations are seen only in cases of

severe metritis (Hirvonen et al., 1999). In dairy cows with toxic puerperal metritis,

antimicrobial therapy is associated with a decrease in serum Hp concentration

(Smith et al., 1998). In cattle, Hp has been proposed as an immunomodulator

(Murata and Miyamoto, 1993).

Uchida et al. (1993) suggested that only a negligible or low basal value of

Hp was detectable in normal bovine serum, but Hp could be induced by an acute

16

phase response such as inflammation, transportation, exhaustation, stress or

starvation.

2.4. LACTOFERRIN

Lactoferrin is an iron-binding glycoprotein belonging to the transferrin

family and is present in secondary granules in neutrophils and milk and is

released upon neutrophil activation (Furmanski and Li 1990; Baker and Lindley

1992; Crocker et al., 2000).

Lactoferrin (LF) is an 80kDa iron-binding glycoprotein that is a component

of the innate immune system and found in many body fluids and secretions

(Shugars et al., 2001).

LF exhibits diverse biological activities ranging from activation of innate

immunity (Miyauchi et al., 1998), to direct microbicidal activity (Ellison, 1994). LF

has been reported to bind to membranes of platelets (Mazurier et al.,1994) ,

monocytes/ macrophages (Birgens, 1994), eosinophils (Thomas et al., 2002),

Exposure of these cells to LF modulates subsequent cellular functions such as

cytokine gene activation (Crouch et al.,1992), cytotoxicity (Shau et al.,1992), and

cell maturation, and a number of immunopotentiating activities (Zuccotti et al.,

2006). Further, direct receptor mediated interactions have been demonstrated

via LF exposure to bacteria, parasites, and viruses, generally resulting in

microbicidal effects (Yu and Schryvers, 2002). Thus LF may play a broad but key

role in resistance to many types of diseases. Among its many roles, lactoferrin

has been reported to have antibacterial, anti-fungal, anti-tumor, antiinflammatory,

and immuno-modulatory properties (Vogel et al., 2003).

Antibacterial properties - Since neutrophils are the primary source of serum

LF, are the first to respond to monocyte: macrophage induced up-regulation of

adhesion molecules and leukocyte chemotaxis, lactoferrin is rapidly mobilized to

sites of infection (Valenti and Antonini 2005). Iron availability is important for the

growth of bacterial pathogens and has been strongly correlated with bacterial

virulence. It is also required for several aspects of microbial metabolism (electron

transport, cellular growth and division, and enzymatic pathways) (Arnold et al.,

1982). These phenomena have been repeatedly demonstrated in pathologic

situations where bacterial overgrowth occurs in the face of high serum iron

17

concentrations (Arnold et al., 1982). Given its iron-withholding ability, LF was

initially assigned its antibacterial role based on its iron-chelating ability (Valenti.

and Antonini 2005).

Anti-inflammatory properties - A major topic of debate over the years has

been the question of whether lactoferrin truly has an antiinflammatory role. There

is evidence that it is synthesized de novo by neutrophils during inflammation

(Baynes and Bezwoda, 1994; Steijns and van Hooijdonk, 2000).

Lipopolysaccharide the non-proteinaceous element of the outer membrane of

gram-negative organisms is a potent stimulator of inflammation (Baveye et al.,

2000). Central to the inflammatory response is stimulation of the host’s innate

immune cells and the endothelium to secrete pro-inflammatory cytokines and up

regulate the expression of adhesion molecules, respectively. The attraction of

inflammatory cells to activation sites leads to the development of deleterious

effects.

The strong association between lactoferrin concentration and incidence of

clinical and subclinical mastitis in dairy cows suggested that lactoferrin may play

an important role in host defense against microbial infection (Kawai et al., 1999;

Hagiwara et al., 2003).

During inflammation and in some pathological conditions, LF levels of

biological fluids may greatly increase. This is particularly noticeable in plasma

where LFconcentration can be as low as 0.4–2 mg/l under normal conditions but

increases to up 200 mg/l in septicaemia (Bennett and Kokocinski, 1978; Maaks

et al., 1989).

2.5 BLOOD PROFILE AND REPRODUCTION:

2.5.1 Plasma calcium:

Ovulatory disturbance is one of the major causes of repeat breeding in

crossbred dairy in India (Ibraheem and Ramachandran 2003). Mineral imbalance

or deficiencies may be cause repeat breeding in cattle (Rupde et al., 1993; Das

et al., 2002). The deficiency of a particular element may influence the level of

other elements in the body fluid and the functional characteristics of endocrine

glands, especially the hypophyseal-gonadal axis (Bhaskaran and Abdullakhan

1981).

18

Calcium (Ca) plays an important role in gonadotropic regulation of ovarian

steroidogenesis (Carnegie and Tsang 1984) and regulation of the membrane

potential of oocytes. Calcium plays an important role in the utilization of

cholesterol by mitochondria or by stimulating the conversion of pregnenolone to

progesterone. GnRH stimulation of LH release from pituitary cells involves a Ca-

dependent mechanism (Carnegie and Tsang 1984). Das et al. (2009) reported

significant (p <0.01) decrease in plasma level of calcium among crossbred cattle

with repeat breeding problem.

The role of calcium and phospholipid-dependent protein kinase and c-

AMP-dependent protein kinase may be crucial in mediating the hormone action.

Peracchia (1978) suggested that Ca is involved in the disruption of cumulus cell

cohesiveness by regulating the number of gap junctions between the cells which

contributes to the process of ovulation. Moreover, a disturbed calcium-

phosphorus ratio has a blocking action on the pituitary gland and consequently

on the ovarian function (Herrick and John, 1977).

Patel et al. (2008) reported that oestrus group had a significantly higher

calcium level at 7th, 8th, 17th and 21st week postpartum in comparison to

anoestrus problems group in Holstein Friesian cows.

2.5.2 Plasma glucose

Glucose, one of the nutrients apparently enhanced postpartum cyclicity

and reproductive performance by increasing the energy status of the animals

and thus stimulated the ovarian follicular growth and luteal functions (Highshoe

et al., 1991; Wehrman et al., 1991). Glucose is major source of energy for the

ovarian steriodogenesis (Rabiee et al., 1997, 1999) and in oocytes (Down et al.,

1996)

Jani et al. (1995) reported high incidence of repeat-breeding and

anoestrous are associated with the low plasma glucose level.

Parmer et al. (1986) reported greater concentration of glucose during the

luteal phase in repeat breeders. El-Belely (1993) suggested that lower

concentration of glucose might be the reason for reduced luteal function in

repeat breeding cows.

19

Richards et al. (1989) reported higher blood glucose concentration

increases progesterone production by increasing pulse and mean concentration

of LH. JoeArosh et al. (1998) suggested that hypoglycemic condition in repeat

breeder causes impaired hypothalamic hypophysial ovarian axis and reduce

ovarian activity. Miyoshi et al. (2001) suggested that cows with higher plasma

glucose concentration will have better ovarian activity. Hence in the present

study, RB group of animals had lower glucose concentration which might have

affected ovarian activity and might have decreased conception rate.

Higher blood glucose concentrations directly increased the progesterone

production by increasing the pulse and mean concentration of LH (Richards et

al., 1989) Poor energy status in repeat breeders due to hypoglycemia could be

the reason for impaired hypothalamic hypophyseal ovarian axis and reduced

ovarian activities (Joe Arosh et al., 1998).

Khan et al. (2010) reported showed significantly higher (P < 0.01) glucose

levels on day 5 of the cycle (50.31±4.19 mg/dl) and day 10 (45.60±6.60 mg/dl),

whereas significantly lower (P = 0.01) level (30.93±4.39 mg/dl) was recorded on

day 20 of the oestrous cycle when compared to day 5 and 10 of the cycle in the

repeat breeding cows.

2.5.3 Plasma urea

According to Dhali (2001) increased blood urea nitrogen concentration

results into negative energy balance. Greater serum or plasma urea nitrogen

concentration reduces LH binding to ovarian receptors, leading to decrease in

serum progesterone concentration and pregnancy rates.

In dairy cows the excess dietary protein increases blood urea level, alters

uterine fluid composition, decreases uterine pH and reduces conception rates

(Elrod and Butler, 1993; Elrod et al., 1993).

Elrod and Butler (1992) suggested that lower uterine pH may not directly

affect the developing embryo, but may alter the availability of ions to the embryo,

thereby affecting hormone receptor interactions, or amino acid, glucose or

lactate uptake by the embryo. It is also possible that changes in ion

concentrations may increase free radical challenge to the conceptus.

20

It has been observed that increased plasma urea concentration may

interfere with the normal inductive actions of progesterone on the

microenvironment of the uterus and, thereby, cause suboptimal conditions for

support of embryo implantation (Hamman et al., 2000 and Papadopoulas et al.,

2001).

Dhali et al. (2006) showed a positive relationship between the milk urea

concentration and interval from parturition to first service.

The conception rate to first service was registered as 68% (WestWood et

al., 1998) with plasma urea nitrogen concentration of approximately 23 mg/dl. In

virgin heifers the poor first service conception rate (82% vs. 61%) has been

found when the peak plasma urea values have increased from 17.5 to 23.6

mg/dl (Elrod and Butler, 1993).

Elrod and Butler (1993) have reported that the conception rate decreases

considerably when plasma urea nitrogen concentration exceeds 16 mg/dl. They

have recorded the conception rate of 87.5% and 42.8% with the plasma urea

nitrogen concentration of <9 mg/dl and >16 mg/dl, respectively.

Ferguson et al. (1993) have suggested that the likelihood of conception

rate decreases with increasing serum urea nitrogen level greater than 20 mg/dl.

Butler et al. (1996) have found the mean pregnancy rate of 68% and 47% with

the milk urea nitrogen concentration <19 mg/dl and >19 mg/dl, respectively.

Ferguson et al. (1993) have also reported that the 21 mg/dl plasma urea nitrogen

is high enough to depress the pregnancy rate.

2.6 NEUTROPHILS

Neutrophils are the most abundant cell type among circulating white cells

and pivotal effector cells in the innate immune response. They are phagocytic

cells that participate in inflammatory reactions as a first line of defense against

invading micro-organisms. They are terminally differentiated and normally have a

very short lifespan (8–20 hr) in circulation and in tissue (1–4 days). Neutrophils

are recruited to sites of inflammation by chemoattractants such as interleukin-8

(IL8). They contribute to the early innate response by rapidly migrating into

inflammed tissues, where their activation triggers microbicidal mechanisms such

as release of proteolytic enzymes and antimicrobial peptides, and rapid

21

production of reactive oxygen species (ROS). Neutrophils function in the innate

response through killing of pathogens by both oxidative and non-oxidative

mechanisms. In addition, neutrophils have a role in stimulation of adaptive

responses producing a variety of chemokines, cytokines and some granule

proteins that are chemotactic not only for neutrophils but for monocytes,

immature dendritic cells and T cells. Thus, activated neutrophils kill

microorganisms but also influence the local milieu through actions both on

immune and epithelial cells, with pro-inflammatory or regulatory effects (Ross et

al., 2006; Nathan, 2006).

Regulation of the neutrophil life span by apoptosis is a crucial process in

the resolution of inflammation, and alterations of apoptosis in neutrophils.

Neutrophils are programmed for spontaneous apoptosis (the intrinsic apoptotic

route). In these cells, this mechanism of apoptosis has special features, probably

due to peculiarities of neutrophil mitochondria, which are pivotal for apoptosis

(Simon, 2003). Importantly, neutrophil apoptosis is highly regulated. Extrinsic

pathway is mainly stimulated by death-inducing receptors belonging to the tumor

necrosis factor (TNF)/nerve growth factor (NGF) receptor super-family, such as

Fas, TNF-related apoptosis inducing ligand (TNFSF10) receptors, TNFRSF9

(CD137), and the type I TNF receptor (Simon, 2003).

Accelerated neutrophils death leads to a decrease of neutrophil counts

(neutropenia), augments the chance of contracting bacterial or fungal infections,

and impairs the resolution of such infections. On the other hand, delayed

neutrophil death elevates neutrophils counts (neutrophilia), which is often

associated with bacterial infection, myeloid leukemia, and acute myocardial

infarction (Akgul et al.,2001 and Maianski et al., 2004).

2.6.1 Apotosis of neutrophils

Apotosis of neutrophil is also an essential cellular event for maintaining

neutrophil number during infection and inflammation. Neutrophils are recruited to

the infected tissues to engulf, kill, and digest invading microorganisms. However,

the enzymes and reactive oxygen species (ROS) released by neutrophils can

also damage the surrounding tissues (Murray et al., 1997). To prevent senescent

neutrophils from releasing their toxic contents, these cells become apoptotic and

22

are then recognized, engulfed, and cleared by professional phagocytes such as

tissue macrophages. This safe clearance provides a mechanism of reducing the

number of viable and activated neutrophils without releasing the potentially

harmful enzymes and ROS, thereby facilitating the resolution of inflammatory

response. Delayed death and clearance of neutrophils in tissues causes

unwanted and exaggerated inflammation. Finally, neutrophil apotosis contributes

to neutrophils’ pathogen killing capability. It is an essential step for the

generation and release of neutrophils extracellular traps (NETs), extracellular

structures composed of chromatin, and granule proteins that bind and kill

invading microorganisms. This mechanism allows neutrophils to fulfill their

antimicrobial function even beyond their life span (Simon, 2003). Thus,

regulation of the neutrophil life span by apoptosis is a crucial process in the

resolution of inflammation, and alterations of apoptosis in neutrophils. In these

cells, this mechanism of apoptosis has special features, probably due to

peculiarities of neutrophil mitochondria, which are pivotal for apoptosis (Simon, 2003). Importantly, neutrophil apoptosis is highly regulated. Extrinsic pathway is

mainly stimulated by death-inducing receptors belonging to the tumor necrosis

factor (TNF)/nerve growth factor (NGF) receptor super-family, such as Fas, TNF-

related apoptosis inducing ligand (TNFSF10) receptors, TNFRSF9 (CD137), and

the type I TNF receptor (Simon, 2003).

Various proapoptotic and antiapoptotic signals at the site of inflammation

can interact on neutrophils and regulate their survival (Hughes and Piontkivska,

2008). Neutrophil apoptosis occurs through two main pathways (Fanning et al.,

1999), one that is mediated via exogenous death receptor signaling (Liles et al.,

1996) and the other that occurs spontaneously through mitochondrial membrane

changes under the influence of Bcl-2 family proteins (Lin et al., 1996). Fas (also

called CD95/APO-1) is a type I membrane glycoprotein belonging to the TNF-

receptor superfamily of molecules. Death signals are initiated in neutrophils when

Fas becomes trimerized upon interaction with its ligand, Fas ligand (FasL).

Activation of Fas receptor by FasL recruits numerous death-domain-containing

proteins to the cytoplasmic death domain of Fas, and these act as adaptor

molecules for the ultimate recruitment and activation of caspase 8 to initiate

apoptosis signaling via a variety of mechanisms (Schulze-Osthoff et al.,1998;

23

Sharma et al., 2000; Kuijpers 2002). Ultimately, caspase 8 activation results in

cleavage of proteins involved in cytoskeletal maintenance and DNA repair, leading

to membrane blebbing, nuclear condensation and collapse, and irreversible cell

death (Robertson et al., 2000 and Zimmermann et al., 2001). Fas receptor and

FasL are constitutively coexpressed in human blood neutrophils, rendering the

cells highly sensitive to apoptosis (Liles et al., 1996).

2.7 Fas GENE

Neutrophil apoptosis occurs through two main pathways (Fanning et al.,

1999), one that is mediated via exogenous death receptor signaling (Liles et al.,

1996) and the other that occurs spontaneously through mitochondrial membrane

changes under the influence of Bcl-2 family proteins (Lin et al., 1996). In the

current study, we chose to examine the main exogenous death receptor of

neutrophils, Fas. Fas (also called CD95/APO-1) is a type I membrane glycoprotein

belonging to the TNF-receptor superfamily of molecules. Death signals are

initiated in neutrophils when Fas becomes trimerized upon interaction with its

ligand, Fas ligand (FasL). Activation of Fas receptor by FasL recruits numerous

death-domain-containing proteins to the cytoplasmic death domain of Fas, and

these act as adaptor molecules for the ultimate recruitment and activation of

caspase 8 to initiate apoptosis signaling via a variety of mechanisms (Schulze-

Osthoff et al., 1998; Sharma et al., 2000). Ultimately, caspase 8 activation results

in cleavage of proteins involved in cytoskeletal maintenance and DNA repair,

leading to membrane blebbing, nuclear condensation and collapse, and

irreversible cell death (Robertson et al., 2000 and Zimmermann et al., 2001). Fas

receptor and FasL are constitutively coexpressed in human blood neutrophils,

rendering the cells highly sensitive to apoptosis (Liles et al., 1996).

2.7.1 Mechanisms of neutrophils apoptosis activated by death receptors (Fas)

Death receptors are cell surface receptors that transmit apoptosis signals

initiated by specific death ligands given by Ashkenazi and Dixit, 1998 in Figure

2.3. They include TNFRs, Fas (Apo-1/CD95), DR3 (Apo-3/TRAMP), DR4

(TRAIL-R1), DR5 (TRAIL-R2) and DR6. The two best-characterised death

receptors, TNFR1 and Fas, are both transmembrane protein members of an

24

expanding TNF nerve growth factor (NGF) family that signals for apoptosis in

many cell types (Ashkenazi and Dixit,1998), including neutrophils (Liles et al.,

1996; Murray et al., 1997). Each death receptor contains cysteine-rich

extracellular domains and a motif in the cytoplasmic region termed a ‘death

domain (DD)’ (Ashkenazi and Dixit, 1998). Death domains are mainly involved in

protein-protein interactions and connect the receptors with the components of

the intracellular apoptosis machinery. Associations between death domains

occur upon receptor-ligand binding and these interactions are necessary for

initiation of apoptosis (Ashkenazi and Dixit, 1998; Nagata, 1997). FasL is the

ligand for Fas and is a homotrimeric molecule. Binding of Fas with trimeric FasL

leads to cross-linking of three receptor molecules resulting in clustering of

intracellular death domains. The association of receptor death domains induces

the recruitment of adaptor proteins (Ashkenazi and Dixit, 1998 and Nagata,

1997). The major adaptor protein is the Fas-associated death domain-containing

protein (FADD), and recruited FADD associates with the activated receptor

through its own death domains. FADD also contains a ‘death effector domain’

(DED) that allows its interaction with procaspase- 8 via its respective DEDs.

Fas/FADD/pro-caspase-8 together form a protein complex called the

‘deathinducing signalling complex’ (DISC) (Medema et al., 1997). Pro-caspase-

has been suggested to be activated according to the ‘induced proximity model’ in

which caspase precursor aggregation mediated by FADD induces

autoprocessing and autoactivation through cross-cleavage (Muzio et al., 1998).

Indeed, gene knock-out experiments in mice in which FADD is deleted have

shown that FADD is one of the essential components of the apoptosis machinery

induced by FasL and TNF-a (Ashkenazi and Dixit, 1998), TNF-a, a trimeric

molecule, is the ligand for TNF receptors. Exposure of cells to TNF-a can induce

multiple effects including cell differentiation, proliferation, apoptosis and other

pro-inflammatory effects. TNF binding induces trimerisation of TNFR1 bringing

the death domains of the receptors into close proximity (Ashkenazi and Dixit,

1998; Nagata, 1997). Subsequently, TNFR-associated death domain-containing

proteins (TRADDs) bind to clustered receptors via their respective DDs. TRADD

can also associate with other secondary adaptor molecules including TNFR-

associated factor-2 (TRAF2) and receptor-interacting protein (RIP) leading to the

activation of the transcription factors, NF-kB and AP-1 (Ashkenazi and Dixit

25

1998; Nagata, 1997). However, TRADD can also associate with FADD, thereby

inducing the activation of pro-caspase-8 which leads to apoptosis (Ashkenazi

and Dixit, 1998 and Nagata, 1997). Whilst TNF-a can induce apoptosis through

TNFR1 in some cell types including neutrophils (Murray et al., 1997), triggering

the activation of NF-kB and AP-1 may induce the expression of survival factors,

thereby providing resistance against apoptosis (Ward et al., 1999; Zong et

al.,1999). In this respect, TNF-a is a bifunctional molecule and the response of a

cell to this agent probably depends upon interplay between pro- and anti-

apoptotic signaling effects.

2.8 TOLL LIKE RECEPTOR 4 (TLR-4) The term TOLL originally referred to a cell surface receptor governing

dorsal/ventral orientation in the early Drosophila larvae (Stein et al., 1991). A

variety of proteins homologous with toll-like receptors have been identified in

humans (Rock et al., 1998 and Takeuchi et al., 2000). TLR-4 is a type 1

transmembrane protein with an intracellular domain homologous to that of the

humans IL1 receptor (Medzhitov et al., 1997). Bovine TLR gene was discovered

by White et al. (2003). Bovine TLR-4 shares genomic structure with human and

mouse counterparts. The overall length of bovine TLR-4 is 11kb, which is

comparable to 10 kb for human and 14 kb for mouse. Most of the differences in

length are found in length of the introns. Toll and TLR family proteins are

characterized by the presence of two primary motifs. An extracellular domain

with leucine rich repeats (LRR) and an intracytoplasmic region containing a

TOLL/ interleucine receptor (TIR) signaling (Rock et al., 1998). Bovine TLR-4

protein consists of 841 amino acids, of which 1 - 23 amino acids form signal

peptide, 24 - 634 amino acid are outside the membrane, 635 - 657 amino acids

are transmembrane helices structure and 658 - 841 amino acids are inside the

membrane (Wang et al., 2007). Interleukin shows various biological actions but

most important action is to recruit and activate neutrophils to site of acute

inflammation (Harada et al., 1994). Neutrophils display several Toll-like receptors

on their surfaces.TLR-4 detects the lipopolysaccharide present on the cell wall of

gram negative microbes. TLRs on the surfaces of macrophages recognize

microbial components, such as LPS, peptidiglycans, and flagellin and cytokine

receptors detect cytokines released by other cells as part of the inflammatory

response.

26

http://www.copewithcytokines.de/cope.cgi?key=Cytokine%20Inter%2dspecies%20Reactivities

http://www.copewithcytokines.de/cope.cgi?key=Cytokine%20Inter%2dspecies%20Reactivities

Figure 2.3 Apoptosis signaling through death receptors.

Activation of TLRs can increase the phagocytic activity of macrophages

and neutrophils and change their physiology in ways that increase their ability to

kill and clear pathogens. Overall, recognition of LPS and initiation of signaling by

TLR-4 is a complex process, which involves several accessory proteins. LPS is

first bound by circulating lipopolysaccharide-binding protein (LBP), which

functions as an opsonin for CD14 (Schumann et al., 1990). CD14 then acts as a

catalyst for the binding of LPS to MD-2 (Wright et al., 1990). After the LPS is

transferred to MD-2, the LPS/MD-2 complex interacts with TLR4. Downstream

signaling by the TLR-4 receptor involves several intercellular TIR domain-

containing adaptors mediating proinflammatory gene expression (O’Neill and

Bowie, 2007; Vogel et al., 2003).Two pathways that initiate downstream TLR-4

signaling are known, namely, the MyD88- and TRIF-dependent pathways.

Sensing the presence of bacteria is an important function of the innate immune

system, and a prerequisite for an adequate immune response. Toll-like receptors

(TLR) have been identified as crucial molecules for detection of invading

pathogens and induction of host defense mechanism (Werling et al., 2006). Each

TLR distinguishes between specific patterns of microbial components, so-called

pathogen-associated molecular patterns.

2.8.1 Expression of TLR-4 Gene in different cells. TLR-4 gene is located on the surfaces of macrophages, neutrophils,

dendritic cells and natural killer cells. Neutrophils display several Toll-like

receptors on their surfaces.TLR-4 detects the lipopolysaccharide present on the

cell walls of gram – negative microbes. TLRs on the surfaces of macrophages

recognize microbial components, such as LPS, peptiglycans, and flagellin and

cytokine receptors detect cytokines released by other cells as part of the

inflammatory response (Janeway et al., 1999). Antigen-presenting cells (APC),

such as monocytes and dendritic cells (DCs), express TLR on their surface,

which recognize and bind these PAMPs and initiate a signalling pathway that

stimulates the host defences through the induction of reactive oxygen and

nitrogen intermediates (ROIs and RNIs) , respectively. The TLR-PAMP

interaction also initiates adaptive immunity as it activates APCs by inducing

production of pro- inflammatory cytokines and up- regulating co- stimulatory

molecules. Moreover , TLR signalling stimulates the maturation and migration

27

of APCs to the draining lymph nodes as observed in mice, although this

migration seems to be more constitutive in ruminants (Haig et al., 1999).

2.8.2 Neutrophils and TLR-4 gene Polymorph nuclear neutrophils (PMN) are key components of the first line

of defense against microbial pathogens (Babior, 1984). They contribute to the

early innate response by rapidly migrating into inflamed tissues, where their

activation triggers microbicidal mechanisms such as release of proteolytic

enzymes and antimicrobial peptides, and rapid production of reactive oxygen

species (ROS). PMN activation is initiated upon recognition of Ab- or

complement-opsonized particles (Greenberg and Grinstein 2002). PMN also

directly recognize microbial products via pattern recognition receptors such as

TLR (Medzhitov, et al., 1997). Ten human TLRs have so far been identified,

mediating responses to pathogen-associated molecular patterns (PAMPs)

shared by many microorganisms. Human PMN have been reported to express

all TLRs except TLR3 (Hayashi, et al., 2003). TLRs are members of the IL-1R

superfamily and share a common activation pathway mediated by their Toll/IL-

1R signaling domain, resulting in activation of NF-B and MAPK (Beutler, 2000).

Despite these shared pathways, TLRs probably show differences in their rate,

intensity, or efficiency of activation, involving unidentified mechanisms. Selective

pathways are reported to be triggered by some TLRs; in particular, TLR2, TLR4,

and TLR9 can activate the PI3K pathway (Yum, et al 2001; Strassheim, et al.,

2004). Activation of cell signaling cascades triggers immune responses leading

to pathogen eradication. PMN are usually short-lived immune cells, but the

prolongation of their life span is critical in their efficiency against pathogens

(Haslett, et al., 1994). PMN activation and survival is likely to be tightly regulated,

as the cytotoxic substances they release can damage adjacent healthy tissue

(Savill, et al., 2002). Many inflammatory mediators, including cytokines, regulate

cell survival by interfering with apoptosis (Murray et al., 1997; Moulding et al.,

1998; Cowburn et al., 2002). Regulation of PMN survival has been widely

studied but remains to be fully elucidated. Increase in TLR-4 expression in

neutrophils during bacterial infection reported by Wolfram et al. (2008) and

Goldammer et al. (2004).

28

CHAPTER –3

MATERIALS AND METHODS

MATERIALS AND METHODS

The present investigation was conducted on Karan-Fries crossbred cattle

reared at cattle yard, National Dairy Research Institute (NDRI) Karnal, Haryana,

India. The study was also conducted at field level reared by farmers of Darar and

Indri villages of Karnal District, Haryana from August 2010 till November, 2011.

3.1 Location of the study area and climate

Geographically Karnal is situated at an altitude of 250 meters above the

mean sea level (Indo-Gangetic alluvial plains) on 290 42// N latitude and 790 54// E

longitude. Darar village is situated at an altitude of 252 meters above the mean

sea level (Indo-Gangetic alluvial plains) on 290 41// N latitude and 790 53// E

longitude. Geographically Indri is situated at an altitude of 249 meters above the

mean sea level (Indo-Gangetic alluvial plains) on 290 42// N latitude and 790 54// E

longitude. The maximum ambient temperature of study area in summer goes up

to <42oC and minimum temperature in winter comes down to <4oC with a diurnal

variation in the order of 15-20oC. The annual rainfall is about 760 to 960 mm,

most of which is received during the month of July and August. Relative humidity

range from 41 to 85 percent (www. weather-forecast.com/locations/karnal).

3.2 Selection and grouping of experimental animals

Recently calved Karan Fries female cattle free from clinical reproductive

tract infections, clinical mastitis, any injury and of 2-3 Parity with Body weight

range 400-460 Kg and milk yield- (7-15 Kg/day) were selected under farm and

field conditions. The animals were monitored for reproductive performance post

partum and were grouped as follows. After selection, all the post partum cows

were monitored up to three consecutive services. Pregnancy diagnosis by rectal

palpation post 45-60 day after each service was done. Animals conceiving up to

three services were considered as regular breeders (RgB) and those that did not

conceive up to three services were considered as repeat breeders (RB). For

RgB group 6 animals were selected and for RB group 14 animals were selected

under both farm and field conditions. Based on conception rate further selected

RB group of animals was divided into two groups a) supplemented with

fermented yeast culture (RB-S) b) Non supplemented (RB-NS). To RB-S group

fermented yeast culture (Saccharomyces cerevisiae; Make Diamond XP) was

supplemented with concentrate @ 12 gm/animal twice daily (5.3 × 105 CFU/g)

during experimental period (21st - 40th week).

All animals were confirmed to be pregnant by 23rd week in RgB group,

where as in RB group none of the animals conceived to 3 services (by AI) till 21st

week under both farm and field conditions.

3.3 Chemicals, glassware and plasticware

Chemicals and utensils required for blood collection and chemical

analysis were purchased from Sisco Research Laboratories., New Mumbai.

3.4 Collection of blood samples

Blood (10 ml) was collected in sterile heparinised vacutainer tubes by

jugular vein puncture, posing minimum disturbance to the animal during

collection. Blood samples were collected at weekly intervals from selected

animals under both farm and field conditions. Blood samples from pregnant

animals were not taken after confirmation of pregnancy by rectal palpation. Immediately after collection, the samples were transported to the laboratory in

ice for further processing.

3.5 Feeding under farm and field conditions.

All cows were fed to meet the nutritional requirements as per NRC (1989)

standards. During postpartum period cows were fed ad lib (at least 15% in

excess of requirement) available green fodders, predominantly, Maize and Jowar

and to some extent Berseem, limited amount of wheat straw as roughage and

concentrates based on body weight and production level of milk. Concentrates

was fed to the individual cow in two major installments, first of which was offered

between 8.00 to 9.00 am. in the morning after weighing of residue left of the

previous day and the second installment was fed between 4.00-5.00 pm. in the

evening before filling their respective feeding manger with another installment of

fodder. Feeding schedule of individual animals was revised at monthly interval

and was reformulated on the basis of body weight of the animal and the milk

yield. The amount of feed and fodder and concentrate offered and residue left by

the individual animals were recorded daily and computed weekly.

