Determining the oncogenic activity of different …...Epstein-Barr virus (EBV) infection is strongly associated with nasopharyngeal carcinoma and EBV genes products are believed to

Determining the oncogenic activity of

different Epstein-Barr virus proteins on

the development of nasopharyngeal

cancer

by

KONG EE LING

A thesis

presented in partial fulfilment of the requirement for the degree of

Master of Science by Research

at Swinburne University of Technology

2018

Abstract.

Nasopharyngeal carcinoma (NPC) is a highly metastatic cancer arising from the

epithelium lining of the nasopharynx and has distinct geographical distribution and

multiple etiological cofactors. Epstein-Barr virus (EBV) infection is strongly associated

with nasopharyngeal carcinoma and EBV genes products are believed to play an

important role in the development of nasopharyngeal carcinoma. However, the definite

pathogenic roles of EBV genes products in premalignant nasopharyngeal epithelial cells

are still to be elucidated. In this study, the oncogenic activity of EBV genes products in

immortalized nasopharyngeal epithelial cells NP460hTert was examined. Four stable

EBV gene expressing NP460hTert was successfully generated. Here, it is shown that

EBV genes BARF1 and BHRF1 expression were able to promote cell proliferation, and

BARF1 expression can promotes cell migration in NP460hTert. In addition, the

autocrine/paracrine activity of secreted BARF1 was examined. Analysis of BARF1

expressing NP460hTert revealed that BARF1 was secreted by nasopharyngeal epithelial

cells into culture medium. Furthermore, it is shown that secreted BARF1 was capable to

stimulate cell proliferation and cell migration in parental NP460hTert. These findings

indicated that BHRF1 and BARF1 greatly affect cell proliferation and cell migration in

NP460hTert and may contribute to transformation of nasopharyngeal epithelial cells.

Acknowledgement

I would like to express my profound gratitude towards Swinburne University of

Technology for providing me this opportunity to conduct and complete my master’s

research project. I would also like to thank Swinburne University of Technology for

awarding me a scholarship and supporting the research with crucial funds and materials.

I would like to thank my supervisor Dr. Paul Neilsen for all his guidance and support

throughout this project. Without his wisdom and knowledge on cancer research, this

project could not be completed. I am also deeply grateful to my co-supervisor Dr. Yap

Lee Fah for expanding my horizons regarding method of research. She also contributed

valuable resources and materials to assist me in completing this project. I would also

like to thank University Malaya for allowing me to do my attachment at their

prestigious state of the art University Malaya Medical Centre. To Associate Professor

Peter Morin, I like to express my appreciation for providing essential materials at the

beginning of this project and moral support throughout the duration of the project.

Finally, I would like to express my sincere appriciation to Dr. Irine Henry for her

diligent proofreading of this thesis.

Last but not least, I am indebted to all my colleagues and staff from both Swinburne

University of Technology and University Malaya, my friends and family for their help

and support throughout the trying times.

Declaration

I, Kong Ee Ling, candidate of Master of Science by Research from Faculty of

Engineering, Computing and Science in Swinburne University of Technology Sarawak

Campus hereby declare that my master thesis entitled “Determining the oncogenic

activity of different Epstein-Barr virus proteins on the development of nasopharyngeal

cancer” is original writing outcome and contains no material or content which has been

accepted for the award to the stated candidate of any other degree or diploma studies,

except where due references are made in the text of the examinable outcomes; and

where the work is based on joint research or publications, the disclosed relative

contributions of the respective workers or authors.

Kong Ee Ling

As the principal coordinating supervisor, I hereby acknowledge and verify that the

above-mentioned statements are legitimate to the best of my knowledge.

Dr Paul Neilsen

Conference presentations/Publications

Kong, EL, Nissom, PM , Yap, LF, Neilsen PM 2016, “Determining the oncogenic

activity of different Epstein-Barr virus proteins on the development of nasopharyngeal

cancer”, 5th NPC Research Day 2016, Nasopharyngeal Carcinoma Society of Malaysia,

Institute for Medical Research, Kuala Lumpur, Malaysia, 3 March, 2016.

