Day Lesson SOL NGSS Activities Assessments

1 Cell Cycle and

Mitosis

BIO 5a LS1.B 1d. Genetics vocab

2d. Cell cycle and Mitosis notes

3d. Cell Cycle Worksheet

Genetics vocabulary

Cell Cycle Worksheet

2 Mitosis BIO 5a,

b, c

LS1.B 4d. Mitosis Lab

5d. Cell Regulation Notes

Mitosis Lab

3 Mitosis and

Meiosis

BIO 5a,

b, c

LS1.B 6d. Notes on Meiosis

7d. Video activity

8d. Begin Mitosis and Meiosis

flipbook

Video activity

4 Flipbook BIO 5d LS1.B Continue Flipbook Flipbook

5 Laws of

Heredity and

Punnett Squares

BIO 5d LS3.A,B 9d. Notes Mendel and Inheritance

10d. Punnett Square Activity

Punnett Square Activity

6 Study Guide –

2nd

Human Heredity

– 4th

BIO 5d LS3.A,B Study Guide

11d. Dihybrid Punnett Calculations

13d. Human Genetics Activity

Dihybrid Cross worksheet

Human Genetics Activity

7 Review – 2nd

Study Guide –

4th

Units A and B – 2nd

Study Guide – 4th

8 Review Units C and D – 2nd

Units A and B – 4th

9 Midterm – 2nd

Review – 4th

Midterm – 2nd

Units C and D – 4th

10 Human Heredity

– 2nd

Midterm - 4th

BIO 5d,

f

LS3.A,B 11d. Dihybrid Punnett Calculations

12d. Notes on other patterns of

inheritance and pedigrees

13d. Human Genetics Activity

14d. Punnett Square and Pedigree

Worksheet

Midterm – 4th

Dihybrid Cross Worksheet

Human Genetics Activity

Punnett Square and

Pedigree Worksheet

11 DNA History

and Structure

Replication

BIO 5e,

g

LS1.A 15d. DNA Replication Lab

16d. Notes on History and Structure

of DNA

17d. DNA Base Pairing Worksheet

DNA Replication Lab

DNA Base Pairing

Worksheet

12 DNA

Transcription

and Translation

BIO 5h LS1.A 18d. Protein Synthesis WebQuest

Begin Genetic Disorders Project

WebQuest

13 DNA Errors BIO 5i LS1.A 19d. DNA Transcription and

Translation Notes

20d. Transcription and Translation

Worksheet

21d. DNA Mutations Notes

22d. Mutations Worksheet

Transcription and

Translation Worksheet

Mutations

Activities

1d. Genetics Vocabulary

2d. Notes on cell cycle and mitosis

3d. Cell Cycle Coloring

4d. Cell Regulation Notes

5d. Mitosis Lab – Onion Root Tip

6d. Notes on Meiosis and cell specialization

7d. Mitosis and Meiosis video activity

8d. Flipbook Directions

9d. Notes on Mendel and Inheritance

10d. Punnett Square Worksheet

11d. Dihybrid Cross Worksheet

12d. Notes on other patterns of inheritance and pedigrees

13d. Human Genetics Activity

14d. Punnett Square and Pedigrees Worksheet

15d. DNA Replication Paperclip Lab

16d. Notes on DNA structure and Replication

17d. DNA Base Pairing Worksheet

18d. Protein Synthesis WebQuest

19d. Transcription and Translation Notes

20d. Base Pairing Worksheet

21d. DNA Mutations Notes

22d. DNA Mutations Worksheet

23d. Genetic Engineering Notes

III. Individual Lesson Plans

14 Genetic

Disorders Project

Work on Project

15 Presentations Finish Projects

Presentations

Presentations

16 Presentations

Genetic

Engineering

BIO 5j LS1.A Presentations

23d. Genetic Engineering Notes

Presentations

17 Study Guide –

Half Day

Study Guide

18 Test Review Review

19 Test BIO 5 LS1.A,B

LS3.A,B

Test Test

Mitosis and Meiosis Lesson Plan – Days 2, 3, 4

Lesson Objectives – Students will be able to:

Create a diagram to model the stages of mitosis and explain the processes occurring at each

stage

Create a diagram to model the stages of meiosis and explain the processes occurring at each

stage.

