RESULTS

Medical Diagnostic Laboratories, L.L.C.Phone: (609) 570-1015 Fax: (609) 570-1030

www.mdlab.com

Detection of Polyomavirus BK and Polyomavirus JCin Urine Specimens by Real-Time PCR

John Entwistle, Melanie Feola, Martin E. Adelson, and Eli MordechaiMedical Diagnostic Laboratories, L.L.C., 2439 Kuser Road, Hamilton, New Jersey 08690

MATERIALS & METHODS (cont.)Real-time PCR Reactions: Each 25 µl reaction contained 2.5 µl of eluted DNA, primers and dual-labeled probes for virus-specific amplification, and BIORAD Master Mix which contains dNTP/dUTP, Hot Goldstar DNA polymerase, MgCl2, and uracil-N-DNA glycosylase (UNG). The real-time PCR reactions were performed on a Rotor-Gene 3000 instrument and included an initial incubation at 50ºC for 2 minutes followed by 35 to 40 cycles of denaturation and annealing/extension with acquisition for free fluorophores immediately following each cycle. Analysis was performed with the Rotor-Gene 3000 Software, Version 6 (Build 38) with slope correction and reaction efficiency threshold enabled and the NTC threshold set to a maximum of 5%.

The real-time primer and probe combinations were tested on positive Polyomavirus BK and Polyomavirus JC specimens purchased from the American Type Cultures Collection (ATCC, Manassas, VA). The Polyomavirus BK amplicon resulting from amplification of the reference strain virus with the real-time PCR assay was subcloned into a plasmid vector, while the Polyomavirus JC genome was purchased in plasmid form. These vectors containing the viral amplification target were used as positive controls. After quantification, serial dilutions of each were tested from 109 to 10 genome equivalents/reaction. In addition to verifying that the primers and probes did not have homology to sequences deposited in the Genbank nucleotide ‘nr’ database, the primer and probe combinations were also tested against a series of human pathogens (Table 1).

Precautions against contamination: Extraction of DNA, preparation of the PCR reactions, amplification in the Rotor-Gene 3000 machines, and the Pyrosequencing procedures were each performed in separate rooms. Pyrogen-free, nuclease-free water was used in the isolation of DNA and ATCC-extracted controls. New Finn pipettes were used solely with filter tips for PCR. PCRs were each prepared in a UV-irradiated PCR biohood and UNG was incorporated into the BIORAD PCR mastermix to minimize, if not eliminate, the possibility of carry-over contamination.

ABSTRACTObjective: To develop a rapid and accurate method for identifying Polyomavirus BK and Polyomavirus JC in urine specimens which are shed in immunosuppressed patients, such as those receiving renal transplants.

Methods: Primers and dual-labeled probes specific for Polyomavirus BK and Polyomavirus JC were developed and optimized for use in real-time PCR assays on a Rotor-Gene RG-3000 platform. DNA was extracted from the urine using an X-tractor Gene (Corbett Robotics, Australia) automated system. To test virus stability, a biologically equivalent concentration of each virus was incubated on UroSwab™ (Copan Diagnostics, Italy) for up to five days prior to extraction. Urine specimens from 120 patients were analyzed using the real-time PCR assays and compared with a Pyrosequencing assay to calculate sensitivity and specificity.

Results: Sensitivity and specificity were calculated for each reaction: Polyomavirus BK, 100% and 100% (5 positives / 115 negatives) and Polyomavirus JC, 100% and 100% (9 positives / 111 negatives). The quantitative capabilities of each assay extended over seven orders of magnitude; no cross-reactivity was observed. Pyrosequencing was used to verify the presence of Polyomavirus BK (sequencing of the real-time PCR amplicon) and JC (sequencing of an alternate gene) in the specimens. Stability assays verified detection of the virus for up to five days post-incubation on UroSwab™ stored at room temperature.

Conclusions: This study, along with the accompanying Pyrosequencing assays, validates the use of real-time PCR for the rapid quantitative detection of two urological pathogens associated with systemic infections. Both procedures were highly sensitive and specific.

INTRODUCTIONThe Polyomavirus BK and JC are double-stranded DNA viruses belonging to the Papovavirus family. The infections are acquired early in childhood and 60-80% of adults in the United States test seropositive for these viruses indicative of prior exposure. The Polyomaviruses often persist as latent infections in a host without causing disease, but may produce infection in a host who is immunocompromised or the recipient of immunosuppressive therapy.

Primary infection of Polyomavirus BK generally occurs in childhood without evident symptoms and the virus can remain latent in the urinary tract. Reactivation can be enhanced by immunosuppressive conditions such as those induced by drugs administered to prevent rejection of transplanted organs, leading to overt clinical disease and generally presenting as renal tract infections. Ureteric stenosis is a common condition where the transitional epithelial cells in the ureter proliferate leading to a partial to total urethral obstruction.