30

Table 3.1 Details of experimental animals under farm conditions

Regular Breeder (RgB)

Sr. No. Animal No. Date of Calving Parity Body Weight (Kg)

1 6625 12.03.10 2 395

2 6751 16.04.10 2 415

3 6791 19.03.10 3 380

4 6880 02.05.10 3 400

5 6453 09.04.10 2 412

6 6741 11.04.10 3 392

NonSupplemented Repeat Breeder (RB-NS)

Sr. No. Animal No. Date of Calving Parity Body Weight( Kg)

7 6650 09.04.10 2 395

8 6817 12.03.10 2 401

9 6931 07.05.10 3 380

10 7045 11.03.10 3 400

11 7028 02.04.10 3 408

12 6333 08.04.10 2 392

13 6726 29.03.10 3 385

Supplemented Repeat Breeder (RB-S)

Sr. No. Animal No. Date of Calving Parity Body Weight(KG)

14 6647 21.03.10 2 400

15 6670 19.04.10 3 403

16 6903 25.03.10 2 397

17 6669 16.04.10 3 376

18 5853 02.05.10 2 407

19 6885 03.04.10 3 394

20 6553 30.03.10 3 389

Table 3.2 Details of experimental animals under field conditions

Regular Breeder (RgB)

Sr.

No. Animal No. Name of owner/village Date of Calving Parity

Body

Weight (Kg)

1 RgB 1 Joga Singh/Darar 12.06.10 3 386

2 RgB 2 Gurulal Singh/Darar 23.08.10 2 392

3 RgB 3 Rakesh Kumar/Darar 09.07.10 3 404

4 RgB 4 Deelip Singh/Darar 03.07.10 3 380

5 RgB 5 Amardeep Singh/Darar 09.08.10 2 406

6 RgB 6 Sompal Singh/Darar 11.07.10 3 384

Non Supplemented Repeat Breeder (RB-NS)

7 RB-NS 1 Jasvir Singh/Darar 19.06.10 2 397

8 RB-NS 2 Balvant singh/Darar 07.08.10 2 386

9 RB-NS 3 Amareet Pal/Darar 13.07.10 3 377

10 RB-NS 4 Darampal Singh/Darar 12.07.10 3 388

11 RB-NS 5 Malvinder Singh/Darar 23.08.10 3 376

12 RB-NS 6 Sompal Singh/Indri 24.06.10 2 392

13 RB-NS 7 Pawan Kumar/Indri 08.07.10 3 402

Supplemented Repeat Breeder (RB-S)

14 RB-S 1 Amanjeet Singh/Darar 16.06.10 2 393

15 RB-S 2 Harbhajan singh/darar 29.06.10 3 398

16 RB-S 3 Karnal Singh/Darar 11.07.10 3 409

17 RB-S 4 Raj Singh/Darar 18.08.10 2 394

18 RB-S 5 Pyarelal/Darar 25.07.10 3 391

19 RB-S 6 Rupesh Kumar/Indri 22.07.10 3 389

20 RB-S 7 Rajesh Kumar/Indri 28.08.10 2 381

Picture 3.1. RB-S animal under Darad village conditions

Picture 3.2 RB-S animal under Darad village conditions

Table 3.3 Composition of concentrate feed supplemented to animals

Components of concentrate Per 100 kg

Maize 30 parts

Deoiled mustard cake 25 parts

Soyabean extraction 10 parts

Wheat bran 10 parts

Deoiled rice bran 15 parts

Molasses 7 parts

Mineral mixture 2 parts

Common salt 1 part

3.6 Estimation of feed intake

The daily feed intake was estimated by subtracting the amount of refusals

from the amount of feed offered. During feeding trial, the amount of feed and

fodder and concentrate offered and residue left by the individual animals were

recorded daily and computed on weekly basis.

3.6.1 Analysis of feed and fodder samples

Samples of green fodders and concentrate mixture being fed and residues left

were analyzed for dry matter (DM) every week.

3.7 Recording of body weight

The body weight of the animals were recorded initially at start of experiment and

then at monthly intervals till the end of the experimental period under farm and

field conditions. Body weight of each animal was recorded early in the morning

between 7.30 am to 8.30 am on an electronic weighing scale before providing

feed to the animals.

3.8 Recording of milk yield

Milking of cows was mainly done by machine milking thrice daily at 5:00

am, 12: 00 noon and 7:00 pm, till the end of the experimental period under farm

and field conditions. The individual milk yields (kg) were recorded at each

milking.

31

3.9 Estimation of plasma parameters

3.9.1 Estimation of blood plasma haptoglobin (Hp):

Haptoglobin was estimated as per the instructions provided with ELISA

test kit (CUSABIO BIOTECH. CO. LTD., USA). The range for concentration of

standards varied from 15.6 ng/ml - 200 ng/ml. The minimum detectible

concentration of haptoglobin by this assay was estimated to be 0.1ng/ml.

3.9.2 Estimation of blood plasma lactoferrin

Lactoferrin was estimated as per the instruction provided with the kit

(Lactoferrin ELISA Quantification set, Belthyl Laboratories,Inc., USA). The range

for concentration of standards varied between 7.5 ng/ml to 500 ng/ml. The

minimum detectible concentration of Lactoferrin by this assay was estimated to

be 1.0 ng/ml.

3.9.3 Estimation of blood plasma insulin-like growth factor-1 (IGF-1)

IGF-1 was estimated as per the instructions provided with the kit Bovine

Insilin-like growth factor (IGF-1) ELISA kit, (CUSABIO BIOTECH CO. LTD,

USA). The range for concentration of standards varied between 3.12 ng/ml to

200 ng/ml. The minimum detectible concentration of IGF-1by this assay was

estimated to be 0.1ng/ml.

3.9.4 Estimation of blood plasma calcium

Plasma calcium was estimated with the help of Atomic absorption

Spectrophotometer (Model PU9100X Atomic Absorption Spectrophotometer,

Philips). The procedure described in AAS (1988) manual for preparation of stock

and standard solutions and choice of instrumental conditions were followed.

Principle

A solution containing small amount of mineral element is converted into

an atomic vapour, usually a flame. The flame breaks up the chemical bonds by

which molecules of specific element enabling individual atom to float freely.

Acetylene is used as fuel and air as oxidant. Specific hollow cathode lamp is

used for the determination of specific element. Thus, the light spectrum with

specific wavelength for minerals is emitted from mineral specific hollow cathode

32

0 10 20 30 40 50 60 700.0

0.5

1.0

1.5

Conc.(ng/ml)

O D

(nm

)

Figure 3.1 Standard curve for plasma IGF-1

0 250 500 750 1000 12500

1

2

3

4

5

Conc. of Hp (ng/ml)

OD

(nm

)

Figure 3.2 Standard curve for plasma Hp

lamp and allowed to pass through the vaporized sample. As a result, the light

source emitting radiation is absorbed by the vaporized sample and thus, there is

a decrease in the intensity of radiation which is measured by a detector. The

absorption of radiation energy is proportional to the concentration of the mineral

in the sample.

Preparation of reagents

Tri-acid mixture

Concentrated nitric acid (HNO3), perchloric acid (HClO4) and sulphuric

acid (H2SO4) were mixed in the ratio of 3:2:1, respectively to prepare tri-acid

mixture.

Working standard solution

Working standard solutions of Calcium (2-20ppm) was prepared by serial

dilutions using stock standard (1000ppm).

Working procedure

1. 1 ml of plasma sample was added to 5 ml of tri-acid mixture.

2. The contents were then kept on a hot plate and digested initially at low

temperature and later at higher temperature till the contents were clear

and perchloric acid fumes ceased to come out.

3. Upon cooling the clear solution was diluted with de-ionized water to a final

volume of 10 ml.

4. A blank was processed simultaneously by using the tri-acid mixture.

5. The instrument was set at zero density with the blank. Then, a series of

working standards were run in Atomic Absorption Spectrophotometer for

the preparation of the standard curve. Finally, the samples were run and

the readings (optical density value) were noted. The concentrations of

calcium were estimated with the help of regression equation from

standard curve.

3.9.5 Estimation of blood urea

The plasma urea was estimated according to protocol developed by

Rahmatulla and Boyde (1980).

33

Principle

Urea forms a complex with the Diacetyl monoxime reagent under hot

acidic conditions (H3PO4). The chemical reaction is stimulated by ferric ions and

is stabilized by thiosemicarbazide.

Urea + Diacetyl monoxime → Red colour complex

Thiosemicarbazide + Fe+

Preparation of reagents

1 Acid Ferric Solution - To 100 ml of concentrated phosphoric acid

(H3PO4; 85%) 300 ml of concentrated sulphuric acid (H2SO4; 97-98%) and 600

ml distilled water was added. Dissolved 100 mg of ferric chloride (Fecl3) in this

solution.

2 Diacetyl monoxime Thiosemicarbazide solution - Dissolved 500 mg of

Diacetyl monoxime (C4H7NO2) and 10 mg of Thiosemicarbazide (CH5N3S) in

distilled water and made to volume 100 ml.

Chromogenic Reagent- Mix two parts of reagent 1 with one part of reagent 2

immediately before use.

Working procedure

Deproteinisation of samples

To 0.2 ml of plasma sample, added 1.8 ml of 5% trichloroacetic acid

(TCA) solution in a centrifuge tube. Mixed well and centrifugd the samples for 10

min at 2000 rpm. After centrifugation, removed the precipitate and collected the

deproteinised samples in another test tube.

Plasma urea concentration

Take 0.2 ml of protein free sample and added 3 ml of chromogenic

reagent. Mixed well, boiled in water bath for 5 minutes. Cooled it at room

temperature and absorbance was read at 525 nm against a blank comprised of

distilled water (0.2 ml) and chromogenic reagent (3 ml).

34

Standard curve

Stock standard urea solution (500µg/ml) was prepared by dissolving 50

mg urea (NH2.CO.NH2) in 100 ml distilled water. Working standard (50 µg/ml)

was prepared by diluting 1 ml of stock with 9 ml of distilled water. Different

volumes of working standard 0.02 ml, 0.04 ml, 0.06 ml, 0.08 ml and 0.10 ml was

taken separately in test-tube and 0.18 ml, 0.16 ml, 0.14ml, 0.12 ml and 0.10 ml

of distilled water was added in respective tubes to make the volume upto 0.2 ml,

then 3 ml of chromogenic reagent was added to each test tube and mixed well.

The blank contained 0.2 ml, of distilled water and 3 ml of chromogenic reagent.

Tubes are then incubated in boiling water bath for 5 minutes exactly, and then

cooled to room temperature and absorbance was read against the blank at 525

nm. Absorbance was plotted against concentration to draw the standard curve.

Conc. of plasma total urea = OD value of unknown/OD value of standard ×

concentration of standard (mg/dl)

3.9.6 Estimation of blood glucose

Glucose in blood plasma was estimated by end-point o-Toluidine method

(Dubowski, 1962) and as given below:

Twenty µl of plasma aliquots were pipetted in 10×75mm test tubes, to

which 3.0 ml of glucose reagent was added. The tubes were then gently shaken

and kept in vigorous boiling water bath (1000 C) for exactly 8 minutes. The tubes

were removed quickly and cooled to room temperature by placing in cold water

for 3 min. The glucose was quantified using Specord 50 analyzer at 625 nm.

Along with each set of tubes, a series of tubes containing standard

glucose ranging from 20 mg/dl to 100 mg/dl were processed identically as for the

unknown tubes described above. In addition, a blank tube containing 20 µl

distilled water and 3 ml of glucose reagent was also added with each set of

estimations. Plasma glucose concentration was calculated from the plotted

graph.

Reagents

1. Trichloroacetic acid (C2HO2Cl3) solution (3% w/v): Dissolved 3 gm of TCA

in distilled water and made to volume upto100 ml.

35

2. O-Toluidine (CH3C6H4NH2) solution (6% v/v): Mixed 6 ml of O-Toluidine

with 94 ml glacial acetic acid (CH3COOH).

3. Glucose (C6H12O6) standard solution

4. Working standard = 1.2 mg/ml

a) The blood plasma, standards and blank were run according to the

protocol given below Table 3.4:

b) After making up to solutions with distilled water, tubes were kept in boiling

water bath for 8 minutes and then cooled under tap water.

c) Reading of absorbance was taken at 625 nm against reagent blank.

d) Plotted a standard curve and read the concentration of unknown sample.

Concentration of glucose (mg/100 ml) =

3.10 IN VITRO STUDY

3.10.1 Chemicals for in vitro study:

RPMI medium: Composition of RPMI -1640 medium given in Table 3.5

The pH of the resulting solution was adjusted to pH-7.2 with the help of IN

NaOH and filtered through 0.22 µm Millex – GV filter unit (Millipore). The medium

was aliquoted in sterilized 100 ml reagent bottles and stored at 4ºC in

refrigerator.

Dulbecco’s phosphate buffer solution: 9.4 gm DPBS (Powder) was dissolved

in 1000 ml water.

3.10.2 Chemicals for gene expression studies

50X Tris acetate buffer (TAE):

• Tris base-121g

• Glacial acetic acid-28.5 ml

• Sodium EDTA-18.6 g

Total volume was made to 500 ml with double distilled and autoclaved

water. The pH of solution was adjusted to 7.5. 50 X TAE buffer was stored at

room temperature.

sample OD × Concentration of standard × dilution factor × 100

standard OD

36

Table 3.4 Protocol for the estimation of plasma glucose

Reagent/solution (ml) Blank Plasma sample

Standard

1 2 3 4 5

Protein free sample - 0.2 - - - - -

Standard - - 0.04 0.08 0.12 0.16 0.20

Distilled water 0.20 - 0.16 0.12 0.08 0.04 0.00

O-Toluidine reagent 3.00 3.00 3.00 3.00 3.00 3.00 3.00

Table 3.5 Composition of RPMI -1640 medium

Ingredients Amount

RPMI – 1640 16.4 g

NaHCO3 2.10 g

Sodium pyruvate 110 mg

HEPES 5.26 g (50 mM)

Penicillin 61 mg (100 IV/ml)

Streptomycin 100 mg (100 µg/ml)

Amphoterecin 0.25 µg/ml

1 X TAE buffer: 2 ml of 50 X TAE buffer solution was diluted to 100 ml with

distilled water.

Ethidium bromide (10 mg/ml, stock): One EtBr tablet (100 mg) was dissolved

in 10 ml of DEPC treated water. Concentration of resulting solution was 10

mg/ml.

Ethidium bromide (0.5 µg/ml, working): EtBr was diluted 10 times (i.e.10 µl

EtBr stock was added to 90 µl DEPC treated water).Concentration after dilution

was 1000 µg/ml. 50 µl from working solution (1000 µg/ml) was added to 100ml

melted agarose gel to make 0.5 µg/ml.

Loading buffer: Loading buffer was prepared by dissolving 25 mg bromophenol

blue and 25 mg xylene cyanol in 10 ml of (aqueous) 50% glycerol.

1.5% Agarose: 1.5 g agarose was weighed and 100 ml of 1 X TAE buffer was

added. It was heated to dissolve and allowed to cool and EtBr in required

amount was added and poured on gel casting tray and was allowed to

polymerise.

0.1% DEPC water: Added 1ml DEPC to 1000 ml MilliQ water and mixed it

properly by vigorous shaking. It was incubated at 370C overnight and then

autoclaved twice at 15 psi for 45 min.

3.10.3 Separation and enumeration of neutrophils

All materials and reagents used for the isolation of blood PMN were

sterile. Isolation of PMN from peripheral blood was performed using hypotonic

lysis of erythrocytes as described by Mehrzad et al. (2001 and 2004). Briefly, 10

ml of heparinized blood was poured into the Falcon tubes and centrifuged (1000

X g, 15 min., 4°C); the plasma layer, buffy coat, and top layer of the blood-

packed cells were discarded. About 2.5 ml of the blood-packed cell was lysed by

adding 5 ml of double distilled water and gently mixed for 45 sec. using a

magnetic stirrer. After restoration of the isotonicity by addition of 2.5 ml of 2.7%

NaCl with gentle mixing for 60 sec., the suspension was centrifuged (1000 X g,

10 min., and 4°C). For the second lysis procedure, after resuspending of the

pellets in 2.5 ml of DPBS (without CaCl2 and MgCl2), 5 ml of double distilled

water was added and gently mixed for 30 sec., then 2.5 ml of 2.7% NaCl was

added, gently mixed for 60 sec., and centrifuged (1000 X g, 5 min., 4°C). The

37

remaining cell pellet was washed 3 times in PBS (300 X g, 10 min., 4°C) and the

final cell pellet was resuspended in RPMI media for further analysis. Cells were

counted in above described way.

The cell suspension (neutrophils and macrophages) was adjusted to 5 x

106 live cells/ml by the culture media (RPMI 1640) containing 10% FCS. 200 µl

of the diluted cell suspension per well in triplicate was placed in a 96 well flat

bottomed tissue culture plate. The cells were allowed to proliferate with

Zymosan (650 µg/ml) and NBT (250 µg/ml) concentrations that had been

determined previously to provide maximal stimulation of bovine phagocytes

(Chaudhury, 2009). In all the cases, final culture volume was 200 µl. The blank

wells consisted of 200 µl of culture media along with same concentrations of

NBT and zymosan. All cultures were allowed to incubate at 37oC in a humidified

CO2 incubator (95% air and 5% CO2) for 2h. After that OD was recorded at 540

nm multiwell scanning spectrophotometer (Microscan MS-5608A).

3.10.4 Determination of number of viable cells

Trypan blue exclusion method was used to determine the proportion of

viable cells in the separated neutrophils. This method is based on the principle

that since the dead cells take up the dye they appear blue whereas the live cells

appear colourless since they do not take up the dye. For finding out the

proportions of live and dead cells in the neutrophils cell suspension, a 50 µl

aliquot of the homogenous suspension was mixed with an equal amount of 0.4%

trypan blue solution (w/v). Haemocytometer chambers were charged with 10 µl

of the above mixture. This was done by touching the edge of the cover slip of the

haemocytometer with the pipette tip, allowing chambers to get filled by capillary

action. The number of colorless viable cells, which had not taken up the dye, and

blue dead cells which had taken up the dye, were counted in the four corner 1

mm squares in both chambers within 10 minutes of charging the

haemocytometer. With the cover slip in place, each corner of the

haemocytometer represents a total volume of 0.1 mm2 or 10-4 cm3. As 1 cm3 is

equivalent to approximately 1 ml, the cell concentration per ml was obtained as

follows.

38

Total cells per ml = Average count (viable + dead cells per square) x 2 (dilution

factor) x 104

The concentration of viable cells per ml was calculated as follows:-

Viable cell per ml = Average count of viable cells per square x 2 (dilution factor)

X 104

The total number of viable cells harvested was calculated as follows:-

Total viable cells = Concentration of viable cells per ml x the original volume of

suspension from which the aliquot was taken.

The cell viability was calculated as follows:-

Total viable cells Cell viability (%) = X 100 Total viable cells + total dead cells

The viability of blood neutrophils in different experiments was found to

range between 95-98% within 6h of processing and declined gradually

afterwards.

3.11 In vitro experiment

In experiment, relative expression of TLR-4 and FAS gene were studied in

blood neutrophils of regular and repeat breeder crossbred karan fries cows.

Glyceraldehydes 3-phosphate dehydrogenase (GAPDH) was kept as as house

keeping gene. For this, blood were collected from six animals of RgB group and

twelve animals of RB group. Blood samples (10 ml) were collected from these

animals into heperinized vaccutainer tubes during experimental period; they

were then subjected to neutrophil isolation as described above.

Then cell neutrophils was adjusted to 5 x 106 live cells/ml by the culture

media (RPMI 1640) containing 10% FCS. 200 µl of the diluted cell suspension

per well in triplicate was placed in a 96 well flat bottomed tissue culture plate.

Then Insulin-like Growth Factor-1 @ 100ng/ml was supplemented to

neutrophils isolated from six animals of repeat breeding group. All cultures were

allowed to incubated at 37oC in a humidified CO2 incubator (95% air and 5%

CO2) for 1hour and then processed further as described below.

39

3.11.1 Preparation of reagents and glassware for RNA isolation

All reagents were prepared in 0.1% DEPC treated sterilized milli Q water

and autoclaved at 1210C for 15 min at 15 lb pressure. All solutions were

prepared using RNase free glass wares and DEPC treated water. The chemicals

reserved for RNA work were handled with baked spatula. Wherever possible,

the solutions were treated with 0.1% DEPC for 12 hr at 370C and autoclaved.

Most of the times, sterile disposable plastic wares were used for the preparation

and storage of RNA. Beakers, tubes and other glass wares used for the RNA

work were treated with DEPC treated water (0.1% in milli Q water) and allowed

to stand for 2 hr at 370C and rinsed several times with sterile water and then

heated to 1000C for 2-3 hr. Disposable gloves were worn during the preparation

of materials and solutions used for the isolation and analysis of RNA.

3.11.2 Quality and quantity of RNA

Quality of RNA was checked by performing agarose gel electrophoresis.

Thirty ml of 1.5% agarose gel was used along with 3 µl EtBr for staining the

bands. It showed two clear sharp bands (28s and 18s). Concentration of RNA

was measured by using UV spectrophotometer.

3.11.3 RNA extraction from blood PMN cells

Total RNA from the blood neutrophils was extracted using Trizol method

as reported by Chonczynski and Sacchi, 1987. In brief, The cell suspension of

neutrophils which was isolated by method described elsewhere, was taken in a

2.0 ml centrifuge tube, 1ml of Trizol reagent (Invitrogen, USA) was added to it

and mixed by 4 to 5 times gentle pippeting. The homogenate was stored for five

minute at room temperature to permit complete dissociation of nucleoprotein

complexes. The lysate was supplemented with 200 μl chloroform per 1 ml of

Trizol reagent and the centrifuge tube was tightly capped and then shaken

vigorously for 15 sec. The resulting mixture was kept at room temperature for 15

min. The mixture was then centrifuged at 12,000 g for 15 min at 4°C, to separate

it into a lower red phenol-chloroform phase, inter phase and the colorless upper

aqueous phase. The aqueous phase was carefully transferred to a fresh tube

40

and RNA was precipitated from the aqueous phase by mixing with isopropanol at

the rate of 500 μl of isopropanol per 1ml of Trizol reagent used for the initial

homogenization. The mixture was incubated at room temperature for 10 min and

centrifuged at 10,000 g for 10 min at 4°C, to obtain RNA precipitate in the form of

a gel like or white pellet at the side and bottom of the tube. The RNA pellet was

washed twice with one ml of 75% ethanol by vortexing and subsequent

centrifugation at 7500 g for 5 min at 4°C. In cases, the RNA pellet got

accumulated at the side of the tube with a tendency to float; ethanol wash was

performed at 12,000 g. The RNA pellet was air dried for 15-30 min. A pellet was

dissolved in 25 μl of RNA storage solution and stored at -80°C for further use.

3.11.4 Quality checking of RNA by agarose gel electrophoresis

The 1.5% gel of high quality molecular biology grade agarose (Sigma

Chem. Co., USA) for molecular biology was prepared by dissolving the agarose

in 1X TAE buffer (pH 8.0) followed by heating in a microwave oven or by keeping

in boiling water bath. Ethidium bromide stock solution was added directly to

molten agarose solution at the rate of 0.5 µg/ml of gel volume before casting the

gel. The surface was leveled before pouring the gel. After complete setting of the

gel, the comb was removed carefully and the gel casting tray was placed in the

electrophoresis tanks containing 1X TAE (pH 8.0) buffer. The DNA samples

were mixed with 5 µl of tracking dye and were loaded slowly into the slots of

submarine gels using micropipette. Electrophoresis was carried out at 8 V/cm

for half an hour. After completion of electrophoresis, the gel was examined under

UV transilluminator.

DNase treatment (by Ambion®’s DNA free Kit)

• 0.1 v/v of DNase I buffer was added to the RNA and mixed gently.

• 1 µl rDNase I enzyme was then added to it, mixed and incubated at 37oC

for 30 mins.

• Then 2 µl DNase inactivation reagent was added and incubated for 2 mins

at room temperature (with occasional shaking).

• It was then centrifuged at 10000 x g for 2 mins.

41

• Upper phase (RNA) was carefully and very gently collected (without

touching or disturbing the white pellet) in a new vial and stored at -80oC

for further use.

3.11.5 Quantification of RNA

RNA was quantified by Nanodrop spectrophotometric analysis using the

convention that one absorbance unit at 260 nm wavelength equals 40 μg RNA

per ml. The ultra violet absorbance was checked at 260 and 280 nm for

determination of RNA concentration and purity. Purity of RNA was judged on the

basis of optical density ratio at 260:280 nm. The samples with acceptable purity

(i.e. ratio 1.65-2.0) were quantified using the following formula and used for

reverse transcription.

Concentration of RNA (μg/μl) = (OD 260 x Dilution factor x 40)/1000

3.11.6 Protocol for first strand cDNA synthesis:

First strand cDNA was prepared from 1µg of RNA using Novagen first

strand cDNA synthesis kit (La Jolla, CA) as follows:

1. In a sterile, RNase-free 1.5ml screw-cap microcentrifuge tube following

reagents were combined • 1 μg total RNA

• 0.5 μl (0.5μg) Oligo(dT)

• or 0.5 μl (50ng) Random Hexamers

• x μl Nuclease-free water

Total volume = 12.5 μl

2. It was incubated to 70°C for 10 minutes. This step helps to alleviate RNA

secondary structure and may allow more efficient priming and cDNA

synthesis.

3. Then it was chilled quickly on ice.

4. It was then centrifuged briefly to collect contents at the bottom of the

tube.

5. Then the remaining components for first strand cDNA synthesis were

added below

42

Figure 3.3 RT-PCR amplified products of TLR-4, Fas and House keeping genes on agarose gel 3%

• 4 μl 5X First Strand Buffer (5X = 250mM Tris-HCl, pH 8.3 at 25°C, 375mM

KCl, 15mM MgCl2) • 2 μl 100mM DTT

• 1μl dNTP Mix (10mM each)

• X μl Nuclease-free water

• 0.5 μl (100U) MMLV Reverse Transcriptase

Total volume = 20 μl

6. The reaction mixture was mixed gently by stirring with the pipet tip and

incubated at room temperature for 10 min before placing at 37°C.

Incubate at 37°C for 60 min. The reaction may be used directly for

amplification or stored at -20°C.

3.11.7 Primers

Specific primers for TLR-2, TLR-4, IL-8, β-actin and GAPDH were

designed to amplify a stretch of less than 200 bp preferably from the 3’ end of

cDNA. The sequence information of gene was retrieved from NCBI database

and suitable primers were designed using primer 3 web interfaces. Details of

primers were given in the table 3 6.

Table 3.6 Details of primers of target and housekeeping genes

Genes Sequence (5′→3′) Acc no. Size (bp)

Annealing Temp (0C)

TLR 4

F GGCATCATCTTCATCGTCCT R CTGGACTCTGGGGTTTACCA AY634630.1 178 59

Fas F- GAAGAGGAGGGACCACA R -TGGGGTGACCTATTGCT

JN380921.1

188 59

GAPDH*

F GGGTCATCATCTCTGCACCT R GGTCATAAGTCCCTCCACGA NM_001034034.1 176 59

*Glyceraldehydes 3-phosphate dehydrogenase

3.11.8 Reaction mixture for real-time PCR

Real-time PCR was performed by using SYBR Green. Reaction mixture

for all the genes, consisted crude first strand cDNA was diluted in 1:1 ratio and

was used for expression studies.

43

Table 3.7 Reaction mixture for Real-Time PCR Roche SYBR green (2X) 5 µl (1X)

Reverse and forward primers (10 µM each) 0.5 µl (0.5 µM each)

PCR grade water 3 µl

Template 1 µl

Reaction programme

Reaction programme for all the genes was as follows:

Table 3.8 Reaction programme for real time PCR Programme Steps Temperature Time Cycles

Initial denaturation - 95 0C 5 min 1

Extension Denaturation 95 0C 15 sec

45 Annealing 59 0C 15 sec Extension 72 0C 20 sec

Melting curve

Denaturation 95 0C 5 sec

1 Renaturation 65 0C 1 min

Final Denaturation 97 0C Continuous

mode Cooling - 40 0C 1 min 1

Melting peaks for all reactions were analyzed for the presence of primer

dimers or secondary structures (if any) in all samples.

Two housekeeping genes (GAPDH) used as reference gene for

normalization of target gene for relative quantification.

The expression of different genes in different samples was performed as:

ΔCP (experimental samples) = Cp (target gene of sample) – Reference index

ΔCP (calibrator) = Cp (target gene of calibrator) – Reference index

Where: Cp – Crossing point

Reference index = Mean (Cp GAPDH)

Fold expression level of all the genes for all the samples was calculated

as follows:

ΔΔCP (quantity of expression) = ΔCP (experimental samples) - ΔCP(calibrator)

expression= (2)–ΔΔCP

44

Figure 3.4 Amplification curve TLR-4

Figure 3.5 Amplification curve Fas

3.11.9 Statistical analysis of relative target gene expression

Generation of quantitative data by real-time PCR is based on the number

of cycles required for optimal amplification generated fluorescence to reach a

specific threshold of detection (the Quantification cycle) (Bustin et al., 2009). The

relative expression ratio of the target gene was tested for significance as per

method given by Pfaffl, (2001). 3.12 Statistical analysis

All statistical analysis were done using SYSTAT software package. Data

from different experiments are presented as Mean±SE. Significance was tested

within each group by one-way ANOVA with multiple comparisons. The Mean±SE

were analyzed by multiple t test between groups. The significance of Mean±SEM

values was tested by employing unpaired t test (Assuming unequal variance).

The correlation was tested by Spearman Rank Order Correlation.

45

CHAPTER –4

RESULTS AND DISCUSSION

RESULTS AND DISCUSSION

Although comparisons have been made between RgB and RB groups

from 4th week itself, animals were not classified as RB at this stage, they were

classified as RB at the end of 21st week of study tenure. All animals were

confirmed to be pregnant by 23rd week in RgB group, where as in RB group

none of the animal conceived to 3 consecutive services (by AI) post partum till

21st week under both farm and field conditions. In RgB group only two animals

were left by 19th week which were not confirmed pregnant. Supplementation of

fermented yeast culture to RB-S groups was initiated at 22nd week post partum

under both farm and field conditions. For first 21 week post partum RgB group

serve as control for RB group where as from 22nd week till 40th week of

experiment RB-NS serve as control for RB-S under both farm and field

conditions. Results for correlation studies are reported, only if they were

significant at least at P<0.05.

4.1 INSULIN-LIKE GROWTH FACTOR-1 (IGF-1)

4.1.1 Concentration of plasma Insulin-like growth factor-1 (ng/ml) in RgB and RB groups under farm conditions.

The Mean±SE concentration of plasma IGF-1 at weekly interval and

Mean±SEM values for RgB and RB groups under farm conditions is presented in

Table 4.1 and depicted in Figure 4.1.