Compare and contrast the process of mitosis and meiosis and determine under which conditions

each process will occur

SOLs –

BIO.5 The student will investigate and understand common mechanisms of inheritance and protein

synthesis. Key concepts include

a) cell growth and division;

b) gamete formation

Materials and Resources –

Microscope, Onion root tip slides, colored pencils

Classroom Management and Safety Issues –

Talk to students about proper microscope use and how to carry it across the room

Procedure –

Engage: 5 minutes

1. Students will get out their warm-up notebooks and will answer the question, “During which stage of

mitosis do the chromosomes line up in the middle of the cell?” This will be a formative used to gauge if

they understood the material taught in the previous lesson.

Explore: 45 minutes

2. Students will get a partner and will receive the mitosis lab activity sheet. We will read over the

instructions and then I will give them a onion root tip slide. This is a formal assessment of whether they

understand what is happening during the stages of mitosis and also how well they can use the

microscope. When the lab is finished they will hand the slides back to me and put the microscopes

away.

Explain: 25 minutes

3. I will use a Powerpoint presentation/ discussion to teach the students the process of Meiosis. Students

will follow along during the presentation. I will periodically ask questions to gauge their understanding.

4. On the last slide we will discuss the differences and similarities between meiosis and mitosis.

Elaborate: 15 minutes

5. Students will receive and activity sheet that has questions based on a video that we will watch on

meiosis and mitosis. This will give the students a more visual representation of what is occurring during

the different stages through the use of a model.

Evaluate: 2 days

6. I will give the students directions to an in-class project that we will work on for the next few class

periods. They will be making a flipbook of the stages of mitosis and meiosis. Each page will include a

visual depiction of the stage as well as a description below. After grading the assignment I will hand it

back to them so they can use it to study for the unit test. This assignment and the unit test are

summative assessment that will be used to see if the students understand the material.

Name _________________________

Observing Mitosis Lab Background:

In a growing plant root, the cells at the tip of the root are constantly dividing to allow the root to grow. Because each cell divides independently of the others, a root tip contains cells at different stages of the cell cycle. This makes a root tip an excellent tissue to study the stages of cell division.

Materials:

prepared slides of onion (allium) root tips

microscope

Procedure: 1. Get one microscope for your lab group and carry it to your lab desk with two hands. Make sure that the low power objective is in position and that the diaphragm is open to the widest setting. 2. Obtain a prepared slide of an onion root tip (there will be three root tips on a slide). Hold the slide up to the light to see the pointed ends of the root sections. This is the root tip where the cells were actively dividing. (The root tips were freshly sliced into thin sections, then preserved when the slide was prepared.) 3. Place the slide on the microscope stage with the root tips pointing away from you. Using the low-power objective to find a root tip, and focus it with the coarse adjust until it is clearly visible. Just above the root “cap” is a region that contains many new small cells. The larger cells of this region were in the process of dividing when the slide was made. These are the cells that you will be observing. Center the image, then switch to high power. 4. Observe the box-like cells that are arranged in rows. The chromosomes of the cells have been stained to make them easily visible. Select one cell whose chromosomes are clearly visible. (If you need to change the focus when using high power, remember to only use the fine adjust!) 5. Sketch the cell that you selected in the box on the right. 6. Look around at the cells again. Select four other cells whose internal appearances are different from each other and the first one that you sketched. Sketch them in the boxes below.

7. As you look at the cells of the root tip, you may notice that some cells seem to be empty inside (there is no dark nucleus or visible chromosomes). This is because these cells are three dimensional, but we are looking at just thin slices of them. (If you slice a hard boiled egg at random, would you definitely see the yolk in your slice? No.) We want to continue to look at the cells, but we will ignore any where we cannot see the genetic material (dark areas). 8. Looking along the rows of cells, identify what stage each cell is in. Use the photos below as

guide.

Interphase Prophase Metaphase Anaphase Telophase

(dark mass) (chromosomes (chromosomes (pulling (two nuclei) visible but lining up apart)

not organized) along equator) 9. Use the data table to record the number of cells that you see in each of the stages. The easiest way to do this is for one person to look through the microscope, going along each row of cells. For each cell, say out loud what stage the cell appears to be in. Another student can make tally marks for each stage.