Table of contents

Chapter 1: Introduction 1

1.1 Nasopharyngeal carcinoma 1

1.1.1 Racial and geographical distribution 1

1.1.2 Histopathology of NPC 6

1.1.3 Clinical presentation and treatment for NPC 8

1.1.4 Etiological factors of NPC 9

1.1.4.1 Environmental factors 9

1.1.4.2 Genetic susceptibility 10

1.1.4.3 Epstein-Barr virus infection 11

1.2 Epstein-Barr virus 12

1.2.1 Route of EBV entry and infection 12

1.2.2 Genome structure and strain variation of EBV 13

1.2.3 EBV latent and lytic states 16

1.2.4 Contribution of EBV genes in NPC oncogenesis 17

1.2.4.1 Latent membrane proteins 18

1.2.4.1.1 LMP1 18

1.2.4.1.2 LMP2 19

1.2.4.2 Epstein-Barr nuclear antigens 20

1.2.4.2.1 EBNA1 20

1.2.4.2.2 EBNA2 and its co-activator EBNA-LP 21

1.2.4.2.3 EBNA3 family 21

1.2.4.3 BamHI-A rightward frame 1 (BARF1) 22

1.2.4.4 BamHI-H rightward frame 1 (BHRF1) 22

1.2.4.5 EBV immediate-early proteins 23

1.2.4.6 EBV-encoded small RNAs 24

1.2.4.7 EBV-encoded microRNAs 24

1.4 In vivo and in vitro model systems of NPC 25

1.5 Aims and objectives 26

Chapter 2: Methodology 27

2.1 Primers design 27

2.2 DNA sample preparation 30

2.2.1 Total RNA extraction for lytic stage NP460hTert-EBV 30

2.2.2 DNase I treatment and cDNA synthesis for PCR amplification 31

2.3 Polymerase chain reaction (PCR) 32

2.4 PCR free nucleotide removal 33

2.5 Agarose gel electrophoresis 33

2.6 Cloning 34

2.6.1 Restriction enzyme digestion 35

2.6.2 Gel purification 35

2.6.3 Ligation of PCR products into pcDNA 3.1 Hygro 36

2.7 Preparation of chemically competent cells 36

2.8 Transformation 37

2.9 Plasmid purification 37

2.10 Sub-cloning into pLVX-Puro 38

2.11 Maxi preparation of pLVX-EBV 39

2.11.1 Preparation of bacteria culture 39

2.11.2 Extraction of plasmid 39

2.11.3 Precipitation of plasmid 39

2.12 Cell lines and reagents 40

2.13 Cell lines maintenance 40

2.14 Cell lines cryopreservation and recovery from cryopreservation 41

2.15 Transfection of HEK293T and lentiviruses production 41

2.16 Establishment of NP460hTert puromycin selection concentration 42

2.17 Transduction of NP460hTert 42

2.18 RNA preparation for reverse-transcription PCR analysis 42

2.18.1 RNA extraction from transduced NP460hTert 42

2.18.2 cDNA synthesis 42

2.18.3 Reverse transcription polymerase chain reaction 44

2.19 Protein extraction and quantification 44

2.19.1 Bradford protein assay 45

2.20 SDS-PAGE 45

2.21 Western blotting 45

2.21.1 Transferring the protein from gel to PVDF membrane 45

2.21.2 Antibody incubation and imaging 46

2.21.3 Stripping and reprobing 46

2.22 Cell proliferation assay with MTT 47

2.23 Migration and wound healing assay 47

2.24 Collection of conditioned medium 47

2.25 Proliferation assay with conditioned medium 48

2.26 Migration assay with conditioned medium 48

Chapter 3: Results and discussion 49

3.1 Introduction 49

3.2 Experiment optimisation 52

3.2.1 Preparation of competent cells and optimisation of transformation 52

3.2.1.2 Discussion 54

3.2.2 Dose response for puromycin selection of NP460hTert 56

3.3 Primer design for the cloning of the 13 EBV genes used in this study 57

3.4 PCR cloning of 13 EBV genes 58

3.4.1 Discussion 64

3.5 PCR sub-cloning of 8 EBV genes into pLVX-Puro 65

3.5.1 Discussion 70

3.6 Sequence analysis of 6 EBV genes in pLVX-Puro 71

3.6.1 Discussion 76

3.7 The generation of 4 EBV genes expressing NP460hTert 78

3.7.1 Discussion 82

3.8 Western blot analysis of 3 EBV genes in transduced NP460hTert 83

3.8.1 Discussion 86

3.8.1.1 BHRF1 87

3.8.1.2 LMP2A 87

3.8.1.3 BARF1 88

3.9 Effect of 3 EBV genes on cell proliferation of transduced NP460hTert 93

3.9.1 Discussion 96

3.9.1.1 BARF1 96

3.9.1.2 BHRF1 97

3.9.1.3 LMP2A 98

3.10 Effect of BARF1 on cell migration in NP460hTert 99

3.10.1 Discussion 105

3.11 Role of secreted BARF1 in cell proliferation and migration of NP460hTert 106

3.11.1 Conditioned medium proliferation assay 106

3.11.2 Conditioned medium migration assay 110

3.11.3 Discussion 113

Chapter 4: General conclusion and future work 115

4.1 Primary data conclusions 115

4.2 Technical conclusions 117

References 121

List of Figures

Chapter 1: Introduction

Figure 1.1 Estimated age-standardized rate of NPC incident in both sexes in the world

3

Figure 1.2 Top 10 Age standardized incidence rates of NPC in Southeast Asian countries

4

Figure 1.3 Age standardized incidence rates of NPC across Malaysia states during 2007-2011

5

Figure 1.4 EBV genome structure and mapping of its latent genes 15

Chapter 2: Methodology

Figure 2.1 The restriction recognition sites of HindIII and XhoI in pcDNA 3.1 Hygro

34

Figure 2.2 The restriction recognition sites of EcorRI and XbaI in pLVX-Puro

38

Chapter 3: Results and discussion

Figure 3.1 The progression of 13 EBV genes in this project 51

Figure 3.2 Puromycin selection of NP460hTert 56

Figure 3.3 The detailed description of the cloning primers 57

Figure 3.4 The restriction enzyme digestion of pcDNA 3.1 Hygro 60

Figure 3.5 Gel images of PCR amplification for Akata cDNA / NP460hTert-EBV cDNA

61

Figure 3.6 Gel images of restriction enzymes digestion for recombinant pcDNA 3.1 Hygro

62

Figure 3.7 Gel images of short amplicons PCR amplification for recombinant pcDNA 3.1 Hygro

63

Figure 3.8 Gel image of restriction enzyme digestion for pcDNA 3.1 Hygro-BZLF1

63

Figure 3.9 The detailed description of the sub-cloning primers 66

Figure 3.10 The restriction enzyme digestion of pLVX-Puro 68

Figure 3.11 Gel images of restriction enzymes digestion for recombinant pLVX-Puro

69

Figure 3.12 Gel image of PCR amplification for EBNA1 and EBNA2 from recombinant pcDNA 3.1 Hygro

70

Figure 3.13 Sequence analysis of LMP2A in pLVX-Puro 72

Figure 3.14 Sequence analysis of BHRF1 in pLVX-Puro 72

Figure 3.15 Sequence analysis of LMP1 in pLVX-Puro 73

Figure 3.16 Sequence analysis of BARF1 in pLVX-Puro 73

Figure 3.17 Sequence analysis of LMP2B in pLVX-Puro 74

Figure 3.18 Sequence analysis of BRLF1 in pLVX-Puro 75

Figure 3.19 Reverser-transcription PCR analysis of NP460hTert-BARF1 and NP460hTert-BHRF1

80

Figure 3.20 Reverser-transcription PCR analysis of LMP2A 81

Figure 3.21 Reverser-transcription PCR analysis of LMP1 81

Figure 3.22 Western blot of LMP2A and BHRF1 in transduced NP460hTert

84

Figure 3.23 Western blot analysis of BARF1 in transduced NP460hTert 85

Figure 3.24 Ponceau S staining of concentrated conditioned medium from NP460hTert-BARF1 and NP460hTert-pLVX

91

Figure 3.25 Western blot analysis of concentrated conditioned medium from NP460hTert-BARF1 and NP460hTert-pLVX

92

Figure 3.26 Cell proliferation analysis of NP460hTert clones at daily intervals by MTT assay

95

Figure 3.27 Preliminary cell migration assay with wound healing method 100

Figure 3.28 Comparison of migration for NP460hTert expressing either BARF1 or vector control pLVX

103

Figure 3.29 Analysis of micrographs by using Tscratch 104

Figure 3.30 The open wound area of NP460hTert-BARF1 and NP460hTert-pLVX at four different time points relative to zero hour

105

Figure 3.31 Optimization of conditioned medium experiments 107

Figure 3.32 Cell proliferation rates of NP460hTert in different conditioned medium

109

Figure 3.33 Comparison of migration for NP460hTert incubated in either conditioned medium form NP460hTert BARF1 (BARF1 CM) or vector control (pLVX CM).

111

Figure 3.34 Analysis of micrographs by using Tscratch 112

Figure 3.35 The open wound area of NP460hTert in conditioned medium form either NP460hTert-BARF1 or NP460hTert-pLVX at four different time points relative to zero hour.