Under farm conditions, at the beginning of experiment (4th week post

partum), level of plasma IGF-1 in RgB and RB groups was 73.14±2.34 and

69.35±3.81ng/ml respectively, the difference was not significant. The results in

the present study indicate concentration of plasma IGF-1 in RgB exhibited

increasing trend from initial week till 23rd week post partum. Within RgB group it

was observed that concentration of plasma IGF-1 increased significantly

(P<0.05) from initial value at 10th and 16th week post partum. It also increased

significantly (P<0.05) over initial value from 16th week post partum till end of

experiment. The percent increase in concentration of plasma IGF-1 over initial

value at 23rd week post partum in RgB groups was 26.1%. Similar increase was

observed in the concentration of plasma IGF-1 in RB group till 21st week post

46 Results & Discussion

partum but difference was not significant throughout the course of the

experiment. The percent increase in plasma IGF-1concentration over initial value

at 21st week post partum in RB groups was 7.74 %. When Mean±SE values for

concentration of plasma IGF-1 was compared between these two groups,

significant (P<0.05) greater concentration was observed in RgB group at all

week intervals except at 4th, 16th and 18th week post partum. The Mean±SEM

concentration of plasma IGF-1 for RgB and RB groups under farm conditions

was 85.31±2.22 and 72.79±2.46 ng/ml respectively, which was significantly

(P<0.05) greater in RgB when compared with RB group.

Concentration of plasma IGF-1 was significantly positively correlated with

concentration of plasma glucose, LF (P<0.01), calcium (P<0.05) and negatively

correlated (P<0.01) with concentration of plasma urea and Hp for RgB and RB

groups (Table 4.41).

4.1.2 Concentration of plasma Insulin-like growth factor-1 (ng/ml) in RB-S and RB-NS groups under farm conditions.


Mean±SEM values for RB-S and RB-NS groups under farm conditions is

presented in Table 4.2 and depicted in Figure 4.1.

From 22nd week, post partum when probiotic (Fermented yeast culture)

was supplemented concentration of plasma IGF-1 was observed to be

80.58±3.75 ng/ml and 79.83±2.67 ng/ml in RB-S and RB-NS group respectively.

An increasing trend in concentration of plasma IGF-1 was observed in RB-S

group whereas decreasing trend was observed in RB-NS group till 40th week

post partum. Within both RB-S and RB-NS group difference was not significant

from initial value throughout the course of the experiment. Concentration of

plasma IGF-1 in RB-S group increased to 85.54±0.39 ng/ml and in RB-NS group

deceased to 73.82±4.29 ng/ml over initial concentration at end of 40th week of

study. The percent increase in concentration of plasma IGF-1 over initial value

in RB-S group at end of experiment was 6.15 %. The percent decrease in

concentration of plasma IGF-1 over initial value in RB-NS group at end of

experiment was 7.52 %. When Mean±SE values for concentration of plasma

IGF-1 was compared between groups significantly greater (P<0.05)


Table 4.1 Concentration of plasma IGF-1(ng/ml) in RgB and RB groups under farm conditions.

Weeks RgB RB

4 73.14A ±2.34 69.35±3.81

5 76.23 a ±1.34 70.13b±2.36

6 81.48 a ±1.18 71.85±1.66

7 78.32 a ±1.91 70.72 b ±2.75

8 82.42 a±1.42a 69.09 b±0.95

9 83.03 a ±3.55 71.02 b ±3.52

10 87.63 Ba ±2.44 70.99 b ±2.75

11 84.34 a ±3.69 69.44 b ±1.06

12 81.84 a ±2.0Aa 71.21 b ±3.39

13 86.34 Ba ±1.02 73.81b±3.71

14 84.52 a±4.00 76.02 b±1.86

15 83.81a±2.27 73.66b±1.11

16 86.59B ±3.87 74.73±3.74

17 90.40 Ba ±2.45 71.06b±2.04

18 88.48 B±1.67 78.60±3.71

19 86.54 Ba ±2.61 77.41b±1.69

20 93.38Ba ±1.60 76.36b±1.66

21 91.67 Ba±2.21 74.72b±2.48

22 93.89B±1.60

23 92.23 B±1.31

Mean±SEM 85.31*±2.22 72.79±2.46

Values with different superscripts (A, B) are significantly different (P<0.05) from initial value within each group. Values with different superscripts (a, b) are significantly different (P<0.05) between RgB and RB groups. * P<0.05

concentration was observed in RB-S group from 33rd to 38th week post partum.

The Mean±SEM concentration of plasma IGF-1 in RB-NS and RB-S groups was

83.20±2.79 and 75.55±3.45 ng/ml respectively, which was significantly (P<0.05)

greater in RB-S when compared with RB-NS group.


plasma glucose, LF (P<0.01) and calcium (P<0.05) concentration and negatively

correlated (P<0.05) with concentration of plasma urea for both RB-S and RB-NS


4.1.3 Concentration of plasma Insulin-like growth factor-1 (ng/ml) in RgB and RB groups under field conditions.


Mean±SEM values for RgB and RB groups under field conditions is presented in


Under field conditions also, at the begining of experiment (4th week post

partum) level of plasma IGF-1 in RgB and RB groups was 79.91±2.10 and

69.94±0.85 ng/ml respectively. The results obtained in the present study

indicated that concentration of plasma IGF-1 exhibited an increasing trend from

initial concentration till 23rd week post partum in RgB group. The percent

increase in concentration of plasma IGF-1 by 23rd week post partum in RgB

group was 8.68%. Similarly, increasing trend in concentration of plasma IGF-1 in

RB group till 21th week post partum also observed. The difference was not

significant from initial value throughout the course of the experiment within both

RgB and RB groups. Plasma IGF-1 concentration in RB group at start of the

experiment was 69.94±0.85 ng/ml which increased to 73.71±3.09 ng/ml by 21st

week post partum. The percent increase in concentration of plasma IGF-1over

initial value at 21th week post partum in RB groups was 5.4 %. When Mean±SE

values for concentration plasma IGF-1 was compared between groups

significantly (P<0.05) greater concentration was observed in RgB group till end

of the experiment except at 8th and 21st week. The Mean±SEM concentration of

plasma IGF-1 for RgB and RB groups under farm conditions was 82.25±1.73 and

71.62±1.68 ng/ml respectively, which was significantly (P<0.05) greater in RgB

when compared with RB group.


Concentration of plasma IGF-1 was significantly positively correlated

(P<0.01) with concentration of plasma glucose, LF (P<0.01), calcium (P<0.05)

and negatively correlated (P<0.01) with concentration of plasma urea and Hp for

RgB and RB groups (Table 4.43).

4.1.4 Concentration of plasma Insulin-like growth factor-1 (ng/ml) in RB-S and RB-NS groups under field conditions.


Mean±SEM values for RB-S and RB-NS groups under field conditions is


At 22nd week post partum when probiotic was supplemented to RB-S

group concentration of plasma IGF-1 was 74.27±1.23 ng/ml and in RB-NS group

was 73.39±1.66 ng/ml. Within RB-S group, concentration of plasma IGF-1

increased from initial value but was significantly (p<0.05) greater only at 30th

week and further from 34th till 37th week. In RB-S group, concentration of plasma

IGF-1 exhibited increasing trend till 40th week. Concentration of plasma IGF-1 in

RB-S group increased to 83.94±1.41 ng/ml from the Mean±SE concentration at

22nd week post partum. The percent increase in plasma IGF-1 in RB-S group at

end of experiment was 13.02 %. In RB-NS group concentration of plasma IGF-1

did not increase significantly from initial value till end of experiment. In RB-NS

group only 2.7% increase was observed in concentration of plasma IGF-1 over

initial value. Concentration of plasma IGF-1 in RB-NS group varied between

72.29 and 77.10 ng/ml during the experimental period. Concentration of plasma

IGF-1 was significantly greater (P<0.05) in RB-S group at 25th, 29th, 33th, 34th,

35th and 40th weeks when compared with RB-NS group. The Mean±SEM

concentration of plasma IGF-1 in RB-NS and RB-S groups was 81.17±1.41 and

74.19±1.75 ng/ml respectively, which was significantly (P<0.05) greater in RB-S

when compared with RB-NS group.

Concentration of plasma IGF-1 was significantly positively correlated

(P<0.01) with plasma glucose, LF and calcium concentration and negatively

correlated (P<0.01) with concentration of plasma urea for RB-S and RB-NS



Table 4.2 Concentration of plasma IGF-1(ng/ml) in RB-S and RB-NS groups under farm conditions.

Weeks RB-S RB-NS

22 80.58±3.75 79.83±2.67

23 80.01±3.12 78.78±3.96

24 78.73±3.52 79.00±4.65

25 80.35±3.71 77.69±2.87

26 82.27±3.06 77.91±3.76

27 80.50±2.71 77.57±2.18

28 80.42±4.79 76.95±3.57

29 80.20±1.27 75.44±2.38

30 86.71±3.57 75.74±4.94

31 83.59 a±1.42 75.32b±2.98

32 84.21±2.79 76.89±4.87

33 85.34 a±2.60 71.9 b±3.33

34 81.21a±2.63 72.93b±4.51

35 86.62a±4.25 73.80b±2.42

36 86.23a±1.86 72.11b±2.33

37 86.94a±4.31 71.95b±4.37

38 86.68a±0.66 73.89b±2.07

39 84.75±3.37 73.93±3.34

40 85.54±0.39 73.82±4.29

Mean±SEM 83.20*±2.79 75.55±3.45

Values with different superscripts (a, b) are significantly different (P<0.05) between RB-S and RB-NS groups. * P<0.05

Table 4.3 Concentration of plasma IGF-1 (ng/ml) in RgB and RB groups under field conditions.

Weeks RgB RB

4 79.91a±2.10 69.94b±0.85

5 75.25a±2.20 68.92b±0.65

6 78.30a±2.23 71.44b±1.71

7 77.09a±3.16 68.71b±1.94

8 77.19±2.48 73.15±0.95

9 78.80a±0.55 70.01b±2.16

10 81.40a±1.12 73.18b±2.27

11 82.11a±1.56 68.43b±1.05

12 81.11a±1.21 69.80b±1.30

13 79.53a±2.71 70.20b±1.37

14 81.61a±4.03 71.76b±2.01

15 83.42a±1.79 72.45b±1.59

16 85.60a±1.17 71.18b±1.37

17 84.41a±0.72 70.89b±2.16

18 86.49a±2.12 74.99b±1.81

19 84.55a±1.51 75.50b±1.59

20 87.59 a±0.72 74.95b±2.27

21 86.29a ±2.12 73.71 b±3.09

22 87.51±0.35

23 86.85±0.71

Mean±SEM 82.25*±1.73 71.62±1.68

Values with different superscripts (a, b) are significantly different (P<0.05) between RgB and RB groups. * P<0.05

Table 4.4 Concentration of plasma IGF-1(ng/ml) in RB-S and RB-NS groups under field conditions.

Weeks RB-S RB-NS

22 74.27A±1.23 73.39±1.66

23 74.96 A ±1.05 75.41±0.99

24 78.14 A ±1.94 73.51±1.00

25 76.16 A a±2.16 74.28 b ±0.90

26 81.84 A ±0.74 74.47±0.98

27 80.31 A ±2.98 72.33±2.54

28 79.61 A ±2.16 74.81±1.09

29 79.43 A a±1.48 75.13b±1.00

30 83.06B±0.85 72.29±1.92

31 82.78 A ±2.08 72.45±1.60

32 79.58 A ±1.37 74.24±1.49

33 82.49 A a±1.10 72.46b±2.30

34 85.48Ba ±0.60 73.28b±1.81

35 83.83Ba±2.01 74.35b±2.08

36 84.42B±0.63 76.66±2.47

37 83.17B±1.78 77.10±2.94

38 85.82 A ±0.57 73.57 b±3.21

39 82.89 A ±0.71 74.57 b±2.17

40 83.94 a±1.41 75.39b±1.18

Mean±SEM 81.17*±1.41 74.19±1.75

Values with different superscripts (A, B) are significantly different (P<0.05) from initial value within each group. Values with different superscripts (a, b) are significantly different (P<0.05) between RB-S and RB-NS groups. * P<0.05

4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 4060

65

70

75

80

85

90

95

100RgB RB-S RB-NS

Weeks

Con

c. o

f pla

sma

IGF-

1(n

g/m

l)

Figure 4.1 Concentration of plasma IGF-1 in RgB and during pre and post supplementation period in RB-S and RB-NS groups under farm conditions.

4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 4060

65

70

75

80

85

90

95

100RgB RB-S RB-NS

Weeks

Con

c.of

pla

sma

IGF-

1(n

g/m

l)

Figure 4.2 Concentration of plasma IGF-1 in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions.

In the present study greater concentration of plasma IGF-1 was observed

in RgB when compared with RB group under both farm and field conditions. In a

variety of species (including farm animals, humans, and laboratory animals)

higher concentration of blood IGF-1 is found in young, well nourished, healthy

individuals (Jones and Clemmons, 1995;Thissen et al.,1994). Animals that are

old, diseased, or mal-nourished exhibited less concentration of plasma IGF-1

that reflect a compromised state of tissue, organ, and cell function (Jones and

Clemmons, 1995 Lucy et al., 1991; Thissen et al., 1994; McNall et al.,1995).

Several studies have established positive relationship between blood IGF-1

concentration and reproductive function of postpartum cattle. Thatcher et al.

(1996), Anandlaxmi et al. (2013) reported that anestrus dairy cows had lower

blood IGF-1 concentration when compared with cows that initiated estrous

cyclicity earlier during the postpartum period. A similar relationship was reported

for beef cattle, the postpartum anestrus cows had lower IGF-1 level when

compared with cyclic cows (Roberts et al., 1997). Blood IGF-1 was correlated

with follicular fluid IGF-1 because the majority of IGF-1 in follicular fluid was

derived from blood (Leeuwenberg et al., 1996). Beam and Butler (1999)

reported positive correlation among serum IGF-1, LH pulsatility and follicular

wave in post partum cows. Wathes (2008) reported that delay or failure of

conception in post partum dairy cows is associated with reduced IGF-1

concentration and also with concentration of urea in plasma.

Low level of IGF-1 and LF reflects lower immune status of repeat

breeding group when compared with regular breeder group. This is un

confirmation with the studies of Nickerson (1989), Oliver and Sordillo (1989) in

different physiological state. Therefore lower concentration of plasma IGF-1 may

be one of the reason for resulting in lower conception rate in RB group under

both farm and field conditions.

The positive correlation between plasma glucose and IGF-1 has also

been reported by Beam and Butler (1999). They observed that plasma level of

IGF-1 is directly related to energy status i.e. glucose and IGF-1 is critical for

ovarian follicular development. In our studies also similar results were observed.

The significant difference in concentration of plasma IGF-1 between RB-S and

RB-NS group as observed under both farm and field conditions, concentration of


plasma IGF-1 being higher in RB-S and RgB groups favored conception at an

earlier age when compared with their counterparts.

4.2 HAPTOGLOBIN (Hp)

4.2.1 Concentration of plasma Hp (ng/ml) in RgB and RB groups under farm Conditions.

The Mean±SE concentration of plasma Hp at weekly interval and


Table 4.5 and depicted in Figure. 4.3.

At the begining of experiment (4th week post partum) concentration of

plasma Hp in RgB and RB groups under farm conditions were 499.02±27.67and

763.47±28.86 ng/ml respectively. The results in the present study indicated that

within both RgB and RB groups there was significant (P<0.05) decrease in

Mean±SE values for concentration of plasma Hp from 7th week till end of the

experiment. The percent decrease in concentration of plasma Hp over initial

concentration at 13th week post partum in RgB groups was 52.56 % which was

maximum at 13th week. Similarly, decreasing trend in concentration of plasma

Hp in RB group till 21st week post partum also observed. Concentration of

plasma Hp in RgB group at the beginning of the experiment was 499.02±27.67

ng/ml which derceased to 290.24±13.43 ng/ml at 23rd week post partum. The

percent decrease in concentration of plasma Hp at 23rd week post partum over

initial value in RgB groups was 41.84 %. Concentration of plasma Hp in RB

group at 4th week was 763.47±28.86 ng/ml which decreased to

394.73±21.11ng/ml at 21st week post partum. The percent decrease in

concentration of plasma Hp at 21st week post partum over initial value in RB

groups was 48.29 %. In RgB group Mean±SE values for concentration of plasma

Hp was significantly less (P<0.05) when compared with RB group throughout the

course of the experiment. The Mean±SEM concentration of plasma Hp for RgB

and RB groups was 315.14±22.42 and 546.56±24.41 ng/ml respectively, which

was significantly (P<0.05) greater in RB when compared with RgB group. The

concentration of plasma Hp was within physiological range.

Concentration of plasma Hp was significantly positively correlated

(P<0.01) with concentration of plasma urea and negatively correlated (P<0.01)


Table 4.5 Concentration of plasma Hp (ng/ml) in RgB and RB groups under farm conditions.

Weeks RgB RB

4 499.02Aa±27.67 763.47Ab±28.68

5 447.02 A a±35.45 727.03 A b±10.86

6 421.86 A a±20.04 678.16 A b±39.92

7 347.86Ba±32.43 585.78Bb±40.50

8 372.86Ba±14.54 608.84Bb ±32.27

9 295.94Ba±12.29 580.43Bb±18.38

10 283.11Ba±23.40 587.26Bb±16.33

11 278.36Ba±14.39 565.69Bb±28.97

12 256.19 Ba ±32.68 527.94 Bb±24.93

13 236.27Ba±21.56 535.03Bb±31.49

14 254.60Ba±37.67 518.92Bb±14.28

15 296.35Ba±14.57 503.82Bb±28.01

16 263.93Ba±12.82 510.03 Bb ±13.51

17 278.35Ba±23.91 470.76Bb±23.06

18 318.85Ba±16.79 454.46Bb±19.57

19 309.85Ba±27.68 418.15Bb±31.11

20 264.08Ba±23.89 407.53Bb ±16.33

21 278.74Ba±19.68 394.73Bb±21.11

22 309.24B±23.46

23 290.24B±13.43

Mean±SEM 315.14±22.42 546.56*±24.41


Table.4.6 Concentration of plasma Hp (ng/ml) in RB-S and RB-NS groups under farm conditions.

Weeks RB-S RB-NS

22 412.14±18.38 422.9±25.54

23 398.93±31.11 411.52±37.73

24 386.52±12.26 411.37±13.91

25 389.16±27.12 410.82±36.88

26 385.25±18.57 424.31±25.07

27 375.36±36.97 444.56±11.11

28 366.35±25.46 425.08±37.98

29 361.35a±18.69 428.64b±22.09

30 350.22±25.57 424.33±43.27

31 350.84a±18.75 445.3 b±11.66

32 348.85±36.76 433.42±28.02

33 312.96a±10.92 420.53 b ±25.36

34 315.16±19.7 403.31±32.87

35 310.43±28.75 392.55±28.09

36 300.26a±12.22 389.37b±35.57

37 309.59±38.29 398.41±27.75

38 299.61a±26.67 390.33 b±17.93

39 305.78±31.49 380.71±34.41

40 295.73±17.82 374.75±27.51

Mean±SEM 346.03±23.97 412.22*±27.50


Table 4.7 Concentration of plasma Hp (ng/ml) in RgB and RB groups under field conditions.

Weeks RgB RB

4 478.14Aa ±27.27 705.56b±11.89

5 446.14 A a±32.06 708.72b±27.54

6 441.81 A a±43.88 690.25 b ±30.20

7 386.98 A a±27.92 699.87b±.1352

8 371.98 A a±36.82 690.93b±28.47

9 315.73Ba±27.95 630.52b±16.19

10 329.23 A a±40.84 599.3 b±38.38

11 297.48Ba±32.68 577.78Bb±24.57

12 315.31Ba±26.84 590.03b±13.24

13 281.39Ba±13.11 547.12Bb±33.62

14 289.01Ba±19.78 531.01Bb±19.00

15 315.76 A a±27.58 515.91 Bb ±13.71

16 273.34Ba±38.46 472.12Bb±24.99

17 297.76Ba±14.66 482.85 Bb±27.64

18 305.26Ba±23.21 464.55 Bb ±39.60

19 309.26 A a±35.56 430.24Bb±28.69

20 293.09Ba±27.25 417.62Bb±14.16

21 297.54 A a±32.35 446.82Bb±18.68

22 308.04 A ±20.41

23 309.04 A ±31.63

Mean±SEM 333.11±29.01 566.74*±23.56


with concentration of plasma LF, IGF-1(P<0.01), glucose and calcium (P<0.05)

for RgB and RB groups (Table 4.41).

4.2.2 Concentration of plasma Hp (ng/ml) in RB-S and RB-NS groups under farm conditions.


Mean±SEM values for RB-S and RB-NS under farm conditions is presented in

Table 4.6 and depicted in Figure. 4.3.

At 22nd week post partum when probiotic supplementation was initiated, in

RB-S group concentration of plasma Hp was 412.14±18.38 ng/ml whereas in

RB-NS group was 422.9±25.54 ng/ml. In both the groups, concentration of

plasma Hp decreased at 40th week of experiment. The values were not

significantly different from initial value throughout the course of the experiment

within RB-S and RB-NS groups. Concentration of plasma Hp in RB-S and RB-

NS at 40th week of experimental period was observed to be 295.73±17.82 and

374.75±27.51ng/ml respectively. The decrease observed in Hp concentration in

RB-NS group was less; hence the difference in the Mean±SE concentration of

Hp in this group at the end of 40th week was not significant when compared with

the Mean±SE Hp concentration at 22nd week. The percent decrease in plasma

Hp concentration over initial value in RB-S and RB-NS group at end of

experiment was 28.24 and 11.38 % respectively. When Mean±SE values for

concentration of plasma Hp was compared between groups, concentration was

significantly (P<0.05) less in RB-S group at 29th, 31st, 33rd, 36th and 38th week.

Mean±SEM concentration of plasma Hp in RB-S and RB-NS groups were

346.03±23.97 and 412.22±27.50 ng/ml respectively, which was significantly

(P<0.05) greater in RB-NS when compared with RB-S group.



with concentration of plasma LF for both the groups (Table 4.42).


4.2.3 Concentration of plasma Hp (ng/ml) in RgB and RB groups under field conditions.




Under field conditions, at the beginning of experiment (4th week post

partum), level of plasma Hp concentration in RgB and RB groups conditions was

478.14±27.27 and 705.56±11.89 ng/ml respectively. The results in the present

study indicate that concentration of plasma Hp when compared within RgB group

it was observed that Mean±SE values for concentration decreased significantly

(P<0.05) at 9th, 11th-14th, 16th-18th and 20th week post partum. The percent

decrease in plasma Hp concentration over initial value at 16th week post partum

in RgB groups was 42.83%, at which Mean± SE concentration of Hp was least.

The percent decrease in plasma Hp concentration over initial value at 23rd week

post partum in RgB groups was 35.4 %. Similar, decreasing trend in

concentration of plasma Hp in RB group from initial value till 21st week post

partum was recorded. Within RB group, concentration of plasma Hp decreased

significantly (P<0.05) at 11th and 13th week and further till end of the experiment.

Mean±SE concentration of plasma Hp in RB group at 1st week of the experiment

was 705.56±11.89 ng/ml which decreased to 446.82±18.68 ng/ml at 21st week

post partum. The percent decrease in plasma Hp concentration over initial value

at 21st week post partum in RB groups was 36.67 %. In RgB group,

concentration of plasma Hp was significantly less (P<0.05) when compared with

RB group throughout the course of the experiment. Mean±SEM concentration of

plasma Hp for RgB and RB groups was 333.11±29.01 and 566.74±23.56 ng/ml

respectively, which was significantly (P<0.01) greater in RB when compared with

RgB group.


(P<0.01) with concentration of plasma urea and negatively correlated with

concentration of plasma LF, IGF-1(P<0.01), glucose and calcium (P<0.05) for

both the groups (Table 4.43).


4.2.4 Concentration of plasma Hp (ng/ml) in RB-S and RB-NS groups under field conditions.

The Mean±SE plasma Hp concentration at weekly interval and



Within RB-S and RB-NS groups Mean±SE values for concentration of

plasma Hp exhibited decreasing trend but difference were not significant from

initial value throughout the course of the experiment. In RB-S group, plasma Hp

concentration decreased to 314.54±12.83 ng/ml by 40th week post partum over

the initial value. The percent decrease observed was 25.85 %. Mean±SE in RB-

NS group plasma Hp concentration increased to 424.83±23.54 ng/ml from

416.5±25.39ng/ml. A 2 % percent increase was observed in plasma Hp

concentration over initial value in RB-NS group at end of experiment. When

Mean±SE values for concentration of plasma Hp was compared between

groups, the concentration was significantly less (P<0.05) at 30th, 32nd- 38th and

40th week interval in RB-S group. The Mean±SEM concentration of plasma Hp

RB-NS and RB-S groups was 364.36±23.35 and 430.01±26.82 ng/ml

respectively, which was significantly (P<0.05) greater in RB-NS when compared

with RB-S group.



with concentration of plasma lactofferrin for both the groups (Table 4.44).

Results obtained indicated that significant greater (P<0.01) concentration

of plasma Hp was present in RB group when compared with RgB under both

farm and field conditions. Hence, the results indicated that greater concentration

of plasma Hp (P<0.01) prevailed in repeat breeding animals when compared

with their counterpart. To the best of our knowledge no reports are available on

plasma level of Hp in repeat breeding animals under tropical conditions.

Although the Mean±SE concentration of plasma Hp in RB and RB-NS group was

significantly higher than their counterparts, the concentration of plasma Hp under

farm or field conditions was observed to be within physiological range (300-

500ng/ml) (Horadagoda et al., 1999; Anand Laxmi et al.,2013) in cows and does


not indicate pathological condition. Under pothological conditions it is reported to

increase in microgram range (Horadagoda et al., 1999). It indicates mild stress

or inflammation in the mentioned groups. Higher plasma Hp concentration at an

earlier stage post partum may be due to inflammatory condition persisting at

earlier stage which decreased later on as reflected by Hp concentration. Higher

plasma Hp concentration in cows with post partum reproductive problems has

been reported by Chan et al. (2004) and Petersen et al. (2004). It was concluded

that Hp seems to be a promising marker of health status by reflecting a broad

spectrum of ongoing clinical as well as subclinical diseases in cows. A low

concentration of plasma Hp in RgB group suggests healthy status of group as

supported by Uchida et al. (1993), who suggested that, only a less concentration

of Hp was detectable in normal bovine serum. This may be one of the reasons

due to which RgB group animals might have concieved ≤3 services. Lower

concentration of plasma Hp in RgB group indicates good health which might

have resulted in conception in less than 3 consecutive services under both farm

and field conditions. Number of investigations indicate the ability of Hp as

unspecific markers of clinical and subclinical infections, to discriminate between

acute and chronic disease and for prognostic purposes, since the duration and

magnitude of the response reflect the severity of the disease and the effect of

treatment (Skinner et al., 1991; Horadagoda et al., 1999; Hultén et al., 1999;

Petersen et al., 2002; Hultén and Demmers, 2002; Lauritzen et al., 2003). Higher

concentration of plasma Hp in RB group suggests subclinical infection or

stress due to which it resulted in delay in conception when compared with RgB

and RB-S groups under both farm and field conditions.

Saini and Webert (1991), reported that plasma Hp was considered to be

involved in dynamic process, involving systemic and metabolic changes

providing an early non-specific defence mechanism against infection before

specific immunity is achieved.

To best of our knowledge this is the first investigation which shows the

effect of Probiotic (Saccharomyces cerevisiae) supplementation to repeat

breeding crossbred cows under farm and field conditions. Different studies

revealed beneficial effect of S. cerevisiae on rumen pH, nutrient availability and

health of ruminant (Callaway and Martin, 1997; Kumar et al., 1997; Dann et al.,


Table 4.8 Concentration of plasma Hp (ng/ml) in RB-S and RB-NS groups under field conditions.

Weeks RB-S RB-NS

22 424.23±26.03 416.50±25.39

23 401.02±17.61 435.12±31.19

24 423.61±24.72 425.64±27.97

25 421.25±11.04 432.32±29.78

26 439.71±28.45 425.81±35.62

27 403.82±25.04 437.73±27.84

28 398.81±12.11 416.58±14.45

29 383.81±28.01 425.14±26.37

30 372.75a±25.89 425.83b±36.10

31 343.37±11.38 446.81±28.73

32 341.38 a±34.88 422.03 b±25.35

33 325.49 a±29.59 410.81b±19.16

34 317.69 a±36.47 444.92b±28.73

35 327.96 a±26.06 431.13b±26.27

36 310.29 a±18.20 425.83b±20.44

37 312.12 a±34.12 446.81b±33.48

38 336.42 a±14.14 444.92 b±11.44

39 324.59±27.07 431.43±37.51

40 314.54a±12.83 424.83b±23.54

Mean±SE 364.36±23.35 430.01*±26.82


4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40200

300

400

500

600

700

800RgB RB-S RB-NS

Weeks

Con

c. o

f pla

sma

Hp

(ng/

ml)

Figure 4.3 Concentration of plasma Hp in RgB and during pre and post supplementation period in RB-S and RB-NS groups under farm conditions.

4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40200

300

400

500

600

700

800RgB RB-S RB-NS

Weeks

Con

c.of

pla

sma

Hp

(ng/

ml)

Figure 4.4 Concentration of plasma Hp in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions.

2000). This improvement in health status of animal is reflected parttially due to

the significant lower concentration of plasma Hp in RB-S group when compared

with RB-NS group under farm and field conditions.

4.3 LACTOFERRIN (LF)

4.3.1 Concentration of plasma LF (ng/ml) in RgB and RB groups under farm conditions.

The Mean±SE concentration of plasma LF at weekly interval and

Mean±SEM values for RgB and RB groups under farm conditions is presented

in Table 4.9 and depicted in Figure 4.5.


partum) level of plasma LF in RgB and RB groups under farm conditions was

248.33±18.40 and 203.84±25.43 ng/ml respectively. Within RgB group it was

observed that Mean±SE values of plasma LF concentration increased

significantly (P<0.05) only at 17th and 19th week post partum over the initial

value. The results in the present study indicated that concentration of plasma LF

in RgB exhibited an increasing trend from initial value till 23rd week.

Concentration of plasma LF in RgB group at start of the experiment was

248.33±18.40 ng/ml which increased to 376.97±24.54ng/ml at 23rd week post

partum. The percent increase in concentration of plasma LF over initial value at

23rd week post partum in RgB groups was 51.80 %. Similarly, increase in trend

in concentration of plasma LF from initial value till 21st week post partum of RB

group was observed. In RB group, concentration of plasma LF increased but

was not significantly different from initial value till end of experiment.