Stage of Cell Cycle Number of cells in the Stage:

Interphase

Prophase

Metaphase

Anaphase

Telophase

Analysis & Conclusions: 1. What stage were the majority of the cells in?

2. What percentage of the cells were in each stage?

Interphase

Prophase

Metaphase

Anaphase

Telophase

3. What evidence shows that mitosis is a continuous process, not a series of separate

events? 4. The onion plant began as a single cell. That cell had X number of chromosomes. (The exact number does not matter, we will just call that number “X”.) How many chromosomes are in each of the cells that you observed? (Give the answer in terms of X.) How do you know?

5. If this onion would reproduce sexually, it would need to produce sperm and/or eggs by the process of meiosis. After meiosis, how many chromosomes would be in each sex cell (in terms of X)?

6. If this onion would complete the process of sexual reproduction (fertilizing an egg cell), how

many chromosomes would be in the zygotes that are produced (in terms of X)?

Mitosis and Meiosis Video Activity – 8d

1. What does diploid mean?

2. What do the beads represent in this simulation?

3. During what phase of interphase is the DNA replicated?

4. What happens during metaphase of mitosis?

5. What pulls the chromatids apart in anaphase?

6. What is the goal of mitosis? Meiosis?

7. How many divisions occur in meiosis?

8. What happens to chromosomes in meiosis during prophase I that is different from prophase in mitosis?

9. During what stage are 2 new nuclei made?

10. How many cells do we end up with at the end of mitosis?

Mitosis and Meiosis Flipbook

You have been contracted by Montgomery County Public Schools to make a flip

book that represents the different stages of mitosis and meiosis. They are looking for

something that is attractive to the eye and also makes it for the person reading it to

understand. Although they are giving you artistic license to draw however you want, they

have strict guidelines for the book that they want you to follow.

The book must have a title page

Each page must have a drawing of the phase it is covering

All drawings must be in color

Each page needs a description of what is occurring in that phase

They have also provided a set of instructions for what each page must have on it.

Page 1 – Title that is colored, name Page 10 – Metaphase I of Meiosis

Page 2 – The word Mitosis Page 11 – Anaphase I of Meiosis

Page 3 – Prophase of Mitosis Page 12 – Telophase I of Meiosis

Page 4 – Metaphase of Mitosis Page 13 – Cytokinesis (2 Cells)

Page 5 – Anaphase of Mitosis Page 14 – Prophase II of Meiosis

Page 6 – Telophase of Mitosis Page 15 – Metaphase II of Meiosis

Page 7 – Cytokinesis Page 16 – Anaphase II of Meiosis

Page 8 – The word Meiosis Page 17 – Telophase II of Meiosis

Page 9 – Prophase I of Meiosis Page 18 – Cytokinesis (4 Cells)

They have provided an example of what each page should look like.

Rubric

Metaphase

Chromosomes line up along the center of the cell

Page Number Drawing (2 Points) Coloring (1 Points) Description and Title

(2 Points)

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

_____/84

DNA Replication, Transcription and Translation – Days 11 and 12

Lesson Objectives – Students will be able to:

Given a DNA sequence be able to write a complementary mRNA strand

Explain the process of DNA replication

Explain the process of protein synthesis, including DNA transcription and translation

SOLs –

BIO.5 The student will investigate and understand common mechanisms of inheritance and protein

synthesis. Key concepts include

g) the structure, function, and replication of nucleic acids;

h) events involved in the construction of proteins;

Materials and Resources –

Paperclips, computer

Classroom management and safety issues –

Put limits on what websites students can access when we do the computer lab

Procedure –

Go over the homework from the night before – 5 min

Engage: 5 min

1. Students will be shown a 3D model of DNA and asked if they know what it is. Students will turn to their

partners and will discuss everything they remember about DNA from middle school. We will then open up

to a class discussion. This will gauge students’ prior knowledge of DNA and will encourage collaboration

in the classroom. It will also inform me what I need to cover in the most detail.

Explore: 50 min

2. Students will get with a partner and will receive a bag of paperclips to perform the lab. In the lab the

students will be simulating replication of DNA by using 4 different colored paperclips for each of the

nucleotides. I will formally assess their understanding of replication using the activity sheet for the lab and

informally assess by walking around during the lab and listening for discussion.

