Design and Synthesis of Small Molecule Agonists Targeting Type I

Interferon and Vitamin D Receptors

by

Joseph M. Keca

A thesis submitted in conformity with the requirements for the degree of Master of Science

Pharmaceutical Sciences University of Toronto

© Copyright by Joseph M. Keca (2014)

ii

DESIGN AND SYNTHESIS OF SMALL MOLECULE

AGONISTS TARGETING TYPE I INTERFERON AND

VITAMIN D RECEPTORS

ABSTRACT

Small molecule agonists were designed and synthesized for two receptor systems: (i) type I

interferon-α/β-receptor (IFNAR), a heterodimeric cell-surface transmembrane receptor; and

(ii) the vitamin D receptor (VDR), a nuclear membrane bound receptor. As part of the first

project, 18 compounds were designed, carrying specific functionalities, and were synthesized

targeting IFNAR. A candidate compound exhibited antiviral activities and induced interferon-

inducible genes, implying their agonist-like interactions at the receptor. As part of the second

project, synthetic strategies were investigated for the synthesis of three hit compounds as

potential agonists of VDR to enable accessibility to target compounds. Three hit molecules

belonging to the class of pyrimidines were synthesized. This thesis outlines the functional

group modifications for exploring agonist activities using rational approaches.

iii

ACKNOWLEDGEMENTS

I would like to take this opportunity to extend my gratitude to the members of the Kotra group,

particularly Dr. Angelica Bello for her perpetual mentorship and guidance. I would also like to

thank my committee members, Dr. Eleanor Fish and Dr. Christine Allen, for the patience and

guidance throughout the completion of my degree. Finally, and most importantly, I want to

extend my most sincere thank you to my supervisor, Dr. Lakshmi Kotra, for giving me the

opportunity many others dream of, and for continually believing in me. The teachings and

preparations you have given me will carry throughout my life, and I am incredibly grateful for

them.

iv

TABLE OF CONTENTS

ABSTRACT ............................................................................................................................... ii  

ACKNOWLEDGEMENTS ........................................................................................................ iii

CHAPTER 1: INTRODUCTION……………………………………………………………….x

CHAPTER 2: DESIGN AND SYNTHESIS OF SMALL MOLECULE AGONISTS TO THE

TYPE I INTERFERON RECEPTOR…………………………………………………………...1

ABSTRACT ................................................................................................................................. 1  

1.   INTRODUCTION ................................................................................................................ 2  

1.1 The Interferon Family of Cytokines ........................................................................................ 2  

1.2 The Binding Event Between Type I IFN-α and its Heterodimeric Cell Surface Receptor ..... 2  

1.3 Clinical Applications and Limitations of Type I IFNs ............................................................ 4  

1.4 Protein-Protein Interactions: Intricacies and Difficulties in Mimicry ..................................... 5  

1.6 Utilization of In Silico Screening for the Identification of IFN-α Mimetics .......................... 9  

1.7 Hypothesis ............................................................................................................................. 10  

1.8 Development of IFN-α2a Mimetics ...................................................................................... 11  

2.   RESULTS AND DISCUSSION ......................................................................................... 12  

2.1 Chemistry ............................................................................................................................... 12  

2.2 Regiochemistry Determination .............................................................................................. 19  

2.3 EMCV Cytopathic Effect (CPE) Reduction .......................................................................... 21  

2.4 Cytotoxicity in CHO Cells .................................................................................................... 21  

2.5 IFN-Stimulated Genes (ISG) Expression .............................................................................. 23  

2.6 Phosphorylation of Tyk2 ....................................................................................................... 23  

2.7 Physicochemical Properties Determination ........................................................................... 24  

3.   CONCLUSION .................................................................................................................. 27  

v

4.   EXPERIMENTAL SECTION ............................................................................................ 27  

5.   APPENDIX ........................................................................................................................ 42  

CHAPTER 3: DESIGN AND SYNTHESIS OF NON-SECOSTEROIDAL AGONISTS

TARGETING THE NUCLEAR MEMBRANE BOUND VITAMIN D RECEPTOR .............. 50  

ABSTRACT ............................................................................................................................... 50  

6.   INTRODUCTION .............................................................................................................. 51  

5.1 Physiological Implications of Vitamin D .............................................................................. 51  

5.2 VDR Activation and Modulation of Cholesterol ................................................................... 53  

5.3 Limitations of Dietary Vitamin D and 1,25D in Treating Hypercholesterolemia ................. 53  

5.4 Rationale ................................................................................................................................ 54  

5.5 Hypothesis ............................................................................................................................. 55  

7.   RESULTS AND DISCUSSION ......................................................................................... 57  

6.1 Synthetic Approach of 6-(pyridin-4-yl)pyrimidine Rings Using Substitutions and

Cyclocondensations ..................................................................................................................... 57  

6.2 Suzuki Cross-Coupling Approach in the Formation of 2,4-dichloro-6-(pyridin-4-

yl)pyrimidine ............................................................................................................................... 59  

6.3 Synthetic Approaches to 2,4-dichloro-6-(pyridin-4-yl)pyrimidine Moiety Utilizing Uracil

as a Building Block ...................................................................................................................... 64  

6.4 Construction of 6-(pyridin-4-yl)pyrimidine Moiety with 2-Chloropyrimidine as a Core

Building Block ............................................................................................................................. 66  

6.5 Synthetic Strategy Involving the Construction of the Pyrimidine Core via Cyclization of

3-Ketoesters and Amidines to Afford KP-156 and KP-172 ........................................................ 68  

6.6 Implementation of Amidine and 3-Ketoester Cyclization to Afford KP-162 ....................... 71  

8.   CONCLUSION .................................................................................................................. 73  

9.   EXPERIMENTAL SECTION ............................................................................................ 73  

CHAPTER 4: CONCLUSIONS AND FUTURE DIRECTIONS. .................................................. 85  

vi

10.   REFERENCES ................................................................................................................ 93  

11.   APPENDIX ..................................................................................................................... 93

vii

List of Figures

Figure 1. Computational model of IFN-α and IFNAR complex. ..................................................... 9  

Figure 2. General structural core of homodimeric structure, leading to hit compounds, hit

compound 1 and hit compound 2. ................................................................................................... 10  

Figure 3. Cartoon representation of IFN-αCon1. ........................................................................... 11  

Figure 4. 2D NOESY NMR spectrum of 4c (Panel A) and 4e (Panel B), confirming the

predicted N1,N1’ regiochemistry. .................................................................................................... 20  

Figure 5. Real-time PCR evaluation of Daudi cells treated for 16 hours with 5 ng/mL IFN-

αcon1 and with 500 µM of candidate compound 4e. The IFN-induced genes ISG15 (A), PKR

(B), and OAS1 (C) were evaluated for elevated expression. ........................................................... 24  

Figure 6. Biosynthetic, photochemical production of vitamin D3 in the skin. ............................... 51  

Figure 7. Metabolism and subsequent activation of vitamin D3 into 1,25D. .................................. 52  

Figure 8. Selected hit compounds identified through in silico screening with potential VDR

agonist activity. ................................................................................................................................ 55  

viii

List of Schemes

Scheme 1. Synthesis of bis-phenyltetrazole derivatives. ................................................................ 13  

Scheme 2. Synthesis of alkyl halide building blocks, reagents and conditions .............................. 14  

Scheme 3. Mechanistic hypotheses for the addition of hydrazoic acid/azide ion to a nitrile to

give a tetrazole. ................................................................................................................................ 17  

Scheme 4. Two different isomers of tetrazole, the 1,5- and 2,5-disubstituted, can be formed

through the concerted cycloaddition. ............................................................................................... 18  

Scheme 5. Retrosynthetic analysis of VDR agonist hit compounds.. ............................................. 56  

Scheme 7. Formation of C-6 para-pyridine substituted pyrimidine using Suzuki-Miyaura

transition metal mediated cross-coupling. ....................................................................................... 61  

Scheme 8. Synthetic approaches utilizing uracil substitution methodologies. ............................... 65  

Scheme 9. Synthesis of pyrimidine core using 2-chloropyrimidine as a central building block. ... 67  

Scheme 10. Refined approach at the generation of VDR agonists using amidine intermediates

for cyclizations, affording KP-156 and KP-172. ............................................................................. 70  

Scheme 11. Synthesis of KP-162 utilizing 3-ketoester and amidine cyclization protocol. ............ 72  

ix

List of Tables

Table 1. Synthesized library of bis-phenyltetrazole derivatives. .................................................... 15  

Table 2. Antiviral activities of compound 4 series based upon maximal cytopathic effect

reduction against EMCV. ................................................................................................................ 22  

Table 3. Experimentally determined physicochemical properties of biologically active

compounds. ...................................................................................................................................... 26  

Table 4. Purity data for synthesized library. ................................................................................... 42  

Table 5. HPLC gradient methods using methanol (0.05% TFA) in water (0.05% TFA) for

purity measurements. ....................................................................................................................... 44  

Table 6. HPLC gradient methods using acetonitrile (0.05% TFA) in water (0.05% TFA) for

purity measurements. ....................................................................................................................... 45  

Table 7. HPLC isocratic methods using methanol (0.05% TFA) in water (0.05% TFA) for

purity measurements. ....................................................................................................................... 45  

Table 8. HPLC isocratic methods using acetonitrile (0.05% TFA) in water (0.05% TFA) for

purity measurements. ....................................................................................................................... 45  

Table 9. HRMS data for bis-phenyltetrazole derivatize series. ...................................................... 46  

Table 10. Suzuki-Miyaura cross-coupling trials incorporating a variety of palladium catalysts,

bases, solvents, and reaction conditions. ......................................................................................... 62  

x

CHAPTER 1: INTRODUCTION

Small molecule agonist drug design is a challenging area of drug discovery, which was

attempted an applied for different biological systems. The molecular design approach was used

in small molecule agonist design, for two different receptor systems: (i) type I interferon-α/β-

receptor (IFNAR), a heterodimeric cell-surface transmembrane receptor; and (ii) the vitamin D

receptor (VDR), a nuclear membrane bound receptor. The first project focused on mimicking

the protein-protein interactions between type I interferon (IFN) and IFNAR, using a small

molecule agonist. Using data obtained from previous in silico screenings, hit compounds were

obtained a used as a template to generate compound libraries with potential agonist activity.

The second project investigated non-secosteroidal VDR agonists, with potential applications in

managing patients with hypercholesterolemia. KP-156, KP-162, and KP-172 were lead

compounds obtained through previous in silico screenings by the Kotra group, and were

subsequently resynthesized in house to confirm the observed VDR agonism.

While these two projects differ in receptor systems, the end goal of small molecule agonist

discovery remains synonymous between them. Each project aims to develop a small molecule

agonist, to circumvent the issues associated with the endogenous ligands. For IFNAR, IFN-α2a

is a clinically relevant therapeutic, particularly in HCV treatment. Limitations associated with

this are pharmacokinetic and fiscal barriers. An orally bioavailable small molecule IFNAR

agonist would have important clinical applications for HCV treatment. For VDR and its

endogenous ligand calcitriol (ROCALTROL®), the current clinical indications for

ROCALTROL® include the management of hypocalcemia and its clinical manifestations in

patients with hypoparathyroidism.55 It is also indicated in the management of secondary

hypoparathyroidism and resultant metabolic bone disease in patients with chronic renal failure

(both predialysis and dialysis patients).56 One of the major limitations of calcitriol treatment is

the hypercalcemic effects associated with it.57 For both of these receptor systems, and the

limitations associated with their endogenous ligands, these projects both aim to develop a small

molecule agonist to potentially circumvent these issues.

1

CHAPTER 2: DESIGN AND SYNTHESIS OF SMALL

MOLECULE AGONISTS TO THE TYPE I INTERFERON

RECEPTOR

ABSTRACT

Interferons (IFNs) are cytokines, classified into types I, II, or III. The type I IFNs, IFNs-α/β,

exhibit pleiotropic activities, including antiviral, growth inhibitory, and immunomodulatory

activities. Interferon-α2a, an FDA approved therapeutic, is a type I IFNα, and binds its cognate

cell surface receptor, interferon-αβ receptor (IFNAR).IFNAR is a heterodimer comprised of two

single, transmembrane spanning proteins, IFNAR1 and IFNAR2, with JAK1 and TYK2 in the

cytoplasmic domain. IFN activation of IFNAR requires engagement and binding of both subunits

to elicit a cascade of signaling events in the cell.

In this chapter, the design and synthesis of bis-phenyltetrazole based non-peptidic small molecules

are investigated for IFN-like activity. Utilizing the molecular design approach, a library of 18

compounds were synthesized. These compounds are symmetrically substituted bis-phenyltetrazole

structures with a diethylether linker connecting the functional moieties mimicking IFN surface

residues. All compounds were evaluated for their antiviral activities, which is a functional end

point, followed by testing for IFN-inducible genes. Compound 4e demonstrated antiviral activity

against EMCV with an EC50 of 0.5 ± 0.2 µM. This compound was also shown to activate Tyk2

phosphorylation, as well as induce IFN-inducible genes.

Declaration of work: All synthetic routes, synthesis of library, characterizations, physiochemical

properties, and purity analysis was performed by Joseph M. Keca. In silico screenings were

performed by Dr. William Wei, and biological evaluations were performed by the Fish group.

2

1. INTRODUCTION

1.1 The Interferon Family of Cytokines

A particular family of cytokines that has received considerable attention in recent years, due to

immunomodulating activity, is interferons (IFNs).1 IFNs bind to one large receptor subgroup, the

type I and type II cytokine-receptor superfamily. This receptor is also known to bind a variety of

interleukins and colony-stimulating factors.2 IFNs are categorized into three distinct classes: type

I, type II, and type III IFN. In humans, the type I IFN family is composed of 16 different

members, with the majority being 12 IFNα subtypes, IFNβ, IFNε, IFNκ, and IFNω.3 The type I

IFNs are of prime focus for research, due to their protective role against viral infection. Similarly,

the type II IFN family exhibits antiviral activities, however, is comprised of one cytokine, IFNγ.

Finally, the type III IFN class is comprised of the IFNλ family, specifically being IFNλ1

(interleukin-29, IL-29), IFNλ2 (interleukin-28A, IL-28A), and IFNλ3 (interleukin-28B, IL-28B).4

There are marked differences in protein sequences and structures among type III IFNs and type I

and type II IFNs. Type III IFNs exhibit greater similarity to members of the interleukin-10 (IL-10)

family. Regardless of this structural similarity, type III IFNs still elicit the same antiviral

responses and induce the activation of IFN-stimulated genes (ISGs), making them most similar to

type I IFNs.5 The activation of these genes has recently been implicated in a variety of cellular

processes, which give new roles for the IFN family of cytokines, extending their function beyond

their well-known role in viral interference.6 With type I IFNs having new roles in intestinal

homeostasis, inflammatory and autoimmune diseases such as coeliac disease and psoriasis, as well

as multiple sclerosis and cancer, it is evident that investigations into the potential therapeutic

applications of this cytokine is of prime interest.6

1.2 The Binding Event Between Type I IFN-α and its Heterodimeric Cell Surface Receptor

The type I and type II cytokine-receptor superfamily comprises of receptors that bind IFN, many

interleukins, and colony-stimulating factors.7 There is a common mechanism of signal

transduction for the aforementioned cytokines, the JAK-STAT pathway. The JAK-STAT pathway

is utilized extensively throughout physiological processes, and its importance has been

demonstrated in studying patients with primary immunodeficiencies.8 The pathway consists of

3

four Janus kinases (JAKs) - JAK1, JAK2, JAK3, and tyrosine kinase 2 (TYK2) - which selectively

associate with the intracellular cytoplasmic domains of various cytokine receptors, including, IFN

receptors.9 Activation from a cytokine results in the phosphorylation of cytoplasmic domains on

the receptors by JAKs. This allows for the selective binding of STATs (signal transducers and

activators of transcription).10 Members of the STAT family include: STAT1, STAT2, STAT3,

STAT4, STAT5A, STAT5B, and STAT6.10

The JAK-STAT pathway is activated upon type I IFN binding to the type I IFN receptor

(interferon-αβ receptor). The interferon-α/β receptor (IFNAR) -a heterodimer comprised of two

single transmembrane spanning proteins, IFNAR1 and IFNAR2, with JAK1 and TYK2 associated

factors in the cytoplasmic domain - requires recruitment of both subunits to elicit signal

transduction. Human IFNAR1 is a 63 kDa protein, composed of 530 amino acids. IFNAR2, the

primary binding element, exists as three isoforms: (i) IFNAR2a, 239 amino acids and 24kDa; (ii)

IFNAR2b, 331 amino acids and 34kDa; and (iii) IFNAR2c, 515 amino acids and is 55kDa.11 All

three isoforms have identical extracellular domains, but deviate in their intracellular domain

sequences.

Type I IFNs bind to IFNAR1 and IFNAR2 extracellular domains, which induces intracellular

signal transduction. Specific domains in IFN-α, termed IFN receptor recognition peptides (IRRPs)

have been implicated in contacting IFNAR1 and IFNAR2 to invoke high affinity binding, receptor

activation, and signal transduction.12 Recruitment of the two IFNAR subunits results in receptor

oligomerization, with rapid autophosphorylation and activation of the receptor-associated JAKs,

JAK1 and TYK2.13 This results in the phosphorylation of the cytoplasmic tails of the receptor

complex, providing a docking site for the STATs - STAT1 and STAT2 - which are subsequently

phosphorylated by JAK1 and TYK2. These DNA-binding proteins are tyrosine-phosphorylated,

allowing for dimerization to occur.10 The dimerized STATs translocate to the nucleus, activating

transcription of ISGs. The main critical complex formed is the heterodimeric complex between

STAT1-STAT2, which effectively forms the ISG factor 3 (ISGF3 complex).14 The mature ISGF3

complex is comprised of the activated (phosphorylated) forms of STAT1 and STAT2, with IRF9

(IFN-regulatory factor 9). The STAT1-STAT2-IRF9 then binds to the promoter regions of ISGs,

specifically IFN-stimulated response element (ISRE).14   Moreover, type I IFNs can induce the

4

formation of STAT1-STAT1, STAT1-STAT3 and STAT3-STAT3 homodimers, which translocate

to the nucleus and bind GAS (IFN-γ-activated site) elements, adjacent to the promoter of ISGs.

Type I IFNs are also involved in several other signalling pathways. The CRKL pathway has been

shown to be IFN-inducible, where JAK activation results in CRKL association with TYK2, and

becomes tyrosine phosphorylated.15 Activated CRKL forms a complex with STAT5, which

subsequently undergoes TYK2-dependent tyrosine phosphorylation.15 CRKL-STAT5 complex

translocates to the nucleus and binds GAS elements. PI3K and NF-κB are also IFN-inducible

signalling pathways.15 JAK1 and TYK2 phosphorylation result in activation of PI3K and AKT,

subsequently mediating downstream activation of mTOR, causing inactivation of GSK-3,

CDKN1A, and CDKN1B, and activation of IKKβ, resulting in activation of NF-κB2.15 Type I

IFNs can also activate NF-κB by a secondary pathway involving linkage of TRAFs (TNF

receptor-associated factors). A third pathway activating NF-κB involves an activation loop via

PKCθ.15 Moreover, the MAPK (mitogen activated protein kinase) pathway has been shown to be

IFN-inducible, where JAK activation and subsequent tyrosine phosphorylation of Vav, leads to the

activation of several MAPKs.15

1.3 Clinical Applications and Limitations of Type I IFNs

In addition to possessing broad spectrum antiviral activity, IFN-α also displays stimulatory and

inhibitory effects on T-cells, as well as a stimulatory effect on natural killer (NK) cells and

macrophages.15 The direct anti-proliferative effects, potential antiangiogenic effects, stimulation of

major histocompatibility-1 (MHC1) expression, and NK cell activity, has resulted in IFN-α

becoming a therapeutically relevant and utilized pharmaceutical.13,16

With the various physiologically important processes IFN-α is involved in, it has become a

therapeutically utilized tool in medicine. Of particular interest in this research is IFN-α2a, or

known by the commonly used trade name, Roferon A. Due to the applications of IFN-α2a in

malignant and non-malignant diseases, it has been applied to a variety of medically relevant

conditions. The current FDA-approved indications for IFN-α2a include Hairy cell leukemia, Non-

Hodgkin's lymphoma, chronic myleogenous leukemia, AIDS-related Kaposi sarcoma, and chronic

5

hepatitis C (HCV).13, 16 Currently, IFN-α and ribavirin treatment remains front line standard of

care in the clinic, when treating chronic hepatitis C infections.

Despite IFN-α having a role in the clinic, there are complex pharmacokinetic issues associated

with the delivery and bioavailability of this peptide, due to proteolytic degradation. To overcome

this, IFN-α is administered subcutaneously or intramuscularly, with absorption being reported

greater than 80%.17 Although there are measureable concentrations for 4 to 24 hours after injection

of IFN-α, the short half-life of 4-16 h for this peptide causes it to be rapidly removed from the

body. As a result, maintaining serum plasma concentrations that will induce a therapeutic response

requires multiple injections. Strategies have been developed to overcome this issue and increase

the circulation time of IFN-α, by means of pegylation. This proved to be effective in decreasing

the clearance rate of IFNs, however, peginterferons (α2a and α2b) were shown to exhibit reduced

bioactivity in comparison to consensus IFN and IFN-α2a.18-20 With the complexities associated

with drug-delivery and pharmacokinetics for IFN-α, it is evident that a small molecule mimetic

which elicits the same physiological response as IFN-α, and circumvents the issues associated

with peptide pharmacokinetics and drug delivery, is of significant interest. It is this that has led

my research into the field of developing small molecules which mimic the protein-protein

interactions observed between IFN-α and its cognate cell surface receptor, IFNAR.

1.4 Protein-Protein Interactions: Intricacies and Difficulties in Mimicry

Protein-protein interactions (PPIs) are observed throughout nature, and are vital in a variety of

cellular processes, from intercellular communication to programmed cell death. Accordingly, a

large number of proteins present as target therapeutic candidates. Of these, a significant proportion

rely on the formation of stable or dynamic protein complexes. These include antigen-antibody

interactions, the organization of active sites of oligomeric enzymes or receptors, and regulatory

processes, such as signal transduction and DNA synthesis.21

PPIs have been considered challenging when attempting to design small molecule mimetics, due to

the large interaction surfaces involved.22 However, it may not be entirely necessarily to mimic the

entire protein binding surface. Instead, there are critical portions on proteins which contribute to

6

the interface binding affinity, termed, "hot-spots".23 Consequently, it can be hypothesized that

these binding sites possessed by hot-spots, as well as the electronic characters associated around

the hot-spot binding interface, can be mimicked by low molecular weight molecules.21, 24

Due to overall protein architecture and super-secondary structure playing an integrative part of

protein-protein interactions and function, PPI mimetics are highly dependent on protein secondary

structure.22 There are three predominantly observed secondary structural elements found in

proteins and in protein-protein interfaces.21, 24 These include: (i) α-helices; (ii) β-sheets; and (iii)

reverse turns. Once the secondary structure element has been identified for the protein of interest

involved in the specified protein-protein interaction, hot-spots can be identified to determine key

amino acids involved in the binding interface. From this, the specific electrostatic environment can

be constructed, in order to rationally develop a focused set of mimetics. The primary peptide

structure is typically translated and converted into cyclic analogues.21 It is then important to

gradually decrease the peptidic nature of the mimetics, eventually reaching a small molecular

probe, absent of peptidic elements.21 This process involves the combination of peptidic and non-

peptidic elements, until ultimately a completely non-peptidic small molecule is produced.21

There are limited reports in the literature of type I IFN mimetics. In 2008, Wang and colleagues

reported the discovery of two IFNα-2b mimetic peptides with antiviral activity, which was

obtained from screening a phage-display heptapeptide library using a novel functional biopanning

method.25 While presenting a unique screening methodology, novel compounds were not

constructed or synthesized; rather, screened for.

A second instance, where IFN-β was successfully mimicked, was reported by Saburo Sone and

Atsushi Sato in 2003, where a 15-mer peptide (SYR6), was shown to compete with IFN-β for

binding to the type I IFN receptor in a concentration-depended manner.26 Similarly, as

demonstrated by Wang and colleagues, the isolation of the peptide was achieved by use of phage-

display screening, using a neutralizing anti-IFN-β monoclonal antibody. While it is important to

note that the work presented by both Wang and colleagues and Saburo Sone and Atsushi Sato is

commendable, the peptidic constructs developed are not without fault. The same pharmacokinetic

and drug delivery issues associated with native IFN would be encountered with these compounds.