113

List of Tables

Chapter 1: Introduction

Table 1.1 EBV gene expression in different type of latency programme 17

Chapter 2: Methodology

Table 2.1 List of cloning primers and gene expression primers 28

Table 2.2 RNA mix setup 31

Table 2.3 Master mix setup 31

Table 2.4 cDNA synthesis conditions 31

Table 2.5 PCR setup 32

Table 2.6 Thermocycling conditions for PCR 32

Table 2.7 Restriction enzymes digestion setup 35

Table 2.8 PCR products ligation setup 36

Table 2.9 The sub-cloning primers 38

Table 2.10 RNA mix setup for High-Capacity cDNA Reverse Transcription Kit

43

Table 2.11 Master mix setup for High-Capacity cDNA Reverse Transcription Kit

43

Table 2.12 cDNA synthesis conditions for High-Capacity cDNA Reverse Transcription Kit

44

Table 2.13 Primary antibody list 46

Table 2.14 Secondary antibody list 46

Chapter 3: Results and discussion

Table 3.1 The sources of competent cells and their condition of preparation

53

Table 3.2 Transformation efficiency of different E.Coli strain 54

Table 3.3 The EBV templates used for PCR of respective genes 58

List of Abbreviations

AP-1 Activator protein 1 APS Ammonium persulfate BAD Bcl2 associated agonist of cell death BARF1 BamHI-A rightward frame 1 BARTs BamHI A rightward transcripts BCR B-cell receptor BHRF1 BamHI-H rightward frame 1 BLAST Basic local alignment search tool BRLF1 BamHI-R leftward frame 1 BZLF1 BamHI-Z lefttward frame 1 CCMB80 Calcium/manganese-based buffer 80 CCND1 Cyclin D1 CDK2 Cyclin dependent kinase 2 CDKN2 Cylin-dependent kinase inhibitor 2 Chk2 Checkpoint kinase 2 CK2 Casein kinase 2 COX-2 Cyclooxygenase-2 CR2 Complement receptor 2 CSF-1 Human colony stimulating factor 1 CTLs Cytotoxic T lymphocytes CXCL10 C-X-C motif chemokine 10 CYP Cytochrome P450 DICE1 Deleted in cancer 1 DMEM Dulbecco's Modified Eagle Medium DMSO Dimethyl sulfoxide EBERs Epstein-Barr virus encoded non-coding RNAs EBNA Epstein-Barr virus nuclear antigen EBV Epstein-Barr virus EBVGC Epstein-Barr virus associated gastric carcinoma ECL Electrogenerated chemiluminescence EGFR Epidermal growth factor receptor EMT Epithelial-mesenchyme-transition ERCC1 Excision repair cross-complementation group 1 ERK Extracellular signal-regulated kinases FAK Focal adhesion kinase FAS Fas cell surface death receptor Foxo3a Forkhead box O3 GEM genetically engineered mouse

GSK3 Glycogen synthase kinase 3 GSTM1 Glutathione S-transferase Mu 1 GWAS Genome-wide association studies HDAC Histone deacetylases HIF-1 α Hypoxia-inducible factor 1-alpha HLA Human leukocyte antigen hOGG1 Human 8-oxoguanine DNA N-glycosylase 1 Hp1α Heterochromatin protein 1 alpha HRP Horseradish peroxidase ID1 Inhibitor of differentiation protein 1 IgA Immunoglobulin A IGF-1 Insulin-like growth factor 1 INF-γ Interferon gamma IRF3 Interferon regulatory factor 3 IRF7 Interferon regulatory factor 7 ITAM Immunoreceptor tyrosine activation motif JAK Janus kinase LCL Lymphoblasoid cell lines LMP Latent membrane protein MAPK Mitogen-activated protein kinase Mcl-1 Induced myeloid leukaemia cell differentiation protein MDM2 Mouse double minute 2 homolog MDS1-EVI1 Myelodyplasia 1 and ecotropic viral insertion site 1 fusion proteins miRs microRNAs MMPs Matrix metalloproteinase mTOR Mammalian target of rapamycin MTT 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium

Bromide, Thiazole Blue MVA Modified vaccinia Anakara NADPH Nicotinamide adenine dinucleotide phosphate NCBI National centre for biotechnology information NcoR Nuclear receptor co-repressor NF-κB Nuclear factor-kappa B NHEJ Non-homologous end joining NK/T Natural killer T cells NOX NADPH oxidase NPC Nasopharyngeal carcinoma ORF Open reading frame PCR Polymerase chain reaction PI3K Phosphoinositide 3-kinase PIGR Polymeric immunoglobulin receptor

PKR Protein kinase R PLUNC Palate, lung and nasal epithelium clone protein PML Promyelocytic leukaemia pRB Retinoblastoma protein PTEN Phosphatase and tensin homolog PUMA p53 upregulated modulator of apoptosis PVDF Polyvinylidene fluoride RAD51L1 DNA repair protein RAD51 homolog 2 RAGE Receptor for advanced glycation end products RASSF1A Ras association domain family member 1 A RBPJ Recombining binding protein suppressor of hairless RT-PCR Reverse transcription polymerase chain reaction SAHA Suberoylanilide hydroxamic acid SCID severely compromised immunedeficient SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis Sky Spleen tyrosine kinase STAT Signal transducer and activator of transcription TBS Tris buffered saline TCR T-cell receptor TGFβ Transforming growth factor beta TIMPs Tissue inhibitor of metalloproteinase TLRs Toll-like receptors TMED Tetramethylethylenediamine TNFRSF19 Tumour necrosis factor receptor superfamily, member 19 TNF-α Tumour necrosis factor alpha TP53 Tumour protein p53 TPA Tetradecanoyl phorbol USP7 Ubiquitin-specific protease UTR Untranslated region VCA Viral capsid antigen VEGF Vascular endothelial growth factor VEGF Vascular endothelial growth factor WHO World health organisation XRCC1 X-ray repair cross-complementing protein 1 ΔNp63 Tumour protein p63 isoform

1

Chapter 1

Introduction

1.1 Nasopharyngeal carcinoma

Nasopharyngeal carcinoma (NPC) is an epithelial cancer arising from epithelium lining

of the nasopharynx. NPC is distinguishable from other epithelial cancers arising from

the head and neck regions by its distinct clinical characteristics, histopathology, racial

and geographical distribution (Tsao et al. 2014).

1.1.1 Racial and geographical distribution

NPC is a rare malignancy throughout most regions of the world especially in Western

countries with an incidence rate of less than 1 per 100,000 per year (Chang & Adami

2006; Tsao et al. 2015; Tsao et al. 2014). NPC also only contributes to 0.6% of all

cancers and is more common in males than females with sex ratio of 2.3:1 (Ferlay et al.