I got this lab from www.tiemanbiology.com and it is titled DNA Replication Paper Clip Activity

Explain: 20 min

3. I will use a PowerPoint to facilitate a class discussion on transcription and translation of DNA. To assess

their understanding I will ask questions throughout the presentation such as, “What does DNA stand for?”

“What is the shape of DNA?” “If we look at DNA like a ladder what would represent the rungs?” This will

make the students think critically about the topic and allow me to gauge understanding.

Elaborate: 50 min

4. Students will go to the computer lab and will work on a webquest that covers the topic of protein

synthesis. I will formally assess their understanding using the activity sheet that goes along with the

webquest and I will informally assess them by walking around and answering questions.

I modified this activity from one that I found on www.crestwood.sparcc.org

Evaluate: 25 min

5. Students will complete an activity sheet on replication, transcription and translation. This will be their

summative assessment on the topic of DNA.

DNA Replication: Paper Clip Activity

Name ____________________________________________________________ Block _________

Quick Review:

7. Each DNA molecule has a unique structure that makes it different from other DNA molecules (or genes.)

8. This difference occurs because the sequence of A, T, C, and G vary from one molecule or gene to another.

What You Need to Know About DNA Replication:

9. To “replicate” means to produce a copy of itself. DNA is the only known molecule that can do this.

10. DNA is able to make an exact replica of itself because of the base pairing characteristics stressed earlier (A with T and C with G).

11. When DNA makes a duplicate molecule of itself, the two strands unwind. 12. After the two strands have pulled apart, new bases (A, T, C, & G) as well as new sugar

and phosphate units come into place according to the base pairing rules. 13. A comes in opposite of T, and C is opposite of G. 14. When this occurs, two identical DNA molecules are created.

______________________________________________________________________________________ Activity Overview:

You will be making a short sequence of a human gene that controls the body’s production of the growth hormone, which causes growth during childhood and adolescence. Genetic engineers call this gene the hGH (human Growth Hormone) gene. This gene is actually made of 573 nucleotide base pairs. You will only construct the first ten bases in the gene.

For this activity, each pair of students will need the following: 14 Blue clips = Adenine (A)

14 Yellow clips

= Thymine (T)

9 Red clips = Cytosine (C) 9 Green clips = Guanine (G)

This activity should take about 35-40 minutes.

STEP ONE: Use the colored paper clips according to the key above and construct the top strand of the hGH according to the diagram of the gene below. Link the ten appropriate colored clips for the top chain shown below.

1 2 3 4 5 6 7 8 9 10 A- A- G- C- T- T- A- T- G- G T- T- C- G- A- A- T- A- C- C

Notice that the bottom strand of the DNA molecule follows the “rule of complementarity,” which means that A bonds with T, and C bonds with G. STEP TWO: Now construct the bottom strand of the hGH gene by linking ten more clips into a chain according to the pattern above. The entire sequence of this gene is known. Your DNA model should resemble the following:

STEP THREE: Set the two chains side-by-side as shown in the drawing above so that A bonds with T, and C bonds with G. You now have a model of the hGH gene (the first ten bases only.)

Compare the two chains with each other side-by-side to verify that C bonds with G, and A bonds with T. When this gene replicates in the nucleus of a cell, the double-strand begins to separate at one end. As it separates, new nucleotide bases are moved into place by enzymes, which form the beginning of two new identical molecules. These A, T, C, and G bases are present in the nucleus of each cell and come from food molecules. When these new bases are brought into place, the A bonds with T, and the C bonds with G.

STEP FOUR: Open your hGH DNA molecule as shown below:

STEP FIVE: Now use the other available clips to create the beginning of two new strands. Remember A with T and C with G. Connect the clips as follows:

STEP SIX: Continue separating the strands and bring in appropriate new bases (clips) to create two complete new double-stranded hGH gene molecules. Remember that A bonds opposite to T, and C is opposite of G. You should have six clips left. Save them for later.

Answer the questions that follow:

3. Examine the two double-stranded DNA molecules. Are they identical or different in any way?

6. If you were asked to replicate each of the two DNA molecules on your table to create

four identical DNA molecules, how would you go about doing this?

3. You now have two copies of a segment of the hGH gene on your table. During periods of growth and cell division, the chromosomes, which are made up of genes, must divide. What features about DNA replication causes each new DNA molecules to be exactly like the original?

