Upload
others
View
7
Download
0
Embed Size (px)
Citation preview
DEFINING THE MOLECULAR BASIS OF HOST RANGE IN PAPAYA RINGSPOT VIRUS (PRSV)
AUSTRALIA
The thesis submitted to the Queensland University of Technology for the
Degree of Doctor of Philosophy
By
Nishantha Jayathilake
Cluster for Molecular Biotechnology
Science Research Centre,
School of Life Sciences
Queensland University of Technology
iii
ABSTRACT
The potyvirus Papaya ringspot virus (PRSV) is widespread throughout the
world in cucurbits (such as zucchini, watermelon, pumpkin etc) and papaya
(papaw). There are two serologically indistinguishable strains of PRSV, which
can only be differentiated on the basis of host range. PRSV-P is able to infect
both papaya and cucurbits whereas PRSV-W only infects cucurbits. Both
infections drastically reduce the yield and market quality of the fruit.
Australian isolates of PRSV-P and –W are very closely related and there is
evidence that PRSV-P arose by mutation from PRSV-W. The aim of this
project was to investigate the molecular basis of the host range difference
between Australian isolates of PRSV-P and –W.
The close relationship between Australian PRSV-P and -W isolates at the
molecular level made this an ideal system to investigate molecular host
range determinants through the development of full-length infectious cDNA
clones. Initially, the complete genomes of PRSV-P and -W were each
incorporated into two overlapping clones; one included the CaMV 35S
promoter fused to the 5’ one third of the PRSV genome and the second
included the 3’ two thirds of the genome (including a 33 nucleotide poly(A)
tail) fused to a CaMV35S terminator. Full-length clones could not be obtained
from subcloning of these fragments due to apparent toxicity in E.coli. Several
approaches were subsequently undertaken to overcome this problem. In an
attempt to prevent transcription of potentially toxic sequences, a plant intron
(St-Ls1 IV2 intron) was engineered into the first coding region (P1) of the
PRSV-W genome. Although clones were obtained using this strategy these
could not be effectively maintained in E.coli. An alternative strategy involved
subcloning of the genome into a low copy number vector, pACYC177, to
minimise expression of toxic sequences. Again this resulted in clones that
produced very small colonies, which were hard to culture and which gave
very low plasmid yields. These plasmids were also difficult to maintain in E.
coli.
iv
A final, successful strategy was developed using overlapping long distance
PCR (OE-LD PCR) to generate full-length infectious PCR products of both
PRSV-P (rPRSV-P) and -W (rPRSV-W) incorporating a CaMV 35S promoter
and terminator. Infectious PCR products of both strains were inoculated onto
squash cotyledons in vitro by microprojectile bombardment and subsequently
mechanically inoculated to squash with greater than 86% efficiency.
RPRSV-P subsequently infected papaya with 96% efficiency while, as
expected, rPRSV-W was unable to infect papaya.
Once a system for generating infectious clones was developed, both
sequence analysis and recombination of infectious clones was utilised to
investigate the underlying host range mechanism. The complete genomes of
PRSV-P and -W were sequenced and compared to each other and to five
full- length sequences of overseas PRSV isolates that were available.
Sequence analysis confirmed the close relationship between the Australian
PRSV isolates (97.8% nucleotide and 98.4% amino acid identity over the
whole genome), supporting the mutation theory between both Australian and
Asian P and W pairs. However, there was no consistent amino acid
difference over the whole genome that correlated with host range or a single
site that could be implicated, suggesting that the mutation and possibly the
position of the mutation is different at least between Asian and Australian
isolates and potentially differs at each mutation event.
To better localise the P/W mutation within the PRSV genome, five different
recombinant hybrid PRSVs (rhPRSV1-5) were generated in which 5’, middle
or 3’ regions of the PRSV-P and -W genomes were exchanged. Infectivity of
all hybrids was confirmed in squash, however, only hybrids including the 3’
third of the PRSV-P genome were able to infect papaya, suggesting that this
region encodes the papaya host range determinant. The region implicated
encodes the genome-linked protein (VPg), NIa protease, replicase (NIb), coat
protein (CP) and 3’ UTR. While further identification of the host range
determinants was not possible due to time constraints, based on studies with
other potyviruses, there is a strong basis for implication of the VPg.
Sequence analysis identified only 2 amino acid differences between the VPg
v
of Australian PRSV-P and -W isolates in regions previously implicated in
pathogenicity. These will be targeted for mutagenesis in ongoing studies.
Identification of the genes/sequences involved in the determination of host
range in PRSV will provide valuable information as to the sequence of events
that lead to infection and will lead to a better understanding of the
significance of changing hosts in the molecular evolution of PRSV, an
essential requirement for the development of long-term sustainable control
strategies against PRSV.
vi
TABLE OF CONTENTS
TITLE PAGE i ABSTRACT iii TABLE OF CONTENTS vi LIST OF FIGURES xii LIST OF TABLES xvi LIST OF ABBREVIATIONS xviii DECLARATION xxi ACKNOWLEDGEMENTS xxii CHAPTER 1 INTRODUCTION 1
1.1 POTYVIRUSES 1
1.1.1 Description 1
1.1.2 Genome structure and gene function 3
1.1.2.1 P1 protein 4
1.1.2.2 HC-Pro protein 5
1.1.2.3 P3 protein & 6K1 8
1.1.2.4 CI protein 9
1.1.2.5 6K2 peptide 10
1.1.2.6 NIa protein 10
1.1.2.7 NIb protein 12
1.1.2.8 Coat protein 13
1.1.2.9 Untranslated regions 14
vii
1.2 PAPAYA RINGSPOT VIRUS (PRSV) 15
1.2.1 Description 15
1.2.2 Genome organisation: comparision with other
potyviruses 20
1.2.3 PRSV in Australia 23
1.3 POTYVIRAL HOST RANGE DITERMINANTS 24
1.3.1 CP and HC-Pro 25
1.3.2 VPg 26
1.3.3 P3, 6K1 and CI 28
1.4 AIMS AND OBJECTIVES 30
CHAPTER 2 GENERAL METHODS AND MATERIALS 31
2.1 GENERAL REAGENTS 31
2.1.1 Sources of special reagents 31
2.1.2 General solutions and media 31
2.2 GENERAL METHODS FOR VIRUS PURIFICATION AND
DETECTION 32
2.2.1 Source and maintenance of virus isolates 32
2.2.2 Enzyme-linked immunosorbent assay (ELISA) 32
2.2.3 Electron microscopy 33
2.3 GENERAL METHODS FOR NUCLEIC ACID EXTRACTION
AND AMPLIFICATION 33
2.3.1 Preparation of crude RNA extract 33
2.3.2 cDNA synthesis 34
2.3.3 Polymerase chain reaction (PCR) 34
2.3.3.1 Standard PCR 34
3.2.3.2 Long-distance PCR ( LD-PCR) 35
viii
2.3.3.3 Overlapping extension long distance
PCR (OE-LD-PCR) 35
2.4 GENERAL METHODS FOR NUCLEIC ACID ANALYSIS 36
2.4.1 Small-scale preparation of plasmid DNA using
alkaline lysis 36
2.4.2 Large-scale plasmid preparation 36
2.4.2 Spectrophotometric determination of nucleic
acid concentration 36
2.4.4 Restriction enzyme analysis 37
2.4.5 Agarose gel electrophoresis 37
2.4.6 DNA sequencing 37
2.4.7 Gel purification of DNA 37
2.5 GENERAL METHODS FOR CLONING 38
2.5.1 Ligation of PCR products into T-tailed vectors 38
2.5.2 Ligation of blunt/sticky end fragments into vectors 38
2.5.3 Transformation of E.coli 38
CHAPTER 3 GENERATION OF INFECTIOUS CLONES OF PRSV-W AND PRSV-P 39
3.1 INTRODUCTION 39
3.2 METHODS AND MATERIALS 41
3.2.1 Oligonucleotide primers 41
3.2.2 Amplification of 5’ and 3’ Megaprimers 42
3.2.3 Cloning of full-length PRSV-P and -W genomes
in 3 overlapping clones 42
3.2.3.1 Preparation of PRSV RNA 42
3.2.3.2 First-strand cDNA synthesis 44
ix
3.2.3.3 PCR Amplification of the PRSV genomes
in three overlapping fragments 44
3.2.3.4 Cloning of PRSV-W and PRSV-P
overlapping fragments 44
3.2.5 Generation of a full-length PRSV-W clone 47
3.2.5.1 insertion of MluI site in p5’Triplet-W 47
3.2.5.2 Generation of pTwin-W 47
3.2.5.2 Subcloning to generate a full-length clone 47
3.2.6 Generation of an intron-containing infectious clone
of PRSV-W 50
3.2.6.1 Insertion of an intron into the P1-coding
region of p5’Triplet-W 50
3.2.6.2 Construction of an intron containing full-length
PRSV-W 53
3.2.7 Generation of a full-length PRSV-W in a low copy
number vector 53
3.2.8 Generation of full-length infectious PCR product
of PRSV- W and PRSV-P 57
3.2.9 Infectivity of full-length PRSV-P and PRSV- W PCR
Products 59 3.2.9.1 Preparation of PCR products for
bombardment 59
3.2.9.2 Bombardment of squash cotyledons with
full-length PCR products 59
3.2.9.3 Detection of PRSV infection and mechanical
inoculation of squash seedlings 60
3.2.9.4 Detection of PRSV infection in inoculated
squash and papaya plants 60
3.3 RESULTS 61
3.3.1 Cloning of PRSV-P and PRSV-W genomes in three
overlapping clones 61
3.3.2 Generation of a full-length PRSV-W infectious clone 63
x
3.3.3 Generation of an infectious PRSV-W clone
containing a plant intron 68
3.3.4 Construction of full-length PRSV-W in a low copy
number vector 72
3.3.5 Generation of full-length infectious PCR products of
PRSV by OE-LD-PCR 77
3.3.6 Infectivity of full-length PCR products of PRSV-P
and PRSV-W 77
3.4 DISCUSSION 85
CHAPTER 4 SEQUENCE ANALYSIS OF THE COMPLETE GENOMES
OF AUSTRALIAN ISOLATES OF PRSV 94
4.1 INTRODUCTION 94
4.2 METHODS AND MATERIALS 95
4.2.1 Oligonucleotide primers 95
4.2.2 Source of PRSV clones 95
4.2.3 Sequencing of PRSV-P and PRSV-W genomes 98
4.3 RESULTS 103
4.3.1 Australian PRSV- P and -W genomes 103
4.3.2 Comparison of Australian isolates to other
full-length PRSV sequences 110
4.3.4 Search for putative host range determinants 113
4.4 DISCUSSION 114
xi
CHAPTER 5 LOCALISATION OF PRSV-P AND PRSV-W HOST RANGE DETERMINANTS BY GENERATION OF RECOMBINANT HYBRID PRSV TRANSCRIPTS 118
5.1 INTRODUCTION 118
5.2 METHODS AND MATERIALS 119
5.2.1 Generation of recombinant PCR products of
PRSV-P and PRSV-W 119
5.2.2.1 Construction of pTwin-W+P and
pTwin-P+W clones 119
5.2.2.2 Amplification of recombinant full-length
PCR products by OE-LD-PCR 121
5.2.3 Infectivity of recombinant PCR products 121
5.3 RESULTS 123
5.3.1 Generation of recombinant PRSV PCR products 123
5.3.2 Infectivity of hybrid PCR products in squash 124
5.3.3 Infectivity of recombinant hybrid PRSVs in papaya 132
5.3.4 Confirmation of the integrity of rhPRSVs in vivo 135
5.4 DISCUSSION 137
CHAPTER 6 GENERAL DISCUSSION AND CONCLUSIONS 143 REFERENCES 150
APPENDIX I 183
LIST OF FIGURES
Figure 1.1 General genome organisation of potyviruses. 4
Figure 1.2 PRSV-P symptoms in mature papaya tree. 17 Figure 1.3 PRSV-P symptoms on papaya fruit. 18
Figure 1.4 PRSV-W symptoms in cucurbits. 19
Figure 1.5 Average % of identity of PRSV proteins with homologous
proteins of six additional potyviruses. 22
Figure 3.1 Strategy for the amplification of megaprimers. 43
Figure 3.2 Strategy for amplification and cloning of the full
PRSV-W genome as three overlapping fragments. 46
Figure 3.3 Strategy for generation of pTwin-W from plasmids
p3’Triplet-W and pMiddle Triplet-W. 48
Figure 3.4 Strategy for generation of full-length clone of PRSV-W
from plasmids p5’Triplet-W* and pTwin-W. 49
Figure 3.5 Strategy for insertion of an intron into the P1-coding
region and construction of p5’Int.Triplet-W. 51, 52
Figure 3.6 Strategy for the generation of a full-length, intron
containing PRSV-W clone from plasmids
p5’Int.Triplet-W and pTwin-W. 54
Figure 3.7 Strategy for generation of full-length low copy
number PRSV-W clone. 55, 56
xiii
Figure 3.8 Strategy for generation of full-length PCR product of
PRSV-W by OE-LD-PCR. 58
Figure 3.9 Three overlapping PCR products representing
full-length PRSV-W. 62
Figure 3.10 Restriction analysis of clones p5’Triplet-W,
pMiddle Triplet-W and p3’Triplet-W. 64, 65
Figure 3.11 Restriction analysis of pTwin-W. 66
Figure 3.12 Restriction analysis of putative full-length PRSV-W clone. 67
Figure3.13 PCR products generated and used for construction
of p5’Int.Triplet-W. 69, 70
Figure 3.14 Purified intron-containing full-length PRSV-W plasmid. 71
Figure 3.15 Restriction analysis with MluI/ BamHI of plasmids
resulting from ligation of the insert of p5’Triplet-W into
low copy number vector pACYC 177. 73
Figure 3.16 Restriction digestion of clones pTwin-W and p5’LC.Triplet-W
during generation of low copy number full-length PRSV-W
plasmid, pFull.LC-W. 74
Figure 3.17 Purified low copy number full-length PRSV-W
plasmid (pFull.LC-W). 75
Figure 3.18 PCR analysis of full-length low copy number PRSV-W
plasmid (pFull.LC-W) showing the presence of P1 and
NIa fragments. 76
Figure 3.19 OE-LD-PCR product of full length PRSV-W. 78
xiv
Figure 3.20 Symptoms of rPRSV-W and -P infection in squash
and papaya. 82
Figure 3.21 Electron micrographs of typical PRSV virons identified in
negative stained leaf dips following inoculation with
rPRSV-W and rPRSV-P. 83
Figure 3.22 RT-PCR analysis of plants inoculated with rPRSV-W to
detect P1, NIa and CP-coding regions. 84
Figure 4.1 Representative of the five overlapping clones used to
generate full-length PRSV genome sequences. 99
Figure 4.2 Location of primers used in cDNA synthesis, PCR
amplification and sequencing of p5’Triplet of
PRSV-P and –W. 100
Figure 4.3 Location of primers used in cDNA synthesis,
PCR amplification and sequencing of the
pMiddle Triplet-P and –W. 101
Figure 4.4 Location of primers used in cDNA synthesis, PCR
amplification and sequencing of the p3’Triplet-P and –W. 102
Figure 4.5 Amino acid sequence alignment of the complete
polyprotein of Australian isolates of PRSV-W
and -P with five overseas isolates. 105-109
Figure 4.6 Nucleotide and amino acid sequence divergence
of full-length PRSV genomes presented as
phylogenetic trees. 111
xv
Figure 5.1 Strategy for generation of pTwin-W+P from p3’Triplet-P
and pMiddle Triplet-W. 120
Figure 5.2 Recombinant hybrid PCR products of PRSV. 122
Figure 5.3 Restriction analysis of pTwin-P+W. 125
Figure 5.4 Agarose gel showing 11027bp PCR product representing
full-length recombinant hybrid PRSV amplified
by OE-LD- PCR. 126
Figure 5.5 RT-PCR amplification of the P1 and CP-coding regions
from rhPRSVs in squash plants that were positive for
PRSV by ELISA. 133
Figure 5.6 RT-PCR analysis of P1 and CP-coding regions of
rhPRSVs in inoculated papaya plants. 136
Figure 6.1. Diagramatic representation of VPg of PRSV-P & W
Showing amino acid differences between pairs of geographic
isolates. 148
xvi
LIST OF TABLES
Table 1.1 Comparision of the genome size of potyviruses. 21
Table 3.1 Summary of infectivity assays (ELISA and symptoms)
on plants inoculated with full-length PRSV-W PCR product. 80
Table 3.2 Summary of infectivity assays (ELISA and symptoms) on
plants inoculated with full-length PRSV-W PCR product. 81
Table 4.1 Sequence of oligonucleotides used in cloning and
sequencing of PRSV-P and -W genomes. 96,97
Table 4.2 Percent divergence between whole genomes of
PRSV isolates. 104
Table 4.3 Percent divergence between coding regions and corresponding
proteins of PRSV isolates compared to AUS-W. 112
Table 5.1 Summary of clones use to make recombinant infectious
PCR products of PRSV. 121
Table 5.2 Assessment of infectivity (ELISA and symptoms) of
recombinant hybrid PRSV PCR product,
rhPRSV1 (WWP), in squash. 127
Table 5.3 Assessment of infectivity (ELISA and symptoms) of
recombinant hybrid PRSV PCR product,
rhPRSV2 (PWW), in squash. 128
Table 5.4 Assessment of infectivity (ELISA and symptoms) of
recombinant hybrid PRSV PCR product,
rhPRSV3 (PPW), in squash. 129
xvii
Table 5.5 Assessment of infectivity (ELISA and symptoms)
of recombinant hybrid PRSV PCR product,
rhPRSV4 (WPP), in squash. 130
Table 5.6 Assessment of infectivity (ELISA and symptoms)
of recombinant hybrid PRSV PCR product,
rhPRSV5 (PWP), in squash. 131
Table 5.7 Assessment of infectivity of rhPRSVs in papaya plants
mechanically inoculated with rhPRSV infected squash. 134
xviii
LIST OF ABBREVIATIONS
A absorbance
bp base pair(s)
BSA bovine serum albumin 0C degrees Celsius
CaMV 35S cauliflower mosaic virus 35S promoter
cDNA complementary deoxyribonucleic acid
CI cylindrical inclusion protein
CP coat protein
dATP deoxyadenosine triphosphate
DEPC diethylpyrocarbonate
dCTP deoxycytidine triphosphate
dGTP deoxyguanosine triphosphate
dTTP deoxythymidine triphosphate
DMSO dimethylsulphoxide
DNA deoxyribonucleic acid
dpi days post inoculation
DsRNA double-stranded ribonucleic acid
DTT dithiothreitol
E.coli Escherichia coli
EDTA ethylenediaminetetra-acetic acid
ELISA enzyme linked immunosorbent assay
g gram(s)
GFP green fluorescent protein
xg gravity
GUS β- glucuronidase
HC-Pro helper component protease
hr hours
IPTG isopropyl-β-D-thiogalactopyranoside
kb kilobase(s)
kDa kilodalton(s)
LD-PCR long-distance polymerase chain reaction
xix
mg milligram(s)
min minutes(s)
mL millilitre(s)
mmol millimole(s)
mM millimolar
MP movement protein
MW molecular weight
NIa nuclear inclusion protein a
NIb nuclear inclusion protein b
ng nanogram(s)
nm nanometres(s)
nt nucleotide(s)
OE-PCR overlapping-extension polymerase chain reaction
OE-LD-PCR overlapping-extension long distance PCR
ORF open reading frame
P1 first protein encoded by potyvirus genome
P3 third protein encoded by potyvirus genome
PBS phosphate buffered saline
PBST phosphate buffered saline with Tween-20
PCR polymerase chain reaction
pmol picomole(s)
RNA ribonucleic acid
RT reverse transcriptase
RT-PCR reverse transcription polymerase chain reaction
S seconds(s)
SDS sodium dodecyl sulphate
SEL size exclusion limit
TAE tris-acetate, EDTA
Taq Thermus aquaticus
TE tris-EDTA
Tris tris (hydroxylmethyl) aminome
UTR untranslated region
UV ultraviolet
V volts
xx
VPg genome linked protein
X-gal 5-brom-4-chloro-3-indolyl-β -D-galactopyranoside
μg microgram(s)
μL microlitre(s)
μM micromolar
xxi
STATEMENT OF AUTHORSHIP
“The work contained in this thesis has not been previously submitted for a
degree or diploma at any other higher education institution. To the best of my
knowledge and belief, the thesis contains no material previously published or
written by another person except where due reference is made”.
Signed: Nishantha Jayathilake Date:
xxii
AKNOWLEDGEMENTS I would like to acknowledge all those who assisted me in one way or another in
the completion of this work.
Most importantly, I would like to express my gratitude to my mother my best
friend and most trusted confidant who has always there for me and inspired me
to learn and to continue learning.
I express my heartfelt gratitude for the advice guidance and suggestions given
by my supervisor, Dr Marion Bateson, during preparation of this thesis. Also, I
gratefully appreciate the molecular biology training received from her during the
past five years.
I would especially like to thank Prof. James Dale, for his guidance and
friendship through this project and for providing me with some great
opportunities along the way.
My profound thanks are also extended to the people in the Plant Biotechnology
group of the Centre for Molecular Biotechnology who have contributed both
knowledge and friendship.
I would also like to thank the many other people in the Centre for Molecular
Biotechnology and School of Life Sciences who have helped in numerous ways
over the years and without whose help this thesis would not have been
completed.
This work would not be possible without personal support from others. My
deepest thanks go to my wonderful wife Hemanthi and my family for their
patience, encouragement, continuous moral support and prayers, expressing
their love and care for me.
1
CHAPTER 1 INTRODUCTION Although there is considerable knowledge of the molecular host range
determinants of a number of plant virus groups, the host range determinants
of potyviruses, the largest family of plant viruses, are only now being
elucidated. Papaya ringspot virus (PRSV) is a species of the potyvirus genus
and is widespread throughout the world. There are two serologically
indistinguishable strains of PRSV, which can only be differentiated on the
basis of their host range. PRSV type P (PRSV-P) is able to infect both
papaya and cucurbits, whereas PRSV type W (PRSV-W) only infects
cucurbits. Both infections drastically reduce the yield and market quality of
the fruit. PRSV-P and –W are very closely related strains and it is thought
that, at least in Australia, PRSV-P arose by mutation from PRSV-W (Bateson
et al., 1994). However, the molecular basis for this mutation has not yet been
defined. Identification of the molecular host range determinants of PRSV will
contribute to a general understanding of potyvirus host range and will help
define the significance of this ability to change host in the molecular evolution
of PRSV.
1.1 POTYVIRUSES
1.1.1 Description The Potyviridae is the largest and economically most important plant virus
family with over 200 species described (Hall et al., 1998). It constitutes
about 25% of known plant viruses and causes diseases in almost all
commercial crops. A large number of potyviruses are important plant
pathogens and cause substantial losses in crop plants of economic
importance such as cereal, millet, fruit, vegetable, sugarcane, oilseed,
ornamentals, fodder and pasture in different parts of the world.
The Potyviridae are divided into six recognised genera, namely Potyvirus,
Bymovirus, Macluravirus, Tritimovirus, Rymovirus and Ipomovirus (van
Regenmortel et al., 2000). Members of the potyvirus genus are transmitted
2
by aphids in a nonpersistent manner and some are also seed transmitted.
Macluraviruses have aphid vectors and are transmitted in a nonpersistent,
noncirculative manner. Rymoviruses and Tritimoviruses are transmitted by
mites, Bymoviruses by fungi and Ipomoviruses are whitefly-borne. Unless
otherwise indicated, in this review, potyviruses will refer to species of the
potyvirus genus, which includes PRSV.
Potyviruses have flexuous, filamentous virions 680-900 nm long and 11-15
nm wide (Shukla and Ward, 1989). Each virion is made up of about 2000
units of a single structural protein surrounding one molecule of positive
sense ssRNA of approximately 10,000 nucleotides (Purcifull et al., 1984).
More than 200 aphid species are known to be vectors of potyviruses
(Edwardson and Christie, 1991). Two virus encoded proteins, the helper
component proteinase (HC-Pro) and the coat protein (CP) are needed for
aphid transmission of potyviruses (Pirone, 1981; 1991; Pirone and Blanc,
1996). It has been found that the N-terminal region of the CP contains a
conserved amino acid motif, Asp-Ala-Gly (DAG), essential for successful
transmission of the virus by the aphids (Lopez-Moya et al., 1999).
Potyviruses infect a wide range of plants, however individual viruses usually
have narrow host ranges within one to three families or genera (Hollings and
Brunt, 1981; Shukla et al., 1994), although some plants are susceptible to a
wide range of potyviruses. For example, a number of potyviruses are able to
induce local lesion infection in legumes, Chenopodium spp and Nicotiana
benthamiana (Shukla et al., 1994). The initial infection process in
potyviruses is poorly understood. Infection can only occur through seed
transmission (only some viruses), physical damage of a plant by insect
vectors or mechanical inoculation (Shukla et al., 1994).
Most potyviruses induce visible symptoms on the leaves, stems, flowers,
fruit and seeds while some do not induce any symptoms. Symptoms induced
by potyvirus infections are generally similar (Hollings and Brunt, 1981;
Shukla et al., 1994). Longitudinal chlorotic or necrotic streaks or both are
frequently induced in monocotyledonous plants. Vein clearing, mosaic
3
mottling, necrosis and distortion of leaves are common symptoms on
dicotyledonous plants. Stunting and reduction of crop yield are also
common. However, the presence and severity of symptoms are variable and
dependent on the particular virus and the strain or isolate (Shukla et al.,
1994).
1.1.2 Genome structure and gene function
Knowledge of the molecular biology of viruses and the functions of the
various proteins encoded by their genomes is essential for the development
of new strategies to control plant viruses. New technologies such as the two-
hybrid systems (Hong et al., 1995; Urcuqui-Inchima et al., 1999; Daròs et al.,
1999; Wang et al., 2000) and the incorporation of reporter genes, such as
green fluorescent protein (GFP) or ß-glucuronidase (GUS) into viral
genomes (Dolja et al., 1992; Schaad and Carrington, 1996; Oparka et al.,
1996; Verver et al., 1998; German-Retana et al., 2000) or fused to proteins
(Li and Carrington, 1993; Rao, 1997) has greatly facilitated the study of
viruses in recent years.
Potyviruses belong to the picorna-like supergroup of viruses whose RNAs
have a protein (VPg) covalently bound to the 5’-end of the genome, a
poly(A) tail at the 3’-end and whose genomes are expressed as a large
polyprotein which is subsequently cleaved co- and/or post-translationally by
proteases to yield functional proteins (Dougherty and Carrington, 1988).
These include a conserved set of genes encoding nonstructural proteins that
are involved in RNA replication. The order of the proteins within the
polyprotein is: first protein (P1), helper component (HC-Pro), third protein
(P3), cylindrical inclusion protein (CI), small nuclear inclusion protein (NIa),
which includes an N-terminal VPg and C-terminal protease domain, large
nuclear inclusion protein (NIb) and coat protein (CP). Small, 6KDa, proteins
are located between the CI and NIa and between the P3 and CI in some
potyviruses (Fig.1.1). Both the VPg and the CP are found in virions, whereas
4
Figure 1.1. General genome organisation of potyviruses
the P1, HC-Pro, P3, CI, NIa and NIb proteins are detected in infected plants
(Dougherty and Carrington, 1988; Rodriguez-Cerezo and Shaw, 1991).
Most of these proteins have been shown to be multifunctional while all the
proteins are involved in genome amplification (reviewed in Urcuqui-Inchima
et al., 2001).
1.1.2.1 P1 protein The P1 protein is one of three proteinases encoded by the potyvirus genome
and autocatalytically cleaves itself from the polyprotein. Conserved amino
acids corresponding to the proteinase catalytic domain have been identified
in the C terminus of all potyvirus P1 proteins (Verchot et al., 1991; Urcuqui-
Inchima et al., 2001). The catalytic triad His, Asp, Ser, typical of the serine-
type proteinases, was identified in the C terminus of the Tobacco etch virus
(TEV) P1 protein (Verchot et al., 1992). Among the different potyviruses,
these amino acids are well conserved with Phe replacing Asp in Potato virus
Y-O (PVY-O) (Yang et al., 1998a). Self-cleavage at the boundary between
P1 and HC-Pro is essential for viability. Tobacco vein mottling virus (TVMV)
C-terminal P1 mutants, where P1 proteinase activity was inactivated, were
not viable, while mutations in the N terminus of the P1 had no affect on virus
viability (Klein et al., 1994). Similar results were found for TEV (Verchot and
Carrington, 1995a). Evidence also suggested that separation of the P1 and
HC-Pro rather than proteinase activity itself is essential for viral infectivity
(Verchot and Carrington, 1995b). Similar results were also found for the
Tritimovirus, Wheat streak mosaic virus (WSMV) (Choi et al., 2002). Non-
poly (A) P1 HC-Pro P3 CI NIa NIb CP
6K1 6K2 VPg
5
specific RNA binding activity in the P1-coding region has been reported for
several potyviruses including TVMV (Brantley and Hunt, 1993), Turnip
mosaic virus (TuMV) (Soumounou and Laliberte, 1994) and Potato virus A
(PVA) (Merits et al., 1998).
Arbatova et al. (1998) reported localisation of PVY P1 protein with
cytoplasmic inclusion bodies and suggested it could be involved in virus cell-
to-cell movement. However, several studies indicate that P1 was not
localised near the plasmodesmata and all P1 mutants were able to move
systemically in infected plants (Urcuqui-Inchima et al., 2001).
The P1 is the least conserved protein among potyviruses (Urcuqui-Inchima
et al., 2001). Sequence identity between Yam mosaic virus (YMV) isolates
was only 65% in the P1 protein compared to about 80% in the HC-Pro, P3
and NIb proteins (Aleman-Verdaguer et al., 1997). High variability in the P1
has also been reported for other potyvirus isolates including PVY (72.8%-
100% amino acid sequence identity between 12 isolates) (Tordo et al.,
1995) and Zucchini yellow mosaic virus (ZYMV) (53.3%-57% amino acid
sequence identity) (Wisler et al., 1995).
1.1.2.2 HC-Pro protein
The potyviral helper component-proteinase (HC-Pro) is a multifunctional
protein involved in aphid transmission, long distance movement, polyprotein
processing, genome amplification, symptom expression and suppression of
posttranscriptional gene silencing.
Early studies demonstrated the involvement of the potyviral HC-Pro in aphid
transmission (Atreya and Pirone, 1993). Evidence suggests that the HC-Pro
must be in a biologically active form to enable transmission of virions (Govier
and Kassanis, 1974; Govier et al., 1977). Based on purification experiments,
Thornbury et al. (1985) suggested that biologically active TVMV HC-Pro is
probably present as a dimer in infected plants. Specific interaction between
CP and HC-Pro (Pirone, 1981), as well as interaction between the HC-Pro
6
and the aphid stylet (Peng et al., 1998), is required for aphid transmission of
potyviruses. Using a protein blotting-overlay assay, Blanc et al. (1997)
demonstrated that only the HC-Pro from an aphid transmissible strain of
TVMV interacted with CP while the HC-Pro from a non-aphid transmissible
strain did not. Also, TVMV mutants in the highly conserved DAG motif
located in the N terminus of the CP were poorly aphid transmissible and
showed decreased interaction with HC-Pro. Studies on the capacity of a
given HC-Pro to retain a given virion in the insect stylets demonstrated that
different aphid species transmit potyviruses to different extents (Wang et al.,
1998).
Significant research has been undertaken to determine the domains that
control aphid transmission. The aphid transmission helper function appears
to require residues within the N-terminal and central region of HC-Pro
(Thornbury et al., 1990; Atreya et al., 1992; Atreya and Pirone, 1993). The
highly conserved ‘KITC' tetra peptide (Lys-Ile/Leu-Thr/Ser-Cys) is found
within a Cys-rich motif in the N-terminal region of the potyvirus HC-Pro
(Thornbury et al., 1990) and is thought to be involved in interaction with the
aphid mouthparts (Blanc et al., 1998). A Lys to Glu change in the KITC
motif of Potato virus C (PVC) HC-Pro, which is a naturally occurring non-
aphid transmissible variant of PVY, had no effect on the ability of the HC-Pro
to bind virions or CP (Blanc et al., 1998). However, only PVY HC-Pro was
present in the food canal of aphids suggesting that the Lys to Glu mutation
of PVC affected HC-Pro stylet interaction (Blanc et al., 1998). In contrast, all
the mutations within the highly conserved Pro-Thr-Lys (PTK) motif, in the
central region of the ZYMV HC-Pro, abolished aphid transmission and
binding to virions (Peng et al., 1998) suggesting that the region permitting
binding to virions lies outside of the N-terminal domain. Interestingly, the N-
terminal region, which includes the KITC motif, has been implicated in
homodimerisation (Urcuqui-Inchima et al., 1999); this ability of HC-Pro to
dimerise may be important for aphid transmission (Urcuqui-Inchima et al.,
1999).
7
Gal-On and Raccah (2000) recently reported that substitution of Ile for Arg in
the conserved FRNK (Phe-Arg-Asn-Lys) motif in the central region of the
HC-Pro affected symptom expression. Cucumber, melon and watermelon
infected with ZYMV containing this mutation were symptomless while
symptoms in squash were altered from severe to mild although
accumulation of the virus reached a level similar to that of wild type ZYMV
(Gal-On and Raccah, 2000). As well, single amino acid changes in the HC-
Pro of Plum pox virus (PPV) caused dramatic effects on symptoms in
herbaceous hosts (Saenz et al., 2001).
The central region of the HC-Pro also appears to be involved in replication.
Mutation of the TEV HC-Pro in the highly conserved Ile-Gly-Asn (IGN) or
Cys-Cys/Ser-Cys (CC/SC) motifs abolished RNA amplification and systemic
movement of the virus, respectively (Cronin et al., 1995). The potyvirus HC-
Pro binds non-specifically to single-stranded nucleic acids with a preference
for RNA (Maia and Bernardi, 1996; Merits et al, 1998). In PVY, two
independent RNA binding domains were identified in the central region of
the HC-Pro (Urcuqui-Inchima et al., 2000).
The HC-Pro has been implicated in cell-to-cell movement of several
potyviruses including PPV (Saenz et al., 2002), TEV (Cronin et al., 1995;
Kasschau et al., 1997), Sweet potato feathery mottle virus (SPFMV) (Sonoda
et al, 2000), Bean common mosaic necrosis virus (BCMNV) and Lettuce
mosaic virus (LMV) (Rojas et al., 1997).
The HC-Pro has been implicated as the region responsible for the synergism
seen between potyviruses and unrelated viruses that results in more severe
symptoms and increased virus accumulation in systemically infected leaves
(Pruss et al., 1997). When SPFMV HC-Pro coding region was introduced into
a Potato virus X (PVX) virus vector it enhanced symptom severity on N.
benthamiana and long distance movement in Ipomea nil and SPMFV HC-Pro
was localised to the phloem of I. nil (Sonoda et al., 2000). The same
synergism was observed for PPV HC-Pro, which enhanced the pathogenicity
of PVX in N. clevelandii and N. benthamiana (Saenz et al., 2002).
8
It has also been demonstrated that the HC-Pro functions as an effective
suppressor of post-transcriptional gene silencing (PTGS) (Anandalakshimi et
al., 1998; Brigneti et al., 1998; Kasschau and Carrington, 1998; Kasschau
and Carrington 2001). Kasschau and Carrington (2001) suggested that the
role of HC-Pro in long distance movement and genome replication depends
on PTGS suppression. They demonstrated that mutations that caused long
distance movement and replication defects also caused defects in PTGS
suppression while mutations that did not interfere with long distance
movement and replication of the virus were similar to wild type HC-Pro in
PTGS suppression.
Like the P1 protein, the HC-Pro cleaves itself from the polyprotein. The
proteolytically active domain has been localised to the C terminus of the HC-
Pro (Carrington et al., 1989) where autocatalytic cleavage occurs at a
conserved Gly-Gly dipeptide at the junction with P3. Among 19 TEV HC-Pro
mutants tested only those with alterations at Cys-649 and His-722 were
defective for HC-Pro autocatalytic activity implicating them as active site
residues and suggesting that the HC-Pro is a cysteine-like proteinase (Oh
and Carrington, 1989). Mutation studies to investigate the amino acid
sequence requirements surrounding the HC-Pro C-terminal cleavage site of
TEV identified four conserved amino acids (Tyr, Val, Gly and Gly) flanking
the cleavage site as essential for recognition of the cleavage site (Carrington
and Herndon, 1992). Mutations affecting the active site residues His-Cys-Gly
of TEV inhibited proteolytic activity and these mutants were amplification
defective (Kasschau and Carrington, 1995). Amplification activity was
unable to be restored by insertion of the TEV NIa cleavage site between the
HC-Pro and P3 coding regions suggesting that an active HC-Pro proteinase
is required in cis for TEV genome amplification.
1.1.2.3 P3 protein & 6K1 The P3 and 6K proteins have been implicated in replication and
pathogenicity. TVMV (Rodriguez-Cerezo et al., 1993) and TEV (Langenberg
and Zhang, 1997) P3 were localised in the cytoplasm and nucleus,
9
respectively. In TVMV, P3 was associated with the CI protein at early
stages of the formation of the cylindrical inclusion bodies and in TEV, P3
was found associated with NIa. Nevertheless, both studies concluded that
the P3 could be involved in virus amplification. In support of this, mutations
in the P3 of TVMV eliminated replication in plants and protoplasts (Klein et
al., 1994).
P3 has recently been implicated in pathogenicity in a number of studies.
Mutations between P3 and 6K1 peptide in PPV resulted in symptomless viral
infections (Riechmann et al., 1995), although virus concentration was not
affected. Saenz et al. (2000) reported the presence of a pathogenicity
determinant in the C-terminal region of the P3/6K1 complex of PPV. They
found the size of this determinant and the kind of symptoms that it induced
were host dependent. P3/6K1 has also been identified as a determinant of
pathogenicity for Pea seed-borne mosaic virus (PSbMV) in peas containing
the resistance gene sbm-2 (Johansen et al., 2001) and for TVMV in Brassica
napus differential line 165 (Jenner et al., 2002). This is discussed further in
section 1.4.
1.1.2.4 CI protein
The potyviral CI protein has NTP binding, NTPase, RNA binding and RNA
helicase activity (Lain et al., 1990; Lain et al., 1991; Fernandez et al., 1995).
The CI protein has seven conserved segments in its N-terminal half
(reviewed in Kadare and Haenni, 1997). These conserved regions have
been implicated in functions including RNA binding activity (segment VI),
NTPase activity (segment II, V) and NTP binding (segment I) (Fernandez et
al, 1995; Fernandez and Garcia, 1996). The function of these segments in
potyviruses is reviewed in Urcuqui-Inchima et al. (2001).
ATPase activity in infected cells was identified in cytoplasmic vesicles close
to the CI inclusions (Chen et al., 1994) that were proposed to be sites of viral
RNA synthesis. There is other, if somewhat limited, evidence for the
involvement of CI in replication. Mutations in the CI of TVMV and TEV were
10
reportedly able to eliminate replication (Klein et al., 1994; Carrington et al.,
1998).
The presence of ATPase activity was also observed in plasmodesmata
(Chen et al., 1994), implicating the CI in cell-to-cell movement. Although
experiments suggest the CI is not a movement protein in the same way as
the HC-Pro or CP (Rojas et al., 1997), studies have supported the
localisation of CI close to plasmodesmata and often in structures crossing
the cell wall into neighbouring cells (Rodriguez-Cerezo et al., 1997; Rojas et
al., 1997). In addition, several mutants of TEV in which replication was not
inhibited, did not move out of the infected cell or were defective in systemic
movement (Carrington et al., 1998). These results support the involvement
of CI in cell-to-cell movement.
1.1.2.5 6K2 peptide
The 6K2 peptide has been implicated in genome amplification and anchoring
of the replication apparatus to ER-like membranes (reviewed by Urcuqui-
Inchima et al., 2001). The 6K2 peptide of TEV was able to abolish transport
of the TEV NIa to the nucleus when bound to the NIa (Restrepo-Hartwig and
Carrington, 1992). Mutations that prevented correct cleavage of the 6K2/NIa
junction resulted in debilitated or non-viable virus (Restrepo-Hartwig and
Carrington, 1994). The central hydrophobic domain of the 6K2 peptide was
shown to be necessary for binding the 6K2 to ER-derived membranes
(Schaad et al., 1997). However, targeting to these membranes may also
require VPg or NIa with 6K2.
1.1.2.6 NIa protein NIa, the small nuclear inclusion protein, is usually found co-localised with the
large nuclear inclusion protein (NIb) in the nucleus, often, but not always in
inclusion bodies. The NIa is composed of two domains, the N-terminal
genome-linked protein (VPg) domain, and the C-terminal proteinase domain
(Dougherty and Parks, 1991). The VPg is required in viral replication and
11
host genotype specificity (Schaad et al., 1997). The VPg attaches covalently
to the 5’ terminus of the genomic RNA through a phosphodiester linkage
with the hydroxyl group of a conserved Tyr (Murphy et al., 1990). Mutation of
the Tyr residue involved in covalent attachment of the VPg to TVMV viral
RNA affected virus replication in protoplasts and also eliminated NIb-NIa
interaction (Hong et al., 1995). These results led Hong et al. (1995) to
conclude that the NIb protein interacts with the VPg domain of the NIa and
that this interaction requires a functional RNA attachment site. Also, this
interaction may be important for the initiation of viral RNA synthesis in
infected cells. Plochocka et al. (1996) used a three-dimensional model of the
PVY VPg to demonstrate covalent attachment of the terminal A residue with
the specific Tyr residue facilitated exposure of the 5’ RNA sequence
enabling interaction with other components for (+) and (-) strand RNA
replication. PVA VPg was shown to bind RNA in a sequence nonspecific
manner (Merits et al., 1998). Using northwestern blots (Merits et al., 1998)
and UV cross-linking assays (Daròs and Carrington, 1997), the NIa was
shown to be able to bind RNA either as NIa-Pro, NIa, 6K2-NIa or VPg. The
precise RNA binding domains of potyvirus NIa have not been characterised
and no RNA binding sequence motifs have been identified (Urcuqui-Inchima
et al., 2001).
The VPg has been shown to be involved in determining host specificity for
systemic movement or replication in several potyviruses including TEV
(Schaad et al., 1997), TVMV (Nicolas et al., 1997), PSbMV (Keller et al.,
1998; Borgstrom and Johansen, 2001) and PVA (Rajamaki and Valkonen,
1999; Guo et al., 2001). This is discussed further in section 1.4
The NIa is the major potyviral proteinase involved in cis and trans proteolytic
cleavage of the C-terminal two thirds of the potyviral polyprotein into
functional proteins (Carrington and Dougherty, 1987). There are at least six
cleavage sites in the viral polyprotein recognised by the NIa protease
(Carrington et al., 1993). Cleavage sites within the polyprotein have a
conserved consensus motif e.g. in TEV the consensus is Glu-x-x-Tyr-x-
Gln↓Ser/Gly where cleavage occurs between the Gln-Gly dipeptides
12
(Carrington et al., 1988). The NIa proteases from TEV and TuMV have
been over-expressed and purified (Kim et al., 1995; Parks et al, 1995) and
the recombinant proteases were shown to be catalytically active. However, a
truncated NIa protease lacking the C-terminal 20-24 amino acids resulting
from autocatalytic activity of the recombinant protease was shown to be less
active (Kim et al., 1995, Parks et al., 1995). In a later study, Kim et al. (1998)
reported that mutation of the C-terminal conserved residues Phe, Val, Lys,
Ile and Leu in the TuMV NIa protease did not exhibit any significant effect on
the cleavage between NIa and NIb, suggesting that the conserved residues
are not essential for the cleavage of the NIa – NIb junction sequence. Earlier
mutational studies on TEV NIa protease indicated that His-46, Asp-81 and
Cys-151 constitute the catalytic triad (Dougherty et al., 1989). Attempts to
delineate the region involved in substrate binding revealed that the C-
terminal 150 amino acid residues of the NIa protease contained the
necessary information for recognition of the cleavage site, and the specificity
determinants were confined to at least three sub-domains between amino
acids 94-166, 166-183, 183-243 of the TEV NIa protease (Parks and
Dougherty, 1991). However, specific amino acid residues involved in
substrate recognition could not be identified. NIa sequence between
positions 40 and 49 was found to be sufficient for nuclear localisation.
