RESEARCH ARTICLE

Deterioration of mitochondrial bioenergetics and ultrastructureimpairment in skeletal muscle of a transgenic minipig model in theearly stages of Huntington’s diseaseMarie Rodinova1, Jana Krizova1, Hana Stufkova1, Bozena Bohuslavova2, Georgina Askeland3,Zaneta Dosoudilova1, Stefan Juhas2, Jana Juhasova2, Zdenka Ellederova2, Jiri Zeman1, Lars Eide3,Jan Motlik2 and Hana Hansikova1,*

ABSTRACTSkeletal muscle wasting and atrophy is one of the more severe clinicalimpairments resulting from the progression of Huntington’s disease(HD). Mitochondrial dysfunction may play a significant role in theetiologyof HD, but the specific condition ofmitochondria inmuscle hasnot been widely studied during the development of HD. To determinethe role of mitochondria in skeletal muscle during the early stages ofHD,we analyzed quadriceps femorismuscle from24-, 36-, 48- and66-month-old transgenicminipigs that expressed theN-terminal portion ofmutated human huntingtin protein (TgHD) and age-matched wild-type(WT) siblings. We found altered ultrastructure of TgHD muscle tissueand mitochondria. There was also significant reduction of activity ofcitrate synthase and respiratory chain complexes (RCCs) I, II and IV,decreased quantity of oligomycin-sensitivity conferring protein(OSCP) and the E2 subunit of pyruvate dehydrogenase (PDHE2),and differential expression of optic atrophy 1 protein (OPA1) anddynamin-related protein 1 (DRP1) in the skeletal muscle of TgHDminipigs. Statistical analysis identified several parameters that weredependent only on HD status and could therefore be used as potentialbiomarkers of disease progression. In particular, the reduction ofbiomarker RCCII subunit SDH30 quantity suggests that similarpathogenic mechanisms underlie disease progression in TgHDminipigs and HD patients. The perturbed biochemical phenotypewas detectable in TgHD minipigs prior to the development ofultrastructural changes and locomotor impairment, which becomeevident at the age of 48 months. Mitochondrial disturbances maycontribute to energetic depression in skeletal muscle in HD, which is inconcordance with the mobility problems observed in this model.

This article has an associated First Person interview with the firstauthor of the paper.

KEY WORDS: Huntington’s disease, Mitochondrial function,Ultrastructure, HD large animal model, Disease development,Skeletal muscle, Biomarkers

INTRODUCTIONHuntington’s disease (HD) is neurodegenerative disorder caused bythe expansion of a polyglutamine stretch within the huntingtinprotein (Htt) (Vonsattel and DiFiglia, 1998; Novak and Tabrizi,2010). The disease is caused by an expansion that leads to theinclusion of over 35 CAG repeats in exon 1 of the huntingtin gene(HTT), resulting in the production of mutated Htt protein (mHtt)(Kremer et al., 1994). Ubiquitous mHtt expression not only causeslesions in specific brain areas but also acts in peripheral tissues,including skeletal and cardiac muscle, and blood cells (Carroll et al.,2015; Trottier et al., 1995).

Peripheral pathologies include HD-related skeletal musclemalfunction. HD patients lose weight, despite normal or evenelevated food intake. The weight loss observed in both HD patientsand animal models is associated with increased energy expenditureand global muscle wasting that is independent of locomotor activity(van der Burg et al., 2009). Recent studies have describedprogressive skeletal muscle atrophy that is demonstrated by adecline in mass in all skeletal muscles types in both fast- and slow-progressing mouse models of HD, including R6/2, HdhQ150 andBACHD (Mielcarek et al., 2015; She et al., 2011; Valadão et al.,2017). Recent evidence indicates that muscle wasting in HD mayoccur independently of basal ganglia and cortex dysfunction(Mantovani et al., 2016; van der Burg et al., 2009).

Several studies have reported defects in mitochondrialfunctioning in HD patients and models that were observed notonly in the central nervous system but also in peripheral tissues suchas skeletal muscles (Reddy, 2014; Gizatullina et al., 2006; Heringet al., 2017). The possible role played by mitochondria in thepathogenesis of HD in muscle is supported by findings includingrespiratory chain complex (RCC) IV deficiency (Kosinski et al.,2007), reduced muscle strength (Busse et al., 2008), decreased ATP/phosphocreatine levels (Lodi et al., 2000) and a lower anaerobicthreshold and higher lactate production after exercise (Ciammolaet al., 2011) in HD patients. Furthermore, cultivated myoblastsdemonstrated a higher level of glycolysis and ultrastructuralimpairment of mitochondrial cristae (Ciammola et al., 2011).Patient myoblasts also showed perturbations in the mitochondrialmembrane potential and cytochrome c release and defective celldifferentiation (Ciammola et al., 2006). Unfortunately, the specificroles played by mitochondria and mitochondrial energeticmetabolism in skeletal muscle during the preclinical and earlyclinical stages of HD have not yet been investigated in detail.Received 3 January 2019; Accepted 18 June 2019

1Laboratory for Study of Mitochondrial Disorders, Department of Pediatrics andAdolescent Medicine, First Faculty of Medicine, Charles University and GeneralUniversity Hospital in Prague, 12108 Prague 2, Czech Republic. 2Laboratory of CellRegeneration and Cell Plasticity, Institute of Animal Physiology and Genetics ASCR, 27721 Libechov, Czech Republic. 3Department of Medical Biochemistry,University of Oslo and Oslo University Hospital, 0372 Oslo, Norway.

*Author for correspondence (hana.hansikova@lf1.cuni.cz)

J.K., 0000-0003-1841-7341; B.B., 0000-0002-9415-5139; G.A., 0000-0001-8532-8029; S.J., 0000-0002-2866-0727; J.J., 0000-0001-7022-6812; Z.E., 0000-0001-6695-6345; J.Z., 0000-0002-2678-7919; L.E., 0000-0003-3948-5183; H.H.,0000-0002-2734-225X

This is an Open Access article distributed under the terms of the Creative Commons AttributionLicense (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use,distribution and reproduction in any medium provided that the original work is properly attributed.

1

© 2019. Published by The Company of Biologists Ltd | Disease Models & Mechanisms (2019) 12, dmm038737. doi:10.1242/dmm.038737

Disea

seModels&Mechan

isms

The objective of this study was to monitor mitochondrial functionin skeletal muscle during the development of HD. To achieve ourgoal, we used transgenic minipigs that contain the N-terminalportion of mutated human huntingtin protein (TgHD) (Baxa et al.,2013), which represent a large animal model of HD that shows aslow progression of HD (Askeland et al., 2018b; Vidinská et al.,2018) and is thus an appropriate representation of the human HDpatient. We examined the mitochondria within the skeletal muscleof the TgHD minipigs in terms of ultrastructure, function andprotein characteristics at ages between 24 and 66 months duringdisease progression.

RESULTSFresh muscle samples collected under standard conditions at theages of 24, 36, 48 and 66 months were used. All analyses inindividual animals were performed using the same muscle sample,which allowed us to correlate all of the parameters with oneanother.

Presence of mHtt in skeletal muscle of the HD modelFirst, we monitored the occurrence of mHtt in skeletal musclesamples from the TgHD animals. mHtt was found in TgHDmusclesat all ages examined (Fig. S1). This finding suggests a possibleinteraction between mHtt and mitochondria in the TgHD minipigmuscle at all ages. The anti-huntingtin antibody EPR5526 revealedthe presence of mHtt (115-117 kDa) in TgHD samples andendogenous Htt (346 kDa) in all samples. High levels of mHtt(115-117 kDa) and fragmented mHtt (60-70 kDa) were detectedusing the anti-poly Q 1C2 antibody.

Body weight and correlation with selected biochemicalparametersThe body weight (BW) of the animals, which is an important factorthat is correlated with muscle atrophy and cachexia in HD, wasrecorded on the day of the sample collection. There were nosignificant differences in the BW between the TgHD and WTanimals or between animals of either sex at the ages of24-66 months (Fig. S2; sex not shown). However, BW wasshown to be correlated with selected mitochondrial parametersrelated to HD (Fig. S5). In particular, complex II (CII)- and complexIV (CIV)-dependent respirations were significantly correlated withBW (P=0.0003 and P=0.0026, respectively) and differed in theTgHD and WT animals (Table S1, Fig. S5A,B). The subunits ofRCCV, F1a and OSCP, correlated significantly with BW(P=0.0248, P=0.0386, respectively) and the curves reflecting thiscorrelation had different slopes (P=0.0061, P=0.0176) for eachgroup (Fig. S5C,D; Table S1F). The correlation of SDH30 (subunitof RCCII) and nDNA damage with BW differed in the TgHD andWT groups (P=0.0401; P=0.0421; Fig. S5E,F).

Skeletal muscle in TgHD minipigs showed ultrastructuralabnormalitiesUltrastructural abnormalities have been found in the mitochondriaof the biceps brachii muscle in HD patients (Ciammola et al.,2006). Therefore, we investigated mitochondrial ultrastructure inminipig muscle samples using electron microscopy analyses,which revealed significant accumulation of glycogen granules andgreater mitochondrial density in the muscles of TgHD minipigs(Fig. 1A). We also observed an aberrant organization of myofibrilsin muscles at the age of 48 months (Fig. 1B). Similar observationswere made in minipig muscles at the age of 66 months (datanot shown).

Fig. 1. Ultrastructure of skeletal muscle from 48-month-old WT and TgHDminipigs analyzed using transmission electron microscopy. (A)Accumulation of glycogen, mitochondrial density and myofibril arrangement inWT and TgHD muscle. Glycogen is indicated in TgHD muscle with an asterisk(top). (B) Higher mitochondrial density and local disruption of hexagonalorganization of myofibrils is observed in TgHD animals (red boxes). Theamount of actin is also increased (yellow box); M, mitochondrion. The selectedpair represents the results of the entire group. TgHD, transgenic; WT, wild type;K209, L93, animal identification numbers.

