DEER TEAM

Behavior Monitoring and Genetic Molecular Analysis of Wild Sika Deer Teachers: Field – Naoki Agetsuma, Yoshimi Agetsuma-Yanagihara, Mari Nishikawa Genome – Miho Murayama Students: Chikara Kusakabe, Kei Hazehara, Mao Asami, Mayuko Nomoto, Nurul Ain Mohd Sharif, Rodrigo de Souza Amaral Introduction The sika deer (Cervus nippon) is known as the Japanese deer where “sika” came from the Japanese word means “deer”. They can be found widely from tropical to subarctic regions. Seven subspecies of deer are found in the Japanese Archipelago (Macdonald 1984). Sika deer exhibit a gradient in body size from south to north (Whitehead 1993). The largest subspecies C. n. yesoensis, inhabits boreal forests in the northern regions of Japan. The smallest subspecies of sika deer, C. n. yakushimae, on which we focused in this study, inhabits evergreen broad-leaved forests in marginal areas of the warm temperate and subtropical zone (Whitehead 1993; Agetsuma et al., 2011). The behaviors of sika deer may vary from individuals. By now, little information is available on behaviors and social interactions of wild Japanese sika deer. Genetic studies provide lot of useful information such as kinship information, male reproductive success, gene flow and genetic diversity of organisms. Until recently, molecular genetic analyses of animals especially primates have been limited by the availability of blood or tissue samples for DNA extraction (Surridge et al., 2002). However, the non-invasive DNA sampling such as fecal samples can has been used widely as alternative sources of cellular material without physically handling wildlife. Fecal DNA samples are used to identify the individuals and sex, relatedness estimates, pedigree construction, estimates of census and effective population size, mark-recapture data, and determination of genetic variation within and between populations (Luikart and England 1999; Taberlet et al. 1999; Frantz et al. 2003). Objectives 1. To study the behaviors and social interactions among wild deer. 2. To identify the sex using genetic markers and genotype mitochondrial haplotype from non-invasive samples (feces). 3. To analyze relationship between social interactions and mitochondrial types. 4. To measure rate of successful sequencing mitochondrial DNA from fecal samples under various conditions.

Materials & Methods Field research was conducted in the western part of Yakushima Island (30˚N, 131˚E), Kyusyu,

Japan from May 22nd, 2016 to May 26th, 2016 (Fig.1). Ecosystem of Yakushima is unique in the temperate areas of the Northen Hemisphere with successive vertical plant distribution and the high rainfall, in excess of 8,000mm annually, including 1,900 plant species and subspecies, 16 mammal species and 150 bird species that makes a rich biodiversity (UNESCO, 2016).

Figure 1. Map of the study area (Tsujino et al., 2004)

We studied three types of fecal samples to investigate sexing and genotyping methods from non-

invasive samples. 1) Fresh 47 fecal samples that collected just after defecation. 2) 20 samples that left outside for few days (Field experiment). 3) 5 samples reserved in a freezer for one year. We determined their sex and mitochondrial haplotype, and then compared with social interactions and their behaviors. (a) Recording behaviors and social interactions

We followed a deer by two people: one was behavioral observer and another was fecal collector.

Behavior and posture of the focal animal was recorded at 2-minute interval (scan sampling) and social interactions between the focal one and other deer were also recorded whenever it happened (ad lib sampling) by the behavioral observer for 2 hours preferably. Behavior was classified into following defined activities: feed: sniffing, masticating or food taking; move: walking without other behaviors; rest: no action, yawing or stretching; ruminate: vomiting, chewing and swallowing; self groom: combing themselves by teeth, or scratching by legs; social interaction: interaction with other individuals; alert: staring at something; and other, behaviors not included in the above categories.

Social interactions were roughly divided into the affiliative interaction or the agonistic interaction. The affiliative interaction included groom and groomed, sniff and sniffed, approach and approached within 1m from focal deer, and stay within 1m from focal deer. When more than two kinds of interactions were recorded at same time, for example, approach and sniff the other, we

recorded only sniff because sniffing couldn’t happen without approaching. The agonistic interactions included replace: approach and others avoid; and replaced, chase and chased, bite and bitten, kick and kicked by hind legs, punch and punched by forelegs, or charge: body attack; and charged.

The fecal collector followed and observed both focal deer and deer that interacted with focal one carefully and collected fecal pellets just after defecation.