Gus/NIa fusion proteins lacking this sequence were unable to translocate to
the nucleus (Schaad et al., 1996).
1.1.2.7 NIb protein
The NIb is the potyviral RNA dependent RNA polymerase (RdRp),
characterised by the presence of a conserved GDD motif and has been
shown to have replicase activity (Koonin, 1991; Hong and Hunt, 1996) and
as might be expected, binds RNA (Merits et al., 1998). Like the NIa, NIb was
found to accumulate in the nucleus of infected cells (Baunoch et al., 1991;
Dougherty and Hiebert, 1980), sometimes in inclusion bodies. Translocation
of the NIb to the nucleus is facilitated by two independent nuclear localisation
signals (Li et al., 1997). The function of the NIb in the nucleus is still
unknown as replicase activity occurs in the cytoplasm or associated with
13
membranes. Using a two-hybrid system, the TVMV NIb protein was shown to
interact with both NIa and CP as well as with itself (Hong et al., 1995).
Mutations in the GDD domain abolished the NIb-CP interaction but not the
NIb-NIa interaction. Unlike TVMV, no self-interaction was found with the NIb
of TEV (Li et al., 1997) or ZYMV (Wang et al., 2000). NIb was found to
interact with NIa through its VPg (Hong et al., 1995; Fellers et al., 1998) or
protease domain (Li et al., 1997; Daròs et al., 1999). ZYMV NIb was also
shown to interact with its host (cucurbit) poly (A) binding protein (Wang et al.,
2000), although the significance to virus replication is unknown.
1.1.2.8 Coat protein CP is a multifunctional protein involved in aphid transmission, cell-to-cell and
systemic movement, encapsidation of viral RNA and the regulation of viral
RNA amplification (Urcuqui-Inchima et al., 2001). The CP can be divided
into 3 general regions, N- and C- terminal regions that are exposed on the
surface of the virion and a highly conserved core region (Shukla and Ward,
1989). Mechanical inoculation after removal of the N and C termini by trypsin
digestion suggested that these regions are not involved in infectivity (Shukla
et al., 1988). The conserved DAG motif, located near the N terminus of the
CP is important in aphid transmission of the virus (Harrison and Robinson,
1988). In TVMV and TEV, most substitutions and all deletions in the DAG
motif resulted in loss or drastic reduction of aphid transmissibility (Atreya et
al., 1995; Lopez-Moya et al., 1999). Some mutations introduced in residues
adjacent to the DAG motif in TEV also affected transmissibility, suggesting
regions other than the DAG motif are required for efficient transmission
(Lopez-Moya et al., 1999). The N-terminal region of the CP must interact
with HC-Pro for successful transmission (Salomon and Bernardi, 1995;
Blanc et al, 1997). Mutations in the DAG motif of TVMV not only abolished
or reduced transmissibility but prevented or reduced binding of the CP with
the HC-Pro (Blanc et al., 1997). In contrast, no interaction was detected
between PVA CP and HC-Pro using the two-hybrid system (Guo et al.,
1999).
14
Mutational studies of the TEV CP revealed that CP is necessary for cell-to-
cell and long-distance movement (Dolja et al., 1994). Deletion of a part of
the N-terminal region of the CP resulted in virus that was defective in cell-to-
cell movement and blocked in systemic movement. A mutation within the
core region of the CP affected virus assembly and subsequently cell-to-cell
movement, while mutations in either the N- or C-terminal regions or both
caused inhibition of systemic movement.
The main function of the CP is to encapsidate the viral RNA, requiring only
the core domain of the CP (Shukla and Ward, 1989). Mutagenesis studies
within the core region of the CP have identified amino acids essential for
virus assembly in a number of studies (Jagadish et al., 1993; Dolja et al.,
1994; Dolja et al., 1995; Varrelmann and Maiss, 2000). Mutations in the
core that affect assembly cannot be trans-complemented by wild type virus
(Varrelmann and Maiss, 2000).
The CP and NIb have been shown to interact (Hong et al., 1995), an
interaction that involves the GDD motif, suggesting the CP is involved in
regulation of RNA synthesis. It has been shown that translation of at least
part of the CP coding region, rather than the presence of the CP itself, can
stimulate genome amplification (Mahajan et al., 1996). This process
functions in cis.
1.1.2.9 Untranslated regions Untranslated regions exist at both the 5’ and 3’ end of the potyviral genome. Potyviral 5’ untranslated regions range in length, are especially rich in
adenine residues and have few guanine residues (Gallie et al., 1987).
Carrington and Freed (1990) showed that the 5’UTR of TEV can function as
an enhancer of translation in plant cells. This was also demonstrated for the
PSbMV 5’UTR (Nicolaisen et al., 1992). Riechmann et al. (1992) suggested
that some conserved regions located in the 5’UTRs of PPV, TEV, TVMV and
PVY may play a role in translation, replication or virus encapsidation.
15
The potyviral 3’UTRs are heterogenous in length, sequence and predicted
secondary structure (Quemada et al., 1990). The primary and secondary
structure of the 3'UTR for potyviruses has been postulated to be involved in
specific replicase recognition for minus-strand synthesis; however, this
function has yet to be attributed to a specific region or sequence. The 3’UTR
is also polyadenylated; this has been shown to be essential for infectivity and
is mediated by polyadenylation sites in the 3’UTR (Takahashi and Uyeda,
1999).
1.2 PAPAYA RINGSPOT VIRUS (PRSV)
1.2.1 Description
Papaya ringspot virus (PRSV) is a member of the potyvirus genus in the
family Potyviridae. PRSV isolates are divided into two strains, type P and W,
which are serologically and morphologically identical and can only be
differentiated on the basis of their host range (Gonsalves and Ishii, 1980).
Although originally classified as different potyviruses (PRSV-W was originally
Watermelon mosaic virus 1), amino acid similarity of approximately 98% of
the NIb, as well as the CP and 3’UTR of US isolates of PRSV-P and -W,
confirmed they are strains of the same virus (Quemada et al., 1990).
PRSV-W isolates naturally infect only cucurbits while PRSV-P isolates infect
both cucurbits and papaya. The experimental host range of PRSV-P
includes 15 species in three families (Caricaceae, Chenopodiaceae,
Cucurbitaceae) while PRSV-W infects 38 species of 11 genera in two
families (Cucurbitaceae, Chenopodiaceae) (Edwardson and Christie, 1986).
The symptoms of PRSV-P include mottling, ringspots and distortion of
leaves (Fig. 1.2), rings and spots on fruit (Fig. 1.3) and streaks with a greasy
or water-soaked appearance on stems and petioles while PRSV-W induces
mottling and distortion of leaves and fruits (Fig.1.4) (Purcifull et al., 1984).
Variation in symptoms is dependent on virus isolate, stage of infection, plant
size and vigour, and temperature (Purcifull et al., 1984).
16
It has been shown that PRSV-P isolates are transmitted by 21 aphid species
in 11 genera with Myzus persicae and Aphis gossypii the most important
natural vectors (Purcifull et al., 1984). PRSV-W isolates are transmitted by
24 aphid species in 15 genera with Myzus persicae, Acyrthosiphum solani,
Aphis craccivora and Macrosiphum euphorbiae as natural vectors (Purcifull
et al., 1984; Shukla et al., 1994). PRSV is not thought to be seed-transmitted
in papaya or cucurbit seed (Purcifull et al., 1984; Shukla et al., 1994).
However, there is one report of seed transmission of PRSV-P in seed of a
local papaya cultivar in the Philippines (Bayot et al., 1990). Papaya leaf-
distortion mosaic virus (PLDMV) identified in papaya in Japan, also shows
the same symptoms of infection as PRSV-P and was first identified as an
isolate of PRSV-P but was subsequently shown to be distinct from PRSV-P
(Maoka et al., 1996).
PRSV is widespread throughout the world. PRSV-P is found in most tropical
and sub-tropical areas where papaya is grown. PRSV-W occurs wherever
cucurbits are grown (Purcifull et al., 1984); however, it has not been reported
in South Africa although the closely related cucurbit virus Moroccan
watermelon mosaic virus (MWMV) is widespread (Lecoq et al., 2002). The
extensive list of countries known to have PRSV include USA, South
America, Caribbean, India, Taiwan, Australia, Thailand, Sri Lanka, Middle
East, Mexico, Germany, France and Italy (De La Rosa and Lastra, 1983;
Purcifull et al., 1984; Shukla et al., 1994). PRSV-P has had devastating
effects on the papaya industry around the world. PRSV was first reported in
Hawaii in 1945 (Jensen, 1949). In Hawaii, PRSV-P became widespread on
Oahu in the early 1950's and has since spread to all commercial papaya
growing regions (Gonsalves, 1998). The virus has drastically affected papaya
17
Figure 1.2 PRSV-P infected papaya.
18
Figure 1.3 PRSV-P infected papaya fruit. Arrows indicate
typical ringspots symptoms on fruit.
19
A B
C
Figure 1.4 PRSV-W infected cucurbits. A & B: Symptoms on
leaves. C: Symptoms on the fruit
20
production and in severely infected regions, PRSV-P infection has eliminated
papaya as a cash crop, resulting in loss of income for farmers and reduced
quality and availability of fruit for consumers. PRSV-P had destroyed most of
the commercial plantations on the west coast of Southern Taiwan within four
years after it was first recorded in 1975 and production dropped 60% in this
period (Yeh et al., 1988). Also, export markets to Hong Kong and Japan
were lost and the industry now has difficulty in supplying even the domestic
market (Yeh et al., 1988). In Brazil, yield reductions averaging 70% have
been measured (Rezende and Costa, 1993). In the Philippines, papaya
production decreased by 85% in six years after PRSV-P was identified in
1982 (Opina, 1991). PRSV-P is also the limiting factor to papaya production
in Mexico and it was reported that up to 90% of plants die from the disease
within a year of planting (Mora-Aquilera et al., 1993).
1.2.2 Genome organisation: comparison with other potyviruses
PRSV virions are flexuous filaments, approximately 780nm long x12nm wide
(Purcifull et al., 1984), containing a single molecule of linear, positive-sense,
ssRNA approximately 10.3kb in length (Yeh et al., 1992).
The complete nucleotide sequence of two isolates of PRSV-P, PRSV HA
(Hawaiian isolate) (Yeh et al., 1992) and PRSV YK (Taiwanese isolate)
(Wang and Yeh, 1997) have been published. Several other full-length
sequences have recently been submitted directly to GenBank (see chapter
4). The PRSV genome has a similar organisation to other members of the
potyvirus genus (Yeh et al., 1992; Wang and Yeh, 1997). The viral RNA of
PRSV is relatively large compared to other potyvirus sequences, which are
generally between 9-10kb long (Table 1.1), although SPFMV is larger
(10.8kb). The average amino acid identity of each protein of PRSV
compared with those of seven other potyviruses is less than 58.6% (Fig.
1.5). There is a 5’UTR of 85 nucleotides, which is short compared to many
other potyvirus 5’UTRs and a 3’UTR of 209 nucleotides which is
polyadenylated (Yeh et al., 1992). PRSV has a relatively long P1 coding
region compared with other potyviruses (Wang and Yeh, 1997). The P1
21
Table 1.1 . Comparision of the genome size of potyviruses (data extracted
from National Centre for Biotechnology Information (NCBI)).
Virus
Size (bp)
Locus
Yam mosaic virus 9608 NC_004752 Potato virus Y strain N isolate N-Jg 9700 AY166867 Peru tomato mosaic virus 9899 NC_004573 Wild potato mosaic virus 9878. NC_004426 Maize dwarf mosaic virus 9515 NC_003377 Sweet potato feathery mottle virus 10820 NC_001841 Johnson grass mosaic virus 9779 NC_003606 Plum pox virus isolate PENN 9786 AF401296 Soybean mosaic virus 9588 AB100443 Sugarcane mosaic virus 9589 SMO278405 Sorghum mosaic virus strain H 9613 SMU57358 Dasheen mosaic virus 10038 NC_003537 Bean common mosaic necrosis virus 9612 NC_004047 Potato virus A 9585 NC_004039 Potato virus V 9848 NC_004010 Leek yellow stripe virus 10142 NC_004011 Cowpea aphid-borne mosaic virus 9465 NC_004013 Cocksfoot streak virus 9663 NC_003742 Lettuce mosaic virus 10080 NC_003605 Clover yellow vein virus 9584 NC_003536 Bean yellow mosaic virus 9532 NC_003492 Zucchini yellow mosaic virus 9591 NC_003224 Peanut mottle virus 9709 NC_002600 Tobacco etch virus 9494 NC_001555 Turnip mosaic virus 9835 NC_002509 Tobacco vein mottling virus 9475 NC_001768 Pea seed-borne mosaic virus 9924 NC_001671 Pepper mottle virus 9640 NC_001517 Scallion mosaic virus 9324 SMO316084 Bean common mosaic virus cowpea isolate Y
10062 BCO312438
22
Figure.1.5. Average % identity of PRSV proteins with homologous proteins
of six additional potyviruses (TEV, TVMV, PVY, PSbMV, Pepper mottle virus
(PeMV), Soybean mosaic virus (SMV)). (Based on the data reported in Yeh
(1994))
protein appears to be the most variable potyviral protein and shows a wide
variation in size (from 29K-63K) among reported potyviruses (Yeh, 1994).
Between the P1 proteins of Taiwanese and Hawaiian PRSV isolates there is
only 70.9% nucleotide identity and 66.7% amino acid identity (Wang and
Yeh, 1997). This high level of variability is also seen within isolates from a
particular country. Henderson (1999) reported 81.41% nucleotide and
76.97% amino acid similarity between the P1 proteins of PRSV-P and W
from Thailand. The Australian PRSV-P and W isolates were reported to be
96.89% and 95.43% similar at the nucleotide and amino acid levels,
respectively (Henderson, 1999).
Next to the P1 protein, the P3 and 6K1 are the least conserved between
PRSV and other potyviruses (Fig.1.5), suggesting that the function of these
proteins may be more virus specific (Yeh, 1994). Remaining proteins range
from 43 to 59% identity with homologous potyvirus proteins (Fig.1.5) (Yeh,
1994). Between the Hawaiian and Taiwanese PRSV-P isolates, amino acid
sequence identity between proteins (excluding P1) ranged from 91.2% (6K1)
to 97.6% (CI) (Wang and Yeh, 1997).
Characterisation of the CP and/or 3’UTR has been reported for several
PRSV isolates (Nagel and Hiebert, 1985; Quemada et al., 1990; Bateson
VPg proteinase
49.4% 43.1%
33.9%
P1 HC Pro P3 CI NIa NIb CP
6K1
14.3% 49.1% 30.6% 55.1% 59.5% 54.5%
23
and Dale, 1992; Wang and Yeh, 1992; Bateson et al., 1994; Bateson et al.,
2002). These studies showed that differences in the CP sequence among
PRSV strains were located mostly in the N terminus and include differences
in number of amino acids as has been demonstrated in other potyviruses
(Shukla et al., 1994). This variation in the CP of PRSV is related to the
difference in geographic origin rather than host specificity (Wang and Yeh,
1997; Bateson et al., 1994; Bateson et al., 2002).
1.2.3 PRSV in Australia
PRSV-W was first recorded in Australia in 1978 (Greber, 1978) and is now
prevalent in most cucurbit growing regions in Queensland, northern New
South Wales and the Northern Territory (Persley, 1997). PRSV-P was first
recorded in Australia in 1991 (Thomas and Dodman, 1993) and it is still
restricted to South East Queensland.
PRSV has a significant economic impact on Queensland cucurbit and
papaya growing regions (Persley, 1997). Almost all cultivars of watermelon
and pumpkin are susceptible to PRSV-W. In the Northern Territory, PRSV-W
causes significant problems in Cucumis melo (rockmelon) and Citrullis
lanatus (watermelon). In Queensland, PRSV-W is of major economic
importance in Cucurbita maxima (Queensland blue pumpkin) and Cucurbita
pepo (zucchini). PRSV-W often occurs as a co-infection with ZYMV resulting
in severe yield losses in cucurbits. When PRSV-P was first reported in
Queensland, restrictions on movement of papaya were put in place and all
symptomatic plants located on commercial properties were destroyed in an
attempt to control the disease. To date, this has been successful. As well,
several immune transgenic papaya lines were developed against this PRSV-
P isolate (Lines et al., 2002) which are available to the industry should the
virus move out of South East Queensland. While it was initially assumed
that PRSV-P had been introduced from overseas, subsequent studies
comparing the coat protein sequences of Australian PRSV-P and -W
isolates with several overseas isolates (Bateson et al., 1994) demonstrated
very low levels of variability (< 2% nucleotide variability) between Australian
24
P and W isolates compared to overseas isolates (up to 12% nucleotide
variability). This close relationship between Australian isolates and the
presence of PRSV-W in Australia at least 20 years before PRSV-P led to the
hypothesis that, at least in Australia, PRSV-P may have arisen by mutation
from PRSV-W (Bateson et al., 1994). As yet the molecular basis of this
mutation is unknown.
1.3 POTYVIRAL HOST RANGE DETERMINANTS It is well established that plant viruses spread from cell to cell by an active
process involving the interaction of specific viral and host factors. Plant
viruses enter host cells through wound sites, which are induced mechanically
or by vector organisms. Spread of infection throughout the plant from the
initially infected cells occurs by two processes. First, viruses spread to
neighbouring cells from initially infected cells; this is short distance or cell-to-
cell movement. A second, long-distance movement allows the viruses to
enter the vascular system and spread systemically throughout the plant. The
host range of a plant virus can be affected by blocking systemic infection at
several stages: (i) initial infection and viral uncoating, (ii) replication of the
virus, (iii) cell-to-cell movement (short distance movement) and (iv)
movement into the vascular system (long distance movement) (v) stimulation
of plant cell defence mechanisms. All of these factors seem to have some
role in host range determination (Matthews, 1991; Schaad et al., 1996).
For most plant virus groups, movement involves one or more specialized
virus-encoded proteins called movement proteins (MPs) (Revers et al.,
1999). Cell-to-cell and long-distance movement of plant virus has been
identified as primary determinants of host range within plant virus groups.
The ability of a virus to move through a plant and cause a systemic infection
is highly dependent upon the host specific interactions, particularly
movement through the plasmodesmata, which connect plant cells together to
form a symplasm (Atabekov and Dorokhor, 1984). Although it is accepted
that plant viruses spread via plasmodesmata, it has been shown that the
typical molecular size exclusion limit (SEL) of plasmodesmata is significantly
25
smaller than would be necessary to allow passage of either the smallest
virus particle or viral nucleoprotein complexes (Dickinson, 1996). Therefore
viral infection must lead to alteration of the aperture structure or size when
viruses spread using plasmodesmata. Studies suggested that the MPs
induce plasmodesmata gating, and then move through the pore carrying viral
nucleic acid to adjacent cells (Derrick et al., 1992; Ding,1998; Fujiwara et
al.,1993; Noueiry et al., 1994; Zambryski and Crawford, 2000). Further,
gating increases the plasmodesmata size exclusion limit for transport of large
molecules between cells. Plasmodesmata between mesophyll cells of
transgenic plants expressing MP have an SEL that is ~10-fold higher than
that of plasmodesmata of control plants.
Potyviruses do not encode a dedicated movement protein (Revers et al.,
1999) but movement functions have been allocated to several proteins, a
number of which have been implicated as determinants of pathogenicity.
1.3.1 CP and HC-Pro
The CP and HC-Pro of potyviruses have been implicated in host range; there
is also evidence that they interact to facilitate systemic infection. The
potyvirus CP was hypothesised to be involved in host range when the CPs of
strains of Sugarcane mosaic virus (SCMV), which differed in host range,
were shown to have a hypervariable region (21-68 amino acids in length) in
the surface exposed N terminus (Frenkel et al., 1991; Xiao et al., 1993).
Although these regions appeared to correlate with host range, this has not
been confirmed. The CP has also been implicated in host range through its
putative movement function. The core region of the CP of TEV was shown to
be essential for cell-to-cell movement and virion assembly, while the N and C
termini were necessary for long distance movement (Dolja et al., 1994;
1995). Comparative studies with TEV in tobacco line Havana 425, which
supports systemic infection, and line V20, which suppresses long distance
movement, demonstrated that the virus was blocked at entry to or exit from
sieve elements (Schaad and Carrington, 1996). They suggested that long-
distance movement of TEV requires a set of host functions that were
26
different to those involved in cell-to- cell movement. Cronin et al. (1995)
demonstrated that the central region of TEV HC-Pro was also required for
long distance movement of TEV and proposed that the HC-Pro and CP
interact to form an active transport complex. Experiments with PVA
supported this concept of co-ordinated interaction between the HC-Pro and
CP (Andrejeva et al., 1999). PVA isolate PVA-B11 differs from isolate PVA-U
as it is not transmitted by aphids and does not systemically infect potato
(Solanum tuberosum L. cv. Pentland Ivory). The authors demonstrated that
the phenotypic effects resulting from simultaneous mutation of the CP and
HC-Pro were different from the expected ‘sum’ of individual mutations and
this suggests coordinated functions of HC-Pro and CP in accumulation and
movement of PVA. On the other hand, Andersen and Johansen (1998)
showed that a change from Ser to Pro at amino acid 47 in the CP of PSbMV
restricted systemic movement of the virus in Chenopodium quinoa.
Interestingly, the CP of PVY was reported to complement cell-to-cell
movement of a CP movement-deficient PVX mutant by a mechanism other
than coating of virions (Fedorkin et al., 2000) while the HC-Pro of SPFMV
reportedly enhances the long distance movement of PVX in Ipomea nil
(Sonoda et al., 2000). Interestingly, while single amino acid changes in the
HC-Pro of subisolates of PPV-PS had a significant effect on virus symptoms
in a range of Nicotiana species (herbaceous hosts) and modified infectivity
on peach seedlings (woody host) (Saenz et al., 2001), the amino acids
eliminating infectivity of 2 subisolates on peach seedlings were not found in
the HC-Pro. Recently, it was reported that expression of the 5’ terminal
region of the TEV genome, including the P1 and HC-Pro coding sequences,
in transgenic plants facilitated the movement of PPV in tobacco (Saenz et al.,
2002). This complementing activity was disturbed by mutation in the HC-Pro
coding sequence of TEV implicating the HC-Pro in long distance movement
(Saenz et al., 2002).
1.3.2 VPg
Recently, the N terminus of the small nuclear inclusion protein (NIa), which
encodes the viral genome linked protein (VPg), has been implicated as a
27
host range determinant of several potyviruses including TVMV (Nicolas et al.,
1997); TEV (Schaad et al., 1997), PSbMV (Keller et al., 1998, Borgstrom and
Johansen, 2001; Hjulsager et al., 2002), PVY (Masuta et al., 1999), PVA
(Rajamaki and Valkonen, 1999; Rajamaki and Valkonen, 2002) and TuMV
(Leonard et al., 2000). In TVMV, 4 amino acids in the VPg were sufficient to
overcome resistance of the recessive va gene in tobacco (Nicolas et al.,
1997). Similarly, a single amino acid change in the VPg of PVY correlated
with the ability to overcome resistance of the va gene (Masuta et al., 1998).
Evidence suggested this was acting at the level of cell-to-cell movement. The
V20 cultivar of Nicotiana tabacum restricts systemic infection by most TEV
strains, including TEV-HAT, but is fully susceptible to TEV-Oxnard. Chimeric
viruses assembled from TEV-HAT and TEV-Oxnard implicated the VPg
domain as a host range determinant of this virus (Schaad et al., 1997).
Pisum sativum line 269818 (sbm-1/sbm-1) is susceptible to PSbMV
pathotype P4 but resistant to the biochemically and serologically related
pathotype P1. Using recombinant infectious clones, the VPg was implicated
as the pathogenicity determinant overcoming sbm-1 resistance (Keller et al.,
1998). Resistance appeared to be at the level of replication rather than cell-
to-cell movement. Subsequently, mutational analysis of the VPg of P1 and
P4 isolates revealed that changes affecting amino acids 105 to 117 in the
central region of VPg influenced virulence on P. sativum line 26981
(Borgstrom and Johansen, 2001).
PVA-M is restricted to the inoculated leaves of Nicandra physaloides while
PVA-B11 infects plants systemically. Site directed mutagenesis of the cDNA
clones of PVA-B11 and PVA-M suggested that the 6K2 protein and the VPg
are determinants of systemic infection in N. physaloides (Rajamaki and
Valkonen, 1999). Furthermore, a recent study by Rajamaki and Valkonen
(2002) showed that virus strain specific resistance to systemic infection with
PVA in Solanum commersonii is overcome by a single amino acid
substitution in the VPg.
28
Interactions have been shown to take place between the VPg of potyviruses
and translation eukaryotic initiation factors involved in initiation of translation
of capped mRNA’s. TuMV VPg has been shown to interact with eIF(iso)4E
of Arabidopsis thaliana (Wittmann et al., 1997) and wheat (Leonard et al.,
2000) as well as eIF4e of Arabidopsis (Leonard et al., 2000), while TEV VPg
was shown to interact with eIF4E from tobacco (Schaad et al., 2000). In
TuMV, the interaction domain was mapped to a stretch of 35 amino acids in
the N terminus of the VPg (Leonard et al., 2000) and is conserved among
potyviruses. This region incorporates the conserved Tyr residue which
covalently links the VPg to the viral RNA. A single amino acid substitution at
a highly conserved Asp residue found within this region completely abolished
the interaction preventing infection of A. thaliana (Leonard et al., 2000).
Interaction between translation initiation factors and the VPg of other types of
viruses has also been reported e.g Tomato ringspot virus (TRV), a Nepovirus
interacts with eIF(iso)4E from Arabidopsis (Leonard et al., 2002). A mutant
line of Arabidopsis lacking the gene encoding eIF(iso)4E but with wild-type
phenotype was isolated (Duprat et al., 2002) and found to be resistant to
TuMV and LMV but not to a Nepovirus or a Cucumovirus. This indicates that
eIF(iso)4E is required for susceptibility to potyviruses but is not essential for
plant growth. A natural recessive resistance gene (pvr2) that confers
resistance to PVY in pepper has been shown to correspond to an eIF4E
gene (Ruffel et al., 2002).
1.3.3 P3, 6K1 and CI
In several instances, pathogenicity determinants have been identified in the
region of the genome incorporating the P3 and 6K1 proteins and on occasion
the CI (Saenz et al., 2000; Dallot et al., 2001; Johansen et al., 2001; Jenner
et al., 2002). PPV–R and PPV-PS induce different symptoms in Nicotiana
clevelandii. Using chimeric PPV-R/PS viruses, the pathogenicity
determinants of these strains were localised to the genomic fragment that
encodes 173 amino acids from the C-terminal part of the P3 and the 6K1
protein (Saenz et al., 2000). This region was sufficient to give PPV-PS
symptoms, although the same region was not sufficient in reciprocal
29
recombinants. Specific sequences in the CI were also required to elicit the
symptoms of PPV-R in N. clevelandii. The same, although smaller region (74
amino acids) determined symptom differences in Pisum sativum.
While pathogenicity determinants in the P-1 pathotype of PSbMV on P.
sativum cv. PI 269818 (with recessive gene sbm-1) were mapped to the VPg
(see 1.3.2.1), determinants in a second PSbMV pathotype, P-2 (resistant to a
second recessive gene sbm-2 in P. sativum cv. Bonneville) were mapped to
the P3-6K1 coding region (Johansen et al., 2001). Resistance afforded by
sbm-2 on P-2 was shown to affect an early step in infection, possibly
replication or cell-to-cell movement (Johansen et al., 2001).
Pathogenic determinants influencing systemic infection of 2 different PPV
isolates on plum were localised to the P3-6K1 coding region using chimeric
virus clones (Dallot et al., 2001). In contrast, determinants of local and
systemic infection in peach were not located accurately and may be
influenced by multiple regions of the genome within the P3-6K1-CI (Dallot et
al., 2000). It was concluded that infection of plum and peach was governed
by different determinants. Two different pathogenicity determinants were
identified in TuMV (Jenner et al., 2002), one in the P3 and one in the CI.
These regions were shown to be pathogenicity determinants for two different
resistance genes in Brassica napus line 165.
Although one of the economically most important plant virus families, and
with a host range that extends (as a family) to most plant families, the
molecular basis of host range in the Potyviridae is still not well defined,
although several coding regions have been implicated in pathogenicity acting
at different levels including movement, cell-to-cell and long distance
movement. It appears that the molecular basis of host range/pathogenicity in
potyviruses is quite complex with single or multiple genome regions involved
as well as single or multiple amino acid substitutions. Determinants may vary
between virus isolates but in general these changes appear to influence the
interaction of the particular potyviral protein with host factors.
30
1.4 AIMS AND OBJECTIVES The most notable and currently only difference between PRSV-P and PRSV-
W is the ability to infect papaya. While early sequence data for USA isolates
demonstrated the close relationship of these two biotypes (Quemada et al.,
1990), it was the historical order of their appearance in Australia and the even
closer relationship between the CP of PRSV-P and -W in Australia that led to
the theory that PRSV-P mutates from PRSV-W (Bateson et al., 1994). As yet,
the molecular host range determinants (HRDs) have not been defined
although defining this mutation and its potential role in the molecular
epidemiology of PRSV has significant implications for control of the virus. To
date, sequence analysis of several genome regions has demonstrated a high
level of similarity between Australian P and W isolates in the P1 (Henderson,
1999), CP (Bateson et al., 1994) and HC-Pro (Stokoe, 1996). Comparison of
the available sequences of Australian PRSV-P and W isolates with overseas
isolates has yet to identify a consistent change that could be attributed to host
range in papaya. However, previous work at QUT investigating P1 as a
potential HRD (Henderson, 1999) has provided a range of tools with which to
continue the identification of potential HRDs in PRSV.
Therefore the aim of this project was to identify the molecular HRDs of PRSV
in papaya through the following specific objectives:
(i) To clone the genomes of Australian isolates of PRSV-P and PRSV-W
and generate infectious clones
(ii) To sequence both genomes fully and compare the data to each other
and other available full-length sequences to identify putative HRDs
(iii) To generate recombinants between the two genomes to firstly, localise the
HRD to a general region of the genome and subsequently, to use sequence
data, further recombinants and mutagenesis to identify the specific HRDs.
31
CHAPTER 2 GENERAL METHODS AND MATERIALS
2.1 GENERAL REAGENTS
2.1.1 Sources of special reagents
DNA molecular weight marker X, (λ 1 Kb DNA ladder) was obtained from
Roche Diagnostics. The low copy number vector pACYC177 was purchased
from New England Biolabs and pGEM-T and pGEM-T Easy were obtained
from Promega. Oligonucleotide primers were commercially prepared by
Bresatec or Pacific Oligos in 5 OD standard purity. All restriction enzymes
were obtained from Roche Diagnostics. All general laboratory chemicals
were analytical grade and were purchased from Sigma, BDH or Ajax
chemicals. Agarose was obtained from Progen.
2.1.2 General solutions and media
Agarose gel loading buffer (6X): 0.25% bromophenol blue, 0.25% xylene
cyanol FF, 15% Ficoll (Type 400)
1 X TAE buffer: 10mM Tris-acetate. 0.5mM EDTA, pH 7.8
1 X TBE buffer: 9mM Tris-Borate, 2mM EDTA
LB broth:1% (w/v) bacto-tryptone, 0.5% (w/v) bacto-yeast extract, and
171mM sodium chloride.
LB agar: LB broth containing 1.5% bacto-agar
Terrific broth: 1.2% (w/v) bacto-tryptone, 2.4% (w/v) bacto-yeast extract,
0.4% (v/v) glycerol, 17mM monopotassium phosphate, 72mM dipotassium
phosphate.
IPTG: isopropyl-β-D-thiogalactopyranoside prepared as 500 μg/ml in sterile H2O.
X-gal: 5 bromo-4-choloro-3-indolyl-β-D-galactopyranoside, 2% (w/v)
prepared in dimethylformamide (DMF).
PBST: 0.14M sodium chloride, 8mM disodium phosphate, 1.4mM
monopotassium phosphate, 2.7mM potassium chloride, 0.05% Tween-20.
PBST/PVP: PBST containing 0.2% BSA, 2% PVP (MW 24000-40000).
32
Phenol: 100mM Tris-HCl pH 8.0 equilibrated phenol containing 0.1% 8-
hydroxyquinoline.
Phenol/Chloroform: 1:1 mixture of phenol and chloroform.
Carbonate coating buffer: 0.16% (w/v) Sodium carbonate, 0.29% (w/v) Sodium
bicarbonate and 1% (w/v) Polyvinylpyrrolidone (MW 24-40,000), PH 9.6.
2.2 GENERAL METHODS FOR VIRUS PURIFICATION AND DETECTION 2.2.1 Source and maintenance of virus isolates
Australian isolates of PRSV-P and W that have been partially characterised
in previous molecular studies [CP (Bateson et al., 1994); P1 (Henderson,
1999), were used in this study. PRSV-P was collected from field grown
Carica papaya plants at Bridgeman Downs in South East Queensland.
PRSV-W was collected from field grown cucurbits at Gatton in South East
Queensland. Material was used immediately or stored at -80oC. PRSV
isolates were propagated in squash (Cucurbita pepo var. Green buttons, S &
G deeds Pty.Ltd.) plants. Cotyledons of 10 day old seedlings were dusted
with carborundum and inoculated with sap prepared from infected leaves
ground in 0.1M potassium phosphate buffer (pH 7.0). Symptoms generally
appeared within 12-14 days and young leaves showing symptoms were
harvested for virus purification at 21 days.
2.2.2 Enzyme-linked immunosorbent assay (ELISA)
A standard plate-trapped ELISA method was used as described by Mowat
and Dawson (1987). Tissue (100mg) was ground in 1mL of 50mM carbonate
coating buffer pH 9.6 using an EppendorfTM micropestle grinder and 200μL
aliquots were coated onto the wells of immunosorb microtitre plates (Nunc).
The plates were incubated in a humid box at 40C overnight. Primary
antibody, raised in a rabbit to a glasshouse isolate of PRSV-W (Bateson,
1995), was diluted 1:1000 in PBST/PVP containing 2% BSA. The wells were
washed 4-5 times with PBST and 200μL of the primary antibody solution was
33
added and incubated for 1.5 hr at room temperature. The wells were washed
thoroughly 4-5 times with PBST and 200μL of swine anti-rabbit lgG-
horseradish peroxidase conjugate (DAKO), diluted 1:2000 in PBST/PVP with
0.2% BSA, was added and incubated at room temperature for 1 hr. Plates
were washed again and reactions measured colorimetrically using o-
phenylenediamine (OPD) (Sigma) and hydrogen peroxide according to the
manufacturers instructions. Results were recorded as +/- colour reaction
compared to buffer and healthy plant tissue controls or measured
spectrophotometrically at A460nm after 10 minutes using BeckmanTM Biomek
plate reader. Readings were considered positive when absorbance values
were at least three times greater than the healthy control.
2.2.3 Electron microscopy
Virus particles in crude leaf dips were visualized by negative staining.
Approximately 50mg of infected tissue was ground in 1mL of 2% potassium
phosphotungstate (PTA), pH 5.8 using an Eppendorf TM micropestle grinder.
A 20μL aliquot of the preparation was pipetted onto a Formvar coated copper
grid and the excess liquid removed by blotting with filter paper. Particles
were visualised at X25,000 magnification using a JEOL 1200 EX
transmission electron microscope.
2.3 GENERAL METHODS FOR NUCLEIC ACID EXTRACTION AND AMPLIFICATION
2.3.1 Preparation of crude RNA extract
RNA was extracted from plant tissue in high pH glycine buffer as described
by Robertson et al. (1991). Healthy and diseased plant tissues (60mg) were
frozen in liquid nitrogen and ground to a fine powder using an Eppendorf TM
micropestle grinder. A 500μL aliquot of extraction buffer G (100mM glycine,
pH 9.5, 100mM NaCl, 10mM EDTA) was added and the sample ground until
thawed. The extract was emulsified with an equal volume of phenol by
34
vortexing for approximately 30 sec. The aqueous phase was collected after
centrifugation at 12,000xg for 15 min at 40C and precipitated by the addition
of 0.1 volume of 3M Na acetate (pH 5.5) and 2.5 volumes of 100% ethanol.
The pellet was collected by centrifugation at 12,000 xg at 40C for 30 min,
washed in 70% ethanol and dried under vacuum. The pellet was
resuspended in 50μL sterile distilled water and stored at -80oC.
2.3.2 cDNA synthesis
For first-strand cDNA synthesis, 5-10μL aliquots of crude RNA extract
(section 2.3.1) were mixed with 30pmol of appropriate primer and heated at
940C for 5 min then quenched immediately on ice before the addition of
remaining components. The final cDNA reaction contained 50mM Tris-HCl
pH 8, 50mM KCl, 10mM MgCl2, 1mM DTT, 1mM EDTA, 10μg/mL BSA, 1mM
each of dATP, dCTP, dGTP, dTTP, 20U Rnasin ribonuclease inhibitor
(Promega) and 0.4 U ExpandTM Reverse Transcriptase in a total volume of
20μL. The reactions were incubated at 420C for 45 min and quenched
immediately on ice. Aliquots of 2-5μL of cDNA were used in PCR reactions.
2.3.3 Polymerase chain reaction (PCR) 2.3.3.1 Standard PCR
Either Taq DNA polymerase (Perkin Elmer) or Pwo DNA polymerase (Roche
Diagnostics) was used to amplify PCR products (< 2kb). PCR reactions
(50µL final volume) included buffer (20mM Tris-HCl pH 8.2, 2mM MgCl2,
10mM KCl, 10µg/mL BSA, 6mM (NH4)2SO4, 0.15% Triton X-100 for Taq or
10mM Tris-HCl pH 8.85, 50mM KCl, 5mM (NH4)2SO4, 2mM MgSO4 for Pwo),
200μM each of dATP, dCTP, dGTP and dTTP (Li salt), 2.5U of enzyme (Taq
or Pwo) and 30pmol of gene specific primers. Reactions were cycled using a
Perkin Elmer Cetus DNA Thermal Cycler 480 (after the addition of mineral oil
to tubes) or using a Hybaid Omnigene Thermal Cycler (without mineral oil
and with heated lid function). Unless otherwise specified, cycling consisted of
35
an initial denaturation cycle at 940C for 2 min followed by 35 cycles of
denaturation at 940C for 30 sec, annealing at 450C for 30sec and extension
at 720C for 30sec.
2.3.3.2 Long-distance PCR
For amplification of larger PCR products the ExpandTM Long Template PCR
system (Roche Diagnostics) was used. Reactions included 150ng template
DNA, 30pmol of each specific primer and/or 150-300ng of megaprimer/s,
50mM Tris-HCl pH 9.2, 16mM (NH4)2SO4, 2.25mM MgCl2, 2% (v/v) DMSO,
1% (v/v) Tween-20, 500μM each of dATP, dCTP, dGTP, dTTP (sodium salts)
and 2.6U ExpandTM enzyme mix in a final volume of 50μL. Amplification was
carried out in thin-walled reaction tubes (Quantum Scientific) using a Hybaid
Omnigene DNA Thermal Cycler with heated lid function. Unless otherwise
specified, cycling conditions consisted of an initial denaturation step of 2 min
at 940C, followed by 10 cycles of denaturing at 940C for 30 sec, annealing at
620C for 30 sec and extending at 680C for 4 min. This was followed by 20
cycles of denaturing at 940C for 30 sec, annealing at 620C for 30 sec and
extending at 680C for 4 min with a cycle elongation of 20 sec for each cycle
and a final elongation of 4 min at 680C.
2.3.3.3 Overlapping extension long distance PCR (OE-LD-PCR)
ExpandTM Long Template PCR system (Roche Diagnostics) was used for
OE-LD-PCR to generate large PCR products from two separate
products/clones. Approximately 100ng each of gel purified (section 2.4.7)
PCR product and plasmid (section 2.4.2) were amplified in an OE-PCR
reaction mix containing ~200ng each of 3’ and 5’ megaprimers in a long
distance PCR reaction (section 2.3.3.2). PCR was optimised for each newly
purified batch of PCR product or megaprimers Thermal cycling consisted of
an initial denaturation step of 2 min at 940C, followed by 35 cycles of
denaturing at 940C for 1 min, annealing at 50-620C for 1 min and extending
at 720C for 7.5 min. This was followed by a final elongation step at 680C for
36
10 min. Annealing temperature often had to be varied for different batches of
ExpandTM enzyme to maximise yield.
2.4 GENERAL METHODS FOR NUCLEIC ACID ANALYSIS
2.4.1 Small-scale preparation of plasmid DNA using alkaline lysis
Overnight bacterial cultures (5mL) grown in LB containing ampicillin
(100μg/mL) were centrifuged at 3000×g for 5 min at room temperature. The
pellet was resuspended in 100μL GTE buffer (50mM glucose, 25mM Tris-
HCl pH 8.0, 10mM EDTA) and transferred to 1.5 mL microfuge tubes. The
cells were lysed by the addition of 200μL 0.2M NaOH/1% SDS and mixed by
inversion. Chromosomal DNA and proteins were precipitated with 150μL 3M
potassium acetate pH 4.7 and 150μL chloroform and separated by
centrifuging for 5 min at 12,000g at room temperature. The supernatant was
collected and precipitated with 1 mL of 100% ethanol and centrifuged for 5
min at 12,000×g at room temperature. The pellet was washed in 70% ethanol
and dried in vacuo. Pellets were resuspended in 50μL sterile H2O containing
20μg/mL RNase.
2.4.2 Large-scale plasmid preparation
QIAGENR Plasmid Maxi Kit was used for large-scale plasmid purification
from 250mL (high copy number plasmids) or 1-1.5L (low copy number
plasmids) as per the manufacturers’ instructions.
2.4.3 Spectrophotometric determination of nucleic acid concentration
The concentration of plasmid DNA and oligonucleotide primers was
determined by measurement of the absorbance at 260 nm (A260) of 50-100μL
of the nucleic acid in a Beckman DU-68 spectrophotometer. Concentration
was calculated assuming A260= 1 for a 50μg/mL solution of DNA and a
20μg/mL solution of oligonucleotide DNA.
37
2.4.4 Restriction enzyme analysis
Plamid DNA or PCR products were digested with restriction enzymes as per
the manufacturer’s protocol using 1-5U enzyme/μg DNA at 370C unless
otherwise stated.
2.4.5 Agarose gel electrophoresis
Unless stated otherwise, gels were prepared as 1% agarose in either TBE or
TAE buffer containing 1μg/mL ethidium bromide. Gels were electrophoresed
at 80-100V for 1-1.5 h and visualised under UV light. Gels were
photographed onto Mitsubishi high-density thermal paper using a Sony
Syngene digital graphic printer.
2.4.6 DNA sequencing
Plasmid templates for sequencing were prepared by alkaline lysis as
described in section 2.4.1 or large-scale plasmid preparation as described in
section 2.4.2. Sequencing reactions were undertaken using the Applied
Biosystems Big Dye Terminator kit as recommended by the manufacturer
and samples analysed at Australian Genome Research Facility (AGRF),
University of Queensland.
2.4.7 Gel purification of DNA
Gel purified PCR products were obtained from agarose gel using QIAGEN
QIAquickTM Gel extraction kit as recommended by the manufacturer.
38
2.5 GENERAL METHODS IN CLONING
2.5.1 Ligation of PCR products into T-tailed vectors
For cloning, 10-100ng of PCR product with ‘A overhangs’, generated by Taq
DNA polymerase (Perkin Elmer), was ligated into 50ng commercially
prepared T-tailed vector, pGEM-T or pGEM-T easy (Promega), using T4
DNA ligase (Promega) overnight at 40C as recommended by the supplier.
Ligations were heat-inactivated at 650C for 10 min before transformation into
Escherichia coli (E.coli) (section 2.5.3).
2.5.2 Ligation of blunt/sticky end fragments into vectors
For general cloning and subcloning of blunt or sticky end DNA fragments,
DNA fragments was ligated directly or after gel purification with appropriate
vector DNA in a reaction containing 30 mM Tris-Hcl pH 7.5, 10 mM MgCl2,
10 mM DTT and 1 mM ATP and 1U of T4 DNA ligase (Roche Diagnostics) in
a final volume of 10µL at 40C overnight (unless otherwise stated).
