Detection of nodavirus in barramundi, Lates calcarifer (Bloch), using recombinant coat protein-based ELISA and RT–PCR

Detection of nodavirus in barramundi, Lates calcarifer

(Bloch), using recombinant coat protein-based ELISA

and RT±PCR

B Huang1, C Tan1, S F Chang2, B Munday3, J A Mathew1, G H Ngoh2 and J Kwang1

1 Institute of Molecular Agrobiology, National University of Singapore, Singapore

2 Central Veterinary Laboratory, Agri-food and Veterinary Authority, Singapore

3 School of Biomedical Science, University of Tasmania, Launceston, Tasmania, Australia

Abstract

The coat protein encoded by the nodavirus RNA2gene originally isolated from greasy grouper, Epi-nephelus tauvina, was cloned, expressed as arecombinant polyhistidine-tailed fusion proteinand characterized by immunoblot analysis. Thepuri®ed recombinant protein was used to developan indirect enzyme-linked immunosorbent assay(ELISA) to detect body exudate and plasmaantibodies against the coat protein in both experi-mentally infected and commercial barramundi. Inaddition, the nucleotide sequence was employed todevelop a RT±PCR detection assay based on the T4region. The results showed that the virus could bedetected as early as 3 days post-infection byRT±PCR while antibodies against the recombinantcoat protein were detectable on day 6 post-infection. Among 112 commercial barramundisamples collected from October 1999 to April2000, 9% showed positive ELISA results whichwere further veri®ed by Western blot.

Keywords: nodavirus, Lates calcarifer, ELISA, RT±PCR, diagnostic.

Introduction

Nodaviruses, which were originally isolated frominsects, are small nonenveloped riboviruses withtwo single-stranded RNA genomes, RNA1 and

RNA2, both of which are necessary for infection.The 3.1 kb RNA1 gene encodes the RNA-depend-ent RNA polymerase and the 1.4 kb RNA2 geneencodes the coat protein (Ball 1994). The genus ofnodavirus that infects ®sh, the betanodavirus (VanRegenmortel, Fauquet, Bishop, Carstens, Estes,Lemon, McGeoch, Maniloff, Mayo, Pringle &Wickner 2000), has of late been found in a variety ofmarine ®sh such as striped jack, Pseudocaranx dentex,barramundi, Lates calcarifer, turbot, Scophthalmusmaximus, seabass Dicentrarchus labrax, and red-spotted grouper, Epinephelus akaara (Glazebrook,Heasman & de Beer 1990; Bloch, Gravningen &Larsen 1991; Breuil, Bonami, Pepin & Pichot 1991;Mori, Nakai, Nagahara, Muroga, Mekuchi &Kanno 1991; Mori, Nakai, Muroga, Arimoto,Mushiake & Furusawa 1992). Nodavirus infectionin ®sh is characterized by extensive cellular vacuo-lation and neuronal degeneration in the centralnervous system and retina. This disease is gainingmore importance because of the high mortality inlarvae and juveniles of marine ®sh and is widespreadin water bodies including the Paci®c, Mediterraneanand Atlantic Oceans (Breuil et al. 1991; Munday,Nakai & Nguyen 1994; Grotmol, Bergh & Totland1999). In general, the earlier the commencement ofdisease, the greater is the rate of mortality whichmay even reach 100% (Munday & Nakai 1997).Therefore, it is essential to develop speci®c andsensitive detection methods for nodavirus infectionin diagnostic and epidemiological work.

The use of light- and electron-microscopyhas enabled detection of nodavirus and thehistopathological lesions caused by it (Yoshikoshi