Concentration of plasma LF in RB group at start of the experiment was

203.84±25.43 ng/ml which increased to 305.06±17.35 ng/ml at 21st week post

partum. The percent increase in concentration of plasma LF over initial value at

21st week post partum in RB groups was 49.65 %. Concentration of plasma LF

was significantly higher (P<0.05) in RgB group at 6th, 10th, 12th, 13th, 15th and 18-

20th weeks when compared with RB group. The Mean±SEM concentration of

plasma LF for RgB and RB groups under farm conditions was 329.68±22.09 and

250.56±22.08 ng/ml respectively, which was significantly (P<0.01) greater in

RgB when compared with RB group.


Concentration of plasma LF was significantly positively correlated with

concentration of plasma IGF-1, glucose (P<0.01), calcium (P<0.05) and

negatively correlated (P<0.01) with concentration of plasma urea and Hp for RgB

and RB groups (Table 4.41).

4.3.2 Concentration of plasma LF (ng/ml) in RB-S and RB-NS groups under farm conditions.





group concentration of plasma LF was 288.39±24.57 ng/ml and in RB-NS

group was 301.92±17.25 ng/ml. Within both RB-S and RB-NS group difference

in concentration was not significant from the initial value till end of the

experiment. In RB-S group, concentration of plasma LF exhibited increasing

trend till the end of experiment. The percent increase in concentration of plasma

LF over initial value in RB-S group at end of experiment (at 22nd week) was

31.01 %. In RB-NS group change observed at 22nd week for concentration of

plasma LF from initial value was not significant. The range of concentration of

plasma LF in RB-NS group varied between 281.36 and 308.73 25 ng/ml during

the experimental period. Only 2 % increase in concentration of plasma LF over

initial value in RB-NS group at end of experiment was recorded. When Mean±SE

values for concentration of plasma LF was compared between groups, values

were significantly (P<0.05) greater in RB-S group at 29th, 31st- 35th and 37th

week. The Mean±SEM concentration of plasma LF in RB-S and RB-NS groups

was 345.41±20.55 and 296.24±21.32 ng/ml respectively, which was significantly

(P<0.05) greater in RB-S when compared with RB-NS group.

Concentration of plasma LF was significantly (P<0.01) positively

correlated with concentration of plasma IGF-1 and negatively correlated with

concentration of plasma urea (P<0.01) and Hp (P<0.05) for both RB-S and RB-

NS groups (Table 4.42).


Table 4.9 Concentration of plasma lactoferrin (ng/ml) in RgB and RB groups under farm conditions.

Weeks RgB RB

4 248.33A±18.40 203.84±25.43

5 256.83 A ±27.99 193.96±27.44

6 294.83a±22.63 190.13b±16.18

7 302.80 A ±23.83 234.67±29.18

8 270.17 A ±18.53 210.84±26.11

9 281.97 A ±21.55 229.84±13.99

10 317.47 A a±8.29 209.34 b±24.18

11 293.05 A ±27.99 254.67±14.73

12 339.93 A a±25.57 260.84b±21.90

13 350.02 A a±19.99 259.84b±25.18

14 313.72 A ±12.09 269.14±23.99

15 335.47 A ±18.50 277.70±24.50

16 362.10 A a±29.09 286.90b±16.18

17 376.18B±12.68 287.65±33.99

18 359.68 A a±18.06 278.23b±26.75

19 375.76Ba ±17.83 266.47b±14.85

20 391.85 A a ±17.50 290.99b±15.55

21 375.67 A ±23.95 305.06±17.35

22 370.77 A ±32.89

23 376.97 A ±24.54

Mean±SEM 329.68*±22.09 250.56±22.08


Table 4.10 Concentration of plasma lactoferrin (ng/ml) in RB-S and RB-NS groups under farm conditions.

Weeks RB-S RB-NS

22 288.39±24.57 301.92±17.25

23 293.14±16.18 287.78±22.76

24 310.47±23.29 282.95±25.94

25 332.42±18.23 306.82±15.84

26 326.35±16.15 312.57±27.34

27 351.59±35.22 304.15±16.15

28 322.14±25.76 305.57±25.19

29 326.38 a±27.35 300.66 b ±23.60

30 362.22±26.42 281.36±27.35

31 348.70 a±18.93 272.77b±26.42

32 376.26 a ±15.70 291.97b±28.93

33 373.76 a ±21.93 302.55b±16.70

34 361.50 a±23.76 282.79b±15.18

35 376.05 a ±18.70 290.40b±12.99

36 360.37±17.47 308.73±24.50

37 371.22 a±14.70 300.11b±16.14

38 360.69±13.34 288.90±31.96

39 343.41±15.66 298.58±16.20

40 377.82±17.07 308.02±14.49

Mean±SEM 345.41*±20.55 296.24±21.32


4.3.3 Concentration of plasma LF (ng/ml) in RgB and RB groups under field conditions.




Under field conditions, at the begining of experiment (4th week post

partum) concentration of plasma LF in RgB and RB groups under field conditions

was 259.11±21.31 and 187.11±24.56 ng/ml respectively. Mean±SE values for

concentration exhibited an increasing trend but difference was not significant

from initial value throughout the course of the experiment in both RgB and RB

groups. The results in the present study indicate that concentration of plasma LF

in RgB showed an increasing trend till 23rd week post partum. The percent

increase in concentration of plasma LF over initial value at 23rd week post

partum in RgB groups was 43.63 %. Similarly, inceasing trend in concentration

of plasma LF in RB group from initial week till 21st week post partum was

recorded. Concentration of plasma LF in RB group at beginning of the

experiment was 187.11±24.56 ng/ml which increased to 302.86±24.93 ng/ml at

21st week post partum. The percent increase in concentration of plasma LF over

initial value at 21st week post partum in RB group was 61.86%. When Mean±SE

values of plasma LF concentration was compared between groups, values were

significantly (P<0.05) greater for RgB group at 7th, 9th, 15th and 20th week. The

Mean±SEM concentration of plasma LF for RgB and RB groups under farm

conditions was 345.41±20.55 and 296.24±21.32 ng/ml respectively, which was

significantly (P<0.01) greater in RgB when compared with RB group.

Concentration of plasma LF was significantly positively correlated with

concentration of plasma IGF-1, glucose (P<0.01), calcium (P<0.05) and

negatively (P<0.01) correlated with concentration of plasma urea and Hp in RgB

and RB groups (Table 4.43).


4.3.4 Concentration of plasma LF (ng/ml) in RB-S and RB-NS groups under field conditions.





group concentration of plasma LF was 317.96±26.12 ng/ml and in RB-NS

group was 322.54±29.18 ng/ml. Within RB-S and RB-NS groups difference was

not significant from the initial value throughout course of the experiment. In RB-S

group, concentration of plasma LF exhibited increasing trend till the end of

experiment. Concentration of plasma LF in RB-S group increased to

392.39±24.07 ng/ml. The percent increase in concentration of plasma LF over

initial value in RB-S group at end of experiment was 23.40 %. In RB-NS group

no significant change was recorded in concentration of plasma LF over initial

value. The range of concentration plasma of LF in RB-NS group varied between

294.81 and 335.96 ng/ml during the experimental period. When Mean±SE

values for concentration of plasma LF was compared between groups,

significantly (P<0.05) greater values were observed in RB-S group at 26th, 30th,

35th- 37th week. The Mean±SEM concentration of plasma LF in RB-S and RB-NS

groups was 368.69±22.27 and 315.43±22.76 ng/ml respectively, which was

significantly (P<0.05) greater in RB-S when compared with RB-NS group.

Concentration of plasma LF was significantly positively correlated

(P<0.01) with concentration of plasma IGF-1 and negatively correlated with

concentration of plasma urea (P<0.01) and Hp (P<0.05) for RB-S and RB-NS


Results obtained in present study indicated that significant (P<0.01)

greater concentration of plasma LF in RgB was present when compared with RB

group under both farm and field conditions. Under both farm and field conditions

concentration of plasma LF in RgB and RB groups was within the normal

physiological range. Results of present study were in accordance with those of

Maaks et al. (1989) reported the normal range i.e. as 0.4–2 mg/l under normal

conditions. In present study animals selected were free from clinical infection.


Table 4.11 Concentration of plasma lactoferrin (ng/ml) in RgB and RB groups under field conditions.

Weeks RgB RB

4 259.11±21.31 187.11±24.56

5 270.41±26.31 188.41±27.57

6 279.61±22.99 217.61±35.18

7 269.92a±15.85 207.92 b ±22.07

8 263.59±27.05 201.59±25.18

9 280.69a±18.10 218.69 b ±14.24

10 269.59±28.71 207.59±19.29

11 290.17±22.00 228.17±27.42

12 277.59±30.95 215.59±18.83

13 319.21a±22.06 217.21b±18.18

14 290.84±33.91 228.84±20.85

15 309.12 a ±17.49 247.12 b ±15.18

16 331.29±26.72 269.29±20.02

17 336.04±35.88 274.04±24.43

18 328.87±25.88 266.87±22.18

19 345.79±27.25 283.79±27.50

20 341.04 a ±19.11 279.04 b±14.43

21 364.86±14.95 302.86±24.93

22 379.96±24.08

23 372.16±12.25

Mean±SEM 308.99*±23.65 235.65±22.34


Table 4.12 Concentration of plasma lactoferrin (ng/ml) in RB-S and RB-NS groups under field conditions.

Weeks RB-S RB-NS

22 317.96±26.12 322.54±29.18

23 310.16±18.26 313.4±27.66

24 333.54±25.29 320.1±26.42

25 325.99±34.27 315.97±22.70

26 346.09 a±15.18 310.22 b±20.44

27 357.33±28.26 304.8±14.13

28 375.54±26.18 298.22±26.90

29 376.79±31.18 294.81±25.35

30 386.29 a±13.80 302.92 b±15.33

31 370.77±24.96 320.01±23.50

32 387.5±32.67 297.54±27.83

33 376.33±18.83 309.21±26.96

34 397.23±19.67 332.38±26.64

35 395.12 a±21.57 321.19 b±20.98

36 401.11 a±15.59 334.99 b±16.99

37 381.95 a ±10.50 316.37b±22.56

38 391.43±15.35 335.96±16.21

39 381.64±21.21 318.5±14.82

40 392.39±24.07 324.01±24.21

Mean±SEM 368.69*±22.27 315.43±22.76


5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41100

150

200

250

300

350

400

450

500RgB RB RB-NS

Weeks

Con

c. o

f pla

sma

Lact

ofer

rin(n

g/m

l)

Figure 4.5 Concentration of plasma LF in RgB and during pre and post supplementation period in RB-S and RB-NS groups under farm conditions.

5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41100

150

200

250

300

350

400

450

500RgB RB-S RB-NS

Weeks

Con

c. o

f pla

sma

Lact

ofer

rin(n

g/m

l)

Figure 4.6 Concentration of plasma LF in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions.

Concentration of plasma LF in RgB and RB remained within normal physiological

range under both farm and field conditions. It is reported that there is 100 fold

increase in concentration of plasma LF during severe inflammation and under

some pathological conditions. It depends on the severity of the condition

(Bennett and Kokocinski, 1978; Maaks et al., 1989).

LF modulates functions of lymphocytes such as cytokine gene activation

(Crouch et al.,1992), cytotoxicity (Shau et al.,1992), B and T cell maturation and

a number of immunopotentiating activities have been ascribed to LF (Zuccotti et

al.,2006). Low level of IGF-1 and LF reflects lower immune status of repeat

breeding groups when compared with regular breeder groups. This is in

confirmation with the reports of Nickerson (1989), Oliver and Sordillo (1989). LF

exhibits diverse biological activities in activation of innate immunity (Miyauchi et

al., 1998). Hence, lower concentration of plasma LF in RB when compared with

RgB group may indicate weaker health and immune status of former group

under both farm and field conditions. This may also be one of reason for reduced

conception rate in RB group under both farm and field conditions.

Chaucheyras et al. (1995), Gattass et al. (2008), Soccol et al. (2010)

reported that S. cerevisiae had the ability to provide growth factors such as

organic acids (methionine and lysine) and vitamins, improving the number of

beneficial rumen microflora, inhibiting growth of pathogens and stimulating

immune function. As probiotic (Saccharomyces cerevisae) shows the positive

effect on immunity of animal which may be one of the reason for significant

greater concentration of plasma LF in RB-S group when compared with RB-NS

group under farm and field conditions. In the present study, supplementation of

fermented yeast culture which is rich source of amino acids and vitamins might

have improved the health status of RB-S group.

4.4 GLUCOSE

4.4.1 Concentration of plasma glucose (mg/dl) in RgB and RB KF cows post partum under farm conditions.

The Mean±SE concentration of plasma glucose at weekly interval and





partum) level of plasma glucose in RgB and RB groups under farm conditions

was 52.56±0.85 and 50.87±0.21 mg/dl respectively. Within RgB and RB groups,

Mean±SE values for concentration of plasma glucose exhibited increasing trend

but difference was not significant from initial value throughout the course of the

experiment. Concentration of plasma glucose ranged between 52.56 and 54.96

mg/dl in RgB group. Similarly in RB group during the experimental period up to

21st week it ranged between 50.87 and 53.26 mg/dl. When Mean±SE values for

concentration of plasma glucose was compared between groups, concentration

was significantly (P<0.05) greater in RgB group from 7th week except at 9th, 16th,

19th and 20th week. The Mean±SEM concentration of plasma glucose for RgB

and RB groups under farm conditions was 53.98±0.45 and 51.97±0.46 mg/dl

respectively, which was significantly (P<0.05) greater in RgB when compared

with RB group.

Concentration of plasma glucose was significantly positively correlated

(P<0.01) with plasma IGF-1, LF (P<0.01), calcium (P<0.05) and negatively

correlated (P<0.05) with plasma concentration of urea and Hp for both RgB and

RB groups (Table 4.41).

4.4.2 Concentration of plasma glucose (mg/dl) in RB-S and RB-NS groups under farm conditions.





group concentration of plasma glucose was 52.13±0.36 mg/dl and in RB-NS

group was 52.19±0.016 mg/dl. After supplementation of probiotic to RB-S group,

concentration of plasma glucose increased significantly (P<0.05) from initial

value from 27th week post partum till the end of the experiment. Within RB-NS

group concentration of plasma glucose did not change significantly from the

initial value till end of experiment. Concentration of plasma glucose ranged

between 52.11and 52.80 mg/dl in RB-NS group during the experimental period.

Concentration of plasma glucose was significantly greater (P<0.05) in RB-S


Table 4.13 Concentration of plasma glucose (mg/dl) in RgB and RB groups under farm conditions.

Weeks RgB RB

4 52.56a±0.85 50.87±0.21

5 52.88 a±0.37 51.16±0.77

6 53.27a±0.71 51.53±0.35

7 52.73 a±0.16 51.09 b±0.31

8 53.40 a±0.50 51.29 b±0.46

9 53.02 a±0.67 51.58±0.16

10 53.32 a±0.37 51.19 b±0.37

11 53.59 a±0.48 51.56 b±0.48

12 54.12 a±0.27 51.95 b±0.76

13 53.89 a±0.15 51.95 b±0.20

14 54.55 a±0.57 52.84 b±0.35

15 54.79 a±0.26 52.79 b±0.52

16 54.60 a±0.78 52.74±0.46

17 54.40 a±0.31 52.80 b±0.55

18 54.66 a±0.55 51.93 b±0.69

19 54.96 a±0.50 53.26±0.71

20 54.92 a±0.24 52.64 b±0.14

21 54.80 a±0.67 52.27±0.75

22 54.49±0.38

23 54.61±0.26

Mean±SEM 53.98*±0.45 51.97±0.46


group from 25th weeks post partum till the end of experiment. The Mean±SEM

concentration of plasma glucose in RB-S and RB-NS groups was 53.76±0.37

and 52.11±0.38 mg/dl respectively, which was significantly (P<0.05) higher in

RB-S when compared with RB-NS group.


(P<0.01) with plasma IGF-1, LF and calcium concentration and negatively

correlated with concentration of plasma urea and Hp for RB-S and RB-NS


4.4.3 Concentration of plasma glucose (mg/dl) in RgB and RB groups under field conditions.





partum) level of plasma glucose in RgB and RB groups under field conditions

was 52.47±0.47 and 50.38±0.69 mg/dl respectively. Within both RgB and RB

groups, Mean±SE values for concentration of plasma glucose exhibited

increasing trend but difference was not significant from initial value throughout

the course of the experiment. Concentration of plasma glucose ranged between

52.38±0.69 and 54.91±0.62 mg/dl in RgB group during 23 weeks of experimental

period. Similarly concentration of plasma glucose in RB group ranged between

50.38±0.69 and 52.72±0.41 mg/dl. When Mean±SE values for concentration of

plasma glucose was compared between groups, significantly (P<0.05) higher

concentration was observed in RgB group at 4th, 5th, 8th,9th , 11th , 14th , 16-19th

and 21st week post partum. The Mean±SEM concentration of plasma glucose for

RgB and RB groups under farm conditions was 53.68±0.44 and 51.76±0.43

mg/dl respectively, which was significantly (P<0.05) greater in RgB when

compared with RB group.

Concentration of plasma glucose was significantly (P<0.01) positively

correlated with concentration of plasma IGF-1, LF, calcium and negatively

(P<0.01) correlated with concentration of plasma urea and Hp for both RgB and



4.4.4 Concentration of plasma glucose (mg/dl) in RB-S and RB-NS groups under field conditions.





group concentration of plasma glucose was 52.16±0.28 mg/dl and in RB-NS

group was 51.98±0.22 mg/dl. Mean±SE values for concentration exhibited

increasing trend but difference was not significant from initial value throughout

the course of the experiment in RB-S and RB-NS groups. After supplementation

of probiotic to RB-S group plasma glucose concentration increased to

54.41±0.18 mg/dl over initial value. Plasma glucose concentration ranged

between 51.63±0.51 and 52.96±0.28 mg/dl in RB-NS group throughout the

experimental period. When Mean±SE values of plasma glucose concentration

was compared between groups, significantly (P<0.05) greater values were

observed in RB-S group at 34th and further from 38-40th week. The Mean±SEM

concentration of plasma glucose in RB-S and RB-NS groups was 53.39±0.41

and 52.48±0.34 mg/dl respectively. Concentration of plasma glucose was

significantly (P<0.05) greater in RB-S when compared with RB-NS group.


(P<0.01) with concentration of plasma IGF-1, LF and calcium and negatively

correlated with concentration of plasma urea and Hp for both RB-S and RB-NS


Results of present study indicated significant higher concentration of

plasma glucose in RgB group when compared with RB group under both farm

and field conditions. It is reported by Richards et al. (1989) that higher blood

glucose concentration increases progesterone production by increasing pulse

and mean concentration of LH which would be one of the reasons for RgB and

RB-S groups to conceive earlier. JoeArosh et al. (1998) suggested that

hypoglycemic condition in repeat breeder causes impaired hypothalamic

hypophysial ovarian axis and reduces ovarian activity. Number of studies show

relation between plasma glucose and ovarian function (Highshoe et al., 1991;


Table 4.14 Concentration of plasma glucose(mg/dl) in RB-S and RB-NS groups under farm conditions.

Weeks RB-S RB-NS

22 52.13 A±0.36 52.19±0.01

23 52.39 A ±0.50 51.86±0.71

24 52.98 A ±0.70 51.95±0.38

25 52.60 A a±0.72 52.25 b±0.11

26 53.32 A a±0.62 52.00b±0.40

27 53.35 Ba±0.38 52.32 b±0.71

28 53.85 Ba±0.06 52.71 b±0.42

29 54.47 Ba±0.22 52.11 b±0.13

30 53.76Ba±0.78 52.90 b±0.52

31 54.30Ba±0.11 51.77 b±0.61

32 53.78Ba±0.35 52.4 b±0.28

33 54.46 Ba±0.24 51.99b±0.33

34 54.07Ba±0.38 51.90b±0.17

35 54.13Ba±0.20 51.87b±0.49

36 54.17Ba±0.28 52.80b±0.28

37 54.46Ba±0.48 51.53b±0.51

38 54.46Ba±0.26 51.92b±0.55

39 54.19Ba±0.17 51.70b±0.47

40 54.61Ba ±0.29 51.97b±0.23

Mean±SEM 53.76*±0.37 52.11±0.38

Values with different superscripts (A, B) are significantly different (P<0.05) from initial value within each group. Values with different superscripts (a, b) are significantly different (P<0.05) between RB-S and RB-NS groups. * P<0.05

Table 4.15 Concentration of plasma glucose (mg/dl) in RgB and RB groups under field conditions.

Weeks RgB RB

4 52.47a±0.47 50.38 b±0.69

5 52.69 a±0.30 50.57 b±0.80

6 52.38±0.69 51.21±0.71

7 52.86±0.47 51.14±0.73

8 52.51±0.47 51.51±0.65

9 53.15a±0.60 51.04b±0.66

10 52.93±0.37 51.80±0.39

11 53.71a±0.46 51.58b±0.23

12 53.23±0.26 52.06±0.47

13 54.10±0.60 52.03±0.14

14 53.70 a±0.47 52.01 b ±0.29

15 53.92±0.68 52.45±0.37

16 54.13 a±0.37 52.12 b±0.30

17 53.85 a±0.50 52.31 b±0.40

18 54.41a±0.28 52.01b±0.23

19 54.73a±0.14 52.19b±0.19

20 54.24±0.60 52.72±0.41

21 54.91a±0.62 52.47b±0.10

22 54.75±0.36

23 54.87±0.22

Mean±SEM 53.68*±0.44 51.76±0.43


Table 4.16 Concentration of plasma glucose (mg/dl) in RB-S and RB-NS groups under field conditions.

Weeks RB-S RB-NS

22 52.16±0.28 51.98±0.22

23 52.72±0.11 51.63±0.51

24 52.13±0.47 52.63±0.44

25 52.51±0.65 52.17±0.33

26 52.34±0.44 52.62±0.56

27 52.73±0.33 51.90±0.38

28 53.09±0.52 52.42±0.21

29 53.36±0.66 52.59±0.18

30 53.24±0.62 52.78±0.58

31 53.46±0.56 52.96±0.28

32 53.64±0.27 52.40±0.47

33 53.74±0.57 52.78±0.38

34 53.78a±0.13 52.89b±0.31

35 54.27±0.38 52.45±0.28

36 54.30±0.55 52.79±0.37

37 54.02±0.42 52.80±0.19

38 54.24a±0.41 52.60b±0.28

39 54.34a±0.48 52.39b±0.34

40 54.41a±0.18 52.36b±0.13

Mean±SEM 53.39*±0.41 52.48±0.34


4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 4040

45

50

55

60

65

70

RgB RB-S RB-NS

Weeks

Conc

. of p

lasm

a G

luco

se(m

g/dl

)

Figure 4.7 Concentration of plasma glucose in RgB and during pre and post supplementation period in RB-S and RB-NS groups under farm conditions.

4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 4040

45

50

55

60

65

70

RgB RB-S RB-NS

Weeks

Conc

. of p

lasm

a G

luco

se(m

g/dl

)

Figure 4.8 Concentration of plasma glucose in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions.

Wehrman et al., 1991; Stewart et al., 1995; Rabiee et al., 1997). Miyoshi et al.

(2001) suggested that cows with higher concentration of plasma glucose will

have better ovarian activity. Even though concentration of plasma glucose was

not significantly different but practically, concentration of 50.38±0.69mg/ml in RB

group at 4th week of experiment, had negative effect on reproductive function.

Hence in the present study, RB group of animals had lower glucose

concentration which might have affected ovarian activity and might have

decreased conception rate. This might be one of the reason of infertility in repeat

breeding groups under both farm and field conditions. The finding of this study

are in accordance with the earlier reports by Jani et al. (1995) who observed

high incidence of repeat-breeding and anoestrous problem associated with the

low plasma glucose level. The present findings are also in agreement with El-

Belely (1993) who suggested that lower level of plasma glucose might be the

reason for reduced luteal function in repeat breeding cows. A contradictory

report (Kapadia et al., 2013) is also available stating no significant difference in

concentration of plasma glucose when compared between RgB and RB groups.

Action of Saccharomyces cerevisiae like oxygen uptake, supply of growth

factors and pH stabilization synergistically act for growth of rumen microbes.

Saccharomyces cerevisiae directly stimulated rumen fungi, which may improve

fiber digestion (Chaucheryas et al., 1995). Nisbet and Martin (1991), Gattass et

al. (2008) reported increase in glucogenic VFA production in rumen of cows

supplemented with Saccharomyces cerevisiae in comparision to RB-NS group.

Glucogenic VFA converts into glucose on metabolism. These mechanisms may

explain the significant (P<0.05) greater concentration of plasma glucose in RB-S

group when compared with RB-NS group under farm and field conditions.

4.5 UREA

4.5.1 Concentration of plasma urea (mg/dl) in RgB and RB groups under farm conditions.

The Mean±SE concentration of plasma urea at weekly interval and





partum) level of plasma urea in RgB and RB groups was 22.29±1.40and

26.03±1.34 mg/dl respectively. Within both RgB and RB groups, Mean±SE

values for concentration exhibited increasing trend but difference was not

significant from initial value till end of the experiment. The results in the present

study indicate that concentration of plasma urea in RgB decreased from initial

value to16.14±1.02 by 23rd week post partum. The percent decrease in

concentration of plasma urea over initial value at 23rd week post partum in RgB

groups was 27.6%. Concentration of plasma urea in RB group at start of the

experiment was 26.03±1.34 mg/dl which decreased to 21.03±0.92 mg/dl at 21st

week post partum. The percent decrease in concentration of plasma urea over

initial value at 21st week post partum in RB groups was 19.2%. When Mean±SE

values for concentration of plasma urea was compared between groups,

significantly (P<0.05) less concentration was observed in RgB group at 5th, 12th,

13th, 17th and 21st week. The Mean±SEM concentration of plasma urea for RgB

and RB groups was 18.6±1.30 and 22.53±1.18 mg/dl. Concentration of plasma

urea was significantly (P<0.01) greater in RB group when compared with RgB

group.

Concentration of plasma urea was significantly positively correlated

(P<0.01) with concentration of plasma Hp and negatively correlated (P<0.01)

with plasma concentration of LF, IGF-1(P<0.01), glucose and calcium (P<0.05)

for both RgB and RB groups (Table 4.41).

4.5.2 Concentration of plasma urea (mg/dl) in RB-S and RB-NS groups under farm conditions.





group concentration of plasma urea was 21.09±1.31 mg/dl whereas in RB-NS

group was 22.55±1.32 mg/dl. Within both RB-S and RB-NS groups,

concentration of plasma urea exhibited decreasing trend but difference was not

significant from initial value till 40th week of experiment. Concentration of plasma


Table 4.17 Concentration of plasma urea (mg/dl) in RgB and RB groups under farm conditions.

Weeks RgB RB

4 22.29±1.40 26.03±1.34

5 21.75a±0.81 25.31b±1.28

6 22.01±1.47 25.32±1.18

7 20.71±0.89 24.11±1.28

8 21.16±0.94 24.21±1.23

9 21.94±0.79 24.23±0.98

10 20.66±0.64 23.42±2.23

11 18.80±1.47 22.49±0.40

12 17.82a ±0.91 21.62 b ±1.28

13 17.92a ±2.26 20.90 b±1.61

14 16.72±1.57 20.68±1.18

15 17.45±0.90 20.33±1.28

16 17.41±1.92 20.99±1.27

17 16.67a±0.92 21.22 b±0.34

18 17.97±2.27 21.95±0.81

19 17.03±1.54 20.62±1.42

20 16.24±1.27 21.07±1.25

21 15.43a±0.82 21.03 b±0.92

22 15.97±2.15

23 16.14±1.02

Mean±SEM 18.6±1.30 22.53**±1.18

Values with different superscripts (a, b) are significantly different (P<0.05) between RgB and RB groups. ** P<0.01

urea in RB-S group decreased to 15.93±0.36 mg/dl and in RB-NS group

deceased to 21.19±0.94 mg/dl over initial value at 40th week. The percent

decrease in RB-S and RB-NS groups at end of experiment was 24.46 and 6.03

% respectively. When Mean±SE values for concentration of plasma urea was

compared between groups, concentration was significantly (P<0.05) less in RB-

S group from 32nd till end of the experiment except at 38th and 39th week. The

Mean±SEM concentration of plasma urea in RB-S and RB-NS groups was

18.23±1.28 and 22.41±1.13 mg/dl respectively. Concentration of plasma urea

was significantly (P<0.05) greater in RB-NS when compared with RB-S group.



with concentration of plasma of IGF-1(P<0.05) and Lactofferrin (P<0.01) for both

RB-S and RB-NS groups (Table 4.42).

4.5.3 Concentration of plasma urea (mg/dl) in RgB and RB groups under field conditions.





partum) level of plasma urea in RgB and RB groups under field conditions was

23.92±1.23 and 25.55±1.10mg/dl respectively. The results in the present study

indicate that Mean±SE values for concentration decreased significantly (P<0.05)

from initial value from 17th-20th week post partum when compared within RgB

group. The percent decrease in concentration of plasma urea over initial value in

the plasma samples collected at 23th week post partum in RgB groups was

34.33%. Similarly, declining trend in concentration of plasma urea in RB group

from initial value till 21th week post partum was observed. Within in RB group

concentration of plasma urea decreased but difference was not significant from

initial value throughout the course of the experiment. Plasma urea concentration

in RB group at start of the experiment was 25.55±1.10 mg/dl decreased to

20.95±0.93 mg/dl at 21th week post partum. The percent decrease in plasma

urea concentration over initial value at 21th week post partum in RB groups was


18%. When Mean±SE values of plasma urea concentration was compared

between groups, significantly (P<0.05) less value was observed for RgB group at

8th, 11th, and further from 18th – 21st week. The Mean±SEM concentration of

plasma urea for RgB and RB groups was 18.55±1.21 and 23.03±1.13 mg/dl.

Concentration of plasma urea was significantly (P<0.05) greater in RB when

compared with RgB group.


(P<0.01) with concentration of plasma Hp and negatively correlated with

concentration of plasma of IGF-1, LF, glucose (P<0.01) and calcium (P<0.05) for

RgB and RB groups (Table 4.43).

4.5.4 Concentration of plasma urea (mg/dl) in RB-S and RB-NS groups under field conditions.

The Mean±SE concentration of plasma urea collected at weekly interval

and Mean±SEM values for RB-S and RB-NS groups under field conditions is



group, concentration of plasma urea was 21.07±0.64mg/dl and in RB-NS group

was 21.71±0.95 mg/dl. Within RB-S and RB-NS groups, concentration of plasma

urea exhibited decreasing trend till the end of experiment tenure but the

difference was not significant from the initial value till 40th week. Plasma urea

concentration in RB-S group decreased to 16.10±1.03 mg/dl and in RB-NS

group decreased to 22.08±1.36 mg/dl over initial value. The percent decrease in

concentration of plasma urea from its initial concentration in both RB-S and RB-

NS groups at the end of the experiment were 23.58 and 1.7 % respectively.