2

RESEARCH ARTICLE Disease Models & Mechanisms (2019) 12, dmm038737. doi:10.1242/dmm.038737

Disea

seModels&Mechan

isms

Reduced function of the respiratory chain and Krebs cyclewas observed in skeletal muscle of TgHD minipigsTo assess the impact of polyQ on mitochondrial function, we applieda broad methodological approach to the observations of mitochondriain fresh skeletal muscle from TgHD minipigs. First, the activity ofthe RCCI (NADH:ubiquinone oxidoreductase, NQR), RCCII(succinate:CoQ reductase, SQR), RCCIII (ubiquinol:cytochrome coxidoreductase, QCCR), RCCIV (cytochrome c oxidase, COX),RCCI+III (NADH:cytochrome c reductase, NCCR) and RCCII+III(succinate:cytochrome c reductase, SCCR) as well as citrate synthase(CS) were determined spectrophotometrically in mitochondriaisolated from fresh tissue. Statistical analysis showed that fouractivity parameters significantly depended upon HD status but not onage or sex. The COX, CS, NCCR and SQR/CS ratio are shown inTable S1A and in Fig. 2A,D, Fig. 3A and Fig. 4A, respectively. Thevalues of the first three activities were lower in the TgHD animalsthan in theWT animals. The slopes of the curves show similar trends,and no breakthroughwas observed at the various ages. No differenceswere found between the sexes.

We next analyzed mitochondrial respiration using high-resolutionrespirometry (Table S1B). The analysis of respiration based on thereduction of oxygen by RCCIV can reveal which oxidativephosphorylation (OXPHOS) complex has altered activity.Substrates that result in the formation of NADH (nicotinamideadenine dinucleotide, reduced), which is oxidized by RCCI orFADH2 (flavin adenine dinucleotide, reduced), which is oxidized byRCCII, were used. Because OXPHOS is highly coupled, a defect inany of the OXPHOS complexes, as well as impaired transport ofmetabolites and/or dysfunction of the NADH/FADH2

oxidoreductases inside the mitochondrial matrix, will result indecreased respiration. Respiration was assessed in isolatedmitochondria in 5 different states; hence, respiration wascharacterized using several specific respiratory ratios (Table S1B).Correlation analyses of 11 respiration parameters showed that 5 ofthese parameters, GM (glutamate+malate, P=0.0321), CII(P=0.0008), CIV (P=0.0003), CIVu (CIV uncoupled maximalrespiration with ascorbate and TMPD as electron carriers andFCCP uncoupler; P=0.0005) and the CI/IV ratio (P=0.0164), were

Fig. 2. Time course of respiratory chain complex IV and citrate synthase functional impairment in TgHD minipig skeletal muscle during thedevelopment of HD. (A) Specific activity of the respiratory chain complex IV (COX) is significantly reduced in TgHD animals in comparison with WT animals(P=0.0271). (B) Complex IV (CIV)-dependent respiration was significantly decreased in TgHD animals (P=0.0003). (C) The ratio of respiratory parametersCI/CIV is significantly increased in the TgHD group, which may indicate reduced functionality of RCCIV in TgHD animals (P=0.0164). (D) The activity of citratesynthase is significantly reduced in TgHD animals (P=0.0171). Analyses were performed with samples collected at the ages of 24, 36, 48 and 66 months. In thebox-whisker plots, median and quartiles are displayed. Circles represent outliers that are further than 1.5IQR from the corresponding quartile. Whiskers show therange of non-outliers. Boxes represent the TgHD andWT groups that consist of all animals in all ages between 24 and 66 months; numbers of analyzed samplesare indicated. Enzyme activities were measured spectrophotometrically and respiration was measured by high-resolution respirometry using an OROBOROSoxygraph.

3

RESEARCH ARTICLE Disease Models & Mechanisms (2019) 12, dmm038737. doi:10.1242/dmm.038737

Disea

seModels&Mechan

isms

significantly dependent only on HD status but not on age or sex(Table S1B and Fig. 3B, Fig. 4B, Fig. 2B,C).Finally, we measured the mitochondrial energy-generating system

capacity (MEGS). The determination of MEGS is a method used forcomplex functional analyses of mitochondrial energetics, and it wasused to analyze 10 different incubations. These incubations wereanalyzed in terms of incubation per CS activity ratios (normalizedrates), or as ratios between certain incubations according to themethod used by Janssen (Janssen et al., 2006). A total of 27 MEGSparameters were statistically analyzed; 5 parameters were found to besignificantly correlated with sex and 12 parameters were significantlycorrelated with age (Table S1E). Although a correlation between theMEGS parameters and HD status was not found, the ratio of reactions(incubations) 1/3 and 2/1 showed different trends when compared interms of TgHD andWT (Fig. S3A,B). Incubation 3 was performed todetermine the ADP (adenine dinucleotide phosphate) stimulationfactor (ratio of incubation 1 to incubation 3), which reflects thecoupling state of oxidation and phosphorylation in mitochondria. Itappears that the coupling of mitochondria is decreased in TgHD(Fig. S3B). Ratio 2/1 in TgHD reflected steeper growth duringdevelopment compared with WT. In the case of OXPHOS or ANT(adenine nucleotide translocator) deficiency, the oxidation rate inincubation 2 would show a smaller decrease than in incubation 1,which would result in an increased incubation 2 to incubation 1 ratio;therefore, a higher 2/1 ratio would indicate decreased functioning ofOXPHOS or ANT in TgHD (Fig. S3A).We quantified the total level of coenzyme Q10, since it is an

important participant in the respiratory chain. However, the totalcoenzyme Q10 content was similar between animals in the TgHDandWT groups, and no significant correlations with age or sex wereobserved (data not shown).

TgHD minipig skeletal muscle showed changes inexpression of selected mitochondrial proteinsTo investigate whether decreased mitochondrial function in TgHDminipig muscle is associated with changes in protein expression,we performed extensive immunoelectrophoretic analyses. Themitochondrial fraction was resolved using blue-native PAGE,which allows the visualization of native, intact OXPHOS

complexes. Our analysis showed that the amount of mitochondrialproteins was generally reduced in TgHD samples compared withWT samples. Representative results at the age of 48 months areshown in Fig. 5A.

Next, selected OXPHOS and PDHc (pyruvate dehydrogenasecomplex) subunits were resolved using SDS-PAGE and thensubjected to immunoblotting; signals for 17 selected proteins foreach age group were statistically analyzed. Three proteins werefound to be significantly dependent only on HD status: SDH30(subunit of RCCII, SDHB, Ip), OSCP (oligomycin-sensitivityconferring protein, subunit of RCCV) and PDHE2 (subunit E2 ofPDHc) (Table S1D). The SDH30 subunit content in the RCCII wassignificantly lower in the TgHD group (P=0.0132) than in the WTgroup, but the correlation between the protein content and HD wassimilar for both groups (Fig. 4D) at the observed ages. The amountof the OSCP subunit of RCCV was significantly lower (P=0.0357)in the TgHD group but showed a similar trend upon comparisonwith the WT group (Fig. 5B).

PDHE2 was significantly decreased in the TgHD group(P=0.0460) in comparison with the WT group and showed adecreased trend in comparison with the WT group (Fig. S6). Asignificant dependence on age for NDUFA9 (subunit of RCCI;P<0.001) and OPA1 (optic atrophy protein 1; P<0.001) was detected(Table S1D). Membrane proteins OPA1 and DRP1 (dynamin-relatedprotein 1) showed interesting trends during development. WhereasOPA1 tended to reducewith age in TgHD (Fig. 6A), DRP1 increasedwith age in TgHD animals in comparison to WT animals (Fig. 6B).

DNA integrity is not affected in TgHDminipig skeletalmuscleWe analyzed nDNA (nuclear DNA) and mtDNA (mitochondrialDNA) damage and copy number in identical sets of muscle samplesfrom animals aged 24-66 months. No significant differences betweenthe DNA parameters were found in the TgHD and WT animals.However, nDNA damage in skeletal muscle was positively correlatedwith age (Table S1C, Fig. S4A) and mtDNA damage (P<0.001;Fig. S4C). The mtDNA copy number was significantly higher infemales compared with males (P=0.02; Fig. S4E, Fig. 4F). The lack ofany oxidative DNA damage was reflected by the fact that the levels ofcoenzyme Q10, which is an important antioxidant, were unaffected.

Fig. 3. Decreased function of respiratory chain complex I in TgHD minipig skeletal muscle during the development of HD. (A) Activity of complex I+III(NCCR, NADH:cytochrome c reductase) is significantly decreased (P=0.0249) in TgHD muscle. (B) Complex I-dependent respiration (GM) is significantlydecreased in TgHD animals (P=0.0321). Analyses were performed with samples collected at the ages of 24, 36, 48 and 66 months. In the box-whisker plots,median and quartiles are displayed. Circles represent outliers that are further than 1.5IQR from the corresponding quartile. Whiskers show the range ofnon-outliers. Boxes represent the TgHD and WT groups that consist of all animals in all ages between 24 and 66 months; numbers of analyzed samples areindicated. Enzyme activities were measured spectrophotometrically and respiration wasmeasured by high-resolution respirometry on anOROBOROS oxygraph.