7

These constructs, however, have provided insights into the complex mechanism of activating

heterodimeric cytokine receptors, knowledge that would be utilized in future research endeavours.

There has been research into the development of IFN-γ mimetics, by Johnson and colleagues in

2005. Here, the group developed peptide mimetics of IFN- γ, that did not act through recognition

by the extracellular domain of the IFN- γ receptor, but instead bound to the cytoplasmic domain of

the receptor chain 1, IFNGR-1.27 While the peptide mimetics played a direct role in the activation

and nuclear translocation of STAT1, they did not interact with the extracellular receptor domain,

which native IFN- γ interacts with. Consequently, these peptide mimetics of IFN-γ are not true

mimetics, since although they may elicit the same physiological JAK-STAT signal transduction

response, they do so in a manner which differs to the mechanism of native IFN- γ, at the upstream

site of protein-protein interaction with the extracellular portion of the receptor.

Limited research has gone into the development of IFN-α receptor agonists or antagonists, despite

their potential as therapeutic agents in the clinic. In order to commence focused and rational

research in this area, it was important to construct a well-developed understating of the binding

interface between IFN-α and IFNAR.11 Fish and colleagues constructed a fundamental model

understanding the relationship between IRRPs and IFNAR1 and IFNAR2.28-30 Their studies

revealed that of the three IRRPs (IRRP1-3), IFNAR2 interacts with IRRP-1 and IRRP-3, whereas

IFNAR1 interacts with IRRP-2.28-30 Using these principles, Fish, Kotra, and colleagues in 2007

developed three-dimensional structural information for the IFNAR-IFN-α binding interface.31 The

obtained data provided insights into the species specificity of IFN-α, as well as defining key hot

spot regions critical for IFN recognition by IFNAR. Increasing the understanding of the critical

regions involved in the IFN-IFNAR binding event, allowed for focused research into identifying

IFN agonists and/or antagonists.

Previous work performed by Kotra and colleagues interrogated the binding sites of IFNAR,32, 33

where the combination of in silico screenings and medicinal chemistry led to identification of

compounds interacting with IFNAR. In 2008, a series of 26 compounds were synthesized to

investigate the interactions present in the IFN-IFNAR complex.33 Of these compounds, two

displayed antagonist activity, effectively disrupting IFN-IFNAR interactions and blocking

8

downstream signalling. This work helped pave the way toward future investigations of IFN

agonists and antagonists.

Kotra and colleagues utilized the knowledge obtained through previous work regarding IRRPs and

IFNAR1 and IFNAR2 to design and synthesize a series of small molecules that mimic IFN-α

epitopes, and interact with IFNAR.33 Key residues of IRRP-1 (Leu30, Arg33, and Asp35) were

used to derive 11 chemical compounds that belong to 5 distinct chemotypes.33 Three compounds

displayed potential mimicry to IRRP-1, and were shown to inhibit IFNAR activation by IFN-α.

Following this, an effort to identify small molecules spanning the surface of IFN-α2a was

undertaken using an in silico approach; compounds were synthesized and these were evaluated for

their potential agonist activities (unpublished data).

9

1.6 Utilization of In Silico Screening for the Identification of IFN-α Mimetics

The fundamental framework developed by Fish and Kotra enabled the utilization of in silico

screening efforts to identify small molecules with potential agonist activity to IFNAR. This

strategy included the utilization of the complete structure of IFN-α2a to identify molecules

spanning the IRRP regions (Figure 1).

Figure 1. Computational model of IFN-α and IFNAR complex. IFN-α2a (green ribbon) complex with its cognate cell surface receptor, IFNAR1 (purple ribbon) and IFNAR2 (orange ribbon). IRRP-1 is presented as cyan, IRRP-2 is shown as green blue, and IRRP-3 is depicted as magenta capped-stick model.11 Over 60 compounds were identified as potential small molecule mimics spanning IRRP-2 and

IRRP-1/-3 regions of the IFN. These compounds were commercially procured and were evaluated

for their potential to exhibit IFN-like protection against the cytopathic effects of viral infection.

This led to the identification of six hits for further investigation, from which a generic

homodimeric structure was derived (Figure 2). Two of these hits, hit compound 1 and hit

compound 2, possessed IFN-like activity, and were considered as candidate compounds to

IRRP-­‐3  

IRRP-­‐2  

IRRP-­‐1  

10

investigate as potential IFNAR agonists. A medicinal chemistry effort was undertaken to explore

the structural features for agonist-like activity.

Figure 2. General structural core of homodimeric structure, leading to hit compounds, hit compound 1 and hit compound 2. Common structural features in both compounds lend to the symmetric homodimeric generic structure. Black boxes represent hidden structural moieties. Red spheres indicate areas in which compounds were derivatized.

1.7 Hypothesis

By recreating hot-spot environments of IRRPs using functional moieties (Figure 3), and placing

them strategically on the diethyl ether linked bis-phenyltetrazole scaffold of hit compound 2, the

new small molecules will possess agonist activity for IFNAR.

11

Figure 3. Panel A: cartoon representation of IFN-αCon1. IRRP-1 (red), IRRP-2 (orange), and IRRP-3 (purple) are shown as capped-stick models. Unity features defined for database searches. Panel B: Hot-spot environments of individual IRRPs. Blue spheres represent positive centers, red spheres indicate negative centers, yellow spheres depict hydrophobic centers, and purple spheres describe hydrogen bond donor atoms. Images provided by Dr. William Wei. IFN-αCon1 is a novel, synthetic consensus IFN-α.11

1.8 Development of IFN-α2a Mimetics

As part of this thesis, I engaged in the rational design and synthesis of IFN-α2a mimetics. To

achieve this, a molecular design approach was implemented using data obtained through in silico

screening (Kotra and co-workers, unpublished results). The Kotra group identified a number of

compounds spanning the surface of IFN, specifically the region of IRRP-2 and the contiguous

surface spanning IRRP-1 and IRRP-3. Two compounds, hit compound 1and hit compound 2, were

identified that fit into the homodimeric chemical ligand structure (Figure 2). As a part of this

IRRP-­‐1  

IRRP-­‐3  

A

IRRP-­‐2  

B

IRRP-­‐3  

IRRP-­‐1  

IRRP-­‐2  

12

thesis, hit compound 2 was considered for structure-activity relationship investigations by

incorporating various functional moieties on the tetrazole moieties. As a first step, a facile,

synthetic route was devised to afford a library of 18 compounds, which were further tested for

potential IFN-like activity.

2. RESULTS AND DISCUSSION

2.1 Chemistry

Small molecules mimicking the protein-protein interactions and binding events between

IFN-α and IFNAR1 and IFNAR2 were investigated, by incorporating a variety of functional

moieties into a central organic scaffold. This array of functional moieties took into account the

addition or absence of hydrophobic (i.e. phenyl) or hydrophilic (i.e. carboxylate) groups, as well as

hydrogen bond donors (i.e. amines, hydroxyl). By utilizing a dynamic array of functionalization,

the exact electrostatic and molecular interactions involved between any lead compound and

IFNAR can be deduced. Understanding the activity profiles of various derivatives will allow for a

greater degree of specific lead compound development. A standardized protocol was developed

and implemented in the synthesis of the bis-phenyltetrazole small molecule library (Scheme 1). .

The bis-phenyltetrazole moiety was used as a core building block, and consequently, synthetic

strategies to afford this architecture were devised. The first process involved 4-cyanophenol 1 as a

central starting material, which was readily reacted with 1-bromo-2-(2-bromoethoxy)ethane in

basic conditions and moderate heating to produce its symmetrical analogue 2 in excellent yields.

Compound 2 possesses two key features which were predicted to be vital for agonist activity.

Firstly, the diethyl ether linker is inert, and possesses little reactivity to both acidic and basic

conditions. Secondly, the linker creates a specific distance between the two bis-phenyltetrazole

moieties, which allow them to potentially span the region between IFNAR1 and IFNAR2. Thus,

the linker enables compound 4 to cover the spatial distance between both subunits, potentially

interacting favourably with key amino acid residues in the receptor.

13

Scheme 1. Synthesis of bis-phenyltetrazole derivatives. a. Reagents and conditions: (a) K2CO3, 1-bromo-2-(2-bromoethoxy)ethane, DMF, 70oC, 4 h; (b) NaN3, ZnBr2, water, MW 180oC, 1 h; (c) NaHCO3, DMF, R-X (alkyl halide), r.t., 24-48 h. Alkyl halides used were either commercially available, or were synthesized in house. Compound 7

was synthesized from 5, using a two-step protocol involving methylation using iodomethane,

followed by subsequent halogenation using elemental bromine and hydrogen bromide. 7 was used

directly on 3 to afford 4a in excellent yields. Compounds 4n-p required alkyl halide building

blocks to be synthesized in house as well. 9 was obtained by alkylation of 8 using 1-bromo-2-

chloroethane, and was directly added to 3 to afford 4p. 11 was obtained using the same procedure,

and was used according to the same protocol to afford 4n-o. Alkyl bromide 13 was synthesized

from 12, using triphenylphosphine and carbon tetrabromide as bromination conditions. 13 was

used according to the same protocol converting 3 to 4 to afford 4h-i.

14

Scheme 2. Synthesis of alkyl halide building blocks, reagents and conditions. A: (a) CH3I, K2CO3, DMF, 60oC, 24 h; (b) Br2, HBr, 0oC, 2 h. B: (c) K2CO3, 1-bromo-2-chloroethane, DMF, r.t., 12 h. C: (d) NaHCO3, 1-bromo-2-chloroethane, DMF, r.t., 12 h. D: (e) CBr4, PPh3, dichloromethane, r.t., 12 h.

The formation of 2 allowed for an ideal compound to convert to its corresponding 5-substituted

2H-tetrazole 3. The tetrazole moiety has received considerable attention, as this functional group

has roles in coordination chemistry as a ligand, in medicinal chemistry as a metabolically stable

surrogate for a carboxylic acid group, and in a variety of materials science applications.34 The

tetrazole moiety was also chosen for its potential towards many useful transformations generating

substituted tetrazoles 4.

A B

C D

15

Table 1. Synthesized library of bis-phenyltetrazole derivatives.

Compound

R - Regiochemistry

4a

N2,N2'

4b

N2,N2'

4c

N1,N1'

4d

N1,N2'

4e

N2,N2'

4f

N2,N2'

4g

N2,N2'

16

4h

N1,N2'

4i

N2,N2'

4j

N2,N2'

4k

N2,N2'

4l

N2,N2'

4m

N2,N2'

4n

N1,N2'

4o

N2,N2'

4p

N2,N2'

4q

N1,N2'

4r

N2,N2'

17

The formation of 3 from 2 was readily achieved using the Sharpless protocol,35 involving the click

synthesis addition of sodium azide to nitrile 2 in water as a solvent and zinc bromide as a catalyst.

There has been debate as to the specific mechanism of the addition of hydrazoic acid/azide ion to a

nitrile to afford a tetrazole, with evidence supporting both a two-step mechanism36, 37 and a

concerted [2 + 3] cycloaddition38 (Scheme 3, mechanism 2). However, more recent studies have

shown that a concerted [2 + 3] cycloaddition is the most likely pathway for the bimolecular

addition of non-ionic azides to nitriles.38 This safe and exceptionally efficient process afforded 3

in excellent yields, without the need for an organic solvent, as well provides for large-scale

applications without the need for organic solvents in the workup or isolation phases. This synthetic

strategy is fiscally advantageous compared with a variety of other tetrazole syntheses involving

organic solvents and costly reagents.39, 40

Scheme 3. Mechanistic hypotheses for the addition of hydrazoic acid/azide ion to a nitrile to give a tetrazole. For the binding interaction between IFN and IFNAR, there are particular sequences on the surface

of IFN, termed IFN receptor recognition peptides (IRRPs), which mediate the binding and signal

transduction when IFN interacts with IFNAR.28 Of the three IRRPs (IRRP1-3), it was predicted

through in silico screening that IFNAR2 interacts with IRRP-1 and IRRP-3, whereas IFNAR1

interacts with IRRP-2.12, 28 The derivatization of 3 into 4 was based upon the principles set by

IRRPs, where specific electronic environments of amino acid residues were represented by

functional groups placed upon 3. The conversion of 3 to 4 was achieved readily through the use of

18

an alkyl halide and base in suitable solvent. A library of 18 compounds were readily generated by

use of this synthetic protocol.

When synthesizing 4, three different regioisomers were observed in certain cases, where alkyl

substituents were placed in a N2,N2', N1,N2', or N1,N1' regiochemistry. The reason for multiple

regioisomers may have two explanations: (i) the specific localization of the tetrazole proton in 3

can be between a 1H- and 2H-position. In the concerted cycloaddition mechanism in the

formation of 3, it is possible to have a 1,5-tetrazole (1H) and 2,5-tetrazole (2H) (Scheme 4).38 The

presence of both regioisomers in the starting material 3 when converted into 4 can lead directly

into both N1,N1' and N2,N2' regioisomers; and (ii) the second rationale behind the observation of

three regioisomers of 4, and the most likely explanation, is the phenomenon of tautomerization. In

the tautomerization of tetrazole, the tetrazole proton can delocalize between N1 and N2.35, 38 As a

result, there becomes a random distribution over time between species of 3 when placed in the

reaction conditions to convert to 4.35, 38 These species include a [1H,1H] , [1H,2H] , and the most

thermodynamically favourable and predominant species, [2H,2H] .35, 38 The presence of these

species in solution can lead directly to its corresponding alkyl substituted analogue 4 when in

presence of the electrophile alkyl halide.

Scheme 4. Two different isomers of tetrazole, the 1,5- and 2,5-disubstituted, can be formed through the concerted cycloaddition.

19

Among the synthesized derivatives, compounds 4c-e led to all three regioisomers, and the single

N1,N1' derivative. It is possible that the alkaline character of 2-chloro-N,N-diethylethan-1-amine

may bias the distribution of tautomer species in solution, since the reagent possesses significant

structural similarity to triethylamine.

2.2 Regiochemistry Determination

An interesting phenomenon occurred when synthesizing 4, as instead of the predicted N2,N2'

regiochemistry, both N1,N1` and N1, N2`were observed in certain cases (derivatives 4c-e, 4h-i,

4n-o, and 4q-r). The variation of regiochemistry has significant implications to the overall

architecture and geometry of the small molecules, which can have significant implications in

receptor binding and recognition. Due to the binding interface of protein-protein interactions

having highly specific orientations and electronic interactions, the geometry of the derivatives can

have significant implications. In the N1,N1` derivative (4c), the tetrazole ring is expected to be

twisted out of the plane of the phenyl ring, causing a 'kink' in the ring system to reduce the steric

and electronic effects of the N1,N1`substituents. This disrupts the interannular conjugation of the

bi-aromatic system, resulting in the observed 'kink'.41

To ascertain the regiochemistry of the synthesized compounds, 2D-NMR methodologies were

applied, specifically 2-D Nuclear Overhauser effect spectroscopy (2D-NOESY). Due to the spatial

disposition of methylene protons in N1 or N2 substitutions, there would be a distinguishable

difference between the spatial correlations of the phenyl-tetrazole protons and respective

methylene protons. I hypothesized that the 13C NMR shift of C-5 in the tetrazole ring would

experience deviations between N1 and N2 regioisomers, due to the direct effect on interannular

conjugation. It has been previously demonstrated that there is a difference between N1 and N2

regioisomers of phenyltetrazoles at C-5, with N2 regioisomers having the larger downfield shift.

This is predicted to due to the increased co-planarity observed between the biaryl system.

2D-NOESY NMR was used on 4c and 4d, due to the possibility of only two regioisomers. 2D-

NOESY of 4c (Figure 4, Panel A) displayed a direct correlation between the methylene protons

substituted onto the tetrazole ring, with that of the phenyl protons adjacent to the tetrazole ring

system. This directly supports the prediction of a N1 substituted system. 4e displayed no

correlation between the respective protons (Figure 4, Panel B), indicating a difference in the

20

spatial correlation, thus eluting to N2 regiochemistry. From this, the correct regiochemistry of 4c-d

was determined, and this knowledge was used to determine the regiochemistry of the complete

compound library.

Figure 4. 2D NOESY NMR spectrum of 4c (Panel A) and 4e (Panel B), confirming the predicted N1,N1’ regiochemistry.

B

A

21

2.3 EMCV Cytopathic Effect (CPE) Reduction

To determine whether the synthesized library of compounds displayed IFN-like antiviral activity,

Daudi cells were infected with encephalomyocarditis virus (EMCV), and treated with each

compound to reveal any reduction in the virus-induced cytopathic effects (Table 2). IFN-α2a was

used as an internal positive control (100% reduction in CPE). Of the 18 bis-phenyltetrazole

compounds screened, 9 displayed CPE reduction with an EC50 in the micromolar range. Of these

compounds, 4e displayed the highest CPE reduction, as well as an EC50 of 0.5 ± 0.2 µM and

maximal CPE reduction of 61%. While three other derivatives displayed a sub-micromolar EC50,

the maximal CPE reduction was below that of 4e, and these were subsequently excluded for

further evaluations due to their low potency. 4e was chosen as a candidate compound for further

evaluation as a potential antiviral agent and activator of IFNAR. These antiviral studies were

conducted by Beata Majchrzak-Kita of the Fish group.

2.4 Cytotoxicity in CHO Cells

Candidate compounds which exhibited good antiviral activity and potential for IFN-like activity

were subjected to cytotoxicity analysis in Chinese hamster ovary (CHO) cells. 4e was evaluated in

CHO cells for any potential cytotoxic effects. Cytotoxicity was minimal, including concentrations

evaluated as high as in the millimolar range. As a result, the low cytotoxicity of 4e made it a more

suitable candidate for later stage evaluations. This experiment was conducted by Ewa Poduch of

the Kotra group.

22

Table 2. Antiviral activities of compound 4 series based upon maximal cytopathic effect reduction against EMCV.

Compound R - Regiochemistry EC50 (µM) Maximal CPE Reduction (%)

4b

N2,N2' 0.1 ± 0.2 15

4c

N1,N1' 100 ± 54.6 8

4d

N1,N2' 25.2 ± 45.9 9

4e

N2,N2' 0.5 ± 0.2 61

4g

N2,N2' 44.8 ± 4.7 60

4o

N2,N2' 14.3 ± 2.2 25

4p

N2,N2' 0.5 ± 0.1 38

4q

N1,N2' 4.8 ± 0.6 41

4r

N2,N2' 0.9 ± 0.3 45

23

2.5 IFN-Stimulated Genes (ISG) Expression

Candidate compounds evaluated and confirmed to be non-cytotoxic were subjected to gene

expression analysis to determine whether any IFN-induced genes are activated by these

compounds. Real-time PCR was used to evaluate Daudi cells treated for 16 hours with 5 ng/mL

IFN-αCon1 and with 500 µM of candidate compounds chosen (4e). ISG15, PKR, and OAS1 were

gene products evaluated for induced expression. 4e displayed the greatest fold induction of gene

expression for all three genes. In IFN-αCon1 treated cells, ISG15 expression was increased 163-

fold, whereas 4e treated cells exhibited a 55-fold increase. For PKR, IFN-αCon1 treated cells

increased expression by 40-fold, and 4e by 5-fold. . For OAS1, IFN-αCon1 increased gene

expression by 8-fold and 4e by 2-fold (Figure 5). This data provides indirect evidence for the

observed antiviral activity of compound 4e, indicating that 4e could potentially be invoking its

activity through IFNAR activation. These studies were conducted by Beata Majchrzak-Kita of the

Fish group.

2.6 Phosphorylation of Tyk2

An early event following the high affinity binding of type I IFNs to IFNAR, is Tyk2

phosphorylation. In a time course study (2, 5, and 15 minutes) the ability of compound 4e to

phosphorylate Tyk2 was examined in cell lysates using Western immunoblot analysis. The data

revealed that treatment with 500 µM of the candidate compound does result in some degree of

phosphorylation of Tyk2, further suggesting its IFN-like activity and potential as an activator of

IFNAR (data not shown). To confidently determine whether 4e binds to IFNAR directly, surface

plasmon resonance studies are currently being investigated.

C

24

Figure 5. Real-time PCR evaluation of Daudi cells treated for 16 hours with 5 ng/mL IFN-αcon1 and with 500 µM of candidate compound 4e. The IFN-induced genes ISG15 (A), PKR (B), and OAS1 (C) were evaluated for elevated expression. KF-112 (hit compound 2) is a vendor purchased compound, with predicted agonist activity to IFNAR. Data obtained and provided by Beata Majchrzak-Kita of the Fish group.

2.7 Physicochemical Properties Determination

The physicochemical properties of biologically active derivatives in series 4 were experimentally

determined and evaluated (Table 3). A wide range of pKa values were obtained for various

analogues in the library of compounds, showing that the library design incorporates both basic,

acidic, and neutral compounds. The distribution-coefficient (logD) was also determined for series

4 at physiological pH, to determine the relative lipophilicity of compounds, and potential

unwanted cytotoxic effects as a result of highly hydrophobic compounds.

0  

50  

100  

150  

200  

IFN-­‐a-­‐con1   KF-­‐112   4e  

Fold

Indu

ctio

n ISG15

0  

10  

20  

30  

40  

50  

IFN-­‐a-­‐con1   KF-­‐112   4e  

Fold

Indu

ctio

n

PKR

0  1  2  3  4  5  6  7  8  9  

IFN-­‐a-­‐con1   KF-­‐112   4e  

Fold

Indu

ctio

n

OAS1

25

The implications of regiochemistry on biological activity and physicochemical properties is

evident in the pKa and logD values obtained. Observing 4c-e, which possess all three regioisomers

(N1,N1`, N1,N2`, and N2,N2`), the experimentally determined physicochemical properties differ

significantly among each derivative. The pKa for 4c (N1,N1’) was determined to be 7.41 ± 0.06,

where 4e (N2,N2`) was 8.33 ± 0.32. Despite both derivatives possessing the same functional

groups, the pKa between both of these compounds differ by almost an order of magnitude. This

can be rationalized due to the steric hindrance of 4c N1,N1’ regiochemistry, which subsequently

disrupts co-planarity between the biaryl system. Protonation of the amino side chain would further

contribute to steric hindrance and electrostatic repulsions, subsequently increasing the acidity of

the functional moiety. 4d (N1,N2`), the asymmetric regioisomer, possessed an intermediate pKa of

7.59 ± 0.11, which roughly lies between the values of 4c and 4e.

Further differences in physicochemical properties among regioisomers 4c-e, the logD (@ pH 7.4)

was calculated for all derivatives in series 4. Although 4c and 4e possess different regiochemistry,

the logD values are similar (4c = 6.801, 4e = 6.669). Interestingly, the asymmetric regioisomers

4d had an experimentally determined logD of 2.831, substantially lower than that of its

corresponding regioisomer partners. This may be due to the asymmetry of the electronic system,

where molecular dipole moments (a vector) do not cancel out, as observed in symmetrical

molecules. The symmetry observed in 4c and 4e presumably reduces the polarity in the overall

dipole moments, where the vector dipoles cancel, subsequently decreasing the overall polarity of

the system.

Due to the complexity of these compounds - their high molecular weights and large polar surface

areas - the use of computational programs to predict physicochemical properties is potentially

unreliable, as observed in the differences in values obtained through predictive software, and that

of the experimentally determined values. An example of this is observed in derivative 4r, where

the reliability of using predictive software for pKa determination was called into question. Using

ChemBioDraw® software, the predicted pKa was 7.93, however, the experimentally determined

value (performed in triplicates) was 7.22 ± 0.19. These values are almost an order of magnitude in

difference, which highlights the caution that should be taken when utilizing predictive software to

determine physicochemical properties. Moreover, the utility and versatility of the Sirius-T3®

system in determining physicochemical properties accurately and quickly is exemplified in these

26

compounds. The molecular size and complexity of these compounds required physicochemical

properties to be experimentally determined, rather than computationally predicted. Experiment

was conducted on a single trial; multiple trials are to be carried out to ensure reproducibility.