2.5.3 Transformation of E.coli
Chemically competent JM83 (supplied by James Miller, QUT), JM109
(Promega) or NM522 (New England Biolabs) were transformed with 50ng-
100ng of ligated plasmid according to the manufacturer’s instructions.
Transformed cells were plated onto LB agar medium containing 100μg/mL
ampicillin, 50μg/mL X-Gal and 1mM IPTG. Plates were incubated at 370C
overnight.
39
CHAPTER 3 GENERATION OF INFECTIOUS CLONES OF PRSV-W AND PRSV-P
3.1 INTRODUCTION
Identification of genome organisation, gene function, replication strategies
and host range determinants of viruses with RNA genomes has been greatly
facilitated by the development of infectious cDNA transcripts (Boyer and
Haenni, 1994). This approach has been particularly useful for the study of
plant viruses (Sanchez et al., 1998; Olsen and Johansen, 2001; Domier et
al., 1989; Riechmann et al., 1990).
Infectious transcripts have been generated using two approaches - in vitro or
in vivo infectious transcripts. The first involves transcription of viral RNA from
a cDNA clone under the control of a bacteriophage T7 or lambda RNA
polymerase promoter and capping of the 5’ terminus in vitro before
inoculation onto the host plant (Weber et al., 1992; Boyer et al., 1993; Viry et
al., 1993; Brugidou et al., 1995; Domier et al., 1989; Riechmann et al., 1990;
Gal-On et al., 1991; Dolja et al., 1992; Flasinski et al., 1996; Puurand et al.,
1996; Jakab et al., 1997). However, infectious transcripts produced in this
way had relatively low infectivity rates. The second more efficient strategy
involves the use of the CaMV 35S plant promoter and terminator sequences
which are respectively incorporated at the 5’ and 3’ terminus of the viral
cDNA to produce in vivo transcripts (Domier et al., 1989; Mori et al., 1991;
Maiss et al., 1992; Gal-On et al., 1995; Fakhfakh et al., 1996; Johansen,
1996; Jakab et al., 1997; Takahashi et al., 1997; Yang et al., 1998b). The
cDNA construct is then inoculated directly onto the plant where the viral RNA
transcripts are synthesized under the control of CaMV 35S promoter.
Infectious RNA transcripts and/or infectious cDNA clones of a range of
different potyviruses have been described including Peanut stripe virus
(PStV) (Flasinski et al., 1996), PVA (Puurand et al., 1996), TEV (Dolja et al.,
1992), TVMV (Domier et al., 1989; Nicolas et al., 1996), ZYMV (Gal-On et
al., 1991; 1995), PPV (Riechmann et al., 1990; Maiss et al., 1992; Lopez-
40
Moya and Garcia, 2000), PSbMV (Johansen, 1996; Olsen and Johansen,
2001), LMV-E (Yang et al., 1998b), Clover yellow vein virus (CIYVV)
(Takahashi et al., 1997), PVY (Jakab et al., 1997) and TuMV (Sanchez et al.,
1998). A cell-free infectious clone of PVY has also been reported (Fakhfakh
et al., 1996; Jakab et al., 1997).
Generation of full-length potyviral clones has proven difficult in a number of
cases due to instability and/or toxicity of some virus sequences in bacteria
(Maiss et al., 1992; Jakab et al., 1997). Alternative methods have been
described to overcome these toxicity-associated problems. These
approaches have included cloning the genome as separate fragments that
are ligated immediately before inoculation (Jakab et al., 1997), use of low
copy number vectors (Payne et al., 1994; Dersch et al., 1994; Gritsun and
Gould, 1998), reduced temperatures (Gritsun and Gould, 1998) and
introduction of introns into the full-length clones (Johansen, 1996; Lopez-
Moya et al., 2000). A special cell-free method was used to generate a
complete infectious cDNA of PVY (Fakhfakh et al., 1996) in which full-length
PCR products of the virus were reverse transcribed and amplified using two
double-stranded megaprimers. The 5’ megaprimer included a CaMV 35S
promoter and the first 665 bases of PVY while the 3’ megaprimer included a
nos terminator, a 100 bp poly (A) region and 19 bases of the PVY 3’UTR.
The final PCR product was bombarded with a helium particle gun into
detached tobacco leaves. After 3-10 days these were used to inoculate
tobacco plants, which led to efficient PVY infection.
Infectious transcripts of two PRSV-P isolates have previously been reported.
In vivo and in vitro clones of a Hawaiian isolate of PRSV-P (HA) and in vitro
transcripts of a Taiwanese isolate of PRSV-P (YK) were generated (Chiang
and Yeh, 1997).
Previously in this laboratory, Henderson (1999) demonstrated infectivity of
full-length infectious PCR products of PRSV-W amplified using megaprimers
from purified viral RNA. The efficiency of amplification of the 11 kb PCR
product was very low and only preliminary results were reported. This
41
chapter describes subsequent strategies used to generate in vivo infectious
transcripts of Australian PRSV-W and PRSV-P isolates.
3.2 METHODS AND MATERIALS
3.2.1 Oligonucleotide primers The sequences of the oligonucleotide primers used to generate and
characterise PRSV-W and PRSV-P infectious clones are given below.
Primers were designed based on previous sequence information for
Australian (Henderson, 1999; Bateson, 1995; Bateson et al., 1994) and
Hawaiian (Gene Bank accession No X67673) (Yeh et al., 1992) PRSV
isolates.
CaMV-5’ 5’TGAGACTTTTCAACAAAGGGTAAT3’
PRSV.P1.SEQ 5’AACCTCCTATCGTACTGAGCTGCTG3’
3’UTR 5’ATACTCGCACTTGTGTGTTTGTCGGG3’
Universal Forward 5’GTAAAACGACGGCCAGT3’
MB104 5’CATACCNAGGAGAGAGTGCAT3’
NIa-1 5’CAATCTCTTGGTGCTGTAAGAGC3’
NIa-2 5’GCTGGAAGCGGAGCTTACACC3’
P3S 5’GGAGAGTTTGATCCAACTACAAACTGC3’
Pisces 5AACCAATTGCGGCTAGTGAG3
Taurus 5AGCTGCTCACATCTTGTCGT3
MB-11 5GGATCCATGTCCAAAAATGAAGCTGTGGATGCT3
MB-12A 5GGATCCGCCCGACAAACACACAAGTGCG3
P3cons 5’CCAGGATTGTTCTAGCAAGCG3’
P1.Int-F 5’GGAAGGTAACAGGTAAGTTTCTGC3’
P1.Int-R 5’GCAGAAACTTACCTGTTACCTTCC3’
Int.P1-F 5’GTTGATGTGCAGGTTTGTCCGTGC3’
Int.P1-R 5’GCACGGACAAACCTGCACATCAAC3’
George 5’GAGACTTTTCAACAAAGGGTAAT3’
George-MluI 5’ACGCGTGAGACTTTTCAACAAAGGGTAAT3’
42
3.2.2 Amplification of 5’ and 3’ Megaprimers Megaprimers, comprising the CaMV 35S transcription signal sequences
(promoter and terminator) and regions overlapping the 5’ and 3’ termini of
PRSV-W, were used to facilitate incorporation of these control signals into
PCR products.
The 479bp 5’megaprimer including the 3’ proximal 343bp of the CaMV 35S
promoter, the 86bp 5’UTR and 50 bp of the P1 gene of PRSV-W, was
amplified from 10ng of plasmid template, pP1CONS.1 (Fig.3.1A) (kindly
supplied by Juliane Henderson, QUT), using 30pmol each of primers CaMV-
5’ and PRSV.P1.SEQ and 2.5U Pwo DNA polymerase (Roche Diagnostics)
as described in section 2.3.3.1. Similarly, the 525bp 3’ megaprimer, which
included the 206bp 3’UTR of PRSV-W, a poly (A) tail of 33 nucleotides and
the 90bp CaMV 35S terminator sequence, was amplified from 100ng of
plasmid template, pCOL123 (Fig.3.1B) using 30pmol each of the 3’UTR and
Universal Forward primers. Gel purified PCR products (section 2.4.7) were
used directly for LD-PCR or cDNA synthesis.
3.2.3 Cloning of full-length PRSV-P and -W genomes in 3 overlapping clones
3.2.3.1 Preparation of PRSV RNA
Genomic RNA was extracted from 0.5-2mg cesium sulfate purified PRSV-W
(kindly supplied by Rod Pudwell, QUT), by incubating with 50 μg/ml
proteinase K and 0.1% SDS at 370C for 30 min. The solution was extracted
once each with phenol and phenol: chloroform (1:1) and the RNA ethanol
precipitated. RNA was resuspended in 50µL of DEPC-H2O. Crude RNA was
extracted from PRSV-P infected papaw tissue as described in section 2.3.1.
43
Figure 3.1 Strategy for the amplification of (A) 5’megaprimer (479bp) using
primers CaMV-5’ and PRSV.P1.SEQ from the plasmid pP1CONS.1 and (B)
3’megaprimer (525bp) using primers 3’UTR and the Universal Forward
primer from the plasmid pCOL123 ( From Henderson, 1999).
44
3.2.3.2 First-strand cDNA synthesis
First-strand cDNA’s were synthesised from PRSV-W genomic RNA and
crude PRSV-P RNA using either the 3’ megaprimer or a specific primer,
P3cons, with the Expand TM Reverse Transcriptase system (Boehringer
Mannheim) as described in section 2.3.2 (Fig.3.2A).
3.2.3.3 PCR amplification of the PRSV genomes in three overlapping fragments
Overlapping LD-PCR products representing the PRSV-W or -P genome were
amplified from 1-5μL of first-strand cDNA with primer pairs as shown in
Figure 3.2B. Megaprimers, which are based on PRSV-W sequence, were
used for generation of both -P and -W clones as previous data (Bateson,
1995; Henderson, 1999) indicated that the 3’ and 5’ UTR’s and the start of
the P1 of Australian isolates are identical. LD-PCR products were generated
using the Expand TM Long Template PCR system (Roche Diagnostics)
(section 2.3.3.2), but with a final elongation step of 5 min at 680C. Products
were analysed by eletrophoresis in 0.8% TAE agarose gels containing
1μg/mL ethidium bromide.
3.2.3.4 Cloning of PRSV-W and PRSV-P overlapping fragments
Before cloning, PCR products were A-tailed by the addition of 100nmoles
dATP and 2.5U Taq polymerase (Perkin Elmer) to each 50μl reaction tube
and incubating at 720C for 15 min. The gel purified PCR products (section
2.4.7) were ligated into pGEM-T as described in section 2.5.1 and
transformed into competent E. coli JM109 cells (section 2.5.3). The resulting
plasmids were checked for orientation of the insert by digestion with
restriction enzymes MluI or NsiI (section 2.4.4). Selected plasmids were
called p3’Triplet-W, p3’Triplet-P, pMiddle Triplet-W, pMiddle Triplet-P,
p5’Triple-W, p5’Triplet-P (Fig.3.2B).
45
Figure 3.2 (A) Strategy for synthesis of PRSV cDNA using 3’ megaprimer
and P3cons. (B) Strategy for amplification and cloning of the full PRSV-W
genome as three overlapping fragments. Primer pairs used for PCR
amplification of the fragments are shown. Arrows indicate direction of DNA
synthesis.
46
VPg NIa NIb
NIaI
CP
3’UTR
33 35S A T
3’megaprimer
P3 CI VPg NIa
P3S NIa-2
P1 HC-Pro P3 35S
5’megaprimer P3cons
B.
6705 bp
6K
6K
5'UTR
35S 5’UTR
P1
HC
P3
p5’Triplet-W
pMiddle Triplet-W7544 bp
P3
CI
NIa
6K
7691 bp
NIa
NIb
CP
3’UTR 33A
35ST
Ligate into pGEM-T
p3’Triplet-W
VPg --- P1 HC-Pro
P3
6K
CI NIa NIb CP ---Poly-A
P3cons
3’megaprimer cDNA 33 35S
A T
3’UTR
cDNA
A. 3'UTR 5'UT
R
PCR
1st strand cDNA
NsiI
NsiI
NsiI
NsiI MluI
MluI
MluI
Ligate into pGEM-T
Ligate into pGEM-T
47
3.2.5 Generation of a full-length PRSV-W clone
3.2.5.1 Insertion of MluI site in p5’Triplet-W The insert from p5’Triplet-W was amplified with primers P3cons and George-
Mlu, which contained an additional MluI site in the George primer sequence,
using ExpandTM Long Template PCR system (section 2.3.3.2). The A-tailed
(section 2.5.1) and gel purified (section 2.4.7) product was ligated into
pGEM-T Easy (section 2.5.1) and transformed into competent E.coli JM109
cells (section 2.5.3). Inserts in the resulting plasmids were fully sequenced.
The selected plasmid was named p5’Triplet-W*.
3.2.5.2 Generation of pTwin-W A partial insert from the clone pMiddle Triplet-W was excised using NsiI
(section 2.4.4) and gel purified (section 2.4.7). The insert was ligated to 50ng
of gel purified NsiI vector fragment from p3’Triplet-W using a vector:insert
ratio of 1:2 as described in section 2.5.2. The DNA was transformed into
competent E. coli JM109 cells (section 2.5.3) (Fig.3.3). Plasmids were
screened by restriction analysis with NsiI to confirm the presence of the
inserted fragment and sequenced across the NsiI site to confirm the correct
orientation of the insert. Plasmid pTwin-W was selected and maxipreped
(section 2.4.2). Plasmid pTwin-P was subsequently generated in the same
way for later applications.
3.2.5.2 Subcloning to generate a full-length clone The insert from clone p5’Triplet-W* was excised using MluI, gel purified
(section 2.4.7) and ligated to 50ng of gel purified MluI vector fragment from
pTwin-W using a vector:insert ratio of 1:5 (section 2.5.2). The DNA was
transformed into competent E. coli JM109 and JM83 (section 2.5.3). Purified
plasmids were screened by restriction analysis with MluI to confirm the
presence of the insert and sequenced across junctions to determine the
correct orientation of the insert (Fig.3.4).
48
Figure 3.3 Strategy for the generation of pTwin-W from plasmids p3’Triplet-W
and pMiddle Triplet-W
pTwin-W10300 bp
7691 bp
NIa
NIb
CP
3’UTR 33A
35ST
p3’Triplet-W pMiddleTriplet -W 7544 bp
P3
CI
NIa 6K
VPg
VPg
NsiI NsiI
NsiI
NsiI
NsiI digest
NsiI digest
P3
CI
6K
NIa
NIb
CP
3’UTR
33A 35ST
VPg
NsiI
NsiI
49
Figure 3.4 Strategy for the generation of a full-length clone of PRSV-W from
plasmids p5’Triplet-W* and pTwin-W.
pTwin-W 10300 bp
p5’Triplet-W* 6705 bp
35S
5’UTR
P1
HC P3
P3
35ST 33 A
3’UTR
CP
NIb
NIa
6K
CI
MluI
MluI
MluI MluI
Full length clone13996bp
NIb NIa VPg
6K
CI
P3
HC
P1
35S
CP
3’UTR 33 A
35S T
MluI
MluI
MluI digest
MluI digest
5’UTR
50
3.2.6 Generation of an intron-containing infectious clone of PRSV-W
3.2.6.1 Insertion of an intron into the P1-coding region of p5’Triplet-W
The St-LS1 IV2 intron (Hanson et al., 1999) was inserted into position 217 of
the P1 coding region of p5’Triplet-W in two steps using Overlapping-
Extension PCR (OE-PCR). Firstly, the intron sequence was fused to the 5’
section of the P1 coding region (Figure 3.5A). A fragment, incorporating the
CaMV 35S promoter, 5’UTR, 217bp of P1 gene and 12bp of intron
sequence, was amplified with Pwo from p5’Triplet-W using primers George
and P1.Int-R (section 2.3.3.1), while a second fragment, comprising a 200bp
intron flanked by 12bp of P1 gene, coding region was amplified using primers
P1.Int-F and Int.P1-R from a clone kindly supplied by N. Gutterson, DNA
Plant Technologies, Oakland (section 2.3.3.1). The gel purified PCR
fragments (approximately 20ng each) were joined by amplification in OE-
PCR in a reaction mix containing Pwo DNA polymerase (Roche Diagnostics)
as described in section 2.3.3.1. To incorporate the remaining P1 coding
region, a PCR fragment, consisting of 12bp of intron sequence, 1425bp,
1370bp and 265bp of P1, HC-Pro and P3 coding regions, respectively, was
amplified from 5’Triplet-W using primers Int.P1-F and P3cons (section
2.3.3.1) (Fig. 3.5B). This fragment was fused to the intron-containing OE-
PCR product by another round of OE-PCR (Figure 3.5B) using approximately
50ng of each gel purified PCR fragments using ExpandTM Long Template
PCR system (Roche Diagnostics) as described in section 2.3.3.2. Thermal
cycling conditions consisted of an initial denaturation step of 2 min at 940C,
followed by 35 cycles of denaturing at 940C for 1 min, annealing at 600C for 1
min and extending at 720C for 4 min with final elongation of 4 min at 720C.
The OE-PCR product was gel purified (section 2.4.7) and ligated into pGEM-
T (section 2.5.1) and transformed into competent E. coli JM109 cells (section
2.5.3). Clones were initially characterised by PCR amplification of the full-
length insert and intron with specific primers to confirm the presence of
correct sequence. A clone, p5’Int.Triplet-W, was fully sequenced.
51
35S 5’
P
HC P3
7691 bp
p5’Triplet-W pSt-Ls1 IV2 3400 bp
George
P1.Int-R
35S 5’UT P1 Intron
35S 5’UTR P1
12
Intron
P1.Int-F
85
PCR (657 bp) PCR (224 bp)
217
35S 5’UT P1 Intron
12
P1 P1 Intron
12 12 200
85 217
George
Int.P1-R
Int.P1-R
P1
P1 P1 Intron
12 12 200
343
343
343 85 217 200 12
OE-PCR
A
Intron
52
Figure 3.5 (A) Strategy for insertion of an intron into the P1 coding region;
(B) Strategy for construction of p5’Int.Triplet-W.
35S 5’UTR P1 P1 Intron
343
85 217 200 12
35S 5’UTR
P1
HC P3
7691 bp
p5’Triplet-W
P3cons
Int.P1-F
12
PCR
P1 HC Int
265
P3
1425 1370
George
P3cons
OE-PCR
35S 5’UTR P1
Intron
343 85 217 200
P1 HC
265
P3
1425 1370
6905 bp
35S
5’UTR
P1 Intron
P1
HC P3
p5’Int.Triplet-W
Ligation into pGEM-T
B
53
3.2.6.2 Construction of an intron-containing full-length PRSV-W Plasmids p5’Int.Triplet-W and pTwin-W were digested with MluI. Gel purified
pTwin-W vector fragment was ligated to the insert fragment from
p5’Int.Triplet-W (Fig. 3.6) in vector:insert ratios of both 1:1 and 1:3 (section
2.5.2). The ligated plasmids were transformed into competent E. coli strains
JM109 and JM83 as described in section 2.5.3. The orientation of the inserts
in the clones was determined by digestion with NsiI and sequencing across
the junctions.
3.2.7 Generation of a full-length PRSV-W in a low copy number vector
The insert from p5’Triplet-W was amplified with primers George and P3cons
using the ExpandTM Long Template PCR system (section 2.3.3.2) and gel
purified (section 2.4.7) (Figure 3.7A). Blunt ends were ensured by incubation
of 1μg of DNA with 2.5U Pwo polymerase (Roche Diagnostics) in Pwo buffer
(10mM Tris-HCl pH 8.85, 50 mM KCl, 5mM (NH4)2SO4, 2mM MgSO4) in a
final reaction volume of 20μL for 30 min at 700C. The reaction was
inactivated by addition of 1μL of 0.5M EDTA. The resultant blunt-ended PCR
product was ligated into 50ng of SmaI digested pACYC177 (New England
Bio Labs) using vector:insert ratios of 1:2 and 1:4 (section 2.5.2.) The
reaction was incubated at 160C overnight and the DNA transformed into
competent E. coli NM52 or JM109 cells (section 2.5.3). Plasmids were
screened by restriction analysis with MluI and BamHI to confirm the
presence and size of the inserted fragment. The entire insert was sequenced
to confirm the presence of correct sequence in the selected plasmids.
Plasmid p5’LC.Triplet-W was selected and maxipreped (section 2.4.2). To
incorporate the remainder of the virus genome into the low copy number
clone, pLC.5’Triplet-W was digested with BamHI (Fig. 3.7B) and blunt ends
generated by filling the 5’ overhang with T4 DNA polymerase (Roche
Diagnostics) in a reaction containing 1X T4 polymerase buffer (Roche
54
Figure 3.6 Strategy for generation of full-length intron containing PRSV-W
clone from plasmids p5’.Int.Triplet-W and pTwin-W.
6905 bp
35S 5’UTR
P1 Intron
P1
HC P3
p5’Int.Triplet-W pTwin-W 10300 bp
P3
CI
6K
NIa
NIb
VPg
CP
3’UTR 33A
35S T
14196 bp
35S
5’UTR P1 Intron
P1
HC
P3
CI
NIa VPg 6K
NIb
CP
3’UTR 33 A
35S T
pFull.Int-W
MluI
MluI
MluI
MluI
MluI MluI
55
6705
35S5’UTR
P1
HC P3
p5’Triplet-P1 HC P3 35S
P3 cons
5'UTR
35S 5’UTR
P1
HC P3
pLC.5’Triplet-W
George
PCR
Ligate into SmaI digested pACYC177
A
pACYC177 3940bp
BamHI (3319)
SmaI (2225)
56
Figure 3.7 Strategy for generation of a full-length low copy number PRSV-W
clone. (A) Generation of pLC.5’Triplet-W. (B) Subcloning the insert of pTwin-
W into pLC.5’Triplet-W to generate full-length low copy number PRSV-W
clone (pFull.LC-W).
35S 5’UTR
P1
HC P3
pLC.5’Triplet-W
MluI
pFull.LC-W
NIb NIa VPg
6K
CI
P3
HC
P1
35S
CP
3’UTR 33 A 35S T
MluI
BamHI (Blunt ended)
pTwin-W10300 bp
P3
35ST 33 A 3’UTR
CP
NIb NIa
6K
CI
MluI
VPg
ApaI ( Blunt ended)
Blunt end
B
57
Diagnostics), 1mM DTT, 1mM rATP, 2mM each of dATP, dCTP, dGTP and
dTTP, 20 µg/mL BSA and 10U of enzyme in a final reaction volume of
100μL. The reaction mix was heated at 370C for 1 hour and then inactivated
by the addition of 1μL of 0.5M EDTA. Plasmid pTwin-W was digested with
ApaI (Fig. 3.6B) and blunt ends generated by removing the 3’ overhang with
Klenow enzyme (Roche Diagnostics) in a reaction containing 10mM Tris-HCl
pH 7.5, 5mM MgCl2, 7.5 mM DTT and 5U of enzyme per 1μg of DNA in a
final reaction volume of 50μL. The reaction was incubated for 15 min at 220C
and then heat inactivated at 750C for 20 min. The resulting blunt-ended
fragments were both digested with MluI and gel purified vector and insert
fragments ligated in 1:1 and 1:3 (vector: insert) ratios (section 2.5.2) (Fig.
3.7B). The ligated plasmids were transformed into competent E. coli NM522,
JM109 and JM83 cells (section 2.5.3). Clones were digested with MluI and
NsiI to confirm the orientation and presence of the insert.
3.2.8 Generation of full-length infectious PCR product of PRSV-W and PRSV-P
A 3.7kb PCR product was amplified from the appropriate 5’ clone, p5’Triplet-
W or p5’Triplet-P, using primers George and P3cons with Pwo polymerase
(Roche Diagnostics) (section 2.3.3.1) (Figure 3.8A). Thermal cycling
consisted of an initial denaturation cycle of 940C for 2 min followed by 35
cycles of denaturation at 940C for 30sec, annealing at 500C for 30sec and
extension for 4 min at 720C. This fragment and the corresponding clone
pTwin-W or P, which overlapped by a region of 265 nucleotides in the P3-
coding region, were amplified by OE-LD-PCR using the ExpandTM Long
Template PCR system to give a full-length PRSV-W or PRSV-P PCR product
(Figure 3.8B). Approximately 100-250ng each of gel purified (section 2.4.7)
PCR product and purified plasmid DNA (section 2.4.2) were amplified in an
OE-LD-PCR reaction containing ~200ng each of 3’ and 5’ megaprimers as
described in section 2.3.3.3. PCR products were analysed by electrophoresis
on 0.8% TBE agarose gels containing 1μg/mL ethidium bromide. Gel purified
PCR product was characterised by restriction enzyme analysis and PCR
58
Figure 3.8 Strategy for generation of a full-length PCR product of PRSV-W
by OE-LD-PCR
PCR
P1 HC 35S 5'UTR
P3 CI VPg NIa NIb CP
3’UTR
OE-PCR
pTwin-W10300 bp
P3
35ST 33 A
3’UTR
CP
NIb NIa
6K
CI
VPg
P1 HC P3 35S
5'UTR
5’megaprimer
3’megaprimer
265bp
6705 bp
35S 5’UTR
P1
HC P3
p5’Triplet-W
P3cons
George A
B
33A 35S T
59
amplification of the P1-coding region with primers Pisces and Taurus, the
NIa coding region with primers NIa-1 and NIa-2, and the CP coding region
with primers MB-11 and MB-12A using PCR product as a template.
3.2.9 Infectivity of full-length PRSV-P and PRSV- W PCR products Microprojectile bombardment of detached squash cotyledons was used to
establish initial infection with full-length PCR products essentially as
described by Henderson (1999).
3.2.9.1 Preparation of PCR products for bombardment PCR products for bombardment were gel purified (section 2.4.7) and the
concentration estimated on a 0.8% TBE agarose gel, aliquoted to give
4μg/tube and then ethanol precipitated using sterile reagents. The dried
pellets were stored at –200C.
3.2.9.2 Bombardment of squash cotyledons with full-length PCR products
Fourteen-day-old in vitro grown squash cotyledons were excised and placed
onto 2% water agar (2 cotyledons per plate). Detached cotyledons were
bombarded as described by Henderson (1999) to deliver a total of 1μg DNA
to each cotyledon. Cotyledons were cultured at 25oC in the light (16hr
photoperiod). The efficiency of the microprojectile bombardment procedure
was initially assessed by GUS expression in a cotyledon shot with control
plasmid, p2K7 (kindly supplied by Rosemarie Lines, QUT), incorporating
both the uidA reporter gene, coding for ß-glucuronidase (GUS), and the
aphA selectable marker gene, coding for neomycin phosphotransferase II,
under the control of the CaMV 35S promoter (Lines., 2002).
60
3.2.9.3 Detection of PRSV infection and mechanical inoculation of squash seedlings
At 10 days post-bombardment, each cotyledon was cut into two halves. One
half of each of the 2 cotyledons for each shot were combined and used to
assay for virus infection in the cotyledons using ELISA (section 2.2.3) and
the other half of each were pooled and used to mechanically inoculate 4
squash seedlings (Henderson, 1999). Extraction buffer only, unshot
cotyledon, healthy squash leaf tissue and PRSV infected squash leaf tissue
controls were included in ELISA tests.
3.2.9.4 Detection of PRSV infection in inoculated squash and papaya plants
PRSV infection in squash plants inoculated from bombarded cotyledons was
assayed using ELISA and RT-PCR to detect viral CP and RNA, respectively.
Leaf tissue (a total of 50mg) was collected and pooled from the two plants
inoculated from each of the shot cotyledons and tested by ELISA (section
2.2.2). Extraction buffer only, healthy squash and PRSV infected squash
controls were also included. Sap from ELISA positive squash plants (pooled
equivalent amounts of tissue from each of the 4 plants representing each
shot) was used to mechanically inoculate 2 papaya plantlets. Plants were
inoculated 3 times at weekly intervals. Inoculated papaya plants were tested
by ELISA (section 2.2.2) and observed for symptoms.
For RT-PCR, crude RNA was extracted from newest leaves (section 2.3.1)
and used for first-strand cDNA synthesis (section 2.3.2) using primer MB-
12A. First- strand cDNA was used as template for amplification of a 900bp
fragment of the CP gene using primers MB-12A and MB-11 (section 2.3.3.1).
61
3.3 RESULTS
The initial and most obvious approach to generating infectious clones of
PRSV-W and PRSV-P was to piece together the genomes from cloned
fragments. Previous work within the laboratory provided a number of tools for
amplification of the genome and incorporation of promoter and terminators
including megaprimers and PCR primers (Henderson, 1999) and preliminary
sequence data for P1 and CP (Henderson, 1999; Bateson, 1995). From this
and previous sequence information for PRSV isolates from Hawaii, a
strategy was designed to clone the PRSV genomes as three overlapping
fragments that could be joined at unique restriction enzyme sites.
3.3.1 Cloning of PRSV-P and PRSV-W genomes in three overlapping clones
Using LD-PCR, three overlapping fragments were generated for both PRSV-
P and PRSV-W. Using the 5’megaprimer and P3cons, a 3705bp fragment
was amplified, which included the CaMV 35S promoter, 5UTR, P1, HC-Pro
and 265bp of P3 sequence (5’ fragment) (Fig. 3.9A). With specific primers
P3S and NIa-2, a 4600bp fragment, including the full P3, CI, 6K, and NIa
(VPg and protease) coding regions was amplified (middle fragment) (Fig.
3.9B). The third fragment of 4398bp, representing the 3’ one-third of the
genome and including 6K, NIa, NIb and CP coding regions as well as the
3UTR, poly(A)33 and the CaMV 35S terminator sequence was amplified with
NIa-1 and the 3’megaprimer (3’ fragment) (Fig. 3.9C).
The fragments for both viruses were cloned into pGEM-T. For further
subcloning, it was essential to have clones in a particular orientation with
respect to restriction enzyme sites in the vector multiple cloning site (MCS).
The size and orientation of the inserts within the plasmids were characterised
by restriction enzyme analysis. Three 5’ fragment clones, five middle
fragment clones and three 3’ fragment clones appeared to have inserts of the
expected size when digested with ApaI. All 5’ and 3’ fragment clones were in
one orientation while middle clones were obtained in both orientations based
62
Figure 3.9 Three overlapping PCR products representing PRSV-W (A)
Lane 1: 3705bp fragment representing 5’ third of genome (B) Lane 1: 4600bp
fragment representing middle third of genome (C) Lane 1: 4398bp fragment
representing 3’ third of genome. M: Molecular weight marker X (Roche
Diagnostics).
C BA
M M M 1 1 1
2036bp
3054bp
2036bp
3054bp 3054bp
2036bp
5090bp 5090bp
5090bp
63
on MluI and NsiI digestion. One clone for each region and for each virus (P
or W), designated p5’Triplet-W or p5’Triplet-P, pMiddle Triplet-W or pMiddle
Triplet-P and p3’Triplet-W or p3’Triplet-P, was selected for generation of
infectious clones (Fig. 3.10A, C, D). The integrity of all virus sequences was
confirmed. These results are presented in chapter 4.
3.3.2 Generation of a full-length PRSV-W infectious clone
Initially, all work was carried out with PRSV-W to test the system. To
facilitate subcloning to make a full-length infectious clone, an MluI site was
required 5’ of the promoter, however all 5’ fragment clones were obtained in
the wrong orientation. Therefore the 5’ fragment was recloned (p5’Triplet-
W*), incorporating an MluI site immediately upstream of the CaMV35S
promoter (Fig 3.10B). Plasmid pTwin-W, incorporating the 3’ two-thirds of the
PRSV-W genome was generated by ligation of a 7222bp NsiI fragment
(including vector and partial insert) from p3’Triplet-W and a 3543bp NsiI
fragment (insert) from pMiddle Triplet-W. The plasmid, with correct insert
size and orientation was selected based on restriction analysis with NsiI
(Fig.3.11) and sequencing across the NsiI site in the NIa gene.
To generate a full-length clone of PRSV-W, a 10486bp MluI fragment
(including vector and insert) from pTwin-W was ligated to a 3606bp MluI
fragment (insert) from p5’Triplet. Only 2 clones of the expected size were
obtained as confirmed by digestion with MluI (Fig.3.12). Sequencing across
the MluI site in the P3 gene showed that in both clones the 5’ fragment had
inserted in the wrong orientation with respect to the remaining genome. This
cloning procedure was repeated several times, however, with the same
result. It was hypothesised that the correct full-length clone could be
expressing a toxic protein within the E.coli host. Subsequently, several
approaches were taken to overcome this.
64
Figure 3.10 Restriction analysis of clones p5’Triplet-W, pMiddleTriplet-W
and p3’Triplet-W. (A) p5’Triplet-W Lane1: Uncut; Lane 2: MluI digested (B)
p5’Triplet-W* Lane1: Uncut; Lane 2: MluI digested, (C) pMiddleTriplet-W
Lanes 1-5: Uncut, Lane 6-10: NsiI digest of plasmids from lanes 1-5; plasmid
in lanes 1 & 6 is incorrect size, plasmids in lanes 2-4 and 7-9 are in one
orientation, plasmid in lane 5 & 10 is in another orientation; (D) p3’Triplet-W
Lane1: uncut; Lane 2: NsiI digested. M: Molecular weight marker X (Roche
Diagnostics).
65
A B
C D
1 2 1 2
1 2 1 2 3 4 5 6 7 8 9 10
M M
M M
1018bp
1018bp
1018bp
3054bp
12216bp
3054bp
3054bp
12216bp
3054bp
1018bp
12216bp 12216bp
66
Figure 3.11 Restriction analysis of pTwin-W. Lane1: Uncut plasmid; Lane 2:
NsiI digested plasmid. M: Molecular weight marker X (Roche Diagnostics)
M 1 2
1018bp
3054bp
12216bp
67
Figure 3.12 Restriction analysis of putative full-length PRSV-W clone.
Lane1: Uncut clone; Lane 2: MluI digested clone. M: Molecular weight
marker X (Roche Diagnostics)
M 1 2
1018bp
3054bp
12216bp
68
3.3.3 Generation of an infectious PRSV-W containing a plant intron
In an attempt to overcome expression of toxic PRSV-W proteins in E.coli, a
plant intron was introduced into the PRSV-W P1-coding region. This would
not be processed in E.coli but should subsequently be spliced upon infection.
Plasmid p5’Int.Triplet-W, incorporating the St-LS1 IV2 intron (200bp) at
position 217 of the P1 coding region, was generated by OE-PCR. Initially, an
857bp fragment (Fig. 3.4A; Fig.3.13.C), consisting of the CaMV 35S
promoter, 5’UTR, PRSV-W P1 coding region (nts 1-217), 200bp intron and
P1 coding region (nts 218-229) was generated by OE-PCR of a 657bp PCR
fragment from p5’Triplet-W (Fig. 3.4A; Fig. 3.13A) and a 224bp PCR
fragment from pSt-LS1 IV2 (Fig. 3.4A; Fig.3.13B). A second fragment of
3072bp (Fig.3.4B; Fig.3.13D), consisting of 12bp of intron sequence, the 3’
1425bp of the P1 coding region and the 5’ 265bp of the P3 coding region,
was amplified from p5’Triplet-W. The two overlapping fragments (875 and
3072bp) were joined by OE-PCR to give a 3905bp fragment (Fig.3.13.E),
which was subsequently cloned. Plasmid p5’Int.Triplet-W (Fig. 3.4B) was
selected from the resulting 3 clones and the sequence confirmed.
Clones containing the full-length PRSV-W genome with an intron
incorporated into the P1-coding region were generated by ligation of a
10486bp MluI fragment (vector) from pW-Twin and 3806bp MluI fragment
(insert) from p5’Int.Triplet-W. Ligation in a ratio of 1:3 vector:insert did
generated some clones. However, the colonies were very small and cultures
inoculated from these colonies were very slow growing and only low
concentration of plasmids could be obtained. Sequence analysis across the
MluI cloning site in P3-coding region confirmed the integrity of and
orientation of the insert in these clones. Unfortunately, attempts to regrow or
scale up the volume of these clones, even at lower temperatures (28oC) was
unsuccessful and after large-scale purification, the concentration of the
plasmids were still very low (Fig. 3.14). Alternative E. coli strains including
JM109, JM83 or NM522 were also unsuccessful.
69
A B
657bp
224bp
M 1 M 1
517bp
1018bp 1018bp
517bp
220bp
1018bp
517bp
857bp
C
70
Figure 3.13 PCR products generated and used for construction of
p5’Int.Triplet-W. (A) Lane 1: 657bp fragment amplified from clone 5’Triplet-
W; (B) Lane 1: 224bp fragment amplified from pSt-Ls1 IV2; (C) Lane 1:
857bp product generated by OE-PCR of 224bp and 657bp products. (D)
Lane 1: 3072bp fragment amplified from clone 5’Triplet-W; (E) 3905bp
product generated by OE-PCR of 3072bp and 857bp products. M: Molecular
weight marker X (Roche Diagnostics).
D E
3072bp
3905bp
M 1
M 1
1018bp
3054bp
1018bp
3054bp 5090bp
5090bp
71
Figure 3.14 Purified intron-containing full-length PRSV-W, pFull.Int-W (Lane
1 and 2). M: Molecular weight marker X (Roche Diagnostics).
M 1 2
1018bp
3054bp
12216bp
72
3.3.4 Construction of full-length PRSV-W in low copy number vector
A second approach to overcoming toxicity in E. coli was to clone the full-
length clone in a low copy number vector to reduce the level of toxic protein
in the host.
The 3705bp insert of p5’Triplet-W was PCR amplified and subcloned into the
low copy number vector, pACYC177. Ligation using a vector:insert ratio of
1:4 resulted in many clones of the expected size, 7645bp. Clones were
digested with MluI and BamHI to confirm the orientation of the insert with
respect to the BamHI site. Clone p5’LC.Triplet-W (Fig.3.7B, Fig.3.15), which
had the P3 sequence adjacent to the BamHI site, was selected and the
integrity of the insert confirmed by sequencing.
The full PRSV-W clone in pACYC177 was subsequently generated by
ligation of the insert from pTwin-W into p5’LC.Triplet-W (Fig.3.7). Both the
7230bp pTwin-W fragment (Fig.3.16A) and the 6450bp p5’LC.Triplet-W
fragment (Fig.3.16B) were generated with one blunt end and one MluI
overhang (sticky end). Ligation of these fragments in 1:3 vector:insert ratio
gave a number of colonies after transformation. These colonies were very
small and initial cultures grew very slowly. Plasmids isolated from these
minipreps were in low concentration (Fig.3.17A) however, PCR amplification
from these clones confirmed that both the p5’LC.Triplet-W and pTwin-W
fragments were present (Fig.3.18). Attempts to regrow these cultures or to
scale-up, including the use of different E. coli strains were consistently
unsuccessful. Using alternative growth temperatures (28oC and 30oC),
different media (Teriffic broth) and chloramphenicol gave better yields in
initial cultures (Fig.3.17B) although this was still low. Each lane in Figure
3.17B represents one fifth of the yield from a 1 litre culture. As well,
restriction enzyme digestion of these plasmids gave only smears on agarose
gels (Fig.3.17C). Because of the difficulties encountered in cloning and/or
maintaining full-length infectious clones, an alternative approach was
eventually
73
Figure 3.15 Restriction analysis with MluI/ BamHI of plasmids resulting from
ligation of the insert of p5’Triplet-W into the low copy number vector
pACYC177. Lane 1-6: plasmids with incorrect insert size and orientation;
Lane 7: Plasmid with correct insert size and orientation (pLC.5’Triplet-W). M:
Molecular weight marker X (Roche Diagnostics).
M 1 2 3 4 5 6 7
517bp
1018bp
3054bp
74
Figure 3.16 Restriction digestion of clones pTwin-W and p5’LC.Triplet-W
during generation of low copy number full-length PRSV-W plasmid, pFull.LC-
W. (A) pTwin-W Lane1: Uncut plasmid; Lane 2: MluI/ApaI digested plasmid.
(B) p5’LC.Triplet-W Lane1: Uncut plasmid; Lane 2 MluI BamHI digested
p5’LC.Triplet-W. M: Molecular weight marker X (Roche Diagnostics).
A B
M 1 2 M 1 2
1018bp
3054bp
12216bp
12216bp
3054bp
1018bp
75
Figure 3.17 Purified low copy number full-length PRSV-W plasmid (pFull.LC-
W). Supercoiled plasmid is indicated by arrow. (A) Lane1: purified from
miniprep; (B) Lane 1: purified after culture in Terrific broth at 280C; Lane 2:
purified after culture in Terrific broth at 300C. (C) Lane1: plasmid following
digestion with MluI. No vector fragment could be observed. M: Molecular
weight marker X (Roche Diagnostics).
A B C
M 1 2 M 1 M 1
3054bp
12216bp 3054bp
3054bp
12216bp
12216bp
76
Figure 3.18 PCR analysis of full-length low copy number PRSV-W plasmid
(pFull.LC-W) showing the presence of P1 and NIa fragments. Lane1: NIa
positive control pTwin-W; Lane2: pFull.LC-W; Lane 3: P1 positive control
pLC.5’Triplet-W; Lane5: pFull.LC-W. M: Molecular weight marker X (Roche
Diagnostics).
M 1 2 3 4
NIa P1
2000bp
900bp
3054bp
1018bp
77
taken. This approach involved generating infectious PCR products using OE-
LD-PCR from two overlapping clones.
3.3.5 Generation of full-length infectious PCR products of PRSV by OE-LD-PCR
Full-length, infectious PRSV products incorporating the CaMV35S promoter
and terminator sequences was generated by OE-LD-PCR of a DNA fragment
representing the 5’ third of the PRSV genome and a plasmid clone
representing the 3’ two-thirds of the genome (Fig 3.8). To generate an
infectious PRSV-W (rPRSV-W), a fragment of 3705bp, consisting of the
CaMV 35S promoter, PRSV-W 5’UTR, P1, HC-Pro and partial P3 coding
regions was amplified from p5’Triplet-W. This fragment had an overlap of
265bp with the P3-coding region in pTwin-W. The fragment was fused to a
7322bp region from pW-Twin by long distance OE-PCR amplification to give
a product of 11027bp (Fig 3.19) incorporating the complete PRSV-W
genome with a short poly (A) tail of 33 nucleotides, flanked by the CaMV35S
promoter and terminator sequences. This product could be consistently
amplified from overlapping clones, although some variation in yield was
found with different batches of Expand enzyme. A low molecular weight band
(~8 kb) of unknown origin was also consistently observed following
amplification (Fig. 3.19). This band was usually in much lower concentration
than the full-length fragment. A similar strategy was also used to generate
full-length infectious PCR product of PRSV-P (rPRSV-P).
3.3.6 Infectivity of full-length PCR products of PRSV-P and PRSV-W
To enable the cloned PRSV genomes to infect plant cells, the DNA must be
delivered to the nucleus for initial transcription from the CaMV 35S promoter.
To maximise this step, the PCR fragments of both rPRSV-P and rPRSV-W
were bombarded into squash cotyledons in vitro to establish infection and
subsequently inoculated onto squash plants in vivo.
78
Figure 3.19 OE-LD-PCR product of full-length PRSV-W (Lane 1).
M: Molecular weight marker X (Roche Diagnostics).
M 1
wells
PCR product (11027bp)
12216bp
3054bp
79
To ensure the bombardment procedure was efficient, cotyledons were
initially bombarded with a control plasmid containing the GUS gene. This
procedure was shown to be relatively efficient with >500 blue foci per cm2.
Infection of rPRSV-W and rPRSV-P was assayed in bombarded squash
cotyledons by ELISA prior to inoculation onto seedlings (Tables 3.1 and.3.2).
One hundred percent of cotyledons bombarded with rPRSV-W (Table 3.1)
and 86.6% of those bombarded with rPRSV-P (Table 3.2) gave ELISA
values > 1.3 which is more than 10 times that observed for the negative
controls. The remaining rPRSV-P inoculated cotyledons gave significantly
lower ELISA values although they were still at least 3 fold above background.