2015). However, high incidences of NPC are observed in endemic regions such as

Southern China, South East Asia, Northern Africa and the Arctic. The incidences of

NPC in both sexes in the world are represented in Figure 1.1. Furthermore,

approximately 81% of global NPC cases are reported in Asia (Ferlay et al. 2013). The

highest incidence rates of NPC from a geographical prospective, demonstrated as age-

standardized rate (ASR) of 25 per 100,000 person-years for males and 9.0 per 100,000

person-years for females, come from Zhongshan city and Zhuhai, respectively (Bray et

al. 2017; Bray et al. 2015). Both endemic areas are located in Guangdong province of

southern China, where the majority of the population is Cantonese. The highest rates of

NPC were also reported among Cantonese in similar regions during 1998-2002 (Feng

2013). Comparable ASRs were observed in nearby cities including Jiangmen,

Guangzhou and Hong Kong, whereas the incidences in Northern china is significantly

lower than that in the South (Bray et al. 2017).

An intermediate incidence rate of NPC has been observed among Southeast Asian

countries. However, the risk of NPC in Southeast Asia varies due to diverse ethnic

backgrounds and social admixture with southern Chinese. Notably, elevated incidences

of NPC were reported among the population of Chinese descent and the populations

2

which have a history of intermarriage with Chinese ancestors (Chang & Adami 2006).

The comparison of NPC incidence for top 10 Southeast Asian countries, demonstrated

as age-standardized rate, is illustrated in Figure 1.2.

3

Figure 1.1: Estimated age-standardized rate of NPC incident in both sexes in the world. Data were taken from the Cancer Incidence in Five

Continents, Volume XI (Bray et al. 2017).

4

Figure 1.2: Top 10 Age standardized incidence rates of NPC in Southeast Asian

countries. Malaysia, Sarawak data are taken from Malaysian National Cancer Registry

Report (Azizah et al. 2016). Unless otherwise stated, data were taken from the Cancer

Incidence in Five Countries, Volume XI (Bray et al. 2017).

Malaysia is one of the endemic regions of NPC with incidence rates in males and

female of 6.4 and 2.2 per 100,000 person-years, respectively (Figure 1.2). Furthermore,

NPC is the fifth most common cancer in Malaysia and third most common in males

(Azizah et al. 2016). In Malaysia, the ethnic group with the highest risk of NPC is

Malaysian Chinese with ASR of 11.0 and 3.5 for male and female, respectively. The

possible factors that contributed to this higher incidence in Malaysian Chinese might be

5

due to their ancestors who originated from endemic regions in Southern China.

Malaysian Malays and Indians come in distant second in NPC incidences with ASR of

3.3 and 1.3 for Malay males and females, respectively; 1.1 and 0.6 for Indian males and

females, respectively. Notably, The Bidayuh people, one of the Sarawak native ethnic

groups, exhibit the highest ASR (ASR 31.5 f or male and 11.8 for female) recorded by

any population-based registry in the world during 1998-2002 (Devi et al. 2004). Other

indigenous groups, the Iban people, also show a high risk of NPC with ASR of 13.1 for

males and 5.6 for females. The unique distribution of NPC incidence among the

Malaysia ethnic groups might have an influence on variation in NPC incidence across

different states. High population of Southern Chinese descendent was known to have

significant correlation with the regional NPC incidence in Southeast Asia (Armstrong,

Kutty & Dharmalingam 1974; Chang & Adami 2006). Indeed, in the Malaysian state of

Selangor during 1968-1972, it had the highest rate of NPC while the population of

Selangor Chinese was also higher than the corresponding proportion for Peninsular

Malaysia as a whole (Armstrong, Kutty & Dharmalingam 1974). Similar racial pattern

for NPC was also observed during 2007-2011. The reported NPC incidence during

2007-2011 was demonstrated in Figure 1.3.

Figure 1.3: Age standardized incidence rates of NPC across Malaysia states during

2007-2011. The data was taken from Malaysia National Cancer Registry Report (Azizah

et al. 2016).

6

NPC incidences are high among the states such as Penang, Johor, and Perak which has

high population of Chinese of 45.6%, 33.6% and 30.4%, respectively (Department of

Statistics, Malaysia). Correspondingly, NPC incidencess in Pahang, Kedah, Perlis,

Terengganu and Kelantan (16.2%, 13.6%, 8.0%, 3.4% and 2.6% population of Chinese,

respectively) are roughly half of those in Penang, Johor and Perak, where a higher

proportion of population is Chinese (Department of Statistics, Malaysia). Likewise, the

NPC incidences in Selangor during 2007-2011 are lower than same state during 1968-

1972 due to the decline in regional Chinese population from 46% to 28% (Armstrong,

Kutty & Dharmalingam 1974). Noteworthy, while Sarawak had the highest NPC

incidences in Malaysia, the state only has Chinese population of 24.5%. The high risk of

NPC in Sarawak was strongly associated with its native population. Sarawak native

population especially Bidayuh and Iban were once reported to have the highest

incidence rate recorded by any population-based registry (Devi et al. 2004). Similarly,

the incidence rates of NPC are high in other Malaysia states on the island of Borneo

(Sabah and WP Labuan) where the major population are indigenous people (Devi et al.

2004).

1.1.2 Histopathology of NPC

Studies in the early 20th century has revealed that NPC does not only consists of a single

type of epithelium cell but is composed of multiple morphologically different

carcinomas (Nicholls & Niedobitek 2013). Thus, identification of nasopharyngeal

biopsies from NPC endemic populations provides a significant pathological diagnosis

for the clinician to enable both appropriate treatment and clinical follow up. Therefore,

it is important to have a universal histopathological classification for terminology,

definition, and classification of different types of NPC (Shanmugaratnam et al. 1979).

In 1978, the World Health Organization proposed an international classification which

classified NPC into three subtypes: keratinizing squamous cell carcinoma, non-

keratinizing carcinoma, and undifferentiated carcinoma (Shanmugaratnam et al. 1979;

Shanmugaratnam & Sobin 2012). Type 1 NPC, keratinising squamous cell carcinoma,

is characterized by well-differentiated squamous cells with the presence of intracellular

bridge, keratinization, and the absence of cellular infiltration. Type II, non-keratinizing

carcinoma, is the squamous carcinoma that is neither anaplastic or undifferentiated nor

non-keratinizing, but has a stratified appearance and well-defined cell margins. Type III,

7

undifferentiated carcinoma, is a carcinoma that non-keratinizing; less differentiated,

feature highly variable cell types, and have distinct cytological characteristics. The

tumour cells appear to have prominent nucleoli, indistinct margins, and arranged in

irregular masses. Undifferentiated NPC represents the most common type of NPC,

approximately 63% of all NPC in low incidence areas and accounting up to 98% in

NPC endemic regions (Lu, Cooper & Lee 2010; Nicholls & Niedobitek 2013; Wei &

Sham 2005).