Table 3. Experimentally determined physicochemical properties of biologically active compounds. pKa and LogD values were derived from a single experiment. To confirm the accuracy and reproducibility of these results, these experiments must be repeated in separate trials. Compound

Code R - pKa LogD (@ pH 7.4)

4c

7.41 ± 0.06 6.801

4d

7.59 ± 0.11 2.831

4e

8.33 ± 0.32 6.669

4h

5.12 ± 0.11 3.423

4i

5.20 ± 0.14 4.99

4n

6.48 ± 0.47 6.284

4o

7.01 ± 0.20 6.937

4p

pKa1 (NR2H): 2.98 ± 0.42 pKa2 (NR3): 7.31 ± 0.58 0.859

4q

7.17 ± 0.15 5.799

4r

7.22 ± 0.19 6.602

27

3. CONCLUSION

IFN-α2a is as a standard of care in HCV treatments in the clinic, with pharmacokinetic barriers

warranting investigations into small molecule mimetics. The Kotra group has discovered several

small molecule agonists for IFNAR using in silico screening, including a bis-phenyltetrazole core

tethered via ethylene ether linker. As part of this thesis project, a synthetic methodology was

developed for this core, and a library of 18 compounds was synthesized. Among these compounds,

4e demonstrated antiviral activity against EMCV with an EC50 of 0.5 ± 0.2 µM. This compound

was also shown to induce Tyk2 phosphorylation, as well as induce IFN-inducible genes (PKR,

OAS1, and ISG15). This work highlights the effectiveness of using the molecular design approach

to design small molecule agonists for cell surface receptors (IFNAR), potentially mimicking

protein-protein interactions.

4. EXPERIMENTAL SECTION

4.1 General. All reactions were performed under N2 in oven-dried glassware. Flash

chromatography was performed using distilled solvents from Sigma-Aldrich. All solvents and

reagents were obtained from commercial sources; anhydrous solvents were prepared following

standard procedures. Chromatographic purifications were performed using performed using 60 Å

(70–230 mesh) silica gel with the indicated solvents as eluents. TLC analysis was performed using

EMD TLC Silica gel 60 F254 Aluminum sheets and visualized using UV light, iodine, ninhydrin,

vanillin, and phosphomolybdic acid stains. Final products were purified by LC/MS on a Waters

LC/MS system equipped with a photodiode array detector using an XBridge semipreparative C18

column (19.2 mm x 150 mm, 5 µm). Mass spectra were recorded using ESI Waters system (+ve)

mode. All HPLC solvents were filtered through Waters membrane filters (47 mm GHP 0.45 µm,

Pall Corporation). Injection samples were filtered using Waters Acrodisc® Syringe Filters 4 mm

PTFE (0.2 µm). NMR spectra were recorded on a Bruker spectrometer (400 MHz for 1H; 101

MHz for 13C). Chemical shifts are reported in δ ppm using tetramethylsilane or the deuterated

28

solvent as the reference. Compounds listed in procedures that were not otherwise mentioned in the

aforementioned schemes were also obtained from commercially available sources.

4.2 Physiochemical Properties Determination. The dissociation constant (pKa) and lipophilicity

(LogP/D) was determined using a Sirius-T3 automated system (Software Version 1.1.0.10, Sirius

Analytical LTD, UK) for compounds 4a-r. KHP calibration titrations were performed before

physicochemical properties were determined for each series of compounds. Deionized water and

spectrophotometric grade dimethylsulfoxide or methanol were used for the pKa or LogP/D

determination. Assays were performed in triplicate at 25oC using 5 µL of 10 mM solution of each

sample per assay. The dissociation constant was determined by the Fast UV pKa experiment in the

presence of neutral buffer to stabilize the pH electrode across the pH range of 2–12 during the

titration of the analyte. The distribution coefficient (LogD) was determined using the pH-metric

method in which the compound was titrated for pKa in the presence of water and octanol solvent

mixture, and compared to the measured aqueous pKa value.

4,4'-Oxybis(ethane-1,2-diyl)-bis(oxy)dibenzonitrile (2). To a suspension of 4-cyanophenol (6.61

g, 55.48 mmol) in anhydrous DMF (50 mL), potassium carbonate (19.17g, 138.70 mmol) was

added under nitrogen atmosphere. The reaction mixture was then set to stir for 30 minutes, to

ensure phenoxide formation. Once complete, 1-bromo-2-(2-bromoethoxy)ethane (3.48 mL, 6.43 g,

27.74 mmol) was added drop-wise over a period of 30 minutes at 0oC. After complete addition,

the reaction temperature was elevated to 70oC for a period of 4 hours. Once the reaction was

complete by TLC analysis, the reaction vessel was removed from heat, cooled to room

temperature, and solvent removed via rotatory evaporator. Next, cold distilled water (50 mL) was

added, and the resulting suspension was extracted with ethyl acetate (2 x 25 mL). The organic

layers were combined, dried over sodium sulfate, and concentrated under reduced pressure.

Hexanes:ethyl acetate (3:1) was added to the resulting solid, where remaining 4-cyanophenol

dissolved, while desired produced remained insoluble. The remaining solid was filtered, washed

with hexanes:ethyl acetate (3:1), and dried under reduced pressure to afford 2 as a white crystalline

solid: 3.67 g, 63% yield). 1H NMR (CDCl3) δ 3.95 (t, J=3.6 Hz, 4 H), 4.20 (t, J=4.4 Hz, 4 H), 6.95

29

(d, J=8.8 Hz, 4 H), 7.58 (d, J=8.8 Hz, 4 H); 13C NMR (CDCl3) δ 161.98, 133.96, 119.11, 115.31,

104.22, 69.68, 67.74.

5,5'-Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole) (3). To a suspension of

sodium azide (1.81 g, 27.83 mmol) and zinc bromide (6.27g, 27.83 mmol) in distilled water (10

mL), was added 2 (1.56 g, 5.06 mmol). Once complete dissolution of the salts was observed, the

reaction vessel was placed under microwave radiation for one hour at 180oC. Once the reaction

was confirmed complete by TLC analysis, the pH was brought to 1.0 with 3N HCl (5 mL), and the

reaction mixture was stirred vigorously for 30 minutes. The resulting solid precipitated was

filtered via vacuum filtration, and washed with 3N HCl (3 x 5 mL), as well as hexanes: ethyl

acetate (1:1, 15 mL). The solid was isolated and dried under reduced pressure, affording 3 as a

light brown solid: 847 mg, 57% yield. 1H NMR (DMSO-d6) δ 3.85 (t, J=4.30 Hz, 4 H), 4.21 (t,

J=4.30 Hz, 4 H), 7.16 (d, J=9.03 Hz, 4 H), 7.97 (d, J=9.03 Hz, 4 H); 13C NMR (DMSO-d6) δ

161.1, 131.8, 129.1, 115.8, 69.4, 67.9.

General Procedure for the Nucleophilic Substitution of 5,5'-oxybis(ethane-1,2-diyl)bis(oxy)

bis(1,4-phenylene)bis(2H-tetrazole) (4). To a reaction vessel charged with nitrogen, 3 (1 eq.) and

sodium bicarbonate (2.5 eq.) was added in anhydrous DMF. The suspension was allowed to stir for

several minutes to ensure the formation of a nucleophilic species. The reaction mixture was then

cooled to 0oC, whereby the halo electrophile (2.2 eq.) suspended in anhydrous DMF was added

drop-wise over several minutes by means of a syringe. The reaction vessel was then warmed to

room temperature, and stirred overnight. Once the reaction was confirmed complete by TLC

analysis, water was added to the reaction mixture and was extracted with ethyl acetate. The

organic layers were subsequently washed with water (2x) and saturated sodium bicarbonate

solution (1x). The organic layers were combined, dried over sodium sulfate, and concentrated in

vacuo to afford the crude product. To the crude product, 3 mL of CH2Cl2 and 0.5 g of silica was

added. The volatile compounds were removed in vacuo, and the white silica powder was placed on

a column. The crude product mixture was purified using flash column chromatography on silica

gel (mobile phase conditions: gradient, ethyl acetate:hexanes, 25% to 60% over 20 minutes).

2,2'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-diyl)bis(1-(4-

(dimethylamino)phenylethanone) (4a) : To a reaction vessel charged with nitrogen, 3 (58 mg,

30

0.147 mmol) and sodium bicarbonate (27.18mg, 0.523 mmol) was added in anhydrous DMF (6

mL). The suspension was allowed to stir for 30 minutes, whereby the reaction mixture was cooled

to 0oC, and to it was added 7 (78.33 mg, 0.323 mmol). After complete addition, the reaction vessel

was warmed to room temperature, and was allowed to stir for 24 hours. Once the reaction was

confirmed complete by TLC analysis, water (10 mL) was added to the reaction mixture and was

extracted with ethyl acetate (2 x 5 mL). The organic layers were combined and washed with water

(2 x 5 mL), and saturated sodium bicarbonate solution (5 mL). The organic layers were combined,

dried over sodium sulphate, and concentrated in vacuo. To the crude product, 3 mL of CH2Cl2 and

0.5 g of silica was added. The volatile compounds were removed in vacuo, and the yellow silica

powder was placed on a column. The crude product mixture was purified using flash column

chromatography on silica gel (gradient, ethyl acetate:hexanes, 25% to 60% over 20 minutes) to

afford 4a as a yellow solid: 28 mg, 38% yield; mp 180-181 oC; 1H NMR (CDCl3) δ 3.10 (s, 12 H),

3.98 (t, J=3.00 Hz, 4 H), 4.23 (t, J=3.00 Hz, 4 H) , 6.01 (s, 4 H), 6.69 (d, J=9.2 Hz, 4 H), 7.01 (d,

J=8.8 Hz, 4 H), 7.90 (d, J=9.2 Hz, 4 H), 8.09 (d, J=8.8 Hz, 4 H); 13C NMR (CDCl3) δ 186.4,

165.3, 160.3, 154.1, 130.5, 128.5, 121.6, 120.3, 114.9, 110.9, 69.9, 67.5, 40.0; IR (cm-1) ν 2953

(CH), 2921 (CH), 1690 (C=O), 1595 (C=C); λmax (nm) 257.5.

3,3'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-

diyl)bis(ethane-1,2-diyl)bis(1H-indole) (4b): This compound was synthesized from 3 (117 mg,

0.296 mmol), sodium bicarbonate (55 mg, 0.593 mmol), and 3-(2-bromoethyl)-1H-indole (133

mg, 0.593 mmol) using the procedure described for compound 4a. A modification was

implemented to the procedure described in 4a, as the reaction mixture was warmed to 60oC and set

to stir for 20 hours. To the crude product, 12 mL of CH2Cl2 and 0.5 g of silica was added. The

volatile compounds were removed in vacuo, and the white silica powder was placed on a column.

The crude product mixture was purified using flash column chromatography on silica gel

(gradient, ethyl acetate:hexanes, 25% to 60% over 25 minutes) to afford 4b as a white solid: 80

mg, 60% yield; mp 149-151 oC; 1H NMR (CDCl3) δ 3.53 (t, J=7.53 Hz, 4 H), 3.98 (t, J=5 Hz , 4

H), 4.23 (t, J=5 Hz , 4 H ), 4.91 (t, J=7.53 Hz, 4 H), 6.97 (d, J=2.26 Hz, 2 H), 7.01 (d, J=8.8 Hz, 4

H), 7.15 (t, J=6.8 Hz, 2 H), 7.21 (t, J=8.0 Hz, 2 H), 7.36 (d, J=8.0 Hz, 2 H), 7.63 (d, J=7.6 Hz, 2

H), 8.07 (d, J=8.8 Hz, 4 H); 13C NMR (CDCl3/ MeOD-d4) δ 164.7, 160.4, 136.3, 128.2, 126.8,

31

122.6, 121.8, 120.0, 119.2, 118.0, 114.9, 111.4, 109.9, 69.8, 67.5, 53.7, 25.6; IR (cm-1) ν 3407

(NH), 3057 (CH), 2954 (CH), 1581 (C=C); λmax (nm) 257.4.

2,2'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-diyl)bis(N,N-

diethylethanamine) (4c). By a procedure similar to that described for 4a, 3 (50 mg, 0.126 mmol)

and sodium bicarbonate (25 mg, 0.278) was added in anhydrous DMF (5 mL). The reaction

mixture was allowed to stir for 30 minutes, and once complete, was placed on an ice bath. After

the temperature of the reaction suspension was brought down to 0oC, potassium iodide (46.30 mg,

0.278 mmol), and (2-chloroethyl)diethylamine hydrochloride (37.83 mg, 0.278 mmol) were added,

and the reaction vessel temperature was elevated to 60oC. Once the reaction was confirmed

complete by TLC analysis, water (20 mL) was added to the reaction mixture and was extracted

with ethyl acetate (3 x 3 mL). The organic layers were combined, dried over sodium sulfate, and

concentrated by use of a rotatory evaporator. To the remaining residue was added 3 mL CH2Cl2

and 0.5 g silica, and the volatile compounds were removed in vacuo. The resulting white silica

powder was placed on a column, a purified via flash chromatography on silica gel (gradient, ethyl

acetate:hexanes, 25% to 60% over 23 minutes). Isolation of three regioisomers (4c-e) was

obtained. Compound 4c was isolated as a clear and colourless, sticky oil: 87 mg, 55% yield; 1H

NMR (CDCl3) δ 1.35 (t, J=7.2 Hz, 12 H), 3.23 (q, J=7.2 Hz, 8 H), 3.69 (t, J=7.6 Hz, 4 H), 3.97 (t,

J=4.8 Hz, 4 H), 4.24 (t, J=4.4 Hz, 4 H), 4.94 (t, J=7.2 Hz, 4 H), 7.04 (d, J=8.8 Hz, 4 H), 7.58 –

7.60 (d, J=8.8 Hz, 4 H). 13C NMR (CDCl3) δ 161.5, 154.6, 130.2, 115.7, 69.7, 67.7, 53.4, 47.0,

42.8, 8.2; IR (cm-1) ν 3035 (CH), 2925 (CH), 1579 (C=C); λmax (nm) 254.0.

2,2'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(1H-tetrazole-1,5-diyl)bis(N,N-

diethylethanamine) (4d). This compound was obtained during the procedure described in 4e, and

was isolated from the regioisomer mixture as a yellow, sticky oil: 87 mg, 55% yield; 1H NMR

(CDCl3) δ 1.34 (t, J=4.8 Hz, 12 H), 3.26 (q, J=7.2 Hz, 8 H), 3.73 (t, J=7.6 Hz, 2 H), 3.83 (t, J=6.4

Hz, 2 H), 3.96 (t, J=4.8 Hz, 4 H), 4.22 (dt, J=5.2 Hz, 4.0 Hz, 4 H), 4.94 (t, J=7.2 Hz, 2 H), 5.13 (t,

J=6.4 Hz, 2 H), 6.99 (d, J=8.8 Hz, 2 H), 7.01 (d, J=8.8 Hz, 2 H), 7.56 (d, J=8.8 Hz, 4 H), 7.94 (d,

J=8.8 Hz, 4 H); 13C NMR (CDCl3) δ 165.6, 161.5, 160.7, 130.2, 128.3, 119.2, 115.7, 115.1, 114.5,

69.8, 69.7, 67.7, 67.6, 49.7, 49.4, 47.3, 47.1, 47.0, 42.7, 8.3, 8.1; IR (cm-1) ν 3021 (CH), 2926

(CH), 1543 (C=O); λmax (nm) 255.0.

32

2,2'-(Oxybis(ethane-2,1-diyl)bis(oxy)bis(4,1-phenylene)bis(2H-tetrazole-5,2-diyl)bis(N,N-

diethylethan-1-amine) (4e). This compound was isolated from the procedure described from 4c,

where 4e was isolated as an orange, sticky oil: 87 mg, 55%; 1H NMR (CDCl3) δ 1.28 (t, J=7.2 Hz,

12 H), 3.22 (q, J=7.2 Hz, 8 H), 3.79 (t, J=6.0, 4 H), 3.94 (d, J=4.0 Hz, 4 H), 4.19 (d, J=4.8 Hz, 4

H), 5.12 (t, J=6.4 Hz, 4 H), 6.96 (d, J=8.4 Hz, 4 H), 7.93 (d, J=8.4 Hz, 4H); 13C NMR (CDCl3)

δ 165.6, 160.7, 128.4, 119.3, 115.1, 69.8, 67.6, 49.4, 47.3, 47.1, 8.2; IR (cm-1) ν 2959 (CH), 2925

(CH), 1582 (C=C); λmax (nm) 256.4.

2,2'-(5,5'-(Oxybis(ethane-1,22,1-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-

diyl)bis(1-(4-(diethylamino)phenylethanone) (4f). This compound was synthesized from 3 (77

mg, 0.195 mmol), sodium bicarbonate (40 mg, 0.429 mmol), and 2-bromo-1-(4-

(diethylamino)phenyl)ethanone (116 mg, 0.429 mmol) using the procedure described for

compound 4a. To the crude product, 15 mL of CH2Cl2 and 0.5 g of silica was added. The volatile

compounds were removed in vacuo, and the white silica powder was placed on a column. The

crude product mixture was purified using flash column chromatography on silica gel (gradient,

ethyl acetate:hexanes, 25% to 60% over 18 minutes) to afford 4f as a white solid: 58 mg, 38%

yield; mp 168-170oC; 1H NMR (CDCl3) δ 1.23 (t, J=7.2 Hz, 12 H), 3.44 (q, J=7.2 Hz, 8 H), 3.98

(t, J=4.0 Hz, 4 H) 4.23 (t, J=4.0 Hz, 4 H), 5.99 (s, 4 H) 6.66 (d, J=9.2 Hz, 4 H), 7.01 (d, J=8.8 Hz,

4 H), 7.86 (d, J=8.8 Hz, 4 H), 8.09 (d, J=8.4 Hz, 4 H); 13C NMR (CDCl3) δ 186.0, 165.3, 160.3,

152.1, 130.8, 130.4, 128.5, 121.0, 120.4, 114.9, 110.5, 69.9, 67.5, 57.5, 44.6, 12.5; IR (cm-1)

ν 2959 (CH), 2921 (CH), 1672 (C=O), 1594 (C=C); λmax (nm) 256.5.

2,2'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-diyl)bis(1-

phenylethanone) (4g). This compound was synthesized from 3 (83 mg, 0.210 mmol), sodium

bicarbonate (53 mg, 0.631 mmol), and 2-bromo-1-phenylethanone (93 mg, 0.403 mmol) using the

procedure described for compound 4a. To the crude product, 10 mL of CH2Cl2 and 0.5 g of silica

was added. The volatile compounds were removed in vacuo, and the white silica powder was

placed on a column. The crude product mixture was purified using flash column chromatography

on silica gel (gradient, ethyl acetate:hexanes, 25% to 60% over 20 minutes) to afford 4g as a light-

yellow solid: 8 mg, 6% yield; mp 124-126 oC; 1H NMR (CDCl3): δ 3.97 – 3.99 (t, J=4.80 Hz, 4

H), 4.24 (t, J=4.0 Hz, 4 H), 6.12 (s, 4 H), 7.02 (d, J=8.8 Hz, 4 H), 7.57 (dd, J=8.0 Hz, 4 H), 7.69 -

33

7.71 (m, 2 H), 8.01 (d, J=7.2 Hz, 4 H), 8.08 (d, J=8.8 Hz, 4 H); 13C NMR (CDCl3) δ 189.0, 165.5,

160.5, 134.6, 133.9, 129.2, 128.5, 128.2, 127.8, 114.9, 69.9, 67.6, 58.1; IR (cm-1) ν 3068 (CH),

2953 (CH), 1702 (C=O), 1580 (C=C); λmax (nm) 254.0.

4-(2-(5-(4-(2-(2-(4-(1-(2-Morpholinoethyl)-1H-tetrazol-5-yl)phenoxy)ethoxy)ethoxy)phenyl)-

2H-tetrazol-2-yl)ethyl)morpholine (4h). This compound was synthesized from 3 (61 mg, 0.151

mmol), sodium bicarbonate (38 mg, 0.453 mmol), and 13 (73 mg, 0.378 mmol) using the

procedure described for compound 4a. To the crude product, 10 mL of CH2Cl2 and 0.5 g of silica

was added. The volatile compounds were removed in vacuo, and the white silica powder was

placed on a column. The crude product mixture was purified using flash column chromatography

on silica gel (gradient, methanol:dichloromethane, 3% to 10% over 30 minutes) to afford 4h as a

yellow, sticky oil: 50 mg, 37%; 1H NMR (CDCl3) δ 3.25 (m, 8 H) 3.69 (t, J=7.2 Hz, 4 H) 3.80 (t,

J=6.4 Hz, 4 H) 3.94 – 3.99 (m, 4 H) 4.21 - 4.25 (m, 4 H) 4.91 (t, J=7.2 Hz, 4 H) 5.13 (t, J=6.4 Hz,

4 H) 6.99 (d, J=8.8 Hz, 2 H) 7.02 (d, J=8.8 Hz, 2 H) 7.54 (d, J=8.8 Hz, 2 H) 7.94 (d, J=8.8 Hz, 2

H); 13C NMR (CDCl3) δ 165.3, 161.6, 160.9, 154.7, 130.3, 128.0, 124.7, 119.4, 115.2, 114.9,

114.8, 114.8, 114.1, 69.5, 69.4, 67.6, 67.4, 67.4, 63.9, 63.6, 54.8, 54.7, 52.4, 52.2, 46.7, 42.4, 29.5,

25.1; IR (cm-1) ν 2928 (CH), 2873 (CH), 1581 (C=C); λmax (nm) 253.4.

4,4'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-

diyl)bis(ethane-1,2-diyl)dimorpholine (4i). This compound was obtained from the procedure

performed in the synthesis of 4h, where the regioisomer 4i was obtained as a light brown, sticky

oil: 50 mg, 37%; 1H NMR (CDCl3) δ 3.24 (br. s., 8 H) 3.81 (t, J=6.0 Hz, 4 H) 3.95 – 3.98 (m, 8

H) 4.21 - 4.23 (m, 12 H) 5.16 (t, J=6.0 Hz, 4H) 6.97 (d, J=8.8 Hz, 4 H) 7.97 (d, J=8.8 Hz, 4 H); 13C NMR (CDCl3) δ 165.5, 160.7, 131.8, 128.4, 119.3, 115.1, 69.8, 67.6, 64.0, 63.7, 54.9, 52.2,

47.4; IR (cm-1) ν 2930 (CH), 2874 (CH), 1615 (C=C); λmax (nm) 256.5.

2,2'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-diyl)bis(1-(4-

(trifluoromethyl)phenylethanone) (4j). This compound was synthesized from 3 (91 mg, 0.230

mmol), sodium bicarbonate (60 mg, 0.692 mmol), and

1-(2-bromoethyl)-4-(trifluoromethyl)benzene (128 mg, 0.507 mmol) using the procedure described

34

for compound 4a. To the crude product, 10 mL of CH2Cl2 and 0.4 g of silica was added. The

volatile compounds were removed in vacuo, and the white silica powder was placed on a column.

The crude product mixture was purified using flash column chromatography on silica gel

(gradient, ethyl acetate:hexanes, 25% to 60% over 15 minutes) to afford 4j as a white solid: 42 mg,

38% yield; mp 123-125 oC; 1H NMR (CDCl3) δ 3.44 (t, J=7.6 Hz, 4 H), 3.99 (t, J=4.8 Hz, 4 H),

4.24 (t, J=4.80 Hz, 4 H), 4.88 (t, J=7.6 Hz, 4 H), 7.03 (d, J=8.8 Hz, 4 H), 7.30 (d, J=8.0 Hz, 4 H),

7.56 (d, J=8.0 Hz, 4 H), 8.05 (d, J=8.8 Hz, 4 H); 13C NMR (CDCl3) δ 165.0, 160.5, 140.5, 140.5,

129.7, 129.4, 129.0, 128.3, 125.1-125.8 (q, J=7.90 Hz, CF3), 120.1, 115.0, 69.9, 67.6, 53.5,

35.4; IR (cm-1) ν 2918 (CH), 2851 (CH), 1735 (C=O), 1542 (C=C); λmax (nm) 256.4.

Diethyl 2,2'-(5,5'-(oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-

diyl)diacetate (4k). This compound was synthesized from 3 (50 mg, 0.126 mmol), sodium

bicarbonate (24 mg, 0.278 mmol), and ethyl bromoacetate (47 mg, 0.278 mmol) using the

procedure described for compound 4a. To the crude product, 10 mL of CH2Cl2 and 0.4 g of silica

was added. The volatile compounds were removed in vacuo, and the white silica powder was

placed on a column. The crude product mixture was purified using flash column chromatography

on silica gel (gradient, ethyl acetate:hexanes, 25% to 60% over 15 minutes) to afford 4k as a white

solid: 20 mg, 28% yield; mp 139-141oC; 1H NMR (CDCl3) δ 1.29 (t, J=7.2 Hz, 6 H), 3.98 (t, J=4.8

Hz, 4 H), 4.23 (t, J=4.8 Hz, 4 H), 4.29 (q, J=7.2 Hz, 4 H), 5.42 (s, 4 H), 7.03 (d, J=8.8 Hz, 4 H),

8.08 (d, J=8.8 Hz, 4 H); 13C NMR (CDCl3) δ 165.5, 160.5, 128.5, 119.9, 114.9, 69.9, 67.6, 62.7,

53.3, 14.0; IR (cm-1) ν 2955 (CH), 2918 (CH), 1745 (C=O), 1581 (C=C); λmax (nm) 256.0.