DNA samples were collected from fecal pellets by wiping off the surface using cotton swab (Fig. 2). The samples were preserved in 1ml of lyses buffer (0.5% SDS, 100mM EDTA, 100mM Tris-HCl and 10mM NaCl (Hayaishi and Kawamono, 2006; Longmire et al. 1997)) and kept in cool and dark place.

Figure 2. Fecal sampling method. ①Soak a new cotton swab in lyses buffer. ②Rub the surface of the feces.

③Soak that in the buffer, stir gently. ④Remove buffer by pressing the swab.

(b) Field experiment Fecal samples that collected just after defecation from three males were used. Those fecal pellets

were set under two conditions, 1:on the forest floor covered by forest canopy (natural condition), 2: on the exposed ground (sever condition). To compare the condition of samples, surface of the pellets and weather were recorded everyday. Every DNA samples were collected from 1-2 pellets under each condition on 2, 5, and 8 days after setting. Those samples were compared the rate of successful sexing and sequencing mitochondrial DNA. (c) Sex identification

We used QIAamp Stool Kit (QIAGEN) to extract DNA from samples. To determine sex, the

region in the amelogenin gene that was developed for sika deer was used (Yamauchi et al. 2000). DNA extraction

For DNA extraction, we followed the protocol of the kit. Briefly, 0.8ml ASL buffer was added to the lyses buffer containing DNA samples and adjusted to about 1.4ml total. After centrifuging the sample at 14,000rpm for 1min, 1 inhibitEx tablet was added to each supernatant liquid of the sample. The tablet needed to be completely dissolved by vortex then incubated for 1min at room temperature. The suspension was centrifuged at 14,000rpm for 3min and supernatant liquid was transferred into a new tube. After centrifuging again at 14,000rpm for 3min, proteinase K and 600 µl of Buffer AL were added to 600µl of supernatant liquid and incubated at 70 oC for 1hour. 600 µl of 99.5% Ethanol was added to the lysate and mixed by vortexing. 600 µl of lysate was added in QIAamp spin column, then

centrifuged at 14,000rpm for 1 min. The filtrate was discarded. Former procedure was repeated twice. 500 µl of AW1 was added to the spin column and centrifuged at 14,000rpm for 1min. Then, AW2 was added to that and centrifuged at 14,000rpm for 3min. After discarding the filtrate, centrifuge that again at same speed for 1min. The spin column was placed to new tube, and 200 µl of warm H2O was added dissolve DNA. After incubating at room temperature for 15min, the sample was centrifuged at 14,000rpm for 1min. PCR amplification

To amplified the region, two primers: KY1(GCCCAGCAGCCCTTCCAG) and KY2(TGGCCAAGCTTCCAGAGGCA) were used. Amplification was conducted in a 10 µl of mixture containing 2.0 µl of template DNA, 0.7 µl of H2O, 5.0 µl of Buffer, 0.1 µl of T4Gene32Protain, 1.6 µl of dNTP, 5pmol of primers KY1 and KY2, and 0.1 µl of LA Taq DNA polymerase. The denaturing process took place at 95ºC for 2min, and was followed by 45cycles of 95ºC 30s, 65ºC 30s, 74ºC 1min. Final extraction was at 74ºC for 10min. The PCR products were electrophoresed on 2% agarose and the gel was visualized under UV Trans illuminator. (d) Genotyping mitochondrial DNA sequencing

We amplified mitochondrial control region (D-loop) which sequence is highly polymorphic

(Nagata et al. 1998) by using two primers: LD5(5’-AAGCCATAGCCCCACTATCAA-3’) and H597(5’-AGGCATTTTCAGTGCCTTGCTTTG-3’). The denaturing process took place at 95ºC for 2min, and was followed by 45cycles of 95ºC 30s, 55ºC 30s, 74ºC 1min. Final extraction was at 74ºC for 10min. Amplification was conducted in a 15 µl of mixture containing 2.0 µl of template DNA, 2.2 µl of H2O, 7.5 µl of Buffer, 0.15 µl of T4Gene32Protain, 2.4 µl of dNTP, 6 pmol of primers KY1 and KY2, and 0.15 µl of LA Taq DNA polymerase.