4

RESEARCH ARTICLE Disease Models & Mechanisms (2019) 12, dmm038737. doi:10.1242/dmm.038737

Disea

seModels&Mechan

isms

DISCUSSIONThe large animal model is suitable for extensiveinvestigations on skeletal muscleSkeletal muscle wasting and atrophy are severe clinical impairmentsthat are connected with the progression of HD (Zielonka et al.,2014). The existence of a large animal TgHD model allowed us toobtain sufficient tissue for our study, which is unavailable frompatients owing to ethical issues. The TgHD minipig model has aslow disease progression, which is similar to that in humans.Therefore, we performed a longitudinal study focused on themitochondrial energy metabolism in muscle, utilizing a battery offunctional, ultrastructural and immunoelectrophoretic methods in aminipig TgHD model. Although we demonstrated the presence ofmHtt and fragments of mHtt in muscle at all ages (Fig. S1), theanimals exhibited significant locomotor functional decline from

48 months of age (Askeland et al., 2018b). Profound walkingdifficulties were clearly demonstrated starting from the age of66 months (see Movie 1 at the age of 72 months and Fig. 7).

Ultrastructural changes in minipig skeletal muscle aresimilar to those in HD patientsFirst, we analyzed the ultrastructure within the skeletal musclesamples using electron microscopy.We observed the accumulationof glycogen granules (Fig. 1) in animals that were 48 months ofage and older. This age of onset is in line with the results of aprevious study that identified locomotor aberrations in transgenicminipigs at 48 months (Askeland et al., 2018a). Increasedglycogen production and storage was shown in isolated humanskeletal muscle cells after prolonged lactate exposure (Lund et al.,2018) and elevated lactate production has also been described

Fig. 4. The time course impairment of function and protein expression for complex II in TgHD minipig skeletal muscle. (A) Ratio of complex II tocitrate synthase activity (SQR/CS parameter) is significantly increased in TgHD animals compared with WT animals (P=0.125). (B) Complex II-dependentrespiration is significantly decreased in TgHD animals (P=0.0008). (C) Rate of oxidation of [1,4-14C]succinate in TgHD animals shows an increasing trend and adifferent slope in comparison to WT animals, which may indicate the need for increased turnover for RCCII. (D) Expression of subunit SDH30 of RCCII issignificantly lower in TgHD animals than in WT animals (P=0.0132). Reduced protein content was observed for all age categories. (E) In contrast, the SDH70subunit of RCCII shows a rising trend, but the groups did not differ significantly. Intensity in panels D and E represents the signal of proteins analyzed bywestern blot and quantified using the Quantity One 1-D Analysis Software (Bio-Rad). In the box-whisker plots, median and quartiles are displayed. Circlesrepresent outliers that are further than 1.5IQR from the corresponding quartile. Whiskers show the range of non-outliers. Boxes represent the TgHD andWT groups that consist of all animals in all ages between 24 and 66 months; numbers of analyzed samples are indicated. (F) Representative WB analysis ofsubunits SDH30 and SDH70 at the age of 66 months. The respective protein pairs from the same blot are indicated with a bracket. Analyses were conductedfor samples collected at the ages of 24, 36, 48 and from 66 months. (G) Quantification of the normalized western blot signal from 5 TgHD and 5 WT muscles(shown in panel F) using Quantity One 1-D Analysis Software (Bio-Rad). Enzyme activities were measured spectrophotometrically, respiration was measured byhigh-resolution respirometry on an OROBOROS oxygraph and the protein content was analyzed using specific antibodies (Abcam) for western blotting.

5

RESEARCH ARTICLE Disease Models & Mechanisms (2019) 12, dmm038737. doi:10.1242/dmm.038737

Disea

seModels&Mechan

isms

previously in myoblasts of HD patients (Ciammola et al., 2011).The expected increased concentrations of lactate in skeletal musclein our TgHD model is in accordance with a demonstratedimpairment of OXPHOS and PDH. We can also speculate thatchanges in the proportion of fiber types in TgHD and their abilityto oxidize lactate in the context of their maximal pyruvateoxidative capacity may have an impact on the conversion of lactateto glycogen (Baldwin et al., 1978).In parallel, we observed differences in the density of

mitochondria in TgHD animals. Ultrastructural changes inmitochondria have also been described in the myoblasts ofHD patients by Squitieri et al. (2010). These authors foundrearrangement of the internal structures of mitochondria inmyoblasts that consisted mostly of pure matrix loss. Myoblastsfrom a heterozygous HD patient with partially altered

mitochondria showed dilated and spaced-out crests, andmitochondria in myoblasts from a homozygous patient displayeddisruption of crests and loss of matrix content (Squitieri et al.,2010). In cross-section, normal myofibrils should create regularhexagons in muscle tissue; however, in TgHD animals, weobserved disorganization of the myofibrils (Fig. 1B) and numerousimpaired foci. Furthermore, it appears that the number of actinunits increased. An actin rod stress response that resulted in actinremodeling has been previously described in connection with HD(Munsie et al., 2011).

Respiratory chain complexes are significantly connectedwith HDWe focused on the oxidative phosphorylation system, where asignificant impairment of the RCCI, RCCII and RCCIV was

Fig. 5. Impairment of OXPHOS protein content in TgHD minipig skeletal muscle. (A) Blue-native PAGE analysis of isolated skeletal muscle mitochondriafrom TgHD minipigs and WT controls; representative analysis at the age of 48 months is shown. Decreased amounts of RCCI, V, III and IV was found in TgHDmuscle. Positions of the respiratory chain complexes are indicated on the left. (B) Decreased levels of OSCP in TgHD animals compared with WT animals(P=0.0176). Intensity in panel B represents the signal of proteins analyzed by western blot and quantified using the Quantity One 1-D Analysis Software(Bio-Rad). In the box-whisker plots, median and quartiles are displayed. Circles represent outliers that are further than 1.5IQR from the corresponding quartile.Whiskers show the range of non-outliers. Boxes represent the TgHD and WT groups that consist of all animals in all ages between 24 and 66 months; numbersof analyzed samples are indicated. (C) Representative western blot analysis of the OSCP and F1a subunits of RCCV at the age of 66 months; the respectiveprotein pairs from the same blot are indicated with a bracket. (D) Quantification of normalized western blot signal from 5 TgHD and 5 WT muscles (shown inpanel C) using Quantity One 1-D Analysis Software (Bio-Rad).

6

RESEARCH ARTICLE Disease Models & Mechanisms (2019) 12, dmm038737. doi:10.1242/dmm.038737

Disea

seModels&Mechan

isms

detected. The functional impairment of RCCIV in the TgHDminipig muscle was confirmed using several approaches (Fig. 2),which found three functional parameters for RCCIV assignificant indicators for HD that could be considered asbiomarkers. Decreased RCCIV activity has been previouslyobserved in the R6/2 striatum and frontal cortex (Tabrizi et al.,2000), in R6/2 skeletal muscle in 14- to 16-week-old mice(Gizatullina et al., 2006) and in a muscle biopsy obtained from apatient many years before they developed chorea (Kosinski et al.,2007). Likewise, we confirmed the functional impairment of theRCCI in TgHD muscle (Fig. 3). The increased CI/CIV ratio(Fig. 2C) in TgHD could indicate that RCCI is less affectedthan RCCIV is in TgHD. Variable defects in RCCI resulting in a25-63% reduction in activity when compared with control valueshave already been described in the muscles of HD patients(Arenas et al., 1998). RCCI activity was also affected in the

cerebral cortex in a 3-nitropropionic acid-induced rat model ofHD (Pandey et al., 2008). In contrast, a previous study of musclebiopsies from 7 pre-symptomatic patients did not show anydisturbances in their respiratory parameters (Buck et al., 2017).We speculate that a defect in RCCI in skeletal muscle could bedetected in parallel with the onset of functional and structuralmuscle cell impairment.

Krebs cycle members play an important role in HDdevelopmentThe most striking impact of HD was detected in RCCII (mainlydecreased levels of subunit SDH30), which functions as part of boththe respiratory chain and the Krebs cycle. Importantly, thisparticular subunit has also been identified as an HD biomarker inperipheral blood mononuclear cells (PBMCs) from HD patients thatfunctions independently of age (Askeland et al., 2018a), which

Fig. 6. Differential expression of selected mitochondrial membrane proteins in TgHD minipig skeletal muscle during aging. (A) OPA1 expressionshowed a decreasing trend with age in TgHD animals compared with WT animals. (B) DRP1 expression showed an increasing trend in TgHD animalscompared with WT animals. Western blot analyses were conducted for samples collected at the ages of 24, 36, 48 and 66 months. Intensity in panels A and Brepresents the signal of proteins analyzed by western blot and quantified using the Quantity One 1-D Analysis Software (Bio-Rad). (C) Representativewestern blot analyses of OPA1, DRP1 and CORE2 at the age of 66 months; the respective protein pairs from the same blot are indicated with a bracket.(D) Quantification of the normalized western blot signal from 5 TgHD and 5WTmuscles (shown in panel C) using Quantity One 1-D Analysis Software (Bio-Rad).

7

RESEARCH ARTICLE Disease Models & Mechanisms (2019) 12, dmm038737. doi:10.1242/dmm.038737

Disea

seModels&Mechan

isms

supports the conclusion that similar pathogenic mechanismsunderlie disease progression in the TgHD minipigs and HDpatients. In the spermatozoa of TgHD minipigs, we alreadyshowed that the SDH30 subunit decreases to 80% at the age of47 months (Krizova et al., 2017). RCCII subunits are specificallydecreased in the striatum of HD patients, and in Htt 171-82Q striatalneurons (Benchoua et al., 2006). RCCII subunits contain Fe-Scenters that represent a specific target for superoxides. It can bepredicted that damage of RCCII subunits will be observed in anumber of conditions that result from oxidative stress (Rustin et al.,2002), including HD, similarly to Friedreich’s ataxia (Rötig et al.,1997). Defects in the RCCII subunits would tend to reduce Krebscycle activity and, consequently, mitochondrial ATP synthesis(Rustin et al., 2002).In addition to impairment of RCCII functioning and protein

expression, a significant decrease of the citrate synthase(CS) activity in TgHD muscle was revealed (Fig. 2D). Thesignificantly elevated activity ratio of RCCII to CS (SQR/CSparameter) found in TgHD (Fig. 4A) may imply that CSactivity is even more strongly affected than RCCII activity.CS activity is a major regulatory step that controls flux throughoutthe Krebs cycle (Tyler, 1992). We can assume that both RCCIIand CS impairment contribute greatly to decreased functioningof the Krebs cycle and that other Krebs cycle enzymes willlikely be affected because of the interconnectivity of individualKrebs cycle reactions. Decreased activity of CS in ‘peripheral’tissue has already been observed in isolated lymphocytes from HDpatients (Askeland et al., 2018a), as well as in isolated thrombocytes(Silva et al., 2013).