2,2'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-diyl)diacetic

acid (4l). To a mixture of 4k (13 mg, 0.021 mmol) in THF (700 µL) and methanol (210 µL) was

added lithium hydroxide (3.04 mg, 0.127 mmol), and the reaction was set to stir at room

temperature overnight, under nitrogen atmosphere. Once the reaction was confirmed complete by

TLC analysis, the reaction solvent was removed under reduced pressure, and to the resulting

residue water (3 mL) was added. Next, 10% HCl (2 mL) was added drop-wise at 0oC until a

precipitate formed. The water was removed via rotatory evaporator, and to the residue was added

methanol/dichloromethane (1:9, 5 mL). The organic layer was filtered, dried over sodium sulphate,

and condensed in vacuo to afford 4l as a white solid: 11 mg, 98% yield; mp 201-202 oC; 1H NMR

35

(DMSO-d6) δ 3.86 (t, J=4.4 Hz, 4 H), 4.20 - 4.22 (m, J=4.4 Hz, 4 H), 5.68 (s, 4 H), 7.13 (d, J=8.8

Hz, 4 H), 7.98 (d, J=8.8 Hz, 4 H); 13C NMR (DMSO-d6) δ 164.3, 160.6, 128.4, 119.7, 115.7, 69.4,

67.8; IR (cm-1) ν 3512 (OH), 2955 (CH), 2917 (CH), 1725 (C=O), 1551 (C=C); λmax (nm) 255.0.

2,2'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-

diyl)diethanol (4m). This compound was synthesized from 3 (52 mg, 0.131 mmol), sodium

bicarbonate (24 mg, 0.290 mmol), and 2-bromoethanol (36 mg, 0.290 mmol) using the procedure

described for compound 4a. To the crude product, 10 mL of CH2Cl2 and 0.4 g of silica was added.

The volatile compounds were removed in vacuo, and the white silica powder was placed on a

column. The crude product mixture was purified using flash column chromatography on silica gel

(gradient, methanol:dichloromethane, 2% to 8% over 25 minutes) to afford 4m as a white solid: 27

mg, 43% yield; mp 159-161 oC; 1H NMR (DMSO-d6) δ 3.87 (t, J=4.0 Hz, 4 H), 3.94 (t, J= 4.80

Hz, 4 H), 4.21 (t, J=4.0 Hz, 4 H), 4.73 (t, J=4.8 Hz, 4 H), 5.07 (br. s., 2 H), 7.12 (d, J=8.8 Hz, 4

H), 7.98 (d, J=8.4 Hz, 4 H); 13C NMR (MeOD-d4) δ 164.8, 160.5, 128.1, 119.8, 114.8, 77.8, 77.5,

77.2, 69.7, 67.4, 59.6, 55.4; IR (cm-1) ν 3675 (OH), 2955 (CH), 2915 (CH), 1592 (C=C); λmax

(nm) 254.4.

Methyl-1-(2-(5-(4-(2-(2-(4-(1-(2-(4-(methoxycarbonyl)piperidin-1-yl)ethyl)-1H-tetrazol-5-

yl)phenoxyethoxyphenyl)-2H-tetrazol-2-yl-ethylpiperidine-4-carboxylate (4n). This compound

was synthesized using a modified approached as described in 4a. This compound was synthesized

from 3 (52 mg, 0.131 mmol), potassium carbonate (24 mg, 0.290 mmol), potassium iodide (6.67

mg, 0.042 mmol), and 11 (68 mg, 0.330 mmol). The reaction mixture was placed under

microwave radiation for 120 minutes at 105oC. The solvent was removed under reduced pressure,

and to the residue, EtOAc (15 mL) was added. The organic layer was washed with water (3 x 5

mL) and saturated sodium bicarbonate solution (5 mL). The organic layers were combined, dried

over sodium sulphate, and condensed in vacuo. To the remaining residue was added 3 mL CH2Cl2

and 0.5 g silica, and the volatile compounds were removed in vacuo. The resulting white silica

powder was placed on a column, a purified via flash chromatography on silica gel (gradient,

methanol:dichloromethane, 3% to 5% over 20 minutes) to afford 4n as a clear oil: 30 mg, 61%; 1H NMR (MeOD-d4) δ 2.23 (br. s., 8 H) 2.77 (br. s., 2 H) 3.24 (br. s., 8 H) 3.73 (s, 6 H) 3.83 (t,

J=6.4 Hz, 2 H) 3.93 (t, J=6.4 Hz, 2 H) 3.96 – 3.99 (m, 4 H) 4.24 - 4.29 (m, 4 H) 4.96 (t, J=6.8 Hz,

2 H) 5.23 (t, J=6.0 Hz, 2 H) 7.10 (d, J=6.8 Hz, 2 H) 7.20 (d, J=6.8 Hz, 2 H) 7.72 (d, J=6.8 Hz, 2

36

H) 8.05 (d, J=6.8 Hz, 2 H); 13C NMR (MeOD-d4) δ 173.3, 165.3, 161.7, 161.0, 154.7, 130.2,

128.0, 119.4, 115.3, 114.8, 69.5, 69.4, 67.6, 67.4, 51.2, 42.6; IR (cm-1) ν 2957 (CH), 2922 (CH),

1729 (C=O), 1541 (C=C); λmax (nm) 254.0.

Dimethyl 1,1'-(5,5'-(oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-

diyl)bis(ethane-1,2-diyl)bis-piperidine-4-carboxylate (4o). This compound was obtained from

the procedure performed in the synthesis of 4n, where the regioisomer 4o was obtained as a clear

oil: 30 mg, 61%; 1H NMR (MeOD-d4) δ 1.98 (br. s, 4 H) 2.23 (br. s., 4 H) 2.78 (br. s., 2 H), 3.73

(s, 2 H) 3.92 (t, J=6.4 Hz, 4 H) 3.98 (t, J=4.4 Hz, 4 H) 4.25 (t, J=4.4 Hz, 4 H) 5.24 (t, J=6.0 Hz, 4

H) 7.099 (d, J=8.4 Hz, 4 H) 8.05 (d, J=8.4 Hz, 4 H); 13C NMR (MeOD-d4) δ 173.2, 165.4, 161.0,

128.0, 119.4, 114.8, 69.5, 67.4, 51.3; IR (cm-1) ν 2924 (CH), 2855 (CH), 1727 (C=O), 1614

(C=C); λmax (nm) 256.0.

1,1'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-

diyl)bis(ethane-1,2-diyl)dipiperazine (4p). To a suspension of 3 (77.83 mg, 0.197 mmol),

potassium iodide (32.76 mg, 0.197 mmol), potassium carbonate (81.82 mg, 0.591 mmol) in

anhydrous DMF (3 mL) was added 9 (54.00 mg, 0.217 mmol). The reaction mixture was placed

under microwave radiation for 45 minutes at 120oC. Once the reaction was confirmed complete by

TLC analysis, water was added (10 mL), and was extracted with EtOAc (3 x 5 mL). The organic

layers were washed with saturated sodium bicarbonate solution (5 mL) and brine solution (5 mL),

dried over sodium sulphate, and condensed in vacuo. To the remaining residue was added 3 mL

CH2Cl2 and 0.5 g silica, and the volatile compounds were removed in vacuo. The resulting white

silica powder was placed on a column, a purified via flash chromatography on silica gel (gradient,

methanol:dichloromethane, 3% to 5% over 25 minutes) to afford Boc-protected 4p as a white

solid: 27 mg, 20% yield. 1H NMR (CDCl3) δ 1.42 - 1.47 (m, 18 H) 2.48 (br s, 4 H) 3.04 (t, J=6.6

Hz, 4 H) 3.36 (t, J=5.2 Hz, 4 H) 3.98 (t, J=4.5 Hz, 4 H) 4.24 (t, J=4.2 Hz, 4 H) 4.64 (t, J=5.0 Hz, 4

H) 4.75 (t, J=6.8 Hz, 4 H) 4.90 (t, J=5.0 Hz, 4 H) 7.03 (d, J=8.8 Hz, 4 H) 8.06 (d, J=8.8 Hz, 4 H).

Finally, Boc-protected 4p was placed in an oven dried RBF, and to it was added trifluoroacetic

acid/dichloromethane (3:7, 4 mL). The reaction mixture was then set to stir at room temperature

for 2 hours. Once the reaction was confirmed complete by TLC analysis, the solvent was removed

under reduced pressure, and to the resulting residue was added saturated sodium bicarbonate

37

solution (5 mL). The aqueous solution was then extracted with EtOAc (3 x 5 mL), organic layers

combined, dried over sodium sulphate, and condensed in vacuo to afford 4p as a clear, yellow,

sticky oil: 11 mg, 99% yield; 1H NMR (CDCl3) δ 2.30 (br. s., 2 H), 2.54 (br. s., 8 H) 2.88 (br. s., 8

H) 3.02 (t, J=6.8 Hz, 2 H) 3.98 (t, J=4.8 Hz, 4 H) 4.23 (t, J=4.8 Hz, 4 H) 4.63 (t, J=5.2 Hz, 2 H)

4.74 (t, J=6.8 Hz, 2 H) 4.89 (t, J=4.8 Hz, 2 H) 7.02 (d, J=7.6 Hz, 4 H) 8.06 (d, J=8.4 Hz, 4 H); 13C

NMR (MeOD-d4) δ 165.4, 160.8, 131.3, 129.1, 127.8, 119.8, 114.7, 114.1, 69.5, 67.4, 55.5, 49.9,

49.0, 43.4, 22.8; IR (cm-1) ν 3354 (NH), 3010 (CH), 2938 (CH),1597 (C=C); λmax (nm) 256.0.

1-(2-(Pyrrolidin-1-yl)ethyl)-5-(4-(2-(2-(4-(2-(2-(pyrrolidin-1-yl-ethyl)-2H-tetrazol-5-

yl)phenoxy)ethoxyphenyl-1H-tetrazole (4q). This compound was synthesized from 3 (158 mg,

0.401 mmol), potassium iodide (66 mg, 0.397 mmol), sodium bicarbonate (101mg, 1.20 mmol),

and 1-(2-chloroethyl)pyrrolidine (134, 1.00 mmol) using the procedure described for compound

4n. To the crude product, 10 mL of CH2Cl2 and 0.4 g of silica was added. The volatile compounds

were removed in vacuo, and the white silica powder was placed on a column. The crude product

mixture was purified using flash column chromatography on silica gel (gradient,

methanol:dichloromethane, 2% to 8% over 30 minutes) to afford 4q as a clear, yellow, sticky oil:

14 mg, 59%; 1H NMR (MeOD-d4) δ 2.04 (br. s., 8 H) 3.64 - 3.81 (m, 8 H) 3.82 - 3.87 (m, 2 H)

3.92 - 4.01 (m, 4 H) 4.04 (t, J=6.0 Hz, 2 H) 4.25 - 4.32 (m, 4 H) 4.97 (t, J=6.0 Hz, 2 H) 5.22 (t,

J=6.0 Hz, 2 H) 7.10 (d, J=8.8, 2.26 Hz, 2 H) 7.20 (d, J=8.8, 2 H) 7.76 (d, J=8.8 Hz, 2 H) 8.60 (d,

J=8.8 Hz, 2 H); 13C NMR (MeOD-d4) δ 165.4, 161.7, 160.9, 154.7, 130.3, 128.0, 119.4, 115.3,

114.8, 114.8, 69.5, 69.4, 67.6, 67.4, 54.4, 54.3, 52.6, 52.5, 43.9, 22.5; IR (cm-1) ν 2980 (CH), 2929

(CH), 1613 (C=C); λmax (nm) 254.0.

5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2-(2-(pyrrolidin-1-yl)ethyl)-2H-

tetrazole (4r). This compound was obtained from the procedure performed in 4q, where the

regioisomer 4r was isolated as a clear, white, sticky oil: 35 mg, 59%; 1H NMR (MeOD-d4) δ 2.11

(br. s., 8 H) 3.87 - 4.05 (m, 16 H) 4.25 (t, J=4.8 Hz, 4 H) 5.20 (t, J=6.0 Hz, 4 H) 7.10 (d, J=9.0 Hz,

4 H) 8.06 (d, J=9.0 Hz, 4 H); 13C NMR (MeOD-d4) δ 165.5, 161.0, 128.0, 119.4, 114.8, 69.5,

67.4, 54.3, 52.7, 22.5; IR (cm-1) ν 2998 (CH), 2926 (CH), 1613 (C=C); λmax (nm) 254.0.

1-(4-(Dimethylamino)phenyl)ethanone (6): To a solution of 4-aminoacetophenone (1.01 g, 7.47

mmol) in anhydrous DMF (10 mL) was added iodomethane (2.33 g, 16.415 mmol) and potassium

38

carbonate (2.83 g, 20.47 mmol). The reaction mixture was heated to 60 oC and stirred under

nitrogen atmosphere for 12 hours. Once the reaction was confirmed complete by TLC analysis, the

reaction mixture was quenched with water (25 mL), and extracted with the EtOAc (2 x 15 mL).

The organic layers were washed with water (2 x 10mL) and saturated sodium bicarbonate solution

(10 mL). The organic layers were combined, dried over sodium sulphate, and condensed in vacuo

to afford 6 as a light yellow solid: 1.16 g, 84% yield. 1H NMR (CDCl3) δ 2.48 - 2.52 (s, 3 H), 3.06

(s, 6 H), 6.65 (d, J=7.2 Hz, 2 H), 7.87 (d, J=7.2 Hz, 2 H).

2-Bromo-1-(4-Dimethylamino)phenylethanone (7): To a round-bottomed flask obtained from an

oven was added 6 (256 mg, 0.0512 mmol). The reaction vessel was placed into an ice bath, and to

it was added HBr (5 mL) at 0oC. Next, once complete dissolution was achieved, bromine (249 mg,

0.0512 mmol) was added drop-wise over a period of 30 minutes, ensuring a controlled amount was

added over the allocated time period. After complete addition, the reaction mixture was left to stir

for one hour in the ice bath. Once the reaction was confirmed complete by TLC analysis, water (10

mL) was added, as well as saturated sodium bicarbonate solution until neutralization was achieved,

and confirmed by pH analysis. The resulting mixture was extracted with dichloromethane (3 x 10

mL), and the organic layers were combined and washed with saturated sodium bicarbonate

solution (2 x 10 mL). The organic layers were dried over sodium sulphate, and condensed via

rotatory evaporator to afford 7 as an orange solid: 322 mg, 85% yield. 1H NMR (CDCl3) δ 3.03 (s,

6 H), 4.32 (s, 2 H), 6.61 (d, J=8.8 Hz, 2 H), 7.84 (d, J=8.8 Hz, 2 H).

tert-Butyl-4-(2-chloroethyl)piperazine-1-carboxylate (9). To a solution of 1-boc-piperazine (315

mg, 1.69 mmol) in anhydrous DMF (10 mL) was added potassium carbonate (701 mg, 5.07

mmol), and the reaction mixture was set to stir at room temperature for 30 minutes. Once

complete, 1-bromo-2-chloroethane (242 mg, 1.69 mmol) was added drip-wise over a period of five

minutes, and the suspension was allowed to stir overnight at room temperature. Once the reaction

was confirmed complete by TLC analysis, water (20 mL) was added, and was extracted with ethyl

acetate (3 x 10 mL). The organic layers were combined, dried over sodium sulphate, and

condensed in vacuo. To the remaining residue was added 3 mL CH2Cl2 and 0.5 g silica, and the

volatile compounds were removed in vacuo. The resulting white silica powder was placed on a

column, a purified via flash chromatography on silica gel (gradient, methanol:dichloromethane,

39

1% to 5% over 20 minutes), to afford 9 as a white powder: 202 mg, 52% yield. 1H NMR (CDCl3)

δ 1.46 (s, 9 H) 3.44 (dt, J=5.6 Hz, 2 H) 3.69 (t, J=5.6 Hz, 2 H) 4.34 (t, J=5.2 Hz, 2 H).

Methyl-1-(2-chloroethyl)piperidine-4-carboxylate (11): This compound was synthesized from

methyl piperidine-4-carboxylate (300 mg, 2.10 mmol), potassium carbonate (890 mg, 6.29 mmol),

and 1-bromo-2-chloroethane (300 mg, 2.10 mmol) using the procedure described for 9. To the

remaining residue was added 3 mL CH2Cl2 and 0.5 g silica, and the volatile compounds were

removed in vacuo. The resulting white silica powder was placed on a column, a purified via flash

chromatography on silica gel (gradient, methanol:dichloromethane, 1% to 5% over 20 minutes), to

afford 11 as an off-white powder: 79 mg, 20% yield. 1H NMR (CDCl3) δ 2.23 - 2.37 (m, 1 H)

2.71 (t, J=4.8 Hz, 2 H) 2.90 (s, 2 H) 3.58 (t, J=4.8 Hz, 2 H) 3.68 (t, 2 H) 3.69 - 3.71 (m, 2 H) 4.05

(br s, 2 H) 4.27 - 4.39 (m, 2 H).

4-(2-Bromoethyl)morpholine (13): To a reaction vessel charged with 12 (541 mg, 4.13 mmol) in

dichloromethane (20 mL) was added carbon tetrabromide (2.05 g, 6.19 mmol) and

triphenylphosphine (1.30 g, 4.95 mmol) in sequential order at 0oC. The resulting reaction mixture

was then slowly warmed to room temperature, and allowed to stir overnight. Once the reaction was

confirmed complete by TLC analysis, the solvent was removed under reduced pressure, and to the

resulting residue was added hexanes (80 mL). The solid precipitate was filtered, and the filtrate

was concentrated via rotatory evaporator to afford 13 as a white solid: 448 mg, 56% yield. 1H

NMR (CDCl3) δ 2.50 (t, J=4.2 Hz, 4 H), 2.78 (t, J=7.8 Hz, 2 H), 3.42 (t, J=7.8 Hz, 2 H), 3.72 (t, J-

=4.2 Hz, 4 H).

4.3 Cell Viability. 2tfgh cells were seeded at a density of 1.5 x 105/mL in 100 mL of DMEM

supplemented with 2% FCS in individual wells of 96-well tissue culture plates. After 24 hours

they were treated with the indicated concentrations of the appropriate compounds for 16h, after

which the medium was replaced DMEM supplemented with 2%FCS for an additional 24h. The

cells were then fixedin ethanol (95%)-fixed, stained with crystal violet (0.1% in 2% ethanol) and

destained (0.5 M NaCl in 50% ethanol).The absorbance of destained cells at 570nm was assessed

using a Microplate reader (Molecular Devices) and Softmax 2.32 software. Viability of the cells

was then determined relative to untreated cells.

40

4.4 Antiviral Assay. 2tfgh cells were seeded at a density of 1.5 x 105/mL in 100 mL of DMEM

supplemented with 2% FCS in individual wells of 96-well tissue culture plates. After 24 hours the

cells were treated with the indicated compounds for 16 h. At the time of virus inoculation, the

medium was aspirated and EMCV was added to individual wells in 100 mL of DMEM, 2% FCS.

After an additional 24 h, cells were ethanol (95%)-fixed and the extent of EMCV infection was

determined by spectrophotometric estimation of viral CPE. Fixed cells were crystal violet (0.1% in

2% ethanol) stained and destained (0.5 M NaCl in 50% ethanol), and the inhibition of virus

infection was estimated from absorbance measurements at 570 nm using a Microplate Reader

(Molecular Divices) and SOFTmax2.32 software relative to untreated and uninfected cells.

4.5 IFN-Stimulated Genes (ISG) Expression. Real-time PCR were perform using a

LightCycler® instrument (Roche) in conjunction with LightCycler® FastStart DNA Master SYBR

GreenPLUS I Kit (Roche). Reactions were performed in a final volume of 20 µl containing 1x

Master SYBR GreenPLUS I buffer, 1µl of each primer (concentration 20µM) and 5 µl template

cDNA ( concentration 100 ng/µl).

The following reaction conditions were used: pre-incubation at 95°C for ten minutes, followed by

45 amplification cycles of denaturation at 95°C for ten seconds, annealing at 60°C for 5 seconds,

extension at 72°C for ten seconds, melting curve analysis at 65°C for 15 seconds and a continuous

acquisition mode of 95°C with a temperature transition rate of 0.1°C/s.

PCRs were performed using the following primers:

ISG15 sequence:

(forward) 5’ GCGGCTGAGAGGCAGCGAAC

(reverse) 5’ TGCCCGCCAGCATCTTCACC

OAS1 sequence:

(forward) 5’ GAGCTCCAGGGCATACTGAG

(reverse) 5’ CCAAGCTCAAGAGCCTCATC

41

PKR sequence:

(forward) 5’ GGCTCCTGTGTGGGAAGTCA

(reverse) 5’ TATGCCAAAAGCCAGAGTCCTT

HPRT sequence:

(forward) 5’ TCCTCCTCTGCTCCGCCACC

(reverse) 5’ TCACTAATCACGACGCCAGGGCT

Reactions were performed in accordance with conditions required for use of LightCycler®

Relative Quantification Software. Standard curves were established for each primer set and both

reference (HPRT) and target (ISG15, OAS1 and PKR) reactions were performed for each sample.

4.6 Phosphorylation of Tyk2. Cells were treated with the indicated doses of the candidate

compounds for 2, 5, and 15 mins. Cells were lysed in a phosphorylation lysis buffer supplemented

with protease and phosphatase inhibitors. Equal protein aliquots were resolved by SDS–PAGE,

and transferred to membranes for immunoblotting with an antibody against tyrosine

phosphorylated Tyk2.

42

5. APPENDIX

The purity for compounds 4a-r were determined by LC/MS analysis using a Waters™ Liquid

Chromatography/Mass Spectrometry system equipped with a PDA (200-500 nm) and a mass

spectrometer (60-2000 Da) detectors. The HPLC methods for purity measurements were

developed using a Waters™ X-Bridge analytical column (4.6 mm x 150 mm, 5 µm), 1 mL/min

flow rate and using gradient or isocratic methods as listed below. High Resolution Mass

Spectrometry was recorded using ESI +ve mode for all the compounds.

Table 4. Purity data for synthesized library.

Compound R - Regiochemistry Method Purity (%) Retention

Time (min)

4a

N2,N2' C 95.07 7.20

L 95.77 2.79

4b

N2,N2'

C 95.32 7.88

L 96.36 4.71

4c

N1,N1' Q 97.80 3.68

A 97.18 5.83

4d

N1,N2' P 99.31 2.43

B 97.58 5.23

4e

N2,N2' P 98.94 4.38

B 97.06 5.58

4f

N2,N2'

H 95.02 9.20

S 95.32 7.05

4g N2,N2' M 96.21 2.25

43

D 96.27 7.36

4h

N1,N2' J 95.24 7.19

K 95.07 5.35

4i

N2,N2'

C 97.89 4.81

P 97.88 3.83

4j

N2,N2' E >99.99 9.17

M >99.99 4.02

4k

N2,N2': N1,N2' (75:25)

N 96.08

N2,N2': 2.83

N1,N2': 3.05

H 96.20

N2,N2': 8.09

N1,N2': 8.20

4l

N2,N2'

D

Total: 97.80

N2,N2': 91.23

N1,N2': 8.77

N2,N2': 5.25

N1,N2': 6.43

F

Total: 97.39

N2,N2': 91.61

N1,N2': 8.39

N2,N2': 2.98

N1,N2': 3.79

4m

N2,N2'

G

Total: 97.53

N2,N2': 90.80

N1,N2': 9.20

N2,N2': 7.47

N1,N2': 7.03

H

Total: 97.20

N2,N2': 89.56

N1,N2':

N2,N2': 6.19

N1,N2': 5.89

44

10.44

4n

N1,N2'

A 99.44 6.00

B 98.55 4.16

4o

N2,N2'

A 99.07 6.37

B 95.41 4.49

4p

N2,N2'

A 99.36 5.39

O 99.06 2.35

4q

N1,N2' I 97.94 3.41

B 98.63 4.26

4r

N2,N2' I 97.58 3.58

B 98.64 4.60

Table 5. HPLC gradient methods using methanol (0.05% TFA) in water (0.05% TFA) for purity measurements.