To remove the primers, PCR products were cleaned-up by using a kit (High Pure PCR product purification kit, Roche). Extracted PCR products were then used for sequencing reaction using mixture of 2.0 µl of Big Dye Terminator v3.1 (ABI), 2.0 µl of Buffer, 1.0 µl of Primer (20µM). The denaturing process took place at 96ºC min, and was followed by 25 cycles of 96ºC 10s, 50ºC 5s, 60ºC 1 min.

We conducted ethanol precipitation using NaOAc. After dry the samples, 4 µl of Hi Di Form Amid (HDFA) was added to the 2 µl of samples on the sequencing plate. The plates were incubated at 95ºC for 2min and immediately transferred unto cold black for 5min. 3130xl sequencer Genetic analyzer sequenced those plates.

(e) Data analysis

We analyzed the data using MEGA7 software to know mitochondrial haplotypes and Network5

to generate networks.

Results and Discussion The relationship between social interaction, age and sex

A total of 22 animals were used as focal animal (10 adult females, 9 adult males, and 3 young)

and 47 animals were sampled during observations, including 13 males, 25 females and 9 young. We observed focal animals for total 2,300 minutes and carried out 1,150 scans for recording posture/behavior.

All animals showed more posture “stand” than “lay”; however, young animals showed a higher frequency of “stand” than adults (Fig. 3).

Figure 3. Frequency of postures observed in wild sika deer.

The most frequent behavior observed in adult sika deer was “feed”; however, in young animals

was “ruminate” (Fig. 4). That difference observed may be because of high frequency of “lay” posture in young animals in shorter observation time than adults. It is necessary to increase sample size to confirm this finding.

Figure 4. Frequency of behaviors observed in wild sika deer.

0%

20%

40%

60%

80%

100%

ADT MALE (N=443) ADT FEMALE (N=619) YOUNG (N=88)

FRE

QU

EN

CY

POSTURE

LAY

STAND

0

20

40

60

80

100

MALE (N=443) FEMALE (N=619) YOUNG (N=88)

FRE

QU

EN

CY

(%)

BEHAVIOR FEEDRESTALARMSOC. INT.RUMINATESELF GRO.OTHERMOVE

Females had more social interactions than other groups (58% of total 137 social interactions observed). Females gave social interactions 1.45 times per hour to other females and got 0.29 times per hour from females (Fig. 5a). They also had many interactions with young such as approaching, staying and grooming. Fig 5b shows that males had more affiliative interactions with female (1.69 times per hour) than with male (0.47 times per hour) and young (0.54 times per hour). However, they didn’t get so many social interactions from others. Male tended to approach to female at first, then try to stay with her. Male approached, groomed and sniffed to other males (0.47 times per hour) but only approached to young (0.54 times per hour). Young tended to approach to females and receive grooming from them (Fig. 5c). Young animals were also interested in other young individuals (approached 1.02 times per hour); however, they did not exchange other social interactions.

Figure 5a. Sociogram of affiliative interaction between focal females and others [times/hour]

Figure 5b. Sociogram of affiliative interaction between focal males and others [times/hour]

Figure 5c. Sociogram of affiliative interaction between focal youngs and others [times/hour]

We got a few agonistic behavior (Fig. 6). Females have many affiliative interaction as mentioned above, but sometimes they have agonistic behavior such as kicking, replacing.

Figure 6. Sociogram of agonistic interaction [times/hour]

Those results indicate that adult females are more sociable. That may suggest that interactions between females are important to form a herd. Sika deer in mainland of Japan make a harem of one male and some females. But in Yakushima, it is said that the harem is quite loosen. On the other hand, male-male and male-young interactions are probably just to check who is this. Males have interest to other males so that they groom and sniff, but they don’t have interest to young. Most of the interaction between female and young may be mother-child interaction. Genetic relation among them is required to clarify this speculation.

Sex identification For the sexing analysis (Fig. 7), from the 47 fecal samples collected, only two animals were misidentified; however, both were young animals justifying the wrong identification by observation.

Figure 7 – Electrophoresis of sexing analysis of sika deer fecal samples. Amelogenin amplfication indecate PCR fragments specific to female 219bp and male 165/219bp.

mtDNA haplotypes

We used 52 fecal samples for haplotype analysis using mtDNA D-loop region. We couldn’t read

sequences from 3 fecal samples, all of which were collected a year ago and were not fresh in sampling. 36 were sequenced successfully with both forward and reverse primers. The length read was about 970bp. 6 were sequenced successfully with only forward primer, and 7 were sequenced successfully with only reverse primer. From them, we identified the haplotypes of 45 individuals, but we couldn’t identify those 4 individuals.