Journal of Fish Diseases 2001, 24, 135±141

Correspondence Dr Jimmy Kwang, Animal Health

Biotechnology Laboratory, Institute of Molecular Agrobiology,

1 Research Link, National University of Singapore,

117604 Singapore. (e-mail: [email protected])

135Ó 2001

Blackwell Science Ltd

& Inoue 1990). However, it is not possible toidentify apparently uninfected ®sh or those at veryearly stages of infection. The availability of puri®edvirus enabled development of an ELISA forantibody detection of striped jack nervous necrosisvirus (SJNNV) (Arimoto, Mushiake, Mizuta,Nakai, Muroga & Furusawa 1992; Mushiake,Arimoto, Furusawa, Furusawa & Muroga 1992).However, puri®ed virus-based ELISA is time-consuming as it involves virus propagation andpuri®cation. Reverse transcription followed bypolymerase chain reaction (RT±PCR) was foundto be a more sensitive method for detection ofSJNVV by ampli®cation of a portion of the RNA2gene (Nishizawa, Mori, Nakai, Furusawa &Muroga 1994). This and other PCR methods havebeen widely applied to study outbreaks of nodavirusinfection (Mushiake, Nishizawa, Nakai, Furusawa& Muroga 1994; Nishizawa, Muroga & Arimoto1996; Thiery, Raymond & Castric 1999; Grotmol,Nerland, Biering, Totland & Nishizawa 2000).However, these methods can be expensive andimpractical for large scale screening and farm-baseddetection. In 1997, the coat protein gene fromencephalitis virus infecting seabass (SB) was clonedand expressed as a recombinant protein in Escheri-chia coli (Sideris 1997). Further, Western blotanalysis of the puri®ed recombinant protein showeda strong antigen±antibody interaction. Thisapproach suggests that it may be possible to developa convenient and economic diagnostic methodsuitable for large scale screening by a bioengineeringtechnique. In the present study, we developed arapid ELISA test to detect plasma and body exudateantibodies against recombinant nodavirus coatprotein of greasy grouper nervous necrosis virus(GGNNV) in experimentally infected and naturallyinfected barramundi. The RT±PCR as suggested byNishizawa et al. (1994) was used to amplify the T4variable region of the RNA2 gene from experi-mentally infected barramundi. Comparison of thesetwo methods allowed investigation of the relationbetween the presence of nodavirus and the antibodyagainst recombinant coat protein.

Materials and methods

Virus strain and seabass cell line

The nodavirus strain and SB cell line (Chong,Ngoh & Chew-Lim 1990) were obtained fromAVA (Agri-food & Veterinary Authority of Singa-

pore). The SB cells were grown in MEM supple-mented with 0.34% NaCl and 0.12% HEPES at23 °C. GGNNV was originally isolated in 1992from brain, head, kidney and liver of greasy grouperEpinephelus tauvina, in Singapore. Full-lengthRNA2 (GenBank Accession number AF318942)was cloned and sequenced in our laboratory.

Virus replication and partial puri®cation

The SB cells were infected with the nodavirus forpropagation and inoculated cultures were harvestedwhen 90% of cells in the monolayer showed speci®ccytopathic effect (CPE). The tissue culture super-natant was either kept at ±80 °C for infectionexperiments or clari®ed by high speed centrifuga-tion at 8000 g for 20 min followed by ultracentrif-ugation of the supernatant at 100 000 g for 2 h inan SW41 swinging bucket rotor (Beckman, Full-erton, CA, USA1 ) for viral nucleic acid extractionfrom the pellets, which were kept at ±80 °C.

Induction of nodavirus disease in barramundi

A total of 35 barramundi, Lates calcarifer (Bloch),juveniles with no previous history of viral nervousnecrosis were obtained from AVA. Absence ofGGNNV and viral infection were further con-®rmed by RT±PCR and recombinant ELISA.Fish were maintained in glass tanks containingUV-irradiated sea water at 25 °C. Among these,seven ®sh samples were used as negative controls forRT±PCR and ELISA. Twenty-eight juvenile bar-ramundi weighing 3±5 g each were immersed in abath containing 104 mL±1 of nodavirus. Followingthe immersion bath, water in the tank was changedseveral times before the ®sh were transferred toclean tanks. This was to ensure proper removal ofresidual virus. On the third day post-infection,seven samples were collected for virus and antibodydetection. Dead ®sh from the experiment were keptat )80 °C until further analysis.

Frozen barramundi juveniles were dissected andthe brains and eyes were homogenized in Trizolreagent (Life Technologies, Rockville, MD, USA2 )for total RNA extraction following the manufac-turer's instructions. One-gram weight of bodytissue excluding the organs, was homogenized in3 mL phosphate buffered saline (PBS) for bodyexudate preparation. After centrifugation at 3000 gfor 10 min, the supernatant was stored at ±20 °Cfor ELISA.