The mitochondrial permeability transition pore may play arole in the pathogenesis of HDAnalyses of selected membrane proteins showed that the level ofoligomycin-sensitivity conferring protein (OSCP) was significantlydecreased in TgHD (Fig. 5B). This parameter was dependent onlyon HD status and not on age or sex (Table S1D). OSCP is a subunitof the F1F0-ATP synthase (in RCCV). OSCP likely plays afundamental role in permeability transition pore (PTP) formationand acts as a sensor for signal(s) that may induce cell death(Antoniel et al., 2014). Mitochondrial PTP (mPTP) inducesmitochondrial injury in HD (Quintanilla et al., 2013). Dataregarding the possible role of OSCP in neurodegeneration areinsufficient, but we can assume the underlying mechanisms basedon the mPTP control. Specific decreases in the levels of OSCP in thebrain during the progression of Alzheimer’s disease (AD) have beendescribed in patients and an in ADmouse model (Beck et al., 2016).OSCP loss and its interplay with amyloid beta disrupts F1F0-ATPsynthase, which leads to reduced ATP production, elevatedoxidative stress and activated mPTP (Beck et al., 2016). Moreexperiments should be conducted to evaluate the possibleparticipation of OSCP in HD.

Impaired fusion/fission apparatus in TgHD muscle maycontribute to ultrastructural changes in mitochondriaTwo other proteins, OPA1 and DRP1 (which are both important forthe structure and function of mitochondria), showed different trendsin protein expression during the development of disease in the TgHDanimals (Fig. 6). OPA1 is a protein in the inner mitochondrialmembrane that is responsible for maintenance of mitochondrial

Fig. 7. Time-chart of HD phenotype development in TgHD minipig model. Results from present publication are colored in black; previously published(or unpublished) data are indicted in gray. Displayed biochemical mitochondrial parameters are dependent exclusively on HD disease (except proteins markedby #) and not on age or gender, so we propose these as biomarkers of HD development. 1Baxa et al., 2013; 2Macakova et al., 2016; 3Krizova et al., 2017;4Vidinska et al., 2018; 5Data described in present publication; 6Askeland et al., 2018b; 7See Movie 1; 8Taras Ardan, Z.E. et al., Institute of Animal Physiology andGenetics AS CR, Czech Republic, unpublished data. Enzymatic activity: COX, cytochrome c oxidase (RCCIV); CS, citrate synthase; NCCR, NADH-cytochrome coxidase (RCCI-III); SQR/CS, ratio of succinate dehydrogenase (RCCII) to citrate synthase activity. Respiration parameters: GM, glutamate-malate (RCCI-dependent respiration); CII, RCCII-dependent respiration; CIV, RCCIV-dependent respiration; CI/CIV, ratio of RCCI- to RCCIV-dependent respiration. Proteins:SDH30, subunit of complex II; OSCP, oligomycin-sensitivity conferring protein subunit of ATPase (RCCV); OPA1, optic atrophy 1 protein; DRP1, dynamin-relatedprotein 1.

8

RESEARCH ARTICLE Disease Models & Mechanisms (2019) 12, dmm038737. doi:10.1242/dmm.038737

Disea

seModels&Mechan

isms

ultrastructure. Fusion of the mitochondrial inner membrane isregulated mainly by OPA1. In addition, OPA1 is crucial for cristaestability (Antoniel et al., 2014). DRP1 is a cytosolic GTPase thatregulates mitochondrial fission, which is important for mitochondrialrenewal, proliferation and redistribution (Hu et al., 2017). Excessivemitochondrial fission causes mitochondrial fragmentation, whichleads to permeabilization of the outer mitochondrial membrane, ATPdepletion, increase in ROS and release of apoptotic factors (Gao et al.,2017). OPA1 levels were decreased in TgHD minipig musclecomparedwith levels inWTminipigmuscle during the progression ofthe disease (Fig. 6A). Our observation is supported by results found inR6/2mice brains,wheremHtt reduced the expression ofOpa1mRNAand promoted OPA1 cleavage (Hering et al., 2017). Conversely,DRP1 levels showed an increase in TgHD minipig muscle as ageincreased (Fig. 6B). Overactivation of DRP1 has been shown to leadto mitochondrial dysfunction and neurodegeneration (Roe and Qi,2018; Cherubini and Ginés, 2017) and muscle atrophy (Romanelloet al., 2010) similar to that seen in HD. Therefore, we suggest that ourfinding of impaired fusion/fission machinery in TgHD muscle maycontribute to ultrastructural changes in mitochondria.

No changes in mtDNA of TgHD skeletal muscleMany studies have observed changes in mtDNA resulting from HD,including decreased copy numbers and the presence of mtDNAdeletions in brain tissue and leukocytes (Liu et al., 2008; Petersenet al., 2014; Banoei et al., 2007; Horton et al., 1995) in patients. In theskeletal muscle of our TgHD model, mtDNA damage was notelevated, and the mtDNA copy numbers did not differ between TgHDandWTanimals. This is in concordancewith our findings of impairedexpression of proteins coded by nuclear DNA, rather than thoseencoded by mtDNA.

Loss of body weight is not the first phenotypicmanifestationin transgenic minipig modelAlthough at the age of 24-66 months we did not observe any decreasein body weight, which is typical of HD, we could argue that musclemass loss will occur at an older age. This is suggested by unpublishedresults showing that there was a significant decrease in the animalbody mass index (ABMI) in TgHD minipigs by the ages of 6 and7 years (Taras Ardan, Z.E. et al., Institute of Animal Physiology andGenetics AS CR, Czech Republic, unpublished data). The ABMI is amore precise measured parameter in large animal models than BW,taking into account dimensions of the animal’s body (Fig. 7).

Various biochemical pathways are involved concurrently inHD pathology and developmentOur 5-year study showed altered ultrastructure in TgHD muscletissue and mitochondria, as well as significant impairment of theOXPHOS system, the Krebs cycle and the mitochondrial stabilizingmembrane system (OPA1 and DRP1) in skeletal muscle of theTgHD minipig model. Owing to the close interconnection betweenOXPHOS and Krebs cycle, it is not clear which defect occurs first:(1) RCCII (SDH30), which results in inhibition of the Krebs cycleand ultimately the respiratory chain, or (2) decreased OXPHOSfunctioning, which inhibits the Krebs cycle because ofdisproportion in reduction equivalents or oxidative stress.Alternatively, it could be that these systems are inhibited inparallel as a result of imbalances in Ca2+, as previously described inHD (Panov et al., 2002). In either case, these biochemical changesprecede the development of visible clinical symptoms related tomuscle in TgHD minipig, when a clear correlation between the ageof onset of ultrastructural changes and locomotor problems was

observed. Throughout the observed period from 24 to 66 months,we did identify changes in the mitochondrial capacity to produceenergy and consequent decreases in muscle functionality occurringat the age of 48 months, which was in concordance with thelocomotor decline observed in the minipig model (Askeland et al.,2018b). Our study has revealed several new aspects of themechanisms underlying HD development, such as the role ofOSCP, which will be explored in our future studies.

TgHD minipig skeletal muscle simulates the development ofHD and is suitable for therapy testing focused on humanmedicineThe TgHD minipig represents a large animal model with a slowprogression of HD (Askeland et al., 2018b; Vidinská et al., 2018)and thus is an appropriate representation of human HD. Anadditional value of our investigation was that our results wereobtained at the end of the first third period in the minipig’s lifetime(a lifetime expectancy for the TgHD minipig is 15 years), whichroughly corresponds to the onset of disease in humans. We haveshown that the TgHD minipig model in many mitochondrialparameters mimics the manifestations and known changesdescribed in the muscle of HD patients (e.g. ultrastructuralchanges, biochemical changes of RCCI, RCCII and RCCIV, andenzymes of the Krebs cycle), which suggest that similarmechanisms underlie disease progression in this model and HDpatients. In TgHD skeletal muscle, we have identified severalparameters exclusively related to HD that could be used asbiomarkers to track disease progression while seeking treatmentand testing drugs to help improve the quality of life of HD patientswith muscle symptoms, or, even better, to prevent the onset ofirreversible changes in skeletal muscle. Our study has also indicatedpossible therapeutic targets such as mPTP. We assume that all ofthese data will also be beneficial to other novel large animal modelswith relevance to human medicine.

MATERIALS AND METHODSAnimalsWe used transgenic minipigs that have one copy of the human HTTtransgene, which encodes the human HD promoter and the first 548 aa,including 124 glutamines (CAG/CAA), that is integrated into chromosome1 q24-q25 (Baxa et al., 2013). Muscle samples were obtained fromminipigsfrom two generations (F1, F2) at the ages of 24, 36, 48 months and66 months [total n=51; 27 TgHD (13 female, 14 male), 24WT (9 female, 15male)]; at each age, there was a minimum of 6 TgHD and 6 WT minipigs.For each experiment, the obtained TgHD samples were paired with thosefrom the WT siblings, which were used as the paired age-related controls.The body weight of each minipig was recorded on the day of samplecollection. The animals were placed under deep anesthesia and perfusedwith cold PBS. Fresh muscle samples from the quadriceps femoris werecollected and stored at 4°C. Subsequent isolation of the mitochondria wasperformed within 2 h of sample collection (see below). All investigationsconducted on each individual were performed using the same sample. Allexperiments in this study were carried out in accordance with the AnimalCare and Use Committee of the Institute of Animal Physiology and Geneticsand were conducted according to current Czech regulations and guidelinesfor animal welfare with the approval of the State Veterinary Administrationof the Czech Republic.