The most sika deer (38 individuals) had Type1 haplotype. Type2 was the second most haplotype (5 individuals). Type 7 and Type 8 were found in one individual, respectively. (See Table 1). In females (N=32), 93.7% were Type1, 6.3% were Type2, and no other haplotypes were found. In males (N=17), on the other hand, 47.1% were Type1, 17.6% were Type2, and 5.9% were Type7 and 8, respectively, and 4 individuals may have the other haplotype than Type1 or Type2.

M M M F M F M

Size marker

219bp

165bp

All Female Male

mtDNA haplotype # animals proportion # animals proportion # animals proportion

Type1 38 77.6% 30 93.6% 8 47.1%

Type2 5 10.2% 2 6.3% 3 17.6%

Type7 1 2.0% 0 0% 1 5.9%

Type8 1 2.0% 0 0% 1 5.9%

Unidentified 4 8.2% 0 0% 4 23.5%

(Total) 49 100% 32 100% 17 100%

Table 1. The haplotypes we found in deer in the study area. The relationship between social interaction and mtDNA haplotype

The total observation time was about 39 hours and we observed 142 social interactions. Among

these social interactions, 94.4% were affiliative interactions such as grooming, approaching and sniffing, and 4.9% were agonistic interactions such as kicking and biting. (Table 3.)

Times % Affiliative 134 94.4 Agonistic 7 4.9 ? 1 0.7 Total 142 100.0

Table 3. The number of the observed social interactions

We could clarify the haplotypes of both focal and interactive individuals in 73 of 142 interactions.

Table 4a and 4b show the relationships between each mtDNA haplotypes and social interactions. Most of the interactions were conducted between Type1 individuals. In both tables, interactions between Type1 female and Type1 female were observed the most (over half of the total number). The result shows that female tended to have more social interactions with the same haplotype females than other haplotype females, although males had no tendency.

Inte

ract

ive

indi

vidu

als Focal individuals

Total Type1 Type2 Female Male Female Male

Type1 Female 15 2 1 1 19 Type1 Male 3 1 1 5 Type2 Female 1 1 Type2 Male 2 1 3 Type7 Male 1 1

Total 20 4 4 1 29 Table 4a. Relationship between each mtDNA haplotypes and social interactions

(concerning to number of interaction pairs ) * including the 1 year females which sex we identified in the experiment

Inte

ract

ive

indi

vidu

als Focal individuals

Total Type1 Type2 Female Male Female Male

Type1 Female 43 5 1 3 52 Type1 Male 3 2 1 6 Type2 Female 13 13 Type2 Male 4 3 7 Type7 Male 10 10

Total 50 17 18 3 88 Table 4b. Relationship between each mtDNA haplotypes and social interactions

( about the number of the social interactions ) * including the 1 year females which sex we identified in the experiment

We could clarify only 29 pairs and 88 interactions. It was too few data to conclude the relationships of the wild Yakushima deer. However, we would like to mention about some part of activity and interaction of them. In this research area, interactions between Type1 individuals were most frequently observed. It probably suggests that Type 1 is common haplotype there and other types may come from other areas. That fact enables to crossbreed between different gene types for incest avoidance. Five of 6 interacting pairs of different haplotypes involved adult males, and 4 of them were male-female pairs. That also supports males move longer distance to seek females, but females tend to stay fixed places. We need further investigations, especially in young animals.

Field experiment of DNA degradation For the DNA degradation experiment (Table 5, Fig. 8), we successfully identified sex of all samples exposed on different conditions; however, the degradation of the mitochondrial DNA was faster in exposed ground than forest ground (Fig. 9). However, it is necessary to increase the sample number to confirm those findings.

Table. 5 – Field experiment of DNA degradation.

Figure 8. Ambient temperature (T) and relative humidity (RH) during field experiment.

Figure 9. Degradation rate of fecal DNA during field experiment.