When Mean±SE values for concentration of plasma urea was compared

between group, values were significantly (P<0.05) less for RB-S group from 29th

week till end of the experiment. The Mean±SEM concentration of plasma urea in

RB-S and RB-NS groups was 18.02±1.8 and 22.68±1.10 mg/dl respectively.

Concentration of plasma urea was significantly (P<0.05) greater in RB-NS when

compared with RB-S group.




Table 4.18 Concentration of plasma urea (mg/dl) in RB-S and RB-NS groups under farm conditions.

Weeks RB-S RB-NS

22 21.09±1.31 22.55±1.32

23 20.83±1.28 22.58±0.53

24 20.35±1.35 23.28±1.27

25 21.42±2.14 23.07±1.24

26 20.82±1.28 23.75±1.43

27 20.93±1.39 22.42±0.92

28 19.87±1.28 22.88±0.99

29 20.00±1.27 22.80±1.24

30 18.27±1.21 22.08±1.28

31 17.80±1.37 23.20±1.20

32 16.88a±1.37 22.37b±1.55

33 16.06a±2.22 23.37b±1.45

34 16.38a±1.16 22.22b±0.95

35 16.34a±0.94 22.10b±1.15

36 15.73a±1.21 21.81b±1.31

37 16.79a±1.21 20.98b±0.21

38 15.55±0.12 20.98±1.23

39 16.32±1.01 22.24±1.26

40 15.93a±0.36 21.19b±0.94

Mean±SEM 18.23±1.28 22.41*±1.13


Table 4.19 Concentration of plasma urea (mg/dl) in RgB and RB groups under field conditions.

Weeks RgB RB

4 23.92A±1.23 25.55±1.10

5 22.75 A ±1.97 24.78±1.08

6 21.71 A ±1.31 23.94±1.44

7 22.41 A ±0.98 24.64±1.07

8 21.06 A a±1.27 24.74b±0.71

9 20.39 A ±2.12 24.76±0.52

10 19.32 A ±1.60 23.25±1.36

11 18.70 A a±1.93 23.98b±0.98

12 18.52 A ±0.82 22.05±1.42

13 17.40 A ±2.71 21.43±1.44

14 17.66 A a±1.21 23.13b±0.63

15 17.09 A a±0.96 22.15 b±1.48

16 17.22 A a±1.32 21.44 b±1.10

17 16.53 Ba±1.28 21.80 b±1.33

18 16.60 Ba ±1.28 22.39 b±0.95

19 15.44 Ba ±0.94 20.95 b±1.30

20 16.07 Ba±1.32 22.62 b±2.26

21 16.35 A a±0.95 20.95 b ±0.93

22 15.24 A ±1.30

23 15.71 A ±1.02

Mean±SEM 18.55±1.21 23.03*±1.13


Table 4.20 Concentration of plasma urea (mg/dl) in RB-S and RB-NS groups under field conditions.

Weeks RB-S RB-NS

22 21.07±0.64 21.71±0.95

23 21.36±1.14 22.63±2.30

24 19.82±0.99 22.24±2.20

25 20.92±1.30 22.62±1.23

26 21.35±0.94 22.85±0.96

27 18.81±1.42 22.58±1.51

28 19.59±0.65 21.54±2.45

29 19.47 a±1.30 23.78±1.30

30 17.57a±1.35 22.30 b±0.90

31 17.38a±2.18 22.36b±1.05

32 16.33a±1.37 23.51b±2021

33 17.95 a±0.81 22.57b±1.45

34 15.85a±2.16 23.36b±0.91

35 15.91a±1.24 23.28b±1.21

36 16.71a±0.94 22.89b±2.76

37 17.17a±1.18 24.14b±0.95

38 17.12a±0.94 22.20b±0.49

39 14.93a±1.06 22.28 b±1.17

40 16.10a±1.03 22.08 b±1.36

Mean±SEM 18.02±1.8 22.68*±1.10


5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 4110

20

30

40

RgB RB-S RB-NS

Weeks

Conc

.of p

lasm

a Ur

ea(m

g/dl

)

Figure 4.9 Concentration of plasma urea in RgB and during pre and post supplementation period in RB-S and RB-NS groups under farm conditions

4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 4010

15

20

25

30

RgB RB-S RB-NS

Weeks

Conc

. of P

lasma

Ure

a(m

g/dl)

Figure 4.10 Concentration of plasma urea in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions.

with concentration of plasma of IGF-1 (P<0.05) and Lactofferrin (P<0.01) for both

RB-S and RB-NS groups (Table 4.44).

In the present study concentration of plasma urea was greater in RB

when compared with RgB group under both farm and field conditions. The

results are in accordance with (WestWood et al., 1998) who reported negative

relationship between concentration of plasma urea and conception rate in cattle.

Number of studies reported negative relationship between plasma concentration

of urea and pregnancy rate (Elrod and Butler, 1993; Elrod et al., 1993; Ferguson

et al. 1993; Dhali et al., 2006). According to Dhali (2001) greater serum or

plasma urea nitrogen concentration reduces LH binding to ovarian receptors and

reduces or delays ovulation. It has been observed that increased concentration

plasma urea may interfere with the normal inductive actions of progesterone on

the microenvironment of the uterus and, thereby, cause suboptimal conditions

for support of embryo implantation (Hamman et al., 2000; Papadopoulas et al.,

2001). As delayed ovulation and inability of embryo implantation are the reasons

of repeat breeding in cattle. In RB group plasma level of urea was greater than

the physiological level, which might have altered uterine pH level and further

development of embryo. Higher concentration of plasma urea may be one of the

causes for repeat breeding under both farm and field conditions.

In the present study negative correlation was observed between plasma

glucose and urea which is in confirmation with other studies of Westwood et al.

(1998), Shingu et al. (2009) and Shehab-el-deen (2011).

4.6 CALCIUM

4.6.1 Concentration of plasma calcium (mg/dl) in RgB and RB groups under farm conditions.

The Mean±SE concentration of plasma calcium at weekly interval and


Table 4.21 and depicted in figure 4.11.


partum) concentration of plasma calcium in RgB and RB groups was 9.44±0.26

and 9.12±0.30 mg/dl respectively. Within both RgB and RB groups, Mean±SE



significant from initial value throughout the course of the experiment. The

percent increase in concentration of plasma calcium post partum in RgB group

was 15.9 %. Concentration of plasma calcium in RB group at the beginning was

9.12±0.30 mg/dl which increased to 9.64±0.18 mg/dl by 21st week post partum.

Only 0.52 mg/dl increase was observed in concentration of plasma calcium by

21th week post partum in RB group. When Mean±SE values for concentration of

plasma calcium was compared between groups, significantly (P<0.05) greater

concentration was observed for RgB group at 14th, 15th, 18th, 19th and 21st week.

The Mean±SEM concentration of plasma calcium for RgB and RB group under

farm conditions was 10.36±0.28 and 9.52±0.27 mg/dl respectively. Concentration

of plasma calcium concentration was significantly (P<0.05) high in RgB when


Concentration of plasma calcium was significantly positively correlated

with concentration of plasma IGF-1, LF (P<0.05), glucose (P<0.01) and

negatively correlated with concentration of plasma urea (P<0.01) and Hp

(P<0.05) for RgB and RB groups (Table 4.41).

4.6.2 Concentration of plasma calcium (mg/dl) in RB-S and RB-NS groups under farm conditions.



presented in Table 4.22 and depicted in figure 4.11.


group, concentration of plasma calcium was 9.73±0.30 mg/dl and in RB-NS

group was 9.79±0.31mg/dl. Mean±SE values for concentration of plasma

calcium exhibited increasing trend but difference was not significant from initial

value till 40th week in RB-S and RB-NS groups. In RB-S group, concentration of

plasma calcium increased from 22nd to 40th week post partum. Concentration of

plasma calcium in RB-S group increased to 10.50±0.29 mg/dl. The percent

increase in concentration of plasma calcium from 22nd to 40th week post partum

in RB-S and RB-NS group was 7.9 % and 1.73 % respectively. When Mean±SE

values of RB-S and RB-NS group was compared, difference was not significant

throughout the course the experiment. The Mean±SEM concentration of plasma


Table.4.21 Concentration of plasma calcium (mg/dl) in RgB and RB groups under farm conditions.

Weeks RgB RB

4 9.44±0.26 9.12±0.30

5 9.61±0.36 9.01±0.20

6 9.54±0.30 9.14±0.30

7 9.71±0.21 9.31±0.26

8 9.64±0.44 9.34±0.31

9 10.09±0.40 9.49±0.20

10 10.25±0.28 9.42±0.39

11 10.50±0.43 9.73±0.13

12 10.57±0.33 9.67±0.31

13 10.61±0.18 9.91±0.36

14 10.70a±0.25 9.57 b±0.10

15 10.50a±0.11 9.69 b ±0.17

16 10.52±0.36 9.49±0.40

17 10.72±0.36 9.79±0.24

18 10.94a±0.14 9.76 b±0.20

19 10.50a±0.13 9.57 b±0.34

20 10.81±0.36 9.73±0.40

21 10.82a±0.34 9.64 b±0.18

22 10.76±0.23

23 10.94±0.17

Mean±SEM 10.36*±0.28 9.52±0.27


calcium in RB-S and RB-NS groups was 10.29±0.32 and 9.96±0.25 mg/dl

respectively. The concentration of plasma calcium was not significantly different

between the groups.


(P<0.05) with concentration plasma IGF-1 for RB-S and RB-NS groups (Table

4.42).

4.6.3 Concentration of plasma calcium (mg/dl) in RgB and RB groups under field conditions.



Table 4.23 and depicted in figure 4.12.


partum) concentration of plasma calcium in RgB and RB groups under field

conditions was 9.02±0.20 and 8.95±0.28 mg/dl respectively. The result in the

present study indicated that plasma calcium concentration in RgB group

increased from initial value till 23rd week but was significantly (P<0.05) different

from initial value only at 19th and 20th week post partum. The percent increase in

plasma calcium concentration over initial value at 23rd week post partum in RgB

groups was 19.3 %. Within RB group, concentration of plasma calcium did not

increase significantly from initial value till the end of experiment. Concentration of

plasma calcium in RB increased from 8.95±0.28 mg/dl to 9.55±0.13 mg/dl at 21st

week post partum. The percent increase in plasma calcium concentration at 21st

week post partum in RB groups was 6.7 %. When Mean±SE values of

concentration of plasma calcium was compared between groups, significantly

higher (P<0.05) values were observed for RgB group from 11th week till the end

of the experiment. The values were not significant except at 12th, 14th and 16th

weeks. The Mean±SEM concentration of plasma calcium for RgB and RB groups

under field conditions was 9.98±0.27 and 9.28±0.21 mg/dl respectively.

Concentration of plasma calcium was significantly (P<0.05) higher in RgB when


Concentration of plasma calcium was significantly (P<0.05) positively

correlated with concentration of plasma IGF-1, LF and glucose and negatively


correlated (P<0.05) with concentration of plasma urea and Hp for both RgB and


4.6.4 Concentration of plasma calcium (mg/dl) in RB-S and RB-NS groups under field conditions.





group concentration of plasma calcium was 9.44±0.16 mg/dl and in RB-NS

group was 9.59±0.28 mg/dl. Within both RB-S and RB-NS groups, Mean±SE


significant from initial value till the end of the experiment. The percent increase in

concentration of plasma calcium over initial value in RB-S group at end of

experiment was 10.27%. In RB-NS group only 6 % increase in concentration of

plasma calcium from initial value was observed. When Mean±SE values for

concentration of plasma calcium was compared between groups, values were

not significantly different till the end of the experiment. The Mean±SEM

concentration of plasma calcium in RB-NS and RB-S groups was 10.19±0.19

and 9.99±0.24 mg/dl respectively. The concentration of plasma calcium was not

significantly different between the groups.


(P<0.05) with concentration of plasma IGF-1 for both RB-S and RB-NS groups

(Table 4.44).

Das et al. (2009) reported significant (p<0.01) decrease in plasma level of

calcium among crossbred cattle with repeat breeding problem. Calcium plays an

important role in gonadotropic regulation of ovarian steroidogenesis (Carnegie

and Tsang, 1984) and ovulation (Peracchia, 1978). Results of present study

indicate significantly greater concentration of plasma calcium in RgB group when

compared with RB group under both farm and field conditions. As disturbed

steriodogenesis and ovulation are causes of infertility, results of present study

may correlate with early conception in RgB group and delay in RB group under

both farm and field conditions.


Table 4.22 Concentration of plasma calcium (mg/dl) in RB-S and RB-NS groups under farm conditions.

Weeks RB-S RB-NS

22 9.73±0.30 9.79±0.31

23 9.65±0.27 9.71±0.31

24 9.97±0.37 9.93±0.28

25 10.12±0.24 9.98±0.11

26 10.22±0.21 9.83±0.30

27 10.16±0.40 9.87±0.23

28 10.35±0.40 10.10±0.28

29 10.33±0.23 9.96±0.30

30 10.40±0.46 9.93±0.10

31 10.28±0.18 9.98±0.24

32 10.50±0.46 10.06±0.26

33 10.28±0.46 9.94±0.13

34 10.30±0.32 9.86±0.29

35 10.54±0.32 10.04±0.31

36 10.50±0.29 10.06±0.23

37 10.50±0.26 10.14±0.26

38 10.66±0.29 10.02±0.27

39 10.44±0.40 10.10±0.32

40 10.50±0.29 9.96±0.21

Mean±SEM 10.29±0.32 9.96±0.25

Table 4.23 Concentration of plasma calcium (mg/dl) in RgB and RB groups under field conditions.

Weeks RgB RB

4 9.02A±0.20 8.95±0.28

5 9.14 A ±0.32 8.82±0.14

6 9.35 A ±0.15 8.95±0.18

7 9.28 A ±0.22 9.12±0.16

8 9.42 A ±0.32 9.05±0.28

9 9.32 A ±0.28 8.95±0.23

10 9.55 A ±0.36 9.16±0.34

11 9.98 A a±0.25 9.24 b±0.19

12 9.76 A ±0.48 9.08±0.33

13 10.06 A a±0.18 9.32 b±0.22

14 10.02 A ±0.30 9.48±0.26

15 9.92 A a±0.17 9.40 b±0.08

16 10.34 A ±0.30 9.40±0.29

17 10.54 A a±0.26 9.70 b ±0.12

18 10.36 va±0.30 9.67 b ±0.09

19 10.82 Ba±0.30 9.48b±0.25

20 10.63 Ba±0.12 9.74 b±0.26

21 10.84 A a ±0.25 9.55b±0.13

22 10.58 A ±0.28

23 10.76 A ±0.42

Mean±SEM 9.98*±0.27 9.28±0.21


Table 4.24 Concentration of plasma calcium (mg/dl) in RB-S and RB-NS groups under field conditions.

Weeks RB-S RB-NS

22 9.44±0.16 9.59±0.28

23 9.56±0.26 9.51±0.14

24 9.88±0.25 9.83±0.24

25 10.03±0.26 9.68±0.26

26 10.13±0.14 9.93±0.16

27 10.07±0.25 9.87±0.14

28 10.26±0.20 9.91±0.19

29 10.24±0.09 9.92±0.26

30 10.31±0.13 10.12±0.23

31 10.19±0.41 9.98±0.37

32 10.41±0.21 9.96±0.35

33 10.39±0.12 10.14±0.30

34 10.33±0.10 10.22±0.29

35 10.45±0.12 10.24±0.18

36 10.41±0.29 10.26±0.12

37 10.31±0.18 10.14±0.35

38 10.47±0.08 10.10±0.18

39 10.35±0.27 10.20±0.28

40 10.41±0.15 10.26±0.24

Mean±SEM 10.19±0.19 9.99±0.24

4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 407

8

9

10

11

12RgB RB-S RB-NS

Weeks

Con

c. o

f pla

sma

Cal

cium

(mg/

dl)

Figure 4.11 Concentration of plasma calcium in RgB and during pre and post supplementation period in RB-S and RB-NS groups under farm conditions.

4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 407

8

9

10

11

12RgB RB-S RB-NS

Weeks

Con

c.of

pla

sma

Cal

cium

(mg/

dl)

Figure 4.12 Concentration of plasma calcium in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions.

Although concentration of calcium is low in RB and RB-NS groups,

animals were not in hypocalcaemic condition. As phenonemena of

steriodogenesis and ovulation are affected by the circulatory level of calcium, the

less concentration of calcium in RB group may be one of the reason resulting in

nil conception rate in cows even after three consecutive services. But in the

present study it was observed that increase in concentration of plasma calcium

in RB-S group was not significant when compared with RB-NS group even after

supplementation. Results are in accordance with Nikkhah et al. (2004) who

reported that change was not significant with respect to level of plasma calcium

in different experimental groups receiving 3, 6 and 12 g of Saccharomyces

cerevisiae per day along with the diet.

4.7 DRY MATTER INTAKE (DMI)

4.7.1 Dry matter intake (Kg/day) in RgB and RB KF groups under farm conditions.

The Mean±SE DMI estimated at weekly interval and Mean±SEM values

for RgB and RB groups under farm conditions is presented in Table 4.25 and

depicted in figure 4.13.


partum) Mean±SE DMI in RgB and RB groups under farm conditions was

12.08±0.43 and 11.80±0.36 kg/day respectively. Within both RgB and RB

groups, Mean±SE values of DMI did not differ significantly from initial value till

the end of the experiment. Highest DMI in RgB group was recorded at 12th week

i.e. 13.37±0.56 kg/day and highest DMI in RB group was recorded at 9th week

i.e. 12.97 kg/day. The percent increase in DMI from 4th week in RgB groups by

23 rd week post partum was 5.2 % and in RB groups by 21st week post partum

was 2.1 %. When Mean±SE values of DMI was compared between group, no

significant difference was observed till the end of the experiment. The

Mean±SEM DMI for RgB and RB groups under farm conditions was 12.71±0.38

and 12.42±0.46 kg/day respectively. But the difference between the DMI for the

two groups was not significantly different.


4.7.2 Dry matter intake (Kg/day) in RB-S and RB-NS groups under farm conditions.


for RB-S and RB-NS groups under farm conditions is presented in Table 4.26

and depicted in figure 4.13.


group Mean±SE DMI was 11.06±0.35 kg/day and in RB-NS group DMI was

11.18±0.39 kg/day. Within RB-S and RB-NS groups, Mean±SE values of DMI

exhibited decreasing trend but difference was not significant from initial value till

40th week post partum. The Mean±SE DMI in RB-S group decreased to

9.30±0.25 kg/day and in RB-NS group deceased to 9.03±0.35 kg/day over initial

DMI. The percent decreases in DMI over initial value in RB-S and RB-NS group

at end of experiment was 15.9 and 19.2 % respectively. When Mean±SE values

of DMI was compared between RB-S and RB-NS groups, significant difference

was not observed till the end of the experiment. The Mean±SEM DMI in RB-S

and RB-NS groups was 10.41±0.37 and 10.12±0.36 kg/day respectively. DMI

values for both RB-S and RB-NS groups were not significantly different.

4.7.3 Dry matter intake (Kg/day) in RgB and RB groups under field conditions.


for RgB and RB groups under field conditions is presented in Table 4.27 and



partum) DMI in RgB and RB groups under field conditions was 11.83±0.23 and

11.43±0.33 kg/day respectively. Mean±SE values of DMI did not differ

significantly within RgB and RB groups from initial value throughout the course of

the experiment. Highest Mean±SE DMI in RgB group was recorded at 8th week

i.e. 12.92±0.44 kg/day and highest Mean±SE DMI in RB group was recorded at

11th week i.e. 12.64±0.09 kg/day. When Mean±SE values of DMI were compared

between groups, difference was not significant till the end of the experiment. The

Mean±SEM DMI for both RgB and RB groups under field conditions was


Table 4.25 Dry matter intake (Kg/day) of RgB and RB groups under farm conditions.

Weeks RgB RB

4 12.08±0.43 11.80±0.36

5 12.50±0.18 11.96±0.55

6 12.73±0.27 12.41±0.45

7 13.08±0.34 12.48±0.39

8 13.30±0.15 12.70±0.65

9 13.17±0.35 12.97±0.35

10 13.26±0.47 12.66±0.57

11 13.34±0.29 12.85±0.26

12 13.37±0.56 12.80±0.45

13 13.06±0.36 12.95±0.43

14 13.20±0.66 12.63±0.28

15 12.90±0.35 12.43±0.37

16 12.87±0.45 12.42±0.34

17 12.71±0.19 12.53±0.55

18 12.72±0.35 12.39±0.58

19 12.54±0.35 12.22±0.77

20 12.20±0.65 11.72±0.34

21 12.21±0.46 11.55±.54

22 11.50±0.25

23 11.45±0.47

Mean±SEM 12.71±0.38 12.42±0.46

Table 4.26 Dry matter intake (Kg/day) in RB-S and RB-NS groups under farm conditions.

Weeks RB-S RB-NS

22 11.06±0.35 11.18±0.39

23 11.12±0.27 11.25±0.35

24 11.08±0.29 10.96±0.32

25 10.90±0.46 10.62±0.25

26 10.90±0.66 10.58±0.26

27 10.75±0.36 10.40±0.45

28 10.57±0.25 10.40±0.43

29 10.68±0.36 10.25±0.28

30 10.57±0.35 10.07±0.47

31 10.48±0.47 10.18±0.34

32 10.41±0.16 10.07±0.45

33 9.96±0.45 9.98±0.28

34 10.20±0.37 9.61±0.37

35 10.22±0.28 9.76±0.26

36 10.27±0.55 9.69±0.49

37 9.86±0.43 9.62±0.36

38 10.03±0.45 9.57±0.55

39 9.50±0.39 9.09±0.27

40 9.30±0.25 9.03±0.35

Mean±SEM 10.41±0.37 10.12±0.36

12.27±0.27 and 12.11±0.34 kg/day respectively. But the difference between the

DMI for the two groups was not significantly different.

4.7.4 Dry matter intake (Kg/day) in RB-S and RB-NS groups under field conditions.


for RB-S and RB-NS groups under field conditions is presented in Table 4.28



group Mean±SE DMI was 10.86±0.32 kg/day and in RB-NS group was

10.93±0.64 kg/day. Within both RB-S and RB-NS groups, Mean±SE values of

DMI exhibited decreasing trend but difference was not significant from initial

value till 40th week post partum. Mean±SE DMI till the end of study period (40th

week) in RB-S group decreased to 9.52±0.21 kg/day and in RB-NS group

deceased to 9.19±0.34 kg/day over initial value. The percent decrease in DMI

over initial value in RB-S and RB-NS groups at end of experiment were 12.33

and 15.9 % respectively. When Mean±SE values of DMI were compared

between groups, difference was not significant till end of the experiment. The

Mean±SEM DMI in RB-S and RB-NS groups under field conditions was

10.28±0.36 and 9.90±0.33 kg/day respectively. DMI values for both RB-S and

RB-NS groups were not significantly different.

In the present study non significantly greater DMI in RgB when compared

with RB groups under both farm and field conditions. Results are in accordance

with Markusfeld et al. (1997) who failed to observe any relationship between

body weight at calving and first service conception rate in crossbred cows.

Similarly, Wathes et al. (2007) did not find a relationship between calving BCS,

BCS at 60 day post partum, or BCS change with the conception at first service.

DMI values were greater in RB-S when compared with RB-NS groups

under both farm and field conditions. But the differences were not significant.

Effect of supplementation of Saccharomyces cerevisae on DMI in RB-S and RB-

NS groups under farm and field conditions are in accordance with study

conducted by (Arambel and Kent, 1990; Soder and Holden, 1999). They

reported non significant change in DMI on systematic supplementation of


Saccharomyces cerevisiae in crossbred cows. Results of present study are

controversial when compared with reports of Williams et al. (1991); Wohlt et al.

(1991) and Dann et al. (2000).They had reported significant increase in DMI on

systematic supplementation of yeast i.e. Saccharomyces cerevisiae in crossbred

cows during stressful conditions like pregnancy or early lactation. Phillips and

VonTungelin (1984) and Barling (2014) reported similarly for catlle under

environmental stress conditions.

4.8 MILK YIELD

4.8.1 Milk yield (Kg/day) in RgB and RB groups under farm conditions.

The Mean±SE milk yield estimated at weekly interval and Mean±SEM

values for RgB and RB groups under farm conditions is presented in Table 4.29



partum) milk yield in RgB and RB groups under farm conditions was 15.7±0.56

and 15.7±0.49 kg/day respectively. Mean±SE values of milk yield when

compared within RgB group significant (P<0.05) difference was observed at 12th

week post partum. Whereas in RB group milk yield was not significantly different

from initial value throughout the course of the experiment. Highest milk yield of

18.3±0.69 kg/day in RgB group was recorded at 12th week and in RB group was

also recorded at 12th week i.e. 17.8±0.58 kg/day. The percent decreased milk

yield over initial value at 23rd week post partum in RgB groups was 4.5% and the

percent decrease in milk yield over initial value at 21st week post partum in RB

groups was 2.5%. When Mean±SE values of milk yield was compared between

groups, significant difference was not observed till the end of the experiment.

The Mean±SEM milk yield for RgB and RB groups under farm conditions was

16.93±0.51 and 16.57±0.56 kg/day respectively. Milk yield recorded for both RgB

and RB groups was not significantly different.


Table 4.27 Dry matter intake (Kg/day) in RgB and RB groups under field conditions.

Weeks RgB RB

4 11.83±0.23 11.43±0.33

5 12.34±0.12 11.94±0.54

6 12.51±0.32 12.21±0.23

7 12.51±0.43 12.18±0.54

8 12.92±0.44 12.47±0.70

9 12.62±0.35 12.52±0.11

10 12.83±0.14 12.53±0.32

11 12.71±0.07 12.64±0.09

12 12.76±0.32 12.57±0.23

13 12.70±0.10 12.24±0.43

14 12.55±0.57 12.42±0.32

15 12.51±0.32 12.12±0.12

16 12.28±0.06 12.31±0.43

17 12.12±0.08 11.82±0.22

18 12.12±0.23 11.78±0.50

19 11.97±0.45 11.70±0.60

20 11.89±0.35 11.64±0.53

21 11.69±0.23 11.42±0.43

22 11.30±0.36

23 11.28±0.25

Mean±SEM 12.27±0.27 12.11±0.34

Table 4.28 Dry matter intake (Kg/day) in RB-S and RB-NS groups under field conditions.

Weeks RB-S RB-NS

22 10.86±0.32 10.93±0.64

23 11.05±0.53 10.68±0.42

24 10.68±0.54 10.57±0.26

25 10.44±0.23 10.33±0.21

26 10.77±0.10 10.29±0.10

27 10.41±0.32 9.99±0.22

28 10.39±0.56 10.16±0.43

29 10.36±0.23 10.06±0.34

30 10.51±0.44 9.98±0.35

31 10.16±0.52 9.76±0.12

32 10.22±0.21 9.88±0.07

33 10.40±0.60 9.64±0.42

34 10.20±0.46 9.53±0.60

35 10.18±0.32 9.72±0.27

36 10.00±0.53 9.46±0.32

37 9.70±0.21 9.32±0.54

38 9.84±0.10 9.30±0.44

39 9.62±0.32 9.26±0.14

40 9.52±0.21 9.19±0.34

Mean±SEM 10.28±0.36 9.90±0.33

4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 408

9

10

11

12

13

14

15RgB RB-NS RB-NS

Weeks

Dry

Mat

ter

Inta

ke(K

g/da

y)

4.13 DMI in RgB and during pre and post supplementation period in RB-S and RB-NS groups under farm condition

4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 408

9

10

11

12

13

14

15Regular Breeder Supplemented RB Non Supplemented RB

Weeks

Dry

Mat

ter I

ntak

e(K

g/da

y)

4.14 DMI in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions

Table 4.29 Milk yield (Kg/day) in RgB and RB groups under farm conditions.

Weeks RgB RB

4 15.7A±0.56 15.7±0.49

5 16.1 A ±0.31 16.2±0.68

6 16.8 A ±0.40 16.8±0.58

7 17.4 A ±0.47 16.5±0.52

8 17.8 A ±0.28 16.9±0.78

9 17.2 A ±0.48 16.7±0.48

10 18.0 A ±0.60 17.6±0.70

11 17.9 A ±0.42 17.4±0.39

12 18.3B±0.69 17.8±0.58

13 18.1 A ±0.49 17.1±0.56

14 17.9 A ±0.79 17.0±0.41

15 18.0 A ±0.48 17.1±0.50

16 17.1 A ±0.58 16.6±0.47

17 17.7 A ±0.32 16.5±0.68

18 16.6 A ±0.48 15.8±0.71

19 16.5 A ±0.48 15.7±0.50

20 16.0 A ±0.78 15.5±0.47

21 15.5 A ±0.59 15.3±0.68

22 15.2 A ±0.38

23 15.0 A ±0.60

Mean±SEM 16.93±0.51 16.57±0.56

Values with different superscripts (A, B) are significantly different (P<0.05) from initial value within each group.

4.8.2 Milk yield (Kg/day) in RB-S and RB-NS groups under farm conditions.

The Mean±SE milk yield recorded at weekly interval and Mean±SEM

values for RB-S and RB-NS groups under farm conditions is presented in Table

4.30 and depicted in figure 4.15.


group, milk yield was 14.5±0.48 kg/day and in RB-NS group milk yield was

14.3±0.52 kg/day. In both RB-S and RB-NS groups, milk yield gradually

decreased till the end of experiment. Within RB-S group, milk yield decreased

over initial value but was significantly (p<0.05) different from initial value only at

33rd and 35th to till the end of the experiment. Whereas within RB-NS group

significant (P<0.05) decreased from initial value was observed from 29th week to

till end of the experiment. Milk yield in RB-S group decreased to 10.3±0.38

kg/day and in RB-NS group it decreased to 9.6±0.58 kg/day from initial values.

The percent decrease in milk yield over initial value in RB-S and RB-NS groups

at end of experiment was 28.96 and 32.86 % respectively. When Mean±SE

values of milk yield was compared between groups, no significant difference was

observed till the end of the experiment. The Mean±SEM milk yield in RB-S and

RB-NS groups under farm conditions was 12.38±0.50 and 11.75±0.51 kg/day

respectively. Milk yield estimated in both RB-NS and RB-S groups was not

significantly different.