Homogenization and isolation of the mitochondrial fractionA 5% homogenate (w/v) was prepared from the fresh tissue in KTEAmedium containing 150 mM KCl, 50 mM Tris-HCl, 2 mM EDTA, pH 7.4and 0.2 µg/ml aprotinin at 4°C using a Ultra-Turrax (IKA, Germany) andsubsequently, a Potter–Elvehjem homogenizer (Bellco glass, Inc., USA).The postnuclear supernatant (PNS) was isolated from the homogenate

9

RESEARCH ARTICLE Disease Models & Mechanisms (2019) 12, dmm038737. doi:10.1242/dmm.038737

Disea

seModels&Mechan

isms

by centrifugation at 600 g for 10 min at 4°C. The PNS was filtered througha nylon mesh. An aliquot of the fresh PNS was used for MEGS(mitochondrial energy-generating system capacity) analyses. Themitochondria were sedimented by centrifugation of the residual PNS at10,000 g for 10 min at 4°C. The pellets were washed with KTEA medium,centrifuged again in the same conditions, and finally resuspended in KTEAat a protein concentration of approximately 20 mg/ml. Fresh aliquots of theisolated mitochondria were used for the enzyme activity determination andrespirometry. The remaining aliquots were stored at −80°C and used forsubsequent western blot (WB) analyses.

Protein concentrationUnless otherwise indicated, the total protein concentration was determinedaccording to the Lowry method (Lowry et al., 1951) for all analyses.

RespirometryOxygen consumption in the isolated mitochondria was measured at 37°Cusing an OROBOROS Oxygraph-2k (OROBOROS Instruments Corp.,Innsbruck, Austria) in a 2 ml chamber containing respiration medium forisolated mitochondria (pH 7.1; 0.5 mM EGTA, 3 mM MgCl2, 60 mMK-lactobionate, 20 mM taurine, 10 mMKH2PO4, 20 mMHEPES, 110 mMsucrose and 1 g/l BSA) (Kuznetsov et al., 2008). The protocol used multiplesubstrates and inhibitors, including 10 mM glutamate, 2.5 mM malate,2.5 mMADP+Mg2+, 0.5 µM rotenone, 10 mM succinate, 1 µM antimycin A,4 mM ascorbate and 0.4 mM TMPD (N,N,N′,N′-tetramethyl-1,4-phenylenediamine) and was conducted as previously described (Kuznetsovet al., 2008). Respiration was uncoupled via titration using 200 nM stepsto a maximum concentration of 1.5 μM FCCP [carbonyl cyanidep-(trifluoromethoxy) phenylhydrazone] and finally inhibited by the additionof 10 mM sodium azide. The mitochondria were verified to be intact bythe addition of 2.5 µM cytochrome c after ADP+Mg2+ addition. Theconsumption of oxygen was expressed as pmol of O2 per second and wasnormalized based on the protein concentration in the chamber (pmol O2/s/mgprotein). Approximately 0.05-0.1 mg protein was used for eachmeasurement.

Measurement of the mitochondrial energy-generating system(MEGS) capacityThe MEGS capacity in fresh postnuclear supernatant was determined bymeasuring the oxidation rates of [1-14C]pyruvate, [U-14C]malate or[1,4-14C]succinate in the presence of various donors and acceptors ofacetylcoenzyme A (AcCoA) and various inhibitors of the oxidativephosphorylation system (OXPHOS) and the Krebs cycle according to themethod used by Janssen (Janssen et al., 2006) using ten differentincubations (Table S1E). For each reaction, 5 μl of PNS with a proteinconcentration of 4–8 mg/ml was used. The 14CO2 production was measuredin a Beckman Coulter LS (Brea, CA, USA). The rate of each individualreaction was normalized according to both the protein concentration and theCS activity. The incubation ratios were compared to evaluate the OXPHOSactivity and the functioning of the Krebs cycle and PDHc. The oxidationrates were expressed as nmol CO2 per minute and were normalized to theprotein concentration in the reaction (nmol CO2/min.mg protein).

Blue native polyacrylamide gel electrophoresis (BN-PAGE)BN-PAGE (Schägger and von Jagow, 1991) was used for separation of themitochondrial membrane protein complexes using 6-15% polyacrylamide(w/v) gradient gels with a Mini Protean® 3 System (Bio-Rad Laboratories).Mitoplasts or mitochondria were solubilized in DDM (n-dodecyl β-D-maltoside; Sigma-Aldrich) at a final DDM/protein ratio of 1.0 mg/mg in abuffer containing 1.5 M aminocaproic acid, 2 mM EDTA and 50 mM bis-Tris (pH 7.0) at 4°C. Serva Blue G (Serva) was added to the solubilizedprotein at a concentration of 0.1 mg/mg detergent and 10 μg protein wasloaded into each lane. Electrophoresis was performed at 40 V and 4°C for1 h and then at 100 V and 4°C.

Western blot analysesThe mitochondrial pellets were incubated on ice in a 2.5× volume of RIPA(radioimmunoprecipitation assay) buffer [50 mM Tris-HCl, pH 7.4,150 mM NaCl, 1 mM PMSF (phenylmethylsulfonyl fluoride), 1 mM

EDTA, 1% Triton X-100, 1% SDS (v/v)] and 1% (v/v) protease inhibitorcocktail (Sigma-Aldrich) for 20 min, with vortexing every 5 min. Themicrotubes were then centrifuged for 20 min at 51,000 g at 4°C, placed onice and the supernatants were transferred to fresh tubes for determination ofprotein concentration (Bradford, 1976) and separation by gel electrophoresis(12% SDS-PAGE) (Fornuskova et al., 2010) using a Mini-Protean System(Bio-Rad). The protein was mixed with 4×SB (sample buffer) containing50 mM Tris-HCl, pH 6.8, 12% (v/v) glycerol, 4% SDS, 2% (v/v)2-mercaptoethanol and 0.01% (w/v) Bromophenol Blue for 30 min at37°C, and 10 μg was loaded into each well of a gel along with a molecularsize marker (Blue Plus2 Prestained Standard, Invitrogen). The proteinswere subsequently electroblotted onto PVDF membranes (Merck). Themembranes were then air-dried overnight, rinsed with 100%methanol (v/v),and blocked in TBS (Tris-buffered saline) containing 5% nonfat dried milkfor 1 h. The membranes were incubated with primary antibodies in TBScontaining 0.1% (v/v) Tween-20 and 2% non-fat dried milk overnight at4°C. Secondary detection was carried out with a peroxidase-conjugatedsecondary antibody (Sigma-Aldrich) in TBS containing 0.1% (v/v) Tween-20 and 2% non-fat dried milk for 1 h. The proteins were visualized with theSuper Signal West Femto Maximum Sensitivity Substrate (ThermoScientific) using the Syngene Imaging System; the intensity of the signalwas quantified using the Quantity One 1-D Analysis Software (Bio-Rad)during the subsequent analysis.

Primary antibodies and dilutions used, along with catalogue numbers andsuppliers were: complex I subunit NDUFA9: anti-NDUFA9 antibody(20C11B11B11, ab14713, Abcam; 1:2500); complex II subunit 30 kDa IPmonoclonal antibody (MS203/D1205, Mitosciences; 1:2000); complex IIsubunit 70 kDa Fp monoclonal antibody (MS204/D1203, Mitosciences;1:10,000); complex III anti-ubiquinol-cytochrome c reductase core protein Iantibody (16D10AD9AH5, ab110252, Abcam; 1:20,000); complex IVanti-MTCO1 antibody (MS404/D0804, Mitosciences; 1:6666); complex IVaanti-COX5A antibody (6E9B12D5, ab110262, Abcam; 1:4000); complex VATP synthase subunit αmonoclonal antibody (MS507/E0564, Mitosciences;1:3000); complex V anti-ATP5O antibody (4C11C10D12, ab110276,Abcam; 1:2000); anti-mitofilin antibody (2E4AD5) – MitochondrialMarker (ab110329, Abcam; 1:1000); purified mouse anti-OPA1 (612606,BD Transduction Laboratories; 1:2000); anti-aconitase 2 antibody(6F12BD9, ab110321, Abcam; 1:2500); anti-DRP1 antibody (ab56788,Abcam; 1:1000); anti-VDAC1/porin antibody (20B12AF2, ab14734,Abcam; 1:3000); PDH antibody cocktail (MSP02/G0351, Mitosciences;1:2000); anti-Huntingtin (EPR5526, ab109115, Abcam; 1:1000); and poly Qantibody 1C2 (MAB1574,Merck; 1:2000). The secondary antibody usedwasanti-mouse IgG (whole molecule)-peroxidase antibody produced in goat(A8924, Sigma-Aldrich; 1:2500).

Activities of mitochondrial enzymesThe activities of the mitochondrial respiratory chain complexes (RCCs)NADH:ubiquinone oxidoreductase (NQR, complex I), succinate:CoQreductase (SQR, complex II), ubiquinol:cytochrome c oxidoreductase(QCCR, complex III), cytochrome c oxidase (COX, complex IV), NADH:cytochrome c reductase (NCCR, complex I+III), and succinate:cytochromec reductase (SCCR, complex II+III) were measured spectrophotometricallyat 37°C in freshly isolated mitochondria according to the method used byRustin et al. (1994); citrate synthase (CS) activity was measured accordingto the method used by Srere (1969) using a Shimadzu 2401 UV-VISspectrophotometer.