All bombarded cotyledons were inoculated onto squash plants and assayed
15 days later to determine if they were systemically infected with PRSV.
rPRSV-W was successfully transmitted to squash plants from 13 of the 15
positive cotyledons (86.6%) as indicated by high ELISA values in 51/60
squash plants (Table 3.1). Corresponding PRSV symptoms, including severe
mottling, distortion and blistering of leaves, were observed in all ELISA
positive squash plants (Fig.3.20). rPRSV-P was transmitted to squash plants
from all 13 cotyledons that had high ELISA (Table 3.2). The 2 cotyledon
samples with low ELISA values did not establish infections when inoculated
onto squash plants. Typical potyvirus-like particles were observed by
electron microscopy of negatively stained squash tissue infected with both
rPRSV-W and rPRSV-P (Fig. 3.21).
Sap from squash infected with rPRSV-P and rPRSV-W was inoculated onto
papaya to confirm the host range integrity of clones. As expected, none of
the papaya plants inoculated from squash infected with rPRSV-W were
positive in ELISA at 28 dpi and no symptoms were detected up to 45 dpi.
However, a total of 24/26 (92%) papaya plants inoculated from squash
infected with rPRSV-P had high ELISA values at 28dpi (Table 3.2). By 45dpi,
25/26 plants showed symptoms of PRSV-P infection. ELISA results from
positive squash and papaya were confirmed by RT-PCR amplification of
80
~900bp fragments of the P1 and CP- coding regions and 2000bp fragments
of the NIa-coding region of PRSV (Fig 3.22). Table 3.1 Summary of infectivity assays (ELISA and symptoms) on plants
inoculated with full-length PRSV-W PCR product. Cotyledons were assayed by
ELISA 10 days post-bombardment (dpb) and inoculated onto squash plants which
were assayed by ELISA and for symptoms at 15 dpi. Positive squash plants were
inoculated onto papaya and assayed by ELISA and symptoms after 28 days then
symptoms monitored again at 45 dpi. Controls are shaded. NI: not inoculated
Cotyledons
Squash
Papaya
ELISAe
ELISAa,e
Symptomsc
ELISAb,e
Symptomsd
Sample
10 dpb 15 dpi 15 dpi 28 dpi 28 dpi 45 dpi Unshot cotyledon 0.122 Buffer only 0.11 0.013 0.142 Healthy squash 0.102 0.12 Healthy papaya 0.204 PRSV-P/papaya 1.452+0.02 ++ ++ PRSV-W/squash 1.497+0.07 ++++ 0.285+0.04 - - - -
Shot # 1 1.438 1.451+0.10 ++++ 0.211+0.01 - - - - Shot # 2 1.524 1.485+0.03 ++++ 0.271+0.06 - - - - Shot # 3 1.346 0.119+0.02 - - - - NI Shot # 4 1.484 1.452+0.13 ++++ 0.229+0.02 - - - - Shot # 5 1.492 1.449+0.41 ++++ 0.223+0.13 - - - - Shot # 6 1.549 1.484+0.07 ++++ 0.205+0.05 - - - - Shot # 7 1.468 1.176+0.69 ++ - + 0.236+0.08 - - - - Shot # 8 1.537 1.409+0.04 ++++ 0.208+0.004 - - - - Shot # 9 1.397 0.191+0.12 - - - - NI Shot # 10 1.538 1.447+0.04 ++++ 0.228+0.03 - - - - Shot # 11 1.573 1.429+0.03 ++++ 0.266+0.05 - - - - Shot # 12 1.327 1.387+0.04 ++++ 0.308+0.02 - - - - Shot # 13 1.458 1.401+0.03 ++++ 0.301+0.008 - - - - Shot # 14 1.562 1.479+0.08 ++++ 0.287+0.02 - - - - Shot # 15 1.346 1.401+0.04 ++++ 0.3095+0.02 - - - - a ELISA values are the average of results from 4 squash plants inoculated from infected cotyledons + standard deviation b ELISA values are the average of results from 2 papaya plants inoculated (3 times each)from infected squash c typical symptoms observed (+) or not (-) for each of the 4 squash plants d typical symptoms observed (+) or not (-) for each of the 2 papaya plants e ELISA values represent absorbance at 460 nm
81
Table 3.2 Summary of infectivity assays (ELISA and symptoms) on plants
inoculated with full-length PRSV-P PCR product. Cotyledons were assayed by
ELISA 10 days post-bombardment (dpb) and inoculated onto squash plants which
were assayed by ELISA and for symptoms at 15 dpi. Positive squash plants were
inoculated onto papaya and assayed by ELISA and symptoms after 28 days then
symptoms monitored again at 45 dpi. Controls are shaded. NI: not inoculated
Cotyledons
Squash
Papaya
ELISAe
ELISAa,e
Symptomsc
ELISAb,e
Symptomsd
Sample
10 dpi 15 dpi 15 dpi 28 dpi 28 dpi 45 dpi Unshot cotyledon 0.104 Buffer only 0.094 0.073 0.091 Healthy squash 0.125 0.105 Healthy papaya 0.118 PRSV-P/ papaya 1.436+0.03 ++++ 1.428+0.04 ++ ++ PRSV-W/ squash 1.402+0.05 ++++ 0.12+0.04 -- --
Shot # 1 1.357 2.231+0.04 ++++ 1.47+0.12 ++ ++ Shot # 2 1.476 1.429+0.05 ++++ 1.209+0.40 + - ++ Shot # 3 1.437 1.409+0.05 ++++ 1.43+0.05 + - ++ Shot # 4 1.496 1.416+0.11 ++++ 1.4155+0.07 ++ ++ Shot # 5 0.572 0.2315+0.14 - - - - NI Shot # 6 1.462 1.412+0.02 ++++ 1.461+0.03 ++ ++ Shot # 7 0.327 0.100+0.02 - - - - NI Shot # 8 1.475 1.385+0.03 ++++ 1.407+0.03 + - ++ Shot # 9 1.395 1.327+0.15 ++++ 1.424+0.06 + - ++ Shot # 10 1.492 1.411+0.03 ++++ 1.434+0.004 ++ ++ Shot # 11 1.395 1.275+0.24 +-++ 1.466+0.006 ++ ++ Shot # 12 1.378 1.372+0.05 ++++ 0.79+0.84 - - + - Shot # 13 1.452 1.404+0.43 ++++ 1.4215+0.06 ++ ++ Shot # 14 1.465 1.418+0.05 ++++ 1.371+0.02 ++ ++ Shot # 15 1.369 1.42+0.04 ++++ 1.414+0.03 + - ++ a ELISA values are the average of results from 4 squash plants inoculated from infected cotyledons + standard deviation b ELISA values are the average of results from 2 papaya plants inoculated (3 times each)from infected squash c typical symptoms observed (+) or not (-) for each of the 4 squash plants d typical symptoms observed (+) or not (-) for each of the 2 papaya plants e ELISA values represent absorbance at 460 nm
82
Figure 3.20 Typical symptoms of PRSV infection, (A) squash infected with
rPRSV-W, (B) papaya infected with rPRSV-P.
A
B
83
Figure 3.21 Electron micrographs of typical PRSV virions identified in
negatively stained leaf dips following inoculation with (A) rPRSV-W (B)
rPRSV-P.
200nm 200nm
A B
84
Figure 3.22 RT-PCR analysis of plants inoculated with rPRSV-W to detect
the P1, NIa and CP-coding regions. (A). Lane 1: Detection of P1-coding
region in positive control p5’Triplet-W; Lane 2: Detection of P1-coding region
in squash infected with rPRSV-W. (B) Lane1: Detection of NIa in positive
control p3’Triplet-W; Lane 2: Detection of NIa in rPRSV-W infected squash;
Lane 3: Detection of CP in positive control p3’Triplet-W; Lane 4: Detection of
CP in rPRSV-W infected squash.
A B
M 1 2 M 1 2 3 4
517bp
1018bp
2036bp 2036bp
1018bp
517bp
85
3.4 Discussion
Full-length infectious PCR products of Australian PRSV-W and –P isolates
were generated as in vivo constructs incorporating a CaMV 35S promoter
and terminator. The ~11kb PCR products were amplified reproducibly by LD-
OE-PCR from overlapping clones. The decision to use this approach resulted
from a number of unsuccessful attempts using different strategies to
generate full-length clones in E. coli.
The decision to use in vivo transcripts for generation of rPRSVs was
originally made by Henderson (1999) as it circumvents a number of
difficulties found when producing infectious transcripts in vitro. In vivo
transcripts eliminate the need for transcription enzymes and a cap analogue
for enhancement of translation initiation or transcript stability (Domier et al.,
1989; Riechmann et al., 1990). In vivo transcription also shows a greater
tolerance for the presence of non-viral nucleotides at the 5’ terminus
(Commandeur et al., 1991). As well, previous studies demonstrated a high
efficiency of infection (90%) of tobacco leaves inoculated with a full-length
PVY PCR product incorporating a CaMV 35S promoter at the 5’ end and
nopaline synthase (NOS) polyadenylation signal at the 3’end when delivered
by microprojectile bombardment (Fakhfakh et al., 1996). In that study, a full-
length PVY PCR product was amplified after reverse transcription from
purified viral RNA. A similar approach was initially used in this study (results
not shown), however, several attempt to clone this product were
unsuccessful. Since cloning was essential for subsequent recombination
experiments, the genomes were cloned in three overlapping parts for
subsequent assembly into full-length genomes.
The basis of in vivo constructs is the inclusion of a plant promoter (and
usually a terminator), which is engineered to drive transcription of an intact
virus sequence when introduced into a plant cell. There is different, and
sometimes conflicting, evidence as to the affect of having additional
nucleotides present at the 5’ and 3’ ends of the viral RNA (either in vivo or in
vitro). Reports of reduced infectivity have been attributed to non-viral bases
86
incorporated at the 5’ or 3’ termini of the transcript (Boyer et al., 1993).
However in several cases, extra non-viral bases had no effect or actually
increased infectivity (Viry et al., 1993; Holy and Aboul-Haidar, 1993). ZYMV
and Beet necrotic yellow vein virus (BNYVV) constructs containing 127 and
40 nucleotides, respectively, at the 5’ end of the viral genome were found to
be infectious (Gal-On et al., 1995; Commandeur et al., 1991). In previous
reports of PRSV-P (Chiang and Yeh, 1997), the significance of minimising
the addition of non-viral nucleotides was demonstrated. Capped in vitro RNA
transcripts of PRSV-P (HA) had one extra guanosine residue at the 5’
terminus and 12 non-viral nucleotides at the 3’ terminus and were infectious
(Chiang and Yeh, 1997). In vivo transcripts of PRSV-P (HA), under the
control of a CaMV 35S promoter and Nos terminator and with 10 non-viral
nucleotides at the 3’ end were infectious whereas transcripts with 33
extraneous nucleotides at the 5’ end and 64 non-viral nucleotides at the 3’
end were not infectious (Chiang and Yeh, 1997).
To ensure that the presence of nonviral nucleotides, particularly at the 5’ end
of the genome, did not influence infectivity, Henderson (1999) engineered
the first nucleotide of the PRSV-W genome immediately adjacent to the
transcription start site of the CaMV 35S promoter. To minimize the size of
megaprimers incorporating the promoter, Henderson (1999) used the
minimal CaMV 35S promoter (343 bp).
The 3’ megaprimer designed by Henderson (1999) included the CaMV 35S
terminator sequence in addition to 33 A residues immediately downstream
from the 3’UTR. The same construct was used in this study, however, the
necessity for including a terminator or poly(A) tail in the construct is
debatable. Poly(A) deficient full-length cDNA clones of CIYVV were found to
be infectious when expressed from the CaMV 35S promoter without a
terminator sequence (Tacahashi and Uyeda, 1999; Takahashi et al., 1997).
In those experiments, the poly (A) tail was replaced with different short
sequences and the infectivity of the cDNA constructs examined. Although the
87
infectivity of the plasmids varied depending on the sequences introduced, all
the constructs were infectious. In all cases, progeny viral RNAs from the
cDNA clones had an authentic viral sequence at their 3’ ends with poly(A)
tails and the downstream nonviral sequences were completely lost. Full-
length cDNA clones of CIYVV, TuMV and ZYMV, placed under the control of
CaMV 35S promoter without a termination sequence, were shown to be
infectious (Takahashi et al, 1997; Sanchez et al 1998; Gal-On et al., 1995),
suggesting again that additional terminator signals are not necessary for
infectivity. It was suggested that the poly(A) tail is extended by either RNA
polymerase slippage or by a host poly(A) polymerase and that a
polyadenylation signal exists at the 3’end of the potyviral genome. As
infectivity of rPRSVs generated in this study was similar to wild type virus,
they were not analysed for nonviral sequences at the 3’ end of the genome.
Using the PCR strategy developed here, the need for a terminator would be
easy to test by generating full-length PCR products using primers to
eliminate terminator and/or poly (A) tail.
Since infectious clones of Hawaiian and Taiwanese isolates of PRSV-P have
previously been reported using both in vivo and in vitro approaches (Chiang
and Yeh, 1997), it was expected that cloning of Australian isolates would be
relatively straightforward. Interestingly, while intermediate cloning steps were
relatively efficient, a full-length clone was not achieved. Insertion of the 5’
fragment (which included the CaMV 35S promoter, 5’UTR, P1, HC-Pro and
partial P3) into the rest of the genome only produced clones with the insert in
the wrong orientation. The same result was obtained several times,
suggesting that the full-length cDNA of Australian PRSV isolates may be
toxic to E. coli cells. Use of different E. coli strains also gave the same
result. A similar result was reported by Johansen (1996) who was unable to
obtain a clone representing part of the genome of PSbMV pathotype 1 (P1)
including the HC-Pro to VPg. Clones covering the HC-Pro and partial P3 or
partial P3 to VPg could be cloned separately but were lethal in E.coli when
joined.
88
Toxicity and/or instability of potyviral clones (Maiss et al., 1992; Jakab et al.,
1997) as well as clones of other RNA viruses (Yamaya et al., 1988; Quillet et
al., 1989; Fakhfakh et al., 1996; Johansen et al., 1996) in bacteria is widely
reported. It has been proposed that the toxic viral products could be derived
from transcriptional expression of viral sequence driven by an upstream
bacterial promoter such as the “LAC” promoter (Yamaya et al., 1988;
Johansen, 1996) or by adventitious prokaryotic promoter activity in the viral
genome (Quillet et al, 1989; Fakhfakh et al., 1996). It is interesting that other
PRSV infectious clones (Chiang and Yeh, 1997) were not toxic. This is
further discussed in chapter 6.
Numerous strategies have been developed in past years to avoid toxicity –
associated problems and several of these approaches were used in this
study. Using low copy number vectors (Payne et al., 1994; Dersch et al.,
1994; Gritsun and Gould, 1998) and reducing the incubation temperature
from 370C to 280C Gritsun and Gould, 1998) has previously been shown to
stabilise full-length cDNA clones in E. coli. In this study, the PRSV-W
genome was cloned into the low copy number vector, PACYC177. Unlike
initial cloning into high copy number plasmids, some colonies were obtained
and plasmids were isolated which were shown to contain the full-length
PRSV-W genome. However, the colonies were very tiny and died after
several hours of incubation in liquid growth media, a feature previously
associated with toxicity of viral sequences (Quillet et al., 1989; Rice et al.,
1989; Lai et al., 1991; Johansen, 1996). Reducing the incubation
temperature to 28-30oC had a small positive effect on the growth rate of the
cells and resulted in a slight increase in plasmid yield, however, the yield was
still not sufficient for infectivity experiments. Interestingly, although the P1
and CP-coding regions could be amplified, confirming the presence of the N
and C termini of PRSV in the plasmid, these clones did not digest well with
restriction enzymes, giving only a smear on agarose. This posed significant
problems for the generation of recombinant clones. Therefore alternative
strategies were investigated.
89
The insertion of introns with multiple stop codons into cDNA clones of plant
viruses has previously been reported to facilitate the generation of full-length
viruses in E. coli (Johansen, 1996; Olsen and Johansen, 2001; Lopez-Moya
et al., 2000). The introns, which are not processed in prokaryotes and
therefore prevent expression in bacteria, are subsequently processed in the
eukaryotic plant cell to produce a normal virus transcript. Johansen (1996)
used introns to overcome toxicity of PSbMV P1 potyviral clones, where
toxicity was associated with joining of the HC-Pro/P3 to the genome region
incorporating P3-VPg. In that case insertion of an intron into the P3 coding
region overcame toxicity enabling normal cloning and amplification in E. coli.
As well, it was demonstrated that up to 3 different introns, inserted up to 4
times in positions between the P1 and VPg could be processed to generate
infectious virus. Introns have also been inserted into the P3 coding region of
infectious clones of LMV (Yang et al., 1998) and PPV (Lopez-Moya et al.,
2000). Although wild type virus could be cloned in these cases, intron-
containing clones of PPV resulted in a more stable, faster growing bacteria
and higher plasmid yield. In this study the St-LS1 IV2 intron (one of those
used by Johansen (1996) was inserted into the P1 coding region of the
PRSV-W genome. This intron has also been used to inhibit Barnase
expression (Hanson et al., 1999) a potent RNase and so was assumed to be
highly functional at inhibiting expression. The P1 was chosen as the site of
insertion on the presumption that viral sequences were being expressed
within the bacteria and were toxic and so insertion into the P1 should prevent
translation of the whole ORF. This strategy however only reduced toxicity
very slightly and was simlar to results obtained after cloning into a low copy
number plasmid i.e. small colonies and very low plasmid yield. Failure of an
intron in the P1-coding region to overcome toxicity suggests that it is likely
that there may be cryptic prokaryotic promoter sequences within the 5’
fragment but downstream of the insertion site in the P1-coding region.
Insertion of introns in several places in the genome may be required to
localise the putative toxic sequence and stabilise the clone in E. coli, since
positions of the promoter elements are accidental and can be different in
various potyvirus species, strains and isolates (Jakab et al., 1997). This was
supported by a report that while a full-length clone of a third PSbMV isolate,
90
PSbMV-L1, with four intron insertions (P1, P3, CI and VPg) was unstable in
E.coli, a clone made with an additional intron in the 6K2 coding region was
stable and less toxic to E.coli resulting in higher plasmid yield (Olsen and
Johansen, 2001).
Although the intron did not prevent toxicity in E.coli in this study, in later
experiments the 5’ fragment clone containing the intron was used to
generate full-length PCR product which was subsequently shown to be
infectious (90%), confirming that the intron was correctly engineered and
spliced (results not shown). It is possible then that insertion of the intron into
the genome of Australian PRSV–W at the P3, considering it was at this point
that clones became toxic, could overcome the problem in future.
However, in an attempt to speed up the project, and since all of the tools
(clone, primers etc) were already available, an alternative approach using
OE-LD-PCR was used. The advantage of overlapping PCR meant that the
genome could be cloned in two fragments to overcome toxicity and then
joined for inoculation. Jakab et al. (1997) reported a similar approach to
avoiding difficulties in making full-length infectious clones of PVY-N605, by
cloning the full-length PVY genome as two overlapping clones which were
ligated prior to inoculation. Using that approach, cDNA and RNA transcripts
were infectious using both mechanical and biolistic inoculation methods.
Advantages of PCR over more traditional cloning and sub-cloning techniques
include the relative ease and the reduction in time involved (Gritsun and
Gould, 1995). Long distance PCR has been successfully used for
amplification of large DNA fragments of up to 35kb from bacteriophage
lamda and up to 42kb from human genomic DNA (Barnes, 1994; Cheng et
al., 1994). This technique has also been used for generation of full-length
infectious cDNA transcripts of numerous viruses (Hayes and Buck, 1990;
Boyer et al., 1993; Pogany et al., 1994; Fakhfakh et al., 1996; Tellier et al.,
1996; Perrin and Hull, 1999; Lopez-Moya and Garcia, 2000; Saldarelli et al.,
2000).
91
Using this approach it was possible to generate full-length infectious PCR
product of PRSV-P and -W, derived from cloned genome components, which
had the potential to be manipulated for future recombination experiments,
overcoming the problems of toxicity in E.coli. Although slightly more complex
than a single full-length infectious clone, this approach can achieve a similar
outcome and is easier to manipulate in subsequent mutation and
recombination studies as clones are smaller.
Products obtained from OE-LD-PCR were generally low in concentration
compared to a standard PCR reaction. The success of the reaction and yield
varied with batches of enzyme, and thermocycles were highly dependent on
the concentration of template DNAs. The presence of the low molecular
weight band meant that the correct size PCR product had to be gel purified,
further reducing the concentration and so the OE-LD-PCR step had to be
repeated several times to obtained sufficient DNA for microprojectile
bombardment. Megaprimers were originally used to incorporate the
promoter and terminator sequences into a full-length PCR product amplified
directly from viral RNA (Fakhfah, 1996; Henderson, 1999). In this study,
since the viral fragments, as well as the promoter and terminator, were
cloned it was not essential to use megaprimers for OE-LD-PCR. However, it
was thought that the longer overlap (5’ megaprimer with 135bp overlap and
3’ megaprimer with 206bp overlap) afforded by the megaprimers would
increase specificity of amplification. Using megaprimers worked well,
however, in future, smaller specific primers could be designed and tested to
see if this increases efficiency of amplification.
The use of overlapping PCR to generate infectious PRSV transcripts has
both advantages (as mentioned above) and disadvantages. The limitations
of PCR itself are well documented (Meyerhans et al., 1990; Higuchi et al.,
1988; Fang et al., 1998) and although the virus genome was cloned, there
was potential to generate errors during the final overlapping-PCR step. The
chance of this was minimised by using enzymes with high-proof reading
ability. The Expand Long Template PCR system used in this experiment is a
92
unique enzyme mix containing Taq DNA polymerase and Pwo DNA
polymerase, a thermostable polymerase with proof reading activity. As well,
because the chance of exactly the same error occurring in more than one
PCR reaction is very low, pooling of PCR products (often as many as 30-50
different PCR reactions) serves to dilute out any potential mutant, perhaps
mimicking a natural population.
Infectivity rates of cDNA clones can vary depending on the inoculation
method used. The efficiency of delivery is especially important for in vivo
transcribed clones which must enter the cell nucleus to replicate (Lopez-
Moya and Garcia, 2000). Particle bombardment is reportedly a more
effective way to introduce DNA directly into the plant cell nucleus compared
to mechanical inoculation of clones (Gal-On et al., 1995). The first report of
successful infection by a full-length PCR product derived from an RNA virus
using particle bombardment was for PVY (Fakhfakh et al., 1996). Lopez-
Moya and Garcia (2000) compared both particle bombardment and
mechanical inoculation methods to inoculate PPV infectious clones. They
reported that only 0.1ng of DNA per plant was required to achieve 100%
infection by biolistic inoculation while 5μg DNA per plant were required to
obtain 100% infection by mechanical inoculation i.e. biolastic inoculation was
105 fold more efficient. They also found mechanical inoculation much more
variable compared to biolistic inoculation, possibly due to differences in the
level of damage caused to plants in each inoculation by hand. Similar results
were found when infectivity of ZYMV infectious clones by mechanical and
biolistic inoculation were compared (Gal-On et al., 1997). In this study, in
vitro bombardment onto squash cotyledons prior to mechanical inoculation
was effective with 86.6% of squash plants becoming infected with PRSV-W
(based on ELISA at 15 dpi) and 86.6% of papaya becoming infected with
PRSV-P (based on ELISA at 28 dpi). This is a similar rate of infectivity as
that reported for PVY infectious full-length PCR product amplified using LD-
PCR incorporating CaMV 35S promoter and NOS terminator and inoculated
initially in vitro to tobacco leaf (Fakhfakh et al., 1996). Fakhfakh et al. (1996)
found that increasing the amount of DNA bombarded from 0.2µg to 0.5µg
93
increased the efficiency of infection to 90%. In this study, cotyledons were
each bombarded with approximately 1 μg of purified PCR product to ensure
maximum efficiency. Nevertheless, even at this concentration infectivity of
cotyledons was not 100%, however, this could be due to other factors such
as quality of cotyledons or variability in bombardment.
rPRSVs behaved like wild-type virus in all aspects. Symptoms were
indistinguishable from wild type virus on both squash and papaya and
electron microscopy confirmed the presence of normal potyvirus-like
particles in leaf dips from infected sap. As well the host range integrity of the
clones was maintained. Some studies have reported delays in symptom
development using infectious clones. Symptom development for PSbMV and
ZYMV transcripts was delayed approximately one week and 10 days,
respectively, when plasmids were used as inoculum instead of purified virus
(Domier et al., 1989; Riechmann et al., 1990; Gal-On et al., 1991; Olsen and
Johansen, 2001). In this study, there was essentially no difference in onset
of symptoms between rPRSVs and wild type controls. This is likely a result of
the inoculation method, as infectivity is initially established in cotyledons in
vitro.
This strategy generated infectious clones of PRSV-P and -W, overcoming
problems of toxicity in E.coli. As well, the availability of the genomes as 3
overlapping clones is an ideal tool for subsequent recombination
experiments, described in Chapter 5.
94
CHAPTER 4 SEQUENCE ANALYSIS OF THE COMPLETE GENOMES
OF AUSTRALIAN ISOLATES OF PRSV
4.1 INTRODUCTION
For RNA viruses, including potyviruses, differences in replication,
pathogenicity and host range can be determined by several or even a single
amino acid change (Gal-On and Raccah, 2000; Skaf et al., 2000; Rajamaki
and Valkonen, 1999; Masuta et al., 1999; Saenz et al., 2000). Identification
of specific mutations associated with a particular phenotype by sequence
analysis and comparison of virus genomes can be difficult because of the
extensive variation in RNA viruses (Domingo et al., 1985). However, this is
more feasible where there are large numbers of sequences available and/or
the sequences are closely related and recently diverged. The latter is true
for Australian PRSV-P and -W isolates. It is believed that PRSV-P arose
relatively recently from PRSV-W in Australia (Bateson et al., 1994; Bateson
et al., 2002) and sequence data has already demonstrated the high level of
nucleotide sequence similarity for the CP (98.8%; Bateson et al., 1994) and
P1 (96.9%; Henderson, 1999) coding regions and 5’UTR (100%; Henderson,
1999) and 3’UTRs (100%; Bateson, 1995). Additionally, there are 5 full-
length PRSV sequences available including PRSV-P from Hawaii (Yeh et
al.,1992; GenBank Accession No. X67673), Taiwan (Wang and Yeh, 1997;
GenBank Accession No. X97251) and Thailand (GenBank Accession No.
AY162218), as well as PRSV-W sequences from Taiwan (GenBank
Accession No. AY027810) and Thailand (Attasart et al., 2002; GenBank
Accession No. AY010722).
While identification of the sequences involved in host range will ultimately
require recombination and mutagenesis studies, comparison of whole
genome sequences can provide valuable information by identifying putative
host range determinants and therefore targets for further studies. In this
chapter, the full genome sequences of the Australia PRSV-P and -W isolates
95
are compared to each other and overseas isolates and the sequences
analysed to identify putative host range determinants.
4.2 METHODS AND MATERIALS
4.2.1 Oligonucleotide primers
The sequences of NIa-1, NIa-2, MB-12A, MB-11, P3cons and Universal
Forward primers are given in Chapter 3 (section 3.2.1.). The sequences of
remaining oligonucleotides used for cloning of the 5’ and 3’ UTRs and for
sequencing of full-length PRSV-P and PRSV-W genomes are given in Table
4.1
4.2.2 Source of PRSV clones
The full-length genomes of PRSV-P and PRSV-W isolates from Australia
were previously cloned in 3 overlapping clones, namely p5’Triplet-P or W,
pMiddle Triplet-W or P and p3’Triplet-P or W (Chapter 3). Since
megaprimers (incorporating the 5’ and 3’UTR’s of PRSV-W) were used in the
generation of these clones and although previous data suggested that these
UTRs are identical between isolates (Bateson, 1995; Henderson, 1999), the
5’ and 3’ UTRs were cloned separately to confirm the sequence. Fragments
representing the 5’UTR and partial P1 (1490bp) and the 3’UTR and CP
(1070bp) were amplified from PRSV-P infected papaya and PRSV-W
infected squash. RNA was extracted using a QIAGEN RNeasyR Plant Mini
Kit. First-strand cDNA’s were synthesised from extracted RNA using primer
Taurus (5’ terminus) and degenerate oligo dT primer (3’ terminus) with the
ExpandTM Reverse Transcriptase system (Roche Diagnostics) as described
in section 2.3.2. PCR products representing 5’UTR and partial P1 (1490bp)
and 3’UTR and CP (1070bp) of both strains were amplified from 1-5 μl of
first-strand cDNA using
96
Table 4.1 Sequence of oligonucleotides used in cloning and sequencing of PRSV-P and W genomes
Name Sequence 5’ – 3’ Reference Name Sequence 5’ – 3’ Reference
1A GGTTTAAAATAAAACATCTCAACACAAC Henderson, 1999 Capricorn ACTATGGTTGGTCGTCTAGG Henderson, 1999
CI-M CACGGAGTAATGCAGCCA This study CI-b CGTGCAGACATATAAGCGTGA This study
CIR-F GTGGATCAACTAAGTAAG This study CI-a GCTTGCTCAAAAACTGCACTG This study
CIQ-R GGGTGCACTGTTCCATCGAAG This study CIM-R TGGCTGCATTACTCCGTG This study
CI-1 ACTCTCGCTTTATGTGC This study CI-R CTTACTTAGTTGATCCAC This study
CP-1 CATGCTACTCCGACATTT This study CP-2 CACCTTATAGTACTATAT This study
Oligo dT TTTTTTTTTTTTTTTTTTTTT(G/A/C) Bateson, 1995 Gemini GGCGATGCAAGAGAAGAATT Henderson, 1999
HC2-R CGTGGTATTGCCTTTCGCCCC This study HC3-R TGTTGCAAGTTATCTTGTGGC This study
HC1-R TGCGTTGGCCGCGTCAGGATG This study MB-14A GGCTTGATTGGATAATCA This study
MB-16A TTTCCGTCACTAGCATCG This study NIaM-R AGCTCTGCTATGGAATGGAGG This study
NIaL1-R AACTGATTTCGAGGGTGGTGG This study NIb-s GGTACCATGAGTGGTGGTCGTTGGCTCTTTG Bateson, 1995
NIa-MF GAAGAGAAGGTTCTGAGG This study NIb-R1 TTGCGCAACACTATCCTC This study
NIb-M GTGATGCGGATGGCTCTC Bateson, 1995 NIa-R2 GACAACAAACTTACCGTG This study
NIa-R AGCCTGCTTGTCGAAGC This study NIa-5 CCATTGCAGGATTTCCTGACAGG This study
NIb-1 GGAGCCAAAGTCTGCGTT This study P3-M GGCTGTGCTTACATTTTC This study
97
Table 4.1 continued/
Name Sequence 5’ – 3’ Reference Name Sequence 5’ – 3’ Reference
P1C-R CAACCTCCTATCGTACTGAGC This study P1B-R GTCAGAAGTGTTACCGCAATC This study
Pisces AACCAATTGCGGCTAGTGAG Henderson, 1999 P3S GGAGAGTTTGACCCAACTACAAACTGC This study
P3M-1 CCTACGCCACCCTATTGAAGG This study P3M-R GAAAATGTAAGCACAGCC This study
P1A-R CCAACTTCGAGTGCCAGGTGC This study Prot-3 CCCACAAACTGACATCTCAATGG This study
RLS-6 AAGTACGTTGACCTGCCGACTC Stokoe, 1996 RLS-3 GGAGGGTCATTCGGACATGTCTC Stokoe, 1996
Rep-1 TTGGCGTGTAAGTGATTTCCCC Bateson, 1995 Rep-2 GTATCGCCATTCACCCGGATCATG Bateson, 1995
RLS-4 TCGCGGCAATTCTGCGTTGGCCGCG Stokoe, 1996 RLS-5 CTTATGGGGCGAAAGGCAATACC Stokoe, 1996
Taurus AGCTGCTCACATCTTGTCGT Henderson, 1999 Universal
Reverse
AACAGCTATGACCATG
98
Expand TM Long Template PCR system (section 2.3.3.2) with primer pairs 1A
/Taurus and MB-11/degenerate oligo dT, respectively. Gel purified (section
2.4.7) products were ligated into pGEM-T (section 2.5.1) and transformed
into competent E.coli JM109 (section 2.5.3).
4.2.3 Sequencing of PRSV-P and PRSV-W genomes
For both PRSV-P and -W, the 3 overlapping clones used to generate
infectious clones were sequenced as shown in Figures 4.1- 4.4. For each of
these regions, at least one other clone was also sequenced. Two clones
each of 5’UTR/P1 and 3’UTR/CP clones were also sequenced using
Universal Forward and Reverse primers and Pisces and Taurus. Clones
were sequenced as described in section 2.4.6.
Contiguous sequences obtained from individual clones were assembled in
SeqManTMII (DNASTAR). The sequences of clones used to generate
infectious transcripts were used for subsequent analysis. The sequence of
the Australian PRSV-P and -W isolates were aligned with the sequences of
PRSV-P from Hawaii (HA isolate; GenBank Accession No. X67673),
Thailand (GenBank Accesion No. AY162218) and Taiwan (YK isolate;
GenBank Accession No. X97251) and PRSV-W from Taiwan (CI isolate;
GenBank Accession No. AY27810) and Thailand (GenBank Accession No.
AY010722). Sequences were prepared using EditSeqTM and MegAlignTM
within the DNASTAR suite of programs and then aligned in ClustalX (version
1.81) (Thompson et al., 1997) using default parameters. Neighbor-joining
trees were generated and bootstrapped (1000 resamplings) in ClustalX and
viewed using TreeView (Page, 1996). Distances (% divergence) were
calculated in MegAlign after aligning using the Jotun Hein algorithm.
99
Figure 4.1 Representation of the five overlapping clones used to generate
full-length PRSV genome sequences.
VPg --- P1 HC P36K
CI NIa NIb CP
VPg NIa NIb
NIa-I
CP
3’UTR 33 A 35ST
P3 CI VPg NIa
P3S NIa-2
P1 HC 35S
5’megaprimer P3cons
3'UTR5'UTR
6K
6K
5'UTR
CP
3’UTR
P1
5'UTR
Taurus 1A
MB-11 Degenerate dT
3’megaprimer
100
Figure 4.2 Location of primers used in cDNA synthesis, PCR amplification
and sequencing of p5’Triplet of PRSV-P and -W
P1 HC-Pro P3 35S
5'UTR
Forward
1A Capricorn
Pisces
Gemini RLS-3
RLS-5
RLS-6 P3S
P1C-R P1B-R
P1A-RTaurus
HC3-R HC2-R
HC1-R
RLS-4
Reverse
101
Fig 4.3 Location of primers used in cDNA synthesis, PCR amplification and
sequencing of pMiddle Triplet -P and –W.
P3 CI VPg NIa 6K
Universal Forward
P3S
P3M-1
P3-M
CI-M
CIR-F
CI-a
NIa1
NIa-MF
Universal Reverse
P3M-R
CI-MR
CI-R
CIQ-R
CI-1
NIa-R
NIaL1-R
NIa-R2
NIaM-R
Prot 3
NIa-5
CI-b
102
Figure 4.4 Location of primers used in cDNA synthesis, PCR amplification and
sequencing of p3’Triplet -P and -W
NIb CP 33 35S A T
VPg NIa 6K 3’UTR
Prot-3 NIa-5
NIa-MF
NIb-1
NIb-S
NIb-M
Rep-2
MB-11
CP-1
CP-2 Universal Reverse
MB-12A
MB-14A
MB-16A
NIb-R2
Rep-1
NIb-R1
NIa-2
NIaM-R
NIaL1-R
NIa-R
NIa-R2
Universal Forward
103
RESULTS 4.3.1 The Australian PRSV- P and -W genomes
The sequences of the full-length genomes of Australian PRSV-P and -W
isolates were determined. At least 2 clones of each genome region were
sequenced. There were only 3 nucleotide changes over the whole genome
between clones of each isolate and none resulted in amino acid changes.
The nucleotide sequences are presented in Appendix 1 and represent the
genomes of PRSV-P and -W contained in the clones used to generate
infectious transcripts, rPRSV-P and rPRSV-W. The genomes of Australian
P and W isolates were both 10,327nt in length and encoded a 5’UTR (85nt),
a single open reading frame (10,038nt), and a 3’UTR (206nt). The genomes
differed from each other by only 2.2% at the nucleotide level over the whole
genome and only 2.6% at the amino acid level in the open reading frame
(Table 4.2). The 5’UTR and 3’ UTR of the Australian PRSV-P and -W
isolates were confirmed to be identical.
The size and organization of the two genomes was typical of other PRSV
isolates. The open reading frame (nts 86-10118) encoded a single
polyprotein with the same putative proteins as previously reported for other
PRSV isolates (Fig.1.1). A number of amino acid motifs implicated in
different potyvirus functions and previously shown to be conserved in
Hawaiian and Taiwanese PRSV isolates (Yeh et al., 1992; Yeh, 1994; Wang
and Yeh, 1997) were also conserved in the Australian isolates (Fig.4.5).
104
Table 4.2. Percent divergence between the genomes of PRSV isolates. Nucleotide
divergence of the complete genome is shown in the upper triangle; amino acid
divergence of the open reading frame is shown in the lower (shaded) triangle.