Polyomavirus JC establishes a latent infection in the kidney after a primary infection similar to BK virus. JC virus has been linked to the development of hemorrhagic cystitis, ureteral stenosis and allograft dysfunction in renal transplant recipients. JC virus is now firmly associated with both nephropathies after transplantation and progressive multifocal leukoencephalopathy. No specific antiviral therapy has been proven effective for Polyomavirus JC.

This poster describes the creation and validation of two real-time PCR assays capable of detecting Polyomavirus BK and JC in urine specimens. Sensitivity: For each pathogen target, a positive vector control containing the amplification target

was generated, serially diluted, and added as template DNA in duplicate. Fluorescent signal acquisition for each fluorophore was performed consecutively during the same reaction. Figure 1 demonstrates the sensitivity and reproducibility achievable with each primer and probe combination. The Polyomavirus BK real-time PCR reaction was able to detect template at concentrations ranging from 109 to 103 genome equivalents per reaction (r2 = 0.99422) while the Polyomavirus JC detection range extended even further from 109 to 10 genome equivalents per reaction (r2 = 0.97822)

Specificity: NCBI BLAST analysis of the primer and probe sequences against the GenBank ‘nr’ database revealed the intended target pathogen as the only identical matches. DNA extracted from 39 human pathogens of viral, bacterial, and fungal origin (Table 1) purchased from ATCC were tested for cross-reactivity and none was detected.

Stability: Serial dilutions of specimens purchased from ATCC were spiked into urine and assayed by the Polyomavirus BK and JC real-time PCR assays to determine a concentration consistent with that

DISCUSSIONTwo viruses associated with renal tract infections are Polyomavirus BK and Polyomavirus JC. Undiagnosed and untreated, infections with these pathogens can cause complicated and serious clinical conditions. Such conditions tend to present in immunocompromised individuals as progressive multifocal leukoencephalopathy, a demyelination disease, or as severe urinary tract infections in renal transplant patients. Laboratory diagnosis is required because clinical presentations can exhibit overlapping symptoms with other infecting pathogens. Identification of the correct infectious pathogen is necessary to devise a proper treatment regimen. Also, sensitive detection techniques are required as low levels of viral infections can be asymptomatic.

This poster describes the development of two real-time PCR assays capable of detecting these pathogens. Real-time PCR holds many significant advances over alternative, more conventional detection technologies, including enhanced sensitivity and specificity. The introduction of these techniques into the clinical laboratory also permits a significant increase in the turn-around time of results. Utilizing the real-time PCR technology proves to be advantageous over cell culture for detection. Detection by conventional tube cell culture is difficult and time consuming because BK virus exhibits slow growth with late (14 to 28 days) and subtle cytopathic effects, while JC virus is reported to replicate solely in primary human fetal glial, SV40 immortalized human fetal glial, and adult human brain cells. Although the hemagglutination (HA) assay has been routinely employed for in vitroquantitation of JC virus, its sensitivity is severely limited. BK virus alternatively utilizes decoy cells as markers of polyomavirus viruria cytology, has a sensitivity of 41.9%, and negative predictive value of 82.8% Pyrosequencing was utilized as a screening test capable of amplifying primer-binding regions and positively identifying the Polyomavirus BK and Polyomavirus JC pathogens by reading DNA sequences within the amplicons.

Although these two reactions were developed, performed and presented as separate assays, real-time PCR is amenable to combinatory assays in which each pathogen could be detected simultaneously. This is accomplished by the chemical attachment of a different fluorophore onto each of the oligonucleotide probes and detecting each consecutively at the conclusion of each amplification cycle. Once optimized, such an assay could provide even more rapid results and also provide quantitative detection of both pathogens simultaneously.

MATERIALS & METHODSPrimers and Probes: Oligonucleotide primers and probes were synthesized by Integrated DNA Technologies (IDT, Coralville, IA). The dual-labeled oligonucleotides were purified by high performance liquid chromatography (HPLC).

Collection and DNA Extraction of Urological Specimens: Clinical specimens were provided by physician offices which send specimens to our laboratory for routine diagnostic testing. Clinical evaluations were not available; no identifiable patient characteristics are presented. Urological specimens were collected in sterile specimen cups. Upon receipt in the laboratory, DNA was extracted using the X-tractor Gene™ (Corbett Robotics, Australia) automated system.

previously identified in clinical specimens. Urine spiked with each virus at this concentration was subsequently absorbed into the UroSwab™ (MDL and Copan Diagnostics). Stability testing was completed over the course of five days whereby the urine was removed from the UroSwab™ and extracted on the X-tractor Gene™ Robot (Corbett Robotics, Australia) automated system. 2.5 µl of eluted DNA from each extraction point was subjected to the Polyomavirus BK and JC real-time PCR assays. Figure 2 demonstrates the stability of each specimen incubated on the UroSwab™ transport system over the five day period.