4.8.3 Milk yield (Kg/day) in RgB and RB groups under field conditions.

The Mean±SE milk yield at weekly interval and Mean±SEM values for

RgB and RB groups under field conditions is presented in Table 4.31 and



partum) milk yield recorded in RgB and RB groups under farm conditions was

15.5±0.56 and 14.9±0.49 kg/day respectively. Within RgB and RB groups,

Mean±SE values of milk yield exhibited not significant difference over initial

value throughout the course of the experiment. Highest Mean±SE milk yield in

RgB group was recorded at 10th week i.e 17.0±0.60 kg/day and in RB group was

recorded at 11th week i.e. 16.4±0.39 kg/day. The percent increase in milk yield


over initial value at 23rd week post partum in RgB groups was 7.74 % in RB and

in group was 4 %. At 21th week post partum. When Mean±SE values of milk yield

was compared between groups, not significant difference was observed till the

end of the experiment. The Mean±SEM milk yield for RgB and RB groups under

farm conditions was 16.11±0.51 and 15.53±0.56 kg/day respectively. Milk yield

recorded in both RgB and RB groups was not significantly different.

4.8.4 Milk yield (Kg/day) in RB-S and RB-NS groups under field conditions.

The Mean±SE milk yield recorded at weekly interval and Mean±SEM

values for RB-S and RB-NS groups under field conditions is presented in Table



group milk yield was 13.5±0.48 kg/day and in RB-NS group milk yield was

13.5±0.52 kg/day. In both in RB-S and RB-NS groups, milk yield showed

decreasing trend till the end of experiment. Mean±SE values of milk yield

decreased significantly (P<0.05) within RB-S group from initial value at 36th, 37th

and 40th week post partum. Whereas within RB-NS group significant (P<0.05)

decreased from initial from 28th week till the end of the experiment. Milk yield in

RB-S group decrease to 9.3±0.38 kg/day and in RB-NS group deceased to

8.4±0.48 kg/day over initial value. The percent decrease in milk yield over initial

value in RB-S and non-supplementation RB group at end of experiment was

31.1 and 37.7 % respectively. When Mean±SE values of milk yield was

compared between groups, not significant difference was observed till the end of

the experiment. The Mean±SEM milk yield in RB-S and RB-NS groups under

field conditions was 11.39±0.50 and 10.71±0.51 kg/day respectively. Milk yield

recorded in both RB-NS and RB-S groups was non significantly different.

Results of present study show higher milk yield in RgB group when

compared with RB under farm and field conditions but were observed to be not

significant. Since at the beginning of the study, the milk yield of RB group was

not significantly different from RgB group, milk yield might not have been a

critical factor resulting in the increase or decrease in blood plasma parameter


Table 4.30 Milk yield (Kg/day) in RB-S and RB-NS groups under farm conditions.

Weeks RB-S RB-NS

22 14.5A±0.48 14.3A±0.52

23 14.6 A ±0.40 14.1 A ±0.48

24 14.1 A ±0.42 13.7 A ±0.48

25 13.6 A ±0.59 13.5 A ±0.38

26 13.6 A ±0.79 13.0 A ±0.39

27 13.2 A ±0.49 13.2 A ±0.58

28 13.2 A ±0.38 12.6 A ±0.56

29 12.8 A ±0.49 11.8B±0.41

30 12.3 A ±0.48 11.6B±0.60

31 12.3 A ±0.60 11.2B±0.47

32 12.0 A ±0.29 11.1B±0.58

33 11.8B±0.58 11.1B±0.41

34 12.0 A ±0.50 10.8B±0.50

35 11.3B±0.41 10.7B±0.39

36 11.1B±0.68 10.8B±0.62

37 10.9B±0.56 10.4B±0.49

38 10.8B±0.58 9.8 B±0.68

39 10.8B±0.52 9.9B±0.50

40 10.3B±0.38 9.6B±0.58

Mean±SEM 12.38±0.50 11.75±0.51


Table 4.31 Milk yield (Kg/day) in RgB and RB groups under field conditions.

Weeks RgB RB

4 15.5±0.56 14.9±0.49

5 16.1±0.31 15.2±0.68

6 16.1±0.04 15.4±0.58

7 16.4±0.47 15.5±0.52

8 16.8±0.26 15.9±0.78

9 16.7±0.42 15.7±0.48

10 17.0±0.60 16.1±0.70

11 16.7±0.42 16.4±0.39

12 16.8±0.69 16.2±0.58

13 17.1±0.49 16.1±0.56

14 16.3±0.79 16.0±0.41

15 17.0±0.48 16.1±0.50

16 16.3±0.58 15.6±0.47

17 16.7±0.32 15.5±0.68

18 15.6±0.48 15.4±0.71

19 15.5±0.34 14.7±0.52

20 15.0±0.78 14.5±0.47

21 14.5±0.59 14.3±0.68

22 14.2±0.38

23 14.3±0.60

Mean±SEM 16.11±0.51 15.53±0.56

Table 4.32 Milk yield (Kg/day) in RB-S and RB-NS groups under field conditions.

Weeks RB-S RB-NS

22 13.5A±0.48 13.5A±0.52

23 13.6 A ±0.40 13.0 A ±0.36

24 13.1 A ±0.42 12.9 A ±0.45

25 12.6 A ±0.59 12.3 A ±0.38

26 12.6 A ±0.79 12.0 A ±0.39

27 12.2 A ±0.49 11.5 A ±0.58

28 12.2 A ±0.38 11.7B±0.56

29 11.8 A ±0.43 11.0B±0.41

30 11.3 A ±0.48 10.8B±0.60

31 11.3 A ±0.60 10.4B±0.47

32 11.0 A ±0.29 10.3B±0.58

33 10.9 A ±0.58 10.3B±0.41

34 10.6 A ±0.47 10.1B±0.50

35 10.5 A ±0.41 9.5B±0.39

36 10.1B±0.68 9.1B±0.62

37 10.1B±0.56 9.2B±0.49

38 9.9 A ±0.58 8.9B±0.68

39 9.8 A ±0.52 8.5B±0.60

40 9.3B±0.38 8.4B±0.48

Mean±SE 11.39±0.50 10.71±0.51


4.15 Milk yield in RgB and during pre and post supplementation period in RB-S and RB-NS groups under farm condition

5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 416

8

10

12

14

16

18

20 RgB RB-S RB-NS

Weeks

Milk

Yie

ld(K

g/da

y)

4.16 Milk yield in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions

and for repeat breeding problem. No reports are available with respect to

comparative studies on milk yield in regular and repeat breeders.

Effect of supplementation of Saccharomyces cerevisae on milk yield in RB-

S and RB-NS groups under farm and field conditions are in accordance with study

conducted by Iwanska et al. (1999); Dann et al. (2000); Majdoub-mathiuothi et al.

(2009). They have demonstrated that supplementation of Saccharomyces

cerevisae had no significant effect on milk yield or milk composition in mid or late

lactation period of dairy cows.

Results of present study are contradictory with studies conducted by

others (Arambel, and Kent 1990; Piva et al., 1993; Robinson 1997).They had

demonstrated significant effect on milk yield or milk composition of dairy cows

when Saccharomyces cerevisae was supplemented in early lactation. Phillips

and VonTungelin, (1984) and Barling, (2014) reported increase in feed intake

and nutrient availability on supplementation of Saccharomyces cerevisiae during

stress to cattle to overcome the stress. Therefore yeast culture was thought to

be best utilized by animals under stress. As animals were in early lactation, they

were in stress. This might be one of the reasons for significant effect on milk

yield or milk composition of dairy cows when Saccharomyces cerevisae was

supplemented. Mostly reports on supplementation are available during early

lactation period.

4.9 BODY WEIGHT

4.9.1 Body weight (Kg) of RgB and RB groups under farm conditions.

The Mean±SE body weight recorded at monthly interval and Mean±SEM

values for RgB and RB groups under farm conditions is presented in Table 4.33



partum) body weight of RgB and RB groups under farm conditions was

402.67±9.18 and 379.22±15.6 kg respectively. When Mean±SE values of milk

yield was compared within and between groups, not significance difference was

observed till the end of the experiment. Highest Mean±SE body weight in RgB

group was recorded as. 453.00±16.26 kg at end of the experiment and in RB

group was recorded as 436.25±17.94 kg at 20th week. There after the body


weight did not change significantly. The Mean±SEM body weight for RgB and

RB groups under farm conditions was 438.30±14.14 and 424.56±17.36 kg

respectively. Body weight recorded for both RgB and RB groups was not


4.9.2 Body weight (Kg) of RB-S and RB-NS groups under farm conditions.

The Mean±SE body weight measured at monthly interval and Mean±SEM

values for RB-S and RB-NS groups under farm conditions is presented in Table



group, Mean±SE body weight was 438.33±13.12 kg and in RB-NS group

Mean±SE body weight was 434.17±17.84 kg. When Mean±SE values of milk

yield was compared between and groups, not significance difference was

observed till the end of the experiment. The percent increase in body weight at

10th month over initial value in RB-S groups was 3 % and in RB-NS group was

1%. The Mean±SEM body weight in RB-S and RB-NS groups under farm

conditions was 442.83±11.91 and 431.77±15.13 kg respectively. The body

weights RB-S and RB-NS groups were not significantly different from each other.

4.9.3 Body weight (Kg) of RgB and RB groups under field conditions.

The Mean±SE body weight recorded at monthly interval and Mean±SEM

values for RgB and RB groups under field conditions is presented in Table 4.35


Under farm conditions, at the begining of experiment (4th week post

partum) Mean±SE body weight of RgB and RB groups under field conditions was

398.45 ±10.14 and 374.42±15.65 kg respectively. When Mean±SE values of milk

yield was compared between and groups, not significance difference was

observed till the end of the experiment. Highest Mean±SE body weight in RgB

group was recorded as 448.56±17.63 kg and in RB group was recorded as

434.75±18.47 kg at end of the experiment. The Mean±SEM body weight for RgB

and RB groups under field conditions was 429.82±13.00 and 419.03±15.39 kg

respectively. Body weight recorded for both RgB and RB groups was not



Table 4.33 Body weight (Kg) in RgB and RB groups under farm conditions.

Weeks RgB RB

4 402.67±9.18 379.22±15.6

8 439.33±12.91 428.98±21.20

12 445.00±11.84 438.57±12.16

16 451.50±20.5 439.78±19.84

20 453.00±16.26 436.25±17.94

Mean±SEM 438.30±14.14 424.56±17.36

Table 4.34 Body weight (Kg) in RB-S and RB-NS groups under farm conditions.

Weeks RB-S RB-NS

22 438.33±13.12 434.17±17.84

26 439.8±16.67 426.33±19.54

30 437±12.86 430.60±16.02

34 447.5±9.06 428.00±10.41

38 451.5±7.84 439.75±11.81

Mean±SEM 442.83±11.91 431.77±15.13

4.17 Body weight in RgB and RB groups under farm conditions

4.18 Body weight in RB-S and RB-NS groups under farm conditions

100.00

150.00

200.00

250.00

300.00

350.00

400.00

450.00

500.00

4 8 12 16 20

Body

Wei

ght

(Kg)

Weeks

RgB RB

100

150

200

250

300

350

400

450

500

22 26 30 34 38

Body

Wei

ght

(Kg)

Weeks

RB-S RB-NS

Table 4.35 Body weight (Kg) in RgB and RB groups under field conditions.

Weeks RgB RB

4 398.45±10.14 374.42±15.65

8 435.23±11.10 422.45±16.23

12 432.54±7.84 430.64±12.16

16 434.32±18.30 432.87±14.44

20 448.56±17.63 434.75±18.47

Mean±SEM 429.82±13.00 419.03±15.39

Table 4.36 Body weight (Kg) in RB-S and RB-S groups under field conditions.

Weeks RB-S RB-NS

22 437.23±8.12 432.17±14.04

26 435.9±12.68 428.34±16.50

30 436.12±7.74 429.70±15.02

34 439.7±12.06 430.56±9.42

38 441.3±14.71 431.75±11.05

Mean±SEM 438.05±11.06 430.50±13.21

4.19 Body weight in RgB and RB groups under field conditions

4.20 Body weight in RB-S and RB-NS groups under field conditions

0.00

100.00

200.00

300.00

400.00

500.00

4 8 12 16 20

Body

Wei

ght (

kg)

Weeks

RgB RB

0

100

200

300

400

500

22 26 30 34 38

Body

Wei

ght (

kg)

Month

RB-S RB-NS

4.9.4 Body weight (Kg) of RB-S and RB-NS groups under field conditions.

The Mean±SE body weight measured at monthly interval and



Form 22nd week post partum when probiotic was supplemented Mean±SE

body weight was 437.23±8.12 kg and in RB-NS group Mean±SE body weight

was 432.17±14.04 kg. When Mean±SE values of milk yield was compared

between and groups, not significance difference was observed till the end of the

experiment. The increase in Mean±SE body weight of RB-S group was by 4.07

% and decrease in body weight in RB-NS group by 0.4 % over initial value at

10th month. The Mean±SEM body weight in RB-S and RB-NS groups under

field conditions was 438.05±11.06 and 430.50±13.21 kg respectively. Body

weight recorded for both RB-S and RB-NS groups were not significantly

different.

In the present study, even though the Mean±SE body weight of RgB was

higher than RB group, no significant difference was observed under both farm

and field conditions. Since at the beginning of the study, not significant difference

was observed for the body weight between RgB and RB groups. In adult animal

Saccharomyces cerevisae supplementation might have had the ability to provide

growth factors such as organic acids (methionine and lysine) and vitamins;

stimulating immune function; improving the numbers of beneficial rumen micro

flora and fiber digestion (Chaucheryas et al., 1995; Gattass et al., 2008; Soccol

et al., 2010). Our results suggest Saccharomyces cerevisae supplementation

might have improved health and feed efficiency of the animal which might have

resulted in increase in body weight, although results were not significantly

different. Results are confirmatory with the report of Markusfeld et al. (1997) who

failed to observe any relationship between body weight at calving and first

service conception rate in crossbred cows. Similarly, Wathes et al. (2007) did not

find a relationship between calving BCS, BCS at 60 day post partum, or BCS

change with the conception at first service.

Effect of supplementation of Saccharomyces cerevisae on body weight in

RB-S and RB-NS groups under farm and field conditions are in accordance with


study conducted by Zhang et al. (2000) who reported that the cows on

supplementation with Saccharomyces cerevisiae had a body weight gain of 1%

greater than that of the control group, but it was not significantly different from

control.

Since at the beginning of the study, the body weight of RB group was not

significantly different from RgB group, Hence body weight might not have been a

critical factor causing the increase or decrease in blood plasma parameters and

for cause of repeat breeding problem.

4.10 CONCEPTION RATE

4.10.1 Conception rate in RgB and RB groups under farm conditions.

Conception rate of RgB and RB groups under farm conditions is

presented in Table 4.37.

Percentage of conception rate of RgB group under farm conditions for first

service was 33.33%. Percentage of conception rate of RgB group under farm

conditions to second service 75%. Percentage of conception rate of RgB group

under farm conditions to third service 100% respectively. In RB group for first 3

services none of the animals conceived. Overall Percentage of conception rate

of RgB and RB groups under farm conditions up to three services was 100 and 0

% respectively.

4.10.2 Conception rate in RB-S and RB-NS groups under farm conditions.

Conception rate of RB-S and RB-NS groups under farm conditions is


Percentage of conception rate of RB-S and RB-NS groups under farm

conditions for first service was 28.57 and 14.29 % respectively. Percentage of

conception rate of RB-S and RB-NS groups under farm conditions to second

service was 40.29 and 16.67 % respectively. Percentage of conception rate of

RB-S and RB-NS groups under farm conditions to third service was 33.3 and 20

% respectively. Overall percentage of conception rate of RB-S and RB-NS

groups under farm conditions up to three services was 71.42 and 42.85 %

respectively.


Table 4.37 Conception rate in RgB and RB groups under farm conditions.

Services RgB RB

1 2/6(33.33%) 0/14(0%)

2 3/4(75%) 0/14(0%)

3 1/1(100%) 0/14(0%)

Overall 6/6(100%) ** 0/14(0%)

Values were presented in percentage. **P<0.01

Table 4.38 Conception rate in RB-S and RB-NS groups under farm conditions.

Services RB-S RB-NS

1 2/7(28.57%) 1/7(14.29%)

2 2/5(40%) 1/6(16.67%)

3 1/3(33.33%) 1/5(20%)

Overall 5/7(71.42%)* 3/7(42.85%)

Values were presented in percentage. * P<0.05

4.10.3 Conception rate in RgB and RB groups under field conditions.

Conception rate of RgB and RB groups under field conditions is presented

in Table 4.39.

Percentage of conception rate of RgB group under farm conditions for first

service was 16.66%. Percentage of conception rate of RgB group under farm

conditions to second service 80%. Percentage of conception rate of RgB group

under farm conditions to third service 100% respectively. In RB group for first 3

services none of the animals conceived. Overall Percentage of Conception rate

of RgB and RB groups under farm conditions up to three services was 100 and 0

% respectively.

4.10.4 Conception rate in RB-S and RB-NS groups under field conditions.

Conception rate of RB-S and RB-NS groups under field conditions is


Percentage of conception rate of RB-S and RB-NS groups under field

conditions to first service was 28.57 and 0 % respectively. Percentage of

conception rate of RB-S and RB-NS groups under field conditions to second

service was 40 and 28.56 % respectively. Percentage of conception rate of RB-S

and RB-NS groups under farm conditions to third service was 0 and 20 %

respectively. Overall percentage of conception rate of RB-S and an RB-NS

group under farm conditions up to three consecutive services was 71.42 and

42.85 % respectively.

To the best of our knowledge this is the first investigation which shows the

effect of Probiotic (Saccharomyces cerevisiae) supplementation on conception

rate of repeat breeding crossbred cows under farm and field conditions. As

discused earlier systematic supplementation of probiotic (Saccharomyces

cerevisiae) significantly improved the plasma level of lactofferin, IGF-1, and

glucose in RB-S group. These parameters are positively correlated with health

and reproductive performance of animal. Whereas systematic supplementation

of probiotic (Saccharomyces cerevisiae) significantly decreased plasma level of

urea and Hp in RB-S groups. These parameters were negatively correlated with

health and reproductive performance of animals. These beneficial changes in

plasma level may be the reason for greater conception rate in RB-S when


compared with RB-NS groups under farm and field conditions. No reports on

supplementation of lactating cows are available for short duration of time up to

120 d post partum in cattle.

4.11 In Vitro Study

4.11.1 Relative expression of TLR-4 mRNA in neutrophils of RB, RB (In vitro IGF-1 supplemented) and RgB groups.

Relative expression of TLR-4 gene in blood neutrophils of RB (In vitro

IGF-1 supplemented) and RgB is presented in Table 4.46 and also depicted in

Figure 4.21. Relative expression of TLR-4 gene in blood neutrophils of RB (In

vitro IGF-1 supplemented) with respect to RB and RgB groups which was

1.13±0.11 and 1.48±0.09 respectively. O’Neill and Bowie (2007) reported

activation of TLR-4 can increase the phagocytic activity of neutrophils and

change their physiology in ways that increase their ability to kill and clear

pathogens. Relative expression of TLR-4 and Fas mRNA in neutrophils may

show immune status of the animal which can be correlate with repeat breeding

problem in Karan Fries cows. Bacterial infection trigger and increase expression

of TLR-4 in neutrophils and lymph node, lower expression of TLR-4 in neutrophil

of RB group does not indicate any bacterial infection but indicating lower immune

status when compared with RgB group which were healthy, did not suffer clinical

infection during study tenure as reported by Wolfram et al., (2008); Goldammer

et al., (2004) increase in TLR-4 expression in neutrophils during bacterial

infection.

4.11.2 Relative expression of Fas mRNA in neutrophils of RB, RB (In vitro IGF-1 supplemented) and RgB groups.

Relative expression of Fas gene in blood neutrophils of RgB and RB (In

vitro IGF-1 supplemented) groups, with respect to RB group is presented in

Table 4.46 and also depicted in Figure 4.21 Relative expression of Fas in blood

neutrophils of RB (In vitro IGF-1 supplemented) and RgB were 1.11±0.10 and

1.41±0.13 which differed significantly (P<0.05).

Regulation of the neutrophil life span by apoptosis is a crucial process in

maintaining number of circulating neutrophils which is regulated by Fas gene

(Simon, 2003). Results of present study suggest that Fas gene has a particular


Table 4.39 Conception rate in RgB and RB groups under field conditions.

Services RgB RB

1 1/6(16.66%) 0/14(14.29%)

2 4/5(80%) 0/14(16.67%)

3 1/1(100%) 0/14(20%)

Overall 6/6(100%) ** 0/14(0%)

Values were presented in percentage. ** P<0.01

Table 4.40 Conception rate in RB-S and RB-NS groups under field conditions.

Services RB-S RB-NS

1 2/7(28.57%) 0/7(0%)

2 3/5(40%) 2/7(28.56%)

3 0/2(0%) 1/5(20%)

Overall 5/7(71.42%)* 3/7(42.85%)

Values were presented in percentage. * P<0.05

Picture 5.1 Calf born of RB-S animal under Darad village conditions

Picture 5.2 Calf born of RB-S animal under Darad village conditions

Table 4.41 Correlation coefficient of plasma parameters in RgB and RB groups under farm conditions.

Hp IGF-1 Glucose Lactoferrin Urea Calcium

Hp 1.000

IGF-1 -0.679** 1.000

Glucose -0.483* 0.872** 1.000

LF -0.829** 0.634** 0.656** 1.000

Urea 0.797** -0.684** -0.530* -0.848** 1.00

calcium -0.502* 0.374* 0.057** 0.407* -0.5* 1.000

Values with superscripts ** significantly(P<0.01) correlated Values with superscripts * significantly(P<0.05) correlated

Table 4.42 Correlation coefficient of plasma parameters in RB-S and RB-NS groups under farm conditions.


Hp 1.000

IGF-1 -0.300 1.000

Glucose -0.176 0.820** 1.000

Lactoferrin -0.541* 0.644** 0.310 1.000

Urea 0.635** -0.541* -0.255 -0.770** 1.000

calcium -0.260 0.369* 0.208 0.302 -0.16 1.000


Table 4.43 Correlation coefficient of plasma parameters in RgB and RB groups under field conditions.


Hp 1.000

IGF-1 -0.692** 1.000

Glucose -0.523* 0.892** 1.000

Lactoferrin -0.856** 0.660** 0.670** 1.000

Urea 0.781** -0.684** -0.557** -0.84** 1.00

Calcium -0.532* 0.389* 0.056** 0.41* -0.49* 1.000


Table 4.44 Correlation coefficient of plasma parameters in RB-S and RB-NS groups under field conditions.


Hp 1.000

IGF-1 -0.310 1.000

Glucose -0.197 0.710** 1.000

Lactoferrin -0.561* 0.668** 0.310 1.000

Urea 0.649** -0.566* -0.262 -0.792** 1.000

Calcium -0.274 0.380* 0.220 0.316 -0.174 1.000 Values with superscripts ** significantly(P<0.01) correlated Values with superscripts * significantly(P<0.05) correlated

role to play in the regulation of neutrophil life span which may play role in

immune function of the animal.

Table 4.45 Relative expression of TLR-4 and Fas mRNA in neutrophils of RB, RB (In vitro IGF-1 supplemented) and RgB group.

Gene RB RgB RB+IGF-l

TLR-4 1 a±0.0 1.48 b±0.09 1.13 a±0.11

FAS 1 a±0.0 1.41 b±0.13 1.11 a±0.10

Values with different superscripts are significantly different (P<0.05)

Figure 4.21 Relative expression of TLR-4 and Fas mRNA in neutrophils of

RB, RB (In vitro IGF-1 supplemented) and RgB group.

In the present study it was observed that whether it was under farm or

field Mean±SEM concentration of plasma IGF-1, Hp, LF and Urea exhibited an

important role in influencing conception rate in repeat breeding crossbred Karan

Fries. Greater concentration of IGF-1 and LF had positive effect on reproductive

performance in Regular breeder yielding 100% conception rate. A novel and

economic technique of supplementation of commercial product fermented yeast

culture to repeat breeding cows @12 g/animal/day from 22nd week till 40th week

post partum, could enhance the plasma level of IGF-1 and LF and decrease Hp

and Urea level, which resulted in attaining 71.42% conception rate. Usually

00.20.40.60.8

11.21.41.61.8

RB Regular Breeder RB+IGF-1

Rela

tive

expr

essi

on o

f mRN

A

TLR-4 FAS


within 23 week, when the repeat breeding animals does not conceive for three

number of services, it is considered as non productive and farmer feels that it’s

an economic loss to him. This simple technology, where repeat breeding

animals, when supplemented with fermented yeast culture, their fertility status

could be upgraded.

In Vitro studies depicted that expression of TLR-4 and Fas genes were

down regulated in neutrophils of repeat breeding cows implicating weak activity

and survival of neutrophils. The dose and time period of incubation for IGF-1 on

neutrophils gene expression parameters were not enough to increase the

expression of genes as observed in control group.


CHAPTER –5

SUMMARY AND CONCLUSIONS

SUMMARY AND CONCLUSIONS

INSULIN-LIKE GROWTH FACTOR-1 (IGF-1)

Concentration of plasma IGF-1 in both RgB and RB groups increased

from initial value till the end of the experiment period (40th week),underfarm and fieldconditions.Mean±SEM concentration of plasma IGF-1was significantly

higher (P<0.01) in RgB groupwhen comparedwithRB groupunder bothfarm and field conditions.

Systematic supplementation of fermented yeast culture(Saccharomyces

cerevisae)caused increasein plasma IGF-1concentrationwithin RB-S groupunder

bothfarm and fieldconditions. Whereas such change was notobserved in

plasma IGF-1concentration in RB-NS groupunder both farm and field conditions.

Mean±SEM plasma IGF-1concentration was significantly higher (P<0.05)in RB-S

groupwhen comparedwith RB-NS group under bothfarm and fieldconditions.

Under both farm and field conditions similar result was observed in which

concentration of plasma IGF-1 was significantly positively correlated with plasma

glucose, LF(P<0.01), calcium (P<0.05)and negatively correlated (P<0.01)

withconcentration of plasma urea and Hp for bothRgB and RB groups.


plasma glucose, LF(P<0.01) and calcium (P<0.05) but negatively

correlated(P<0.05) with of plasma urea for both RB-S and RB-NS groupsunder

farm conditions.

Similarly under field conditions alsoconcentration ofplasma IGF-1was

significantly positively correlated (P<0.01) with concentration of plasma glucose,

LF, calcium (P<0.05)and negatively correlated (P<0.01) with plasma urea and

Hp for RB-S and RB-NS groups.

HAPTOGLOBIN (Hp)

Concentration ofplasma Hp decreased in RgB and RBgroupsover the

initial valueunderbothfarm and fieldconditions. Concentration plasma Hp

wassignificantlyless(P<0.05) in RgBgroup whencomparedwithRBgroup under

bothfarm and fieldconditions.

86

Systematic supplementation of fermented yeast culture (Saccharomyces

cerevisae)caused decreaseinconcentration of plasma HpofRB-S.Similarly it

wasobserved inRB-NS group till the end of experiment (40th week) under

bothfarm and fieldconditions. Mean±SEM plasma Hp was significantly

(P<0.05)lower inRB-S whencomparedwith RB-NS groupunder bothfarm and fieldconditions.

Under farm conditions, plasma Hp was significantly positively correlated

(P<0.01) with plasma urea concentration and negatively correlated (P<0.01) with

plasma LF, IGF-1(P<0.01), glucose and calcium (P<0.05) for RgB and RB

groups.

Under field conditions, for both RgB and RB groups, plasma Hp was

significantly positively correlated (P<0.01) with plasma urea and negatively

correlated (P<0.0) with plasma LF.

For RB-S and RB-NS groups, plasma Hp was significantly positively

correlated (P<0.01) with plasma urea and negatively correlated (P<0.01) with

plasma LF under farm conditions.

Concentration of Plasma Hp was significantly positively correlated

(P<0.01) with plasma urea and negatively correlated (P<0.01) with plasma LF,

IGF-1(P<0.01), glucose and calcium (P<0.05) for both RB-S and RB-NS

groupsunder field conditions.

LACTOFERRIN (LF)

Under bothfarm and fieldconditions, concentration of plasma LFexhibited

an increasing trend forRgB and RB groupsfrom theinitial value till end of the

experiment period. Mean±SEM concentration of plasma LFwas significantly

higher (P<0.05) in RgB groupwhen comparedwithRB group under bothfarm and fieldconditions.

Systematic supplementation offermented yeast culture (Saccharomyces

cerevisae) increased plasma LF concentration of both RB-S and RB-NS groups

till the end of experiment (40th week)under both farm and field

conditions.Mean±SEM concentration of plasma Hp was significantly

higher(P<0.05)inRB-S group when compared with RB-NS groupunder both farm

and field conditions.

87

Under farm and field conditions, similar correlations for plasma LFwas

observed where itwas significantly positively correlated with plasma IGF-1,

glucose (P<0.01), calcium (P<0.05)and negatively correlated (P<0.01) with

plasma urea and Hp for RgB and RB groups.

Concentration of plasma LFwas significantly (P<0.01) positively correlated

with plasma IGF-1 concentration and negatively correlated withof plasma

urea(P<0.01) and Hp(P<0.05) for both RB-S and RB-NS groupsunder farm conditions. Similar correlation results for concentration of plasma LFwas

observed with concentration of plasmaIGF-1, urea and Hp for both RB-S and

RB-NS groupsunder field conditions.

GLUCOSE

Under farm and field conditions, significantly (P<0.05) greater

concentration of plasma glucose was observed in RgB group when compared

with RB group at different intervals.Within RgB and RB groups, no significant

increasewas observed from initial value throughout the course of the experiment,

under farm and field conditions. Mean±SEM concentration of plasma glucose

was significantly higher (P<0.05)in RgB groupwhen compared with RB

groupunder both farm and field conditions.


cerevisae) causedincreasein concentration ofplasma glucosein RB-Sgroup

underfarm and fieldconditions. Whereas such trend was not recorded in

concentration ofplasma glucose inRB-NS group under both farm and field

conditions.Mean±SEM concentration ofplasma glucosewas significantly

higher(P<0.05) inRB-Sgroup when compared withRB-NSgroup under bothfarm and fieldconditions.


with plasma IGF-1, LF(P<0.01), calcium (P<0.05)and negatively correlated

(P<0.05) with plasma urea and Hp for RgB and RB groupsunder farm conditions.

Under field conditions, concentration of plasma glucose was significantly

(P<0.01) positively correlated with plasma IGF-1, LF, calcium concentration and

88

negatively (P<0.01) correlated with plasma urea and Hp for both RgB and RB

groups.

Similar results were observed with glucose under farmand field

conditions, where concentration of plasma glucose was significantly positively

correlated (P<0.01) with plasma IGF-1, LF and calcium and negatively correlated

with plasma urea and Hp for RB-S and RB-NS groups.