Method

Gradient System,

Methanol:Water (0.05% TFA)

Total Time

A 0-98% in 10 mins 10 mins

B 30-98% in 10 mins 10 mins

C 30-98% in 10 mins, 98% for 5 mins

15 mins

D 50-98% in 10 mins 10 mins

E 50-98% in 15 mins 15 mins

65-98% in 10 mins 10 mins

45

Table 6. HPLC gradient methods using acetonitrile (0.05% TFA) in water (0.05% TFA) for purity measurements. Method Gradient System,

Acetonitrile:Water (0.05% TFA)

Total Time

G 0-98% in 10 mins 10 mins H 0-98% in 7 mins,

98% for 3 mins 10 mins

I 40-98% in 10 mins 10 mins J 0-65% in 10 mins 10 mins K 0-85% in 7 mins,

85-98% in 3 mins 10 mins

Table 7. HPLC isocratic methods using methanol (0.05% TFA) in water (0.05% TFA) for purity measurements. Method Isocratic System

Methanol:Water (0.05% TFA)

Total Time

L 80% 15 mins M 85% 10 mins N 75% 10 mins O 50% 10 mins P 40% 10 mins Q 35% 10 mins R 35% 15 mins

Table 8. HPLC isocratic methods using acetonitrile (0.05% TFA) in water (0.05% TFA) for purity measurements. Method Isocratic System,

Acetonitrile:Water (0.05% TFA)

Total Time

S 70% 10 mins

46

Table 9. HRMS data for bis-phenyltetrazole derivatize series.

Compound Structure Formula for [M+H]+

Calculated for [M+H]

Found for [M+H]

4a

C38H41N10O5 717.3261 717.3165

4b

C38H37N10O3 681.3050 681.2854

4c

C30H45N10O3 593.3676 593.3929

4d

C30H45N10O3 593.3676 593.3929

4e

C30H45N10O3 593.3676 593.3929

47

4f

C42H49N10O5 773.3887 773.4268

4g

C34H31N8O5 631.2418 631.2192

4i

C30H41N10O5 621.3261 621.1801

4j

C36H33F6N8O3 739.2580 739.2278

4k

C26H31N8O7 567.2316 567.2146

48

4l

C22H23N8O7 511.1690 511.2071

4m

C22H27N8O5 483.2104 483.2341

4n

C36H49N10O7 733.3785 733.4281

4o

C36H49N10O7 733.3785 733.4281

49

4p

C30H43N12O3 619.3581 619.3787

4q

C30H41N10O3 589.3363 589.3606

4q

C30H41N10O3 589.3363 589.2333

4h

C30H41N10O5 621.3261 621.3627

50

CHAPTER 3: DESIGN AND SYNTHESIS OF NON-

SECOSTEROIDAL AGONISTS TARGETING THE NUCLEAR

MEMBRANE BOUND VITAMIN D RECEPTOR

ABSTRACT

Vitamin D has received increased attention over the past several years, attributable to a variety of

potential therapeutic applications, which include nutritional rickets and regulation of calcium

homeostasis. More recently, vitamin D has been linked to the reduction of cholesterol in humans,

providing a novel way of managing cholesterol in patients. Administration of the hepatic activated

vitamin D active metabolite, 1,25-dihydroxyvitamin D3 (1,25D), has potential therapeutic

limitations, largely attributed to its induction of elevated high circulating calcium concentrations

(hypercalcemia).42 In this work, we aim to circumvent these associated limitations of 1,25D by the

design and synthesis of non-secosteroidal 1,25D mimetics which exhibit agonism to the vitamin D

receptor (VDR). To date, the vast majority of VDR ligands are secosteroids, which cause

hypercalcemia. Our aim is to prevent this observed issue of hypercalcemia by designing non-

secosteroidal VDR agonists.

Through previous in silico screening efforts performed by the Kotra group, a series of small

molecules were selected and evaluated for activity towards VDR. Three candidate compounds

were selected (KP-156, 162, and 172), and were re-synthesized to reproduce observed activities.

These compounds possess a central, tri-substituted pyrimidine scaffold, representing a complete

non-secosteroidal structure. An elaborate and efficient synthetic route has been devised which

affords key intermediates readily. An cyclocondensation reaction between substituted 3-ketoesters

and amidines affords a key tri-substituted pyrimidine intermediate, which can be functionalized

rapidly, permitting the generation of compound libraries. To our knowledge, this is the first

reported evidence of this class of compounds to exhibit VDR agonism, as well as the first reported

synthesis in generating the key functionalized pyrimidine moiety. This work highlights significant

efforts into developing a novel synthetic route to afford this organic scaffold.43, 44

Declaration of work: All synthetic schemes, synthesis of compounds, and characterizations were

performed by Joseph M. Keca. In silico screenings were performed by Dr. William Wei.

51

6. INTRODUCTION

5.1 Physiological Implications of Vitamin D

Vitamin D has received growing attention over recent years, due to various reports describing its

pleiotropic activities. In addition to being a key dietary supplement, vitamin D has shown a role in

cancer as a chemopreventive agent, as well an immunomodulator.42, 45, 46 More recently, vitamin D

has displayed a role in lowering cholesterol, highlighting another therapeutic potential.

Conventionally, vitamin D is an essential nutrient in maintaining calcium homeostasis and bone

integrity. Consequences of vitamin D deficiency include nutritional rickets in children, as well as

osteomalacia in adults.47 In humans, endogenous production of vitamin D3 occurs via sunlight,

where the synthesis of provitamin D3 (7-dehydrocholesterol, Figure 4) occurs from acetyl-

coenzyme A.47 7-dehydrocholesterol undergoes a photochemical electrocyclic reaction upon

sunlight irradiation to form previtamin D3 (Figure 6), whereby a subsequent thermal 1,7-

sigmatropic reaction yields vitamin D3.48 Interestingly, these two key reactions which form

vitamin D3 occur in the absence of an enzyme, elucidating the importance of sunlight in these

reactions as an essential component for product conversion.

Figure 6. Biosynthetic, photochemical production of vitamin D3 in the skin. Before having the ability to perform biological functions, vitamin D3 must be metabolized into its

active form. Vitamin D3 is first hydroxylated at C-25 by hepatic CYP27A1 to form

25-hydroxyvitamin D3 (25D, Figure 6), one of the major circulating forms of vitamin D3.49 Next, a

tightly regulated 1α−hydroxylation occurs in the kidney, catalyzed by CYP27B1, to afford the

active metabolite, 1,25-dihydroxyvitamin D3 (1,25D, Figure 7). Hydroxylation at the 24R-position

52

can occur under adequate vitamin D supply and normal plasma Ca2+ concentration (9-10 mg/dl)

for both 25D and 1,25D,47 affording 1,24R,25D and 24R,25D (Figure 7). The 24-hydroxylation is

mediated by CYP24, whose expression is regulated by 1,25D binding to VDR, acting as a negative

feedback mechanism to modulate and decrease high levels of active 1,25D.50, 51 Active 1,25D

exhibits its biological activities through binding to VDR, which acts as a ligand-regulated

transcription factor.

Figure 7. Metabolism and subsequent activation of vitamin D3 into 1,25D.

53

5.2 VDR Activation and Modulation of Cholesterol

As previously noted, VDR activation plays a critical role in calcium homeostasis and phosphorus

metabolism, as well as regulation of proliferation and differentiation of cells, and

immunomodulation. More recently, and the specific purpose for our investigations into VDR

agonists, is the newly characterized role of VDR and cholesterol modulation.52 While cholesterol

is an essential component of cell membranes and steroidogenesis, elevated levels can lead to

atherosclerosis and coronary heart disease.52 Cholesterol is converted into bile acids by the 7α-

hydroxylase, CYP7A1,53 a rate-limiting enzyme in classical bile acid biosynthesis. One of the

primary negative feedback regulation mechanisms of CYP7A1 is the human farnesoid X receptor

(FXR) and human small heterodimer partner (SHP) regulatory cascade.54 FXR and SHP act to

down-regulate CYP7A1 activity, thereby preventing the conversion of cholesterol to bile acids and

subsequent modulation of cholesterol levels.52 It has been found that VDR activation acts to inhibit

SHP activity through an FXR independent mechanism, subsequently preventing the ability of SHP

to down-regulate CYP7A1.52 This up-regulation of CYP7A1 results in the direct conversion of

cholesterol into bile acids, effectively lowering cholesterol levels. The VDR-mediated cholesterol

lowering mechanism has been demonstrated in both in vitro and in vivo models, illustrating a

novel therapeutic target for cholesterol modulation.

5.3 Limitations of Dietary Vitamin D and 1,25D in Treating Hypercholesterolemia

While the novel mechanism of up-regulation of CYP7A1 through VDR induction provides a novel

therapeutic target for cholesterol lowering, the use of dietary vitamin D and its active metabolite,

1,25D, to lower cholesterol, possesses several barriers. The use of dietary vitamin D for

cholesterol is a topic of considerable debate, as the levels of 1,25D that are synthesized following

vitamin D3 ingestion are significantly low, under a therapeutically relevant level.52 Due to the

uncertainty that surrounds the use of dietary vitamin D in treating hypercholesterolemia, further

investigations are required in order to determine whether there is any therapeutic potential.

Another alternative would be the use of the active hormone, 1,25D (calcitriol, commercially

available under the brand name ROCALTROL®). The current clinical indications for

ROCALTROL® include the management of hypocalcemia and its clinical manifestations in

patients with hypoparathyroidism.55 It is also indicated in the management of secondary

hypoparathyroidism and resultant metabolic bone disease in patients with chronic renal failure

54

(both predialysis and dialysis patients).56 One of the major limitations of calcitriol treatment is the

hypercalcemic effects associated with it.57 The dose-limiting hypercalcemia of ROCALTROL®

and other 1,25D marketed drugs, prevents their use in chronic and/or acute treatment of

hypercholesterolemia. This highlights the limitation of the therapeutic potential of 1,25D, due to

induction of elevated high circulating calcium concentrations.

While analogues of calcitriol have been developed with reduced hypercalcemic effects –

paricalcitol (ZEMPLAR®) and doxercalciferol (HECTOROL®) – subsequent dose-limiting

hypercalcemia still remains.58, 59 The hypercalcemic effects of 1,25D have been proposed to be

associated with the secosteroidal nature of vitamin D and its active metabolites.60, 61 As a result,

efforts have been made to consider non-secosteroidal VDR agonists to circumvent the

hypercalcemia limitations of 1,25D treatment. A variety of 1,25D analogues have been developed

with no associated hypercalcemic effects, while maintaining the ability to induce VDR.62

However, poor efficacy and potency of these compounds have resulted in clinical trial failures.42

Currently, there are new non-secosteroidal VDR agonists emerging that demonstrate VDR

agonism in vitro.60 Further studies are required to investigate the therapeutic potential of these

compounds in animal models, and ultimately humans. Accordingly, a major focus of these studies

was the identification and synthesis of a non-secosteroidal VDR agonist, with potential to be used

in treating hypercholesterolemia, without the observed hypercalcemic effects of secosteroidal

VDR ligands.

5.4 Rationale

In silico screening efforts were applied to identify non-secosteroidal small molecules with

potential agonist activity to VDR. Previous work from the Kotra group analyzed the 34 available

VDR crystal structures in the protein databank to understand the three-dimensional features of the

ligand binding site. Using the X-ray crystal structures of VDR bound by 1,25D in the binding

pocket, key binding interactions were defined. After carefully screening a library of molecules in

the VDR, 128 hit compounds were identified. From these 128 hit compounds, 67 compounds were

purchased from vendors, and were screened through biological evaluations performed by the

groups of Drs. Sandy Pang and Carolyn Cummins. Of these compounds, three compounds were

the most active (KP-156, KP-162, and KP-172, Figure 8).

55

Figure 8. Selected hit compounds identified through in silico screening with potential VDR agonist activity.

The biological evaluation of the three compounds indicated a potential role as VDR agonists. The

focus of this project was to confirm these observations, which required the compounds to be

synthesized in house, requiring an effort to design a synthetic process for these compounds. A

retrosynthetic analysis was implemented to design a feasible, efficient route to target compounds

(Scheme 5). To our knowledge, there is no reported synthesis of the 2-(piperidin-3-yl)-6-(pyridin-

4-yl)pyrimidin-4-ol scaffold (KP-156 and KP-172), as well as the 6-(piperidin-3-yl)-2-(pyridin-4-

yl)pyrimidin-4-ol scaffold (KP-162), which required significant effort to develop a feasible and

effective synthesis for these compounds. After exploring a variety of synthetic pathways, a

feasible and effective synthetic strategy was developed to generate the 2-(piperidin-3-yl)-6-

(pyridin-4-yl)pyrimidin-4-ol scaffold in high yields. This synthetic approach can be manipulated to

produce KP-162, which possesses inverted regiochemistry in the pyrimidine scaffold.

5.5 Hypothesis

Develop a synthetic pathway to access and re-synthesize KP-156, KP-162, and KP-172, such that

these compounds can be analyzed for their VDR agonist activities.

56

Scheme 5. Retrosynthetic analysis of VDR agonist hit compounds. Panel A: Retrosynthetic route of KP-156 and KP-172, sharing identical regiochemistry on pyrimidine core. Panel B: Retrosynthetic route of KP-162, possessing inverse regiochemistry to KP-156/KP-172 on pyrimidine core.

A

B

57

7. RESULTS AND DISCUSSION

6.1 Synthetic Approach of 6-(pyridin-4-yl)pyrimidine Rings Using Substitutions and

Cyclocondensations

The initial synthetic approach for the target compounds (KP-156,162, and 172) utilized 2,4,6-

trichloropyrimidine as a core building block. Due to the tri-halide functionality, it would be

possible to implement the desired three substitutions observed in the target compounds. The first

step involved introducing 4-pyridyl at C-6 in the pyrimidine ring. Generating this functionality

posed numerous synthetic challenges. Refer to Scheme 6. This was observed in 1, as generating

the free base of 4-bromopyridine hydrochloride resulted in immediate polymerization within

minutes. Consequently, approaches were taken to circumvent these initial issues. Liberation of free

base 1 in a suitable base and organic solvent was achieved in minutes, which was directly

converted to the corresponding pyridine-N-oxide (PNO) 2. This compound displayed improved

stability, including absent polymerization and stability under atmospheric conditions.

Additionally, pyridine-N-oxides possess favourable characteristics not observed in pyridine alone,

such as increased nucleophilicity and electrophilicity, higher dipole-moment [4.37 D (PNO) versus

2.03 D (pyridine)], and decreased basicity [pKa = 0.79 (PNO) versus pKa = 5.2 (pyridine)].63 The

modulated nucleophilic and electrophilic properties of 2 led to various synthetic strategies to

introduce 4-pyridyl at C-6 on 2,4,6-trichloropyrimidine.

Previous synthetic approaches have utilized direct nucleophilic substitutions using

4-lithiopyridyl species, generated from the corresponding 4-halopyridine.64 Moreover, the

corresponding Grignard derivative of 2 could be implemented as another nucleophile (3). Both

approaches were attempted, and the formation of the lithium salt of 2 and the Grignard 3 were

readily produced. However, complications arose when attempting to directly add 2 or 3 onto 2,4,6-

trichloropyrimidine. In both cases, rapid polymerization and degradation of the pyridine-N-oxide

derivative was observed. Attempts were made using the N-oxide free corresponding 4-

bromopyridine, but to no avail. Efforts using lithium-mediated or magnesium mediated

nucleophilic addition resulted in no product formation.

To circumvent these issues, attempts were considered to directly build the pyrimidine ring, with

the desired 6-(pyridin-4-yl)pyrimidine functionality. To achieve this, a cyclocondensation

58

approach was formulated which involves a 3-ketoester (5) and urea or thiourea (6). This approach

was first reported in 1972,65 which has been refined further in a number of publications to reduce

reaction times and improve product yields.66, 67 Firstly, the corresponding 3-ketoester derivative of

pyridine was synthesized using classical Claisen condensation conditions, to afford 5 in excellent

yields. Next, a variety of synthetic approaches were used to generate 7 via cyclocondensation

between 5 and 6 (or thiourea). Solvent-free, Bronsted-acid, and Lewis-acid mediated approaches

were attempted, however, no product conversion was observed. Using sodium methoxide and

elevated temperatures produced 7 in low-to-moderate yields, which was further optimized to

reduce reaction durations to 15 minutes by use of microwave irradiation. Subsequent aromatization

of the pyrimidine ring and chlorination was attempted using phosphorus (V) oxychloride, thionyl

chloride, and oxalyl chloride. However, in all three cases, implementing a variety of reaction

conditions, no conversion to 8 was observed. As a result of this, the synthetic approach required

modifications to alleviate these issues, as without 8, the formation of target 17 is unattainable.

Scheme 6. Initial synthetic approach for the generation of the pyrimidine ring.

59

6.2 Suzuki Cross-Coupling Approach in the Formation of 2,4-dichloro-6-(pyridin-4-

yl)pyrimidine

With the observed barriers of the previous synthetic approach, attempts were made to circumvent

these by the use of Suzuki cross coupling. This well-known methodology involves the palladium-

catalyzed cross coupling between organoboronic acid/boronic esters, and halides. Specifically, the

organoboronic acid/boronic ester is an sp2 carbon centre, with the halide having sp2 or sp3

hybridization. With significant developments over the past few decades, the versatility of Suzuki

coupling has broadened enormously, such that the scope of reaction partners is not restricted to

aryls, but includes alkyls, alkenyls, and alkynyls. Previously, Suzuki reactions were performed in

our group using methoxyphenyl boronic acid and nitrophenyl boronic acid derivatives with 2,4,6-

trichloropyrimidine as a coupling partner with considerable success in each case. As a result of the

successes observed in phenylboronic acids couplings to 2,4,6-trichloropyrimidine, this

methodology was directly implemented for the formation of the 2,4-dichloro-6-(pyridin-4-

yl)pyrimidine core structure.

Initial attempts were made using 9 and pyridin-4-ylboronic acid 10. Pd(PPh3)4 was used as an

initial palladium catalyst, with Na2CO3 as a base, and 1,2-dimethoxyethane (DME) as a solvent.

Preliminary reactions proved unsuccessful, with visible polymerization occurring rapidly upon

complete reagent addition. Catalyst loading with Pd(PPh3)4 was modulated between 0.5 mol%, to a

maximum of 10 mol%. Additionally, the base and solvent were modified. However, in all trials

performed, no evidence of the formation of 8 was observed. This resulted in re-evaluation of the

catalyst choice, as well as the incorporation of ligands to promote product conversion. It is well

known that the oxidative addition step in the Suzuki mechanism is the most energetically

unfavourable event. As such, electron rich palladium catalysts, due to strongly electron rich

ligands, circumvent these issues. This led to the application of a variety of combinations between

palladium catalysts and ligands (Table 10).

Pd2dba3 was applied, with the bulky, electron-rich ligands, XPhos and RuPhos. Additionally, a

variety of bases were employed, due to the importance of boronic acid activation. Activation of the

boron atom enhances the polarization of the organic ligand, subsequently facilitating

transmetallation. After numerous trials between 9 and 10, which included a variety of

60

combinations among Pd2dba3, Pd(OAc)2, XPhos and RuPhos, bases, and solvents, as well as

modulation of catalyst percent loading to ligand percent loading, no product conversion to 8 was

observed. Potassium pyridine-4-trifluoroborate was also implemented as an organotrifluoroborate

reagent, as organotrifluoroborates have been shown to couple well with unactivated aryl and alkyl

halides.68 After attempts using Pd2dba3 and Pd(OAc)2 as catalysts, XPhos, RuPhos, and PPh3 as

ligands, in a variety of combinations and loading percentages, no formation of 8 was observed.

Additionally, 2,4-dichloro-6-methoxypyrimidine was synthesized as a slightly activated aryl halide

coupling partner. It was predicted that methoxy substitution on the pyrimidine ring would

contribute electron density to the system, facilitating the oxidative addition to palladium. Since the

tri-chloro substituted 9 is electron deficient and deactivated, introduction of methoxy would

significantly alter the electronics of the pyrimidine ring, thereby potentially affording 8. After a

variety of trials between 2,4-dichloro-6-methoxypyrimidine and 10 or pyridine-4-trifluoroborate,

no formation of 11 was observed.

After unsuccessful trials, another highly bulky, electron rich palladium catalyst was employed,

(t-Bu)2P(OH)]2PdCl2 (abbreviated as POPd). This air-stable palladium-phosphinous acid based

catalyst has been shown to successfully couple a variety of unactivated aryl and vinyl halides with

numerous arylboronic acids and organozinc reagents.69, 70 An extensive investigation into the

application of the POPd catalyst took place, which utilized the organoboronic reagent 10, as well

as a synthesized 4-pyridineboronic acid pinacol ester, with a variety of aryl halide coupling

partners. Trials were attempted with 9 and 10, utilizing a variety of catalyst loadings, bases, and

solvents. In all trials, no observable formation of 8 was observed. Attempts with 6-chlorouracil as

a halide coupling partner with 10 was also unsuccessful. Moreover, use of 4-pyridineboronic acid

pinacol ester and 9 led to no observable formation of 8, regardless of catalyst loadings, bases, or

solvents used. As a result of this, we concluded that palladium-mediated cross-couplings between

halogenated pyrimidines and 4-halopyridines is an unsuccessful synthetic strategy, warranting

alternative approaches in the formation of 6-(pyridin-4-yl)pyrimidine functionality.

61

Scheme 7. Formation of C-6 para-pyridine substituted pyrimidine using Suzuki-Miyaura transition metal mediated cross-coupling.

62

Table 10. Suzuki-Miyaura cross-coupling trials incorporating a variety of palladium catalysts, bases, solvents, and reaction conditions. Trial Organic boronic

acid Derivative Halide Palladium

Catalyst Ligand Base Solvent Temperature

(oC) Time

(h)

1

Pd(PPh3)4 None Na2CO3 DME 80 4

2

Pd(PPh3)4 None K2CO3 DME 90 24

3

Pd(PPh3)4 None K2CO3 1,4-dioxane 110 24

4

Pd(PPh3)4 None K2CO3 n-butanol 100 24

5

Pd2dba3 XPhos K3PO4 n-butanol 100 24

6

Pd2dba3 XPhos K2CO3 1,4-dioxane 105 24

7

Pd2dba3 XPhos K3PO4 1,4-dioxane 100 24

8

Pd2dba3 XPhos K3PO4 n-butanol 100 24

9

Pd(OAc)2 RuPhos K2CO3 Ethanol 85 24

10

Pd(OAc)2 RuPhos K3PO4 Ethanol 85 24

63

11

Pd(OAc)2 RuPhos K2CO3 1,4,-dioxane 105 24

12

Pd2dba3 XPhos K2CO3 1,4-dioxane r.t. 24

13

Pd(OAc)2 RuPhos Na2CO3 Ethanol 85 18

14

Pd2dba3 RuPhos K2CO3 1,4-dioxane 100 24

15

Pd(OAc)2 PPh3 Na2CO3 THF/H2O 90 24

16

POPd None K2CO3 1,4-dioxane 100 24

17

POPd None K2CO3 1,4-dioxane/H2O

100 24

18

POPd None K2CO3 THF 85 24

19

POPd None K2CO3 1,4-dioxane 110 24

20

POPd None NEt3 DMF 120 24

21

POPd None K2CO3 DMF 120 24

64

22

POPd None NEt3 DMF 120 24

23

POPd None K2CO3 1,4-dioxane/H2O

90 18

24

Pd(PPh3)4 None Na2CO3 DME/H2O (6:1)

80 24

6.3 Synthetic Approaches to 2,4-dichloro-6-(pyridin-4-yl)pyrimidine Moiety Utilizing Uracil as a

Building Block

With previous efforts failing to afford the core 2,4-dichloro-6-(pyridin-4-yl)pyrimidine moiety,

synthetic strategies involving uracil as a central building block were devised. In this approach

(Scheme 8), the substitution on C-6 in uracil is implemented, by modulation of kinetic and

thermodynamic properties of uracil through temperature and base modulations. The first approach

involved the generation of the anion at uracil C-6 by treatment with LDA at -78oC. It is well

known that C-6 anion formation is selective over C-5 when treated with LDA at this temperature.

Formation of this anion has been extensively used as a nucleophile on a variety of aryl and alkyl

electrophiles. With this knowledge, the C-6 uracil anion was treated with 1, however, no evidence

of 7 was observed. Instead, 1 was completely consumed in undesired, polymerization side

reactions. The reciprocal was also attempted, where 4-lithiopyridine was generated in situ (not

shown), and was added over 18. As observed previously, product conversion to 7 did not occur.