AUS-W AUS-P HAW-P TAIW-W TAIW-P THAI-W THAI-P
AUS-W *** 2.2 7.5 19.0 19.2 18.9 19.8
AUS-P 2.6 *** 7.8 19.3 19.3 19.3 20.0
HAW-P 5.4 5.7 *** 19.3 19.3 19.2 19.7
TAIW-W 9.4 9.9 10.1 *** 5.0 12.6 11.5
TAIW-P 9.6 10.1 10.1 3.3 *** 12.2 11.2
THAI-W 9.1 9.6 9.3 5.9 6.3 *** 12.9
THAI-P 9.9 10.3 10.1 6.6 7.1 6.1 ***
105
AUS-W MSSLYTLRPA AQYDRRLESK KGSGWIEHKL ERKGDRGNTH YCSEFDISKG AKILQLVQIG NAEVGRTFLE GNRFVRANIF EIIRKTMVGR LGYDFESELW VCHDCGNTSD KYFKKCDCGE AUS-P ---------- ---------- ---------- ---------- F--------- ---------- ---------- ---------- ---------- ---------- ---E-S---- ---------- HAW-P --------A- ---------- -----V---- ----E----- ---------- ---------- -T-------- ---------- ---------- ---------- --RN-DK--E ---------- TAIW-P -----Q-Q-I -LK--L-SHE R-K------- ----E----R -VG--V--E- ---------- -T----A--- ---RI--D-- --VK------ ---------- C--S-D---A ---------- TAIW-W -----Q-Q-I -LK--L-SH- R-K--Y---- ----E---SR HVG--V--E- -R----I--- ------A--- ---RT--D-- --VK------ ---------- C--S-D---A ---------- THAI-W -----Q-Q-I -LK--L-SH- R-K------- ----E----R HVG--V--E- ---------- ---I------ -D-RTQ-D-- ---K-----H ------CG-- C--S-D---- ---------- THAI-P -----Q-Q-I -LK--L-AHE R-K------- ---------R HVG--VV-E- ------I--- ------A--- -D-KT--D-- --VK-----H ------C--- C--S-DK--A ---------- AUS-W KYYYSERNLM KTIQDLMYQF DMTPSEINSV DFDYLADAVD YAERSVKGSQ VPEPVELAMM EPIAASEKGT LVVSELKVVP VTTKVEEAWT IQIGEIPVPL VVIKETPVIS GVNGTLNSTG AUS-P ---------- R--------- ---------- ---------- ---------- ---------- -------E-- ---------- ------K--- ---------- ----K----- S--------- HAW-P T--------- R-MN------ ---------- -LE---N--- ---QL--R-- ---------- ---V--GE-I -M---PE-M- ---------- ---------- ---------- --E------- TAIW-P ------G--I -SMR------ ---T---EQ- GY----E--- F--Q-GVKFK A-A-E-PEI- -TS-S--G-L --A--PEI-- I---A----- ------S--- ---------- -MSR--S--- TAIW-W ------G--I -SMH------ --ST---EQ- GY----E--N F--L--VE-K T-A-E-PEIV NTG-SI-G-L --A--PEI-S I--------- ------S--- ---------- -MSK--S--- THAI-W ---------I -SMH------ ---AA--DQ- GL----E--- ---Q---K-K --V-D-PEFV -VL----ESH ---P-PE--S ---RA----- ---------- ---R------ ----M-S--- THAI-P ---------I -SMH------ N--A---DQ- EYN---E--N F--Q--IK-K --VS--PDFV K--V---ESL ---P-PEI-- ---------- ---------- I--------- ------E--- AUS-W FSLEADVTKM VEKEVPQEEV KEAVHLALEV GNEIAEKKPE LNLTPYWSAS LELHKRVRKH KEHAKIAAIQ VQKEQEENQK IFSTMELRLD LKSRRRNQTV VCDKRGTLKW ETRQGCKKSR AUS-P ------I--- -K-------- ---------- ---F------ ---------- ---------- ---------- -L----D--- ----L--K-- ---------- ---------- K----H---- HAW-P ------I--L ----IL---- ---------- ---------- -K-I------ ------I--- ---------- ----R-KD-- V--AL----N --------A- ---------- --QR-H---K TAIW-P -----EIA-P ATST---S-I E--AY----- ---------- -K-------- ---------- ------E--R -R--K-RD-R --AAL-AK-N -GT--KG-I- ---------- -KC-QR---K TAIW-W -----E-A-P ATST---N-I ---------- ---------- -K------V- ---------- ------E--R -R--K-RD-R --AAL-AK-N -GT--KG-I- ---------- KKY-KR---K THAI-W -----EIA-P AKST---D-- ---------- ---------- -K-A------ ---------- -----SE-LR -RR-K-RDHR --AAL-AK-N --A--QG-V- ------I--- KK--QR-RNK THAI-P -----EI-DS -KSTAL-N-I ---------- ---------- -K-------- ---Y------ -----TE--R ----K-M-KR --AAL-GE-N --A--QGKVI ---------- KK--Q--R-K AUS-W LMQQVSDSVV TQIHRDFGCE PQYFEPQLPG IKRATSKKIC RSRKYSRIVG SNKINYVMKN LCDIIIERSI PVELVTRRCK RRIIQKEGRS YVQLRHMGGI RTRQDVSSSP EMEQLFTQFC AUS-P --------A- ---YH----- ---------- ---------- ---------- N--------- ---------- ---------E ---------- -------S-- ---------- ---------- HAW-P ----A--F-- ----C----K T--S--HI-- --QS------ KP--H----- NS----I--- ---T----G- ------K--- ---L------ -------N-- -A-------- D--L------ TAIW-P VVA------- -K--GN-E-- TRDLDVAI-- --C-----MW KKQ-S-KLR- ---------- --E--VD-NV ----I-K--R -S-FR-D-KN -------S-G NAPR------ ---K---R-- TAIW-W VIA------- -K--SN-E-- TRDLDVAI-- --C-----MW KKQ-S-K-M- ---------- --E--VD-N- ----I-K--R ---FR-D-KN --R----S-G NAP------- ---R---R-- THAI-W MVA-L----- -K--AN-E-R TPNLDVET-- --C----VTR KKQTQPK-F- ---V------ ------D-N- ----I-K--- ---FRMD-KN --H----D-N NAPR-----S D--K---R-- THAI-P VIA------- -K--SN-E-- TRNIDVAI-- V-C-----LQ KEQ-QF-L-- ---V------ -----VD-N- -I--I-K--- ---FR-D-KN -------D-- NAPR------ ---E--VRL- AUS-W KFLVGHKPFK SENLTFGSSG LIFKPKFADN VGRYFGDYFI VRGRLGGRLF DGRSKLARSI YAKMDQYNDV AEKFWLGFNR AFLRHRKPTD HTCTSDMDVT MCGEVAALAT IILFPCHKIT AUS-P --------L- ---------- ---R---T-- ---------V ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- HAW-P --------L- -K-------- ---------- ---------V -------K-- ---------V ---------- ---------- ---------- ---------- ---------- ---------- TAIW-P ---IRRQSV- AAR--H---- ---R-----R I-----E--- T---YA-K-- ---------V RMN-E----I ---------- ---------- -V-------- ---------- ---------- TAIW-W ---IRRQSV- AAR--H---- ---------R I-----E--- T---YA-K-- -------K-V RM--E----- ---------- T-------A- -V-------- ---------- ---------- THAI-W ---IRKQSIN AA---H---- ---------R T-----E--- T---CE-K-- -------K-V RMR-E----- ---------- ---------- -V-------- ---------- ---------- THAI-P ----RRQSV- ASC--H---- ---------R ------E--- T---CE-K-- -------K-V RMR-E----- ---------- ---------- -V-------- ---------- ---------- AUS-W CNTCMIKVKG RVIDEVGEDL NCELERLRET PSSYGGSFGH VSTLLDQLNR VLNARNMNDG AFKEIAKRID AKKESPWTHM TAINNTLIKG SLATGYEFER ASDSLLEIVR WHLKRTESIK AUS-P ---------- ---------- ------Q--- L---E----- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- HAW-P -----S---- ---------- ---------- L-A------- ---------- ---------- -------K-- E--------- -T-----Y-- ---------- --N--R---- ---------- TAIW-P -----N---- ---------- ---------- L--------- ---------- ---------- ----V--K-- G--------L ---------- -----N--GK -----R---- ---------- TAIW-W -----N---- ---------- ---------- L--------- ---------- ---------- ----V--K-- E--------L ---------- -----N--GK -----R---- ---------- THAI-W -----N---- ---------- ---------- L--------R ---------- ---------- -------K-- E------I-- ---------- ---------- -----R-V-- ---------- THAI-P -----N---- ---------- ---------- L--------- ---------- ---------- -------K-- E--------- ---------- -----N---K ---N-R---- ----------
P1 120
240
360
480
KITC conserved motif for aphid transmission
▼ Cysteine cluster/ zinc finger
▼ ▼ ▼ 600
720
HC-Pro
▼ ▼
■ conserved amino acids involved in protease activity
106
AUS-W AGSVESFRNK RSGKAHFNPA LTCDNQLDKN GNFLWGERQY HAKRFFANYF EKIDHSKGYE YYSQRQNPNG IRKIAIGNLV FSTNLERFRQ QMVEHHIDQG PITRECIALR NNNYVHVCSC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- --I------- ---------- HAW-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- TAIW-P ---------- ---------- --------R- ---------- ---------- ---------- ---------- ---V-----I ---------- ---------- ---------- ---------- TAIW-W ---------- ---------- --------R- ---------- ---------- ---------- ---------- ---V-----I ---------- -----Y---- ---------- ---------- THAI-W ---------- ---------- --------R- ---------- ---------- ---------- ---------- ---------I ---------- ---------- ---------- ---------- THAI-P ---------- ---------- --------R- ---------- ---------- ---------- --C------- ---------I ---------- ---------- ---------- ---------- AUS-W VTLDDGTPAT SELKTPTKNH IVLGNSGDPK YVDLPTLESD SMYIAKKGYC YMNIFLAMLI NIPENEAKDF TKRVRDLVGS KLGEWPTMLD VATCANQLII FHPDAANAEL PRILVDHRQK AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- P--------- ---------- ---------- ---------- ---------- HAW-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- --------VV ---------- -Q-------- TAIW-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- TAIW-W ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- THAI-W ---------- ---------- ---------- ---------- ------R--- ---------- ---------- ---------- ---------- --------V- ---------- ---------- THAI-P ---------- ---------- ---------- ---------- ------R--- ---------- ---------- ---------- ---------- ---------- ---------- ---------- AUS-W TMHVIDSFGS VDSGYHVLKA NTVNQLIQFA REPLDSEMKH YIVGGEFDPT TNCLHQLIRV IYKPHELRNL LRNEPYLIVI ALMSPSVLLT LFNSGAIEHA LNYWIKRDQD VVEVIILVEQ AUS-P ---------- ------I--- ---------- -D-------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -----V---- HAW-P ---------- ------I--- ---------- -D-------- ---------- ---------- --------S- ---------- ---------- ------V--- ---------- -----V---- TAIW-P ---------- ------I--- ---------- ---------- ---------- -S-------- ---------- ---------- ---------- ---------- ---------- -----V---- TAIW-W ---------- ------I--- ---------- ---------- ---------- -S-------- ---------- ---------- ---------- ---------- ---------- -----V---- THAI-W ---------- ------I-N- ---------- ---------- ---------- -S-------- ---------- -------V-- ---------- ---------- ---------- -----V---- THAI-P ---------- ------I--- ---------- ---------- ---------- -S-------- ---------- ---------- ---------- ---------- -S-------- -----V---- AUS-W LCRKVTLART ILEQFNEIRQ NARDIHELMD RNNKPWISYD RSLELLSVYA NSQLTDEGLF KQGFSTLDPK LREAVEKTYA TLLKEEWRAL SLFQKLHLRY FAFKSQPSFS EYLKPKGRAD AUS-P ---------- ---------- ---------- ---------- ---------- ---------L ---------- ---------- ---Q------ ---------- ---------- ---------- HAW-P ---------- ---------- ----L----- ---------- ---------- ---------L ---------R ---------- ---Q------ ---------- ---------- ---------- TAIW-P ---------- ---------- ---------- ---------- ---------- ---------L ---------R ---------- A--Q------ ---------- ---------- ---------- TAIW-W ---------- ---------- ---------- ---------- ---------- ---------L ---------R ---------- A--Q------ ---------- ---------- ---------- THAI-W ---------I ---------- ---------- ---------- ---------- ---------L ---------R ---------- A--Q------ ---------- ---------- ---------- THAI-P ---------- ---------- ---------- ---------- ---------- ---------L ---------R ---------- V--Q------ ---------- ---------- -------C-- AUS-W LKIVYDFSPK YCVHEVGKAL LQPVKAGAEF TSRIINGCGT FIRKSAARGC AYIFKDLFQF VHVVLVLSIL LQIFRSVQGI ATEHIQLKQA KAEMEKQEDF DRLEALYAEL CVKIGEQPTA AUS-P ---------- ---------- ---------- ------S--- -V-------- ----R----- ---------- -----N---- V--------- -------K-- N--------- -I-------- HAW-P ---------- ---------F -L------KI A--------A -------K-- ---------- ---------- ------A--- ----L----- ---V-R-K-- ---------- ---S-----T TAIW-P ---------- --------T- ---I----KI --HL------ -----V---- ---------- ---------- ------A--- ---------- ---V---R-- ---------- ---S-----F TAIW-W --VA------ --------T- ---I-V--KI ---L------ ---------- ---------- ---------- ------A--- ---------- ---V---K-- ---------- ---S-----V THAI-W ---------- ---------- ---I-----I ---LL----- ---------- ---------- ---------- ------A--- -M-------- ---A---K-Y ---------- ---N-D---T THAI-P ---------- ---------- -R-IE---KI ---FMS---- ---R------ ---------- ---------- ------A--- ---------- ---V-R-K-- ---------- ---G------ AUS-W EEFLDFVMER EPRLKDQAYS LIHIPVIHQA KSDNEKKLEQ VIAFITLILM MVDVDKSDCV YRILNKFKGV INSCNTNVYH QSLDDIKDFY EDKQLTIDFD ITGENQINRG PIDVTFEKWW AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- HAW-P ---------- ---------N --Y------- ---------- ---------- -I-------- ---------- ---S------ ------R--- ---------- ---------- ---------- TAIW-P ---------- -------V-- ---------- ---------- ---------- -I-------- ---------- -K---SD--- ------R--- ---------- ---------- -V-------- TAIW-W ---------- -------V-- ---------- ---------- ---------- -I-------- ---------- ---------- ------R--- ---------- ---------- ---------- THAI-W ---------- ---------- ---------- ---------- ---------- -I-------- ---------- ---------- ------R--- ---------- ---------- ---------- THAI-P ---I------ ---------- ---------- ---------- ---------- -I-------- ---------- -K--D----- ------R--- ---------- ---------- ----------
840
960*** ***** conserved amino acids involved in protease activity
P3
*1080
Mlu1 ▼
1200
1320
CI 1440 6K1
107
AUS-W DNQLSNNNTV GHYRIGGMFV EFSRSNAATV ASEIAHSPER EFLVRGAVGS GKSTNLPFLL SKHGSVLLIE PTRPLCENVC KQLRGDPFHC NPTIRMRGLT AFGSTNITIM TSGFALHYYA AUS-P ---------- -------T-I -----T---- ---------- ---------- ---------- ---S------ ---------- ---------- ---------- ---------- ---------- HAW-P ---------I -------T-- ----V----- ---------- ---------- ---------- ---------- ---------- -----E---- ---------- ---------- ---------- TAIW-P ---------I -------T-- ---------- ---------- ---------- ---------- ----N----- ---------- ----SE---- ---------- --D------- ---------- TAIW-W ---------I -------T-- ---------- ---------- ---------- ---------- ----N----- ---------- -----E---- ---------- ---------- ---------- THAI-W ---------I -------T-- ---------- ---------- ---------- ---------- ---------- ---------- -----E---- ---------- ---------- ---------- THAI-P ---------I -------A-- ----V----- --------D- ---------- ---------- ----N----- ---------- -----E---- ---------- ---------- ---------- AUS-W HNIQQLRLFD FIIFDECHVI DSQAMAFYCL MEGNAVEKKI LKVSATPPGR EVEFSTQFPT KIVTEQSISF KQLVDNFGTG ANSDVTAFAD NILVYVASYN EVDQLSKLLS DKGYLVTKID AUS-P ---------- ---------- ---------- -----I---- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- HAW-P ---------- ---------- ---------- -----I---- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- TAIW-P ---------- ---------- ---------- -----I---- ---------- ---------- ---------- ---------- ---------- -V-------- ---------- ---------- TAIW-W ---P------ ---------- ---------- -----I---- ---------- -------Y-- ---------- ---------- ---------- ---------- ---------- ---------- THAI-W --L------- ---------- ---------- -----I---V ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- THAI-P --L------- ---------- ---------- -----I---V ---------- ---------I R--------- ---------- ------I--- ---------- ---------- ---------- AUS-W GRTMKVGKTE ISTSGTKSKK HFIVATNIIE NGVTLDIEAV IDFGMKVVPE MDSDNRMIRY SKQAISFGER IQRLGRVGRH KEGIALRIGH TEKGIQEIPE MAATEAAFLS FTYGLPVMTH AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- HAW-P ---------- -------F-- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- TAIW-P ---------- ---------- ---------- ---------- ---------- ---------- ----V----- ---------- ---------- ---------- ---------- ---------- TAIW-W ---------- -----M---- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- THAI-W ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- THAI-P -------R-- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- AUS-W NVGLSLLKNC TVRQARTMQQ YELSPFFTQN LVNFDGTVHP KIDVLLRPYK LRDCEIRLSE AAIPHGVQSI WMSAREYEAV GSRLCLEGDV RIPFLIKDVP ERLYKELWDI VQTYKRDFTF AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -G-------- ---------- ---------- ---------- HAW-P ---------- ---------- ---------- ---------- ---------- -----V---- ---------- -L---D---- -G-------- ---------- ---------- ---------- TAIW-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -G-----S-- ---------- ----R----- ---------- TAIW-W ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -G-----S-- ---------- ----R----- ---------- THAI-W ---------- ---------- ---------- ---------- ---------- -----V---- ---------- ---------- -G-------- ---------- ---------- ---------- THAI-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -G-------- ---------- ---------- -------Y-- AUS-W GRINSVSAGK IAYTLRTDVY SIPRTLITID KLIESENMKH AHFKAMTSCT GLNSSFSLLG IINTIQSRYL VDHSVENIRK LQLAKAQIQQ LEAHVQENNV ENLIQSLGAV RAVYHQGVDG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ------S--- HAW-P ---------- ---------- ---------- ---------- ---------- ---------- V--------- ---------- ---------- ----M----- ---------- ------S--- TAIW-P ---------- ---------- ---------- ---------- ---------- ---------- V--------- ---------- ---------- ---------- ---------I ---------- TAIW-W ---------- ---------- ---------- ---------- ---------- ---------- V--------- ---------- ---------- ---------- ---------- ------S--- THAI-W ---------- ---------- ---------- ---------- ---------- ---------- V--------- ---------- ---------- ---------- ---------- G-----S--- THAI-P ---------- ---------- ---------- ---------- ---------- ---------- V--------- ---------- ---------- ---------- ---------- ------S--- AUS-W VKHIKRELGL KGIWDGSLMI KDAIICGFTM VGGAMLLYQH FRDKLINVHV FHQGFSARQR QKLRFKSAAN AKLGREVYGD DGTIEHYFGE AYTKKGNKKG KMHGMGVKTR KFVATYGFKP AUS-P ---------- --L------- ---------- A--------- -----T---- ---------- ---------- ---------- ---------- ---------- ---------- ---------- HAW-P F--------- --V------- ----V----- A--------- ----FT---- ---------- ---------- ---------- ---------- ---------- ---------- ---------- TAIW-P ---------- --V------- ---LV----- A--------- -----TS--- ---------- ---------- ---------- ---------- ---------- ---------- ---------- TAIW-W ---------- --V------- ---L------ A--------- -----T--Y- ---------- ---------- ---------- ---------- ---------- ---------- ---------- THAI-W ---------- --V------- ----V----- A--------- -----T-I-- ---------- ---------- ---------- ---------- ---------- R--------- ---------- THAI-P I--------- --V------- ----V----- A--------- -----T---- ---------- -----R---- ------I--- ---------- ---------- R--------- ----------
***** **** 1560
**** conserved nucleotide binding motif
1680
1800
1920
6K22040
NIa ▼
▼ forms covalent bond with viral RNA
2160 Nsi1 ▼
108
AUS-W EDYSYVRYLD PLTGETLDES PQTDISMVQE HFGDIRSKYM DSDSFDKQAL IANNTIKAYY VRNSAKTALE VDLTPHNPLK VCDNKLTIAG FPDREAELRQ TGPPRTIQFD QVPPPSKSVH AUS-P ---------- ---------- ---------- ---------- --------V- ---------- ---------- ---------- ---------- ---------- --------V- ---------- HAW-P ---------- ---------- ---------D --S---R--- ------R--- ---------- ------A--- ---------- ---------- ---------- --------V- ---------- TAIW-P ---------- ---------N ---------- ------N--- E-----R-S- ----V----- ---------- ---------- ---T------ ---------- ----K--LV- -----T---- TAIW-W ---------- ---------- ---------- ------N--- E-----R-S- ----V----- I--------- ---------- ---T------ ---------- ----K--LA- -----T---- THAI-W ---------- ---------- ---------- ------N--- G-----R--- ----V----- ---------- ---------- ---T------ ---------- -------LA- -----T---- THAI-P ---------- ---------- ---------- ------N--- E-----R-S- ----V----- ---------- ---------- ---------- -----S---- -------LAN -----T---- AUS-W HEGKSLCQGM RNYNGIASVV CHLKNTSGDG RSLFGIGYNS FIITNRHLFK ENNGELIVQS QHGKFVVKNT TTLRIAPVGK TDLLIIRMPK DFPPFHSRAR FRAMKAGDKV CMIGVDYQDN AUS-P ---------- ---------- ---------- K--------- ---------- K--------- ---------- ---------- ---------- ---------- ---------- ---------- HAW-P ---------- ---------- --------K- K--------- ---------- --------K- -----I---- ---Q------ ---------- ---------- ---------- --------E- TAIW-P ---------- ---------- --------K- -----V---- ---------- --------K- ---------- ----L----- ---------- ---------- ---------- --------E- TAIW-W ---------- ---------- ---------- -----V---- ---------- --------K- ---------- A---L----- ---------N ---------K ---------- --------E- THAI-W ---------- ---------- ---------- -----V---- ---------- --------K- ---------- S------I-- ---------- ----S----- --T------- --------E- THAI-P ---------- ---------- --------K- -----V---- ---------- --------K- ---------- ---------- ---------- ---------- ---------- --------E- AUS-W HIASKVSETS IISEGTGEFG CHWISTNDGD CGNPLVSVSD GFIVGLHSLS TSTGDQNFFA KIPAQFEEKV LRKIDDLTWS KHWSYNVNEL SWGALKVWES RPEAIFNAQK EVNQLNVFEQ AUS-P ---------- -----M---- ---------- ---------- ---------- ---------- --------NI ---------- ---------- ---------- ---------- ---R------ HAW-P ---------- -------D-- ---------- ---------- ---------- ---------- ---------- ---------- ------I--- ---------- ---------- ---------- TAIW-P ---------- -----M---- S--------- ---------- -Y-------- ---------- ----F----- --R------- ------I--- ---------- ---------- -I-------- TAIW-W ---------- ---------- ---------- ---------- -Y-------- ---------- ----F----- --R------- ---------- ---------- ---------- -I-------- THAI-W ---------- ---------- ---------- ---------- ---------- ---------- ----F----- --R------- ---------- ---------- ---------- -ID------- THAI-P ---------- ---D-S---- ---------- ---------- ---------- ---------- ----L----I --Q------- ------I--- ---------- ---------- -ID------- AUS-W SGSRWLFDKL HGNLKGVSSA SSNLVTKHVV KGICPLFRNY LECNEEAKVF FIPLMGHYMK SVLSKEAYTK DLLKYSSDIV VGEVNHDVFE DSVAQVIELL NDYECPELEY ITDSEVIIQA AUS-P ---H------ ---------- ---------- ---------- ---D------ -N-------- --------I- ---------- ---------- ------V--- --H------- ---------- HAW-P --G------- ---------- P--------- ---------- ---D----A- -S-------- --------I- ---------- ---------- ---------- --H------- ---------- TAIW-P ---------- ---------- ---------- --------S- --------T- -N-------- --------V- --M------I ----D----- E-----V--- --H------- ---------- TAIW-W ---------- ---------- ---------- ---------- --------T- -S-------- --------V- ---------I ----D----- E-----V--- --H------- ---------- THAI-W ---------- ---------- P--------- --V-----S- ---D----A- -S-------- --------V- ---------I ----D----- ---------- --H------- V--------- THAI-P ---------- --S---I--- ---------- ---------- ---D----A- -S-------- --------V- ---------I ----D----- E-----V--- --H------- ---------- AUS-W LNMDAAVGAL YTGKKRKYFE GSTVEHRQAL VRKSCERLYE GKMGVWNGSL KAELRPAEKV LAKKTRSFTA APLDTLLGAK VCVDDFNNWF YSKNMECPWT VGMTKFYKGW DEFLRKFPDG AUS-P -------V-- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- HAW-P ---------- ---------- ---------- ---------- -R-------- ---------- ---------- ---------- ---------- ---------- ---------- ----K----- TAIW-P ---------- ---------- ---------- ---------G -Q-------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- TAIW-W ---------- -K-------- -------HT- ---------- -R-------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- THAI-W ---------- ---------- ---------- ---------- -R-------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- THAI-P ---------- ---------- ----D----- ---------- -R--I----- ---------- ---------- ---------- ---------- ---------- ---------- ---------- AUS-W WVYCDADGSQ FDSSLTPYLL NAVLSIRLWA MEDWDIGEQM LKNLYGEITY TPILTPDGTI VKKFKGNNSG QPSTVVDNTL MVLITMYYAL RKAGYDTKAQ EDMCVFYING DDLCTAIHPD AUS-P ---------- -----I---- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ------A-T- K--------- ----I----- HAW-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- --------T- ---------- ----I----- TAIW-P ---------- ---------- ---------- -------S-- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ----I----- TAIW-W ---------- ---------- ---------- -------A-- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ----I----N THAI-W ----G----- ---------- ---------- -------A-- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ----I----- THAI-P ---------- ---------- ---------- -------A-- ---------- ---------- ---------- ---------- ---------- -------E-- KEL------- ----I-----
2280
# #
### (HDC) catalytic triad of protease domain
2400 protease VPg
# 2520
2640 NIb
2760
******* ***** ********* *** ** ******* consensus involved in RNA polymerase function
2880
109
AUS-W HEHVLDSFSS SFAELGLKYD FTQRHRNKQD LWFMSHRGIL IDDIYIPKLE PERIVAILEW DKSKLPEHRL EAITAAMIES WGYGELTQQI RRFYQWVLEQ APFNELAKQG RAPYVSEVGL AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -------H-- ---------- ---------- ---------- HAW-P ---------- ---------- -A-------N ---------- ---------- ---------- ---------- ---------- ----D--H-- ---------- ---------- ---------- TAIW-P ---------- ---------- -N-------- ---------- ---------- ---------- ---------- ---------- ---E---H-- ---------- ---------- ---------- TAIW-W ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---E---H-- ---------- --Y------- ---------- THAI-W ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -------H-- ---------- ---------- ---------- THAI-P -----V---- ---------- ---------- ---------- -G-T------ ---------- ---------- ---------- -------H-- ---------- ---------- ---------- AUS-W RRLYTSERGS MDELEAYIDK YFERERGDSP ELLVYHESRS VDDYQLVCSN NTHVFHQSKN EAVDAGLNEK LKEKE..KQK EKEKEKQKEK EKDDASDGND VSTSTKTGER DRDVNVGTSG AUS-P ------K--- ---------- ---------- ---------- A--------- ---------- ---------- -R-------- ---------- ---------- ---------- ---------- HAW-P ---------- ---------- ---------- ---------G T--------- ---------- ---------- ---------- ---------- ---G------ ---------- ---------- TAIW-P ------K--- ---------- ---------- ---------- T-NH--TRGS ---------- ----T----- ---------- ----D--QD- DN-G------ ---------- -----A---- TAIW-W ---S------ ---------- ---------- ---------- A--H--A-GS ---------- ---------- -----KE--- ----DE--D- DN-G------ ---------- -----A---- THAI-W ---------- ---------- ---------- ---------- T-------GE S--------- ---------- F--------- -.--D---D- NN-G------ ---------- -----A---- THAI-P ---------- -----V---- ---------- D--------- A--HHF--G- D--------- ---------- ---------R -.--D---G- DNNG------ ---------- -----A---- AUS-W TFTVPRIKSF TDKMILPRIK GKTVLNLNHL LQYNPQQIDI SNTRATQSQF EKWYEGVRNG YGLNDNEMQV MLNGLMVWCI ENGTSPDVSG VWVMMDGETQ VDYPIKPLIE HATPTFRQIM AUS-P ---------- ---------- --P------- ---------- ---------- ---------D ---------- ---------- -------I-- ---------- ---------- ----S----- HAW-P ---------- ----V----- ---------- ---------- ------H--- ---------D ---------- ---------- -------I-- ---------- ---------- ----S----- TAIW-P ---------- ---------- ---------- -----K-V-- ---------- ---------D ---------- ---------- -------I-- ---------- ---------- ----S----- TAIW-W ---------- ---------- ---------- ---------- ---------- --------DD ---------- ---------- -------I-- --------N- ---------- ----S----- THAI-W ---------- ---------- ---------- ---------- ---------- ---------D ---------- ---------- -------I-- ---------- ---------- ----S----- THAI-P ---------- -------K-- ---------- ---------- ---------- ---------D ---------L ---------- -------I-- ---------- AE-------- ----S----- AUS-W VHFSNAAEAY IAKRNATERY MPRYGIKRNL TDISLARYAF DFYEVNSKTP DRAREAHMQM KAAALRNTSR RMFGMDGSVS NKEENTERHT VGDVNRDMHS LLGMRN AUS-P A--------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -E-------- ------ HAW-P A--------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -E-------- ------ TAIW-P A--------- --------K- ---------- ---------- ---------- ---------- --------N- K--------- ---------- -E-------- ------ TAIW-W A--------- ---------- ---------- ---------- ---------- ---------- --------N- ---------- ---------- -E-------- ------ THAI-W A--------- ---------- ---------- ---------- ---------- ---------- --------G- ---------- ---------- -E---K---- ------ THAI-P A--------- ---------- ---------- ---------- ---------- ---------- -------A-- ---------- ---------- -E-------- ------
Figure 4.5. Alignment of the complete polyprotein of Australian isolates of PRSV-W (AUS-W) and PRSV-P (AUS-P) with
PRSV-P isolates from Hawaii (HAW-P), Taiwan (TAIW-P) and Thailand (THAI-P) and PRSV-W isolates from Taiwan
(TAIW-W) and Thailand (THAI-W). The start of each protein, based on the predicted protease cleavage site, is indicated
with arrows above the alignment. Previously described conserved regions (Yeh et al., 1992) are indicated on the right hand
side.
* 3000
CP (1) CP (2) 3120
3240
3344
x x x xxx DAG Motif involved in aphid transmission
110
4.3.2 Comparison of Australian isolates to other full-length PRSV sequences
The nucleotide and amino acid sequence of the genomes of the two
Australian isolates, AUS-P and AUS-W, were compared to the genome
sequences of PRSV-P isolates from Hawaii (HAW-P), Taiwan (TAIW-P) and
Thailand (THAI-P) and PRSV-W isolates from Taiwan (TAIW-W) and
Thailand (THAI-W) and the divergence calculated for the whole genome
(Table 4.2). The greatest divergence over the whole genome was between
the Australian and Thai PRSV-P isolates (20% nucleotide, 10.3% amino
acid). Variability was associated with geographical origin rather than host
range since AUS-P and AUS-W isolates were closer to each other than to
any of the other isolates and most divergent from the Asian P and W
isolates. Taiwanese P and W isolates were also very close (3% nucleotide,
5.5% amino acid). This very close relationship was not seen with the Thai P
and W isolates which were 12.9% divergent at the nucleotide level. When
phylogenetic trees were generated from the complete genome sequences
(Fig.4.6A.B), the Australian isolates clustered together closely, as did the
Taiwanese isolates. Although more distant, the Thai isolates did diverge from
the same node in the amino acid tree (Fig.4.6B). The Asian isolates were
more closely related to each other and as has previously been demonstrated
in the coat protein, the Hawaiian isolate clustered closely with the Australian
isolates. With the exception of the relationship between the Thai isolates at
the amino acid level, all relationships were supported by high bootstrap
values.
When all isolates were compared to the Australian PRSV-W isolate (Table
4.3), the greatest divergence was seen in the 5’UTR, with maximum
divergence between Taiwanese and Australian isolates (50.7%). In contrast,
the 3’UTR sequences were highly conserved with a maximum of only 6%
divergence (Table 4.3). Interestingly, highest divergence in the 3’UTR was
111
Figure 4.6. Nucleotide (A) and amino acid (B) sequence divergence of full-
length PRSV genomes presented as unrooted phylogenetic trees. The
number of bootstrap trees (/1000) in which particular nodes were found is
shown.
10%
THAI-W
THAI-P
TAIW-W
TAIW -P 10001000
HAW -PAUS-W
AUS-P 1000
1000
1%
THAI-W
THAI-P
447
TAIW-P
TAIW-W
1000
HAW-P
AUS-W
AUS-P
1000
1000
A.
B.
112
TABLE 4.3. Percent divergence between coding regions and corresponding proteins of PRSV isolates compared to AUS-W.
5’UTR P1 HC-Pro
P3 6K1 CI 6K2 VPg NIa-Pro NIb CP 3’UTR
nt 0 3.4 1.8 2.3 0.6 1.7 2.4 2.0 2.0 2.6 2.3 0 AUST-P aa - 5.1 1.5 3.3 0 0.9 7.2 1.1 2.6 2.8 2.6 -
nt 8.9 11.7 7.0 6.2 9.0 7.3 6.1 6.5 6.8 7.5 4.2 6.0 HAW-P
aa - 15.4 3.1 7.0 4.0 2.1 13.2 3.2 3.4 3.0 3.3 -
nt 48.5 37.8 15.7 15.0 12.1 14.9 16.1 22.8 18.5 18.1 11.5 5.0 TAIW-W
aa - 41.5 4.0 6.0 1.9 2.1 11.2 6.0 4.8 3.8 6.8 -
nt 50.7 38.5 15.5 14.6 15.2 14.6 13.8 21.3 18.8 18.9 12.9 3.9 TAIW-P
aa - 41.5 3.6 5.7 8.1 2.6 11.2 6.0 5.2 3.6 8.6 -
nt 39.5 37.5 16.4 15.6 11.2 14.4 13.7 19.8 19.0 18.4 11.0 2.9 THAI-W
aa - 42.5 3.4 6.0 1.9 1.8 11.2 4.9 4.8 3.2 6.1 -
nt 48.1 38.8 15.3 16.4 14.5 16.2 16.1 18.9 19.6 20.0 12.8 2.9 THAI-P
aa - 40.6 3.1 7.0 6.0 2.7 11.2 7.2 5.2 5.2 8.3 -
113
seen in the Hawaiian isolate, which is closest to the Australian isolate in all
other genome regions.
In the coding regions the Asian isolates were most divergent from AUS-W
and for most of the coding regions, variability at the nucleotide level was not
observed in the corresponding amino acid sequences, reflecting functional
constraints on these proteins. The two exceptions to this were the P1 and
6K2 coding regions (Table 4.3). Nucleotide sequence variation in the P1
(compared to AUS-W) was as high as 38.8% (THAI-P/AUS-W) while amino
acid variation was up to 42.5% (THAI-W/AUS-W) indicating a significant
number of nucleotide changes resulted in amino acid changes. This was also
seen in the smaller 6K2. Interestingly the greatest ratio of nucleotide to amino
acid changes in the 6K2 was seen in the Australian and Hawaiian isolates,
those that were phylogenetically closest to the AUS-W.
The most highly conserved coding region was the CI (0.9-2.7% amino acid
divergence) (Table 4.3) and then the order from most to least conserved was
CI < HC-Pro < NIa-pro/NIb < VPg < CP < P3 < 6K1 < 6K2 < P1. 4.3.4 Search for putative host range determinants
The close relationship between the Australian P and W isolate over the whole
genome compared to other isolates is consistent with the theory that PRSV-P
arose from PRSV-W in Australia. Based on studies with other potyviruses
and the high level of similarity between the Australian isolates it is likely that
host range is determined by one or more amino acid changes. Therefore, all
sites in the aligned polyproteins where Australian PRSV-P and -W isolates
differed (Fig. 4.5) were scanned to identify amino acid variation that could
potentially be linked to the ability of PRSV-P to infect papaya. There were a
total of 84 amino acid differences between AUS-P and W spread over the
whole polyprotein (with the exception of the 6K1), however, no site/s were
found where there was a specific amino acid occurring in all P isolates but
not W. This suggests that amino acids associated with host range may be
114
different between the different isolates. Sequences were then analysed to
look for any site where the W isolates were different from the P isolates, even
if the changes were not consistent. (i.e. any site where one P and W were the
same was eliminated). Again, no such site was identified. This suggests that
the actual site/s of mutation may be different between different geographical
pairs. Further experiments including recombination and mutagenesis will be
necessary to determine the site in the Australian isolates.
4.4 Discussion
In this study the genomes of Australian isolates of PRSV-P and -W were
sequenced. The very close relationship between these isolates supports the
theory that PRSV-P arose from PRSV-W (Bateson et al., 1994) although
comparison of these sequences with other full-length PRSV genomes could
not identify the host range determinant/s. The phylogenetic relationship
between Taiwanese and Thai PRSV-P and -W pairs also supports a similar
scenario, although the relationship between the Thai isolates is not as clear-
cut. There is considerable variation in PRSV in Thailand (Chaleeprom, 1997;
Bateson et al., 2002) and it is possible that these two particular isolates have
had considerable time to diverge.
As previously reported, both 5’ and 3’ UTRs were completely conserved in
the Australian isolates (Henderson, 1999; Bateson, 1995), as was the 6K1
protein, eliminating these as potential sites of HRDs. Interestingly, the 5’UTR
was the most variable region between isolates, although the first 23
nucleotides were completely conserved in all PRSV sequences as has
previously been reported for other potyviruses (Shukla et al., 1994). Although
the remaining 5’UTR sequence was highly variable, all isolates retained a
high number (7-10 copies) of the tripeptide repeat (CAA) in this region. The
presence of these repeats was previously noted in Hawaiian and Taiwanese
PRSV isolates (Wang and Yeh, 1997) and suggested to be involved in
efficiency of translation as reported for the omega sequence of TMV.
Variation between PRSV isolates in the 3’UTR was predominantly in the first
115
half of the region with the 3’ terminal half highly conserved in all sequences,
reflecting its putative involvement in specific replicase recognition for minus-
strand synthesis (Shukla et al., 1994).
Of the other coding regions, the CP, previously implicated in virus cell-to-cell
and systemic movement (Dolja et al., 1994; 1995; Lopez-Moya and Pirone,
1998), is unlikely to be a HRD for infectivity in papaya. Since the Australian
mutation appears to be relatively recent (Bateson et al., 1994; Bateson et al.,
2002), and is likely to have occurred only once, it would be expected to be
consistent, at least in Australian P isolates. However, previous studies of
variability in the CP of Australian P and W isolates (Bateson et al., 1994) do
not support this. Interestingly, the variability seen in the coat protein between
these two Australian isolates is slightly higher (2.3% nucleotide, 2.6% amino
acid) than previously reported for Australian isolates (<2%) (Bateson et al.,
1994). Both isolates used in this (and a previous) study were field isolates
and so some natural variation would be expected. As well, the PRSV-P
isolate was collected from the same site as the original PRSV BD isolate
although almost 5 years later. Therefore, the increase in variation in the CP is
most likely natural variation over time.
Of the remaining coding regions, the HC-Pro, P3, CI, NIa (VPg and protease)
and NIb are all relatively conserved at the amino acid level, irrespective of
the variablility at the nucleotide level. There were multiple amino acid
differences between AUS-P and AUS-W in all of these regions, making
identification of putative determinants impossible without further studies. All
of these regions have previously been implicated in movement or
pathogenicity (reviewed in chapter 1) and could potentially be determinants
of host range. Interestingly, the P1 and 6K2 had a high ratio of nucleotide to
amino acid changes. Unlike other coding regions, the P1 and 6K2 regions did
not appear to be restricted by functional constraints. With the exception of
the C-terminal protease activity of the P1, the function of these coding
regions is not well defined. There is no definitive evidence that the P1 is a
host range determinant. Interestingly, although the P1 is highly variable at the
amino acid level there are several blocks of conserved amino acids e.g.
116
amino acids 111-120 are totally conserved in all isolates while in other
conserved blocks amino acid substitutions are conservative. Blocks of
conserved amino acids are also seen in the P1 of other potyviruses such as
Yam mosaic virus (YMV) (Aleman-Verdaguer et al., 1997). The significance
of this is not known. The 6K2 peptide has been implicated in genome
amplification and anchoring of the replication apparatus to ER-like
membranes (these proteins are reviewed in chapter 1). The 6K2 has been
implicated in pathogenicity in PVA (Rajamaki and Valkonen, 1999).
It was interesting to note that the ratio of nucleotide to amino acid changes
(not given) for each coding region was consistently higher in AUS-P and
HAW-P and lower in Asian isolates. The AUS-P and HAW-P mutations are
thought to be relatively recent and this high ratio most likely reflects
continuing adaptation to the new host. This pattern of variation was not
consistent in the 6K1 region. Variation at the nucleotide level increased as
seen for other coding regions with AUS-P the least variable (0.6%), HAW-P
next (9.0%) and then Asian isolates (11.2-15.2%). However at the amino acid
level, with the exception of AUS-P, there was higher amino acid variation in
the P isolates (HAW-P 4%, TAIW-P 8.1%, THAI-P 6%) than the W isolates
(both TAIW-W and THAI-W 1.9%). The absence of differences between
AUS-W and AUS-P in this region eliminates it as a putative HRD, however, it
is possible that increased amino acid mutations in this region reflect
differences in adaptation to host. It has been found that after considerable
time in papaya, PRSV-P is no longer able to infect cucurbits. The Australian
P isolate, a recent mutation, can still be efficiently inoculated to both papaw
and cucurbits (Persley, 1997) and interestingly is very similar to the
Australian W isolate in the 6K1. The 6K1 protein has been implicated with
the P3 in pathogenicity in different hosts (Dallot et al., 2001; Johansen et al.,
2001; Saenz et al., 2001). Amino acid changes in PRSV-P might positively
influence interaction with a host factor in papaya or alternatively might
represent changes resulting from absence of selection as a result of no
interaction. High conservation in the W isolates suggests a potentially
important function in cucurbits. A survey of variation in the 6K1 of current
field isolates of PRSV-P and -W from Australia would be interesting.
117
In conclusion, sequence analysis alone is not sufficient to identify PRSV
HRDs for infection of papaya. In fact, it is possible that each mutation from
PRSV-W to PRSV-P in different geographic locations has involved a different
amino acid and possibly a different genome position, although it is still
possible that changes are occurring in the same general region.
118
CHAPTER 5 LOCALISATION OF PRSV-P AND PRSV-W HOST RANGE DETERMINANTS BY GENERATION OF RECOMBINANT HYBRID PRSV TRANSCRIPTS
5.1 INTRODUCTION
The determinants of plant viral pathogenesis and host range vary
considerably both within and between families and there are a number of
potential stages at which either the virus or the host may block systemic
infection causing these differences (Matthews, 1991). Current advances in
recombinant DNA technology have facilitated the manipulation of infectious
viral clones of many viruses, including potyviruses, using recombination and
mutagenesis to unravel the basis of virus pathogenicity and host range
(Revers et al., 1999; Nicolas et al., 1997; Schaad et al., 1997; Andersen and
Johansen, 1998; Saenz et al. 2000). As a result of this technology, over the
past 5 years, our knowledge of the molecular determinants of host range in
potyviruses has increased dramatically (reviewed in Chapter 1). However,
compared to other virus families the host range determinants and the genes
responsible for replication and movement in potyviruses are still poorly
understood
There is significant circumstantial evidence that PRSV-P arises by mutation
from PRSV-W, at least in Australia (Bateson et al., 1994; Bateson et al.,
2002). The similarity in the genome sequence of these biotypes suggests
that the ability of PRSV-P to infect papaya is the result of a change in one or
more amino acids within the PRSV-W genome (Chapter 4). However,
comparison of Australian isolates of PRSV-P and W with five other full-length
sequences failed to identify one consistent amino acid difference between
PRSV-P and -W that could be attributed to the ability to infect the different
hosts (Chapter 4). Therefore, to identify the molecular host range
determinants, they must first be localised to a particular region of the genome
using recombination of infectious clones and then specific amino acids
implicated by site-directed mutagenesis.
119
This chapter reports the generation of recombinant, hybrid PRSV P/ W
clones and localisation of the molecular host range determinants of PRSV-P
infection of papaya within the PRSV genome.
5.2 METHODS AND MATERIALS
5.2.1 Generation of recombinant PCR products of PRSV-P and PRSV-W
Five different recombinant full-length PCR products made by exchanging
genomic regions between the two Australian isolates of PRSV-P and PRSV-
W, were generated by OE-LD-PCR from recombinant clones p5’Triplet-W,
p5’Triplet-P, pMiddleTriplet-W, pMiddleTriplet-P, p3’Triplet-W, p3’Triplet-P,
pTwin-W and pTwin-P (generated in chapter 3).
5.2.2.1 Construction of pTwin-W+P and pTwin-P+W clones
In order to generate the recombinant PCR products, two additional
recombinant clones were constructed to use as templates in OE-LD-PCR.
Both pTwin-W+P and pTwin-P+W clones were constructed essentially as
previously described for pTwin-P and pTwin–W (section 4.2.7). Plasmid
pTwin-W+P and pTwin-P+W were generated by swapping the insert and
vector fragments from NsiI digested pTwin-W and NsiI digested pTwin-P
(Figure 5.1). Plasmids were screened by digestion with NsiI to confirm the
presence of the inserted fragment and sequenced analysis to confirm the
orientation and integrity of the recombinant clones.
120
Figure 5.1 Strategy for generation of pTwin-W+P from p3’Triplet-P
and pMiddle Triplet-W
7691 bp
NIa
NIb
CP
3’UTR 33A
35ST
p3’Triplet-P pMiddle Triplet-W 7544 bp
P3
CI
NIa 6
VPg
VPg
NsiI NsiI
NsiI
NsiI
NsiI digest & purify insert fragment
NsiI digest & purify vector fragment
insert vector
ligate
pTwin-W+P 10300 bp
P3
CI
6K
NIa
NIb
CP
3’UTR 33A
35ST
NsiI
NsiI VPg
121
5.2.2.2 Amplification of recombinant PCR products by OE-LD-PCR
The five recombinant hybrid full-length PCR products (Fig.5.2) were
generated using various combinations of clones as templates in OE-LD-PCR
(Table 5.1) as previously described for amplification of full-length infectious
PCR products of PRSV-P and PRSV-W (section 4.2.10).
Table 5.1 Summary of clones use to make recombinant infectious PCR
products of PRSV
Recombinant PCR
Product
3’ clone used in OE-LD-PCR
5’ clone used in OE-LD-
PCR
rhPRSV1 (WWP)a pTwin W+P p5'Triplet-W
rhPRSV2 (PWW) pTwin W p5'Triplet-P
rhPRSV3 (PPW) pTwin P+W p5'Triplet-P
rhPRSV4 (WPP) pTwin-P P5'Triplet-W
rhPRSV5 (PWP) pTwin W+P p5'Triplet-P asource of PRSV for 5’, middle, 3’ regions of recombinant product is shown in
brackets
5.2.3 Infectivity of recombinant PCR products The recombinant PCR products and controls (rPRSV-P and rPRSV-W) were
inoculated onto squash cotyledons by microprojectile bombardment (section
3.2.9.1-2) and subsequently onto squash as previously described for rPRSV-
W (section 3.2.9.3). Infectivity was assessed by symptom development,
ELISA and RT-PCR (section 3.2.9.3). Tissue from ELISA positive squash
plants for each rhPRSV and rPRSV-P and W was collected and the tissue
from similar lines pooled and stored at -80oC. This tissue was used to
inoculate papaya.
122
FIGURE 5.2 Recombinant hybrid PCR products of PRSV. Regions derived from PRSV-W are shown in green and
regions derived from PRSV-P are shown in yellow .
P3 CI NIa NIb CP
3’ UTR
33 35S A T P1 HC-Pro 35S 5'
UTR 6K rhPRSV2 (PWW)
P3 CI NIa NIb CP
3’ UTR
33 35S A T P1 HC-Pro
35S 5'
UTR rhPRSV3 (PPW) 6K
CI NIa NIb CP 33 35S A T P1 HC-Pro 5'
UTR 6K 35S rhPRSV4 (WPP) P3 3' UTR
CI NIa NIb CP 6K 33 35S A T P1 HC-Pro 35S
5’ UTR rhPRSV5 (PWP) P3 3'
UTR
rhPRSV1 (WWP) CI NIa NIb CP
3’UTR 33 35S A T P1 HC-Pro 5'
UTR 6K 35S P3
123
Papaya (8 replicates each) was inoculated with infected squash tissue (0.5g
randomly selected from pooled material) 3 times at weekly intervals.
Infectivity in papaya was assessed by symptom development, ELISA and
RT-PCR.
Integrity of the recombinants in vivo was confirmed by RT-PCR of part of the
P3 and NIa-coding regions that overlap the junctions used to generate
recombinant hybrids. RNA was extracted from infected squash and papaya
using a QIAGEN RNeasyR Plant Mini Kit (Roche Diagnostics). First strand
cDNAs were synthesised from extracted RNA using primers NIa-2 and P3M-
R as described in section 2.3.2 and used in a standard PCR reaction (section
2.3.3.2) with primers NIa-1/ NIa-2 or RLS-6/ P3M-R, respectively. PCR
products were gel purified and used directly for sequencing with either NIa-5
or P3S.
5.3 RESULTS 5.3.1 Generation of recombinant PRSV PCR products
As an initial approach to identify the region of the PRSV genome that
incorporated the mutation enabling PRSV-P to infect papaya, a series of
recombinant genomes was assembled that included different combinations
of PRSV-P and W 5’, middle and 3’ regions (Fig.5.1). The regions included
in recombinants were based on the three original clones generated
previously (chapter 3).
Initially, two new P/W hybrid constructs, pTwin-W+P and pTwin-P+W, were
generated, incorporating the middle one third of PRSV-W fused to the 3’ one
third of PRSV-P and the middle one third of PRSV-P fused to the 3’ one third
of PRSV-W, respectively. Plasmid pTwin-W+P was derived from ligation of
the NsiI fragment from pMiddle Triplet-W into the NsiI site of p3’Triplet-P.