UREA

Concentration of plasma urea decreased in RgB group over the initial

valueunder farm and field conditions. Mean±SEM concentration of plasma

ureawas significantly higher in RB group when compared withRgB group under

bothfarm and fieldconditions.


cerevisae)decreased concentrationof plasmaureainRB-S groupover the initial

value at the end of experiment (40th week) under bothfarm and fieldconditions.

The values were not significantly different. Whereassuch decrease was not

observed inRB-NS groupover the initial value at the end of experiment (40th

week)underboth farm and field conditions.Concentration ofplasma ureawas

significantly lower inRB-S groupwhen compared with RB-NS groupunder

bothfarm and fieldconditions.Concentration of plasma urea was significantly

(P<0.01) greater in RB-NS when compared with RB-S group, under both farm and field conditions.

Under farm and field conditions, concentration of plasma urea was

significantly positively correlated (P<0.01) withplasma Hp and negatively

correlated (P<0.01) with plasma LF, IGF-1(P<0.01), glucose and calcium

(P<0.05) for both RgB and RB groups.


(P<0.01) with plasma Hp and negatively correlated (P<0.01) with plasma IGF-

1(P<0.05) andLF(P<0.01) for both RB-S and RB-NS groups under farm and field conditions.

CALCIUM

89

The results in the present study indicated an increasing trend in plasma

calcium concentration in RgB and RB groups over the initial value till the end of

the experiment period (23rd week)under both farm and field

conditions.Mean±SEM concentration of plasma calcium was significantly

higher(P<0.05) in RgB groupwhen compared withRB groupunder both farm and

field conditions.


cerevisae)showed increasing trend in plasma calcium concentration inRB-S and

RB-NS groups till the end of experiment (40th week)under both farm and field

conditions.Concentration ofplasma calciumwas significantly higher(P<0.05)

inRB-S groupswhen compared withRB-NS groupsunder both farm and field

conditions.

Under farm conditions, concentration of plasma calcium was significantly

positively correlated (P<0.01) with concentration of plasma IGF-1, LF (P<0.05),

glucose (P<0.01)and negatively correlated (P<0.01) with plasma urea and Hp

(P<0.05) for RgB and RB groups.

Concentration of plasma calcium was significantly(P<0.05) positively

correlated with plasma IGF-1, LF andglucose and negatively correlated (P<0.05)

with plasma urea and Hp for both RgB and RB groupsunder field conditions.

Under farm and field conditions,plasma calcium was significantly

positively correlated (P<0.05) with plasma IGF-1 in both RB-S and RB-NS

groups.

DRY MATTER INTAKE (DMI)

DMI (Mean±SEM)washigher in RgB groupwhen compared withRB

groupbut was not significantly differentunderboth farm and fieldconditions.Mean±SEM DMIwashigherinRB-S groupwhen compared with

RB-NS group but was not significantly differentunderfarm and fieldconditions.

MILK YIELD

Milk yield (Mean±SEM) washigher in RgB groupwhen compared with RB

groupbut was not significantly differentunderboth farm and fieldconditions. Milk

90

yieldwas higherin RB-S group when compared with RB-NS group but was not

significantly differentunder bothfarm and fieldconditions.

BODY WEIGHT

Body weight (Mean±SEM) was higher in RgB groupwhen compared with

RB groupbut was not significantly differentunderboth farm and field conditions.Mean±SEM body weight was higherin RB-S group when compared

with RB-NS group but was not significantly differentunder farm and field

conditions.

CONCEPTION RATE

Percentage of conception rate to first service was 33.33 and 16.66%

respectively for RgB group under farm and field conditions. In RgB groups 100%

of the animals conceived and in RB group none of the animals conceived for first

3consecutive services under both farm and field conditions.

Percentage of conception rate to first service was 28.57 and 14.29 %

respectivelyfor RB-S and RB-NS groups underfarm conditions. Percentage of

conception rate of RB-S and RB-NS groups underfield conditions to first service

was 28.57 and 0 % respectively. Percentage of conception rate of RB-S and RB-

NS groups under farm conditions up to three services was 71.42 and 42.85 %

respectively under both farm and field conditions.

In Vitro Study

Relative expression of TLR-4 and Fas genes in blood neutrophils of RB

group was significantly less (P<0.05) when compared with the expression of

neutrophilic genes in RgB group. On in vitro supplementation of IGF-1 to RB

group neutrophils, it did not significantly change relative expression of mentioned

genes. The dose of IGF-1 and duration of incubation for the in vitro studies,

could not increase the expression level of genes. Still further work is required in

this area.

Supplementation of fermented yeast culture to RB cows led to increase in the

level of plasma IGF-1, glucose, calcium, LFand decreased the level of Hp and

urea which further resulted in improvement in fertility in crossbred KF cows

under both farm and field conditions. The positively correlated parameters with

91

IGF-1 had positive effect on fertility where as negatively correlated parameters

had negative effect. Supplementation of fermented yeast culture restricted the

decline in milk yield of repeat breeding animals when compared with non

supplementing animals under farm conditions. Whereas under field condition no

such condition was observe.The values for DMI, body weight were not

significantly different between the group under farm and field condition. This

suggests mild stress or inflammation to be persisting in RB animals post partum

which led to delay in conception.

In correlation studies, it was observed that Plasma IGF-1, Glucose,

Lactofferin and Calciumparameters related positively with conception rate were

all significantly positively correlated whereas plasma Hp and urea parameters

negatively related with conception rate were also positively correlated with each

other.

Finally it is concluded that,

Differential plasma levels of different parameters studied wererelated with

Repeat Breeding problem in crossbred Karan Fries cows under both farm

and field conditions.

Supplementation of fermented yeast culture to repeat breeding crossbred

Karan Fries Cows might have resulted in providing nutrient, improvement

in nutrient utilization, rumen function which in turn resulted in

improvement of production performance. Further it reduced the repeat

breeding problem in cross bred cows under both farm and field conditions.

Relative lower level of expression of TLR-4 and Fas mRNA in

neutrophils can be relatedwith repeat breeding problem in Karan Fries

cows.

92

BIBLIOGRAPHY

BIBLIOGRAPHY

Adashi, E.Y. and Roban, R.M.1992. Intraovarian regulation. Peptidergic

signaling systems. Trends Endocrinol. and Metabol. 3: 243–248.

Adashi, E.Y. 1998. The IGF family and folliculogenesis. J. Reprod. Immunol.

39:13–19.

Akgul, C., Moulding, D.A. and Edwards, S.W. 2001. Molecular control of

neutrophil apoptosis. FEBS Lett. 487:318–322.

Alsemgeest, S.P.M., Kalsbeek, H.C., Wensing,T., Koeman, J.P., Van-Ederen,

A.M. and Gruys, E. 1994. Concentrations of serum amyloid A (SAA) and

haptoglobin (hp) as parameters of inflammatory diseases in cattle. Vet. Q.

16: 21–23.

Anand Laxmi, N., Namagirilakshmi, S., Shashikant, D.D. and Shiv, P. 2012.

Implications of supplementation of fermented yeast culture to metritic

cross bred Karan Fries cows on plasma parameters and productive

performance. I. Res. J. Agricul. Sci. and Soil Sci. 2: 459-464.

Anand Laxmi, N., Namagirilakshmi, S., Shashikant. D.D. and Shiv, P. 2013.

Implications of fermented yeast culture supplementation on plasma

parameters and productive performance of anoetrus cross bred cows.

Vet. Praction. 12: 281-287.

Arambel, M.J. and Kent, B.A. 1990. Effect of yeast culture on nutrient digestibility

and milk yield response in early- to mid lactation dairy cows. J. Dairy Sci.

73:1560–1563.

Armstrong, D.G. and Webb, R. 1997. Ovarian follicular dominance: novel

mechanisms and protein factors. Revi.of Reprod. 2: 139–146.

Arnold, R.R., Russell J.E., Champion, W.J., Brewer, M., and Gauthier, J. 1982.

Bactericidal Activity of Human Lactoferrin: Differentiation from the Stasis

of Iron Deprivation. Infect. and Immun. 35: 792 - 799.

Ashkenazi A. and Dixit V.M. 1998. Death receptors: signaling and modulation.

Sci. 281: 1305–1308.

Babior, B.M.1984. Oxidants from phagocytes: agents of defense and destruction.

Blood. 64: 959.

Baker, E.N. and Lindley, P.F. 1992. New perspectives on the structure and

function of transferrins. J Inorg Biochem. 47:147–60.

Balasubramanian, K., Lavoie, H.A., Garmey, J.C., Stocco, D.M. and Veldhius,

J.D. 1997. Regulation of porcine granulosa cell steroidogenic acute

regulatory protein (StAR) by IGF-1: synergism with FSH or protein kinase

an agonist. Endocrinol. 138: 433–439.

Barling, K. 2014. Outsmart Stress in Beef Cattle. 2014. Stress.

http://beefmagazine.com.

Baveye, S., Elass, E., Fernig, D.G., Blanquart, C., and Legrand, D. 2000.

Human lactoferrin interacts with soluble CD14 and inhibits expression of

endothelial adhesion molecules, e-selectin and ICAM, induced CD14-

lipopolysaccharide complex. Infect. Immun. 68: 6519 - 6525.

Baynes, R.D., and Bezwoda, W.R. 1994. Lactoferrin and the inflammatory

response. Adv. Experim. Med. and Bio. 357: 133 -141.

Beam, S.W. and Butler, W.R. 1999. Effects of energy balance on follicular

development and first ovulation in post partum dairy cows. J. Reprod.

Fertil. Suppl. 54: 411–424.

Beharka, A.A., Nagaraja, T.G., Morrill, J.L., Kennedy, G.A. and Klemm, R.D.

1998. Effects of form of the diet on anatomical, microbial, and

fermentative development of the rumen of neonatal calves. J. Dairy Sci.

81: 1946-1955.

Bennett, R.M. and Kokocinski, T. 1978. Lactoferrin content of peripheral blood

cells. Br J Haematol. 39: 509–521.

Beutler, B. 2000. TLR4: central component of the sole mammalian LPS sensor.

Curr. Opin. Immunol. 12:20.

ii

http://beefmagazine.com/

Bhaskaran, B. and Abdullakhan, C.K. 1981. Role of blood serum inorganic

phosphorus in postparturient anoestrous cows. Livesto. Adviser. 9: 33-36.

Birgens, H,S. 1994. The monocytic receptor for lactoferrin and its involvement in

lactoferrin-mediated iron transport. Adv. Exp. Med. Biol. 357: 99–109.

Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggett, J., Kubista, M.,

Mueller, R., Nolan, T., Pfaffl, M. W., Shipley, G. L., Vandesompele, J. and

Wittwer, C.T. 2009. The MIQE guidelines: minimum information for

publication of quantitative Real-time PCR experiment. Clin.chem. 55:

611-622.

Butler, W.R., Calaman, J.J. and Beam, S.W.1996. Plasma and milk urea

nitrogen in relation to pregnancy rate in lactating dairy cattle. J Anim Sci.

74: 858-865.

Callaway, E.S. and Martin, S.A. 1997. Effect of Saccharomyces cerevisiae

culture on ruminal bacteria that utilize lactate and digest cellulose. J. Dairy

Sci. 80: 2035-2044.

Carnegie, J.A. and Tsang, B.K. 1984. The calcium calmodulin system;

participation in the regulation of steroidogenesis activity at different stages

of granulose cell differentiation. Biology of Reprod. 30: 515-522.

Carroll, J.A. 2008. Bidirectional communication: growth and immunity in

domestic livestock. J. Anim. Sci. 86: 126–137.

Chan, J.P., Chu, C.C., Fung, H.P., Chuang, S.T., Lin, Y.C., Chu, R.M. and Lee,

S.L. 2004. Serum Haptoglobin concentration in cattle. J. Vet.Med.Sci.

66:43-46.

Chaucheryras, F., Fonty, G., Bertin, G. and Gouet, P. 1995. In vitro utilization by

a ruminal acetogenic bacterium cultivated alone or in association with an

Archea methanogen is stimulated by a probiotic strain of Saccharomyces

cerevisiae. Appl. Environ. Microbiol. 61: 3466-3467.

Chaudhury, M. 2009. Evaluation of immune response by lymphocyte proliferation

and phygocytic activity during peripartum period in high producing cows.

iii

M V Sc Thesis submitted to department of animal physiology, National

Dairy Research Institute, Karnal, Harayana, India.

Choncznski, P. and Sccchi, N. 1987.Single-step method of RNA isolation by acid

guanidinium thiocynate phenol chloroform extraction.

Anim.biochem.162:156-159.

Chung, P.H., Sandhoff, T.W. and McLean, M.P. 1998. Hormone and

prostaglandin F2 regulation of messenger ribonucleic acid encoding

steroidogenic acute regulatory protein in human corpora lutea. Endocrino.

81:153–160.

Coleman, D.A., Thayne, W.V. and Dailey, R.A. 1985. Factors affecting

reproductive performance of dairy cows. J Dairy Sci. 68:1793–1803.

Conner, J.G., and Eckersall, P.D. 1988. Bovine acute phase response following

turpentine injection. Res. Vet. Sci. 44: 82–88.

Cowburn, A.S., Cadwallader, K.A., Reed, B.J., Farahi, N. and Chilvers, E.R.

2002. Role of PI3-kinase-dependent Bad phosphorylation and altered

transcription in cytokine-mediated neutrophil survival. Blood .100:2607.

Crocker, I.P., Baker, P.N. and Fletcher, J. 2000. Neutrophil function in pregnancy

and rheumatoidarthritis. Ann. Rheum. Dis. 59: 555–564.

Crouch, S.P., Slater, K.J. and Fletcher, J. 1992. Regulation of cytokine release

from mononuclear cells by the iron-binding protein lactoferrin. Blood. 80:

235–240.

Dann, H.M., Drackley, J.K., McCoy, G.C., Hutjens, M.F., and Garrett, J.E. 2000.

Effects of yeast culture (Saccharomyces cerevisiae) on prepartum intake

and postpartumintake and milk production of Jersey cows. J. Dairy Sci.

83:123–127.

Das, J.M., Dutta, P., Deka, K.C., Biswas, R.K., Sarmah, B.C. and Dhali, A. 2009.

Comparative study on serum macro and micro mineral profiles during

oestrus in repeat breeding crossbred cattle with impaired and normal

ovulation. Livest. Res. for Rural Devel. 21: 72.

iv

Das, S., Bandopadhya, S.K., Basu, S., Ghosh, B.B. and Dattagupta, R.

2002. Blood mineral profile of normal cyclic and repeat breeder crossbred

cows under rural condition. Ind. J. Anim. Reprod. 23: 167-169.

Daughaday, W.H., Hall, K., Raben, M.S., Salmon, W.D. Jr, Van Den Brande, J.L.

and Van Wik, J.J. 1972. Somatomedin: proposed designation for

sulphation factor. Nature. 235: 107.

Dawson, K.A., Newman. K.E. and Boling, J.A. 1990. Effect of microbial

supplement containing yeast and lactobacilli on roughage fed ruminal

microbial activities. J. Anim. Sci. 68: 3392 – 3398.

Delange, J., Langlois, M., Ouyang, J., Claeys, G., De Buyzere, M. and Wuyts, B.

1998. Effect of haptoglobin phenotypes on growth of Streptococcus

pyogenes. Clin. Chem. Lab. Med. 36: 691–696.

deMoura, M.D., Choi, D., Adashi, E.Y. and Payne, D.W. 1997. Insulin-like growth

factor-I mediated amplification of follicle-stimulating hormonesupported

progesterone accumulation by cultured rat granulosa cells:enhancement

of steroidogenic enzyme activity and expression. Biol. of Reprod. 56:

946–953.

Devoto, L., Christenson, L.K., MeAllister, J.M., Makrigiannakis, A. and Strauss,

J.F. 1999. Insulin and insulin-like growth factor-I and -II modulate human

granulosalutein cell steroidogenesis: enhancement of steroidogenic acute

regulatory protein (StAR) expression. Mol. Human Reprod. 5: 1003–1010.

Dhali, 2001. Studies on the effect of feeding management system on blood and

milk urea concentration in dairy cattle. Ph .D thesis, submitted to NDRI

(Deemed University), Karnal, Haryana, India.

Dhali, A., Mishra, D.P., Mehla. R.K., and Sirohi, S.K. 2006. Usefulness of Milk

Urea Concentration to Monitor the Herd. ReproductivePerformances in

Crossbred Karan-fries Cows. Asian-Aust. J. Anim. Sci. 19: 26-30

Down, S.M., Humpherson, P.Q., Martin, K.L. and Leese HJ .1996. Glucose

utilization during induced meiotic maturation in cumulus cells enclosed

mouse oocytes. Mol. Repro. Devlop. 44: 121-131.

v

Dubowski, K.M. 1962. An o-Toluidine method for body-fluid glucose

determination. Clinical Chemistry. 8: 215-235.

Eaton, J.W., Brandt, P. and Mahoney, J.R., 1982. Haptoglobin: A natural

bacteriostat. Sci. 215: 691–693.

Eckersall, P.D. and Conner, J.G. 1990. Plasma haptoglobin in cattle (Bos taurus)

exists as polymers in association with albumin. Comp. Biochem. Physiol.

96: 309–314.

El-Belely, M.S.1993. Progesterone, estrogen and selected biochemical

constituents in plasma and uterine flushings of normal and repeat breeder

buffalo cows. J. Agri. Sci. 120: 241 – 250.

Ellison, R.T. 1994. The Effect of lactoferrin on Gram-negative bacteria 3rd. Adv.

Exp. Med. Biol. 357: 71–90.

Elmer, G.W. and McFarland, L.V. 2001. Biotherapeutic agents in the treatment of

infections diarrhoca, gas fermenterol. Quin. North. Ameri. 30: 837-854.

Elrod, C.C. and Butler, W.R. 1993. Reduction of fertility & alteration of uterine pH

in heifers fed excess ruminally degradable protein. J. Anim. Sci. 71: 694.

Elrod, C.C., Amburgh, M.V. and Butler WR. 1993. Alteration of pH in response to

increased dietary protein in cattle are uniqueto the uterus. J. Anim. Sci.

71: 702-706.

Elrod, C.C. and Butler, W.R. 1992. Endometrial ion transport: Response to urea

and ammonia. J. Anim. Sci. 71: 271.

Enemark, J.M.D. 2008. The monitoring, prevention and treatment of sub-acute

ruminal acidosis (SARA): a review. Vet. J. 176: 32-43.

Erasmus, L.J., Botha, P.M. and Kistner, A. 1992. Effect of yeast culture

supplement on production, rumen fermentation, and duodenal nitrogen

flow in dairy cows. J. Dairy Sci.75: 3056-3065.

vi

Fahey, J., Sullivan, K.O., Crilly, J. and Mee, J.F. 2002. The effect of feeding and

management practices on calving rate in dairy herds. Anim. Reprod.

Sci.74: 133–150.

Fanning, N.F., Redmnd, H.P. and Bouchier-Hayes, D. 1999. Neutrophils and

apoptosis. In The Neutrophils: New Outlook for Old Cells. Ed. DI

Gabrilovich. London: Imperial College Press. 231–242.

Ferguson, J.D., Galligan, D.T., Blanchard, T. and Reeves, M. 1993. Serum

urea nitrogen and conception rate: The usefulness of the test information.

J. Dairy Sci. 76: 3742-3746.

Flood, M.R., Gage, T.L. and Bunch,T.D. 1993. Effect of various growth-

promoting factors on preimplantation bovine embryo development in vitro.

Theriogenol. 39: 823-833.

Fuller, R. 1989. A review: Probiotics in man and animals. J. Appl. Bact. 66: 365-

378.

Funston, R.N., Seidel, G.E., Klindt, J. and Roberts, A.J. 1996. Insulin-like growth

factor I and insulin-like growth factor-binding proteins in bovine serum and

follicular fluid before and after the preovulatory surge of luteinizing

hormone. Biol. of Reprod. 55: 1390–1396.

Furmanski, P. and Li, Z.P. 1990. Multiple forms of lactoferrin in normal and

leukemic humangranulocytes. Exp. Hematol.18: 932–945.

Garg, D.D. 2008. Efficiency of utilization of leguminous straw based complete

feed blocks alone and in combination with probiotics (Saccharomyces

cerevisiae) in ration of sheep. Ph. D. thesis, Rajasthan Agricultural

University, Bikaner, Rajasthan, India.

Garrett, J. 2000. “Use Yeast Culture to “Feed the Rumen First.” Diamond V.

Gattass, Carlos, Borges, and Assumpçao. 2008. Efeito da suplementaçao com

cultura de levedura na fermentaçao ruminal de bovinos de corte. R. Bras.

Zootec. 37: 711-716 .

vii

Gauldie, J., Richards, C., Northemann, W., Fey, G. and Baumann, H. 1989. IFN

beta 2/BSF2/IL-6 is themonocyte-derived HSF that regulates receptor-

specific acute phase gene regulation inhepatocytes. Ann. N.Y. Acad. Sci.

55:746–759.

Girard, I.D. 1996. Charactetization of stimulatory activities from Saccharomyces

cerevisiae on the growth and activities of ruminal bacteria. Ph.D.

Dissertation. University of Kentucky, Lexington, UK.

Giudice, L.C. 1992. Insulin-like growth factors and ovarian development. Endoc.

Rev. 13: 641–669.

Giudice, L.C. 1995. The insulin-like growth factor system in normal and abnormal

human ovarian follicle development. The Ameri. J. Med. 98 (Supplement

1): 48S-54S.

Goldammer, T., Zerbe, H., Molennar, A., Schuberth, H.J., Brunner, R.M., Kata,

S.R., and Seyfert, H.M. 2004. Mastitis Increases Mammary mRNA

Abundance of β-Defensin 5, Toll-Like-Receptor 2 (TLR2), and TLR4 but

Not TLR9 in Cattle. Clin. Diagn. Lab. Immunol. 11: 174–185.

Gordon, I. 2005. Reproductive Technologies in Farm Animals, CABI Publishing,

London, ISBN-10: 0851998623, pp: 346.

Greenberg, S. and Grinstein, S. 2002. Phagocytosis and innate immunity. Curr.

Opin. Immunol. 14:136.

Gustafsson, H., and Emanuelson, S. 2002. Charactrisation of repeat breeding

syndrome in swedish driry cattle. Acta Vet. Scan.43: 115-125.

Hagiwara, S., Kawai, K., Anri, A. and Nagahata, H. 2003.

Lactoferrinconcentrations in milk from normal and subclinical mastitic

cows. J. Vet. Med. Sci. 65: 319–323.

Haig, D.M., Hopkins, J. and Miller, H.R. 1999. Local immune responses in

afferent and efferent lymph. Immun. 96: 155-163.

viii

Hammon, H.M., Zanker, I.A. and Blum, J.W. 2000. Delayed colostrum feeding

affects IGF-I and insulin plasma concentrations in neonatal calves. J.

Dairy Sci. 83: 85-92.

Harada, A., Sekido, N., Akahoshi, T., Wada, T., Mukarda, N. and Matsushima, K.

1994. Essential involvement of interleukin-8 (IL-8) in acute inflammation. J

Leuko. Biol. 56:599-564.

Haslett, C., Savill, J., Whyte, M.K., Stern, M., Dransfield, I. and Meagher, L.C.

1994. Granulocyte apoptosis and the control of inflammation. Philos.

Trans. R. Soc. London Biol. Sci. 345: 327.

Hayashi, F., Means, T.K. and Luster, A.D. 2003. Toll-like receptors stimulate

human neutrophil function. Blood .102:2660.

Herrick, B. and John. 1977. External factors affecting reproduction in dairy cattle.

In: Some papers contributed to the 1st All India Symposium on Animal

Reproduction, Punjab Agricultural University, Ludhiana, India, 1-9.

Highshoe, A.P., Cochran, V., Corah, L.R., Kiracofe, G.H., Harmon, D.L. and

Perry, R.C. 1991. Effects of calcium soaps of fatty acids on postpartum

reproductive functions in beef cows. J. Anim. Sci. 69: 4097 – 4103.

Hirvonen, J., Huszenicza, G., Kulcsàr, M. and Pyörälä, S. 1999. Acute-phase

response in dairy cows with acute postpartum metritis. Theriogen. 51:

1071–1083.

Horadagoda, N.U., Knox, K.M.G., Gibbs, H.A., Reid, S.W.J., Horagoda, A.,

Edwards, S.E.R. and Eckersall, P.D. 1999. Acute phase proteinsin cattle:

discrimination between acute and chronic inflammation. Vet. Rec. 144:

437–441.

Hossner, K.L., McCusker, R.H. and Dodson, M.V. 1997. Insulin-like growth

factors and binding proteins in domestic animals. Anim.Sci..64:1–15.

Hughes, A.L. and Piontkivska, H. 2008. Functional diversification of the Toll-like

receptor gene family. Immunogenetics. 60: 249–256.

ix

http://www.pubmedcentral.nih.gov/redirect3.cgi?&&auth=0nC5LI9fPTgi04pmRUBjpI42VNty8pgscH-8swkxT&reftype=publisher&artid=2431982&article-id=2431982&iid=167847&issue-id=167847&jid=319&journal-id=319&FROM=Article%7CFront%20Matter&TO=Content%20Provider%7CArticle%7CRestricted%20Access&rendering-type=normal&&http://www.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&retmode=ref&cmd=prlinks&id=18415094

Hultén, C., Sandgren, B., Skiöldebrand, E., Klingeborn, B., Marhaug, G.,

Forsberg, M.1999. The acute phase protein serum amyloid A (SAA) as an

inflammatory marker in equineInfluenza Virus infection. Acta Vet. Scand.

40: 323–333.

Hultén, C. and Demmers, S. 2002. Serum amyloid A(SAA) as an aid in the

management of infectious disease in the foal: comparison with

totalleucocyte count, neutrophil count and fibrinogen. Equine Vet. J. 34:

693–698.

Hwa, V., Oh, Y. and Rosenfeld, R.G. 1999. The insulin-like growth factor-binding

protein (IGFBP) superfamily. Endoc. Rev. 20: 761-787.

Ibraheem, K.C. and Ramachandran K. 2003. Bovine infertility: a field oriented

categorisation based on investigation among crossbred cattle in a district

of Kerala. Ind. J. of Anim. Sci. 73: 155-157.

Iwanska, S.D., Strusinska, W., Zalewski, D. and A. Opaka. 1999. The effect of

Saccharomyces cerevisiae 1026 used alone or with vitamin-mineral

premix on milk yield and milk composition in dairy cows. Acta Vet.

Hungarica. 47: 41-52.

Janeway, C.A., Travers, P., Walport, M. and Capra, J.D. 1999. The immune

system in health and disease. Immunobiology, New York: Elsevier

Science, London.

Jani, R.G., Prajapati, B.R. and Dave, M.R. 1995. Hematological and biochemical

changes in normal fertile and infertile Surti buffalo heifers. Ind. J. Anim.

Reprod. 5: 14 – 22.

JoeArosh, A., Kathiresan, D., Devanathan, T.G., Rajasundaram. R.C. and

Rajasekaran J. 1998. Blood biochemical profile in normal cyclical and

anoestrous cows. Indian. J. Anim. Sci. 68: 1154 – 1156.

Jones, J.I. and Clemmons, D.R. 1995. Insulin-like growth factors and their

binding proteins: biological actions. Endoc. Rev.16:3–34.

x

Jouany, J.P. 2001. Twenty years of research and now more relevant than ever

the coming of age of yeast cultures in ruminant diets. In: Responding to a

Changing Agricultural Landscape.Alltech’s European, Middle Eastern and

African Lecture Tour. 44-69.

Kamra, D.N. and Pathak NN. 2005. Improvement in livestock productivity by use

of probiotics: A review. Ind. J. Anim. Sci. 75: 128-134.

Kamra, D.N., Chaudhary, L.C., Singh, R. and Pathak, N.N. 1996. Influence of

feeding probiotics on body weight gain and nutrient digestibility in rabbits.

World rabbit Sci. 4: 85-88.

Kapadiya, F. M., Siddiquee, G. M., Sutariya, T. V., Patel, B. R. and Parmar, S.

M. 2013. Effect of Antibiotic Therapy on Blood Plasma Biochemical

Constituents In Repeat Breeder Mehsana Buffaloes. Wayamba J Anim.

Sci. 5: 719-722.

Kawai, K., Hagiwara, S., Anri, A. and Nagahata, H. 1999. Lactoferrin

concentration in milk of bovine clinical mastitis. Vet. Res. Commun. 23:

391–398.

Keene, W.R, Jandl, J.H. 1965. The sites of hemoglobin catabolism. Blood. 26:

705–718.

Khan, S., Thangavel, A. and Selvasubramaniyan, S. 2010. Blood Biochemical

profile in repeat Breeding cows. Tamilnadu J. Vet. Anim. Sci. 6: 75-80.

Kimura, M., Nakao, T., Moriyoshi, M. and Kawata, K. 1987. Luteal phase

deficiency as a possible cause of repeat breeding in dairy cows. British

Vet. J.143: 560–566.

Kluger, M.J., Ringler, D.H. and Anver, M.R. 1975. Fever and survival. Sci. 188: 166–168.

Kowalik, B., Michałowski. T., Pająk, J.J, Taciak, M. and Zalewska, M. 2011. The

effect of live yeast, Saccharomyces cerevisiae, and their metabolites on

ciliate fauna, fibrolytic and amylolytic activity, carbohydrate digestion and

fermentation in the rumen of goats. J Anim Feed Sci. 20: 526–536.

xi

Krehbiel, C.R., Rust, S.R., Zhang, G. and Gilliland, S.E. 2003. Bacterial direct-

fed microbials in ruminant diets: Perfomance response and mode of

action. J. Dairy Sci. 81: 120-132.

Kuijpers, T.W. 2002. Clinical symptoms and neutropenia: the balance of

neutrophil development, functional activity and cell death. European J

Pediatrics. 161: 75–82.

Kumar, U., Sareen, V.K. and Singh, S. 1997. Effect of yeast

culturesupplementation on ruminal microbial populations and metabolism

in buffalo calves fed a high roughage diet. J. Sci. Food Agric.73: 231–236.

Laborde, J.M. 2008. Effects of probiotics and yeast culture on rumen

development and growth of dairy calves. Thesis submitted to the

Graduate Faculty of the Louisiana State University and Agricultural and

Mechanical College, USA.

Laron, Z. 2001. Insulin-like growth factor 1 (IGF-1): a growth hormone. J Clin.

Pathol: Mol. Pathol. 54: 311-316.

Lauritzen, B., Lykkesfeldt, J., Skaanild, M.T., Angen, O., Nielsen, J.P. and Friis,

C. 2003. Putative biomarkers for evaluating antibiotic treatment: an

experimental model of porcineActinobacillus pleuropneumoniae infection.

Res. Vet. Sci. 74: 261–270.