Journal of Fish Diseases 2001, 24, 135±141 B Huang et al. Nodavirus detection by ELISA and RT±PCR

136Ó 2001


Fish and plasma samples

A total of 112 commercial adult barramundi eachweighing 100±400 g were collected at various timesfrom October 1999 to April 2000. The ®sh wereanaesthetized with MS-222 and blood was drawnfrom the caudal vein using a 1-mL syringecontaining 0.2 mL of 3.2% sodium citrate. Plasmasamples were separated by centrifugation at 3000 gfor 3 min and kept at ±20 °C for ELISA.

Cloning of coat protein gene

The oligonucleotide primers used in this study andtheir annealing temperatures are listed in Table 1.The open reading frame of the coat protein gene,which is 1017 bp in length, was obtained byRT±PCR ampli®cation with primers RNA2±5¢and RNA2±3¢ containing appropriate restrictionenzyme sites and then cloned into pQE30. Brie¯y,complementary DNA was synthesized by usingExpand Reverse Transcriptase (Boehringer Mann-heim, Mannheim, Germany3 ) and a speci®c reverseprimer RNA2±3¢ under conditions suggested bythe manufacturer. The PCR reactions were carriedout in a DNA thermal cycler (GeneAmp 9600;Perkin-Elmer Cetus, Boston, MA, USA4 ) in 50 lLreaction mix containing 10 mm Tris±HCl, pH 8.3,50 mm KCl, 1.5 mm MgCl2, 170 mm of eachdNTP, 20 pmol of each primer, 200 ng cDNA and2.5 U Taq/Pfu polymerase mix (Boehringer Mann-heim5 ). The ampli®cation was performed with aninitial denaturation at 94 °C for 2 min followed by30 cycles of denaturation at 94 °C for 30 s,annealing at 56 °C for 30 s and extension at72 °C for 1 min. In addition, an extension step of7 min at 72 °C was added at the end of the lastcycle to ensure full length synthesis of thisfragment. The E. coli strain JM105 (AmershamPharmacia, Uppsala, Sweden) and vector pQE30(Qiagen, Hilden, Germany6,7 ) were used for gene

cloning and expression. The E. coli strain wasgrown in Luria Bertani (LB) broth. For selection oftransformants and plasmid maintenance, themedium was supplemented with 100 lg mL±1

ampicillin.

Expression and puri®cationof polyhistidine-tailed fusion protein

Induction of coat protein in expression vectorpQE30 in E. coli strain JM105 was achieved byaddition of 1 mm isopropyl-d-thiogalactopyrano-side (IPTG) (®nal concentration) at mid-exponen-tial growth phase and incubation of the culture for4 h. Following induction, the cells were harvestedand resuspended in 25 mL of 50 mm phosphatebuffer (pH 8.0) supplemented with 8 m urea. Thepolyhistidine-tailed fusion proteins were puri®edfrom these cell extracts using Ni2+ chelate af®nitychromatography (Qiagen) according to the manu-facturer's instructions. The bound fusion proteinswere eluted by slowly decreasing the pH from 8.0 to4.5 with 50 mm phosphate buffer (NaH2PO4)containing 300 mm NaCl and 8 m urea. The purityof the recombinant proteins were veri®ed by SDS±PAGE and further con®rmed by immunoblottingusing antinodavirus polyclonal antibody raised inguinea pig.

Immunoblotting

Puri®ed polyhistidine-tailed coat proteins wereelectrophoresed on 12% SDS±PAGE gels andimmunoblot analysis was performed. Guinea pigsera against the nodavirus strain were used at adilution of 1:400. Seabass plasma and rabbitantiseabass sera were applied at 1:25 and 1:250dilutions, respectively. Bound antibodies werevisualized on immunoblots using horseradishperoxidase conjugated guinea pig or rabbit IgG ata dilution of 1:1000.

Table 1 Oligonucleotide primers for ampli®cation of nodavirus Singapore strain RNA2 gene

Target region Primer Sequencea Linker TAnnb (°C)

ORFc NVSRNA2±5¢ cggggtaccATGGTACGCAAGGGTGATAAG KpnI 62

NVSRNA2±3¢ cccaagcttTTAGTTTCCCGAGTCAACCC HindIII 60

T4 NVRNA2-F2 CGTGTCAGTGCTGTGTCGCTG 68

NVRNA2-R3 CGAGTCAACCCTGGTGCAGAC 68

a Lowercase letters indicate nucleotides added to create restriction enzyme recognition sites (in italics) for cloning.b TAnn indicates annealing temperature.c ORF stands for open reading frame.