Analysis: The Pyrosequencing assay was used as an initial screen of DNA extracted from urological specimens to establish a panel of positive samples for each pathogen. The screening was able to identify both Polyomavirus BK and JC samples (Figure 3).

Pathogen Real-Time PCR Analysis: By using the Pyrosequencing results as a standard, sensitivity and specificity scores were calculated for Polyomavirus BK and Polyomavirus JC by the real-time PCR assays (Table 2).

Chlamydia trachomatis Bacteroides fragilis Coxsackie VirusGardnerella vaginalis Mobiluncus curtisii Cryptococcus neoformansNeisserria gonhorrhea Mobiluncus mulieris Babesia microti

Trichomonas vaginalis HTLV-I Bartonella henselaeUreaplasma urealyticum Human Herpesvirus Bartonella bacilliformisHerpes Simplex Virus (HHV) Type 6 Bartonella quintana (HSV) Type 1 Candida albicans Babesia microtiHSV-2 Candida glabrata Trichosporon cutaneumHuman Papillomavirus (HPV) Candida parapsilosis Mycoplasma genitaliumEpstein-Barr Virus (EBV) Candida tropicalis Mycoplasma salivariumCytomegalovirus (CMV) Aspergillus fumigatus Mycoplasma hominisMycoplasma fermentans HHV-8 Chlamydia pneumoniaeMycoplasma pneumoniae Adenovirus Helicobacter pyloriBorrelia burgdorferi Brucella ovis

Table 1: Bacterial, viral, and fungal pathogens for which the specificity of the real-time primers and probes were assessed.

Figure 1: Sensitivity testing of Real-time PCR reactions.Plasmids were created (Polyomavirus BK) or purchased (Polyomavirus JC) for each assay containing the amplicon product. Following quantitation through spectrophotometric analysis, ten-fold serial dilu-tions of each vector were used in duplicate as template DNA. Standard curves, including the r2 value for each amplification reaction, are shown above at right.

Table 2: Specificity and sensitivity for Polyomavirus BK and Polyomavirus JC real-time PCR assays standardized against Pyrosequencing.

Pyrosequencing Positive

Pyrosequencing Negative

Total

PBK RT-PCR Positive 5 (4%) 0 (0%) 5 (4%)

PBK RT-PCR Negative 0 (0%) 115 (96%) 115 (96%)

Total 5 (4%) 115 (96%) 120 (100%)

Variable Value 95% Confidence IntervalSensitivity 100.0% 66.4% to 100.0%

Specificity 100.0% 96.7% to 100.0%

Positive Predictive Value 100.0% 66.4% to 100.0%

Negative Predictive Value 100.0% 96.7% to 100.0%

Pyrosequencing Positive

Pyrosequencing Negative

Total

PJC RT-PCR Positive 9 (8%) 0 (0%) 9 (8%)

PJC RT-PCR Negative 0 (0%) 111 (93%) 111 (93%)

Total 9 (8%) 111 (93%) 120 (100%)

Variable Value 95% Confidence IntervalSensitivity 100.0% 66.4% to 100.0%

Specificity 100.0% 96.7% to 100.0%

Positive Predictive Value 100.0% 66.4% to 100.0%

Negative Predictive Value 100.0% 96.7% to 100.0%

Figure 3. Example Pyrosequencing Results (Pyrograms) for the Polyomavirus BK and JC Pyrosequencing assays.

Polyomavirus JC negative control - No Discernable Sequence

Polyomavirus BK negative control - No Discernable SequencePolyomavirus JC

Polyomavirus BK

Dilution: 109 to 10 genome equivalents/reactionAmplicon Size: 149 bp

Dilution: 109 to 103 genome equivalents/reactionAmplicon Size: 112 bp

Figure 2. Time-course stability of Polyomavirus JC and BK in UroSwab™. The graphical data presented shows the mean (red block) and standard deviation (error bars) of Polyomavirus JC (left) and Polyomavirus BK (right) in genome equivalents/reaction detected for each sample over the period of five days (Days 0, 1, 2, 3, 4 and 5).

Polyomavirus JC Stability Polyomavirus BK Stability

Polyomavirus BK positive control - GGCTGCTGCTGCTATAGAAGTTCAAATTGCA

Polyomavirus JC positive control - AGTTTCAACAGTTGGGCTTTTTCAGCAGCCAGCTATGGCTTTACAATTATTTAAT