*Cells can divide along with their DNA in this manner without any errors for thousands of replications. On occasion an error can occur. When this type of error occurs in a cell that is destined to become an egg or a sperm cell, it is called a “mutation.” So what is a gene mutation?

STEP SEVEN: To demonstrate a gene mutation, place one of your paper clip hGH DNA strands in front of you. Identify the second nucleotide base called Adenine (A), which is blue. To cause a

mutation, remove this 2nd

blue clip and replace it with a red Cytosine (C) clip. You have just demonstrated how a mutation occurs. This replacement usually occurs when the DNA is replicating.

4. When this mutated DNA molecule replicates, will the resulting new DNA be similar or different from the hGH gene? Explain.

*This type of mutation can be caused by a variety of circumstances, including radiation, chemical exposure, or it can occur spontaneously without known cause.

5. Draw structures of the new double-stranded mutated gene you created by using the letters A, T, C, and G in a manner similar to that shown earlier.

*Since the sequence of bases is different in this molecule, the genetic code is different. This gene CANNOT direct the cell to produce normal human growth hormone.

6. In your own words, explain how mutations can occur in cells and how this might affect the new organism with the mutation.

NAME_____________________ Protein Synthesis WebQuest

Topic: Protein Synthesis

A. Go to: http://www.wisc-online.com/objects/index_tj.asp?objid=AP1302

Read the animation page by page – just click the “next” button when you are ready to

move on.

1. How does the mRNA leave the nucleus?

2. Is just one mRNA molecule made? Explain.

3. How many amino acids does each codon code for?

4. Describe the structure of a tRNA molecule.

5. Where does the energy to form the peptide bond between two amino acids come

from?

6. Can a single mRNA be read more than once? Explain.

B. Go to: http://learn.genetics.utah.edu/units/basics/transcribe/

Click the button that says “click here to begin”

Use the keyboard to type the bases that would form the mRNA.

1. List your bases from mRNA:

2. Which process did you just complete?

Follow the instructions to determine the order of the amino acids.

3. What is the first amino acid?

4. List the order of your amino acids.

5. How did the process know to end?

6. Which process did you just complete?

Read the script on the right side of the webpage.

7. Describe the process of transcription.

8. Describe the process of translation.

Overview:

Go to: http://www.zerobio.com/drag_oa/protein/transcription.htm

Scroll down and complete the transcription activity. Check to see if you are correct

1. Which base in RNA is replaced by uracil?

2. How many mRNA codons are illustrated above?

3. What is the name of the enzyme that creates the mRNA copy from DNA?

4. What is the name of the sugar in the mRNA nucleotides?

5. What is the mRNA transcript for the DNA sequence, TTACGC

Click Next at the bottom of the page.

Scroll down complete the translation activity . Check to see if you are correct.

1. What organelle assists tRNA in translating the mRNA in the cytoplasm?

2. The role of tRNA is to carry a(n):

3. Is a tRNA anticodon more similar to DNA or RNA in nucleotide sequence?

4. If the mRNA codon is CGA, the tRNA anticodon that binds with it is:

Name ______________________________ Period:_________________

DNA Base Pairing Worksheet There are base pairing rules for writing complimentary DNA strands for a given

strand. A pairs with T C pairs with G

In RNA, A pairs with U, instead of T. Write the complimentary DNA strand for each given strand of DNA.

9. CGTAAGCGCTAATTA

10. TCTTAAATGATCGATC

11. AATGAATAGCTAGCTT

12. GGCATTCGCGATCATG

13. CGTTAGCATGCTTCAT

14. ACTAACGGTAGCTAGC

Now write the mRNA strand for the given DNA strand.

15. ATGTCGCTGATACTGT

16. GAAGCGATCAGTTACG

17. AATGAATAGCTAGCTT

18. GGCATTCGCGATCATG

19. CGTTAGCATGCTTCAT

20. ACTAACGGTAGCTAGC

Now you will translate the amino acid sequence for the given tRNA strand.

Remember that codons are 3 base pairs long.

4. AUG CAC UGU CCU UUC GCU GAC

5. GAG AUC UGG UUG GAA UCG

6. AGC GUA UUA ACG UAU CAU

7. AGU CGA UCG AUG CGG AUG AUA

8. GUC GUC GAU AGC UAU CAU GCA

Transcribe the following DNA strand.