137Ó 2001


Enzyme-linked immunosorbent assay

Optimal concentrations of puri®ed recombinantcoat protein, conjugates and plasma dilutions forELISA were determined by checkerboard titration.The recombinant protein (100 ng) diluted with0.1 m sodium bicarbonate buffer (pH 9.6) was usedto coat each well of 96 well microtitre plastic plates(Microtiterä Styrene Immunoassay Plate, Dynex,USA) which were incubated overnight at 4 °C. Theplates were then washed ®ve times with PBScontaining 0.1% Tween 20 (PBST20) and blockedwith 5% milk for 1 h at 37 °C. After washing withPBST20, 100 lL of barramundi plasma at 1:25dilution was added to each well and the plates wereincubated for 20 min at 37 °C. Following thewash, 100 lL of rabbit anti-seabass sera was addedat 1:250 dilution and incubated for another 20 minat 37 °C. After washing the plates as above, 100 lLof HRP-conjugated rabbit IgG was added at 1:1000dilution followed by incubation for 20 min at37 °C. Later 100 lL of o-phenylenediamine dihy-drochloride (Sigma, St. Louis, MO, USA8 ) substratesolution was added and the plates were incubatedfor 20 min at room temperature. The reaction wasstopped by the addition of 25 lL of 4 m H2SO4

and optical density (OD) at wavelength 490 nmwas determined using a Elx808ultra microplatereader (Bio-Tek Instruments Inc, USA). All sampleswere run in duplicate. The ELISA results wereexpressed as a ratio of the OD490 of sample (P) tothe OD490 of negative control (N) and a P/N ratio>2 was considered positive.

RT±PCR

The detection of nodavirus RNA2 gene byRT±PCR was carried out as described previously(Nishizawa et al. 1994). Of the ®ve target regions inthe open reading frame of the RNA2 gene, T4(420 bp) was selected as the target sequence forPCR ampli®cation in this study. A pair of primersF2 and R3 (Table 1), with some modi®cationsbased on nucleotides of the strain used in this study,was employed to amplify this fragment.

Results

Infection experiments

Infected ®sh with clinical signs such as abnormalswimming with the head towards the bottom of the

tank in a typical `whirling' pattern were observed onday 4 post-infection. Two days later (on day 6 post-infection), four of the challenged ®sh died and theremaining 17 ®sh died on day 8 post-infection.

Recombinant protein

The polyhistidine tailed fusion proteins werepuri®ed from the cell extracts and the majority ofthe proteins were eluted at pH 4.5.

Immunoreactivity of recombinant nodaviruscoat protein

When analysed by 12% SDS±PAGE, the apparentmolecular weight of puri®ed recombinant coatprotein was approximately 37 kDa, as predicted(Fig. 1A). The immunoreactivity of fusion proteinwas detected by immunoblotting and could berecognized by guinea pig sera against nodavirus, butdid not react with pre-bled sera (Fig. 1B).

Detection of nodavirus by RT±PCR and ELISA

Total RNA from diseased and normal juvenilebarramundi brain and eye tissues were subjected toRT±PCR ampli®cation of the T4 region of thenodavirus strain. The ampli®cation from diseased®sh yielded a 420-bp DNA product (data notshown) corresponding to that obtained fromSJNNV RNA. The virus was detected in all thesamples from infected ®sh from 3 to 8 day post-infection, but not in control ®sh (Table 2). ThePCR products were further sequenced to verify thatthe speci®ed viral target was ampli®ed in thereaction. The virus could be detected as early as day3 post-infection by RT±PCR although clinical signshad not appeared. These results indicate that all thejuvenile barramundi in the present study wereexperimentally infected with the nodavirus strain.

ELISA results of antibody detection againstrecombinant coat protein are shown in Table 2.No detectable antibodies were found on the day 3post-infection. However, on day 6 post-infection,three of four ®sh tested positive. No antibodies weredetected in any of the seven samples from thenegative control group. This suggests that antibod-ies against nodavirus coat protein are formed asearly as 6 days post-infection. Nevertheless, onlyseven of 17 infected ®sh, which were collectedimmediately after death on day 8 post-infection,tested positive for antibody production. Thus,


138Ó 2001


although nodavirus infection of barramundi couldbe detected by RT±PCR and ELISA, the lattermethod was unable to detect the infection at veryearly stages of the infection.