50

60

70

80

90

RH

%

202122232425

0 1 2 3 4 5 6 7 8

T oC

Days

0

20

40

60

80

100

0 2 5 8

% o

f cor

rect

ly

sequ

enci

ng D

NA

Days

Forest

DAY 0 DAY 2 DAY 5 DAY 8

FOREST

Quality moist shiny

dark brown

dry shiny

reddish black

opaque rough black

wet rough

dark brown

Sexing + + + + + + + + + + + +

Mit DNA + - + + + + - + - + - -

EXPOSED

Quality moist shiny

dark brown

dry(crack) shiny

reddish black

dry(crack) smooth black

dry(no crack) not opaque

black

Sexing + + + + + + + + + + + +

Mit DNA + - + - - - - - - - 0 -

Conclusions In summary, the present study shows that feed was the most frequent behavior executed by deer and females showed more social interactions than males and young individuals in the study area. According to the genetic analysis, the Type1 was the most frequent haplotype observed in the sampled area, and almost all social interactions between different haplotypes were male – female interaction. In addition, apparently, fecal samples could be used for sexing up to 8 days after defecation, but fecal mitochondrial DNA would be degrade faster. Acknowledgments We would like to thank Agetsuma, Agetsuma-Yanagihara, Nishikawa and Murayama senseis for all support for the execution of this study, and The Monkey Team members (Akito Toge, Liu Jie, Gisele de Castro Maciel Valdevino, Sanjeeta Pokharel, Ryoma Otsuka) for the help with genetic analysis. We also thank Hanya sensei and other teachers who organized these two science courses. We thank PWS program for supporting us in Yakushima Field and Genome Science courses. References Agetsuma, N., AgetsumaYanagihara, Y., and Takafumi, H., 2011. Food habits of Japanese deer in an evergreen forest: litter-feeding deer. Mammal Biol 76: 201–207

Frantz, A.C., L.C. Pope, P.J. Carpenter, T.J. Roper, G.J. Wilson, J. Delahays, and T. Burke. 2003. Reliable microsatellite genotyping of the Eurasian badger (Meles meles) using faecal DNA. Molecular Ecology Notes 12:1649-1661.

Hayaishi, S., and Kawamoto, Y., 2006. Low genetic diversity and biased distribution of mitochondrial DNA haplotypes in the Japanese macaque (Macaca fuscata yakui) on Yakushima Island. Primates 47:158-164.

Longmire, J.L., Maltbie, M., and Baker, R.J., 1997. Use of "lysis buffer" in DNA isolation and its implication for museum collections. Museum of Texas Tech University: Lubbock. Luikart, G. and P.R. England. 1999. Statistical analysis of microsatellite DNA data. Trends in Ecology and Evolution 14:253-256. Macdonald, D. W., 1984. The encyclopaedia of animals 4. Equinox Ltd, Oxford. Nagata, J., Masuda, R., Kaji, K., Kaneko, M., and Yoshida, M.C., 1998. Genetic variation and population structure of the japanese sika deer (Cervus nippon) in Hokkaido Island, based on mitochondrial D-loop sequences. Mol Ecol 7.7: 871-77.

Surridge, A.K., Smith, A.C., Buchanan-Smith, H.M., and Mundy, N.I., 2002. Single-copy nuclear DNA sequences obtained from noninvasively collected primate feces. Am J Primatol 56:185-190.

Taberlet, P., Camarra, J.J., Griffin, S., Uhrès, E., Hanotte, O., Waits, L.P., Dubois-Paganon, C., Burke, T., and Bouvet, J. 1997. Noninvasive genetic tracking of the endangered Pyrenean brown bear population. Mol Ecol 6:869-876.

Taberlet, P., L.P. Waits, and G. Luikart. 1999. Non-invasive sampling: look before you leap. Trends in Ecology and Evolution 14: 323-327. Tsujino, R., Noma, N., and Yumoto, T., 2004. Growth of the sika deer (Cervus nippon yakushimae) population in the western lowland forests of Yakushima Island, Japan. Mammal Stud 29: 105-111.

Whitehead, G.K., 1993. Encyclopaedia of deer. Swan Hill Press, Shrewbury. “Yakushima.” - UNESCO World Heritage Centre. UNESCO, n.d. Web. 20 June 2016. Yamauchi, K., Shin-ichiro, H., Koji, K., Yukari, T., and Yuji, M., 2000. Sex determination based on fecal DNA analysis of the amelogenin gene in sika deer (Cervus Nippon). J Vet Med Sci 62.6: 669-71.