In 1991, a modification of WHO classification was proposed which divided NPC into

two subtypes: squamous cell carcinoma and non-keratinizing carcinoma

(Shanmugaratnam & Sobin 1991; Shanmugaratnam & Sobin 1993). The

undifferentiated carcinoma is combined with non-keratinizing carcinoma into a single

category of non-keratinizing carcinoma, which was further subdivided into two subsets,

namely differentiated non-keratinizing carcinoma and undifferentiated non-keratinizing

carcinoma. The criterion that are used for this classification was that both non-

keratinizing carcinoma and undifferentiated carcinoma have several overlapping

histologic features such as the strong relationship with Epstein-Barr virus, more

sensitive to radiotherapy, and better prognosis than keratinizing squamous cell

carcinoma (Marks, Phillips & Menck 1998; Shanmugaratnam & Sobin 1991).

In 2005, WHO update its NPC classification proposed in 1991, which still maintains the

separation between keratinizing squamous cell carcinoma and non-keratinizing

carcinoma; and basaloid squamous cell carcinoma is first included into the classification

(Li & Zong 2014). Basaloid squamous cell carcinoma is a rare tumour of nasopharynx

that has the similar morphological features but low malignant potential when compared

to the other tumours occurring in head and neck sites (Li & Zong 2014; Nicholls &

Niedobitek 2013). In addition, the main purpose for this update in classification is to

determine the treatment options and prognosis for NPC regardless of differentiation

status or other factors (Nicholls & Niedobitek 2013).

8

1.1.3 Clinical presentation and treatment for NPC

Anatomically, NPC originated from the Fossa of Rosenmüller of the nasopharynx and

spreads towards local cavities (Dubrulle, Souillard & Hermans 2007; Li et al. 2012a).

NPC patients can be presented with one or multiple symptoms caused by presence of

tumour mass in the nasopharynx (epistaxis, nasal obstruction, and discharge),

dysfunction of the Eustachian tube (hearing loss), superior extension of the tumour

(headache, diplopia, facial pain and numbness) and neck masses (Wei & Sham 2005).

The most common presenting symptoms were neck masses, followed by nasal

symptoms, aural symptoms, and headache (Adham et al. 2012; Lee et al. 1997; Suzina

& Hamzah 2003; Tiong & Selva 2005; Wei & Sham 2005). The definite diagnosis of

NPC depends on the clinical presentation of the disease followed by endoscopic

examination of nasopharynx, histopathological examination of biopsy from

nasopharynx lesion, and visualisation with cross-sectional imaging. In recent years,

Epstein-Barr virus specific serology has demonstrated to be a useful tool in diagnosis of

NPC. Epstein-Barr virus antibody titres (IgA) against viral capsid antigen (VCA) and

early antigen (EA), and plasma EBV DNA were usually elevated in sera of NPC

patients (Chai et al. 2012; Coghill et al. 2014; De Paschale & Clerici 2012).

Furthermore, the levels of EBV specific screening markers were increased from early

stage to advanced stage. Unfortunately, majority of the patients with NPC were

diagnosed in advanced stage due to the fact that presentation of early stage NPC can

often be asymptomatic or misdiagnosed with benign conditions (Liu 1999; Prasad &

Pua 2000). In Malaysia, approximately 60% of the NPC patients presented to the clinic

have advanced stages of NPC (Azizah et al. 2016). The most common early symptom of

NPC, neck masses, is actually the sign of regional metastatic into lymph node which

implies advanced stage NPC. Distant metastasis is frequent among NPC patients, with

the common metastasis sites being bone, liver, and lung (Bensouda et al. 2011b).

NPC is highly responsive to radiotherapy in early stage with >90% of cure rate and thus

treatment with radiation alone is generally recommended (Chua et al. 2003; Lee et al.

2005; Ove, Allison & Lu 2010). However, the cure rate of radiotherapy for patients with

advanced stage of NPC remains unsatisfactory with a median survival of approximately

12 months (Ma & Chan 2006). Multidisciplinary treatment with concurrent

chemoradiation with or without adjuvant chemotherapy has been shown to improve the

9

overall survival and disease-free survival in locoregionally advanced NPC patients (Al-

Sarraf et al. 1998; Chan et al. 2005; Kwong et al. 2004; Lee et al. 2005; Lin et al. 2003;

Wee et al. 2005). Despite improvement in treatment, relapse or metastatic NPC remains

a major challenge for advanced stage NPC patients (Ma & Chan 2006). As the

understanding of the molecular pathogenesis of NPC increases and its strong association

with EBV, new treatment approaches were evaluated to improve the cure rate. For

example, molecular targeted therapies against epidermal growth factor receptor (EGFR)

and vascular endothelial growth factor (VEGF), adoptive therapy with autologous EBV-

specific cytotoxic T cells (CTLs), and vaccination with a modified vaccinia Ankara

(MVA) against EBV latent antigens were reported to have promising response in

treatments of advanced NPC (Chia et al. 2014; Hui et al. 2013; Lee et al. 2012; Ma et al.

2012; Taylor et al. 2014).

1.1.4 Etiological factors of NPC

The distinct epidemiology, racial, and geographical distribution of NPC reflects the

interplay of environmental factors, genetic susceptibility and Epstein-Barr virus

infection in its oncogenesis.

1.1.4.1 Environmental factors

Many agents in the environment have been suggested to be correlated with NPC risk.

One of the potent agents that has been widely reported to be associated with an

increased NPC risk in endemic regions is preserved foods especially Chinese-style

salted fish (Yu & Yuan 2002). Fish and other food that are preserved in salt are

traditional staple foods among endemic populations. Consumption of Chinese-style

salted fish, especially during childhood, has a significant correlation with an elevated

NPC risk (Jia et al. 2010; Yu et al. 1986). Besides salted fish, consumption of other

preserved foods including eggs, fruits, meats, rancid butter, and vegetables have also

been incriminated as risk factors for NPC (Armstrong et al. 1998; Farrow et al. 1998;

Feng et al. 2007; Gallicchio et al. 2006; Jia et al. 2010; Lee et al. 1994). On the other

hand, consumption of fresh fruits and vegetables have been reported to be protective

against NPC (Farrow et al. 1998; Feng et al. 2007; Yu & Yuan 2002). The presence of

carcinogenic compounds such as volatile nitrosamines and their precursors were often

detected in preserved foods and they were strongly associated with NPC development

10

(Poirier et al. 1989; Poirier et al. 1987; Ward et al. 2000). Volatile nitrosamines and

their precursors were shown to induce malignant tumours of the nasal and paranasal

regions in animal models (Zheng et al. 1994). In addition, mutagens and EBV activating

compounds were also reported to be detected in preserved foods (Poirier et al. 1989;

Shao et al. 1988).