7. TGAGTCGACTGGCTGACCGTAGAC

8. CTTGGCTTATGGTGGTTCGCTCGC

The following are pieces of mRNA. Give the DNA strand from which it was transcribed.

4. GAGAUCUGGUUGGAAUCG

5. AGCGUAUUAACGUAUCAU Complete the table below showing the sequences of DNA, mRNA codons, tRNA anticodons and

the amino acids. Remember the genetic code is based on mRNA codons.

DNA

1. 2. GAT 3.

mRNA codon

UAU

4. 5.

6.

Amino Acid

Tryptophan 10. 11. 12.

5. Using the following piece of DNA, give the mRNA molecule and

the amino acid sequence for which it codes. DNA – A T A T A A A C G A G G A A A T T C C G G G C G mRNA –

Amino acids –

2. Use the mRNA sequence to find the DNA sequence and the amino acid sequence.

DNA – mRNA – A U G C C U A C A U G U G G U G U A A C C U U

A Amino acids –

IV. Assessment

I plan to assess student understanding in a variety of different ways. Throughout each of

my lessons I have informal formative assessment to help me gauge whether the students

understand the material before I move on to new topics. Most of the time my informal

assessments come in the form of group work and class discussions. This ensures that the students

do not fall behind in the material. I also included formal assessments in each lesson plan in the

form of labs, worksheets, web quests, etc. This provides support and practice for each topic. I

walk around during each assignment as well to informally assess that they are doing the work

correctly. Finally, the unit culminates in 2 summative assessments, one in the form a test and the

other in the form of a presentation. I chose to do two different types of summative assessments in

order to see if the students have fully mastered the material. The ability to apply content in a

variety of ways shows mastery. All of my assessments are written with the lesson objectives in

mind, which are all taken from the SOLs. Each lesson plan starts with the lesson objectives listed

as well as the SOLs so I can show what it is I want the students to achieve from each lesson.

From there I include activities that facilitate the learning of each topic as well as other types of

assessments to guarantee mastery. Below are some of the assessments that I used throughout this

unit.

Genetic Disorders Research Project

You have been challenged to incorporate your knowledge about cells, cell division, genetics, and

DNA to research and present on a specific genetic disorder. You have already completed your

basic study about the ideas of genetics and mutations. Now with the information that you have

you are being asked to research a specific genetic disorder and give an oral presentation along

with creating an engaging presentation in the form of a PowerPoint.

Your presentation should include all of the following information:

The name of the disorder

Who discovered the disorder and who has done research

Signs and symptoms

What causes the disorder?

How is the disorder inherited? Sex-linked or autosomal? Recessive or dominant? Etc.

What types of treatments are given to someone with this disorder?

How is this disorder diagnosed?

How many people in the population have this disorder? Is one gender affected more

frequently?

2 interesting facts about the disorder

List of references

Other important information:

You will receive a random genetic disorder chosen out of a beaker.

We will have 2 full days in class to work on this project. Our days in the computer lab are

going to be 4/10 and 4/14. Whatever you do not finish in class must be done at home.

Presentations are going to be given on Tuesday 4/15, the order will be determined

randomly. The presentation should last for 5-7 minutes and should allow 3 minutes for

questions at the end.

Your presentation must have at least 3 references listed in APA format

Rubric for Presentations

Criteria Points Possible Points Awarded Comments

Name of Disorder 5

Discoverer and Researchers

5

Signs and Symptoms

10

Cause of disorder 10

How the disorder is inherited

10

Treatments 10

How the disorder is diagnosed

10

Who has the disorder

10

2 interesting facts 10

References 5

Eye Contact 5

Time (5-7 min) 5

Voice Volume 5

Total _________________

List of Possible Disorders

Angelman syndrome Angelman syndrome Celiac Disease Celiac Disease Color Blindness Color Blindness Cystic Fibrosis Cystic Fibrosis Down Syndrome Down Syndrome Duchenne Muscular Dystrophy Duchenne Muscular Dystrophy Fragile X Syndrome Fragile X Syndrome Hemophilia Hemophilia Huntington’s disease Huntington’s disease Klinefelter syndrome Klinefelter syndrome Noonan Syndrome Noonan Syndrome Phenylketonuria Phenylketonuria Polycystic Kidney Disease Polycystic Kidney Disease Sickle-cell Anemia Sickle-cell Anemia Tay Sachs Disease Tay Sachs Disease Triple-X Syndrome Triple-X Syndrome Turner’s Syndrome Turner’s Syndrome