Leeuwenberg, B.R., Hudson, N.L., Moore, L.G., Hurst, P.R., and McNatty, K.P.

1996. Peripheral and ovarian IGF-I concentrations during the ovine

oestrous cycle. J. Endocrinol.148: 281–289.

Liles, W.C., Kiener, P.A., Ledbetter, J.A., Aruffo, A. and Klebanoff, S.J. 1996.

Differential expression of Fas (CD95) and Fas ligand on normal human

phagocytes: implications for the regulation of apoptosis in neutrophils. J.

Exp. Med. 184: 429–440.

Lin, E.Y., Orlofsky, A., Wang, H.G., Reed, J.C. and Prystowsky, M.B. 1996. A1,

a Bcl-2 family member, prolongs cell survival and permits myeloid

differentiation. Blood. 87: 983–992.

xii

Linn, J. and Raeth-Knight, M. 2006. “Yeast in Dairy Cattle Diets.” 2006 Four

State Dairy Nutrition and Management Conference. 85-90.

Lucy, M.C., Beck, J., Staples, C.R., Head, H.H., De LaSota, R.L. and Thatcher,

W.W. 1991. Follicular dynamics, plasma metabolites, and growth factors

in lactating cows with positive or negative energy balance during the

periestrual period. Reprod.Nutr. Devel. 32: 331–341.

Lucy, M.C. 2001.Reproductive loss in high-producing dairy cattle: Where will it

end?. J. Dairy Sci. 84:1277–1293.

Maaks, S., Yan, H.Z. and Wood, W.G. 1989. Development and evaluation

ofluminescence based sandwich assay for plasma lactoferrin as amarker

for sepsis and bacterial infections in pediatric medicine. J. Biolumines

Chemilumines. 3: 221–226.

Maianski, N.A., Maianski, A.N., Kuijpers, T.W. and Roos, D. 2004. Apoptosis of

neutrophils. Acta Haematol.11:56–66.

Majdoub-Mathlouthi, L., Kraiem, K. and Larbier, M. 2009. Effects of feeding

Saccharomyces cerevisiae Sc 47 to dairy cows on milk yield and milk

components, in Tunisian conditions. Livest. Res. Rural Develop. 21: 73.

Mamluk, R., Greber, Y. and Meiden, R. 1999. Hormonal regulation of messenger

ribonucleic acid expression for steroidogenic factor-I, steroidogenic acute

regulatory protein and cytochrome P450scc in bovine luteal cells. Biol.

Reprod. 60: 628–634.

Markusfeld, D., Galon, N. and Ezra, E. 1997. Body condition score, health, yield

andfertility in dairy cows. Vet. Rec. 141: 67-72.

Maurya, M.S., Singh, R., Pathak, N.N. and Kamra, D.N. 1993. Effect of feeding

live yeast (Sachharomyces cerevisiae) on nutrient digestibility in goats. In:

Proceedings of Sixth Animal Nutrition Research Workers Conference,

Bhubaneswar, Sept. 13-16. 142.

Mazurier, J., Legrand, D., Leveugle, B., Rochard, E., Montreuil, J. and Spik, G.

1994. Study on the binding of lactotransferrin (lactoferrin) to human PHA-

xiii

activated lymphocytes and nonactivated platelets: Localisation and

description of the receptor-binding site.Adv. Exp. Med. Biol. 357:111–119.

McDougall, S. 2006. Reproduction performance and management of dairy cattle.

J. Reprod. Dev. 52:185–194.

McNall, A.D., Etherton, T.D. and Fosmire, G.J. 1995. The impaired growth

induced by zinc deficiency in rats is associated with decreased expression

of the hepatic insulin-like growth factor I and growth hormone receptor

genes. J. Nutr.125: 874–879.

Medema, J.P., Scaffidi, C., Kischkel, F.C., Shevchenko, A., Mann, M and

Krammer, P.H. 1997. FLICE is activated by association with the CD95

death-inducing signaling complex (DISC). EMBO J. 16: 2794–2804.

Medzhitov, R.P., Preston,H. and Janeway, C.A. Jr. 1997. A human homologue of

the Drosophila Toll protein signals activation of adaptive immunity.

Nature. 388:394.

Mehrzad, J., Duchateau, L. and Burvenich, C. 2004. Viability of milk neutrophils

and sevearity of bovine coliform mastitis. J. Dairy Sci. 87: 4150-4162.

Mehrzad, J., Dosogne, H., Meyer, E. and Burvenich, C. 2001. Local and

systemic effects of endotoxin mastitis on the chemiluminescence of milk

and blood neutrophils in dairy cows. Vet. Res., 32:131–144.

Miyauchi, H., Hashimoto, S., Nakajima, M., Shinoda, I., Fukuwatari, Y. and

Hayasawa, H. 1998. Bovine lactoferrin stimulates the phagocytic activity

of human neutrophils: Identification of its active domain. Cell Immunol.

187: 34–37.

Miyoshi, S., Pate, J.L., Palmquist, D.L. 2001. Effects of propylene glycol

drenching on energy balance, plasma glucose, plasma insulin, ovarian

function and conception in dairy cows. Anim. Reprod. Sci. 68: 29–43.

Morimatsu, M., Sarikaputi, M., Syotu, B., Saito, M., Yamamoto, S. and Naiki, M.

1992. Bovine haptoglobin: single radial immunodiffusion assay of its

xiv

polymeric forms and dramatic rise in acute-phase sera. Vet. Immunol.

Immunopathol. 33: 365–372

Morimatsu, M., Syoto, B., Shimada, N., Fujinaga, T., Yamamoto, S., Saito, M.

and Naiki, M. 1991.Isolation and characterization of bovine haptoglobin

from acute phase sera, J. Biol. Chem. 266: 11833–11837.

Moulding, D.A., Quayle, J.A., Hart, C.A. and Edwards, S.W. 1998. Mcl-1

expression in human neutrophils: regulation by cytokines and correlation

with cell survival. Blood. 92: 2495-2499.

Murata, H. and Miyamoto, T. 1993. Bovine haptoglobin as a possible immune

modulator in the sera of transported calves. Br. Vet. J. 149: 277–283.

Murray, J., Barbara, J.A., Dunkley, S.A., Lopez, A.F., VanOstade, X. and

Condliffe, A.M . 1997. Regulation of neutrophils apoptosis by tumour

necrosis factor-a: requirement for TNFR55 and TNFR75 for induction of

apoptosis in vitro. Blood. 90: 2772–2783

Muzio, M., Stockwell, B.R., Stennicke, H.R., Salvesen, G.S. and Dixit, V.M.

1998. An induced proximity model for caspase-8 activation. J. Biol. Chem.

273: 2926–2930.

NRC. 1989. Nutrient requirements of dairy cattle, 6th revised edition. National

Academy Press, Washington, DC,USA.

Nagata, S. 1997. Apoptosis by death factor. Cell. 88: 355–365.

Nathan, C. 2006. Neutrophils and immunity: challenges and opportunities.

Nature Revi. Immunol. 6: 173-182.

Newbold, C.J., Wallace, R.J. and McIntosh. F.M. 1996. Mode of action of the

yeast Saccharomyces cerevisiae as a feed additive for ruminants. British

J. Nutrition. 76: 249-261.

Nickerson, S.C. 1989. Immunological aspects of mammary involution. J. Dairy

Sci. 72: 1665-1678.

xv

Nikkhah, A., Bonadaki, M.D. and Zali, A. 2004. Effects of feeding yeast

(Saccharomyces cerevisiae) on productive performance of lactating

Holstein dairy cows. Iranian J. Agri. Sci. 35: 53-60.

Nisbet, D.J. and Martin, S.A. 1991. Effect of a Saccharomyces cerevisiae culture

on lactate utilization by the ruminal bacterium Selenomonas ruminantium.

J. Anim. Sci. 69: 4628-4633.

Nuttinck, F., Charpigny, G., Mermillod, P., Loosfelt, H., Meduri, G., Freret, S.,

Grimard, B. and Heyman, Y. 2004. Expression of components of the

insulin-like growth factor system and gonadotropin receptors in bovine

cumulus-oocyte complexes during oocyte maturation. Domestic Anim.

Endoc. 27: 179-195.

O’Neill, L.A. and Bowie, A.G. 2007. The family of five: TIR-domain-containing

adaptors in Toll-like receptor signaling. Nat. Rev. Immunol. 7: 353–64.

Oliver, S.P., and Sordillo, L.M. 1989. Approaches to the manipulation of

mammary involution. J.Dairy Sci. 72: 1647-1664.

Opsomer, G., Grohn, Y.T., Hertl, J., Coryn, M., Deluyker, H. and de Kruif A.

2000. Risk factors for post partum ovarian dysfunction in high producing

dairy cows in Belgium: A field study. Theriogenol. 53: 841–857.

Owens, F.N., Secrist, D.S., Hill, W.J. and Gill, D.R. 1998. Acidosis in cattle: A

review. J. Anim. Sci. 76: 275-286.

Papadopoulos, S., Lonergan, P., Gath, V., Quinn, K.M., Evans, C., O'Callaghan,

D. and Bolan, M.P. 2001. Effect of diet quantity and urea supplementation

on oocyte and embryo quality in sheep. Theriogenol. 55:1059-1069.

Parker, R.B. 1974. Probiotics in other half of the antibiotics story. Anim. Nutr.

And Health. 28: 4-8.

Parmer, K.I., Mehta, V.M. and Patel, J.M. 1986. Biochemical profile in repeat

breeding crossbred cows relations to different phases of oestrous cycle.

Indian J. Anim. Reprod. 2: 31-35.

xvi

Patel, P.M., Dhami, A.J. and Kavani, F.S. 2008. Postpartum Plasma Profile of

Calcium, Phosphorus and Magnesium in Holstein Friesian Cows With out

and with Hormone Therapy. Int. J. cow sci. 4: 6-10.

Peracchia, C. 1978. Calcium effect on gap junction structure and cell

coupling. Nature Land. 271: 669-671

Perks, C.M, Peters, A.R. and Wathes, D.C. 1999. Follicular and luteal

expression of insulin-like growth factors I and II and the type 1 IGF

receptor in the bovine ovary. J. Reprod. Ferti. 116: 157–165.

Petersen, H.H., Ersboll, A.K., Jensen, C.S. and Nielsen, J.P. 2002. Variation of

serum haptoglobin concentration in slaughter pigs of different health

status. Prev. Vet. Med. 54: 325–335.

Petersen, H.H., Nielsen, J.P., Heegaard, P.M.H. 2004. Application of acute

phase protein measurements in veterinary clinical chemistry. Vet. Res.35:

163–187.

Pfaffl, M.W. 2001. Relative Quantification in: Real-time PCR. International

University Line. 63-82.

Phillips, W.A., VonTungelin, D.L. 1984. Effect of adding yeast culture to the

receiving ration of stressed stocker calves. Anim. Sci. Rep. 117: 116-121.

Piva, G., Belladonna, S., Fusconi, G. and Sicbaldi, F. 1993. Effects of yeast on

dairy cow performance, ruminal fermentation, blood components, and milk

manufacturing properties. J. Dairy Sci. 76: 2717–2722.

Plata, F.P., Mendoza, G.D., BarcenaGama, J.R. and Gonzalez, S.M. 1994.

Effect of a yeast culture (Saccharomyces cerevisiae) on neutral detergent

fiber digestion in steers fed oat straw based diets. Anim. Feed Sci.

Technol. 49: 203-210.

Plym Forshell, K., Andersson, L. and Pehrson, B. 1991. The Relationships

between the Fertility of Dairy Cows and Clinical and Biochemical

Measurements, with Special Reference to Plasma Glucose and Milk

Acetone. J. vet. Med. 38: 608-616.

xvii

Polonovski, M. and Jayle, M.F. 1939. Peroxydasesanimales. Leur spécificité et

leur role biologique. Bull. Soc. Chim. Biol. 66: 91.

Prahalada, H.K., Kamra, D.N. and Pathak, N.N. 2002. Effect of feeding

Saccharomyces cerevisiae and Lactobacillus acidophilus on nutrient

utilization and performance of crossbred cattle calves. Int. J. Anim. Sci.16:

103-107.

Putnam, D.E., schwab, C.G., socha, M.T., whitehouse, N.L., kierstead, N.A. and

Garthwaite, B.D. 1997. Effect of Yeast Culture in the Diets of Early

Lactation Dairy Cows on Ruminal Fermentation and Passage of Nitrogen

Fractions and Amino Acids to the Small Intestine. J. Dairy Sci. 80: 374–

384.

Putnam, F.W. 1975. Haptoglobin, in: Putnam F.W.(Ed.), The plasma proteins,

Academic Press.

Rabiee, A.R., Lean, I.J., Gooden, J.M. and Miller, B.G. 1999. Relationships

among metabolites influencing ovarian function. J. Dairy Sci. 82: 39-44.

Rabiee, A.R., Lean, I.J., Gooden, J.M, Miller, B.G. and Scaramuzzi, R.J. 1997.

An evaluation of transovarian uptake of matabolites using arterio-venous

difference methods in dairy cattle. Anim. Repro. Sci. 48: 9-25.

Rahmatullah, M. and Boyde, T.R.C. 1980. Improvement in the determination of

urea using dacetylmonoxime method with and without deproteinization.

Clinica Chimica Acta. 107: 3-9.

Rao, T.N., Rao, Z.P. and Rama, P. 2001. Supplementation of probiotics on

growth performance in sheep. Indian J. Anim. Nutr. 20: 224 – 226.

Rao, S., Venkatasubramanian, V.N. and Wit, J.D. 1995. Consequenceces of

cross breeding Programme in India. Ecomo. Polit. Weekly. 30: 112-116.

Richards, M.W., Wettemann, R.P. and Schenemann, M.H. 1989. Nutitional

anestrus in beef cows: Concentrations of glucose and nonestrified fatty

acids in plasma and insulin in serum. J. Anim. Sci. 67: 2354 – 2362.

xviii

Rinderknecht, E. and Humbel, R.E. 1976. Amino-terminal sequences of two

polypeptides from human serum with non suppressible insulin-like and

cell-growth-promoting activities: Evidence for structural homology with

insulin B chain. PNAS. 73: 4379-4381.

Roberts, A.J., Nugent, R.A., Klindt, J. and Jenkins, T.G. 1997. Circulating insulin-

like growth factor I, insulin-like growth factor binding proteins, growth

hormone, and resumption of estrus in postpartum cows subjected to

dietary energy restriction. J. Anim. Sci. 75:1909–1917.

Roberts, S.J. 1971. Veterinary Obstetrics and Genital Diseases

(Theriogenology). Published by the Author, Ithaca, New York, USA. 496-

506.

Robertson, J.D., Orrenius, S. and Zhivotovsky, B. 2000. Review: nuclear events

in apoptosis. J. Struct. Biol.. 120: 346–358.

Robinson, P.H .1997. Effect of Yeast Culture (Saccharomyces cerevisiae) on

adaptation of cows to postpartum diets.J. Dairy Sci. 80: 1119-1125.

Robinson, P.H. and Garrett, J.E. 1999. Effect of yeast culture (Saccharomyces

cerevisiae) on adaptation of cows to postpartum diets and on lactational

performance. J. Anim Sci. 77: 988-999.

Rock, F.L., Hardiman, T.G., Kastelein, J.C. and Bazan, R.A. 1998. A family of

human receptors structurally related to Drosophila Toll. Proceedings of

the National Academy of Sciences (USA). 95: 588-593.

Ross, E.A., Douglas, M.R. and Wong, S.H. 2006. Interaction between integrin

a9b1 and vascular cell adhesion molecule-1 (VCAM-1) inhibits neutrophil

apoptosis. Blood.107:1178–1183.

Rossi, S., Dell-Orto C.A., Bassini, V., Chevaux, A.L.E. and Savoini, G. 2006.

“Effects of live yeast in beef cattle studied.” Feedstuffs. 11.

Royal, M.D., Darwash, A.O., Flint, A.P.F., Webb, R., Wooliams, J.A. and

Lamming, G.E. 2000. Declining fertility in dairy cattle: Changes in

traditional and endocrine parameters of fertility. Anim. Sci. 70: 487–501.

xix

Rupde, N.D., Rode, A.M., Sarode, D.B., Zade, N.N., Jagtap, D.G. and Kaikini,

A.S. 1993. Serum biochemical profile in repeat breeders. Indian J. Anim.

Reprod. 14: 79-81.

Saini, P.K. and Webert, D.W. 1991. Application of acute phase reactants during

antemortemand postmortem meat inspection. J. Am. Vet. Med. Assoc.

198:1898–1901.

Salmon, W.D. Jr., and Daughaday, W.H. 1956. Sulfation factor, a serum

component mediating the action of growth hormone in stimulating

incorporation of sulfate into cartilage. J.Clin. Invest. 35 (abstract): 733.

Salmon, W.D. Jr., and Daughaday, W.H. 1957. A hormonally controlled serum

factor which stimulates sulfate incorporation by cartilage in vitro. J. Lab.

Clini. Med. 149: 825-836.

Salonen, M., Hirvonen, J., Pyörälä, S., Sankari, S. and Sandholm, M. 1996.

Quantitative determination of bovine serum haptoglobin in experimentally

induced Escherichia coli mastitis. Res. Vet. Sci. 60: 88–91.

Savill, J., Dransfield I., Gregory, C. and Haslett, C. 2002. A blast from the past:

clearance of apoptotic cells regulates immune responses. Nat. Rev.

Immunol. 2: 965.

Saxena, M.S. 2004. Repeat breeding in cows and buffaloes. In Proc. “National

Symposium on conservation and propagation of indigenous breeds of

cattle and buffaloes” held at Pantnagar, Uttaranchal, from Feb 26-28.

Schulze-Osthoff, K., Ferrari, D., Los, M., Wesselborg, S. and Peter, M.E. 1998.

Apoptosis signaling by death receptors. European J. Biochem. 254: 439–

459.

Schumann, R.R., Leong, S.R., Flaggs, G.W., Gray, P.W., Wright, S.D.,

Mathison, J.C., Tobias, P.S. and Ulevitch, R.J. 1990. Structure and

function of liposaccharide binding protein. Sci. 249: 1429-31.

Sharma, K., Wang, R.X., Zhang, L.Y., Yin, D.L., Luo, X.Y., Solomon, J.C., Jiang,

R.F., Markos, K., Davidson, W., Scott, D.W. and Shi, Y.F. 2000. Death the

xx

Fas way: regulation and pathophysiology of CD95 and its ligand.

Pharmacol. Therapeuti.. 88: 333–347.

Shau, H., Kim A, Golub, S.H. and Leukoc, J. 1992. Modulation of natural killer

and lymphokine-activated killer cell cytotoxicity by lactoferrin. J. Leuko.

Biol. 51: 343–349.

Shehab-el-deen. 2011. Effects of metabolic stressors and high temperature on

oocyte and embryo quality in high yielding dairy cows. Ph D.Thesis

submitted to Faculty of Veterinary Medicine, Ghent University.Merelbeke.

Belgium.

Sheldon, I.M., Noakes, D.E., Rycroft, A. and Dobson, H. 2001. Acute phase

protein responses to uterine bacterial contamination in cattle after calving.

Vet. Rec. 148: 172–175.

Shingu, H., Hodate, K., Kushibiki, S., Touno, E., Oshibe, A., Ueda, Y. Shinoda,

M. and Ohashi S. 2009. Effects of growth hormone-releasing hormone

treatment on milk production and plasma hormones and metabolites in

lactating Japanese Black cows under negative energy balance. J. Anim.

Sci. 87:1247–1253.

Shugars, D.C., Watkins, C.A. and Cowen, H.J. 2001. Salivary concentration of

secretary leukocyte protease inhibitor, an antimicrobial protein, is

decreased with advanced age. Gerontol. 47: 246–253.

Silverman, L., Eimerl, S. and Orly, L. 1999. CCAAT enhancer binding protein

beta and GATA-4-binding regions within the promoter of the steroidogenic

acute regulatory protein (StAR) gene are required for transcription in rat

ovarian cells. J. Biol. Chem. 274: 17987–17996.

Simon, H.U. 2003. Neutrophil apoptosis pathways and their modifications in

inflammation. Immunol. Rev. 193: 101–110.

Skinner, J.G., Brown, R.A.L. and Roberts, L.1991. Bovine haptoglobin response

in clinically defined field conditions. Vet. Rec. 128: 147–149.

xxi

Smith, B.I., Donovan, G.A., Risco, C., Littell, R., Young, C., Stanker, L.H. and

Elliott, J. 1998. Comparison of various antibiotic treatments for cows

diagnosed with toxic puerperal metritis. J. Dairy Sci. 81: 1555–1562.

Soccol, C.R., Vandenberghe, L.P. de, S., Spier, M.R., Medeiros, A.B.P.,

Yamaguishi, C.T., Lindner, J.D.D., Pandey, A. and Thomaz-Soccol, V.

2010. The Potential of Probiotics. Food Technol. Biotechnol. 48: 413–

434.

Soder, K.J. and Holden L.A. 1999. Dry matter intake and milk yield and

composition of cows fed yeast prepartum and postpartum. Indian J.

Dairy Sci. 82: 605-610.

Spicer, L.J. and Echternkamp, S.E. 1995. The ovarian insulin and insulin-like

growth factor system with an emphasis on domestic animals. Domest.

Anim. Endocrinol. 12: 223–245.

Spicer, L.J. 2004. Proteolytic degradation of insulin-like growth factor binding

proteins by ovarian follicles: a control mechanism for selection of

dominant follicles. Biol. Reprod. 70: 1223-1230.

Steijns, J.M. and Van Hooijdonk, A.C.M. 2000. Occurrence, structure,

biochemical properties and technological characteristics of lactoferrin.

Brit. J. Nutri. 84, Suppl. 1: S11-S17.

Stein, D., Roth, S., Vogelsang, E. and Nusslein-Volhard, C. 1991. The polarity of

the dorsoventral axis in the Drosophila embryo is defined by an

extracellular signal. Cell. 65: 725-735.

Stewart, R.E., Spicer, L.J., Hamilton, T.D. and Keefer, B.E. 1995. Effect of

insulin-like growth factor-I and insulin on proliferation, and basal and

luteinizing hormone-induced steroidogenesis of bovine thecal cells:

involving of glucose and receptors for insulin-like growth factor1. J. Anim.

Sci. 73: 3719-3731.

Strassheim, D.K., Asehnoune, J.S., Park, J.Y., Kim, Q.H., Richter, D., Kuhn, K.,

Mitra, S. and Abraham, E. 2004. Phosphoinositide 3-kinase and Akt

xxii

occupy central roles in inflammatory responses of Toll-like receptor 2-

stimulated neutrophils. J. Immunol. 172: 5727.

Sudo, N., Shimizu, T., Kawashima, C., Kaneko, E., Tetsuka, M. and Miyamoto A.

2007. Insulin-like growth factor-I (IGF-I) system during follicle

development in the bovine ovary: relationship among IGF-I, type 1 IGF

receptor (IGFR-1) and pregnancyassociated plasma protein-A (PAPP-A).

Molecular Cellular Endocrinol. 264: 197- 203.

Sune, R.W. and Muhlbach P.R.F. 1998. Effect of yeast culture (Saccharomyces

cerevisiae) strain 1026 addition on milk yield and milk quality of Holstein

cows in pasture. Revista Brasileira-de-Zootecnia. 27: 1248-1252.

Takeuchi, O., Hoshino, K. and Akira, S. 2000. Cutting edge: TLR2-deficient and

MyD88-deficient mice are highly susceptible to Staphylococcus aureus

infection. J. Immunol. 165: 5392–5396.

Thatcher, W.W., LaSota, R.D., Schmitt, E.J., Diaz, T.C., Badinga, L., Simmen,

F.A., Staples, C.R. and Drost, M. 1996. Control and management of

ovarian follicles in cattle to optimize fertility. Reprod. Fertil. Devel. 8: 203–

217.

Thissen, J.P., Ketelslegers, J.M. and Underwood, L.E. 1994. Nutritional

regulation of the insulin-like growth factors. Endocr. Rev. 15: 80–101.

Thomas, L.L., Xu, W. and Ardon, T.T. 2002. Immobilized Lactoferrin Is a

Stimulus for Eosinophil Activation. J. Immunol.169: 993–999.

Uchida, E., Katon, N. and Takahashi, K. 1993. Appearance of Haptoglobin in

serum from cows at paruration. J. Vet. Med. Sci. 55: 893-894.

Urban, R.J., Garmey, J.C., Shupnik, M.A. and Veldhuis, J.D. 1990. Insulin-like

growth factor type-I increase concentrations of mRNA encoding

CYP450scc enzyme in primary cultures of porcine granulosa cells.

Endocrinology.127: 2481–2488.

Valenti, P. and Antonini, G. 2005. Lactoferrin an important host defence against

microbial and viral attack. Cellul. Molecul.Life Sci. 62: 2576- 2587

xxiii

Vogel, S.N., Fitzgerald, K.A. and Fenton, M.J. 2003. TLRs: Differential adaptor

utilization by toll –like receptors mediates TLR- specific patterns of gene

expression. Mol. Intervet. 3: 466-77.

Wang, X.P., Xu, S.Z., Gao, X. and Ren, H.Y. 2007. Genetic polymorphism of

TLR-4 gene and correlation with mastitis in cattle. J. Genet. and Genom.

34: 406-412.

Ward, C., Chilvers, E.R., Lawson, M.F., Pryde, J.G., Fujihara, S. and Farrow,

S.N. 1999 NF-kB activation is a critical regulator of human granulocyte

apoptosis in vitro. J. Biol. Chem. 274: 4309–4318.

Wathes, D.C., Fenwick, M., Cheng, Z., Bourne, N., Llewellyn, S., Morris, D.G.,

Kenny, D., Murphy, J. and Fitzpatrick R. 2007. Influence of negative

energy balance on cyclicity and fertility in the high producing dairy cow.

Theriogenol. 68: 232.

Wathes, D.C. 2008. Metabolic effects on the reproductive tract environment and

conception rates in the dairy cow. Havemeyer Found Monogr Ser. 21: 15–

19.

Wathes, D.C., Taylor VJ, Cheng Z and Mann GE. 2003. Follicle growth, corpus

luteum function and their effects on embryo development in postpartum

dairy cows. Reprod. Suppl. 61:219–237.

Wehrman, M.E., Welsh, T.H. and Williams, G.L. 1991. Diet induced hyperlipemia

in cattle modifies intracellular cholesterol environment, modulates ovarian

follicular dynamics and hastens the onset of postpartum luteal activity.

Biol. Reprod. 95: 514 – 523.

Werling, D., Piercy, J., Coffey, T.J. 2006. Expression of TOLL-like receptors

(TLR) by bovine antigen-presenting cells-potential role in pathogen

discrimination? Vet. Immunol. Immunopathol. 112: 2–11.

Westwood, C.T., Lean, I.J. and Kellaway, R.C.1998. Indications and implications

for testing of milk urea in dairy cattle: a quantitative review Part 2. Effect

of dietary protein onreproductive performance. N. Z. Vet. J. 46: 123–130.

xxiv

White, S.N., Taylor, K.H., Abbey, C.A., Gill, C.A. and Womack, J.E. 2003.

Haplotype variation in bovine Toll-like receptor 4 and computational

prediction of a positively selected ligand-binding domain. Proc. Natl. Acad.

Sci. 100: 10364-10369.

Williams, P.E.V. and Lyons, I. P. 1988. Understanding the biochemical mode of

action of yeast culture. Biotechnology in feed industry. In: Proceedings of

Alltech’s 4th Annual symposium. 79-99.

Williams, P.E., Tait, C.A., Innes,G.M. and Newbold C.J. 1991. Effects of the

inclusion of yeast culture (Saccharomyces cerevisiae plus growth

medium) in the diet of dairy cows on milk yield and forage degradation

and fermentation patterns in the rumen of steers. J. Ani. Sci. 69: 3016-

3026.

Wohlt, J.E., Finkelstein, A.D. and Chung, C.H. 1991. Yeast culture to improve

intake, nutrient digestibility and performance by dairy cattle during early

lactation. J.Dairy Sci. 74: 1395-1400.

Wolfram, P., Holm, Z., Juliane, G., Wei,.Y., Hans-Martin, S., Gerd, N. and Hans-

Joachim S. 2008. Escherichia coli, but not Staphylococcus aureustriggers

anearly increased expression of factors contributing to the innate immune

defense in the udder of the cow. Vet. Res. 39: 18.

Wright, S.D., Ramos, R.A., Tobias, P.S., Ulevitch, R.J. and Mathison, J.C. 1990.

CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS

binding protein. Sci. 249:1431-1433.

Yoon, I.K. and Stern, M.D.1996. Effects of Saccharomyces cerevisiae and

Aspergillus oryzae cultures on ruminal fermentation in dairy cows. J. Dairy

Sci. 79: 411-417.

Yu, R.H. and Schryvers, A.B. 2002. Bacterial lactoferrin receptors: Insights from

characterizing the Moraxella bovis receptors. Biochem. Cell Biol. 80: 81–

90.

Yum, H.K., Arcaroli, J., Kupfner, J., Shenkar, R., Penninger, J.M., Sasaki, T.,

Yang, K.Y., Park, J.S, and Abraham, E. 2001. Involvement of

xxv

phosphoinositide 3-kinases in neutrophil activation and the development

of acute lung injury. J. Immunol. 167: 6601.

Zhang, Y.L., Cheng, Q.F., Cao, Y.X., Wang, Y.H., Zhang, Z.S., Wu, Y.Q. and

Zhou, Y.Y. 2000. Effects of yeast (Saccharomyces cerevisiae) on milk

production and composition in Holstein dairy cows. China Dairy Cattle. 5:

20-22.

Zimmermann, K.C., Bonzon, C. and Green, D.R. 2001. The machinery of

programmed cell death. Pharmacol. and Therapeut. 92: 57–70.

Zong, W.X., Edelstein, L.C., Chen, C., Bash, J. and Gélinas, C. 1999. The

prosurvival Bcl-2 homolog Bfl-1/A1 is a direct transcriptional target of NF-

kB that blocks TNF-a-induced apoptosis. Genes Dev. 13: 382–387.

Zuccotti, G.V., Salvini, F., Riva, E. and Agostoni, C. 2006. Oral lactoferrin in HIV-

1 vertically infected children: an observational follow-up of plasma viral

load and immune parameters. J. Int. Med. Res. 34: 88–94.

Zulu, C.V., Nakao, T. and Sakamukai, Y. 2002. Insulin-Like Growth Fasctor-1 as

possible hormonal mediator of nutritional regulation of reproduction in

cattle. J. Vet. Med. Sci. 6: 657-665.

xxvi

Documents

DAIRY CATTLE PHYSIOLOGY DIVISION ICAR …...The study was also conducted at field level reared by farmers of Daradand Indri villages of Karnal. Recently calved cows free from clinical