Detection of antibodies against nodavirus coatprotein in commercial barramundi

Of 112 barramundi samples collected from October1999 to April 2000, ELISA detection con®rmed 10samples to be positive for antibodies against noda-virus coat protein, suggesting that the commercialbarramundi had been infected with nodavirusand/or were nodavirus carriers. The ELISA resultswere further veri®ed by immunoblot (Fig. 2).

Discussion

The nodavirus strain (GGNNV) used in this studywas originally isolated from greasy grouper fromSingapore in 1992. Analysis of the completenucleotide and amino acid sequence of RNA2

Figure 1 (A) Shows the expression and puri®cation of recombinant capsid protein. M is prestained protein marker. (B) Shows

immunoblot analysis of capsid protein with guinea pig sera. Lane 1 is prebled serum and lane 2 is guinea pig serum immunized with

nodavirus.

Table 2 Detection of exudate antibodies and nodavirus by

ELISA and RT±PCR in infected seabass

Group Samples

No. of antibody

positive/no. of ®sh

No. of PCR

positive/no. of ®sh

1 Negative control 0/7 0/7

2 3 days p.i.* 0/7 7/7

3 6 days p.i. 3/4 4/4

4 8 days p.i. 7/17 17/17

* Post-infection.

Figure 2 Western blot analysis of commercial ®sh samples using

recombinant capsid protein. Lanes 1±6 are positive samples in

ELISA and lane 7 is negative in ELISA.


139Ó 2001


suggests that this strain is closely related to red-spotted grouper nervous necrosis virus (RGNNV),and possesses features common to all other ®shnodaviruses. The nucleotide sequence of GGNNVRNA2 is 1433 bp in length and contains a singleORF which encodes a 338 a.a. (nucleotides27±1043) capsid protein with a molecular mass of37 kDa. The sequence similarities between theRNA2 of GGNNV and those of other known ®shnodaviruses are between 75.7% and 98.6% at thenucleotide level, and between 80.5% and 98.9% atthe amino acid level. The signi®cant level ofnucleotide sequence identity among the coatprotein genes of different ®sh nodaviruses con®rmsthat they are closely related. The high conservationamong ®sh nodaviruses supports previous reportsshowing cross-reactivity among different ®sh nod-aviruses (Delsert, Morin & Comps 1997). Usingpolyclonal antisera Munday et al. (1994) found aclose antigenic relationship between SJNNV andbarramundi NNV and also it has been found that anodavirus detected in the Atlantic halibut cross-reacted with polyclonal antisera raised againstSJNNV and DIEV (Grotmol, Totland, Thorud& Hjeltnes 1997). Previous ®ndings using immu-noblot assays also indicate that different ®shnodaviruses share a signi®cant number of antigenicdeterminants although they are immunologicallynot identical to each other (Nakai, Nguyen,Nishizawa, Muroga, Arimoto & Ootsuki 1994;Nguyen, Mekuchi, Imura, Nakai, Nishizawa &Muroga 1994; Grotmol et al. 1997; Nishizawa,Takano & Muroga 1999). The signi®cant homol-ogy of capsid protein sequences among different®sh nodaviruses forms the basis of our experimentssuggesting that the recombinant capsid protein is apotential candidate for developing diagnostic meth-ods to detect ®sh nodaviruses.

To enable characterization and production of thiscapsid protein, the whole ORF was cloned intoexpression vector pQE30 and successfully expressedas recombinant poly histidine tailed protein withthe same molecular mass as predicted. This recom-binant capsid protein could be recognized by guineapig polyclonal antibody against GGNNV inimmunoblot analysis which was further con®rmedby the positive reaction with expressed capsidprotein in the Western blot. Thus, the puri®edprotein is suitable for developing speci®c and rapiddiagnostic assays.

Furthermore, an indirect ELISA based onrecombinant capsid protein of GGNNV was

developed to detect body exudate and plasmaantibodies. Our data showed that exudate antibod-ies against capsid protein could be detected fromday 6 post-infection onwards but the antibody titrecould not be monitored beyond 8 days as a result of100% mortality. The dose of virus in the bath mayhave been too high to sustain the ®sh for longerthan 8 days.