Besides consumption of preserved foods, chronic tobacco smoking and heavy alcohol

consumption have also been suggested to be the important risk factors for NPC (Chen et

al. 2009; Xue et al. 2013). The cumulative effect of exposure to tobacco smoking and

alcohol consumption on the risk of NPC is substantial, and a dose dependent pattern

was observed (Marron et al. 2010). Non-dietary risk factors correlated with increased

NPC risk have also been reported. Occupational exposure to formaldehyde, fume and

wood dust were associated with increased risk of NPC (Armstrong et al. 2000; Cogliano

et al. 2005; Hildesheim et al. 2001; Vaughan et al. 2000).

1.1.4.2 Genetic susceptibility

The distinct racial distribution of NPC and widely documented familial clustering

suggested the important contribution of genetic predisposition in NPC carcinogenesis

(Jia et al. 2004; Levine et al. 1992; Zeng & Jia 2002). The strong association of EBV in

NPC pathogenesis has inspired the investigation on possible involvement of human

leukocyte antigen (HLA) in NPC. HLA class I genes is involved in the identification

and presentation of foreign antigens, including EBV peptides, to induce cytotoxic

immune response against infected cells. Recently, genome-wide association studies

(GWAS) has revealed multiple NPC associated loci within the HLA region (Bei et al.

2010; Tse et al. 2009). Apart from the HLA loci, several other loci across different

chromosomes have been reported to confer susceptibility for NPC. These loci included

locus region located on 4p15.1-q12, 5p13.1, 3p21, MDS1-EVI1 (myelodyplasia 1 and

ecotropic viral insertion site 1 fusion proteins) on 3p26.2, CDKN2A-CDKNS2B

(cyclin-dependent kinase inhibitor) gene cluster on 9p21 and TNFRSF19 (tumour

necrosis factor receptor superfamily, member 19) on 13p12 (Bei et al. 2010; Feng et al.

2002; Hu et al. 2008; Ng et al. 2009; Xiong et al. 2004). Genetic polymorphism in

environment-response genes has also been reported to increase the effects of exogenous

risk factors and is associated with NPC development. Many polymorphisms in genes

such as those involved in carcinogenic metabolism (CYP2E1, CYP2A6 and GSTM1),

11

DNA repair (XRCC1, hOGG1, ERCC1 and RAD51L1), cell cycle regulation (TP53,

MDM2 and CCND1), immune response (TLRs, PLUNC, interleukins and FAS), and

EBV receptors (PIGR and TCR) were shown to be associated with increased risks of

NPC (Cao et al. 2010; Chen & Chan 1994; Cho et al. 2003; Dai et al. 2014; Gao et al.

2009; He et al. 2007; He et al. 2005; Hildesheim et al. 1995; Hirunsatit et al. 2003; Jin

et al. 2014; Kongruttanachok et al. 2001; Liao et al. 2014; Liu et al. 2015; Qin et al.

2011; Qin et al. 2014; Tiwawech et al. 2006; Wei et al. 2007a; Wei et al. 2009; Wei et

al. 2007b; Wei et al. 2010; Xiao et al. 2010; Yang et al. 2012; Yang et al. 2009; Zhou et

al. 2006; Zhuo et al. 2009a; Zhuo et al. 2009b).

1.1.4.3 Epstein-Barr virus infection

In addition to the environmental factors and genetic predispositions, Epstein-Barr virus

(EBV) infection was consistently found in NPC. Non-keratinizing NPC especially

undifferentiated carcinoma is always associated with EBV, regardless of the racial and

geographical distribution, whereas the association of keratinizing NPC with EBV is less

consistent in non-endemic regions (Raab-Traub 2002; Tao & Chan 2007; Tsao et al.

2015). The involvement of EBV in NPC pathogenesis has been evidenced based on

multiple serological observations from NPC patients. The association of EBV infection

and NPC was first suggested based on the elevated levels of antibodies, especially IgA,

against EBV antigens in NPC patients (Chien et al. 2001; Henle et al. 1970). Besides,

EBV DNA and RNA were detected in almost all the tumour cells and precursor lesion

cells but not normal adjacent epithelial cells nor biopsies from non-NPC patients

(Niedobitek et al. 1991; Pathmanathan et al. 1995a; Ramayanti et al. 2017; Tsai et al.

1998). Moreover, the antibodies and plasma EBV DNA titres were positively correlated

with disease development and prognosis (Chai et al. 2012; Coghill et al. 2014; De

Paschale & Clerici 2012; Tao et al. 1995; Yeung et al. 1993). Lastly, the monoclonality

of EBV genome in NPC biopsies indicates that EBV infection precedes the clonal

expansion of malignant cells (Pathmanathan et al. 1995b; Raab-Traub & Flynn 1986).

The role of EBV in molecular pathogenesis of NPC will be further elaborated in the

following sections.

12

1.2 Epstein-Barr virus

Epstein-Barr virus (EBV) is a human herpesvirus that belongs to the genus

Lyphocryptovirus within the subfamily of gamma herpesviruses (Middeldorp et al.

2003). EBV was identified and designated in 1964 from a subpopulation of Burkitt

lymphoma derived tumour cells (Epstein, Achong & Barr 1964). Subsequently, EBV

was also identified as the first human tumour virus. EBV is highly infectious where

more than 90% of the world population has the lifelong infection with EBV (Young &

Dawson 2014). Despite widespread of EBV, the infection during childhood is usually

asymptomatic and results in lifelong healthy carrier. The infection during adulthood is

however symptomatic and may lead to infectious mononucleosis (Slots et al. 2006).

EBV is commonly transmitted through oropharyngeal secretion, blood transfusion, and

organ transplantation (Hjalgrim, Friborg & Melbye 2007). Although EBV infection is

asymptomatic, EBV is strongly associated with the development of several human

malignant diseases. EBV has been suggested to play an important role in the formation

and maintenance of NPC, Burkitt’s lymphoma, Hodgkin’s lymphoma, NK/T-cell

lymphoma, and gastric carcinoma (Carbone, Gloghini & Dotti 2008; Hjalgrim, Friborg

& Melbye 2007; Murray & Bell 2015; Nishikawa et al. 2014; Rochford & Moormann

2015; Young, Yap & Murray 2016).