The W fragment included bases that encode the P3, CI, 6K and N-terminal
124
49 amino acids of the VPg. This 49 amino acid region of the VPg is identical
between PRSV-P and -W. Similarly, to generate pTwin-P+W, the NsiI
fragment from pMiddle Triplet-P was inserted into p3’Triplet-W. Restriction
digestion with NsiI confirmed the presence and correct size of the insert in
each case. Sequencing across the junction between the two fragments within
the pTwin plasmids confirmed the correct orientation and origin of the PRSV-
P and PRSV-W fragments (Fig.5.3).
Subsequently, five different recombinant hybrid full-length PCR products
(rhPRSV1-5) (Fig.5.1) were generated by LD-OE-PCR. This was achieved
using either pTwin-P+W or pTwin-W+P, in combination with either p5’Triplet-
W or p5’Triplet-P. Since the region overlapping the PRSV-P and -W 5’ and
Twin clones was identical at the amino acid level, it was not necessary to
make a hybrid 5’ clone. Recombinant hybrid PCR products, each 11027 bp
in length were amplified (Fig.5.4).
5.3.2 Infectivity of hybrid PCR products in squash
The integrity of the recombinant hybrid PCR products (rhPRSV1-5) was
assayed initially in squash as all hybrids were expected to be able to infect
squash. Infectivity was initially assessed by ELISA in bombarded squash
cotyledons at 10 days post-bombardment (Tables 5.2 - 5.6). The control
rPRSV-W consistently gave ELISA values of >1.3 in bombarded cotyledons.
Infectivity of cotyledons following bombardment with recombinant hybrid
PRSVs 1-5 was very efficient with 86%, 86%, 94%, 86%, and 93% of
cotyledons, respectively, giving ELISA values >1.3.
Cotyledons were subsequently used to inoculate squash plants and were
assessed for infection at 15 dpi by ELISA and the presence of typical PRSV
symptoms (Tables 5.2 - 5.6).
125
Figure 5.3 Restriction analysis of pTwin-P+W. Lane1: Uncut plasmid; Lane2-4:
NsiI digested plasmid. M: Molecular weight marker X (Roche Diagnostics)
M 1 2 3 4
12216bp
3054bp
126
Figure 5.4 Agarose gel showing 11027bp PCR product representing full-
length recombinant hybrid PRSV amplified by OE-LD-PCR (Lane 1). M:
Molecular weight marker X (Roche Diagnostics).
M 1
11027bp 12216bp
3054bp
127
Table 5.2. Assessment of infectivity of recombinant hybrid PRSV PCR
product, rhPRSV1 (WWP), in squash. Cotyledons were assayed by ELISA
10 days post-bombardment (dpb) and inoculated onto squash plants.
Squash were assayed by ELISA and for symptoms at 15 dpi.
Cotyledons Squash
ELISAd ELISAa, d Symptomsb Sample 10 dpb 15 dpi 15 dpi
Unshot cotyledon 0.125 Buffer only 0.174 0.148 PRSV-W/squashc 1.432 1.382 Healthy squashc 0.182 0.155 rPRSV-W 1.365 1.372+0.05 ++++ Shot # 1 1.394 1.371+0.070 ++++ Shot # 2 1.426 1.296+0.19 -+++ Shot # 3 1.354 1.404+0.04 ++++ Shot # 4 0.218 0.197+0.04 ---- Shot # 5 0.290 0.192+0.02 ---- Shot # 6 1.396 1.389+0.04 ++++ Shot # 7 1.420 1.402+0.04 ++++ Shot # 8 1.368 1.114+0.56 +-++ Shot # 9 1.386 1.365+0.06 ++++ Shot # 10 1.409 1.404+0.02 ++++ Shot # 11 1.362 1.121+0.54 +-++ Shot # 12 1.294 0.215+0.04 ---- Shot # 13 1.428 1.406+0.03 ++++ Shot # 14 1.382 1.396+0.05 ++++ Shot # 15 1.396 1.357+0.07 ++++
a ELISA values are the average of results from 4 squash plants inoculated from infected cotyledons + standard deviation b typical symptoms observed (+) or no symptoms (-) for each of the 4 squash plants c ELISA control – frozen tissue dELISA values represent absorbance at 460nm
128
Table 5.3. Assessment of infectivity of recombinant hybrid PRSV
PCR product, rhPRSV2 (PWW), in squash. Cotyledons were assayed
by ELISA 10 days post-bombardment (dpb) and inoculated onto
squash plants. Squash were assayed by ELISA and for symptoms at
15 dpi.
Cotyledons Squash
ELISAd ELISAa, d Symptomsb Sample 10 dpb 15 dpi 15 dpi
Unshot cotyledon 0.185 Buffer only 0.115 0.143 PRSV-W/squashc 1.433 1.386 Healthy squashc 0.212 0.293 rPRSV-W 1.358 1.405+0.05 ++++ Shot # 1 1.465 1.393+0.03 ++++ Shot # 2 1.438 1.292+0.19 ++-+ Shot # 3 0.241 0.2455+0.07 ---- Shot # 4 1.378 1.413+0.02 ++++ Shot # 5 1.372 1.413+0.02 ++++ Shot # 6 1.437 1.377+0.06 ++++ Shot # 7 1.479 1.420+0.04 ++++ Shot # 8 1.388 1.373+0.04 ++++ Shot # 9 1.388 1.475+0.18 ++++ Shot # 10 1.422 1.411+0.03 ++++ Shot # 11 0.213 0.257+0.06 ---- Shot # 12 1.385 1.424+0.03 ++++ Shot # 13 1.394 1.338+0.07 ++++ Shot # 14 1.437 1.319+0.14 ++++ Shot # 15 1.382 1.39+0.06 ++++
a ELISA values are the average of results from 4 squash plants inoculated from infected cotyledons + standard deviation b typical symptoms observed (+) or not (-) for each of the 4 squash plants c ELISA control – frozen tissue dELISA values represent absorbance at 460nm
129
Table 5.4. Assessment of infectivity of recombinant hybrid PRSV PCR
product, rhPRSV3 (PPW), in squash. Cotyledons were assayed by ELISA 10
days post-bombardment (dpb) and inoculated onto squash plants. Squash
were assayed by ELISA and for symptoms at 15 dpi.
Cotyledons Squash
ELISAd ELISAa, d Symptomsb Sample 10 dpb 15 dpi 15 dpi
Unshot cotyledon 0.142 Buffer only 0.193 0.182 PRSV-W/squashc 1.432 1.378 Healthy squashc 0.202 0.193 rPRSV-W 1.458 1.131+0.6 ++-+ Shot # 1 1.389 1.417+0.03 ++++ Shot # 2 0.358 0.269+0.08 ---- Shot # 3 1.395 1.447+0.04 ++++ Shot # 4 1.363 1.387+0.06 ++++ Shot # 5 1.442 1.421+0.06 ++++ Shot # 6 1.386 0.238+0.03 ---- Shot # 7 1.379 1.425+0.07 ++++ Shot # 8 1.466 1.41+0.05 ++++ Shot # 9 1.439 1.417+0.05 ++++ Shot # 10 1.395 1.440+0.05 ++++ Shot # 11 1.379 1.361+0.06 ++++ Shot # 12 1.436 1.423+0.04 ++++ Shot # 13 1.373 1.394+0.04 ++++ Shot # 14 1.366 1.408+0.06 ++++ Shot # 15 1.495 1.459+0.06 ++++ Shot # 16 1.365 1.437+0.04 ++++
a ELISA values are the average of results from 4 squash plants inoculated from infected cotyledons + standard deviation b typical symptoms observed (+) or not (-) for each of the 4 squash plants c ELISA control – frozen tissue dELISA values represent absorbance at 460nm
130
Table 5.5. Assessment of infectivity of recombinant hybrid PRSV PCR
product, rhPRSV4 (WPP), in squash. Cotyledons were assayed by ELISA 10
days post-bombardment (dpb) and inoculated onto squash plants. Squash
were assayed by ELISA and for symptoms at 15 dpi.
Cotyledons Squash
ELISAd ELISAa, d Symptomsb Sample 10 dpb 15 dpi 15 dpi
Unshot cotyledon 0.109 Buffer only 0.192 0.138 PRSV-W/squashc 1.374 1.366 Healthy squashc 0.201 0.195 rPRSV-W 1.379 1.385+0.03 ++++ Shot # 1 1.426 1.386+0.03 ++++ Shot # 2 1.375 1.465+0.02 ++++ Shot # 3 1.373 1.395+0.05 ++++ Shot # 4 1.437 1.423+0.05 ++++ Shot # 5 1.427 1.421+0.06 ++++ Shot # 6 1.395 1.410+0.03 ++++ Shot # 7 1.379 1.434+0.04 ++++ Shot # 8 1.329 1.456+0.05 ++++ Shot # 9 1.452 1.385+0.04 ++++ Shot # 10 0.285 0.256+0.04 ---- Shot # 11 1.395 1.409+0.03 ++++ Shot # 12 1.369 1.390+0.06 ++++ Shot # 13 1.395 1.389+0.05 ++++ Shot # 14 0.352 0.231+0.05 ---- Shot # 15 1.427 1.407+0.03 ++++
a ELISA values are the average of results from 4 squash plants inoculated from infected cotyledons + standard deviation b typical symptoms observed (+) or not (-) for each of the 4 squash plants c ELISA control – frozen tissue dELISA values represent absorbance at 460nm
131
Table 5.6. Assessment of infectivity of recombinant hybrid PRSV PCR
product, rhPRSV5 (PWP), in squash. Cotyledons were assayed by ELISA 10
days post-bombardment (dpb) and inoculated onto squash plants. Squash
were assayed by ELISA and for symptoms at 15 dpi.
Cotyledons Squash
ELISAd ELISAa, d Symptomsb
Sample 10 dpb 15 dpi 15 dpi
Unshot cotyledon 0.167 Buffer only 0.103 0.095 PRSV-W/squashc 1.364 1.433 Healthy squashc 0.236 0.323 rPRSV-W 1.394 1.423+0.05 ++++ Shot # 1 1.357 1.452+0.03 ++++ Shot # 2 1.386 1.434+0.04 ++++ Shot # 3 1.432 1.334+0.13 +++- Shot # 4 1.428 1.203+0.46 ++-+ Shot # 5 1.385 0.205+0.05 ---- Shot # 6 1.390 1.382+0.06 ++++ Shot # 7 1.375 1.447+0.04 ++++ Shot # 8 1.428 1.414+0.05 ++++ Shot # 9 1.442 1.399+0.06 ++++ Shot # 10 1.394 1.405+0.04 ++++ Shot # 11 1.481 1.383+0.04 ++++ Shot # 12 1.453 1.409+0.03 ++++ Shot # 13 0.251 0.207+0.03 ---- Shot # 14 1.439 1.431+0.03 ++++ Shot # 15 1.390 1.299+0.05 ++-+
a ELISA values are the average of results from 4 squash plants inoculated from infected cotyledons + standard deviation b typical symptoms observed (+) or not (-) for each of the 4 squash plants c ELISA control – frozen tissue dELISA values represent absorbance at 460nm
132
All squash plants inoculated from cotyledons infected with the control
rPRSV-W, with the exception of one plant (see Table 5.4), gave average
ELISA values of >1.1 and showed strong symptoms including severe
mottling distortion and blistering. Of the recombinant hybrids, 45/60 plants of
rhPRSV1, 51/60 plants of rhPRSV2, 56/64 plants of rhPRSV3, 52/60 plants
of rhPRSV4 and 49/60 plants of rhPRSV5 showed typical symptoms of
PRSV infection at 15 dpi. Cotyledons that were negative by ELISA did not
produce symptoms or positive ELISA in squash. Only 4 cotyledons with high
ELISA values failed to produce symptoms or positive ELISA values on any of
the 4 plants inoculated with each cotyledon. Remaining cotyledons that had
positive ELISA values consistently showed symptoms on at least 3 out of 4
inoculated squash plants and had average ELISA values > 1.1 (Tables 5.2-
6). The presence of virus in ELISA positive squash was also confirmed by
RT-PCR using primers to amplify ~900 bp fragments from the P1 and CP-
coding regions (Fig.5.5).
5.3.3 Infectivity of recombinant hybrid PRSVs in papaya
To determine which region of the PRSV-P genome (5’, middle or 3’) was
sufficient to enable infectivity in papaya, squash plants infected with the five
rhPRSVs were inoculated onto papaya plants. Controls included squash
infected with PRSV-P, PRSV-W, rPRSV-P and rPRSV-W. For each rhPRSV,
8 papaya plants were inoculated 3 times each. Plants were assessed by
ELISA and for symptoms at 28 and 45 days after inoculation (Table 5.7). As
expected, no papaya plants inoculated with PRSV-W and rPRSV-W
developed symptoms and all had ELISA values equivalent to background
after 45 days. All papaya plants inoculated with native PRSV-P showed
symptoms that included mottling, distortion and blistering of the plants after
28 days and were positive by ELISA. Plants inoculated with rPRSV-P were
slower to develop symptoms. Only 50% showed some symptoms after 28
days although this increased to 87.5% (7/8 plants) by 45 dpi. However, virus
was detectable by ELISA in all 7 plants at 28 dpi.
133
Figure 5.5 RT-PCR amplification of the P1 and CP coding regions from
rhPRSVs in squash plants that were positive for PRSV by ELISA. Lane 1:
Healthy squash control; Lanes 2, 10: PRSV-W infected squash control; Lane
3: p5’Triplet-W plasmid control; Lanes 4, 12: rPRSV-W infected squash
control; Lanes 5-9: squash infected with rhPRSV1-5; Lane 11: pTwin-W
plasmid control; Lanes 13-17: squash infected with rhPRSV1-5. M: Molecular
weight marker X (Roche Diagnostics).
P1 coding region CP coding region
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 M
- 900bp
134
Table 5.7 Assessment of infectivity of rhPRSVs in papaya plants
mechanically inoculated with rhPRSV infected squash. All plants were
inoculated 3 times each at weekly intervals. Symptoms were assessed
at 28 and 45 dpi. Controls are shaded.
ELISAa,c Symptoms ELISAa,c Symptoms Sample 28 dpi 28 dpi 45 dpi 45 dpi
% Infected after 45 daysb
Buffer only 0.093 0.082
Healthy papaya 0.216 0.221
PRSV-W 0.208+0.02 -------- 0.206+0.03 -------- 0%
PRSV-P 1.426+0.04 ++++++++ 1.428+0.04 ++++++++ 100%
rPRSV-W 0.212+0.05 -------- 0.225+0.04 -------- 0%
rPRSV-P 1.198+0.37 ++---+-+ 1.258+0.40 ++++-+++ 87.5%
rhPRSV1 (WWP) 0.881+0.44 -----+-+ 1.056+0.50 -+-+-+++ 75%
rhPRSV2 (PWW) 0.23+0.05 -------- 0.238+0.05 -------- 0%
rhPRSV3 (PPW) 0.216+0.03 -------- 0.219+0.03 --------- 0%
rhPRSV4 (WPP) 1.107+0.43 ++----++ 1.266+0.40 +++++-++ 88%
rhPRSV5 (PWP) 0.96+0.5 -++----+ 1.109+0.60 +++-++-+ 75% a ELISA values are average of 8 plants + std deviation b % plants infected based on ELISA values at 45 dpi c ELISA values represent absorbance at 460nm
135
At least 75% of papaya inoculated with rhPRSV1 (WWP), rhPRSV4 (WPP)
and rhPRSV5 (PWP) developed typical PRSV-P symptoms by 45 dpi. All
plants with symptoms had positive ELISA values at both 28 dpi and 45 dpi
(Table 5.7). One plant inoculated with rhPRSV1 (WWP) was ELISA positive
at 28 and 45 dpi but was not recorded as showing symptoms after 45 days.
No papaya plants inoculated with rhPRSV2 (PWW) or rhPRSV3 (PPW) had
developed symptoms by 45 days or had ELISA values above background
(Table 5.7). The presence/absence of virus in plants infected with rhPRSV1-
5 was confirmed by RT-PCR of the P1 and CP-coding regions (Fig.5.6). PCR
products of ~900 bp were amplified from rhPRSV1, 4 and 5 but no products
were detected from plants inoculated with rhPRSV2 and 3. Based on these
results, it can be deduced that the host range determinant/s enabling PRSV
to infect papaya are located in the 3’ one third of the genome that includes
the NIa (VPg/ NIa-pro), NIb, or CP. 5.3.4 Confirmation of the integrity of rhPRSVs in vivo
To confirm that infection attributed to rhPRSVs, particularly in papaya, was
not a result of reversion to wild-type or contamination, RT-PCR was used to
generate PCR products that spanned both the NsiI site in the VPg and the
MluI site in the P3. These sites delineated the junction between PRSV-P and
PRSV-W sequences in the recombinants. The regions on both sides of the
junctions were sequenced and confirmed the presence of nucleotides/amino
acids definitive of PRSV-P or -W in recombinants.
136
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 M
P1 coding region CP coding region
Figure 5.6 RT-PCR analysis of P1 and CP coding regions of rhPRSVs in
inoculated papaya plants. Lane 1: Healthy papaya control; Lane 2, 10: PRSV-P
infected papaya control; Lane 3: p5’Triplet-P plasmid control; Lane 4, 12:
rPRSV-P infected papaya control, Lane 5-9: papaya inoculated with rhPRSV1-
5, Lane11: pTwin-P plasmid control, Lane 13-17: papaya inoculated with
rhPRSV1-5. M: Molecular weight marker X (Roche Diagnostics).
- 900bp
137
5.4 Discussion
In this study, the OE-LD-PCR system for generating infectious rPRSVs has
proven effective for development and testing of recombinant hybrids of
Australian PRSV-P and -W isolates and has targeted the PRSV HRDs to the
3’ region of the genome.
Five full-length recombinant hybrid PRSVs were generated by exchanging
regions of PRSV-P and –W genomes. The overlapping PCR strategy
facilitated the generation of these hybrids as only two new clones had to be
generated (pTwin-P+W and pTwin–W+P). It was important to ensure that the
region of overlap was completely conserved (at the amino acid level) when
generating recombinant hybrids otherwise the resulting PCR clones would be
a mixed population in the overlapping regions. The region of the P3 that
overlapped between the p5’Triplet clones and the pTwin clones was
conserved between Australian PRSV-P and -W isolates. All five recombinant
hybrids infected at least 86% of squash cotyledons and at least 75% were
successfully mechanically inoculated onto squash plants. Recombinants that
did not include the 3’ end of PRSV-P genome (rhPRSV2, 3) did not infect
papaya. Efficiency of infection of recombinant hybrids that were infectious in
papaya (rhPRSV1, 4, 5) was generally lower (75-88%) than wild type PRSV-
P (100%) after 45 days. However, the rPRSV-P control was also less
efficient than wild type i.e. at 45dpi 87.5% of papaya was infected. This was
clearer at 28dpi when all wild type inoculated plants were doubled in
symptoms but only 50% of those inoculated with rPRSV-P. This difference in
efficiency is not likely to be due to the inoculation method since all infections
were first established in squash and only ELISA positive squash were used
for inoculation. In initial studies (Chapter 3) the efficiency of infectivity of
rPRSV-P was 100% at 45dpi (with the exception of 3 plants from 2 shots)
although at 28dpi it ranged from 50-100%, again slower than wild type.
Although it was demonstrated that rPRSVs produced typical virions and
symptoms, it is possible that either the sequence cloned represents a less
efficient variant or the construct itself renders the virions less efficient. As
previously discussed in chapter 3 the composition of the 3’ end of the clone
138
can influence its infectivity. In these constructs, there is a short poly A tail (33
nucleotides) followed by a nos terminator. It is not known if extra nucleotides
will be present on the RNA transcript as a result of the terminator or if native
signals in the 3’UTR will generate a wild type transcript. Interestingly,
rhPRSV4 & 5, each containing approximately 70% of the PRSV-P genome
were slightly more efficient than rhPRSV1 with only 30% of the PRSV-P
genome. These experiments need to be repeated several times before any
significance can be attributed to this observation.
In this study, the NIa, NIb and CP coding regions and 3’ UTR were
implicated as sites that may endode PRSV HRDs for infectivity in papaya.
The 3’UTRs can be eliminated as they are identical between Australian
PRSV-P and -W isolates. In other potyviruses, the CP-coding region has
been implicated in virus cell-to-cell and systemic movement (Dolja et al.,
1994; 1995; Lopez-Moya and Pirone, 1998) (reviewed in chapter 1). A single
amino acid change in the CP was able to alter movement of two PSbMV
isolates in Chenopodium quinoa (Anderson and Johansen, 1998), although
this amino acid did not govern movement in all PSbMV isolates, suggesting
involvement of other regions/amino acids. In this case, the ability of different
isolates to infect a particular host appeared to relate to their ability to move in
the host. While it is clear that PRSV-W does not infect papaya systemically, it
is not known if it can replicate in papaya cells or move locally in inoculated
leaves. This could be investigated further in the future. It is unlikely,
however, that the CP-coding region is responsible for determining PRSV
host range in papaya. Earlier studies that compared the sequence of the CP-
coding region of 6 isolates of PRSV-P and -W from Australia (Bateson et al.,
1994) did not identify any amino acid changes that correlated with biotype.
As it is likely that the Australian P population only recently diverged and most
likely has only mutated once, we would expect the HRD to be consistent at
least in Australian isolates. As well, a study by Henderson (1999) determined
that PRSV-P could not complement PRSV-W in trans when co-inoculated
onto papaya. In other studies, mutations in the CP core that affected
assembly with RNA, cell-to-cell and systemic movement were rescued in
trans by transgenic CP (Dolja et al., 1994; 1995). The CP has also been
139
eliminated as the site of HRDs in Taiwanese isolates when the PRSV-W CP-
coding region was engineered to replace the PRSV-P CP-coding region in a
Taiwanese PRSV-P infectious clone. The recombinant clone was still able to
infect papaya (Yeh et al., 1997)
The NIb is the potyviral RdRp or replicase and has not been directly
implicated as a host range determinant, although it was recently
demonstrated that the NIb replicase of a strain of PVY (PVY MSNR) was the
elicitor of a hypersensitive response in root knot nematode resistant tobacco
i.e. functioned as an avirulence factor (Fellers et al., 2002). The authors
noted that in other examples of potyvirus virulence, the proteins did not
induce a hypersensitive response. PRSV-W does not induce a HS response
on papaya. There is considerable evidence that host factors are required for
template specific RNA-dependent RNA synthesis of plus-strand viruses
(reviewed in Lai, 1998). RdRP preparations purified from virus infected cells
usually contain cellular proteins which, when removed, result in loss of
replicase activity or specificity (Lai, 1998). In TMV and BMV the eukaryotic
translation initiation factor eIF-3 was shown to be associated with the viral
RdRP (Quadt et al., 1993; Osman and Buck, 1997). More recently, the NIb
of ZYMV was reported to bind to a host poly-(A) binding protein (Wang et al.,
2000). These demonstrated associations with host factors open up the
possibility for the involvement of the NIb as a determinant of pathogenicity.
Interestingly, approximately half (14/29) of the amino acid differences
between the Australian P and W isolates in the region identified in this
chapter were in the NIb.
The remaining coding region, the NIa, comprises the VPg domain and
protease domain. There were six (out of 29) changes in this region between
Australian -P and –W isolates. The protease domain of the NIa is involved in
cleavage of the 3’ two thirds of the potyviral genome. While the activity of this
domain is essential for infectivity, there is no evidence to date that the
protease domain interacts with any host factors and as such has not been
implicated in host range.
140
On the other hand, the VPg domain has been implicated in pathogenicity in a
number of different potyviruses including PVY (Masuta et al., 1999),TVMV
(Nicolas et al., 1997), PSbMV (Keller et al., 1998; Borgstrom and Johansen,
2001) and PVA (Rajamaki and Valkonen, 1999; Rajamaki and Valkonen,
2002). There is evidence for the involvement of the VPg in host range at the
level of both movement and replication. In several examples where amino
acid changes in the VPg were able to break resistance, resistant isolates
were able to infect inoculated leaves but not move systemically. Changes in
the VPg enabled vascular movement. This was the case with PVY (Masuta
et al., 1999) and TVMV (Nicolas et al., 1997) infection of tobacco carrying the
va resistance gene, and PVA infection of Nicandra physaloides (Rajamaki
and Valkonen, 1999) and Solanum commensonii (Rajamaki and Valkonen,
2002). In contrast, where the VPg of PSbMV pathotypes was implicated in
overcoming resistance in Pisum sativum, no replication of non-resistance
breaking pathotypes of PSbMV could be detected in protoplasts from
resistant P.sativum lines (Keller et al., 1998), suggesting that replication,
rather than movement, was being affected. As previously mentioned, it is not
known if PRSV-W can replicate or move in inoculated leaves.
In all of the above examples, the amino acid changes that were implicated as
HRDs predominantly occurred in a 30 amino acid region of the VPg
approximately 100 amino acids from the N terminus of the VPg. In some
cases a single mutation e.g. a K/R105E change in PVY (Masuta et al., 1999),
a V116M in PVA (Rajamaki and Valkonen, 1999) or a H118Y in PVA
(Rajamaki and Valkonen, 2002) was sufficient to overcome resistance. In
other cases, multiple mutations within this region were shown to be
necessary e.g. four amino acid changes (SP..RN ->CS..KS) in TVMV
(Nicolas et al., 1997) and three changes (FVT->VRS) in PSbMV (Borgstrom
and Johansen, 2001) were identified. Interestingly, in PVA, while a V116M
change could break resistance, a second change L185S, just up from the
VPg/pro cleavage site also enabled the virus to overcome resistance
although systemic infection was much slower (Rajamaki and Valkonen,
1999). In Australian PRSV isolates there are only two amino acid differences
in the VPg (Figure 4.5). The first A116V is in the same variable region of the
141
VPg implicated in other potyviruses (discussed above). The second amino
acid difference F176V, occurs slightly upsteam (~ 9 amino acids) of the
L185S change, which was implicated in breaking resistance in PVA
(Rajamaki and Valkonen, 1999). It is possible that one or perhaps both of
these changes is responsible for PRSV-P being able to infect papaya.
In none of the studies where complementation was tested, was the action of
the VPg of the one isolate able to be complemented by the resistance
breaking isolate (Nicolas et al., 1997; Rajamaki and Valkonen, 1999;
Borgstrom and Johansen, 2001). This is similar to results reported by
Henderson (1999) who demonstrated that PRSV-P could not complement
PRSV-W and support infection of papaya. Borgstrom and Johansen (2001)
demonstrated that expression of complementing VPg from elsewhere in the
genome was not sufficient to complement and hypothesised that the activity
of the VPg is in cis rather than trans and requires expression from it’s normal
genome position.
The mechanism of action of the VPg in determining host range in the
previous examples is not completely understood. Evidence suggests the VPg
is not eliciting a defence response in the plant that is preventing infection
(Borgstrom and Johansen, 2001). It has been suggested that because the
resistance that is overcome by mutations in the VPg is recessive, e.g. the va
gene in tobacco (Nicolas et al., 1997; Masuta et al., 1998) and sbm-1 gene in
P. sativum (Keller et al., 1998), this reflects the absence of a host factor to
interact with the virus i.e. the dominant form of these genes encode a host
factor that interacts with the virus to enable infection (Borgstrom and
Johansen, 2001). The only host factors so far demonstrated to interact with
the VPg are the eukaryotic translation initiation factors eIF4E (Schaad et al.,
2000; Ruffel et al., 2002) and eIF(iso)4E (Wittman et al., 1997) (reviewed in
chapter 1). An eIF(iso)4E-binding domain of 35 amino acids (amino acids 59-
93) that is highly conserved among potyviruses, was identified in the N
terminus of the TuMV VPg (Leonard et al., 2000). Mutation of D77, even with
related amino acids, prevented interaction of the VPg and eIF(iso)4E and
prevent the virus from infecting. It has been shown that this/these factors are
142
essential for virus replication but nonessential for plant function (Duprat et
al., 2002). In PRSV, the region in the VPg corresponding to the binding
domain comprises amino acids 2152 to 2186 (Figure 4.5). With the exception
of an S2180N mutation in TAIW-P, this region is completely conserved. This
region does not correspond to the region of the VPg implicated in most other
potyviruses. Therefore, if it is the VPg determining host range in PRSV, it is
unlikely due to interaction with eIF4E or eIF(iso)4E. Alternatively, some other
as yet unknown host factor that interacts with the centre and/or C terminus of
the VPg is implicated.
143
CHAPTER 6 GENERAL DISCUSSION AND CONCLUSIONS
As a family, the Potyviridae have a wide host range although it is much
narrower at the level of genera. Although substantial advances have been
made in recent years in understanding the molecular biology of the
interactions between potyviruses and their hosts, potyvirus molecular host
range determinants are still not well characterised. The more we understand
about the molecular basis for the host range of the viruses, the greater the
chance to develop effective control methods to limit virus spread.
It is generally accepted that plant viruses spread intercellularly by an active
process involving the interplay of specific viral and host factors. The nature of
the host factors required for virus movement is poorly understood, but for
most plant viruses the movement process involves one or more specialized
virus encoded movement proteins (MPs) Jansen et al., 1998; Citovsky et al.,
1990; Waigmann et al., 1994; Ding et al., 1995). Although the potyviral
genome does not encode a dedicated MP, movement functions have been
allocated to several multifunctional proteins making the process of identifying
host range determinants more complex.
PRSV is an important virus of cucurbits and papaya and has caused
devastation in many countries, particularly in papaya. Control of PRSV has
been very difficult using traditional methods. Approaches have included
generation of interspecific hybrids between Carica papaya and wild Carica
species (Manshardt, 1992; Magdalita et al., 1997) and mild strain cross
protection (Yeh and Gonsalves, 1984; Rezende and Pacheco, 1998; Wang et
al., 1987) although in general these methods have had limited success.
More recently, genetically engineered PRSV resistant transgenic papaya
have been used with success to control PRSV in Hawaii (reviewed in
Gonsalves, 1998) and are being developed for other countries including
Thailand (Chowpongpang, 2002) and Australia (Lines et al., 2002).
Interestingly, this resistance is strain specific and although plants are
immune to local isolates, resistance can be overcome by as little as 4%
144
difference (Tennant et al., 1994). Studies of PRSV has demonstrated high
levels of variation within and between different countries (Bateson et al.,
2002) and much of this has arisen from movement of plants between
countries, particularly in Asia (Bateson et al., 2002). As a result, methods to
restrict introduction of papaya from other geographic regions is still important
in association with transgenic resistance. As well, there is evidence that
mutation also occurs and contributes to variability (Bateson et al., 2002)
although the frequency of occurrence or complexity of this mutation is not
known. Therefore, the significance of cucurbits in the spread of PRSV-P is
unknown. Understanding the nature of the mutation will enable us to better
map the molecular epidemiology of PRSV and to understand the significance
of movement from cucurbits to papaya in the spread of PRSV around the
world.
In this study, full-length infectious PCR products of PRSV-P and –W and five
different recombinant hybrids of PRSV-P and –W were generated to identify
the sequence(s) coding for the host range difference between PRSV-P and –
W. Although the results of this thesis did not identify the specific amino acid
changes for this host range difference it was concluded that: (1) there were
no major differences between the two genomes of Australian PRSV isolates
that could account for the different host range suggesting molecular host
range determinants are likely to be amino acid changes rather than
insertions/ deletions; (2) in the entire seven full-length genomes of PRSV–P
and –W analysed, there were no consistent amino acid change/s found that
can account for the host range difference and therefore the specific
mutation/s may be different in each geographic pair; (3) the molecular host
range determinants enabling PRSV to infect papaya are found in the 3’
region of the genome that encodes the VPg, NIa protease, NIb and CP.
The most challenging part of this project was the generation of infectious
clones. Although PRSV-P of Hawaiian and Taiwanese isolates have been
successfully cloned and multiplied in E.coli (Chiang and Yeh, 1997), it was
not possible to clone the full-length genome of the Australian isolates,
145
reflecting the sequence variation between these isolates and those for
Hawaii and Taiwan. The genome was able to be cloned in two parts, but,
addition of the 5’ clone appeared to make the clone toxic, even at low copy
number. This is very similar to that reported for PSbMV P1 and P4
(Johansen, 1996). Attempts to generate infectious clones of many viruses
including some potyviruses, have reportedly had toxicity-associated
problems where they cannot be propagated efficiently in E.coli (Gritsun and
Gould, 1995; Herchenroder et al., 1995; Yang et al., 1998b; Fakhfakh et al.,
1996; Tellier et al., 1996; Lopez-Moya et al., 2000; Yamshchikov et al.,
2001). To circumvent this problem, alternative strategies were developed.
Insertion of an intron was investigated as it has been successful for other
potyviruses, as introns will not be spliced in bacteria and so disrupts the toxic
sequence (Yamshchikov et al, 2001). Introns must place in the correct
position in the genome where they can interrupt the sequences generating
toxic products (Johansen, 1996; Lopez-Moya and Garcia, 2000). In this
study, insertion of an intron into the P1 coding region of the full-length PRSV-
W clone did not stabilise the clone in E.coli. It was hoped to stop expression
of viral sequences from upstream promoters e.g. CaMV35S, LacZ etc. The
intron used (St-LS1 IV2 intron) was the same as that used by Johansen
(1996) for PSBMV and has also been used to prevent expression of barnase
(Hanson et al., 1999) which is extremely toxic. Since it was subsequently
shown using the OL-LD-PCR system that the intron is correctly processed to
produce infectious virus, it is likely that the intron was not placed in a suitable
position in the genome to interrupt the generation of toxic products in
bacteria. It is likely that these toxic sequences are being transcribed from
cryptic sites within the P1, HC-Pro or P3 of the PRSV genome and that these
sites are not present in Taiwanese and Hawaiian sequences. Johansen
(1996) demonstrated that, although PSbMV pathotypes P1 and P4 are
closely related viruses, regions of P4 were toxic in E.coli while P1 could be
cloned. By placing introns in a number of positions, including the P3, it was
possible to overcome the toxicity. Therefore, in future, manipulation of
infectious PRSV clones to incorporate introns in alternative and possibly
multiple regions could be investigated.
146
Full-length PCR products incorporating the CaMV 35S promoter and
terminator have previously been use for infectivity studies using particle
bombardment without cloning to overcome toxicity-associated problems
(Fakhfakh, 1996). Using the same theory, full-length infectious PCR products
of PRSV-P and –W, incorporating a CaMV 35S promoter and terminator
were generated using OE-LD-PCR, overcoming the problem of assembling a
full-length PRSV-W in one single clone in E.coli. Overlapping PCR has
previously been used to generate full-length viral PCR products to overcome
the same problem, including Hepatitis C (Wang et al., 1997) and Tick-borne
encephalitis virus (Gritsun and Gould, 1995). Long-distance PCR using a
mixture of thermostable DNA polymerases, one which has high processivity
and the other with a 3’-5’ exonuclease activity, allows amplification of much
longer templates with minimal sequence alterations, as the proof reading
enzyme removes pairing mismatches (Barnes, 1994). Non-specific
amplification is a major weakness of long-distance PCR, and could not be
generated in standard PCR, as the annealing sites would be too far apart
(Wang et al., 1997). Using OE-LD-PCR to generate infectious recombinant
hybrids of PRSV (exchanging the different regions of two strains) was easier
and quicker without the need for a final cloning step.
Infectivity experiments of five different hybrids of PRSV localised the host
range determinants of PRSV to the 3’ end of the genome. Based on previous
literature, it was concluded that the most likely candidate for the HRD is the
VPg (Chapter 5). Recently Chen et al. (2003) reported that recombination of
infectious clones of PRSV-P and W from Taiwan had localised the HRD for
infectivity of papaya to the NIa. This supports the studies undertaken here as
well as the hypothesis that the HRD are in the VPg.
As there is no consistent change between PRSV-P and -W sequences when
all seven are aligned it will be interesting to see which HRD are significant for
the overseas isolates. In Australian isolates there are only two amino acid
differences in the VPg (A->V and F->V) and these changes occur in regions
of the VPg previously implicated in pathogenicity in potyviruses (Fig. 6.1). At
the position of the A->V change there is an A->S change in Thai isolates but
147
no corresponding change in Taiwanese isolates. However, there is an S->N
change just upstream (towards the highly conserved N terminus) and an I->V
change just downstream of this region. At the position of the F->V mutation
in Australian isolates there is an A->V change in Taiwanese isolates but the
Thai sequences are identical (A). However, there is a D->N change in the
next position. If, as evidence suggests, the VPg is the site of the HRDs, it
may be that multiple changes are necessary as all pairs of isolates have at
least two amino acid differences in comparable regions. This could cause a
conformational change so that the PRSV-P VPg is then able to interact with
the papaya host factor. However, since PRSV-P can still infect cucurbits it
must still be able to interact with the cucurbit host factor. Although the
regions incorporating the changes do not correspond to the eIF4 binding
region, it is likely that the VPg interacts with many host proteins involved in
transcription, translation and movement. At least 10 different tomato proteins
were identified in yeast two-hybrid studies as interacting with the VPg of TEV
(Schaad et al., 2000).
As discussed in Chapter 1 and 5, the VPg has been implicated in host range
in a number of studies. There is evidence for a role both in movement and
replication of potyviruses (Nicolas et al., 1997; Schaad et al., 1997; Rajamaki
and Valkonen, 1999; Hamalainen et al., 2000, Keller et al., 1998). It is not
known at what level that resistance to PRSV-W in papaya is occurring.
PRSV-W does not produce any symptoms (lesions etc) on papaya and so
resistance could be acting at the level of replication. In future, it would be
useful to investigate replication of these infectious PCR products in papaya
protoplasts.
148
S-N I-V A-V
D-N A-S G-E T-N A-S
A-V F-V
K-R V-I
eIF4 binding domain
Central region linked to pathogenicity
C-terminal region linked to pathogenicity
Aus P/W
Taiw P/W
Thai P/W
Figure 6.1.Diagramatic representation of VPg of PRSV-P & W showing amino acid differences (below lines)
between pairs of geographic isolates.
149
Even if the determinants are identified, the mechanism by which this occurs
still needs to be defined
Interestingly, cucurbits (Cucurbitaceae) and papaya (Caricaceae) are
reasonably closely related (Hutchinson, 1969). PRSV-W resistance genes
have been identified in cucurbits (Wai and Grummet, 1995; Wai et al. 1997)
and this resistance has been linked to resistance to other potyviruses such
as ZYMV. There is also resistance to PRSV-P in some wild Carica species
(Horovitz and Jimenez, 1967). Since a natural recessive resistance gene
(pvr2) that confers resistance to PVY in pepper has been shown to
correspond to an eIF4E gene (Ruffel et al., 2002), it will be interesting in
future to see if inability of PRSV-P to infect other Carica sp. is due to the
same mechanism as the resistance to PRSV-W in Carica papaya.
Although the changes in the host range of PRSV VPg in Australia were only
V-A mutations, a recent report for Pepper mild mottle virus (Hagiwara et al.,
2002) suggests a V-A change in the viral replicase was able to influence viral
accumulation, indicating that if occurring in the appropriate position, this
change can be significant.
In conclusion, in this project an effective system was developed for
generation of recombinant infectious PRSV that overcame problems with
toxicity. Sequence analysis of the full genomes confirmed the close
relationship of PRSV-P and -W in Australia and supported the hypothesis
that PRSV-P arose by mutation from PRSV-W. Using this system of
recombinant clones and sequence data, the HRD of PRSV has been
localised to the 3’ end of the genome and it appears likely that the host range
differences are mediated by one or two V-A changes in the VPg. Further
recombination and site-directed mutagenesis experiments are now required
to confirm the involvement of these changes and accurately identify the
HRDs of PRSV in Australia.
150
REFERENCES
Aleman-Verdaguer, M.E., Goudou-Urbino, C., Dubern, J., Beachy, R.N. and
Fauquet, C. (1997). Analysis of the sequence diversity of the P1, HC, P3,
NIb and CP genomic regions of several Yam mosaic potyvirus isolates:
implications for the intraspecies molecular diversity of potyviruses. Journal of
General Virology 78, 1253-1264.
Anandalakshimi, R., Pruss, G.J., Ge, X., Marathe, R., Mallory, A.C., Smith,
T.H. and Vance, V.B. (1998). A viral suppressor of gene silencing in plants.
Proceedings of the National Academy of Sciences of the United States of
America 93, 13079-13084.
Andersen, K. and Johansen, I.E. (1998). A single conserved amino acid in
the coat protein gene of Pea seed-borne mosaic potyvirus modulates the
ability of the virus to move systemically in Chenopodium quinoa. Virology
241, 304-311.
Andrejeva, J., Puurand, U., Merits, A., Rabenstein, F., Jarvekulg, L. and
Valkonen, J.P.T. (1999). Potyvirus helper component-proteinase and coat
protein (CP) have coordinated functions in virus-host interactions and the
same CP motif affects virus transmission and accumulation. Journal of
General Virology 80, 1133-1139.
Arbatova, J., Lehto, K., Pehu, E. and Pehu, T. (1998). Localization of the P1
protein of Potato Y potyvirus in association with cytoplasmic inclusion bodies
and in the cytoplasm of infected cells. Journal of General Virology 79, 2319-
2323.
Atabekov, J.G. and Dorokhov, Y.L. (1984). Plant virus-specific transport
function and resistance of plants to viruses. Advances in Virus Research 29,
313-364.
151
Atreya, C.D., Atreya, P.L., Thornbury, D.W. and Pirone, T.P. (1992). Site-
directed mutations in the potyvirus HC-Pro gene affect helper component
activity, virus accumulation and symptom expression in infected tobacco
plants. Virology 191, 106-111.
Atreya, C.D. and Pirone, T.P. (1993). Mutational analysis of the helper
component-proteinase gene of a potyvirus: effects of amino acid
substitutions, deletions and gene replacement on virulence and aphid
transmissibility. Proceedings of the National Academy of Sciences of the
United States of America 90, 11919-11923.
Atreya, P.L., Lopez-Moya, J.J., Chu, M., Atreya, C.D. and Pirone, T.P.
(1995). Mutational analysis of the coat protein N-terminal amino acids
involved in potyviral transmission by aphids. Journal of General Virology 76,
265-270.
Attasart, P., Charoensilp, G., Kertbundit, S., Panyim, S. and Juricek, M.
(2002). Nucleotide sequence of a Thai isolate of Papaya ringspot virus type
W. Acta Virologica 46, 241-246.
Barnes, W.M. (1994). PCR amplification of up to 35kb DNA with high fidelity
and high yield from bacteriophage templates. Proceedings of the National
Academy of Sciences of the United States of America 91, 2216-2220.
Bateson, M.F. (1995). Developing transgenic resistance for potyviruses. PhD
Thesis, Queensland University of Technology, Australia.
Bateson, M. and Dale, J. (1992). The nucleotide sequence of the coat protein
gene and 3' untranslated region of Papaya ringspot virus type W (Aust).
Archives of Virology 123, 101-109.
Bateson, M.F., Henderson, J., Chaleeprom, W., Gibbs, A.J. and Dale, J.L.
(1994). Papaya ringspot potyvirus: isolate variability and the origin of PRSV-
P (Aust). Journal of General Virology 75, 3547-3553.
152
Bateson, M.F., Lines, R.E., Revill, P., Chaleeprom, W., Ha, C.V., Gibbs, A.J.
and Dale, J.L. (2002). On the evolution and molecular epidemiology of the
potyvirus Papaya ringspot virus. Journal of General Virology 83, 2575-2585.
Bayot, R.G., Villegas, V.N., Magdalita, P.M., Jovellana, M.D., Espino, T.M.
and Exconde, S.B. (1990). Seed transmissibility of Papaya ringspot virus.
Philippine Journal of Crop Science 15, 107-111.
Blanc, S., Ammar, E.D., Garcia-Lampasona, S., Dolja, V.V., Llave, C., Baker,
J. and Pirone, T.P. (1998). Mutations in the potyvirus helper component
protein: effects on interaction with virions and aphid stylets. Journal of
General Virology 79, 3119-3122.
Blanc, S., Lopez-Moya, J., Wang, R., Gracia-Lampasona, S., Thornbury,
W.D. and Pirone, T.P. (1997). A specific interaction between coat protein and
helper component correlates with aphid transmission of a potyvirus. Virology
231, 141-147.