A second approach was implemented, involving the copper(I) iodide and cesium carbonate

mediated coupling of aryl halides to C-6 of uracil. In this synthetic strategy, uracil was protected

with benzyl bromide, to reduce the possibility of side reactions, including the generation of

multiple anions on free uracil. Subsequent deprotection and aromatization/chlorination of benzyl-

protected uracil 20 would then afford the desired product 8, allowing for a variety of

functionalization to the pyrimidine core. While copper(I) iodide is not required for substitution on

65

uracil, it has been shown to selectively increase the ratio between C-6 and C-5 substitution

products.71 First, 18 was protected with benzyl bromide, generating 20. Coupling between 20 and

1 was attempted using copper(I) iodide and cesium carbonate in N,N-dimethylformamide at

elevated temperatures. No evidence of 21 was observed, regardless of temperature and reaction

duration. Trials were attempted with the addition of Pd(OAc)2 and PPh3. However, all trials were

unsuccessful in generating the desired product 21. With these unsuccessful strategies using uracil

as a core building block, it was decided to abandon further investigations into these

methodologies, and explore other synthetically feasible intervention strategies.

Scheme 8. Synthetic approaches utilizing uracil substitution methodologies.

66

6.4 Construction of 6-(pyridin-4-yl)pyrimidine Moiety with 2-Chloropyrimidine as a Core

Building Block

The previous synthetic strategies utilizing 2,4,6-trichloropyrimidine 9 resulted in unsuccessful

outcomes in the generation of key intermediates. The significant electron deficient properties, as

well as a strong propensity to undergo competing polymerizations, led to the investigation into

alternative core building blocks that possess the pyrimidine functionality. A strategy was devised

(Scheme 9) which applies 2-chloropyrimidine 24 as a core building block. The electronics of the

pyrimidine ring in 24 is significantly different to its di- and tri-chloro substituted counterparts. As

a result, the electron density in 24 allows for greater versatility in synthetic approaches.

Additionally, functionalization at C-4 and C-6 on 24 is well characterized, constituting

investigating synthetic approaches with it as a core building block.

The synthetic approach involves the generation of 4-lithiopyridine 23 from the corresponding 4-

bromopyrimidine hydrochloride 1. Subsequent addition to 24 selectively adds at C-6, generating

compound 25 in low to moderate yields. The regeneration of aromaticity was readily achieved in

quantitative yields using the oxidizing agent DDQ, affording 26. The next approach was to

functionalize selectively at C-2 on 26 with 13, using an n-Bu3Sn-adduct intermediate through

treatment with n-Bu3SnLi (formed in situ from LDA and n-Bu3SnH).72 Formation of the n-Bu3Sn-

adduct 27 was not achieved after several attempted trails. In all cases, formation of the adduct was

not observed, consequently halting the addition of 13 at C-2.

To circumvent these issues, the formation of the n-Bu3Sn-adduct was directly attempted on 24,

which has been previously reported.72 The n-Bu3Sn-adduct 28 was obtained in moderate yields,

with subsequent treatment of 13 affording the desired C-2 functionality. Dehydration of 29 using

phosphorus (V) oxychloride and pyridine afforded the unsaturated product 30 in good yields.

Catalytic hydrogenation was employed on 30 to afford 31 in quantitative yields. Next, introduction

of 4-pyridyl at C-6 on 31 was attempted using the same successful protocol in the formation of 25.

After several attempts, no evidence of product 32 was observed, with considerable polymerization

occurring. Subsequent hydroxylation and reductive aminations would afford target 17. However,

without key intermediate 33, this synthetic approach was rendered ineffective.

67

This synthetic strategy highlights the errors attempting to derivatize core pyrimidine building

blocks with the 4-pyridyl functionality. Due to the well-known instability and poor reactivity of 4-

pyridyl in coupling and substitution reactions, investigating alternative synthetic approaches

circumventing these continuously observed issues became the focus of subsequent synthetic

strategies.

Scheme 9. Synthesis of pyrimidine core using 2-chloropyrimidine as a central building block.

68

6.5 Synthetic Strategy Involving the Construction of the Pyrimidine Core via Cyclization of

3-Ketoesters and Amidines to Afford KP-156 and KP-172

Previous synthetic strategies were based upon the utilization of a core pyrimidine or uracil

backbone, with subsequent derivatizations involving 4-pyridyl at C-6. The introduction of

4-pyridyl at C-6 on pyrimidine proved to be challenging when using 2,4,6-trichloropyrimidine 9,

as well as 2-chloropyrimidine 24. These barriers throughout the synthetic strategies based upon

this paradigm caused renewed interest into the construction of the pyrimidine ring. Initial attempts

utilized a cyclocondensation reaction between ethyl-3-oxo-3-(pyridin-4-yl)propanoate 5 and

urea/thiourea. However, regeneration of aromaticity and subsequent chlorination proved difficult.

It has been shown that the construction of pyrimidine rings can be achieved through a cyclization

mechanism between 3-ketoesters and amidines.70, 73 As a result of this, and following careful

examination of the cyclization mechanism, I devised the constructs of amidine 38 and 3-ketoester

5. These critical intermediates were predicted to undergo a cyclization to afford 39, which

possesses all three desired substitutions and functionalities on the core pyrimidine backbone in

target 17.

This new synthetic scheme eliminates several steps to the target 17, as well generating a core

intermediate 33, which can be readily functionalized with a variety of alkyl bromides 41, rapidly

generating a large library of compounds. Due to the limited commercial availability of 38,

including fiscal issues, a facile synthetic scheme was devised which utilized low cost materials.

DL-Nipecotic acid 34 is commercially available and inexpensive, and was readily converted into

N-boc-protected 35 in excellent yields. Conversion of 35 carboxylic acid into amide was achieved

through a rapid, two-step protocol involving activation with isobutyl chloroformate, and

subsequent treatment with ammonium hydroxide, generating 36. Next, the methyl imidolate 37

was quickly formed in excellent yields by treatment of 36 with trimethyloxonium

tetrafluoroborate. The activated compound 37 was then converted to its corresponding amidine

hydrochloride salt 38, by use of ammonium chloride in methanol, under refluxing conditions.

As previously mentioned, the corresponding 3-ketoester derivative of pyridine was synthesized

using classical Claisen condensation conditions, to afford 5. The synthesis of the crucial

69

intermediates 5 and 38 allowed for the attempt at the cyclization protocol. Treatment of these

compounds with a suitable base (K2CO3), and in an appropriate solvent (ethanol), resulted in the

key intermediate 39 in good yields. Deprotection of 39 by treatment with TFA eluted 33, allowing

for substitutions to occur at N-1 of piperidine. Attempts were made to derivatize 33 by means of

reductive amination by suitable substituted benzaldehydes 16. However, after utilizing a variety of

borohydride reagents and reaction conditions, the methodology proved ineffective. This led to the

reduction of substituted benzaldehydes (16) using NaBH4, to afford free, primary hydroxyl

derivatives 40.

Activation of hydroxyl derivatives 40 by mesylation was attempted to improve the electrophilicity

of compounds, aiding in addition to the piperidine nitrogen of 33. A variety of reaction conditions

were employed, but to no avail, as 17 was not observed. A successful approach was devised, in

synthesizing the corresponding alkyl bromide from 40, mediated by CBr4 and PPh3, to afford 41.

Treatment of 33 with 41 led to the formation of 17 in good yields. An alkyl iodide derivative of 41

was synthesized and subjected to the same reaction conditions with 33. Formation of target 17 was

obtained, yielding both KP-156 and KP-172. To our knowledge, this is the first disclosed synthesis

of a 2-(piperidin-3-yl)-6-(pyridin-4-yl)pyrimidin-4-ol functionality using this approach. With

pyrimidine scaffolds playing a prominent role in drug discovery and design, this novel synthetic

design allows for access to these moieties, with the ability to derivatize rapidly for library

generation.

70

Scheme 10. Refined approach at the generation of VDR agonists using amidine intermediates for cyclizations, affording KP-156 and KP-172.

71

6.6 Implementation of Amidine and 3-Ketoester Cyclization to Afford KP-162

With the success of the cyclization protocol between 3-ketoesters and amidines to afford KP-156

and KP-172, the methodology was directly applied into the synthesis of KP-162. KP-162 differs

from KP-156 and KP-172 by the reversal of regiochemistry in the pyrimidine ring, where C-2

contains a 4-pyridyl functionality, and C-6 possesses a 1,3-piperidinyl moiety. To obtain the key

intermediate 48, it was necessary to reverse the 3-ketoester and amidine building blocks used in

the synthesis of KP-156 and KP-172. Instead, in this synthesis, the 3-ketoester 46 and amidine 47

was required in order to afford 48 (Scheme 11). Due to the limited commercial availability of 46,

in house synthesis was necessary. An efficient and facile protocol was devised, which includes

boc-protection of piperidin-3-ylmethanol 42 to afford 43, with subsequent PCC mediated

oxidation to obtain 44. Due to the instability of 44, it was necessary to immediately convert it to

46, by a two-step procedure involving coupling of 44 and 45 by Wilkinson’s catalyst and

diethylzinc, with subsequent oxidation by Dess-Martin periodinane to afford 46.

Obtaining the key intermediate 46 allowed for the cyclization protocol to be implemented with

amidine 47. Utilizing the same conditions outlined for 33, compound 48 was obtained in excellent

yields. The building block 52 was synthesized from vanillin 49, beginning with benzyl protection

of phenolic hydroxyl affording 50. Subsequent reduction to 51 allowed for facile conversion into

52, by use of CBr4 and PPh3 mediated bromination. Coupling of 48 and 52 afforded 53 in excellent

yields. Deprotection of 53 by use of hydrogenolysis conditions resulted in KP-162 in quantitative

yields. The synthesis of KP-162 highlighted the versatility of the cyclization protocol between 3-

ketoesters and amidines, whereby these substituents can be modulated to afford a diverse library of

substituted pyrimidine scaffolds.

72

Scheme 11. Synthesis of KP-162 utilizing 3-ketoester and amidine cyclization protocol.

73

8. CONCLUSION

The novel mechanism of up-regulation of CYP7A1 through VDR induction suggests a therapeutic

target for cholesterol management. The dose-limiting hypercalcemia of 1,25D (commercially

available as ROCALTROL®), and uncertainty in using dietary vitamin D for cholesterol lowering,

led to investigations into non-secosteroidal VDR agonists. KP-156, KP-162, and KP-172 were

lead compounds obtained through previous in silico screenings by the Kotra group, and were

subsequently resynthesized in house to confirm the observed VDR agonism. An extensive

investigation into the synthesis of these compounds led to the formation of a novel synthetic route,

utilizing a key cyclization between 3-ketoesters and amidines to afford tri-substituted pyrimidine

scaffolds readily. KP-156, KP-162, and KP-172 were synthesized according to this protocol.

9. EXPERIMENTAL SECTION

General. All reactions were performed under N2 in oven-dried glassware. Flash chromatography

was performed using distilled solvents from Sigma-Aldrich. All solvents and reagents were

obtained from commercial sources; anhydrous solvents were prepared following standard

procedures. Chromatographic purifications were performed using performed using 60 Å (70–230

mesh) silica gel with the indicated solvents as eluents. TLC analysis was performed using EMD

TLC Silica gel 60 F254 Aluminum sheets and visualized using UV light, ninhydrin, iodine, vanillin,

and phosphomolybdic acid stains. Final products were purified by LC/MS on a Waters LC/MS

system equipped with a photodiode array detector using an XBridge semipreparative C18 column

(19.2 mm x 150 mm, 5 µm). Mass spectra were recorded using ESI Waters system (+ve) mode.

All HPLC solvents were filtered through Waters membrane filters (47 mm GHP 0.45 µm, Pall

Corporation). Injection samples were filtered using Waters Acrodisc® Syringe Filters 4 mm PTFE

(0.2 µm). NMR spectra were recorded on a Bruker spectrometer (400 MHz for 1H; 101 MHz for 13C). Chemical shifts are reported in δ ppm using tetramethylsilane or the deuterated solvent as the

reference. Compounds listed in procedures that were not otherwise mentioned in the

aforementioned schemes were also obtained from commercially available sources.

1-(tert-Butoxycarbonyl)piperidine-3-carboxylic acid (35): To a reaction vessel charged with

nitrogen was added 34 (179 mg, 1.39 mmol) and sodium carbonate (551 mg, 5.20 mmol), in 10

74

mL of a 1:1 THF/H2O mixture at 0oC. Next, Di-tert-butyl dicarbonate (333 mg, 1.53 mmol) was

added in several portions over 10 minutes, and the reaction mixture was set to stir for 2 hours after

complete addition. Once the reaction was confirmed complete by TLC analysis, THF was removed

under reduced pressure, and the reaction vessel was place on an ice bath. The reaction mixture was

then acidified to pH 3 by 1M HCl at 0oC, causing a precipitate to form, and the aqueous mixture

was extracted with ethyl acetate (3 x 10 mL). The organic layers were combined and washed with

water (2 x 5 mL), and saturated brine solution (10 mL). ). The organic layers were combined, dried

over magnesium sulfate, and concentrated in vacuo. To the crude product, 3 mL of CH2Cl2 and

0.5 g of silica was added. The volatile compounds were removed in vacuo, and the white silica

powder was placed on a column. The crude product mixture was purified using flash column

chromatography on silica gel (gradient, ethyl acetate:hexanes, 25% to 60% over 20 minutes) to

afford 35 as a white solid: 290 mg, 91% yield; 1H NMR (CDCl3) δ 1.46 (s, 9 H), 1.54 - 1.76 (m, 1

H), 1.99 - 2.17 (m, 2 H), 2.43 - 2.62 (m, 2 H), 2.86 (t, J=1.0 Hz, 2 H), 3.89 (d, J=13.3 Hz, 2 H),

10.68 (br. s., 1 H); 13C NMR (CDCl3) δ 179.0, 154.7, 79.9, 41.1, 28.4, 27.2, 24.1, 10.3.

tert-Butyl 3-carbamoylpiperidine-1-carboxylate (36): To a reaction vessel charged with

nitrogen was added 35 (50 mg, 218 µmol) in 3 mL of anhydrous THF. The reaction vessel was

then placed on a 1,4-dioxane/water bath, and to it was added triethylamine (36 µL, 257 µmol), and

set to stir for 5 minutes at this temperature. Next, isobutyl chloroformate (33 µL, 251 µmol) was

added, and the resulting solution was stirred for 15 minutes. After this duration in time,

ammonium hydroxide (1 mL) was added, and the reaction mixture was allowed to stir for 10

minutes. Once the reaction was confirmed complete by TLC analysis, THF was removed under

reduced pressure, and water (3 mL) was added to the mixture. The aqueous solution was extracted

with ethyl acetate (2 x 5 mL), combined, washed with saturated sodium bicarbonate (10 mL),

saturated brine solution (5 mL), dried over magnesium sulfate, and concentrated in vacuo. No

additional purification was required, and 36 was obtained as a white solid: 41 mg, 82% yield; 1H NMR (CDCl3) δ 1.44 (s, 9 H) 1.59 - 1.77 (m, 2 H) 1.76 - 1.96 (m, 2 H) 2.31 - 2.42 (m, 2 H)

3.83 (s, 1 H) 3.93 (br. d, J=1.0 Hz, 2 H).

tert-Butyl 3-(imino(methoxy)methyl)piperidine-1-carboxylate (37): To a reaction vessel

charged with nitrogen, was added 36 (282 mg, 1.24 mmol) in 10 mL of anhydrous CH2Cl2, and

placed on an ice bath. To this mixture was added trimethyloxonium tetrafluoroborate (238 mg,

75

1.61 mmol) in several portions of 5 minutes, where after complete addition the reaction vessel was

allowed to warm to room temperature, and stir for 2 hours. Once the reaction was confirmed

complete by TLC analysis, the reaction vessel was placed on an ice bath, and to it was added

saturated sodium bicarbonate solution (15 mL). The aqueous mixture was then extracted with

CH2Cl2 (2 x 15 mL). The organic layers with combined, washed with saturated brine solution (15

mL), dried over magnesium sulfate, and concentrated in vacuo to afford 37 as a clear, colourless

oil. Further purification was not required: 280 mg, 94% yield; 1H NMR (CDCl3) δ 1.32 (s, 9 H),

1.80 - 2.12 (m, 1 H), 2.29 (d, J=6.0 Hz, 1 H), 3.49 (m, J=6.9 Hz, 1 H), 3.70 (m, J=7.3 Hz, 1 H),

3.76 (s, 3 H), 3.81 (m, J=7.3 Hz, 1 H), 3.84 - 3.87 (m, 2 H), 3.95 (m, J=6.5 Hz, 1 H).

tert-Butyl 3-carbamimidoylpiperidine-1-carboxylate hydrochloride (38): To a flame-dried

RBF charged several times with nitrogen, was added 37 (2.74 g, 11.30 mmol) and 6 mL of

anhydrous CH3OH. Powdered ammonium chloride (616 mg, 11.53 mmol) was then added, and the

mixture was set to reflux for 2.5 hours. Once the reaction was confirmed complete by TLC

analysis, solvent was removed under reduced pressure. The resulting solid was then washed with

CH2Cl2 (30 mL) and filtered. The solid was further washed with CH2Cl2 (2 x 15 mL), whereby the

solid was collected, and dried under reduced pressure overnight to afford 38 as a white solid: 2.20

g, 89% yield; 1H NMR (MeOD-d4) δ 1.48 (s, 9 H), 1.78 - 1.84 (m, 1 H), 1.86 (m, J=3.5 Hz, 1 H),

2.05 - 2.12 (m, 1 H), 2.66 - 2.68 (m, 1 H), 2.83 - 2.93 (m, 1 H), 3.02 - 3.17 (m, 1 H), 3.52 (m,

J=7.00 Hz, 1 H), 4.03 (m, J=13.1 Hz, 1 H), 4.17 (m, J=12.5 Hz, 1 H); 13C NMR (D2O) δ 173.4,

82.2, 73.2, 72.2, 50.1, 49.5, 49.1, 42.1, 28.9, 25.3, 19.6.

Ethyl-3-oxo-3-(pyridin-4-yl)propanoate (5): To a flame-dried RBF, charged several times with

nitrogen, was added anhydrous ethyl acetate (19.72 mL, 201 mmol), and was placed on an ice

bath. To this mixture at 0oC was added sodium hydride (1.05 g, 26.3 mmol) in several portions

over 5 minutes, and the mixture was allowed to stir for an additional 5 minutes. Next, ethyl

isonicotinate (5.93 mL, 39.6 mmol) was added drip-wise over 10 minutes, whereby after complete

addition, the reaction mixture was then heated to reflux for 3 hours. Once the reaction was

confirmed complete by TLC analysis, the reaction vessel was cooled on an ice bath, and to it was

added ice water (20 mL). The aqueous mixture was then acidified to pH 6 with 5% citric acid

solution, and the resulting mixture was extracted with ethyl acetate (2 x 30 mL). The organic

layers were combined, washed with water (20 mL), saturated sodium bicarbonate (20 mL),

76

saturated brine solution (25 mL), dried over magnesium sulfate, and concentrated in vauco. The

crude product mixture was directly purified using flash column chromatography on silica gel

(gradient, ethyl acetate:hexanes, 25% to 60% over 20 minutes) to afford 5 as an off-white solid:

5.85 g, 83% yield; 1H NMR (CDCl3) δ 1.29 (t, J=7.2 Hz, 3 H), 3.95 (s, 2 H), 4.23 (q, J=1.0 Hz, 2

H), 7.55 (d, J=1.0 Hz, 2 H), 8.65 (d, J=1.0 Hz, 2 H).

tert-Butyl-3-(4-hydroxy-6-(pyridin-4-yl)pyrimidin-2-yl)piperidine-1-carboxylate (39): To a

flame-dried RBF, charged several times with nitrogen, was added 38 (2.17 g, 9.55 mmol), and

powdered potassium carbonate (2.46 g, 17.8 mmol) in 10 mL of anhydrous ethanol, and set to stir

for 30 minutes at room temperature. To the reaction mixture was added 5 (1.28 g, 6.63 mmol) in 5

mL of anhydrous ethanol. After complete addition, the reaction mixture was then heated to 75oC

for 24 hours. Once the reaction was confirmed complete by TLC analysis, solvent was then

removed under reduced pressure. Water (25 mL) was then added to the resulting residue, and was

subsequently extracted with ethyl acetate (3 x 20 mL). The organic layers were combined, washed

with saturated sodium bicarbonate (25 mL), saturated brine solution (25 mL), dried over

magnesium sulfate, and condensed under reduced pressure. To the remaining residue was added 20

mL CH2Cl2 and 3.0 g silica, and the volatile compounds were removed in vacuo. The resulting

white silica powder was placed on a column, and purified via flash chromatography on silica gel

(gradient, methanol:dichloromethane, 1% to 5% over 20 minutes), to afford 39 as a white solid:

1.21 g, 54% yield; 1H NMR (CDCl3) δ 1.47 (s, 9 H), 1.81 - 2.01 (m, 1 H), 2.15 (m, J=13.6 Hz, 1

H), 2.31 - 2.39 (m, 1 H), 2.69 - 2.78 (m, 1 H), 2.82 - 2.94 (m, 1 H), 3.01 (t, J=13.1 Hz, 1 H), 3.82 -

3.91 (m, 1 H), 4.01 (m, J=13.8 Hz, 1 H), 4.20 - 4.31 (m, 1 H), 6.85 (s, 1 H), 7.90 (d, J=1.0 Hz, 2

H), 8.69 (d, J=4.8 Hz, 3 H), 8.68 (d, J=1.0 Hz, 2 H); 13C NMR ((MeOD-d4) δ 208.5, 149.5, 144.7,

121.4, 109.2, 79.9, 47.4, 47.2, 42.4, 27.7, 27.2

2-(Piperidin-3-yl)-6-(pyridin-4-yl)pyrimidin-4-ol (33): To a flame-dried RBF, charged several

times with nitrogen, was added 39 (35 mg, 98.2 µmol) in 2 mL of trifluoroacetic

acid/dichloromethane (1:9) at 0oC. The reaction mixture was then allowed to warm to room

77

temperature, and stir for 1 hour. Once the reaction was confirmed complete by TLC analysis,

solvent was then removed under reduced pressure, to afford 33 as a clear, colourless oil:

quantitative yields; 1H NMR (MeOD-d4) δ 1.66 - 1.76 (m, 1 H), 1.77 - 1.89 (m, 1 H), 1.89 - 2.02

(m, 1 H), 2.13 - 2.22 (m, 1 H), 2.69 (m, J=8.30 Hz, 1 H), 2.94 - 3.06 (m, 1 H), 3.07 - 3.19 (m, 1

H), 3.23 - 3.35 (m, 1 H), 3.47 - 3.58 (m, 1 H), 7.16 (s, 1 H), 8.58 (d, J=6.8 Hz, 2 H), 8.87 (d, J=6.8

Hz, 2 H); 13C NMR (MeOD-d4) δ 176.1, 163.8, 162.4, 160.1, 159.7, 159.3, 158.9, 155.6, 153.1,

142.0, 124.6, 119.7, 116.9, 114.0, 113.1, 111.2, 53.6, 45.0, 44.8, 43.7, 43.7, 38.1, 38.0, 27.4, 25.8,

21.1, 20.5.

2-(1-(3,5-Dimethoxybenzyl)piperidin-3-yl)-6-(pyridin-4-yl)pyrimidin-4-ol (17a, KP-156): To a

flame-dried RBF, charged several times with nitrogen, was added 33 (68 mg, 0.27 mmol), and

sodium bicarbonate (67 mg, 0.80 mmol) in 8 mL of anhydrous N,N-dimethylformamide, and

allowed to stir for 30 minutes. Once complete, the reaction vessel was placed on an ice bath, and to

it was added 41 (68 mg, 0.29 mmol) in 3 mL of anhydrous N,N-dimethylformamide drip-wise over

5 minutes. Upon complete addition, the reaction mixture was allowed to warm to room

temperature, and set to stir for 24 hours. Once the reaction was confirmed complete by TLC

analysis, the mixture was quenched with water (15 mL), and the aqueous mixture was extracted

with ethyl acetate (3 x 10 mL). The organic layers were combined, washed with water (10 mL),

saturated sodium bicarbonate (10 mL), saturated brine solution (15 mL), dried over magnesium

sulfate, and concentrated in vacuo. To the remaining residue was added 10 mL CH2Cl2 and 0.1 g

silica, and the volatile compounds were removed in vacuo. The resulting white silica powder was

placed on a column, and purified via flash chromatography on silica gel (gradient,

methanol:dichloromethane, 1% to 5% over 30 minutes), to afford 17a as a white solid: 55 mg,

75% yield; 1H NMR (CDCl3) δ 1.54 - 1.63 (m, 1 H), 1.65 - 1.92 (m, 1 H), 2.04 (d, J=12.3 Hz, 1

H), 2.12 - 2.29 (m, 1 H), 2.39 (m, J=11.5 Hz, 1 H), 2.48 - 2.55 (m, 1 H), 3.05 - 3.20 (m, 1 H), 3.35

- 3.48 (m, 1 H), 3.65 (m, J=12.3 Hz, 1 H), 3.79 (s, 2 H), 3.85 (s, 6 H), 6.42 (s, 1 H), 6.57 (s, 2 H),

6.74 (s, 1 H), 7.76 (d, J=5.8 Hz, 2 H), 8.71 (d, J=5.5 Hz, 4 H), 13.12 (br. s., 1 H); 13C NMR

(CDCl3) δ 26.9, 28.5, 53.9, 54.0, 54.3, 55.3, 55.5, 63.6, 63.7, 98.9, 100.3, 107.0, 109.8, 121.0,

128.6, 132.1, 150.5, 161.1; λmax (nm) 202.4, 229.4, 277.4, 312.4.