The RT±PCR has been successfully used indetection of SJNNV (Mushiake et al. 1994;Nishizawa et al. 1994). The T4 region locatedin the variable region of the RNA2 gene is consideredto be the most suitable target region for PCRampli®cation of SJNNV coat protein gene whencompared with other regions, as T4 does not yieldnon-speci®c products and is also not affected byRNA secondary structure (Nishizawa et al. 1994). Inthe present study, the T4 region was ampli®ed usingmodi®ed primers by RT±PCR of total RNA fromplasma and exudates, as well as brain and eye tissuesof infected juvenile barramundi, as early as day 3post-infection. However, there is a possibility thatRT±PCR has ampli®ed residual virus from the bathchallenge in spite of steps taken to ensure completeremoval of residual virus by several washings.

Thus, RT±PCR could detect virus earlier thanantibody detection by ELISA, which supports theview that PCR ampli®cation is a speci®c andsensitive method for the diagnosis of ®sh nodavirus(Nishizawa et al. 1994). However, RT±PCR is atime-consuming and relatively expensive methodwhich is not particularly practical for large scaledetection of virus. Further, as the T4 region isvariable, primer selection for RT±PCR has to bebased on the speci®c nucleotide sequence ofdifferent nodaviruses. Compared with RT±PCR,the ELISA method developed in this study is moreconvenient and economic, especially for farm-basedlarge scale preliminary screening before con®rma-tion by virological methods.

Acknowledgments

The authors thank Phillip Crosbie for providingrabbit anti-seabass sera. This work was supported bythe National Science and Technology Board ofSingapore.

References

Arimoto M., Mushiake K., Mizuta Y., Nakai T., Muroga K.

& Furusawa I. (1992) Detection of striped jack nervous


140Ó 2001


necrosis virus (SJNNV) by enzyme-linked immunosorbant

assay (ELISA). Fish Pathology 27, 191±195.

Ball L.A. (1994) Nodaviruses. In: Encyclopedia of Virology (ed. by

R.G. Webster & A. Granoff), Vol. 2, pp. 919±925. Academic

Press, San Diego.

Bloch B., Gravningen K. & Larsen J.L. (1991) Encephalomy-

elitis among turbot associated with a picornavirus-like agent.

Diseases of Aquatic Organisms 10, 65±70.

Breuil G., Bonami J.R., Pepin J.F. & Pichot Y. (1991) Viral

infection (picorna-like virus) associated with mass mortalities

in hatchery-reared sea-bass (Dicentrarchus labrax) larvae and

juveniles. Aquaculture 97, 109±116.

Chong S.Y., Ngoh G.H. & Chew-Lim M. (1990) Study of three

tissue culture viral isolates from marine food®sh. SingaporeJournal of Primary Industries 18, 54±57.

Delsert C., Morin N. & Comps M. (1997) A ®sh encephalitis

virus that differs from other nodaviruses by its capsid protein

processing. Archives of Virology 142, 2359±2371.

Glazebrook J.S., Heasman M.P. & de Beer S.W. (1990) Picorna-

like viral particles associated with mass mortalities in larval

barramundi, Lates calcarifer Bloch. Journal of Fish Diseases 13,

245±249.

Grotmol S. , Bergh O. & Totland G.K. (1999) Transmission of

viral encephalopathy and retinopathy (VER) to yolk-sac larvae

of the Atlantic halibut Hippoglossus hippoglossus: occurrence of

nodavirus in various organs and a possible route of infection.

Diseases of Aquatic Organisms 36, 95±106.

Grotmol S., Nerland A.H., Biering E., Totland G.K. &

Nishizawa T. (2000) Characterization of the capsid protein

gene from a nodavirus strain affecting the Atlantic halibut

Hippoglossus hippoglossus and design of an optimal reverse-

transcriptase polymerase chain reaction (RT-PCR) detection

assay. Diseases of Aquatic Organisms 39, 79±88.

Grotmol S., Totland G.K., Thorud K. & Hjeltnes B.K. (1997)

Vacuolating encephalopathy and retinopathy associated with a

nodavirus-like agent: a probable cause of mass mortality of

cultured larval and juvenile Atlantic halibut Hippoglossushippoglossus. Diseases of Aquatic Organisms 29, 85±97.