Briefly, to measure the activities of complexes I and I+III, approximately20 µg of mitochondrial protein was incubated for 3 min in distilled water todisrupt the mitochondrial membranes. The rotenone-sensitive complex Iactivity was then measured in 1 ml of assay medium (50 mM Tris-HCl,pH 8.1, 2.5 mg/ml BSA, 50 µM decylubiquinone, 0.3 mM KCN and0.1 mM NADH with and without 3 µM rotenone) based on the decrease inabsorbance at 340 nm due to NADH oxidation (ε=6.22 mM cm−1).

The rotenone-sensitive complex I+III activity was determined byincubating 20 μg of mitochondria in 1 ml assay medium (50 mM Tris-HCl,pH 8.1, 2.5 mg/ml BSA, 40 mM cytochrome c, 2 mM KCN and 0.1 mMNADH with and without 3 µM rotenone) and measuring the increase inabsorbance at 550 nm (ε=19.6 mM cm−1) due to reduction of cytochrome c.

10

RESEARCH ARTICLE Disease Models & Mechanisms (2019) 12, dmm038737. doi:10.1242/dmm.038737

Disea

seModels&Mechan

isms

Complex II activity (succinate-DCPIP oxidoreductase) was determined byincubating 20 μg of mitochondrial extract in 1 ml of assay medium (10 mMpotassium phosphate, pH 7.8, 2 mM EDTA, 1 mg/ml BSA, 0.3 mM KCN,10 mM succinate, 3 µM rotenone, 0.2 mM ATP, 80 µM DCPIP, 1 µMantimycin and 50 µM decylubiquinone) and measuring the decrease inabsorbance at 600 nm due to the reduction of DCPIP (ε=20.1 mM cm−1).

Complex II+III activity was determined by incubating 20 μgmitochondria in 1 ml assay medium (50 mM potassium phosphate, pH7.8, 2 mM EDTA, 1 mg/ml BSA, 0.3 mM KCN, 10 mM succinate, 3 µMrotenone, 0.2 mM ATP and 40 µM cytochrome c) and measuring theincrease in absorbance at 550 nm (ε=19.6 mM cm−1).

Complex III activity was determined by incubating 20 μgmitochondria in1 ml assay medium (50 mM KPi, pH 7.8, 2 mM EDTA, 1 mg/ml BSA,0.3 mM KCN, 50 µM cytochrome c and 50 µM ubiquinol) and measuringthe increase in absorbance at 550 nm (ε=19.6 mM cm−1).

Complex IV activity was determined in isolated mitochondria byincubating 20 µg of mitochondrial protein in 1 ml of assay medium(40 mM potassium phosphate, pH 7.0, 1 mg/ml BSA, 25 µM reducedcytochrome c, and 2.5 mM n-dodecyl-β-D-maltoside) and measuring theoxidation of reduced cytochrome c (II) at 550 nm (ε=19.6 mM cm−1).

CS activity was determined using a mixture containing 100 mM Tris-HCl, pH 8.1, 0.1 mMDTNB [5,5′-dithio-bis(2-nitrobenzoic acid)], 2.5 mMn-dodecyl-β-D-maltoside), 20 µg mitochondrial protein, 0.5 mM acetylcoenzyme A and 0.5 mM oxaloacetate. The activity was measured at412 nm (ε=13.6 mM cm−1). For calculation of the final backgroundactivity, the activity without oxaloacetate was subtracted.

The activities were expressed as nmol substrate converted per minuteand normalized to the protein content in the reaction (nmol/min.mgprotein).

The pyruvate dehydrogenase activity was determined by measuring the14CO2 produced by the decarboxylation of [1-14C]pyruvate in an assaycontaining 20-50 µg mitochondrial protein, as previously described(Cahova et al., 2015).

Total coenzyme Q10 contentThe total Q10 content in muscle homogenate was determined using HPLCwith UV detection at 275 nm according to the method of Mosca et al.(2002). The results were expressed as pmol Q10/mg protein.

Electron microscopySkeletal muscle was fixed in 10% paraformaldehyde at 4°C for 1 week,washed with PBS and dehydrated using an ethanol series. The dehydratedsamples were embedded in Durcupan Epon, sectioned using a UltracutReichert microtome at a thickness ranging from 60 to 90 nm, stained withlead citrate and uranyl acetate, and observed with a Jeol JEM 1400+transmission electron microscope.

DNA analysesDNAwas isolated fromminipig muscle samples using the DNeasy Blood &Tissue Kit (Qiagen) according to the manufacturer’s protocol with minormodifications. Samples at ∼5 mm were homogenized with 1.4 mm whiteceramic beads in buffer ATL for 30 s at 6.5 m/s using a Fastprep 24®

instrument. The samples were subsequently incubated overnight at 56°Cwith proteinase K and agitated to facilitate lysis. DNA concentration andpurity were measured using a spectrophotometer (Epoch microplatespectrophotometer) and the samples were subsequently adjusted to thedesired concentration. DNA integrity was assessed using a qPCR-basedmethod (RADF) as previously described (Wang et al., 2016; Askeland et al.,2018a). The primers used to assess mtDNA damage were Fwd (5′-3′) T-CGCAACTGCCTAAAACTCA and Rev (5′-3′) GAATTGGCAAGGGT-TGGTAA. The primers used to assess nDNA damage were Fwd (5′-3′)GTTGTGAATGGTGCTAACTGCT and Rev (5′-3′) ACCAGAGACAA-TAAAGCAGAGGAG. The mtDNA copy number was determined usingqPCR with primers for the mtDNA gene MT-RNR1 and the single copynDNA gene (HBB), which yielded the relative mtDNA content based on theratio of the mtDNA gene product to that of the nDNA gene using standardcurves. The primers used to determine the mtDNA copy number wereMT-RNR1 Fwd (5′-3′) TCGCAACTGCCTAAAACTCA and Rev (5′-3′)

GAATTGGCAAGGGTTGGTAA; those used to measure the HBB genewere Fwd (5′-3′) CTCCTGGGCAACGTGATAGT and Rev (5′-3′)GGTTCAGAGGAAAAAGGGCTCCTCCT.

StatisticsUsing our set of minipig muscle samples, we focused on the statisticalanalysis of three possible interfering factors: (1) the effect of HD itself, (2)the effect of sex and (3) the effect of aging. The differences between theobserved mitochondrial characteristics in the TgHD minipigs and theWT controls with respect to age and sex were examined using linearregression models with mixed effects. The pairs of WT and correspondingage-paired TgHD were considered as a random effect. Box-Coxtransformations were used to gain the normality of residuals. For eachmodel, the statistical significance of the parameter was tested. If theparameter was not significant at the 5% level, it was removed from themodel, and a reduced model was presented. In the box-whisker plots,median and quartiles are displayed. Circles represent outliers that are furtherthan 1.5IQR from the corresponding quartile. Whiskers show the range ofnon-outliers. The analysis was performed using the statistical package Rversion 3.4.4 (R Core Team, 2018).

AcknowledgementsWewould like to give special thanks to Daniela Sedlackova and Suzana Knopova fortechnical support. The authors are grateful to Dr Vaclav Capek for advancedstatistical analysis of the data.

Competing interestsThe authors declare no competing or financial interests.

Author contributionsConceptualization: M.R., J.K., Z.E., L.E., J.M., H.H.; Methodology: M.R., J.K., G.A.,S.J., Z.E., L.E., J.M., H.H.; Validation: L.E., H.H.; Investigation: M.R., J.K., H.S.,B.B., G.A., Z.D., S.J., Z.E., H.H.; Resources: B.B., S.J., J.J., Z.E., J.M.; Datacuration: L.E., H.H.; Writing - original draft: M.R., H.H.; Writing - review & editing:Z.E., L.E., J.M., H.H.; Supervision: Z.E., J.Z., L.E., J.M., H.H.; Project administration:Z.E., L.E., J.M., H.H.; Funding acquisition: Z.E., J.Z., L.E., J.M., H.H.

FundingThis research was funded by the Ministry of Education, Youth and Sports [theNorwegian Financial Mechanism Program 2009-2014, Project Contract no. MSMT-28477/2014 (Project ID -7F14308); National Sustainability Program (project numberLO1609) and Program LD-COST (CZ) (Project ID LD15099)]; institutional researchsupport from Charles University (PROGRES Q26/LF1/3 and UNCE 204064); andThe Czech Science Foundation (GACR 14-36804G).

Supplementary informationSupplementary information available online athttp://dmm.biologists.org/lookup/doi/10.1242/dmm.038737.supplemental

ReferencesAntoniel, M., Giorgio, V., Fogolari, F., Glick, G. D., Bernardi, P. and Lippe, G.