1-(Bromomethyl)-3,5-dimethoxybenzene (41): To a reaction vessel charged with 40 (330 mg,

1.97 mmol) in 10 mL of anhydrous CH2Cl2 was added carbon tetrabromide (982 mg, 2.98 mmol)

78

and triphenylphosphine (622 mg, 2.37 mmol) in sequential order at 0oC. The resulting reaction

mixture was then slowly warmed to room temperature, and allowed to stir overnight. Once the

reaction was confirmed complete by TLC analysis, the solvent was removed under reduced

pressure, and to the resulting residue was added hexanes (80 mL). The solid precipitate was

filtered, and the filtrate was concentrated via rotatory evaporator to afford 41 as a white solid: 389

mg, 86% yield; 1H NMR (CDCl3) δ 3.70 (s, 6 H), 4.33 (s, 2 H), 6.31 (s, 1 H), 6.45 (s, 2 H); 13C

NMR (CDCl3) δ 33.66, 55.40, 100.59, 106.96, 139.73, 160.89.

4-(2-Methoxyethoxy)benzaldehyde (55): To a flamed dried RBF was added

4-hydroxybenzaldehyde (1.97 g, 16.10 mmol) and powdered cesium carbonate (5.51 g, 16.90

mmol) in 20 mL of anhydrous N,N-dimethylformamide, and was allowed to stir for 30 mins.

Next, 2-bromoethyl methyl ether (1.59 mL, 16.90 mmol) was added drip-wise at 0oC. Upon

complete addition, the reaction vessel was warmed to room temperature, and was allowed to stir

overnight. Once the reaction was confirmed complete by TLC analysis, the solvent was removed

under reduced pressure, and to the resulting residue was added water (30 mL), and was extracted

with ethyl acetate (3 x 20 mL). The organic layers were combined, washed with water (25 mL),

saturated sodium bicarbonate (25 mL), saturated brine solution (35 mL), dried over magnesium

sulfate, and concentrated in vacuo to afford 55 as a white solid: 2.65 g, 84% yield; 1H NMR

(CDCl3) δ 3.41 (s, 3 H), 3.74 (t, J=1.0 Hz, 2 H), 4.16 (t, J=1.0 Hz, 2 H), 7.00 (d, J=8.5 Hz, 2 H),

7.79 (d, J=8.8 Hz, 2 H), 9.84 (s, 1 H); 13C NMR (CDCl3) δ 190.6, 163.7, 131.7, 129.9, 114.7, 70.5,

67.5, 58.9.

(4-(2-Methoxyethoxy)phenyl)methanol (56): To a reaction vessel charged with 55 (1.64 g, 9.10

mmol) in 15 mL of anhydrous methanol, was added sodium borohydride (860 mg, 22.75 mmol) at

0oC in several portions, and was allowed to stir at this temperature for one hour. Once the reaction

was confirmed complete by TLC analysis, the solvent was removed under reduced pressure, and to

the resulting residue was added water (40 mL), and was extracted with ethyl acetate (3 x 30 mL).

The organic layers were combined, washed with saturated brine solution (35 mL), dried over

magnesium sulfate, and concentrated in vacuo to afford 56 as a white solid: 1.35 g, 81% yield; 1H

NMR (CDCl3) δ 3.38 (s, 3 H), 3.49 (br. s., 1 H), 3.67 (t, J=1.0 Hz, 2 H), 4.02 (t, J=1.0 Hz, 2 H),

4.46 (s, 2 H), 6.83 (d, J=8.5 Hz, 2 H), 7.18 (d, J=8.5 Hz, 2 H); 13C NMR (CDCl3) δ 158.1, 133.6,

128.5, 114.5, 71.0, 67.1, 64.3, 59.1.

79

1-(Bromomethyl)-4-(2-methoxyethoxy)benzene (57): This compound was synthesized from 56

(745 mg, 4.09 mmol), carbon tetrabromide (2.03 g, 6.13 mmol), and triphenylphosphine (1.29 g,

4.91 mmol) in 15 mL of anhydrous dichloromethane, using the same procedure outlined for

compound 41. To the crude product, 40 mL of CH2Cl2 and 4.2 g of silica was added. The volatile

compounds were removed in vacuo, and the white silica powder was placed on a column. The

crude product mixture was purified using flash column chromatography on silica gel (gradient,

ethyl acetate:hexanes, 10% to 20% over 20 minutes) to afford 57 as a white solid: 710 mg, 71%

yield; 1H NMR (CDCl3) δ 3.44 (s, 3 H), 3.74 (t, J=1.0 Hz, 2 H), 4.11 (t, J=1.0 Hz, 2 H), 4.49 (s, 2

H), 6.89 (d, J=8.5 Hz, 2 H), 7.31 (d, J=8.5 Hz, 2 H); 13C NMR (CDCl3) δ 158.9, 130.4, 130.2,

114.9, 70.9, 67.3, 59.2, 33.9.

2-(1-(4-(2-Methoxyethoxy)benzyl)piperidin-3-yl)-6-(pyridin-4-yl)pyrimidin-4-ol (17b, KP-

172): This compound was synthesized from 33 (74 mg, 0.29 mmol) and 57 (78 mg, 0.32 mmol),

using the same procedure outlined for 17a (KP-156). To the crude product, 10 mL of CH2Cl2 and

0.4 g of silica was added. The volatile compounds were removed in vacuo, and the white silica

powder was placed on a column. The crude product mixture was purified using flash column

chromatography on silica gel (gradient, methanol:dichloromethane, 2% to 8% over 30 minutes) to

afford 17b (KP-172) as a white solid: 15 mg, 15% yield; 1H NMR (CDCl3) δ 1.63 - 1.86 (m, 2 H),

2.03 (m, J=12.8 Hz, 1 H), 2.12 - 2.27 (m, 1 H), 2.34 (m, J=10.0 Hz, 1 H), 2.42 - 2.55 (m, 1 H),

3.03 - 3.26 (m, 3 H), 3.44 (s, 3 H), 3.45 (s, 2 H), 3.73 (t, J=1.0 Hz, 2 H), 4.10 (t, J=1.0 Hz, 2 H),

6.74 (s, 1 H), 6.94 (d, J=8.5 Hz, 2 H), 7.33 (d, J=8.3 Hz, 2 H), 7.76 (d, J=6.0 Hz, 2 H), 8.71 (d,

J=6.0 Hz, 2 H), 13.13 (br. s., 1 H); 13C NMR (DMSO-d6) δ 163.1, 158.3, 150.8, 144.0, 132.3,

130.6, 128.4, 121.3, 115.4, 114.6, 109.8, 70.9, 67.3, 58.6, 53.2, 28.8.; λmax (nm) 198.4, 230.4,

271.4, 277.4, 310.4.

tert-Butyl 3-(hydroxymethyl)piperidine-1-carboxylate (43): To a reaction vessel was added 42

(1.59 g, 13.8 mmol) and triethylamine (2.10 mL, 15.1 mmol) in 20 mL of tetrahydrofuran/water

(1:1) at 0oC. At this temperature was added di-tert-butyl dicarbonate (3.62 g, 16.6 mmol), and after

complete addition, was allowed to warm to room temperature and stir overnight. Once the reaction

was confirmed complete by TLC analysis, the solvent was removed under reduced pressure, and to

the resulting residue was added water (40 mL), and was extracted with ethyl acetate (3 x 30 mL).

The organic layers were combined, washed with saturated sodium bicarbonate solution (15 mL),

80

0.5M HCl (15 mL), saturated brine solution (35 mL), dried over magnesium sulfate, and

concentrated in vacuo to afford 51 as a white solid: 2.15 g, 75% yield; 1H NMR (CDCl3) δ 1.24 -

1.28 (m, 1 H), 1.46 (s, 9 H), 1.61 - 1.71 (m, 2 H), 1.82 (m, J=4.0 Hz, 2 H), 1.79 (m, J=3.8 Hz, 2

H), 2.74 (br. s., 2 H), 3.47 (t, J=5.3 Hz, 2 H), 3.90 (br. s., 2 H); 13C NMR (CDCl3) δ 171.0, 155.0,

146.6, 84.9, 79.2, 64.3, 60.2, 38.2, 28.3, 27.2, 26.9, 24.1, 20.8, 14.0.

tert-Butyl 3-formylpiperidine-1-carboxylate (44): To a stirred suspension of pyridinium

chlorochromate (3.34 g, 15.5 mmol) and celite (2.38 g) in 50 mL of anhydrous dichloromethane

was added 43 (2.22 g, 10.3 mmol) suspended in 10 mL of anhydrous dichloromethane, drip-wise

at 0oC. The mixture was then set to stir overnight at room temperature. Once the reaction was

confirmed complete by TLC analysis, the mixture was passed through a filter with 5 g of celite.

The filtrate was collected and concentrated under reduced pressure. To the crude product, 35 mL

of CH2Cl2 and 3.0 g of silica was added. The volatile compounds were removed in vacuo, and the

silica powder was placed on a column. The crude product mixture was purified using flash column

chromatography on silica gel (isocratic, ethyl acetate:hexanes, 10%, 20 minutes) to afford 44 as a

white solid: 621 mg, 28% yield; 1H NMR (CDCl3) δ 1.46 (s, 9 H), 1.68 (m, J=3.4 Hz, 2 H), 1.88 -

2.00 (m, 1 H), 2.40 - 2.47 (m, 1 H), 3.06 - 3.13 (m, 1 H), 3.30 - 3.41 (m, 1 H), 3.64 (m, J=12.8 Hz,

1 H), 3.85 - 4.01 (m, 2 H), 9.70 (s, 1 H); 13C NMR (CDCl3) δ 202.5, 79.8, 54.9, 50.5, 47.9, 42.3,

28.4, 24.2, 23.7.

tert-Butyl 3-(3-ethoxy-3-oxopropanoyl)piperidine-1-carboxylate (46): To a flame dried RBF

containing 44 (196 mg, 0.919 mmol) in 5 mL anhydrous tetrahydrofuran, was added Wilkinson’s

catalyst (43 mg, 46 µmol), and ethyl bromoacetate 45 (0.101 mL, 0.919 mmol). The reaction

mixture was then cooled to 0oC, and diethyl zinc (2.02 mL, 2.02 mmol, 1 M in hexanes) was

added drip-wise, and the mixture was allowed to stir for an additional 10 minutes at 0oC. Once the

reaction was confirmed complete by TLC analysis, the reaction is quenched by the addition of

saturated sodium bicarbonate solution (10 mL), and was subsequently extracted with ethyl acetate

(2 x 10 mL). The organic layers were combined, washed with saturated brine solution (15 mL),

dried over magnesium sulfate, and concentrated in vacuo. To the remaining residue was added 10

mL CH2Cl2 and 0.5 g silica, and the volatile compounds were removed in vacuo. The resulting

white silica powder was placed on a column, and purified via flash chromatography on silica gel

(isocratic, ethyl acetate:hexanes, 20% over 20 minutes) to afford intermediate tert-butyl 3-(3-

81

ethoxy-1-hydroxy-3-oxopropyl)piperidine-1-carboxylate as a white solid: 203 mg, 73% yield; 1H NMR (CDCl3) δ 1.19 (t, J=1.0 Hz, 3 H), 1.38 (s, 9 H), 1.41 - 1.50 (m, 1 H), 1.53 - 1.69 (m, 1

H), 2.34 - 2.47 (m, 2 H), 2.50 (m, J=3.0 Hz, 1 H), 2.64 - 2.86 (m, 2 H), 3.18 (m, J=4.0 Hz, 1 H),

3.78 - 3.81 (m, 1 H), 4.10 (q, J=7.3 Hz, 2 H); 13C NMR (CDCl3) δ 172.8, 79.4, 60.7, 40.9, 39.0,

28.4, 27.0, 25.2, 24.3, 14.1.

This compound was immediately converted to 46 following characterizations. To a solution of

tert-butyl 3-(3-ethoxy-1-hydroxy-3-oxopropyl)piperidine-1-carboxylate (109 mg, 0.361 mmol) in

5 mL anhydrous CH2Cl2, is added Dess-Martin periodinane (169 mg, 0.397 mmol) at 0oC. The

mixture was then allowed to stir at room temperature for 30 minutes. The reaction is then

quenched by the addition of sodium thiosulfate (400 mg) in 15 mL of saturated sodium

bicarbonate solution, and was allowed to stir for an additional 10 minutes. The mixture was then

extracted with dichloromethane (2 x 10 mL), dried over magnesium sulfate, and concentrated in

vacuo. To the remaining residue was added 15 mL CH2Cl2 and 0.35 g silica, and the volatile

compounds were removed in vacuo. The resulting white silica powder was placed on a column,

and purified via flash chromatography on silica gel (isocratic, ethyl acetate:hexanes, 10% over 20

minutes) to afford 46 as a white solid: 100 mg, 96% yield; 1H NMR (CDCl3) δ 0.78 – 0.81 (m, 1

H), 1.21 (t, J=7.2 Hz, 3 H), 1.39 (s, 9 H), 1.53 (m, J=10.0 Hz, 1 H), 1.59 - 1.75 (m, 1 H), 1.77 -

2.00 (m, 1 H), 2.41 - 2.66 (m, 1 H), 2.67 - 2.86 (m, 1 H), 2.87 - 3.03 (m, 1 H), 3.45 (s, 2 H), 3.80

(br. s., 1 H), 4.00 (br. s., 1 H), 4.13 (q, J=7.0 Hz, 2 H); 13C NMR (CDCl3) δ 203.6, 167.0, 88.6,

79.8, 61.4, 60.1, 48.5, 47.8, 41.6, 28.4, 24.1, 14.2.

6-(Piperidin-3-yl)-2-(pyridin-4-yl)pyrimidin-4-ol (48): This compound was synthesized from 46

(821 mg, 2.74 mmol) and 4-amidinopyridine hydrochloride 47 (540 mg, 3.43 mmol) using the

same procedure outlined for compound 39. To the remaining residue was added 20 mL CH2Cl2

and 2.0 g silica, and the volatile compounds were removed in vacuo. The resulting yellow silica

powder was placed on a column, and purified via flash chromatography on silica gel (gradient,

methanol:dichloromethane, 0% to 20% over 30 minutes), to afford boc-protected intermediate tert-

butyl 3-(6-hydroxy-2-(pyridin-4-yl)pyrimidin-4-yl)piperidine-1-carboxylate as light yellow

crystals: 421 mg, 46% yield; 1H NMR (CDCl3) δ 1.22 - 1.36 (m, 1 H), 1.48 (s, 9 H), 1.56 - 1.68

(m, 1 H), 1.79 (m, J=12.8 Hz, 1 H), 2.04 - 2.13 (m, 1 H), 2.68 - 2.81 (m, 1 H), 2.83 - 2.99 (m, 1

H), 2.99 - 3.20 (m, 1 H), 4.05 - 4.09 (m, 1 H), 4.17 - 4.50 (m, 1 H), 6.47 (s, 1 H), 8.21 (d, J=5.5

82

Hz, 2 H), 8.85 (d, J=5.3 Hz, 2 H), 13.71 (br. s., 1 H); 13C NMR (CDCl3) δ 170.2, 165.6, 154.5,

150.6, 139.5, 121.4, 111.2, 79.7, 43.3, 29.3, 28.4. Next, tert-butyl 3-(6-hydroxy-2-(pyridin-4-

yl)pyrimidin-4-yl)piperidine-1-carboxylate (122 mg, 0.342 mmol) was suspended in 3 mL of

trifluoroacetic acid/dichloromethane (1:4), and allowed to stir at room temperature for 1 hour.

Once complete, the solvent was removed in vacuo to afford 48 as a light yellow solid: 87 mg,

quantitative yields; 1H NMR (MeOD-d4) δ 1.24 (m, J=17.1 Hz, 1 H), 1.81 - 2.03 (m, 1 H), 2.03 -

2.12 (m, 1 H), 2.19 (m, J=8.5 Hz, 1 H), 2.90 - 3.16 (m, 1 H), 3.21 - 3.36 (m, 2 H), 3.38 - 3.50 (m,

1 H), 3.66 (m, J=12.3 Hz, 1 H), 6.80 (s, 1 H), 8.94 (d, J=1.0 Hz, 2 H), 9.00 (d, J=1.0 Hz, 2 H); 13C

NMR (MeOD-d4) δ 170.1, 159.8, 157.9, 152.9, 142.1, 125.2, 117.0, 114.2, 107.0, 46.4, 43.7, 40.1,

27.7, 26.3, 21.6.

4-(Benzyloxy)-3-methoxybenzaldehyde (50): To a suspension of vanillin 49 (2.57 g, 16.92

mmol), in 25 mL of anhydrous N,N-dimethylformamide, was added benzyl bromide (2.07 mL,

17.43 mmol) slowly, followed by potassium carbonate (5.61 g, 40.60 mmol), and was rapidly

stirred for 2 hours. Once the reaction was confirmed complete by TLC analysis, the mixture was

partitioned into diethyl ether/water (1:1, 100 mL), and stirred for 5 minutes. The organic and

aqueous layers were separated, and the aqueous layer was extracted with diethyl ether (3 x 35 mL).

The combined organic layers were washed with water (50 mL), saturated brine solution (50 mL),

dried over magnesium sulfate, and concentrated, after washing with hexanes (40 mL), and

refiltering the filtrate, to afford 50 as a white solid: 3.90 g, 95% yield; 1H NMR (CDCl3) δ 3.90

(s, 3 H), 5.20 (s, 2 H), 6.96 (d, J=8.3 Hz, 1 H), 7.26 - 7.33 (m, 1 H), 7.33 - 7.39 (m, 3 H), 7.39 -

7.46 (m, 3 H), 9.81 (s, 1 H); 13C NMR (CDCl3) δ 190.9, 153.6, 150.1, 136.0, 130.3, 128.7, 128.2,

127.2, 126.5, 112.4, 109.4, 70.8, 56.0.

(4-(Benzyloxy)-3-methoxyphenyl)methanol (51): This compound was synthesized from 50 (3.50

g, 14.45 mmol), and sodium borohydride (1.37 g, 36.12 mmol) in 25 mL of anhydrous methanol

using the same procedure outlined for compound 56, to afford 51 as a white crystalline solid:

3.49g, 97% yield; 1H NMR (CDCl3) δ 3.88 (s, 3 H), 4.58 (d, J=5.3 Hz, 2 H), 5.14 (s, 2 H), 6.76 -

6.87 (m, 2 H), 6.93 (s, 1 H), 7.24 - 7.32 (m, 1 H), 7.35 (t, J=7.5 Hz, 2 H), 7.40 - 7.45 (m, 2 H); 13C

NMR (CDCl3) δ 149.8, 147.7, 137.1, 134.2, 128.5, 127.8, 127.3, 119.3, 114.0, 111.0, 71.1, 65.3,

56.0.

83

1-(Benzyloxy)-4-(bromomethyl)-2-methoxybenzene (52): This compound was synthesized from

51 (2.88 g, 11.81 mmol), carbon tetrabromide (5.87 g, 17.71 mmol), and triphenylphosphine (3.72

g, 14.71 mmol) in 20 mL of anhydrous CH2Cl2, following the same protocol outlined for

compound 41, to afford 52 as a white solid: 1.80 g, 49% yield; 1H NMR (CDCl3) δ 3.87 (s, 3 H),

4.45 (s, 2 H), 5.12 (s, 2 H), 6.79 (d, J=8.0 Hz, 1 H), 6.83 - 6.87 (m, 1 H), 6.90 - 6.92 (m, 1 H), 7.25

- 7.31 (m, 1 H), 7.34 (t, J=7.5 Hz, 2 H), 7.38 - 7.43 (m, 2 H); 13C NMR (CDCl3) δ 149.7, 148.4,

136.9, 130.7, 128.6, 127.9, 127.3, 121.5, 113.7, 112.7, 71.0, 56.0, 34.4.

6-(1-(4-(Benzyloxy)-3-methoxybenzyl)piperidin-3-yl)-2-(pyridin-4-yl)pyrimidin-4-ol (53):

This compound was synthesized from 48 (87 mg, 0.34 mmol) and 52 (120 mg, 0.390 mmol) using

the same procedure outlined for compounds KP-156 (17a) and KP-172 (17b). To the remaining

residue was added 0.8 mL CH2Cl2 and was directly placed into a column, and purified via flash

chromatography on silica gel (gradient, methanol:dichloromethane, 0% to 20% over 30 minutes),

to afford 53 as a white solid: 45 mg, 27% yield; 1H NMR (CDCl3) δ 1.11 - 1.38 (m, 1 H), 1.61

(br. s., 1 H), 1.80 (br. s., 2 H), 2.00 (m, J=11.3 Hz, 1 H), 2.17 (br. s., 1 H), 2.36 (br. s., 1 H), 3.17

(br. s., 1 H), 3.47 (s, 2 H), 3.54 - 3.72 (m, 1 H), 3.87 (s, 3 H), 5.13 (s, 2 H), 6.40 (br. s., 1 H), 6.79

(m, J=8.1, 8.1, 8.1 Hz, 2 H), 6.98 (s, 1 H), 7.25 - 7.31 (m, 1 H), 7.35 (t, J=7.4 Hz, 2 H), 7.42 (d,

J=1.0 Hz, 2 H), 8.11 (d, J=4.5 Hz, 2 H), 8.81 (d, J=1.0 Hz, 2 H); 13C NMR (CDCl3) δ 150.7,

149.7, 137.1, 128.5, 127.8, 127.2, 121.4, 113.6, 113.0, 71.1, 56.0.

6-(1-(4-Hydroxy-3-methoxybenzyl)piperidin-3-yl)-2-(pyridin-4-yl)pyrimidin-4-ol (KP-162):

To a flamed dried RBF was added 53 (15 mg, 31.1 µmol) and palladium on carbon (3.31 mg, 3.11

µmol) in 2 mL of anhydrous methanol. The reaction vessel was sealed, and flushed several times

with hydrogen, before being subjected to hydrogen atmosphere for 48 h. Once the reaction was

confirmed complete by TLC analysis, the reaction mixture was filtered, and washed with methanol

(15 mL). The filtrate was collected and concentrated to afford an off-white solid. To the crude

mixture was added 0.7 mL CH2Cl2, and was added directly subjected to flash column

chromatography (gradient, methanol:dichloromethane, 5% to 20% over 35 minutes), to afford KP-

162 as a white solid: 12 mg, 98% yield; 1H NMR (MeOD-d4) δ 1.75 - 1.94 (m, 2 H), 1.94 - 2.04

(m, 1 H), 2.08 (d, J=13.3 Hz, 1 H), 2.81 (br. s., 1 H), 2.99 - 3.10 (m, 2 H), 3.29 (d, J=12.5 Hz, 1

H), 3.46 (d, J=7.8 Hz, 1 H), 3.77 - 3.84 (m, 3 H), 4.03 (s, 2 H), 6.32 (s, 1 H), 6.82 (d, J=8.0 Hz, 1

H), 6.89 (dd, J=8.2, 1.4 Hz, 1 H), 7.05 (s, 1 H), 8.05 (d, J=5.5 Hz, 2 H), 8.65 (d, J=5.5 Hz, 2 H);

84

13C NMR (DMSO-d6,) δ 150.7, 147.8, 145.9, 129.5, 122.0, 119.5, 115.5, 113.4, 111.5, 63.4, 62.8,

57.8, 56.0, 53.5, 49.1, 43.4, 29.2, 24.9; λmax (nm) 201.4, 224.4, 279.4.