Mori K., Nakai T., Muroga K., Arimoto M., Mushiake K. &

Furusawa I. (1992) Properties of a new virus belonging to

nodaviridae found in larval striped jack (Pseudocaranx dentex)

with nervous necrosis. Virology 187, 368±371.

Mori K., Nakai T., Nagahara M., Muroga K., Mekuchi T.

& Kanno T. (1991) A viral disease in hatchery-reared larvae

and juveniles of redspotted grouper. Gyobyo Kenkyu 26,

209±210.

Munday B.L. & Nakai T. (1997) Special topic review: nodavi-

ruses as pathogens in larval and juvenile marine ®n®sh. WorldJournal of Microbiology &. Biotechnology 13, 375±381.

Munday B.L., Nakai T. & Nguyen H.D. (1994) Antigenic

relationship of the picorna-like virus of larval barramundi,

Lates calcarifer Bloch to the nodavirus of larval striped jack,

Pseudocaranx dentex (Bloch & Schneider). Australian Veterin-ary Journal 71, 384.

Mushiake K., Arimoto M., Furusawa T., Furusawa I. &

Muroga K. (1992) Detection of antibodies against striped jack

nervous necrosis virus (SJNNV) from brood stocks of striped

jack. Nippon Suisan Gakkaishi 58, 2351±2356.

Mushiake K., Nishizawa T., Nakai T., Furusawa I. & Muroga K.

(1994) Control of VNN in striped jack: selection of spawners

based on the detection of SJNNV gene by polymerase chain

reaction (PCR). Fish Pathology 29, 177±182.

Nakai T., Nguyen H.D., Nishizawa T., Muroga K., Arimoto M.

& Ootsuki K. (1994) Occurrence of viral nervous necrosis in

kelp grouper and tiger puffer. Fish Pathology 29, 211±212.

Nguyen H.D., Mekuchi T., Imura K., Nakai T., Nishizawa T. &

Muroga K. (1994) Occurrence of viral nervous necrosis

(VNN) in hatchery-reared juvenile Japanese ¯ounder Para-lichthys olivaceus. Fisheries Science 60, 551±554.

Nishizawa T., Mori K., Nakai T., Furusawa I. & Muroga K.

(1994) Polymerase chain reaction (PCR) ampli®cation of

RNA of striped jack nervous necrosis virus (SJNNV). Diseasesof Aquatic Organisms 18, 103±107.

Nishizawa T., Muroga K. & Arimoto M. (1996) Failure of the

polymerase chain reaction (PCR) method to detect striped

jack nervous necrosis virus (SJNNV) in striped jack Pseudo-caranx dentex selected as spawners. Journal of Aquatic AnimalHealth 8, 332±334.

Nishizawa T., Takano R. & Muroga K. (1999) Mapping a

neutralizing epitope on the coat protein of striped jack nervous

necrosis virus. Journal of General Virology 80, 3023±3027.

Sideris D.C. (1997) Cloning, expression and puri®cation of the

coat protein of encephalitis virus (DIEV) infecting Dicen-trarchus labrax. Biochemistry and Molecular Biology Interna-tional 2, 409±417.

Thiery R., Raymond J.C. & Castric J. (1999) Natural outbreak

of viral encephalopathy and retinopathy in juvenile sea bass,

Dicentrarchus labrax: study by nested reverse transcriptase-

polymerase chain reaction. Virus Research 63, 11±17.

Van Regenmortel M.H.V., Fauquet C.M., Bishop D.H.L.,

Carstens E.B., Estes M.K., Lemon S.M., McGeoch D.J.,

Maniloff J., Mayo M.A., Pringle C.R. & Wickner R.B.

(2000) Virus Taxonomy, Classi®cation and Nomenclature ofViruses, 7th edn. Academic Press, San Diego.

Yoshikoshi K. & Inoue K. (1990) Viral nervous necrosis in

hatchery-reared larvae and juveniles of Japanese parrot®sh,

Oplegnathus fasciatus (Temminck & Schlegel). Journal of FishDiseases 13, 69±77.

Received 6 September 2000Accepted 16 November 2000


141Ó 2001


Documents

Detection of nodavirus in barramundi, Lates calcarifer (Bloch), using recombinant coat protein-based ELISA and RT–PCR