(2014). The oligomycin-sensitivity conferring protein of mitochondrial ATPsynthase: emerging new roles in mitochondrial pathophysiology. Int. J. Mol. Sci.15, 7513-7536. doi:10.3390/ijms15057513

Arenas, J., Campos, Y., Ribacoba, R., Martın, M. A., Rubio, J. C., Ablanedo, P.and Cabello, A. (1998). Complex I defect in muscle from patients withHuntington’s disease. Ann. Neurol. 43, 397-400. doi:10.1002/ana.410430321

Askeland, G., Dosoudilova, Z., Rodinova, M., Klempir, J., Liskova, I.,Kusnierczyk, A., Bjørås, M., Nesse, G., Klungland, A., Hansikova, H. et al.(2018a). Increased nuclear DNA damage precedes mitochondrial dysfunction inperipheral blood mononuclear cells from Huntington’s disease patients. Sci. Rep.8, 9817. doi:10.1038/s41598-018-27985-y

Askeland, G., Rodinova, M., Stufkova, H., Dosoudilova, Z., Baxa, M.,Smatlikova, P., Bohuslavova, B., Klempir, J., Nguyen, T. D., Kusnierczyk,A. et al. (2018b). A transgenic minipig model of Huntington’s disease shows earlysigns of behavioral and molecular pathologies. Dis. Model. Mech. 11,dmm035949. doi:10.1242/dmm.035949

Baldwin, K. M., Hooker, A. M. and Herrick, R. E. (1978). Lactate oxidative capacityin different types of muscle. Biochem. Biophys. Res. Commun. 83, 151-157.doi:10.1016/0006-291X(78)90410-2

Banoei, M. M., Houshmand, M., Panahi, M. S. S., Shariati, P., Rostami, M.,Manshadi, M. D. and Majidizadeh, T. (2007). Huntington’s disease andmitochondrial DNA deletions: event or regular mechanism for mutant huntingtin

11

RESEARCH ARTICLE Disease Models & Mechanisms (2019) 12, dmm038737. doi:10.1242/dmm.038737

Disea

seModels&Mechan

isms

protein and CAG repeats expansion?! Cell. Mol. Neurobiol. 27, 867-875. doi:10.1007/s10571-007-9206-5

Baxa, M., Hruska-Plochan, M., Juhas, S., Vodicka, P., Pavlok, A., Juhasova, J.,Miyanohara, A., Nejime, T., Klima, J., Macakova, M. et al. (2013). A transgenicminipig model of Huntington’s Disease. J. Huntingtons Dis. 2, 47-68. doi:10.3233/JHD-130001

Beck, S. J., Guo, L., Phensy, A., Tian, J., Wang, L., Tandon, N., Gauba, E., Lu, L.,Pascual, J. M., Kroener, S. et al. (2016). Deregulation of mitochondrial F1FO-ATP synthase via OSCP in Alzheimer’s disease. Nat. Commun. 7, 11483. doi:10.1038/ncomms11483

Benchoua, A., Trioulier, Y., Zala, D., Gaillard, M.-C., Lefort, N., Dufour, N.,Saudou, F., Elalouf, J.-M., Hirsch, E., Hantraye, P. et al. (2006). Involvement ofmitochondrial complex II defects in neuronal death produced by N-terminusfragment of mutated huntingtin. Mol. Biol. Cell 17, 1652-1663. doi:10.1091/mbc.e05-07-0607

Bradford, M. M. (1976). A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dye binding. Anal.Biochem. 72, 248-254. doi:10.1016/0003-2697(76)90527-3

Buck, E., Zugel, M., Schumann, U., Merz, T., Gumpp, A. M., Witting, A.,Steinacker, J. M., Landwehrmeyer, G. B., Weydt, P., Calzia, E. et al. (2017).High-resolution respirometry of fine-needle muscle biopsies in pre-manifestHuntington’s disease expansion mutation carriers shows normal mitochondrialrespiratory function. PLoS ONE 12, e0175248. doi:10.1371/journal.pone.0175248

Busse, M. E., Hughes, G., Wiles, C. M. and Rosser, A. E. (2008). Use of hand-helddynamometry in the evaluation of lower limb muscle strength in people withHuntington’s disease. J. Neurol. 255, 1534-1540. doi:10.1007/s00415-008-0964-x

Cahova, M., Chrastina, P., Hansikova, H., Drahota, Z., Trnovska, J., Skop, V.,Spacilova, J., Malinska, H., Oliyarnyk, O., Papackova, Z. et al. (2015).Carnitine supplementation alleviates lipid metabolism derangements and protectsagainst oxidative stress in non-obese hereditary hypertriglyceridemic rats. Appl.Physiol. Nutr. Metab. 40, 280-291. doi:10.1139/apnm-2014-0163

Carroll, J. B., Bates, G. P., Steffan, J., Saft, C. and Tabrizi, S. J. (2015). Treatingthe whole body in Huntington’s disease. Lancet Neurol. 14, 1135-1142. doi:10.1016/S1474-4422(15)00177-5

Cherubini, M. and Gines, S. (2017). Mitochondrial fragmentation in neuronaldegeneration: toward an understanding of HD striatal susceptibility. Biochem.Biophys. Res. Commun. 483, 1063-1068. doi:10.1016/j.bbrc.2016.08.042

Ciammola, A., Sassone, J., Alberti, L., Meola, G., Mancinelli, E., Russo, M. A.,Squitieri, F. and Silani, V. (2006). Increased apoptosis, Huntingtin inclusions andaltered differentiation in muscle cell cultures from Huntington’s disease subjects.Cell Death Differ. 13, 2068-2078. doi:10.1038/sj.cdd.4401967

Ciammola, A., Sassone, J., Sciacco, M., Mencacci, N. E., Ripolone, M., Bizzi, C.,Colciago, C., Moggio, M., Parati, G., Silani, V. et al. (2011). Low anaerobicthreshold and increased skeletal muscle lactate production in subjects withHuntington’s disease. Mov. Disord. 26, 130-137. doi:10.1002/mds.23258

Fornuskova, D., Stiburek, L., Wenchich, L., Vinsova, K., Hansikova, H. andZeman, J. (2010). Novel insights into the assembly and function of humannuclear-encoded cytochrome c oxidase subunits 4, 5a, 6a, 7a and 7b.Biochem. J.428, 363-374. doi:10.1042/BJ20091714

Gao, J., Wang, L., Liu, J., Xie, F., Su, B. and Wang, X. (2017). Abnormalities ofmitochondrial dynamics in neurodegenerative diseases. Antioxidants 6, 25.doi:10.3390/antiox6020025

Gizatullina, Z. Z., Lindenberg, K. S., Harjes, P., Chen, Y., Kosinski, C. M.,Landwehrmeyer, B. G., Ludolph, A. C., Striggow, F., Zierz, S. and Gellerich,F. N. (2006). Low stability of Huntington muscle mitochondria against Ca2+ in R6/2 mice. Ann. Neurol. 59, 407-411. doi:10.1002/ana.20754

Hering, T., Kojer, K., Birth, N., Hallitsch, J., Taanman, J.-W. and Orth, M. (2017).Mitochondrial cristae remodelling is associated with disrupted OPA1oligomerisation in the Huntington’s disease R6/2 fragment model. Exp. Neurol.288, 167-175. doi:10.1016/j.expneurol.2016.10.017

Horton, T. M., Graham, B. H., Corral-Debrinski, M., Shoffner, J. M., Kaufman,A. E., Beal, M. F. and Wallace, D. C. (1995). Marked increase in mitochondrialDNA deletion levels in the cerebral cortex of Huntington’s disease patients.Neurology 45, 1879-1883. doi:10.1212/WNL.45.10.1879

Hu, C., Huang, Y. and Li, L. (2017). Drp1-dependent mitochondrial fission playscritical roles in physiological and pathological progresses in mammals. Int. J. Mol.Sci. 18, 144. doi:10.3390/ijms18010144

Janssen, A. J. M., Trijbels, F. J., Sengers, R. C., Wintjes, L. T., Ruitenbeek, W.,Smeitink, J. A., Morava, E., van Engelen, B. G., van den Heuvel, L. P. andRodenburg, R. J. (2006). Measurement of the energy-generating capacity ofhuman muscle mitochondria: diagnostic procedure and application to humanpathology. Clin. Chem. 52, 860-871. doi:10.1373/clinchem.2005.062414

Kosinski, C. M., Schlangen, C., Gellerich, F. N., Gizatullina, Z., Deschauer, M.,Schiefer, J., Young, A. B., Landwehrmeyer, G. B., Toyka, K. V., Sellhaus, B.et al. (2007). Myopathy as a first symptom of Huntington’s disease in a Marathonrunner. Mov. Disord. 22, 1637-1640. doi:10.1002/mds.21550

Kremer, B., Goldberg, P., Andrew, S. E., Theilmann, J., Telenius, H., Zeisler, J.,Squitieri, F., Lin, B., Bassett, A., Almqvist, E. et al. (1994). Aworldwide study ofthe Huntington’s diseasemutation. The sensitivity and specificity of measuring CAGrepeats. N. Engl. J. Med. 330, 1401-1406. doi:10.1056/NEJM199405193302001

Krizova, J., Stufkova, H., Rodinova, M., Macakova, M., Bohuslavova, B.,Vidinska, D., Klima, J., Ellederova, Z., Pavlok, A., Howland, D. S. et al. (2017).Mitochondrial metabolism in a large-animal model of huntington disease: the huntfor biomarkers in the spermatozoa of presymptomatic minipigs. Neurodegener.Dis. 17, 213-226. doi:10.1159/000475467

Kuznetsov, A. V., Veksler, V., Gellerich, F. N., Saks, V., Margreiter, R. and Kunz,W. S. (2008). Analysis of mitochondrial function in situ in permeabilized musclefibers, tissues and cells. Nat. Protoc. 3, 965-976. doi:10.1038/nprot.2008.61

Liu, C.-S., Cheng, W.-L., Kuo, S.-J., Li, J.-Y., Soong, B.-W. andWei, Y.-H. (2008).Depletion of mitochondrial DNA in leukocytes of patients with poly-Q diseases.J. Neurol. Sci. 264, 18-21. doi:10.1016/j.jns.2007.07.016

Lodi, R., Schapira, A. H. V., Manners, D., Styles, P., Wood, N. W., Taylor, D. J.andWarner, T. T. (2000). Abnormal in vivo skeletal muscle energy metabolism inHuntington’s disease and dentatorubropallidoluysian atrophy. Ann. Neurol. 48,72-76. doi:10.1002/1531-8249(200007)48:1<72::AID-ANA11>3.0.CO;2-I

Lowry, O. H., Rosebrough, N. J., Farr, A. L. and Randall, R. J. (1951). Proteinmeasurement with the Folin phenol reagent. J. Biol. Chem. 193, 265-275.