Genetics Test

Multiple Choice – (2 points each)

_____ DNA replication occurs during which phase of the cell cycle?

a. G1 phase b. S phase c. G2 phase d. M phase

_____ Cell division in prokaryotic organisms is called

a. Binary fission b. Meiosis c. Mitosis d. Cytokinesis

_____ The collective name for the phases of the cell cycle in which no division takes place is

a. Mitosis b. M phase c. Meiosis d. Interphase

_____ During what phase of Meiosis does crossing over occur between homologous

chromosomes?

a. Prophase I b. Metaphase I c. Metaphase II d. Prophase II

_____ Which of Mendel’s laws of inheritance states that during meiosis alleles separate and

move to different cells?

a. Law of Dominance b. Law of Fertilization c. Law of Segregation d. Law of Independent Assortment

_____ DNA contains all of the following nitrogenous bases except

a. Uracil b. Guanine c. Thymine d. Cytosine

_____ Which of the following nitrogenous bases pairs up with cytosine?

a. Adenine b. Uracil c. Thymine d. Guanine

_____ What is the correct sequence of the complementary DNA strand of ATCGTAGCT?

a. GCTACGATC b. TCGATGCTA c. ATCGTAGCT d. TAGCATCGA

_____ What is the percentage of G if the percentage of T is 20%?

a. 15% b. 20% c. 30% d. 40%

_____ What is the sugar that is present in RNA?

a. Uracil b. Deoxyribose c. Ribose d. Glucose

_____ Which type of point mutation results from the addition of an extra base into the code?

a. Inversion b. Deletion c. Substitution d. Insertion

_____ What type of chromosomal mutation is the result from a loss of part or all of the

chromosome?

a. Duplication b. Deletion c. Substitution d. Translocation

Matching Section – (2 points each)

_____ Physical characteristics a. homologous

_____ The genetic makeup b. homozygous

_____ The term for two of the same alleles c. phenotype

_____ The term for two different alleles d. genotype

_____ One chromosome from each parent e. heterozygous

Phases of Mitosis – Put the phases of mitosis in order from 1-5 then write what is happening

in each stage (10 points)

_____ Metaphase - ______________________________________________________________

_____ Telophase - ______________________________________________________________

_____ Cytokinesis - _____________________________________________________________

_____ Prophase - _______________________________________________________________

_____ Anaphase - ______________________________________________________________

Mitosis vs Meiosis Chart – Fill in the chart with differences between mitosis and meiosis

(16 points)

Criteria Mitosis Meiosis

Purpose

Number of divisions

Daughter cell # of chromosomes (haploid or diploid)

Where it takes place

Punnett Squares

In flies, blue eyes are dominant to red eyes.

what are the genotypes of the possible offspring

of a male who is heterozygous dominant and a

female that is homozygous recessive? (5 points)

_________________________________

What is the chance that a male who is heterozygous

for type A blood and a female that is heterozygous

for type B blood could give birth to a child with type

O blood? (5 points)

_________________________________

Freckles are dominant to no freckles and dimples are dominant to no dimples. Perform a cross

between a male that is heterozygous for both traits and a female that is homozygous recessive for

both traits. (7 points)

What are the chances that

a child will have dimples

but no freckles?

_______________________________

Protein Synthesis

Transcribe the following DNA strand into mRNA (5 points)

TAC CTG GCC ACT

________________________________

Using the amino acid chart determine

the sequence of amino acids from your

transcribed mRNA (5 points)

________________________________

________________________________

________________________________

Pedigrees

Using the pedigree to the right, answer

the following questions.

1. Is this pedigree recessive or

dominant?

_______________________________

_______________________________

2. What evidence can you use to

support your claim?

______________________________________________________________________________

______________________________________________________________________________

3. Which genotype must the first female in generation two have using XN

as the normal allele

and Xn as the affected allele?

______________________________________________________________________________

______________________________________________________________________________