85

CHAPTER 4: CONCLUSIONS AND FUTURE DIRECTIONS

The molecular design approach was applied in small molecule agonist design, for two different

receptor systems: (i) type I interferon-α/β-receptor (IFNAR), a heterodimeric cell-surface

transmembrane receptor; and (ii) the vitamin D receptor (VDR), a nuclear membrane bound

receptor. The first project focused on mimicking the protein-protein interactions between type I

IFN and IFNAR, using a small molecule agonist. By using the core bis-phenyltetrazole scaffold of

hit compound 2, a library of 18 compounds were synthesized, and evaluated for potential IFN-like

activity. All compounds were evaluated for their antiviral activities, which is a functional end

point, followed by testing for Tyk2 phosphorylation and induction of IFN-inducible genes.

Compound 4e demonstrated antiviral activity against EMCV with an EC50 of 0.5 ± 0.2 µM. This

compound was also shown to induce Tyk2 phosphorylation, as well as induce IFN-inducible genes

(PKR, OAS1, and ISG15). Results from surface plasmon resonance (SPR) studies indicate 4e

directly binds to IFNAR2, confirming binding interaction between 4e and IFNAR. Future studies

will be focused on structure-activity relationships to better understand how 4e interacts with

IFNAR, allowing for rational structural modifications to improve the binding affinity to IFNAR.

The second project investigated non-secosteroidal VDR agonists, with potential applications in

managing patients with hypercholesterolemia. KP-156, KP-162, and KP-172 were lead

compounds obtained through previous in silico screenings by the Kotra group, and were

subsequently resynthesized in house to confirm the observed VDR agonism. Each lead compound

possessed a core tri-substituted pyrimidine scaffold, of which the synthetic route has not been

reported. As such, an extensive investigation into the synthesis of these compounds led to the

formation of a novel synthetic route, involving a key cyclization between 3-ketoesters and

amidines. KP-156, KP-162, and KP-172 were synthesized according to this protocol. These

compounds were subsequently sent to collaborators to confirm VDR agonism, and the results are

to be obtained in the near future.

While these two projects differ in receptor systems, the end goal of small molecule agonist

discovery remains synonymous between them. Each project aims to develop a small molecule

agonist, to circumvent the issues associated with the endogenous ligands. For IFNAR, IFN-α2a is

a clinically relevant therapeutic, particularly in HCV treatment. Limitations associated with this

86

are pharmacokinetic and fiscal barriers. For VDR and its endogenous ligand calcitriol

(ROCALTROL®), the current clinical indications for ROCALTROL® include the management of

hypocalcemia and its clinical manifestations in patients with hypoparathyroidism.55 It is also

indicated in the management of secondary hypoparathyroidism and resultant metabolic bone

disease in patients with chronic renal failure (both predialysis and dialysis patients).56 One of the

major limitations of calcitriol treatment is the hypercalcemic effects associated with it.57 For both

of these receptor systems, and the limitations associated with their endogenous ligands, these

projects both aim to develop a small molecule agonist to potentially circumvent these issues.

To date, only a limited number of IFNAR small molecule agonists have been reported. In 2012,

Sudoh and colleagues reported an orally available, small molecule IFN agonist that was shown to

inhibit viral replication, and bind to IFNAR2.74 More recently, Kotra, Fish, and colleagues used

key residues of IRRP-1 (Leu30, Arg33, and Asp35) to derive 11 chemical compounds that belong

to 5 distinct chemotypes.33 Three compounds displayed potential mimicry to IRRP-1, and were

shown to inhibit IFNAR activation by IFN-α. In the current work, compound 4e demonstrated

IFN-like activity through antiviral protection, Tyk2 phosphorylation, induction of IFN-inducible

genes (PKR, OAS1, and ISG15), and SPR confirmation of IFNAR2 binding, highlighting the

importance of these findings.

While analogues of calcitriol have been developed with reduced hypercalcemic effects –

paricalcitol (ZEMPLAR®) and doxercalciferol (HECTOROL®) – subsequent dose-limiting

hypercalcemia still remains.58, 59 A variety of non-secosteroidal 1,25D analogues have been

developed with no associated hypercalcemic effects, while maintaining the ability to induce

VDR.62 However, poor efficacy and potency of these compounds have resulted in clinical trial

failures.42 Currently, there are new non-secosteroidal VDR agonists emerging that demonstrate

VDR agonism in vitro.60 Further studies are required to investigate the therapeutic potential of

these compounds in animal models, and ultimately humans. The lead compounds KP-156, KP-

162, and KP-172 highlight non-secosteroidal VDR agonists with potential future applications in

hypercholesterolemia treatment. While these compounds are to be evaluated for biological

activities, one of the most significant achievements in this project was the development of a novel

synthetic route for two specific tri-substituted pyrimidine scaffolds, of which, have not been

87

reported to date. This synthetic route offers the ability for the re-synthesis of vendor purchased

compounds, but also allows access to develop large compound libraries.

The results obtained demonstrated the effectiveness of the molecular design approach in

developing small molecule agonists for two different receptor systems, IFNAR and VDR. For the

IFNAR project, future research should be aimed at understanding which residues 4e is interacting

with, which will allow for focused structural modifications to improve its binding affinity to

IFNAR. Computational modellings can investigate these SAR studies, to better our understanding

where 4e is interacting between IFNAR1 and IFNAR2. This same approach should be utilized in

future work in VDR agonists. It is known that 4-pyridyl in KP-156, KP-162, and KP-172 is critical

for VDR agonism (whereas 3-,and 2-pyridyl eliminate agonist activity). Thus, future investigations

should focus on which elements in the pyrimidine scaffold are also critical for activity. Modulating

substituted phenyls is an initial approach, as well as changing the 1,3-piperdinyl moiety to

potentially a 1,4-piperidinyl or 1,4-piperazine, to determine which geometry is critical for agonist

activity. However, as an initial starting point, computation modellings should be utilized to

determine preliminary critical elements, facilitating rational structural modifications in the future.

In summary, the molecular design approach for small molecular agonist design was applied to two

different receptor systems: (i) IFNAR; and (ii) VDR. The effectiveness of this approach is

exemplified by the successful lead candidates coming from each project (4e for IFNAR; KP-156,

KP-162, and KP-172 for VDR). As a result, it is evident that this approach can be applied to a

variety of receptor systems, with different cellular localizations and ligands (proteinaceous or

small molecule) for future small molecule agonist drug discovery efforts.

88

10. REFERENCES

1. de Weerd, N. A.; Nguyen, T. The interferons and their receptors—distribution and regulation. Immunology and Cell Biology 2012, 90, 483-491. 2. Stark, G. R.; Kerr, I. M.; Williams, B. R.; Silverman, R. H.; Schreiber, R. D. How cells respond to interferons. Annual Review of Biochemistry 1998, 67, 227-264. 3. Gad, H. H.; Dellgren, C.; Hamming, O. J.; Vends, S.; Paludan, S. R.; Hartmann, R. Interferon-λ is functionally an interferon but structurally related to the interleukin-10 family. Journal of Biological Chemistry 2009, 284, 20869-20875. 4. Pestka, S.; Krause, C. D.; Walter, M. R. Interferons, interferon-­‐like cytokines, and their receptors. Immunological Reviews 2004, 202, 8-32. 5. González-Navajas, J. M.; Lee, J.; David, M.; Raz, E. Immunomodulatory functions of type I interferons. Nature Reviews Immunology 2012, 12, 125-135. 6. Iwasaki, A.; Medzhitov, R. Toll-like receptor control of the adaptive immune responses. Nature Immunology 2004, 5, 987-995. 7. Leonard, W. J.; O'Shea, J. J. JAKs and STATs: biological implications. Annual Review of Immunology 1998, 16, 293-322. 8. Casanova, J.-L.; Holland, S. M.; Notarangelo, L. D. Inborn errors of human JAKs and STATs. Immunity 2012, 36, 515-528. 9. O'Shea, J. J.; Holland, S. M.; Staudt, L. M. JAKs and STATs in immunity, immunodeficiency, and cancer. New England Journal of Medicine 2013, 368, 161-170. 10. Minegishi, Y.; Saito, M.; Morio, T.; Watanabe, K.; Agematsu, K.; Tsuchiya, S.; Takada, H.; Hara, T.; Kawamura, N.; Ariga, T. Human tyrosine kinase 2 deficiency reveals its requisite roles in multiple cytokine signals involved in innate and acquired immunity. Immunity 2006, 25, 745-755. 11. Kumaran, J.; Wei, L.; Kotra, L. P.; Fish, E. N. A structural basis for interferon-alpha-receptor interactions. FASEB J 2007, 21, 3288-96. 12. Bello, A. M.; Bende, T.; Wei, L.; Wang, X.; Majchrzak-Kita, B.; Fish, E. N.; Kotra, L. P. De novo design of nonpeptidic compounds targeting the interactions between interferon-α and its cognate cell surface receptor. Journal of Medicinal Chemistry 2008, 51, 2734-2743. 13. Jonasch, E.; Haluska, F. G. Interferon in oncological practice: review of interferon biology, clinical applications, and toxicities. The Oncologist 2001, 6, 34-55. 14. Platanias, L. C. Mechanisms of type-I-and type-II-interferon-mediated signalling. Nature Reviews Immunology 2005, 5, 375-386. 15. Hervas-Stubbs, S.; Perez-Gracia, J. L.; Rouzaut, A.; Sanmamed, M. F.; Le Bon, A.; Melero, I. Direct effects of type I interferons on cells of the immune system. Clinical Cancer Research 2011, 17, 2619-2627. 16. Wang, B. X.; Platanias, L. C.; Fish, E. N. STAT activation in malignancies: roles in tumor progression and in the generation of antineoplastic effects of IFNs. Journal of Interferon & Cytokine Research 2013, 33, 181-188. 17. Weiss, K. Safety profile of interferon-alpha therapy. Seminars in Oncology 1998, 8, 9-13. 18. Fried, M. W.; Shiffman, M. L.; Reddy, K. R.; Smith, C.; Marinos, G.; Gonçales Jr, F. L.; Häussinger, D.; Diago, M.; Carosi, G.; Dhumeaux, D. Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection. New England Journal of Medicine 2002, 347, 975-982. 19. Glue, P.; Fang, J. W.; Rouzier-Panis, R.; Raffanel, C.; Sabo, R.; Gupta, S. K.; Salfi, M.; Jacobs, S. Pegylated interferon-α2b: Pharmacokinetics, pharmacodynamics, safety, and preliminary efficacy data. Clinical Pharmacology & Therapeutics 2000, 68, 556-567.

89

20. Erickson, A. K.; Seiwert, S.; Gale Jr, M. Antiviral potency analysis and functional comparison of consensus interferon, interferon-alpha2a and pegylated interferon-alpha2b against hepatitis C virus infection. Antiviral Therapy 2008, 13, 851. 21. Jesus Perez de Vega, M.; Martín-Martínez, M.; González-Muñiz, R. Modulation of protein-protein interactions by stabilizing/mimicking protein secondary structure elements. Current Topics in Medicinal Chemistry 2007, 7, 33-62. 22. Archakov, A. I.; Govorun, V. M.; Dubanov, A. V.; Ivanov, Y. D.; Veselovsky, A. V.; Lewi, P.; Janssen, P. Protein-­‐protein interactions as a target for drugs in proteomics. Proteomics 2003, 3, 380-391. 23. Veselovsky, A.; Ivanov, Y. D.; Ivanov, A.; Archakov, A.; Lewi, P.; Janssen, P. Protein–protein interactions: mechanisms and modification by drugs. Journal of Molecular Recognition 2002, 15, 405-422. 24. Wills, R. J. Clinical pharmacokinetics of interferons. Clinical Pharmacokinetics 1990, 19, 390-399. 25. Zhang, Q.; Bai, G.; Tian, W.; Cao, Y.; Wang, C. Identification of antiviral mimetic peptides with interferon α-­‐2b-­‐like activity from a random peptide library using a novel functional biopanning method1. Acta Pharmacologica Sinica 2008, 29, 634-640. 26. Sato, A.; Sone, S. A peptide mimetic of human interferon (IFN)-beta. Journal of Biochemistry 3, 371, 603-608. 27. Ahmed, C. M.; Burkhart, M. A.; Subramaniam, P. S.; Mujtaba, M. G.; Johnson, H. M. Peptide mimetics of gamma interferon possess antiviral properties against vaccinia virus and other viruses in the presence of poxvirus B8R protein. Journal of Virology 2005, 79, 5632-5639. 28. Fish, E. N. Definition of receptor binding domains in interferon-α. Journal of Interferon Research 1992, 12, 257-266. 29. Korn, A. P.; Rose, D. R.; Fish, E. N. Three-dimensional model of a human interferon-α consensus sequence. Journal of Interferon Research 1994, 14, 1-9. 30. Fish, E. Interferon receptor recognition peptides enhance the biological potency of interferon alphas. FEBS Letters 1995, 365, 87-91. 31. Kumaran, J.; Wei, L.; Kotra, L. P.; Fish, E. N. A structural basis for interferon-α-receptor interactions. The FASEB Journal 2007, 21, 3288-3296. 32. Bello, A. M.; Bende, T.; Wei, L.; Wang, X.; Majchrzak-Kita, B.; Fish, E. N.; Kotra, L. P. De novo design of nonpeptidic compounds targeting the interactions between interferon-alpha and its cognate cell surface receptor. Journal of Medicinal Chemistry 2008, 51, 2734-43. 33. Angelica M. Bello, L. W., Beata Majchrzak-Kita, Noruê Salum, Meena K. Purohit,; Eleanor N. Fish, L. P. K. Small molecule mimetics of an interferon-α receptor interacting domain. Bioorganic & Medicinal Chemistry 2014, 22, 8. 34. Singh, H.; Chawla, A. S.; Kapoor, V. K.; Paul, D.; Malhotra, R. K. 4 Medicinal chemistry of tetrazoles. Progress in Medicinal Chemistry 1980, 17, 151-183. 35. Demko, Z. P.; Sharpless, K. B. Preparation of 5-substituted 1 H-tetrazoles from nitriles in water. The Journal of Organic Chemistry 2001, 66, 7945-7950. 36. Finnegan, W. G.; Henry, R. A.; Lofquist, R. An improved synthesis of 5-substituted tetrazoles. Journal of the American Chemical Society 1958, 80, 3908-3911. 37. Jursic, B. S.; Zdravkovski, Z. Semiempirical and ab initio study of 1, 3-dipolar addition of azide anion to organic cyanides. Journal of Molecular Structure: THEOCHEM 1994, 312, 11-22.

90

38. Himo, F.; Demko, Z. P.; Noodleman, L.; Sharpless, K. B. Mechanisms of tetrazole formation by addition of azide to nitriles. Journal of the American Chemical Society 2002, 124, 12210-12216. 39. Cantillo, D.; Gutmann, B.; Kappe, C. O. Mechanistic Insights on Azide− Nitrile Cycloadditions: On the Dialkyltin Oxide− Trimethylsilyl Azide Route and a New Vilsmeier− Haack-Type Organocatalyst. Journal of the American Chemical Society 2011, 133, 4465-4475. 40. Heravi, M. M.; Fazeli, A.; Oskooie, H. A.; Beheshtiha, Y. S.; Valizadeh, H. Click Synthesis of 5-Substituted 1H-Tetrazoles from Aldehydes, Hydroxylamine, and [bmim] N3 via One-Pot, Three-Component Reaction. Synlett 2012, 23, 2927-2930. 41. Butler, R. N.; Garvin, V. C. A study of annular tautomerism, interannular conjugation, and methylation reactions of ortho-substituted-5-aryltetrazoles using carbon-13 and hydrogen-1 nmr Spectroscopy. Journal of Chemical Society Perkin Trans. 1981, 1, 390-393. 42. Deeb, K. K.; Trump, D. L.; Johnson, C. S. Vitamin D signalling pathways in cancer: potential for anticancer therapeutics. Nature Reviews Cancer 2007, 7, 684-700. 43. Mangelsdorf, D. J.; Thummel, C.; Beato, M.; Herrlich, P.; Schütz, G.; Umesono, K.; Blumberg, B.; Kastner, P.; Mark, M.; Chambon, P. The nuclear receptor superfamily: the second decade. Cell 1995, 83, 835-839. 44. Haussler, M. R.; Whitfield, G. K.; Haussler, C. A.; Hsieh, J. C.; Thompson, P. D.; Selznick, S. H.; Dominguez, C. E.; Jurutka, P. W. The nuclear vitamin D receptor: biological and molecular regulatory properties revealed. Journal of Bone and Mineral Research 1998, 13, 325-349. 45. White, J. H. Vitamin D signaling, infectious diseases, and regulation of innate immunity. Infection and Immunity 2008, 76, 3837-3843. 46. Lin, R.; Nagai, Y.; Sladek, R.; Bastien, Y.; Ho, J.; Petrecca, K.; Sotiropoulou, G.; Diamandis, E. P.; Hudson, T. J.; White, J. H. Expression profiling in squamous carcinoma cells reveals pleiotropic effects of vitamin D3 analog EB1089 signaling on cell proliferation, differentiation, and immune system regulation. Molecular Endocrinology 2002, 16, 1243-1256. 47. Yamada, S.; Shimizu, M.; Yamamoto, K. Structure–function relationships of vitamin D including ligand recognition by the vitamin D receptor. Medicinal Research Reviews 2003, 23, 89-115. 48. Havinga, E. Vitamin D, example and challenge. Experientia 1973, 29, 1181-1193. 49. Blunt, J.; DeLuca, H. F.; Schnoes, H. 25-hydroxycholecalciferol. A biologically active metabolite of vitamin D3. Biochemistry 1968, 7, 3317-3322. 50. Ohyama, Y.; Hayashi, S.-i.; Okuda, K. Purification of 25-hydroxyvitamin D3 24-hydroxylase from rat kidney mitochondria. FEBS Letters 1989, 255, 405-408. 51. Chen, K.-S.; Prahl, J. M.; DeLuca, H. F. Isolation and expression of human 1, 25-dihydroxyvitamin D3 24-hydroxylase cDNA. Proceedings of the National Academy of Sciences 1993, 90, 4543-4547. 52. Chow, E. C.; Magomedova, L.; Quach, H. P.; Patel, R.; Durk, M. R.; Fan, J.; Maeng, H.-J.; Irondi, K.; Anakk, S.; Moore, D. D. Vitamin D receptor activation down-regulates the small heterodimer partner and increases CYP7A1 to lower cholesterol. Gastroenterology 2014, 146, 1048-1059. 53. Chiang, J. Y. Regulation of bile acid synthesis: pathways, nuclear receptors, and mechanisms. Journal of hepatology 2004, 40, 539-551. 54. Lu, T. T.; Makishima, M.; Repa, J. J.; Schoonjans, K.; Kerr, T. A.; Auwerx, J.; Mangelsdorf, D. J. Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Molecular Cell 2000, 6, 507-515.

91

55. Malek, M.; Fakharian, M. Treatment result with rocaltrol pulse among patient with secondary hyperparathyroidism in hemodialysis ward. Journal of Babol University of Medical Sciences 2004, 6, 24-30. 56. Winer, K. K.; Ko, C. W.; Reynolds, J. C.; Dowdy, K.; Keil, M.; Peterson, D.; Gerber, L. H.; McGarvey, C.; Cutler Jr, G. B. Long-term treatment of hypoparathyroidism: a randomized controlled study comparing parathyroid hormone-(1–34) versus calcitriol and calcium. The Journal of Clinical Endocrinology & Metabolism 2003, 88, 4214-4220. 57. Sprague, S. M.; Llach, F.; Amdahl, M.; Taccetta, C.; Batlle, D. Paricalcitol versus calcitriol in the treatment of secondary hyperparathyroidism. Kidney International 2003, 63, 1483-1490. 58. Lindberg, J. S. New Vitamin D analogs. Seminars in Dialysis 2001, 1, 229-230. 59. St-Arnaud, R.; Arabian, A.; Akhouayri, O.; Knutson, J. C.; Strugnell, S. A. Differential effects of oral doxercalciferol (Hectorol®) or paricalcitol (Zemplar®) in the Cyp27b1-null mouse model of uremia. Nephron Experimental Nephrology 2011, 119, 67-74. 60. Fischer, J.; Wang, T.-T.; Kaldre, D.; Rochel, N.; Moras, D.; White, J. H.; Gleason, J. L. Synthetically accessible non-secosteroidal hybrid molecules combining vitamin D receptor agonism and histone deacetylase inhibition. Chemistry & Biology 2012, 19, 963-971. 61. Asano, L.; Ito, I.; Kuwabara, N.; Waku, T.; Yanagisawa, J.; Miyachi, H.; Shimizu, T. Structural basis for vitamin D receptor agonism by novel non-secosteroidal ligands. FEBS Letters 2013, 587, 957-963. 62. Eelen, G.; Gysemans, C.; Verlinden, L.; Vanoirbeek, E.; De Clercq, P.; Van Haver, D.; Mathieu, C.; Bouillon, R.; Verstuyf, A. Mechanism and potential of the growth-inhibitory actions of vitamin D and analogs. Current Medicinal Chemistry 2007, 14, 1893-1910. 63. Zhan, C.; Léger, J. M.; Huc, I. Cross-­‐Hybridization of Pyridinedicarboxamide Helical Strands and Their N-­‐Oxides. Angewandte Chemie International Edition 2006, 45, 4625-4628. 64. Kelly, T. R.; Wei, X.; Sundaresan, J. Maxonine: structure correction and synthesis. Tetrahedron Letters 1993, 34, 6173-6176. 65. Neidlein, R.; Menche, G. Synthese von 3.4-­‐sowie 4-­‐Substituierten Uracilen und Thiouracilen. Archive der Pharmazie 1972, 305, 596-601. 66. Mojtahedi, M. M.; Saidi, M. R.; Shirzi, J. S.; Bolourtchian, M. Microwave promoted efficient synthesis of substituted uracils and thiouracils under solvent-free conditions. Synthetic Communications 2002, 32, 851-855. 67. Burgula, L. N.; Radhakrishnan, K.; Kundu, L. M. Synthesis of modified uracil and cytosine nucleobases using a microwave-assisted method. Tetrahedron Letters 2012, 53, 2639-2642. 68. Molander, G. A.; Argintaru, O. A.; Aron, I.; Dreher, S. D. Nickel-Catalyzed Cross-Coupling of Potassium Aryl-and Heteroaryltrifluoroborates with Unactivated Alkyl Halides. Organic Letters 2010, 12, 5783-5785. 69. Li, G. Y. Highly Active, Air-Stable Palladium Catalysts for the CC and CS Bond-Forming Reactions of Vinyl and Aryl Chlorides: Use of Commercially Available [(t-Bu)2P(OH)]2PdCl2,[(t-Bu)2P(OH)PdCl2]2, and [[(t-Bu)2PO·H·OP(t-Bu)2]PdCl]2 as Catalysts. The Journal of Organic Chemistry 2002, 67, 3643-3650. 70. Khanapure, S. P.; Garvey, D. S. Use of highly reactive, versatile and air-stable Palladium-phosphinous acid complex [(t-Bu)2P(OH)]2PdCl2(POPd) as a catalyst for the optimized Suzuki-Miyaura cross-coupling of less reactive heteroaryl chlorides and arylboronic acids. Tetrahedron Letters 2004, 45, 567-577.

92

71. Cheng, C.; Shih, Y.-C.; Chen, H.-T.; Chien, T.-C. Regioselective arylation of uracil and 4-pyridone derivatives via copper(I) bromide mediated C–H bond activation. Tetrahedron 2013, 69, 1387-1396. 72. Kamei, K.; Maeda, N.; Katsuragi-Ogino, R.; Koyama, M.; Nakajima, M.; Tatsuoka, T.; Ohno, T.; Inoue, T. New piperidinyl-and 1, 2, 3, 6-tetrahydropyridinyl-pyrimidine derivatives as selective 5-HT receptor agonists with highly potent anti-ischemic effects. Bioorganic & Medicinal Chemistry Letters 2005, 15, 2990-2993. 73. Kataoka, K.; Kosugi, T.; Ishii, T.; Takeuchi, T.; Tsutsumi, T.; Nakano, A.; Unoki, G.; Yamamoto, M.; Sakai, Y. Pyrrolopyrimidine derivatives. US Patent 20,050,277,773: 2005. 74. Konishi, H.; Okamoto, K.; Ohmori, Y.; Yoshino, H.; Ohmori, H.; Ashihara, M.; Hirata, Y.; Ohta, A.; Sakamoto, H.; Hada, N. An orally available, small-molecule interferon inhibits viral replication. Scientific Reports 2012, 2, 1-9.

93

11. APPENDIX

Scheme 11. Precursor synthesis for KP-172.