Lund, J., Aas, V., Tingstad, R. H., van Hees, A. and Nikolic, N. (2018). Utilizationof lactic acid in human myotubes and interplay with glucose and fatty acidmetabolism. Sci. Rep. 8, 9814. doi:10.1038/s41598-018-28249-5

Macakova, M., Bohuslavova, B., Vochozkova, P., Pavlok, A., Sedlackova, M.,Vidinska, D., Vochyanova, K., Liskova, I., Valekova, I., Baxa, M. et al. (2016).Mutated Huntingtin causes testicular pathology in transgenic minipig boars.Neurodegener. Dis. 16, 245-259. doi:10.1159/000443665

Mantovani, S., Gordon, R., Li, R., Christie, D. C., Kumar, V. and Woodruff, T. M.(2016). Motor deficits associated with Huntington’s disease occur in the absenceof striatal degeneration in BACHD transgenic mice. Hum. Mol. Genet. 25,1780-1791. doi:10.1093/hmg/ddw050

Mielcarek, M., Toczek, M., Smeets, C. J. L. M., Franklin, S. A., Bondulich, M. K.,Jolinon, N., Muller, T., Ahmed, M., Dick, J. R. T., Piotrowska, I. et al. (2015).HDAC4-myogenin axis as an important marker of HD-related skeletal muscleatrophy. PLoS Genet. 11, e1005021. doi:10.1371/journal.pgen.1005021

Mosca, F., Fattorini, D., Bompadre, S. and Littarru, G. P. (2002). Assay ofcoenzyme Q(10) in plasma by a single dilution step. Anal. Biochem. 305, 49-54.doi:10.1006/abio.2002.5653

Munsie, L., Caron, N., Atwal, R. S., Marsden, I., Wild, E. J., Bamburg, J. R.,Tabrizi, S. J. and Truant, R. (2011). Mutant huntingtin causes defective actinremodeling during stress: defining a new role for transglutaminase 2 inneurodegenerative disease. Hum. Mol. Genet. 20, 1937-1951. doi:10.1093/hmg/ddr075

Novak, M. J. U. and Tabrizi, S. J. (2010). Huntington’s disease. BMJ 340, c3109.doi:10.1136/bmj.c3109

Pandey, M., Varghese, M., Sindhu, K. M., Sreetama, S., Navneet, A. K.,Mohanakumar, K. P. and Usha, R. (2008). Mitochondrial NAD+-linked State 3respiration and complex-I activity are compromised in the cerebral cortex of3-nitropropionic acid-induced rat model of Huntington’s disease. J. Neurochem.104, 420-434. doi:10.1111/j.1471-4159.2007.04996.x

Panov, A. V., Gutekunst, C.-A., Leavitt, B. R., Hayden, M. R., Burke, J. R.,Strittmatter, W. J. and Greenamyre, J. T. (2002). Early mitochondrial calciumdefects in Huntington’s disease are a direct effect of polyglutamines. Nat.Neurosci. 5, 731-736. doi:10.1038/nn884

Petersen, M. H., Budtz-Jørgensen, E., Sørensen, S. A., Nielsen, J. E., Hjermind,L. E., Vinther-Jensen, T., Nielsen, S. M. B. and Nørremølle, A. (2014).Reduction in mitochondrial DNA copy number in peripheral leukocytes after onsetof Huntington’s disease. Mitochondrion 17, 14-21. doi:10.1016/j.mito.2014.05.001

Quintanilla, R. A., Jin, Y. N., von Bernhardi, R. and Johnson, G. V. W. (2013).Mitochondrial permeability transition pore induces mitochondria injury inHuntington disease. Mol. Neurodegener. 8, 45. doi:10.1186/1750-1326-8-45

Reddy, P. H. (2014). Increased mitochondrial fission and neuronal dysfunction inHuntington’s disease: implications for molecular inhibitors of excessivemitochondrial fission. Drug Discov. Today 19, 951-955. doi:10.1016/j.drudis.2014.03.020

Roe, A. J. andQi, X. (2018). Drp1 phosphorylation byMAPK1 causesmitochondrialdysfunction in cell culture model of Huntington’s disease. Biochem. Biophys. Res.Commun. 496, 706-711. doi:10.1016/j.bbrc.2018.01.114

Romanello, V., Guadagnin, E., Gomes, L., Roder, I., Sandri, C., Petersen, Y.,Milan, G., Masiero, E., DEL Piccolo, P., Foretz, M. et al. (2010). Mitochondrialfission and remodelling contributes to muscle atrophy. EMBO J. 29, 1774-1785.doi:10.1038/emboj.2010.60

Rotig, A., de Lonlay, P., Chretien, D., Foury, F., Koenig, M., Sidi, D., Munnich, A.and Rustin, P. (1997). Aconitase and mitochondrial iron-sulphur proteindeficiency in Friedreich ataxia. Nat. Genet. 17, 215-217. doi:10.1038/ng1097-215

Rustin, P., Chretien, D., Bourgeron, T., Gerard, B., Rotig, A., Saudubray, J. M.and Munnich, A. (1994). Biochemical and molecular investigations in respiratorychain deficiencies.Clin.Chim.Acta228, 35-51. doi:10.1016/0009-8981(94)90055-8

Rustin, P., Munnich, A. and Rotig, A. (2002). Succinate dehydrogenase andhuman diseases: new insights into a well-known enzyme. Eur. J. Hum. Genet. 10,289-291. doi:10.1038/sj.ejhg.5200793

12

RESEARCH ARTICLE Disease Models & Mechanisms (2019) 12, dmm038737. doi:10.1242/dmm.038737

Disea

seModels&Mechan

isms

Schagger, H. and von Jagow, G. (1991). Blue native electrophoresis for isolation ofmembrane protein complexes in enzymatically active form. Anal. Biochem. 199,223-231. doi:10.1016/0003-2697(91)90094-A

She, P., Zhang, Z., Marchionini, D., Diaz, W. C., Jetton, T. J., Kimball, S. R., Vary,T. C., Lang, C. H. and Lynch, C. J. (2011). Molecular characterization of skeletalmuscle atrophy in the R6/2 mouse model of Huntington’s disease. Am. J. Physiol.Endocrinol. Metab. 301, E49-E61. doi:10.1152/ajpendo.00630.2010

Silva, A. C., Almeida, S., Laço, M., Duarte, A. I., Domingues, J., Oliveira, C. R.,Januario, C. and Rego, A. C. (2013). Mitochondrial respiratory chain complexactivity and bioenergetic alterations in human platelets derived from pre-symptomatic and symptomatic Huntington’s disease carriers. Mitochondrion 13,801-809. doi:10.1016/j.mito.2013.05.006

Squitieri, F., Falleni, A., Cannella, M., Orobello, S., Fulceri, F., Lenzi, P. andFornai, F. (2010). Abnormal morphology of peripheral cell tissues from patientswith Huntington disease. J Neural Transm (Vienna) 117, 77-83. doi:10.1007/s00702-009-0328-4

Srere, D. (1969). [1] Citrate synthase. [EC 4.1.3.7. Citrate oxaloacetate-lyase (CoA-acetylating)].Methods Enzymol. 13(C), 3-11. doi:10.1016/0076-6879(69)13005-0

Tabrizi, S. J., Workman, J., Hart, P. E., Mangiarini, L., Mahal, A., Bates, G.,Cooper, J. M. and Schapira, A. H. V. (2000). Mitochondrial dysfunction and freeradical damage in the Huntington R6/2 transgenic mouse. Ann. Neurol. 47, 80-86.doi:10.1002/1531-8249(200001)47:1<80::AID-ANA13>3.0.CO;2-K

Trottier, Y., Devys, D., Imbert, G., Saudou, F., An, I., Lutz, Y., Weber, C., Agid, Y.,Hirsch, E. C. and Mandel, J.-L. (1995). Cellular localization of the Huntington’s

disease protein and discrimination of the normal and mutated form. Nat. Genet.10, 104-110. doi:10.1038/ng0595-104

Tyler, D. D. (1992). The Mitochondrion in Health and Disease. VCH Publishers:Weinheim, New York.

Valadao, P. A. C., de Aragao, B. C., Andrade, J. N., Magalhaes-Gomes, M. P. S.,Foureaux, G., Joviano-Santos, J. V., Nogueira, J. C., Ribeiro, F. M., Tapia,J. C. and Guatimosim, C. (2017). Muscle atrophy is associated with cervicalspinal motoneuron loss in BACHD mouse model for Huntington’s disease.Eur. J. Neurosci. 45, 785-796. doi:10.1111/ejn.13510

van der Burg, J. M. M., Bjorkqvist, M. and Brundin, P. (2009). Beyond the brain:widespread pathology in Huntington’s disease. Lancet Neurol. 8, 765-774. doi:10.1016/S1474-4422(09)70178-4

Vidinska, D., Vochozkova, P., Smatlıkova, P., Ardan, T., Klıma, J., Juhas, S.,Juhasova, J., Bohuslavova, B., Baxa, M., Valekova, I. et al. (2018). Gradualphenotype development in Huntington disease transgenic minipig model at 24months of age. Neurodegener. Dis. 18, 107-119. doi:10.1159/000488592

Vonsattel, J. P. G. and Difiglia, M. (1998). Huntington disease. J. Neuropathol.Exp. Neurol. 57, 369-384. doi:10.1097/00005072-199805000-00001

Wang, W., Scheffler, K., Esbensen, Y. and Eide, L. (2016). Quantification of DNAdamage by real-time qPCR. Methods Mol. Biol. 1351, 27-32. doi:10.1007/978-1-4939-3040-1_3

Zielonka, D., Piotrowska, I., Marcinkowski, J. T. and Mielcarek, M. (2014).Skeletal muscle pathology in Huntington’s disease. Front. Physiol. 5, 380. doi:10.3389/fphys.2014.00380

13

RESEARCH ARTICLE Disease Models & Mechanisms (2019) 12, dmm038737. doi:10.1242/dmm.038737

Disea

seModels&Mechan

isms