1.2.1 Route of EBV entry and infection

The primary infection site for EBV in humans is suggested to be the epithelium of

oropharynyx (Tsao et al. 2015). EBV has strong tropism for both B lymphocytes and

epithelial cells. EBV is readily infected and transforms B lymphocytes through the

binding of viral envelop protein gp350 to CR2 receptor that is present on the surface of

B lymphocytes (Young, Arrand & Murray 2007). This interaction is facilitated by

binding of three EBV glycoproteins with the HLA class II antigens on the surface of B

lymphocytes (Tsang & Tsao 2015; Tsao et al. 2012). Once infected, B lymphocytes shut

down all the viral protein expression to avoid immune recognition and is driven into

resting memory B lymphocytes thus established a lifelong host infection (Hochberg et

al. 2004; Thorley-Lawson 2005). In contrast, EBV infection in epithelial cells is less

efficient due to the absence CR2 receptor on the epithelial cell surface. The entry of

EBV into epithelial cells can be achieved via direct cell-to-cell contact with EBV

lymphocytes or mediated by a multispan viral membrane protein that is encoded by

13

EBV BMRF2 ORF (Chesnokova & Hutt-Fletcher 2014; Imai, Nishikawa & Takada

1998). This membrane protein interacts with the integrin presence on the surface of

epithelial cells and triggers the incursion of EBV (Hutt-Fletcher 2007). Interestingly, the

EBV virions produced from lytic stage of B lymphocytes tend to be lacking gp42 and

preferably target epithelial cells, whereas the virions produced from epithelial cells were

high in gp42 and preferably target B lymphocytes (Shannon-Lowe et al. 2006). This

mechanism facilitated the continuous shuttling of EBV in between B lymphocytes and

epithelial cells, which was important for its persistency and spreading. Spontaneous

reactivation of infected B lymphocytes will be differentiated into viruses producing

plasma cells and migrated into the mucosal epithelium of oropharynx (Laichalk &

Thorley-Lawson 2005; Thorley-Lawson 2005). The viruses will be released into

mucosal surface, which, in turn sheds in the saliva (Hadinoto et al. 2009). The viruses

may then infect the epithelial cells in oropharynx, in this case nasopharyngeal

epithelium (Thorley-Lawson 2015).

1.2.2 Genome structure and strain variation of EBV

The first EBV genome that was completely sequenced and published in 1984 was the

B95.8 strain of EBV (Baer et al. 1984). EBV has a linear double-stranded DNA genome,

approximately 180 kilo base pairs in length and encoded for more than 85 genes. EBV

genome is divided into unique sequence domains, internal repeat sequences and a series

of 0.5 kb terminal direct repeats (Young, Arrand & Murray 2007). The genome exists as

a linear stranded DNA in the virus particle, whereas it exists as a circular episome inside

the nucleus of host cells (Baer et al. 1984). The detailed structures of EBV genome are

illustrated in Figure 1.4.

EBV strains can be classified into two subtypes, type 1 and type 2, which is categorized

based on the sequence polymorphisms within EBNA2, EBNA3A, EBNA3B and

EBNA3C genes (Sample et al. 1990). The EBNA2 proteins encoded by type 1 EBV

were only 56 % identical to type 2 EBV EBNA2 (Palser et al. 2015). The geographical

distributions of EBV subtypes vary extensively across the world. Type 1 EBV strains is

more prevalent worldwide especially among Asian and European population, while type

2 EBV strains is more abundant in Africa (Chang et al. 2009). Multiple novel strains of

EBV have been identified and 83 EBV genomes were completely sequenced since the

introduction of modern sequencing technologies (Farrell 2015; Feederle et al. 2015).

14

The complete EBV genome sequences have revealed a substantial genetic variation in

EBV genes (Farrell 2015; Palser et al. 2015). In particular, the most prominent gene of

variation that related to NPC was 30 base pairs at the c-terminal of LMP1 (da Costa,

Marques-Silva & Moreli 2015). This variation of LMP1 was highly associated with

poor prognosis of NPC (Pai et al. 2007). Recently, an EBV strain designated M81, was

isolated from a Chinese NPC patient and had genetic resemblance to other viruses

present in NPC (Tsai et al. 2013). The M81 EBV strain was reported to have enhanced

tropism for epithelial cells and has the ability to replicate at unprecedented rate.

15

Figure 1.4: EBV genome structure and mapping of its latent genes. A: Circular form of

B95.8 EBV genome and location of EBV latent genes. OriP represent the origin of

replication where host DNA polymerase is bound and initiate the viral genome

replication during latent stage. The short thick green arrows represent exons encoding

latent proteins: six Epstein–Barr nuclear antigens (EBNAs 1, 2, 3A, 3B and 3C, and

EBNA-LP), latent membrane proteins (LMPs 1, 2A and 2B), BamHI fragment H

rightward open reading frame (BHRF1) and BamHI-A fragment rightward reading

frame (BARF1). The short blue arrows at the top represent the highly transcribed non-

polyadenylated EBV-encoded RNAs (EBER1 and EBER2). Cp, Wp and Qp represent

the promoter for EBV transcription. B: Linear form of EBV B95.8 genome and ORF for

EBV latent protein including viral microRNAs (miR) on BamHI restriction map. TR

represents the terminal repeats at both end of the genome. Figure adapted from Epstein–

Barr virus: more than 50 years old and still providing surprises (Young, Yap & Murray

2016).

16

1.2.3 EBV latent and lytic states

In host cells, EBV infection can be in either lytic or latent states. During latent infection,

the EBV genome appears as a circular episome and it is replicated during cell division

by host DNA polymerase together with host chromosomes (Kenney & Mertz 2014).

Furthermore, only a limited set of viral latent genes were expressed for the persistence

of the EBV genome and the virons production was ceased in EBV latent infection. The

extent of EBV latent genes expression depends on the type of host cells and can be

classified into four different latency stages (Hammerschmidt 2015). For example, type

III latency genes for robust proliferation and expansion were expressed in

lymphoblastoid cells, whereas a set more restricted type II latency genes were expressed

in epithelial cells. Regardless the cell type, EBV latent genes were the contributing

factor to the development of EBV associated malignancies (Kang & Kieff 2015). The

detailed EBV latency programs were listed in Table 1.1.

In contrast to latent state, lytic state of EBV results in linearization of EBV genome,

mass production of virions, cessation of cell proliferation and eventually leads to death

of the host cell (Murata & Tsurumi 2014; Sato et al. 1990). The lytic state is supported

by expression of more than 70 lytic genes of EBV that is required for viral DNA

amplification and viral morphogenesis (Hammerschmidt 2015). Lytic reactivation of

latent EBV could be induced when the host cells were exposed to several stimuli such

as tetradecanoyl phorbol acetate (TPA), suberanilohydroxamic acid (SAHA), sodium

butyrate, B-cell receptor (BCR) stimulation, hypoxia and transforming growth factor

beta (TGFβ) (Kenney 2007). The lytic state of EBV infection was important for the

virus shredding and spreading from host to host, cell to cell (Kenney & Mertz 2014).