Borgstrom, B. and Johansen, I.E. (2001). Mutations in Pea seed borne
mosaic virus genome-linked protein VPg alter pathotype-specific virulence in
Pisum sativum. Molecular Plant Microbe Interactions 14, 707-714.
Boyer, J.C. and Haenni, A.L. (1994). Infectious transcripts and cDNA clones
of RNA viruses. Virology 198, 415-426.
Boyer, J.C., Drugeon, G., Seron, K., Morch-Devignes, M.D., Agnes, F. and
Haenni, A.L. (1993). In vitro transcripts of Turnip yellow mosaic virus
encompassing a long 3' extension or produced from a full-length cDNA clone
harbouring a 2kb-long PCR amplified segment are infectious. Research in
Virology 144, 339-348.
153
Brantley, J.D. and Hunt, A.G. (1993). The N-terminal protein of the
polyprotein encoded by the potyvirus Tobacco vein mottle virus is an RNA-
binding protein. Journal of General Virology 74, 1157-1162.
Brigneti, G., Voinnet, O., Li, W.X., Ji, L.H., Ding, S.W. and Baulcombe, D.C.
(1998). Viral pathogenicity determinants are suppressors of transgene
silencing in Nicotiana benthamiana. EMBO Journal 17, 6739-6746.
Brugidou, C., Holt, C., Yassi, M.N., Zhang, S., Beachy, R. and Fauquet, C.
(1995). Synthesis of an infectious full-length cDNA clone of Rice yellow
mottle virus and mutagenesis of the coat protein gene. Virology 206, 108-
155.
Carrington, J.C. and Dougherty, W.G. (1987). Processing of the Tobacco
etch virus 49K protease requires autoproteolysis. Virology 160, 355-362.
Carrington, J.C. and Freed, D.D. (1990). Cap-independent enhancement of
translation by a plant potyvirus 5' nontranslated region. Journal of Virology
64, 1590-1597.
Carrington, J.C. and Herndon, K.L. (1992). Characterization of the potyviral
HC-Pro autoproteolytic cleavage site. Virology 187, 308-315.
Carrington, J.C., Cary, S.M. and Dougherty, W.G. (1988). Mutational
analysis of Tobacco etch virus polyprotein processing: cis and trans
proteolytic activities of polyproteins containing the 49-kilodalton proteinase.
Journal of Virology 62, 2313-2320.
Carrington, J.C., Cary, S.M., Parks, T.D. and Dougherty, G. (1989). A
second proteinase encoded by a plant potyvirus genome. EMBO Journal 8,
365-370.
154
Carrington, J.C., Haldeman, R., Dolja, V.V. and Restrepo-Hartwig, M.A.
(1993). Internal clevage and trans-proteolytic activities of the VPg-proteinase
(NIa) of Tobacco etch potyvirus in vivo. Journal of Virology 67, 6995-7000.
Carrington, J.C., Jensen, P.E. and Schaad, M.C. (1998). Genetic evidence
for an essential role for potyvirus CI protein in cell-to-cell movement. Plant
Journal 14, 393-400.
Chaleeprom, W.S. (1996). Genome analysis of Papaya ringspot potyvirus
and a related virus. PhD Thesis, Queensland University of Technology,
Australia.
Chen, S., Das, P. and Hari, V. (1994). In situ localization of ATPase activity
in cells of plants infected by maize dwarf mosaic potyvirus. Archives of
Virology 134, 433-439.
Chen, K.C., Wang, C.H., Liu, F.L., Su, W.C. and Yeh, S.D. (2003). The NIa
gene of Papaya Ringspot Virus is the host determinant for papaya infection.
7th International Congress of Plant Molecular Biology, Barcelona (Abstract).
Cheng, S., Fockler, C., Barnes, W.M. and Higuchi, R. (1994). Effective
amplification of long targets from cloned inserts and human genomic DNA.
Proceedings of the National Academy of Sciences of the United States of
America 91, 5695-5699.
Chiang, C.H. and Yeh, S.D. (1997). Infectivity assays of in vitro and in vivo
transcripts of papaya ringspot potyvirus. Botanical Bulletin of Academia
Sinica 38, 153-163.
Choi, I, Horken, K.M., Stenger, D.C. and French, R. (2002). Mapping of the
P1 proteinase cleavage site in the polyprotein of Wheat streak mosaic virus
(genus Tritimovirus). Journal of General Virology 83, 443-450.
155
Chowpongpang, S. (2002). Development of genetically engineered
resistance to Papaya Ringspot Potyvirus (PRSV) in Thailand. PhD Thesis,
Queensland Univesity of Technology, Australia.
Citovsky, V., Knorr, D., Schuster, G. and Zambryski, P. (1990). The P30
movement protein of tobacco mosaic virus is a single-strand nucleic acid
binding protein. Cell 60, 637-647.
Commandeur, U., Jarausch, W., Li, Y., Koenig, R. and Burgermeister, W.
(1991). cDNAs of beet necrotic yellow vein virus RNAs 3 and 4 are rendered
biologically active in a plasmid containing the cauliflower mosaic virus
35Spromoter. Virology 185, 493-495.
Cronin, S., Verchot, J., Haldeman-Cahill, R., Schaad, M.C. and Carrington,
J.C. (1995). Long-distance movement factor: a transport function of the
potyvirus helper component proteinase. Plant Cell 7, 549-559.
Dallot, S., Douine, L.Q., Saenz, P., Cervera, M.T., Garcia, J.A. and Quiot,
J.B. (2001). Identification of plum pox virus determinants implicated in
specific interactions with different Prunus spp. Phytopathology 91, 159-164.
Daròs, J.A. and Carrington, J.C. (1997). RNA binding activity of NIa
proteinase of tobacco etch potyvirus. Virology 237, 327-336.
Daròs, J.A., Schaad, M.C. and Carrington, J.C. (1999). Functional analysis of
the interaction between VPg-proteinase (NIa) and RNA polymerase (NIb) of
tobacco etch potyvirus, using conditional and suppressor mutants. Journal of
Virology 73, 8732-8740.
De La Rosa, M. and Lastra, R. (1983). Purification and partial
characterization of Papaya ringspot virus. Phytopathologische Zeitschrift
106, 329-336.
156
Derrick, P.M., Barker, H. and Oparka, K.J. (1992). Increase in
plasmodesmatal permeability during cell-to-cell spread of Tobacco rattle
virus from individually inoculated cells. Plant Cell 4, 1405-1412.
Dersch, P., Fsihi, H. and Bremer, E. (1994). Low-copy-number T7 vectors for
selective gene expression and efficient protein overproduction in Escherichia
coli. FEMS Microbiology Letters 123, 19-26.
Dickinson, V.J. (1996). The product of maize streak virus ORF V1 is
associated with secondary plasmodesmata and is first detected with the
onset of viral lesions. Virology 220, 51-59.
Ding, B. (1998). Intercellular protein trafficking through plasmodesmata.
Plant Molecular Biology 38, 279-310.
Ding, S.W., Li, W.X. and Symons, R.H. (1995). A novel naturally occurring
hybrid gene encoded by a plant RNA virus facilitates long distance virus
movement. EMBO Journal 14, 5762-5772.
Dolja, V.V., Haldeman-Cahill, R., Montgomery, A.E., Vandenbosch, K.A. and
Carrington, J.C. (1995). Capsid protein determinants involved in the cell-to-
cell and long-distance movement of tobacco etch potyvirus. Virology 206,
1007-1016.
Dolja, V.V., Haldeman, R., Robertson, N.L., Dougherty, G.W. and Carrington,
J.C. (1994). Distinct functions of capsid protein in assembly and movement
of tobacco etch potyvirus in plants. EMBO Journal 13, 1482-1491.
Dolja, V.V., McBride, H.J. and Carrington, J.C. (1992). Tagging of plant
potyvirus replication and movement by insertion of �-glucuronidase into the
viral polyprotein. Proceedings of the National Academy of Sciences of the
United States of America 89, 10208-10212.
157
Domier, L.L., Franklin, K.M., Hunt, A.G., Rhoads, R.E. and Shaw, J.G.
(1989). Infectious in vitro transcripts from cloned cDNA of potyvirus, tobacco
vein mottling virus. Proceedings of the National Academy of Sciences of the
United States of America 86, 3509-3513.
Domingo, E., Martinez-Salas, E., Sobrino, F., De la Torre, J.C., Portela, A.,
Ortin, J., Lopez-Galindez, C., Perez-Brena, P., Villaneuva, N., Najera, R.,
Vandepol, S. and Steinhauer, D., De Polo, N., Holland, J. (1985). The
quasispecies (extremely heterogenous) nature of viral RNA genome
populations: biological relevance. A review. Gene 40, 1-8.
Dougherty, W.G. and Carrington, J.C. (1988). Expression and function of
potyviral gene products. Annual Review of Phytopathology 26, 123-143.
Dougherty, W.G. and Hiebert, E. (1980). Translation of potyvirus RNA in
rabbit reticulocyte lysate: reaction conditions and identification of capsid
protein as one of the products of in vitro translation of tobbaco etch and
pepper mottle viral RNAs. Virology 10, 466-474.
Dougherty, W.G. and Parks, T.D. (1991). Post-translational processing of the
tobacco etch virus 49-kDa small nuclear inclusion polyprotein: identification
of an internal cleavage site and delimitation of VPg and proteinase domains.
Virology 183, 449-456.
Dougherty, W.G., Parks, T.D., Cary, S.M., Bazan, J.F. and Fletterick, R.J.
(1989). Characterization of the catalytic residues of the tobacco etch virus
49-kDa proteinase. Virology 172, 302-310.
Duprat, A., Caranta, C., Revers, F., Menand, B., Browning, K.S. and
Robaglia, C. (2002). The Arabidopsis eukaryotic initiation factor (iso)4E is
dispensable for plant growth but required for susceptibility to potyviruses.
The Plant Journal 32, 927-934.
158
Edwardson, J.R. and Christie, R.G. (1986). Viruses infecting forage legumes.
Florida Agriculture Experiment Station Monograph series 4.
Edwardson, J. R. and Christie, R.G. (1991). The potyvirus group. Volumes I-
IV, Florida Agricultural Experiment Station Monograph series 16.
Fang, G., Zhu, G., Burger, H., Keithly, J.S. and Weiser, B. (1998). Minimizing
DNA recombination during long RT-PCR. Journal of General Virology 76,
139-148.
Fakhfakh, H., Vilaine, F., Makni, M. and Robaglia, C. (1996). Cell-free
cloning and biolistic inoculation of an infectious cDNA of potato virus Y.
Journal of General Virology 77, 519-523.
Fedorkin, O.N., Merits, A., Lucchesi, J., Solovyev, A.G., Saarma, M.,
Morozov, S.Yu. and Makinen, K. (2000). Complementation of the movement-
deficient mutations in potato virus X: potyvirus coat protein mediates cell-to-
cell trafficking of C-terminal truncation but not deletion mutant of potexvirus
coat protein. Virology 270, 31-42.
Fellers, J. P., Tremblay, D., Handest, M.F. and Lommel, S.A. (2002). The
Potato virus Y MSNR NIb-replicase is the elicitor of a veinal necrosis-
hypersensitive response in root knot nematode resistant tobacco. Molecular
Plant Pathology 3, 145-152.
Fellers, J., Wan, J., Hong, Y., Collins, G.B. and Hunt, A.G. (1998). In vitro
interactions between a potyvirus-encoded, genome-linked protein and RNA-
dependent RNA polymerase. Journal of General Virology 79, 2043-2049.
Fernandez, A. and Garcia, J.A. (1996). The RNA helicase CI from plum pox
potyvirus has two regions involved in binding to RNA. FEBS Letters 338,
206-210.
159
Fernandez, A., Lain, S. and Garcia, J.A. (1995). RNA helicase activity of the
plum pox potyvirus CI protein expressed in Escherichia coli. Mapping of an
RNA binding domain. Nucleic Acids Research. 23, 1327-1332.
Flasinski, S., Gunasinghe, U.B., Gonzales, R.A. and Cassidy, B.G. (1996).
The cDNA sequence and infectious transcripts of peanut stripe virus. Gene
171, 299-300.
Frenkel, M.J., Jilka, J.M., McKern, N.M., Strike, P.M., Clark, J.M., Shukla,
D.D. and Ward, C.W. (1991). Unexpected sequence diversity in the amino
terminal ends of the coat proteins of strains of sugarcane mosaic virus.
Journal of General Virology 72, 237-247.
Fujiwara, T., Giesman-Cookmeyer, D., Ding, B., Lommel, S. and Lucas, W.J.
(1993). Cell-to-cell trafficking of macromolecules through plasmodesmata
potentiated by the Red clover necrotic mosaic virus movement protein. Plant
Cell 5,1783-1794.
Gallie, D.R., Sleat, D.E., Watts, J.W., Turner, P.C. and Wilson, T.M.A.
(1987). A comparison of eukaryotic viral 5'-leader sequences as enhancers
of mRNA expression in vivo. Nucleic Acids Research 15, 8693-8711.
Gal-On, A. and Raccah, B. (2000). A point mutation in the FRANK motif of
the potyvirus helper component-protease gene alters symptom expression in
cucurbits and elicits protection against the severe homologous virus.
Phytopathology 90, 467-473.
Gal-On, A., Antignus, Y., Rosner, A. and Raccah, B. (1991). Infectious in
vitro RNA transcripts derived from cloned cDNA of the cucurbit potyvirus,
Zucchini yellow mosaic virus. Journal of General Virology 72, 2639-2643.
160
Gal-On, A., Meiri, E., Elman, C., Gray, D.J. and Gaba, V. (1997). Simple
hand-held devices for the efficient infection of plants with viral-encoding
constructs by particle bombardment. Journal of General Virology 64, 103-
110.
Gal-On, A., Meiri, E., Huet, H., Hua, J. W., Raccah, B. and Gaba, V. (1995).
Particle bombardment drastically increases the infectivity of cloned DNA of
zucchini yellow mosaic potyvirus. Journal of General Virology 76, 3223-3227.
German-Retana, S., Candresse, T., Alias, E., Delbos, R. and Le, G,O (2000).
Effects of green fluorescent protein or ß-glucuronidase tagging on the
accumulation and pathogenicity of a resistance-breaking Lettuce mosaic
virus isolate in susceptible and resistant lettuce cultivars. Molecular Plant
Microbe Interactions 13, 316-324.
Gonsalves, D. (1998). Control of papaya ringspot virus in papaya: a case
study. Annual Review of Phytopathology 36, 415-437.
Gonsalves, D. and Ishii, M. (1980). Purification and serology of papaya
ringspot virus. Phytopathology 70, 1028-1032.
Govier, D.A. and Kassanis, B. (1974). A virus-induced component of plant
sap needed when aphids acquire potato virus Y from purified preparations.
Virology 61, 420-426.
Govier, D.A., Kassanis, B. and Pirone, T.P. (1977). Partial purification and
characterization of the potato virus Y helper component. Virology 78, 306-
314.
Greber, R.S. (1978). Watermelon mosaic virus I & II in Queensland cucurbit
crops. Australian Journal of Agricultural Research 29, 235-1245.
Gritsun, T.S. and Gould, E.A. (1995). Infectious transcripts of tick-borne
encephalitis virus, generated in days by RT-PCR. Virology 214, 611-618.
161
Gritsun, T.S. and Gould, E.A. (1998). Development and analysis of a tick-
borne encephalitis virus infectious clone using a novel and rapid strategy.
Journal of Virological Methods 76, 109-120.
Guo, D., Merits, A. and Saarma, M. (1999). Self-association and mapping of
interaction domains of helper component-proteinase of potato A potyvirus.
Journal of General Virology 80, 1127-1131.
Guo, D., Rajamäki, M.L., Saarma, M. and Valkonen, J.P. (2001). Towards a
protein interaction map of potyviruses: protein interaction matrixes of two
potyviruses based on the yeast two-hybrid system. Journal of General
Virology 82, 935-939.
Hall, J.S., Adams, B., Parsons, T.J., French, R., Lane, L.C. and Jensen, S.G.
(1998). Molecular cloning, sequencing, and phylogenetic relationship of a
new potyvirus: Sugarcane mosaic virus, and a reevaluation of the
classification of the potyviridae. Molecular Phylogenetics and Evolution 10,
323-332.
Hanson, B., Engler, D., Moy, Y., Newman, B., Ralston, E. and Gutterson, N.
(1999). A simple method to enrich an Agrobacterium-transformed population
for plants containing only T-DNA sequences. Plant Journal 19, 727-734.
Harrison, B.D. and Robinson, D.J. (1988). Molecular variation in vector-borne
plant viruses: epidmiological significance. Philosophical Transactions of the
Royal Society of London. Series B: Biological Sciences 321, 447-462.
Hayes, R.J. and Buck, K.W. (1990). Infectious cucumber mosaic virus RNA
transcribed in vitro from clones obtained from cDNA amplified using the
polymerase chain reaction. Journal of General Virology 71, 2503-2508.
162
Hagiwara, K., Ichiki, T.U., Ogawa, Y., Omura, T. and Tsuda, S. (2002). A single amino acid substitution in 126-kDa protein of Pepper mild mottle virus
associates with symptom attenuation in pepper; the complete nucleotide
sequence of an attenuated strain, C-1421. Archives of Virology 147, 833-
840.
Hämäläinen, J.H., Kekarainen, T., Gebhardt, C., Watanabe, K.N. and
Valkonen, J.P. (2000). Recessive and dominant genes interfere with the
vascular transport of Potato virus A in diploid potatoes. Molecular Plant-
Microbe Interactions 13, 402-412.
Henderson, J. (1999). Towards identification of host range determinants of
Papaya ringspot potyvirus. PhD Thesis. Queensland University of
Technology, Australia
Herchenroder, O., Turek, R., Neumann-Haefelin, D., Rethwilm, A. and
Schneider, J. (1995). Infectious proviral clones of chimpanzee foamy virus
(SFVcpz) generated by long PCR reveal close functional relatedness to
human foamy virus. Virology 214, 685-689.
Higuchi, R., Krummel, B. and Saiki, R.K. (1998). A general method of in vitro
preparation and specific mutagenesis of DNA fragments: study of protein and
DNA interactions. Nucleic Acids Research 16, 7351-7367.
Hjulsager, C.K., Lund, O.S. and Johansen, I. E. (2002). A new pathotype of
Pea seed-borne mosaic viruse explained by properties of the P3-6K1- and
viral genome-linked protein (VPg)-coding regions. Molecular Plant-Microbe
Interactions 15, 169-171.
Hollings, M. and Brunt, A.A. (1981). Potyviruses. In:Handbook of plant virus
infections and comparative diagnosis. Kurstak E. (ED) Elsevier/north-Holland
Biomedical Press, Amsterdam, Netherlands.
163
Holy, S. and Aboul-Haidar, M.G. (1993). Production of infectious in vitro
transcripts from a full-length clover yellow mosaic virus cDNA clone. Journal
of General Virology 74, 718-784.
Hong, Y. and Hunt, A.G. (1996). RNA polymerase activity catalyzed by a
potyvirus-encoded RNA-dependent RNA polymerase. Virology 226, 146-151.
Hong, Y., Levay, K., Murphy, J.F.,Klein, P.G., Shaw, J.G. and Hunt, A.G.
(1995). A potyvirus polymerase interacts with the viral coat protein and VPg
in yeast cells. Virology 214, 159-166.
Horovitz, S and Jimenenz, H. (1967). Cruzamientos interspecificos e
intergenéricos en Caricaceas y sus implicaciones fitotécnicas. Agron. Trop.
(Maracay) 17, 323-343.
Hutchinson, J. (1969). Evolution and phylogeny of flowering plants.
Academic Press.
Jagadish, M.N., Huang, D. and Ward, C.W. (1993). Site-directed
mutagenesis of a potyvirus coat protein and its assembly in Escherichia coli.
Journal of General Virology 74, 893-896.
Jakab, G., Droz, E., Brigneti, G., Baulcombe, D. and Malnoe, P. (1997).
Infectious in vivo and in vitro transcripts from a full-length cDNA clone of
PVY-N605, a Swiss necrotic isolate of potato virus Y. Journal of General
Virology 78, 3141-3145.
Jansen, K.A., Wolfs, C.J., Lohuis, H., Goldbach, R.W. and Verduin, B.J.
(1998). Characterization of the brome mosaic virus movement protein
expressed in E. coli. Virology 242, 387-394.
164
Jenner, C.E., Tomimura, K., Ohshima, K., Hughes, S.L. and Walsh, J.A.
(2002). Mutations in Turnip mosaic virus P3 and cylindrical inclusion proteins
are separately required to overcome two Brassica napus resistance genes.
Virology 300, 50-59.
Jensen, D.D. (1949). Papaya virus diseases with special reference to papaya
ringspot. Phytopathology 39, 191-211.
Johansen, I.E. (1996). Intron insertion facilitates amplification of cloned virus
cDNA in Escherichia coli while biological activity is reestablished after
transcription in vivo. Proceedings of the National Academy of Sciences of the
United States of America 93, 12400-12405.
Johansen, I.E., Keller, K.E., Dougherty, W.G. and Hampton, R.O. (1996).
Biological and molecular properties of a pathotype P-1 and a pathotype P-4
isolate of pea seed-borne mosaic virus. Journal of General Virology 77, 1329-1333.
Johansen, I.E., Lund, O.S., Hjulsager, C.K. and Laursen, J. (2001).
Recessive resistance in Pisum sativum and potyvirus pathotype resolved in a
gene-for-cistron correspondence between host and virus. Journal of Virology
75, 6609-6614.
Kadare, G. and Haenni, A.L. (1997). Virus-encoded RNA helicases. Journal
of Virology 71, 2583-2590.
Kasschau, K.D. and Carrington, J.C. (1995). Requirement for HC-Pro
processing during genome amplification of tobacco etch potyvirus. Virology
209, 268-273.
Kasschau, K.D. and Carrington, J.C. (1998). A counter defensive strategy of
plant viruses: suppression of post-transcriptional gene silencing. Cell 95,
461-470.
165
Kasschau, K.D. and Carrington, J.C. (2001). Long-distance movement and
replication maintenance functions correlate with silencing suppression
activity of potyviral HC-Pro. Virology 285, 71-81.
Kasschau, K.D., Cronin, S. and Carrington, J.C. (1997). Genome
amplification and long-distance movement functions associated with the
central domain of tobacco etch potyvirus helper component-proteinase.
Virology 228, 251-262.
Keller, K.E., Johansen, E.I., Martin, R.R. and Hampton, R.O. (1998).
Potyvirus genome-linked protein (VPg) determines pea seed-borne mosaic
virus pathotype-specific virulence in Pisum sativum. Molecular Plant-Microbe
Interactions 11, 124-130.
Kim, D., Han, J.S., Lew, J., Kim, S.S., Kang, B.H., Hwang, D.C., Jang, D.S.,
Kim, W., Song, B.D. and Choi, K.Y. (1998). Effects of mutations in the C-
terminal region of NIa protease on cis-cleavage between NIa and NIb.
Virology 241, 94-100.
Kim, D.H., Park, Y.S., Kim, S.S., Lew, J., Nam, H.G. and Choi, K.Y. (1995).
Expression, purification and identification of a novel self-cleavage site of the
NIa C-terminal 27-kDa protease of turnip mosaic potyvirus C5. Virology 213,
517-525.
Klein, P.G., Klein, R.R., Cerezo, E.R., Hunt, A.G. and Shaw, J.G. (1994).
Mutational analysis of the tobacco vein mottling virus genome. Virology 204,
759-769.
Koonin, E.V. (1991). The phylogeny of RNA-dependent RNA polymerases of
positive-strand RNA viruses. Journal of General Virology 72, 2197-2206.
Lai, M.M.C. (1998). Cellular factors in the transcription and replication of viral
RNA genomes: a parallel to DNA-dependent RNA transcription. Virology
244, 1-12.
166
Lai, C.J., Zhao, B., Hori, H. and Bray, M. (1991). Infectious RNA transcribed
from stably cloned full-length cDNA of dengue type 4 virus. Proceedings of
the National Academy of Sciences of the United States of America 88, 5139-
5143.
Lain, S., Martin, M.T., Riechmann, J.L. and Garcia, J.A. (1991). Noval
catalytic activity associated with positive-strand RNA virus infection: nucleic
acid-stimulated ATPase activity of the plum pox potyvirus helicaselike
protein. Journal of Virology 65, 1-6.
Lain, S., Riechmann, J.L. and Garcia, J.A. (1990). RNA helicase: a noval
activity associated with a protein encoded by a positive strand RNA virus.
Nucleic Acids Research 18, 7003-7006.
Langenberg, W.G. and Zhang, L. (1997). Immunocytology shows the
presence of tobacco etch virus P3 protein in nuclear inclusions. Journal of
Structural Biology 118, 243-247.
Lecoq, H., Dafalla, G., Desbiez, C., Wipf-Scheibel, C., Delecolle, B., Lanina,
T., Ullah, Z. and Grumet, R. (2000). Biological and molecular
characterization of Moroccan watermelon mosaic virus and potyvirus isolate
from Eastern Sudan. Plant Disease 85, 547-552.
Leonard, S., Plante, D., Wittmann, S., Daigneault, N., Fortin, M.G. and
Laliberte, J.F. (2000). Complex formation between potyvirus VPg and
translation eukaryotic initiation factor 4E correlates with virus infectivity.
Journal of Virology 74, 7730-7737.
Li, X.H. and Carrington, J.C. (1993). Nuclear transport of tobacco etch
potyviral RNA-dependent RNA polymerase is highly sensitive to sequence
alterations. Virology 193, 951-958.
167
Li, X.H., Valdez, P., Olvera, R.E. and Carrington, J.C. (1997). Function of the
tobacco etch virus RNA polymerase (NIb): subcellular transport and protein-
protein interaction with VPg/ proteinase (NIa). Journal of Virology 71, 1598-
1607.
Lines, R.E. (2002). Development of virus resistant papaya in Australia and
Vietnam. PhD Thesis. Queensland University of Technology, Australia.
Lines, R.,E., Persley, D., Dale, J.L., Drew, R. and Bateson, M.F. (2002).
Genetically engineered immunity to Papaya ringspot virus in Australian
papaya cultivars. Molecular Breeding 10, 1119-129.
Lopez-Moya, J.J. and Garcia, A.J. (2000). Construction of a stable and highly
infectious intron-containing cDNA clone of plum pox potyvirus and its use to
infect plants by particle bombardment. Virus Research 68, 99-107.
Lopez-Moya, J. and Pirone, T.P. (1998). Charge changes near the N-
terminus of the coat protein of two potyviruses affect virus movement.
Journal of General Virology 79, 161-165.
Lopez-Moya, J.J., Fernandez-Fernandez, M.R., Cambra, M. and Garcia, J.A.
(2000). Biotechnological aspects of Plum pox virus. Journal of
Biotechnology. 76, 121-136.
Lopez-Moya, J.J., Wang, R.Y. and Pirone, T.P. (1999). Context of the coat
protein DAG motif affects potyvirus transmissibility by aphids. Journal of
General Virology 80, 3281-3288.
Magdalita, P.M., Persley, D.M., Godwin, I.D., Drew, R.A. and Adkins, S.W.
(1997). Screening Carica papaya x C. cauliflora hybrids for resistance to
papaya ringspot virus-type P. Plant Pathology 46, 837-841.
168
Mahajan, S., Dolja, V.V. and Carrington, J.C. (1996). Roles of the sequence
encoding tobacco etch virus capsid protein in genome amplification:
requirements for the translation process and a cis-active element. Journal of
General Virology 70, 4370-4379.
Maia, I.G. and Bernardi, F. (1996). Nucleic acid-binding properties of a
bacterially expressed potato virus Y helper component-proteinase. Journal of
General Virology 77, 869-877.
Maiss, E., Timpe, U., Brisske-Rode, A., Lesemann, D.E. and Casper, R.
(1992). Infectious in vivo transcripts of a plum pox potyvirus full-length cDNA
clone containing the cauliflower mosaic virus 35S RNA promoter. Journal of
General Virology 73, 709-713.
Manshardt, R.M. (1992). Papaya. In: Biotechnology of Perennial Fruit Crops.
R.E.Litz (Ed) CAB International, 489-511.
Maoka, T., Kashiwazaki, S., Tsuda, S., Usugi, T. and Hibino, H. (1996).
Nucleotide sequence of the capsid protein gene of papaya leaf-distortion
mosaic potyvirus. Archives of Virology 141, 197-204.
Masuta, C., Nishimura, M., Morishita, H. and Hataya, T. (1999). A single
amino acid change in viral genome-associated protein of potato virus Y
correlates with resistance breaking in "virgin A mutant" tobacco.
Phytopathology 89, 118-123.
Matthews, R.E.F. (1991). Plant Virology. Academic Press Inc., California.
Merits, A., Guo, D. and Saarma, M. (1998). VPg, coat protein and five non-
structural proteins of potato A potyvirus bind RNA in a sequence-unspecific
manner. Journal of General Virology 79, 3123-3127.
Meyerhans, A., Vartanian, J.P. and Wain-Hobson, S. (1990). DNA
recombination during PCR. Nucleic Acids Research 18, 1687-1691.
169
Mora-Aquilera, G., Nieto-Angel, D., Teliz, D. and Campbell, C.L. (1993).
Development of a prediction model for papaya ringspot in Veracruz, Mexico.
Plant Disease 77, 1205-1211.
Mori, M., Mise, K., Kobayashi, K., Okuno, T. and Furusawa, I. (1991).
Infectivity of plasmids containing brome mosaic cDNA linked to the
cauliflower mosaic virus 35S RNA promoter. Journal of General Virology 72,
243-246.
Mowat, W.P. and Dawson, S. (1987). Detection and identification of plant
viruses by ELISA using crude sap extracts and unfractionated antisera.
Journal of Virological Methods 15, 233-247
Murphy, J.F., Rhoads, R.E., Hunt, A.G. and Shaw, J.G. (1990). The VPg of
tobacco etch virus RNA is the 49-kDa proteinase or the N-terminal 24-kDa
part of the proteinase. Virology 178, 285-288.
Nagel, J. and Hiebert, E. (1985). Complementary DNA cloning and
expression of the papaya ringspot potyvirus sequences encoding capsid
protein and a nuclear inclusion like protein in E. coli. Virology 143, 435-441.
Nicolas, O, Pirone, T.P. and Hellmann, G.M. (1996). Construction and
analysis of infectious transcriptsfrom a resistance-breaking strain of tobacco
vein mottling potyvirus. Archives of Virology 141,1535-1552.
Nicolas, O., Dunnington, S.W., Gotow, L.F., Pirone, T.P. and Hellmann, G.M.
(1997). Variations in the VPg protein allow a potyvirus to overcome va gene
resistance in tobacco. Virology 237, 452-459.
Nicolaisen, M., Jahansen, E., Poulsen, G.B. and Borkhardt, B. (1992). The
5'untranslated region from pea seedborne mosaic potyvirus RNA as a
translation enhancer in pea and tobacco protoplasts. FEBS Letters 303, 169-
172.
170
Noueiry, A.O., Lucas, W.J. and Gilbertson, R.L. (1994). Two proteins of a
plant DNA virus coordinate nuclear and plasmodesmal transport. Cell 76, 925-932.
Oh, C.S. and Carrington, J.C. (1989). Identification of essential residues in
potyvirus proteinase HC-Pro by site-directed mutagenesis. Virology 173,
692-699.
Olsen, B.S. and Johansen, I.E. (2001). Nucleotide sequence and infectious
cDNA clone of the L1 isolate of Pea seed-borne mosaic potyvirus. Archives
of Virology 146, 15-25.
Oparka, K.J., Boevink, P. and Cruz, S.S. (1996). Studying the movement of
plant viruses using green fluorescent protein. Trends in Plant Science 1, 412-
418.
Opina, O.S. (1991). Epidemiology of papaya ringspot. Proceedings First
National Symposium/ Workshop on Ringspot and other Diseases of Papaya
in the Philippines, Bureau of Plant Industry, Manila, Philippines, 46-51.
Osman, T.A.M. and Buck, K.W. (1997). The tobacco mosaic virus RNA
polymerase complex contains a plant protein related to the RNA-binding
subunit of yeast eIF-3. Journal of Virology 71, 6075-6082.
Page, R.M.D. (1996). TREEVIEW: an application to display phylogenetic
trees on personal computers. Computer Applications in the Biosciences 12,
357-358.
Parks, T.D. and Dougherty, W.G. (1991). Substrate recognition by the NIa
proteinase of two potyviruses involves multiple domains: characterization
using genetically engineered hybrid protinase molecules. Virology 182, 17-
27.
171
Parks, T.D., Howard, E.D., Wolpert, T.J., Arp., D.J. and Dougherty, W.G.
(1995). Expression and purification of a recombinant tobacco etch virus NIa
proteinase: biochemical analyses of the full-length and a naturally occurring
truncated proteinase form. Virology 210, 194-201.
Payne, S.L., Rausch, J., Rushlow, K. Montelaro, R.C., Issel, C., Flaherty, M.,
Perry, S., Sellon, D. and Fuller, F. (1994). Characterization of infectious
molecular clones of equine infectious anemia virus. Journal of General
Virology 75, 425-429.
Peng, Y., Kadoury, D., Gal-On, A., Huet, H., Wang, Y. and Raccah, B.
(1998). Mutations in the HC-Pro gene of zucchini yellow mosaic potyvirus:
effects on aphid transmission and binding to purified virions. Journal of
General Virology 79, 897-904.
Perrin, Y. and Hull, R. (1999). Original reverse transcription polymerase
chain reaction method to obtain the full-length cDNA of rice tungro spherical
virus. Journal of Virological Methods 79, 161-168.
Persley, D.M. (1997). Identification, epidemiology and control of papaya
ringspot virus, recently recorded in papaya (Carica papaya) in Australia.
Master’s thesis, Queensland University of Technology Brisbane.
Pirone, T.P. (1981). Efficiency and selectivity of the helper component
mediated aphid transmission of purified potyviruses. Phytopathology 71, 922-
924.
Pirone, T.P. (1991). Viral genes and gene products that determine insect
transmissibility. Seminars in Virology 2, 81-87.
Pirone, T.P. and Blanc, S. (1996). Helper-dependent vector transmission of
plant viruses. Annual Review of Phytopathology 34, 227-247.
172
Plochocka, D., Welnicki, M. Zielenkiewicz, P. and Ostoja-Za-gorski, W.
(1996). Three-dimensional model of the potyviral genome-linked protein.
Proceedings of the National Academy of Sciences of the United States of
America 93, 12150-12154.
Pogany, J., Huang, Q., Romero, J., Nagy, P.D. and Bujarski, J.J. (1994).
Infectious transcripts from PCR-amplified broad bean mottle bromovirus
cDNA clones and variable nature of leader regions in RNA 3 segment.
Journal of General Virology 75, 693-697.
Pruss, G., Ge, X., Shi, X.M., Carrington, J.C. and Vance, V.B. (1997). Plant
viral synergism: the potyviral genome encodes a broad-range pathogenicity
enhancer that transactivates replication of heterologous viruses. Plant Cell 9,
859-868.
Purcifull, D.E., Edwardson, J., Hiebert, E.L. and Gonsalves, D. (1984).
Papaya ringspot virus. CMI/AAB description of plant viruses No.292.
Puurand, U., Valkonen, J.P.T., Makinen, K., Rabenstein, F. and Saarma, M.
(1996). Infectious in vitro transcripts from cloned cDNA of the potato A
potyvirus. Virus Research 40, 135-140.
Quadt, R., Kao, C.C., Browning, K.S., Hershberger, R.P. and Ahlquist, P.
(1993). Characterisation of a host protein associated with brome mosaic
virus RNA-dependent RNA polymerase. Proceedings of the National
Academy of Sciences of the United States of America 90, 1498-1502.
Quemada, H., L'Hostis, B., Gonsalves, D., Reardon, I.M., Heinrikson, R.,
Seiu, L.C. and Slightom, J.L. (1990). The nucleotide sequence of the 3'-
terminal regions of papaya ringspot virus strains W and P. Journal of General
Virology 71, 203-210.
173
Quillet, L., Guilley, H., Jonard, G. and Richards, K. (1989). In vitro synthesis
of biologically active beet necrotic yellow vein virus RNA. Virology 172, 293-
301.
Rajamaki, M.L. and Valkonen, J.P.T. (1999). The 6K2 protein and the VPg of
potato virus A are determinants of systemic infection in Nicandra
physaloides. Molecular Plant-Microbe Interactions 12, 1074-1081.
Rajamaki, M.L. and Valkonen, J.P.T. (2002). Viral genome-linked protein
(VPg) controls accumulation and phloem-loading of a potyvirus in inoculated
potato leaves. Molecular Plant-Microbe Interactions 15, 138-149.
Rao, A.L.N. (1997). Analysis of cell-to-cell movement competence of coat
protein defective variants of cowpea chlorotic mottle virus. Virology 232, 358-
395.
Restrepo-Hartwig, M.A. and Carrington, J.C. (1992). Regulation of nuclear
transport of a plant potyvirus protein by autoproteolysis. Journal of Virology
66, 5662-5666.
Restrepo-Hartwig, M.A. and Carrington, J.C. (1994). The tobacco etch
potyvirus 6-kilodalton protein is membrane associated and involved in viral
replication. Journal of Virology 68, 2388-2397.
Revers, F., Gall, O.L., Candresse, T. and Maule, A.J. (1999). New advances
in understanding the molecular biology of plant/potyvirus interactions.
Molecular Plant-Microbe Interactions 12, 367-376.
Rezende, J.A.M. and Costa, A.S. (1993). Papaya diseases caused by virus
and mycoplasma. Summa Phytopathologica 19, 73-79.
Rezende, J.A.M. and Pacheco, D.A. (1998). Control of papaya ringspot
virus-type W in zucchini squash by cross-protection. Plant Disease 82, 171-
175.
174
Rice, C.M., Grakoui, A., Galler, R. and Chambers, T.J. (1989). Transcription
of infectious yellow fever RNA from full-length cDNA templates produced by
in vitro lidation. The New Biologist 1, 285-296.
Riechmann, J.L., Cervera, M.T. and Garcia, J.A. (1995). Processing of the
plum pox virus polyprotein at the P3-6K1 junction is not required for virus
viability. Journal of General Virology 76, 951-956.
Riechmann, J.L., Lain, S. and Garcia, J.A. (1990). Infectious in vitro
transcripts from a plum pox virus cDNA clone. Virology 177, 710-716.
Riechmann, J.L., Lain, S. and Garcia, J.A. (1992). Highlights and prospects
of potyvirus molecular biology. Virology 177, 710-716.
Robertson, N.L., French, N.L. and Gray, S.M. (1991). Use of group-specific
primers and the polymerase chain reaction for the detection and identification
of luteoviruses. Journal of General Virology 72, 1473-1477.
Rodriguez-Cerezo, E. and Shaw, J.G. (1991). Two newly detected
nonstructural viral proteins in potyvirus-infected cells. Virology 185, 572-579.
Rodriguez-Cerezo, E., Ammar, E.D., Pirone, T.P. and Shaw, J.G. (1993).
Association of the non-structural P3 viral protein with cylindrical inclusions in
potyvirus-infected cells. Journal of General Virology 74, 1945-1949.
Rodriguez-Cerezo, E., Findlay, K., Shaw, J.G., Lomonossoff, G.P., Qiu, S.G.,
Linstead, P., Shanks, M. and Risco, C. (1997). The coat and cylindrical
inclusion proteins of a potyvirus are associated with connections between
plant cells. Virology 236, 296-306.
Rojas, M.R., Zerbini, F.M., Allison, R.F., Gilbertson, R.L. and Lucass, W.J.
(1997). Capsid protein and helper component-proteinase function as
potyvirus cell-to-cell movement proteins. Virology 237, 283-295.
175
Ruffel, S., Dussault, M., Palloix, A., Moury, B., Bendahmane, A., Robaglia
and C., Caranta, C. (2202). A natural recessive resistance gene against
potato virus Y in pepper corresponds to the eukaryotic initiation factor 4E
(eIF4E). The Plant Journal 32, 1067-1075.
Saenz, P., Cervera, M.T., Dallot, S., Quiot, L., Quiot, J.B., Riechmann, J.L.
and Garcia, J.A (2000). Identification of a pathogenicity determinant of Plum
pox virus in the sequence encoding the C-terminal region of protein P3+6K1.
Journal of General Virology 81, 557-566.
Saenz, P., Quiot, L., Quiot, J.B., Candresse, T. and Garcia, J.A. (2001).
Pathogenicity determinants in the complex virus population of a plum pox
virus isolate. Molecular Plant-Microbe Interactions 14, 278-287.
Saenz, P., Salvador, B., Simon-Mateo, C., Kasschau, K.D., Carrington, J.C.
and Garcia, J.A. (2002). Host-specific involvement of the HC protein in the
long-distance movement of potyviruses. Journal of Virology 76, 1922-1931.
Saldarelli, P., Dell'Orco, M. and Minafra, A. (2000). Infectious cDNA clones
of two grapevine viruses. Archives of Virology 145, 397-405.
Salomon, R. and Bernardi, F. (1995). Inhibition of viral aphid transmission by
the N-terminus of the maize dwarf mosaic virus coat protein. Virology 213,
676-679.
Sanchez, F., Martinez-Herrera, D., Aguilar, I. and Ponz, F. (1998). Infectivity
of turnip mosaic potyvirus cDNA clones and transcripts on the systemic host
Arabidopsis thaliana and local lesion hosts. Virus Research 55, 207-219.
Schaad, M.C. and Carrington, J.C. (1996). Suppression of long-distance
movement of tobacco etch virus in a nonsusceptible host. Journal of Virology
70, 2556-2561.
176
Schaad, M.C., Anderberg, R.J. and Carrington, J.C. (2000). Strain-specific
interaction of the tobacco etch virus NIa protein with the translation initiation
factor eIF4E in the yeast two-hybrid system. Virology 273, 300-306.
Schaad, M.C., Lellis, A.D. and Carrington, J.C. (1997). VPg of tobacco etch
potyvirus is a host genotype-specific determinant for long-distance
movement. Journal of Virology 71, 8624-8631.
Schaad, M.C., Cahill, R.H., Cronin, S. and Carrington, J.C. (1996). Analysis
of the VPg-proteinase (NIa) encoded by tobacco etch potyvirus: effects of
mutations on subcellular transport, proteolytic processing, and genome
amplification. Journal of Virology 70, 7039-7048.
Shukla, D.D. and Ward, C.W. (1989). Structure of potyvirus coat proteins and
its application in the taxonomy of the potyvirus group. Advances in Virus
Research 36, 273-314.
Shukla, D.D., Jilka, J., Tosic, M. and Ford, R.E. (1989). A noval approach to
the serology of potyviruses involving affinity-purified polyclonal antibodies
directed towards virus-specific N termini of coat proteins. Journal of General
Virology 70, 13-23.
Shukla, D.D., Ward, C.W. and Brunt, A.A. (1994). The Potyviridae. C.A.B
International, Wallingford, Uk.
Skaf, J.S., Schultz, M.H., Hirata, H. and De Zoeten, G.A. (2000). Mutational
evidence that the VPg is involved in the replication and not the movement of
Pea enation mosaic virus-1. Journal of General Virology 81, 1103-1109.
Sonoda, S., Koiwa, H., Kanda, K., Kato, H., Shimono, M. and Nishiguchi, M.
(2000). The helper component-proteinase of Sweet potato feathery mottle
virus facilitates systemic spread of Potato virus X in Ipomoea nil.
Phytopathology 90, 944-950.
177
Soumonuou, Y. and Laliberte, J.F. (1994). Nucleic-acid binding properties of
the P1 protein of turnip mosaic potyvirus produced in Escherichia coli.
Journal of General Virology 75, 2567-2573.
Stokoe, R. (1996). Amplification of the papaya ringspot virus type P genome
by long-distance PCR and sequence variability within the helper component
of PRSV-P and PRSV-W. Honours Thesis, Queensland University of
Technology, Brisbane.
Suranto, G., K.H., Shukla, D.D. and Pallaghy, C.K. (1998). Coat protein
sequence of Krish-infecting strain of Johnsongrass mosaic potyvirus.
Archives of Virology 143, 1015-1020.
Tacahashi, Y. and Uyeda, I. (1999). Restoration of the 3' end of potyvirus
RNA derived from poly(A)-deficient infectious cDNA clones. Virology 265,
147-152.
Takahashi, Y., Takahashi, T. and Uyeda, I. (1997). A cDNA clone to Clover
yellow vein potyvirus genome is highly infectious. Virus Genes 14, 235-243.
Tellier, R., Bukh, J., Emerson, S.U. and Purcell, R.H. (1996). Amplification of
the full-length hepatitis A virus genome by long reverse transcription-PCR
and transcription of infectious RNA directly from the amplicon. Proceedings
of the National Academy of Sciences of the United States of America 93,
4370-4373.
Tennant, P., Gonsalves, C., Fitch, M., Manshardt, R., Slightom, J. L. and
Gonsalves, D. (1994). Differential protection against papaya ringspot virus
isolates in coat protein gene transgenic papaya and classically cross-
protected papaya. Phytopathology 84, 1359-1366.
Thomas, J.E. and Dodman, R.L. (1993). The first record of papaya ringspot
virus-type P from Australia. Australasian Plant Pathology 22, 2-7.
178
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and Higgins,
D.G. (1997). The ClustalX windows interface: flexible strategies for multiple
sequence alignment aided by quality analysis tools. Nucleic Acids Research
24, 4876-4882.
Thornbury, D.W., Hellmann, G.M., Rhoads, R.E. and Pirone, T.P. (1985).
Purification and characterisation of potyvirus helper component. Virology
144, 260-267.
Thornbury, D.W., Patterson, C.A., Dessens, J.T. and Pirone, T.P. (1990).
Comparative sequence of helper-component (HC) region of potato virus Y
and a HC-defective strain, potato virus C. Virology 178, 573-578.
Tordo, V.M.J., Chachulska, A.M., Fakhfakh, H., Romancer, M.L., Robaglia,
C. and Astier-Manifacier, S. (1995). Sequence polymorphism in the P1
coding region of potato virus Y genomic RNA. Journal of General Virology
76, 939-949.
Urcuqui-Inchima, S., Haenni, A. and Bernardi, F. (2001). Potyvirus proteins:
a wealth of functions. Virus Research 74, 157-175.
Urcuqui-Inchima, S., Maia, I.G., Arruda, P., Haenni, A.L. and Bernardi, F.
(2000). Deletion mapping of the potyviral helper component-proteinase
reveals two regions involved in RNA binding. Virology 268, 104-111.
Urcuqui-Inchima, S., Walter, J., Drugeon, G., German-Retana, S., Haenni,
A.L., Candresse, T., Bernardi, F. and Le Gall, O. (1999). Potyvirus helper
component-proteinase self-interaction in the yeast two-hybrid system and
delineation of the interaction domain involved. Virology 258, 95-99.
179
Van Regenmortel, M.H.V., Fauquet, C.M., Bishop, D.H.L., Carstens, E.B.,
Estes, M.K., Lemon, S.M., Maniloff, J., Mayo, M.A., McGeoch, D.J., Pringle,
C.R. and Wickner, R.B. (2000). Virus Taxonomy, Seventh report of the
International Committee on Taxonomy of Viruses. International Union of
Microbiological Societies 7, 703-724.
Verchot, J. and Carrington, J.C. (1995a.). Debilitation of plant potyvirus
infectivity by P1 proteinase-inactivating mutations and restoration by second-
site modifications. Journal of Virology 69, 1582-1590.
Verchot, J. and Carrington, J.C. (1995b). Evidence that the potyvirus P1
proteinase functions in trans as an accessory factor for genome
amplification. Journal of Virology 69, 3668-3674.
Verchot, J., Herndon, K.L. and Carrington, J.C. (1992). Mutational analysis of
the tobacco etch potyviral 35-kDa proteinase: identification of essential
residues and requirements for autoproteolysis. Virology 190, 298-306.
Verchot, J., Koonin, E.V. and Carrington, J.C. (1991). The 35-kDa protein
from the amino-terminus of the potyviral polyprotein functions as a third
virus-encoded proteinase. Virology 185, 527-535.
Varrelmann, M. and Maiss, E. (2000). Mutations in the coat protein gene of
Plum pox virus suppress particle assembly, heterologous encapsidation and
complementation in transgenic plants of Nicotiana benthamiana. Journal of
General Virology 81, 567-576.
Verver, J., Wellink, J., Lent, J.V., Gopinath, K. and Kammen, A.V. (1998).
Studies on the movement of cowpea mosaic virus using the jellyfish green
fluorescent protein. Virology 242, 22-27.
Viry, M., Serghini, M.A., Hans, F., Ritzenthaler, C., Pinck, M. and Pinck, L.
(1993). Biologically active transcripts from cloned cDNA of genomic
grapevine fanleaf nepovirus RNAs. Journal of General Virology 74, 169-174.
180
Wai, T. and Grummet, R. (1995). Inheritance of resistance to the watermelon
strain of papaya ringspot virus in cucumber line TMG-1. Hort. Science 30,
338-340.
Wai, T., Staub, J.E., Kabelka, W. and Grumet, R. (1997). Linkage analysis of
potyvirus resistance alleles in cucumber. Journal of Heredity 88, 454-458.
Waigmann, E., Lucas, W.J., Citovsky, V. and Zambryski, P. (1994). Direct
functional assay for tobacco mosaic virus cell-to-cell movement protein and
identification of a domain involved in increasing plasmodesmal permeability.
Proceedings of the National Academy of Sciences of the United States of
America 91, 1433-1437.
Wang, C.H. and Yeh, S.D. (1992). Nucleotide sequence comparison of the
3'terminal regions of severe, mild and non-papaya infecting strains of papaya
ringspot virus. Archives of Virology 127, 345-354.
Wang, C.H. and Yeh, S.D. (1997). Divergence and conservation of the
genomic RNAs of Taiwan and Hawaii strains of papaya ringspot potyvirus.
Archives of Virology 142, 271-285.
Wang, L., Radkowski, M., Vargas, H., Rakela, J. and Laskus, T. (1997).
Amplification and fusion of long fragments of hepatitis C virus genome.
Journal of Virological Methods 68, 217-223.
Wang, H.L., Wang, Y., Cookmeyer, D.G., Lommel, S.A. and Lucas, W.J.
(1998). Mutations in viral movement protein alter systemic infection and
identify an intercellular barrier to entry into the phloem long-distance
transport system. Virology 245, 75-89.
Wang, H.L., Yeh, S.D., Chiu, R.J. and Gonsalves, D. (1987). Effectiveness of
cross-protection by mild mutants of papaya ringspot virus for control of
ringspot disease of papaya in Taiwan. Plant Disease 71, 491-497.
181
Wang, X., Ullah, Z. and Grumet, R. (2000). Interaction between zucchini
yellow mosaic potyvirus RNA-dependent RNA polymerase and host poly-(A)
binding protein. Virology 275, 433-443.
Weber, H., Haeckel, P. and Pfitzner, A.J.P. (1992). A cDNA clone of tomato
mosaic virus is infectious in plants. Journal of Virology 45, 3909-3912.
Wisler, G.C., Purcifull, D.E. and Heibert E. (1995). Characterisation of the
P1 protein and coding region of the zucchini yellow mosaic virus. Journal of
General Virology 76, 37-45.
Wittmann, S., Chatel, H., Fortin, M.G. and Laliberte, J.F. (1997). Interaction
of the viral protein genome linked of turnip mosaic potyvirus with the
translational eukaryotic initiation factor (iso)4E of Arabidopsis thaliana using
the yeast two-hybrid system. Virology 234, 84-92.
Xiao, X.W., Frenkel, M.J., Teakle, D.S., Ward, C.W. and Shukla, D.D. (1993).
Sequence diversity in the surface-exposed amino-terminal of the coat protein
of seven strains of sugarcane mosaic virus correlates to their host range.
Archives of Virology 132, 399-408.
Yamaya, Y., Yoshioka, M., Meshi, T., Okada, Y. and Ohno, T. (1988).
Expression of tobacco mosaic virus RNA in transgenic plants. Molecular &
General Genetics 211, 520-525.
Yamshchikov, V., Mishin, V. and Cominelli, F. (2001). A new strategy in
design of +RNA virus infectious clones enabling their stable propagation in
E. coli. Virology 281, 272-280.
Yang, L.J., Hidaka, M.Masaki, H. and Uozumi, T. (1998a). Detection of
Potato virus Y P1 protein in infected cells and analysis of its cleavage site.
Biosciences, Biotechnology, and Biochemistry 62, 380-382.
182
Yang, S.J., Revers, F., Souche, S., Lot, H., Gall, O.L., Candresse, T. and
Dunez, J. (1998b). Construction of full-length cDNA clones of lettuce mosaic
virus (LMV) and the effects on their viability in Escherichia coli and on their
infectivity to plants. Archives of Virology 143, 2443-2451.
Yeh, S.D. (1994). Comparison of the genetic organisation of papaya ringspot
virus with other potyviruses. Plant Pathology Bulletin 3, 54-64.
Yeh, S.D. and Gonsalves, D. (1984). Evaluation of induced mutants of
papaya ringspot virus for control by cross protection. Phytopathology 74:
1086-1089.
Yeh, S.D., Gonsalves, D., Wang, H.I., Namba, R. and Chiu, R.J. (1988).
Control of papaya ringspot virus by cross protection. Plant Disease 72, 375-
380.
Yeh, S.D., Jan, F.J., Chiang, C.H., Doong, T.J., Chen, M.C., Chung, P.H.
and Bau, H.J. (1992). Complete nucleotide sequence and genetic
organisation of papaya ringspot virus RNA. Journal of General Virology 73,
2531-2541.
Yeh, S.D., Wang, C.H. and Chiang, C.H. (1997). Genetically-engineered
attenuated strain for control of papaya ringspot virus by cross protection. 5th
international Congress of Plant Molecular Biology, Singapore (Abstract).
Zambryski, P. and Crawford, K. (2000). Plasmodesmata: gatekeepers for
cell-to-cell transport of development signals in plants. Annual Review of Cell
and Developmental Biology 16, 393-421.
183
APPENDIX I Alignment of the full-length nucleotide sequences of Australian isolates of PRSV-W
(AUS-W) and PRSV-P (AUS-P). 80 AUS-W AAAATAAAAC ATCTCAACAC AACACAATCA AAAACACTTC AACAAGTATC AACTTATCTC ATTTTCAATT GTCATAGCAA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 160 AUS-W GCAACAATGT CTTCTCTGTA CACTTTGCGA CCAGCAGCTC AGTACGATAG GAGGTTGGAG AGCAAGAAAG GTTCTGGCTG AUS-P ---------- ---------- ---------- ---------- ---------- ------A--- ---------- ---------- 240 AUS-W GATCGAGCAC AAACTCGAAA GAAAAGGGGA TAGAGGAAAC ACTCACTATT GTAGTGAGTT TGACATTAGC AAGGGTGCCA AUS-P ---------- ---------- ---------- ---------- -------T-- ---------- ---------- ---------- 320 AUS-W AGATTCTGCA ATTGGTGCAG ATTGGTAACG CTGAAGTTGG AAGGACCTTC CTGGAAGGTA ACAGATTTGT CCGTGCAAAC AUS-P ---------- ---------- ---------- ---------- ---------- --A------- ---------- ---------- 400 AUS-W ATATTCGAGA TCATCCGGAA AACTATGGTT GGTCGTCTAG GATATGATTT CGAGAGTGAG CTATGGGTTT GTCACGATTG AUS-P --------A- ----T----- ---------- ---------- ---------- ---------A ---------- -------A-- 480 AUS-W CGGTAACACT TCTGACAAAT ACTTCAAGAA ATGTGACTGT GGAGAAAAAT ATTACTACTC TGAAAGAAAC CTGATGAAAA AUS-P -A-------- ---------- ---------- ---------- ---------- -------T-- ------G--- -------GG- 560 AUS-W CAATACAAGA CCTGATGTAT CAGTTTGACA TGACACCATC AGAGATTAAC TCCGTCGATT TTGATTATCT TGCTGATGCA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ----------
AUS-W GTGGATTATG CTGAGCGGTC AGTCAAGGGA TCTCAAGTTC CGGAACCTGT GGAACTTGCA ATGATGGAAC CAATTGCGGC AUS-P ---------- ----A----- ---------- ---------- ---------- ---------- ---------- ---------- 720 AUS-W TAGTGAGAAA GGTACTCTAG TGGTTTCTGA ACTAAAAGTT GTGCCTGTAA CTACCAAAGT TGAAGAAGCA TGGACTATAC AUS-P -------G-- ---------- ---------- ---------- ---------- ---------- ----A----- ---------- 800 AUS-W AGATTGGGGA AATTCCTGTC CCACTTGTTG TTATTAAGGA AACACCAGTT ATTAGTGGTG TGAATGGAAC TCTGAACTCA AUS-P ---------- ---------- --------G- --------A- ---------- ------A--- ---------- ------T--- 880 AUS-W ACTGGTTTCT CACTTGAAGC CGATGTTACA AAAATGGTTG AGAAGGAAGT CCCTCAGGAA GAGGTGAAAG AAGCAGTGCA AUS-P ---------- ---------- T---A----- ---------A ---------- ---------- ---------- ---------- 960
184
AUS-W CCTGGCACTC GAAGTTGGTA ACGAGATTGC TGAGAAGAAA CCTGAACTCA ATCTAACACC ATACTGGAGT GCTAGCCTTG AUS-P ---------- ---------- -----T---- ---------- ---------- --T------- ---------- -----T---- 1040 AUS-W AGTTGCACAA GAGAGTTCGT AAGCATAAGG AGCATGCTAA GATTGCAGCA ATTCAAGTTC AGAAGGAACA AGAGGAAAAT AUS-P ---------- ---------- ---------- ---------- ---------- ---------- T--------- G-----T--- 1120 AUS-W CAGAAGATAT TCTCAACTAT GGAGTTAAGG CTTGACTTAA AGTCAAGGAG AAGAAATCAA ACTGTGGTCT GTGACAAAAG AUS-P ---------- --------C- T-------A- ---------- ---------- ---------- ---------- ---------- 1200 AUS-W AGGTACACTT AAATGGGAGA CCCGACAAGG TTGCAAGAAG AGTAGGCTAA TGCAACAAGT GAGTGATTCT GTTGTCACTC AUS-P ---------- ------A--- ---------- -CA------- ---------- ---------- ---------- -C-------- 1280 AUS-W AAATTCATCG TGATTTTGGG TGTGAACCTC AATATTTTGA ACCTCAACTT CCTGGCATCA AGCGAGCTAC ATCTAAGAAG AUS-P -----T---A ---------T ---------- ---------- ---------- ---------- ---------- ---------- 1360 AUS-W ATCTGCAGAT CGCGCAAGTA TTCGAGAATT GTTGGTAGTA ACAAGATAAA TTATGTCATG AAAAACCTGT GTGACATAAT AUS-P --T------- ---------- ---A------ -------A-- ---------- ---------- ---------- ---------- 1440 AUS-W CATTGAAAGA AGCATTCCTG TAGAGCTTGT TACGAGGCGA TGCAAGAGAA GAATTATTCA GAAGGAAGGT AGAAGCTATG AUS-P ---------- ---------- ---------- ---------- ---G------ ---------- ---------- ---------- 1520 AUS-W TGCAGTTGAG GCACATGGGT GGCATTCGAA CACGACAAGA TGTGAGCAGC TCGCCCGAAA TGGAGCAATT ATTCACGCAA AUS-P ---------- -------A-- ---------- ---------- ---------- ---------- ---------- ---------- 1600 AUS-W TTTTGCAAGT TTTTAGTTGG ACACAAACCA TTTAAATCCG AAAATCTGAC GTTTGGTTCT AGCGGCCTAA TTTTCAAGCC AUS-P ---------- ----G----- ---------- C-C------- ---------- ---C------ --T-----G- -C----G--- 1680 AUS-W AAAGTTTGCC GACAATGTGG GGCGATACTT TGGAGACTAT TTTATTGTTC GAGGACGTCT TGGAGGTAGG CTATTTGATG AUS-P -------A-- ---------- ---------- ---G------ ---G------ ---------- ---------- ---------- 1760 AUS-W GTAGATCAAA ACTAGCGAGA TCAATCTATG CCAAGATGGA TCAATACAAT GACGTGGCTG AAAAATTCTG GCTTGGTTTT AUS-P ---------- ---------- ---------- ---------- ------T--- ---------- ---------- ---------- 1840 AUS-W AATAGGGCTT TTCTACGGCA TAGAAAACCA ACGGACCATA CTTGCACGTC TGACATGGAT GTCACAATGT GTGGGGAGGT AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ----------
185
1920 AUS-W AGCAGCTCTT GCAACTATAA TCCTGTTTCC ATGCCACAAG ATAACTTGCA ACACTTGCAT GATCAAAGTA AAGGGAAGAG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 2000 AUS-W TCATTGACGA AGTCGGTGAG GATTTAAATT GTGAGCTTGA AAGGCTGCGT GAAACTCCCT CATCATATGG AGGGTCATTC AUS-P ---------- ---------- ---------- ---------- -----AA--- -------T-- ---------A ---------- 2080 AUS-W GGACATGTCT CAACATTACT TGATCAACTA AACAGAGTTT TGAATGCGCG GAACATGAAC GATGGAGCTT TTAAAGAGAT AUS-P ---------- ---------- ---------- ---------- ---------- ---------T ---------- -------A-- 2160 AUS-W TGCGAAGAGG ATTGATGCAA AGAAAGAGAG TCCTTGGACT CACATGACAG CCATCAACAA CACGCTCATC AAAGGTTCGC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 2240 AUS-W TAGCAACTGG CTACGAATTT GAAAGAGCGT CTGATAGTCT CCTGGAAATC GTGAGGTGGC ATCTCAAAAG GACAGAATCA AUS-P ---------- ---------- ---------- ---------- ------G--T ---------- ---------- ---------- 2320 AUS-W ATAAAAGCTG GCAGTGTTGA AAGTTTTAGA AACAAGCGTT CTGGAAAAGC TCACTTCAAC CCAGCTCTTA CGTGTGATAA AUS-P ---------- -T-------- ---------- ---------- ---------- ---------- ---------- ---------- 2400 AUS-W TCAGTTGGAC AAGAATGGTA ATTTCTTATG GGGCGAAAGG CAATACCACG CCAAGAGATT CTTTGCCAAC TATTTCGAGA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 2480 AUS-W AGATTGATCA TAGTAAGGGT TATGAGTACT ATAGTCAACG CCAAAACCCA AATGGTATCA GGAAGATAGC TATTGGCAAT AUS-P ---------- ---------- ---------- ---------- ---------- ---------- -A-------- ---------- 2560 AUS-W TTGGTATTTT CAACAAATTT GGAGAGATTT CGACAGCAAA TGGTTGAACA CCACATTGAT CAAGGACCAA TTACCCGTGA AUS-P ---------- ---------- ---------- --G--A---- ---------- ---------- ---------- ---T------ 2640 AUS-W GTGTATCGCA TTGCGCAATA ACAATTATGT TCATGTATGC AGCTGCGTAA CTTTAGATGA TGGAACTCCA GCAACAAGTG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 2720 AUS-W AGTTGAAGAC TCCTACCAAG AATCACATTG TGCTTGGTAA TTCTGGTGAT CCTAAGTACG TTGACCTGCC GACTCTTGAG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 2800 AUS-W TCTGATTCGA TGTACATAGC CAAGAAGGGT TATTGCTACA TGAACATCTT TTTGGCGATG CTTATAAACA TACCCGAGAA
186
AUS-P ---------- ---------- ---------- --------T- ---------- ---------- --C------- ---------- 2880 AUS-W TGAGGCGAAA GACTTCACAA AGAGAGTTCG TGACCTTGTG GGTTCAAAAC TTGGAGAGTG GCCAACGATG TTGGATGTAG AUS-P ---------G ------C--- ---------- ---------- ---------- ---------- ---------- --A------- 2960 AUS-W CAACATGCGC AAATCAGCTA ATAATCTTTC ATCCTGACGC GGCCAACGCA GAATTGCCGC GAATTCTAGT GGACCACCGA AUS-P ---------- ---------G ---------- ---------- ---------- ---------- ---------- C--------- 3040 AUS-W CAGAAAACAA TGCATGTCAT TGACTCTTTT GGGTCCGTGG ATTCTGGATA TCATGTATTG AAAGCAAACA CAGTTAATCA AUS-P ---------- ---------- ---------- ---------- ---------- ----A----- ---------- ---------- 3120 AUS-W GCTGATCCAA TTCGCTAGGG AGCCACTCGA TAGCGAGATG AAGCACTACA TTGTCGGTGG AGAGTTTGAC CCGACTACTA AUS-P ---------- ---------- -T-----T-- ---T------ ---------- ---------- ---------- ---------- 3200 AUS-W ACTGCTTGCA TCAGTTGATT CGTGTCATCT ATAAGCCTCA TGAACTCCGG AACTTGCTCA GGAATGAACC ATACCTGATT AUS-P ---------- ---------- -----T---- -C-----C-- ---------A ---------- ---------- ------A--- 3280 AUS-W GTGATTGCAT TGATGTCACC AAGTGTACTT TTAACTTTGT TCAATAGTGG TGCGATTGAG CACGCGTTGA ATTATTGGAT AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 3360 AUS-W CAAAAGGGAT CAAGATGTTG TTGAGGTCAT TATTTTAGTG GAGCAATTAT GCAGAAAAGT GACGCTTGCT AGAACAATCC AUS-P ---------- --G------- ----A----- -G-------- ---------- ----G----- ---------- ---------- 3440 AUS-W TGGAGCAGTT CAATGAAATT CGTCAAAATG CGAGAGATAT ACATGAGCTA ATGGATCGAA ACAATAAGCC TTGGATTTCA AUS-P ---------- T--------- ---------- ---------- ---------- ---------- ---------- ---------- 3520 AUS-W TATGATCGCT CATTGGAACT ATTGAGTGTG TATGCAAATT CGCAGTTGAC GGATGAAGGT CTGTTCAAGC AAGGCTTTTC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---C------ ----A----- 3600 AUS-W AACATTAGAC CCTAAGTTGC GTGAAGCTGT GGAAAAAACC TACGCCACCC TATTGAAGGA AGAGTGGCGT GCGTTAAGTT AUS-P ---------- ---------- ---------- ---------- ---------- -----C---- ---------- ---------- 3680 AUS-W TGTTTCAAAA GTTGCACTTA AGGTACTTTG CATTCAAGTC ACAACCGTCT TTTTCCGAGT ATTTAAAGCC AAAAGGGCGC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ----------
187
3760 AUS-W GCAGATTTAA AAATTGTATA CGACTTCTCA CCGAAGTATT GTGTACACGA GGTCGGGAAG GCGTTGTTAC AGCCAGTCAA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 3840 AUS-W GGCCGGGGCT GAATTCACGT CGCGAATCAT TAATGGTTGC GGAACTTTCA TTCGGAAGAG TGCCGCAAGA GGCTGTGCTT AUS-P ---------- ---------- ---------- ----A----- ---------G ---------- ---------- ---------- 3920 AUS-W ACATTTTCAA GGATCTTTTC CAGTTTGTAC ATGTAGTACT AGTTTTAAGC ATTTTATTAC AAATTTTTAG GAGTGTGCAA AUS-P ---------G ---------- ---------- ---------- ---------- ---------- ---------- --A------- 4000 AUS-W GGAATTGCCA CAGAGCATAT ACAATTGAAG CAGGCGAAGG CAGAAATGGA GAAACAGGAG GATTTTGATC GTCTGGAGGC AUS-P -------T-- ---------- ---------- -----A---- ---------- -------A-- -----CA--- ---------- 4080 AUS-W TTTATACGCT GAACTGTGCG TTAAGATCGG TGAGCAACCA ACTGCTGAAG AATTTCTTGA TTTTGTGATG GAGCGTGAAC AUS-P ---------- ---------A ---------- ---------- ---------- ---------- ---------- ---------- 4160 AUS-W CAAGGCTGAA GGATCAAGCT TATAGTTTAA TCCACATACC AGTGATTCAT CAAGCAAAAT CGGACAATGA GAAAAAGCTC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 4240 AUS-W GAGCAAGTCA TTGCATTTAT TACATTAATT TTAATGATGG TCGACGTGGA CAAGAGCGAT TGTGTTTACA GAATCTTGAA AUS-P ---------- ---------- ---------- ---------- -T-------- ---------- ---------- ---------- 4320 AUS-W TAAGTTTAAA GGCGTGATAA ACTCTTGCAA CACAAATGTT TATCACCAGT CTTTAGATGA CATTAAGGAT TTCTATGAAG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 4400 AUS-W ACAAGCAGTT GACTATTGAC TTCGATATCA CTGGAGAAAA TCAGATCAAT AGAGGACCTA TAGACGTTAC ATTCGAGAAA AUS-P ---------- ---------T ---------- ---------- ---------- ---------- ---------- ---------- 4480 AUS-W TGGTGGGATA ACCAATTGTC CAACAACAAC ACAGTTGGCC ATTATCGAAT TGGGGGAATG TTCGTTGAAT TTTCACGGAG AUS-P ---------- ---------- ---------- ---------- ---------- --------CA ---A------ ---------- 4560 AUS-W TAATGCAGCC ACTGTAGCTA GTGAGATAGC TCATAGTCCT GAGCGTGAGT TTCTAGTTCG CGGAGCTGTT GGTAGTGGTA AUS-P --C------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 4640 AUS-W AATCAACGAA TCTACCTTTC TTACTTAGTA AGCATGGCAG CGTGCTGTTA ATAGAGCCCA CCAGACCTCT TTGCGAGAAC
188
AUS-P ---------- ---------- ---------- -----A-T-- ---------- ---------- ---------- ------A--- 4720 AUS-W GTTTGTAAGC AACTACGTGG TGACCCATTC CATTGCAATC CAACCATTCG CATGCGTGGG TTAACGGCTT TCGGTTCTAC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 4800 AUS-W CAACATCACG ATAATGACAA GCGGATTTGC TTTACATTAT TACGCTCACA ACATTCAGCA ATTGAGGCTC TTTGATTTCA AUS-P A--------- ---------- ---------- ---------- ---------- -------A-- ---------- ---------- 4880 AUS-W TAATTTTTGA TGAATGTCAT GTCATAGATA GCCAAGCCAT GGCCTTCTAC TGCCTTATGG AGGGGAACGC TGTTGAGAAA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- -A-------- 4960 AUS-W AAGATTCTCA AAGTTTCTGC CACGCCACCT GGGCGTGAGG TTGAGTTTTC AACACAATTC CCAACAAAAA TTGTAACTGA AUS-P --------T- ---------- ---------- ---------- ---------- ---------- --G-----G- ---------- 5040 AUS-W ACAATCCATA AGCTTTAAAC AGTTGGTTGA CAACTTCGGT ACTGGTGCGA ATAGTGATGT GACTGCCTTT GCTGACAACA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 5120 AUS-W TATTAGTTTA TGTCGCGAGT TACAATGAAG TGGATCAACT AAGTAAGCTC TTATCCGATA AAGGCTACTT GGTCACTAAA AUS-P ---------- ---------- ---------- ---------- ---------- --G------- ---------- ---------- 5200 AUS-W ATCGATGGAA GAACGATGAA AGTTGGAAAG ACTGAAATTT CTACTAGTGG CACAAAATCC AAAAAGCATT TCATAGTTGC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 5280 AUS-W CACAAATATC ATCGAGAACG GCGTCACACT TGACATAGAA GCTGTCATAG ATTTTGGGAT GAAAGTAGTA CCTGAGATGG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 5360 AUS-W ATTCAGACAA TCGCATGATT CGGTACTCGA AGCAAGCAAT CAGTTTTGGA GAGAGAATTC AAAGACTTGG GCGAGTGGGA AUS-P ---------- ---------- --------A- ---------- ---------- ---------- ---------- ---------- 5440 AUS-W AGACACAAAG AAGGAATTGC ACTAAGAATT GGACACACGG AGAAAGGCAT TCAAGAAATT CCAGAGATGG CAGCTACTGA AUS-P ---------- ---------- ---------- ---------- -------T-- ---------- ---------- ---------- 5520 AUS-W GGCAGCTTTT CTGAGCTTCA CGTATGGCTT GCCTGTTATG ACGCACAATG TAGGGTTAAG CTTGCTCAAA AACTGCACTG AUS-P A--------- T--------- ---------- ---------- --T------- ---------- ---------- ----------
189
5600 AUS-W TGAGACAAGC ACGTACAATG CAACAGTACG AACTAAGCCC GTTCTTCACA CAAAATTTAG TTAACTTCGA TGGAACAGTA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- -A-------- ---------- 5680 AUS-W CACCCCAAGA TTGATGTTCT GTTACGCCCT TATAAACTGA GAGATTGTGA AATCAGGTTA AGTGAAGCAG CGATACCGCA AUS-P ---------- ---------- ---------- -----G---- ---------- ---------- ---------- ---------- 5760 AUS-W TGGGGTGCAG TCTATTTGGA TGTCTGCTCG AGAGTATGAA GCAGTTGGAA GCCGTCTTTG CCTAGAAGGC GATGTCAGAA AUS-P ---------- ---------- ---------- ---------- ---------G ---------- ---------T ---------- 5840 AUS-W TACCGTTCCT CATTAAAGAT GTTCCTGAGC GATTATACAA GGAACTGTGG GATATCGTGC AGACATATAA GCGTGACTTT AUS-P ---------- ------G--- ---------- -G-------- ---------- ---------- ---------- ---------- 5920 AUS-W ACATTTGGGC GAATTAATTC TGTATCCGCT GGGAAAATTG CGTACACATT AAGAACTGAT GTATATTCTA TTCCCAGAAC AUS-P ---------- -G-------- ---------- ---------- ---------- ---------- --G------- ---------- 6000 AUS-W TCTCATAACA ATTGACAAAC TGATTGAGAG TGAAAACATG AAGCATGCCC ATTTTAAAGC TATGACAAGT TGCACTGGCC AUS-P ---------- ---------- ---------- ---------- ---------- -C-------- ---------- ---------- 6080 AUS-W TAAACTCTAG CTTCTCTCTC CTTGGTATCA TAAACACTAT CCAGAGTAGA TACCTAGTTG ACCATTCAGT TGAAAATATC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 6160 AUS-W AGAAAACTTC AGCTGGCAAA GGCCCAGATC CAACAACTCG AAGCTCATGT GCAAGAGAAC AACGTTGAGA ATTTGATTCA AUS-P ---------- -------G-- ---------- ---------- ---------- ---------- --T------- -C-------- 6240 AUS-W ATCTCTTGGT GCTGTCAGAG CTGTTTATCA TCAAGGTGTT GATGGAGTTA AGCACATAAA GCGAGAGTTG GGCTTGAAAG AUS-P ---------- ---------- ---------- ----A----- ---------- ---------- ---------- ---------- 6320 AUS-W GAATTTGGGA TGGCTCATTG ATGATTAAGG ATGCGATTAT ATGCGGTTTC ACAATGGTTG GCGGTGCGAT GCTCTTGTAC AUS-P --C------- ---------- ---------- ---------- ---------- -------C-- ---------- ---------- 6400 AUS-W CAACACTTTC GTGATAAGCT TATAAATGTT CATGTGTTTC ACCAAGGTTT CTCTGCGCGA CAGCGGCAAA AGTTAAGATT AUS-P ---------- ---------- --C------- ---------- ---------- ---------- -----A---- ----G----- 6480
190
AUS-W TAAGTCAGCA GCAAATGCTA AGCTTGGTCG AGAGGTTTAT GGAGATGATG GGACCATTGA GCACTATTTC GGAGAAGCGT AUS-P ---------- ---------- ---------- ---------- ---------- -------C-- ---------- ---------- 6560 AUS-W ACACGAAGAA AGGAAACAAG AAAGGAAAGA TGCATGGCAT GGGTGTCAAA ACGAGAAAAT TCGTTGCGAC ATATGGATTT AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 6640 AUS-W AAACCAGAGG ATTACTCGTA CGTGCGGTAC TTGGATCCTT TAACAGGTGA GACTTTGGAT GAAAGCCCAC AAACTGACAT AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 6720 AUS-W CTCAATGGTG CAAGAGCATT TTGGTGATAT TCGGAGTAAG TATATGGATT CAGACAGCTT CGACAAGCAG GCTTTAATAG AUS-P ---------- ---------- -------C-- ---------- ---------- ---------- ---------- -T-------- 6800 AUS-W CAAACAATAC AATTAAGGCC TATTACGTCC GAAACTCCGC GAAAACAGCA TTGGAAGTCG ATTTGACACC GCACAACCCT AUS-P ---------- G--------- --------T- ---------- ---G------ ---------- ---------- ---------- 6880 AUS-W CTGAAAGTCT GTGATAACAA ATTGACCATT GCAGGATTTC CTGACAGGGA AGCTGAGCTG AGACAGACAG GCCCGCCCAG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 6960 AUS-W AACTATTCAA TTCGATCAAG TTCCACCACC CTCGAAATCA GTTCATCATG AAGGAAAAAG TCTTTGTCAA GGTATGAGGA AUS-P ---A------ G-T------- ---------- ---------- ---------- ---------- ---------- --------A- 7040 AUS-W ATTACAATGG CATAGCTTCT GTGGTTTGTC ATTTGAAAAA CACATCAGGA GATGGGAGGA GCCTATTTGG AATTGGATAC AUS-P ---------- ---------- ---------- ---------- ---------- -------A-- ---------- ---------T 7120 AUS-W AATTCATTCA TCATCACAAA CCGACATTTG TTTAAGGAGA ATAATGGTGA ACTTATAGTG CAATCCCAAC ACGGTAAGTT AUS-P ---------- ---------- ---------- ------A--- ---------- ---------- ---------- ---------- 7200 AUS-W TGTTGTCAAG AACACCACAA CGCTTCGAAT TGCTCCAGTT GGAAAGACTG ATCTTCTAAT CATTCGGATG CCGAAAGATT AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 7280 AUS-W TTCCTCCATT CCATAGCAGA GCTAGGTTTA GGGCCATGAA AGCTGGGGAC AAGGTTTGCA TGATAGGTGT TGACTACCAA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 7360 AUS-W GACAATCATA TCGCGAGCAA AGTATCTGAG ACTTCTATCA TCAGCGAAGG CACGGGAGAG TTTGGATGTC ACTGGATATC AUS-P --T------- ---------- ---------- ---------- ---------- --T------- ---------- ----------
191
7440 AUS-W CACGAATGAC GGTGATTGTG GTAATCCACT AGTTAGTGTT TCAGATGGTT TTATTGTTGG CTTGCATAGT TTATCGACAT AUS-P ---------- --------C- ---------- ---------- ---------- ---------- ---------- ---------- 7520 AUS-W CAACTGGAGA TCAAAATTTC TTCGCTAAAA TACCCGCGCA ATTTGAAGAG AAGGTTCTGA GGAAAATTGA TGATCTAACT AUS-P ----C----- ---------- ---------- -------A-- ---------- --TA------ ---------- ---------- 7600 AUS-W TGGAGTAAAC ACTGGAGCTA CAATGTTAAT GAATTGAGTT GGGGAGCTCT TAAAGTGTGG GAAAGTCGGC CCGAAGCAAT AUS-P -----C---- ---------- ------C--- ---------- ---------- ---------- ---------- ---------- 7680 AUS-W TTTTAATGCA CAAAAAGAAG TTAATCAATT GAATGTTTTC GAGCAAAGTG GTAGTCGTTG GCTCTTTGAC AAATTACACG AUS-P ---------- ---------- ------G--- ---------- ---------- ------A--- ---------- ---------- 7760 AUS-W GTAATTTGAA AGGTGTAAGC TCCGCTTCCA GCAATTTGGT GACGAAGCAC GTTGTTAAAG GTATTTGTCC TCTCTTTAGG AUS-P ---------- ---------- ---------- ---------- ---A------ ---------- ---------- ---------- 7840 AUS-W AATTACCTCG AGTGTAATGA GGAGGCTAAG GTTTTCTTCA TTCCACTTAT GGGTCACTAC ATGAAGAGTG TTCTGAGCAA AUS-P ---------- -----G---- ---------- ---------- A--------- ------T--- ---------- ---------- 7920 AUS-W GGAAGCATAC ACTAAGGATT TATTGAAATA TTCAAGTGAC ATTGTCGTTG GAGAAGTTAA TCACGATGTT TTTGAGGATA AUS-P ---------- -T-------- ---------- ---------- ---------- ---------- C--------- ---------- 8000 AUS-W GTGTTGCGCA AGTTATCGAG CTGTTAAATG ATTACGAGTG TCCCGAACTT GAATACATTA CAGACAGCGA AGTGATTATA AUS-P ---------- ----G----- ---------- --C----A-- ---------- --------C- ---------- ---------- 8080 AUS-W CAGGCCTTGA ACATGGATGC AGCTGTTGGA GCCTTATACA CGGGAAAGAA AAGGAAATAT TTTGAGGGGT CAACAGTGGA AUS-P ---------- ---------- --------TG --------T- ---------- ---------- ---------- ---------- 8160 AUS-W GCATAGGCAA GCTCTTGTAC GGAAAAGCTG TGAACGTCTC TACGAAGGGA AAATGGGCGT CTGGAACGGT TCGTTAAAGG AUS-P ---------- ---------- ---------- ---G------ ---------- ---------- ---------- ---------- 8240 AUS-W CTGAGCTGAG ACCAGCTGAA AAAGTGCTCG CGAAAAAGAC AAGGTCATTT ACAGCAGCTC CTCTTGACAC ACTGTTAGGA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- -T-------- 8320
192
AUS-W GCCAAAGTCT GCGTTGATGA TTTCAACAAC TGGTTCTACA GTAAAAATAT GGAATGCCCA TGGACCGTTG GAATGACAAA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 8400 AUS-W ATTTTACAAA GGCTGGGACG AGTTTCTGAG GAAATTTCCT GATGGCTGGG TGTATTGTGA TGCGGATGGC TCTCAGTTCG AUS-P ---------- ---------- ---------- ---------C --C------- ---------- ---------- ---------- 8480 AUS-W ATAGCTCATT AACACCATAC TTGTTGAATG CTGTGCTATC AATTCGGTTA TGGGCGATGG AGGACTGGGA TATTGGAGAA AUS-P ---------- --T------T ---------- ---------- ---------- ---------- ----T----- ---------- 8560 AUS-W CAAATGCTTA AAAACCTGTA TGGGGAAATC ACTTACACGC CAATTTTGAC ACCAGACGGA ACAATTGTTA AAAAGTTTAA AUS-P --------C- ---------- ---------- -----T---- -G-------- ------T--- --------C- ---------- 8640 AUS-W AGGGAATAAT AGTGGCCAAC CTTCGACGGT TGTCGACAAT ACATTGATGG TTCTAATCAC AATGTATTAT GCGCTGCGGA AUS-P ---------- ---------- -------A-- ---------- ---------- ---------- ---------- ---------- 8720 AUS-W AGGCTGGTTA CGATACAAAG GCCCAAGAAG ATATGTGTGT ATTTTATATA AATGGTGATG ATCTCTGTAC TGCCATTCAC AUS-P ---------- ----G----- A-----A--- ---------- ---------- ---------- ---------T ---------- 8800 AUS-W CCGGATCATG AACATGTTCT TGACTCATTC TCTAGTTCAT TTGCTGAGCT TGGGCTTAAG TATGATTTCA CACAAAGGCA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 8880 AUS-W CCGGAATAAA CAGGATTTGT GGTTTATGTC GCATCGAGGT ATTCTGATTG ATGATATTTA CATTCCGAAA CTTGAACCTG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 8960 AUS-W AGCGAATTGT TGCAATTCTT GAATGGGACA AATCTAAGCT TCCGGAGCAT CGATTGGAAG CAATCACAGC AGCAATGATA AUS-P ---------- ---------- ---------- ----A----- ---------- --------G- ---------- ---------- 9040 AUS-W GAGTCATGGG GTTATGGTGA GTTAACACAA CAGATTCGCA GATTCTACCA ATGGGTTCTC GAGCAAGCTC CATTCAATGA AUS-P ---------- -------C-- ---------C --A------- ---------- ---------- ---------- ---------- 9120 AUS-W GTTGGCGAAA CAAGGAAGGG CTCCATACGT CTCGGAAGTT GGATTGAGAA GACTGTACAC AAGTGAACGT GGATCAATGG AUS-P ---------- ---------- ---------- ---------- ---------- --T------- ----A----- ---------- 9200 AUS-W ATGAATTGGA AGCGTATATA GACAAATACT TTGAGCGTGA GAGGGGAGAC TCACCCGAAC TACTGGTATA TCATGAATCA AUS-P ---------- ---------- --T------- -------C-- ---------- ---------- ---------- ----------
193
9280 AUS-W AGGAGTGTTG ATGATTATCA ACTTGTTTGT AGTAACAATA CACACGTGTT TCATCAGTCC AAAAATGAAG CTGTGGATGC AUS-P -----C-C-- -C-------- ---------- ---------- ---------- C--------- ---------- ---------- 9360 AUS-W TGGTTTGAAC GAAAAGCTCA AAGAAAAAGA AAAACAGAAA GAAAAAGAAA AAGAAAAACA AAAAGAGAAA GAAAAAGACG AUS-P ---------- ---------- G--------- ---------- ---------- ---------- ---------- ---------- 9440 AUS-W ATGCTAGTGA CGGAAATGAT GTGTCAACTA GCACAAAAAC TGGAGAGAGA GATAGAGATG TCAATGTTGG GACCAGTGGA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 9520 AUS-W ACTTTCACTG TTCCAAGAAT CAAATCATTT ACTGACAAGA TGATTCTACC AAGAATTAAG GGAAAGACTG TCCTTAATTT AUS-P ---------- ---------- ---------- -----T---- ---------- ---------- ------C--- ---------- 9600 AUS-W AAATCACCTT CTTCAGTATA ACCCGCAACA AATTGACATT TCTAACACTC GTGCCACCCA GTCACAATTT GAGAAGTGGT AUS-P ---------- ---------- -T-------- ---------- ---------- -------T-- ---------- ---------- 9680 AUS-W ATGAGGGAGT GAGGAATGGT TATGGCCTTA ATGATAATGA AATGCAAGTG ATGCTAAATG GCTTGATGGT TTGGTGTATC AUS-P ---------- --------A- ---------- ---------- ---------- ---T------ ---------- ---------- 9760 AUS-W GAGAATGGTA CATCTCCAGA CGTATCTGGT GTCTGGGTTA TGATGGATGG GGAAACCCAA GTTGATTATC CAATCAAGCC AUS-P ---------- ---------- TA-------C --T------- ---------- ---------- ---------- ---------- 9840 AUS-W TTTAATTGAA CATGCTACTC CGACATTTAG GCAAATTATG GTTCACTTTA GTAACGCGGC AGAAGCATAT ATTGCAAAGA AUS-P ------C--G ---------- --T------- ---------- -C-------- ---------- ---------- ---------- 9920 AUS-W GAAATGCTAC TGAGAGGTAC ATGCCGCGGT ATGGAATCAA GAGAAATTTG ACTGACATTA GCCTCGCTAG ATACGCTTTC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ----A----- ---------- 10000 AUS-W GATTTCTATG AGGTGAATTC GAAAACACCT GATAGGGCTC GCGAAGCTCA CATGCAGATG AAAGCTGCAG CGCTGCGAAA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 10080 AUS-W CACTAGTCGC AGAATGTTTG GTATGGACGG CAGTGTTAGT AACAAGGAAG AAAACACGGA GAGACACACA GTGGGAGATG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ----A----- 10160
194
AUS-W TCAATAGAGA CATGCACTCT CTCCTGGGTA TGCGCAACTG AATACTCGCA CTTGTGTGTT TGTCGGGCCT GGCTCGACCT AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 10240 AUS-W TGTTTCACCT TATAGTACTA TATAAGCATT AGAATACAGT GTGGCTGCGC CACCGCTTCT ATTTTACAGT GAGGGTAGCC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 10320 AUS-W CTCCGTGCTT TTAGTATTAT TCGAGTTCTC TGAGTCTCCA TACAGTGTGG GTGGCCCACG TGCTATTCGA GCCTCTTAGA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 10321 AUS-W ATGAGAG AUS-P -------