Besides the latent state, the EBV lytic state was also contributing to the development of

EBV malignancies including NPC through induction of genome instability, secretion of

growth factor and production of oncogenic cytokines (Fang et al. 2009; Hong et al.

2005; Li et al. 2016a; Wu et al. 2010).

17

Table 1.1: EBV gene expression in different type of latency programme

EBERs, non-coding RNA; BARTs, BamHI A rightward transcripts microRNAs; EBNA,

EBV nuclear antigen; LMP, latent membrane proteins; NPC, Nasopharyngeal

carcinoma; EBVGC, EBV associated gastric carcinoma. Table adapted from The role of

Epstein–Barr virus in epithelial malignancies (Tsao et al. 2015).

1.2.4 Contribution of EBV genes in NPC oncogenesis

The consistent detection of EBV in NPC cases, presence of monoclonal expansion of

vial genome and continued expression of EBV genes in tumour cells suggested that

EBV may play a key role in the development of NPC. In NPC, EBV infection was

classified as type II latency where the latent genes, including EBNA1, LMP1, LMP2,

BARF1, BHRF1 and BARTs were consistently expressed and detected (Gilligan et al.

1991; Houali et al. 2007; Liu et al. 2000; Ramayanti et al. 2017; Sam et al. 1993; Young

et al. 1988). The potential contributions of these EBV genes in development of NPC are

summarized below. Although EBNA2, EBNA3A, EBNA3B, EBNA3C and EBNALP

were not transcribed in NPC, their contribution to other EBV associated malignancies

will be discussed as well (Young et al. 1988). In addition, two early lytic genes, BZLF1

and BRLF1 and their oncogenic properties are also highlighted below.

Latency type EBV genes expressed Cell types or associated disease

Type 0 EBERs Memory B lymphocytes

Type II EBERs, EBNA1, BARTs Burkitt’s lymphoma

Type II EBERs, EBNA1, LMPs, BARTs NPC, EBVGC, Hodgkin

lymphoma, NK/T lymphoma

Type III

EBERs, EBNA1, EBNA2,

EBNA3A, EBNA3B, EBNA3C,

LMPs

Lymphoblastoid cell lines (LCL)

18

1.2.4.1 Latent membrane proteins

1.2.4.1.1 LMP1

LMP1 was considered as a classical oncogene as it was the first EBV protein that

demonstrated transforming ability in B lymphocytes and rodent fibroblast (Kaye, Izumi

& Kieff 1993; Wang, Liebowitz & Kieff 1985). Subsequent studies on LMP1 have

revealed this viral protein could induce multiple oncogenic activities in EBV infected

cells (Dawson, Port & Young 2012). LMP1 was a transmembrane protein containing a

cytoplasmic amino terminus, six hydrophobic transmembrane segments and a long

cytoplasmic carboxyl terminus (Morris, Dawson & Young 2009). The carboxyl

terminus of LMP1 contains three activation regions that involved in the regulation of

several signalling pathways including canonical and non-canonical NF-κB cascades,

PI3K/Akt cascade, MAPK cascade, JAK/STAT cascades and IRF7 cascades, thereby it

promotes cell proliferation, survival and resistance of apoptosis in NPC cells (Dawson,

Port & Young 2012; Kieser & Sterz 2015; Tsang & Tsao 2015). LMP1 can alter normal

cell growth control and survival through modulation of tumour suppression genes p53

and RASSF1A (Li et al. 2007; Sheu et al. 2004; Wu et al. 2004). LMP1 can also

stimulate the cell cycle through downregulates p16/ p21 and upregulates CDK2 (Lo et

al. 2004). Furthermore, LMP1 also confers resistance to TGFβ-mediated growth

suppression by inducing the inhibitor of differentiation protein 1 (ID1) in

nasopharyngeal epithelial cells (Lo et al. 2010). It also enhances cell survival by

promoting expression of anti-apoptotic genes, such as Mcl-1, while supressing the

expression of pro-apoptotic genes, such as BAD and Foxo3a (Lo et al. 2010; Tsao et al.

2015). LMP1 can contribute to the tumour microenvironment by inducing the

production of pro-inflammatory cytokines and chemokines (Dawson, Port & Young

2012; Huang et al. 2010).

In addition, LMP1 also promotes cell motility, invasion and metastasis in NPC cells.

LMP1 induces alteration of cell-cell adhesion through epithelial-mesenchyme-transition

(EMT) by repressing E-cadherin expression, while upregulating Twist, Snail and Slug

(Horikawa et al. 2011; Lo et al. 2004). It also alters the cell-matrix adhesion and matrix

degradation by inducing the expression of various matrix metalloproteinases (MMPs),

whilst suppressing the expression of tissue inhibitor of metalloproteinases (TIMPs)

(Chang, Chang & Hung 2008; Lee et al. 2007). LMP1 also contributed to angiogenesis

19

process by inducing the expression of VEGF, COX-2, HIF-1α and RAGE (Kondo et al.

2006; Morris, Dawson & Young 2009; Murono et al. 2001; Tsuji et al. 2008).

1.2.4.1.2 LMP2

The LMP2 genes encoded two EBV transmembrane proteins LMP2A and LMP2B. The

two forms of LMP2 differ in that only LMP2A has an additional cytosolic sequence of

119 amino acids at amino terminus (Dawson, Port & Young 2012). The proteins share

other structural characteristics including twelve transmembrane segments and a

cytoplasmic carboxyl terminus (Cen & Longnecker 2015). Although LMP2A and

LMP2B share common functions, only LMP2A can contribute to modulation of

PI3K/Akt pathway due to the presence of activation regions such as ITAM motif and

YEEA domain at cytoplasmic amino terminus (Cen & Longnecker 2015; Dawson, Port

& Young 2012). In contrast to LMP2A, the primary function of LMP2B was to

negatively regulate LMP2A signalling (Rovedo & Longnecker 2007). LMP2A was

involved in the activation of PI3K/Akt pathway, thus it can modulate PI3K/Akt

effectors and induce remarkable phenotypic changes in epithelia cells (Raab-Traub

2015). LMP2A induces anchorage-independent growth in soft agar and promote β-

catenin signalling in epithelial cells through activation of PI3K/Akt and phosphorylation

of GSK3 (Fukuda & Longnecker 2007; Morrison & Raab-Traub 2005; Scholle, Bendt

& Raab-Traub 2000). LMP2A also inhibits epithelial cell differentiation through

PI3K/Akt-mediated stabilisation of ΔNp63 (Fotheringham, Mazzucca & Raab-Traub

2010). In addition, LMP2A inhibits TGFβ-mediated apoptosis and stimulates mTOR-

mediated protein synthesis in epithelial cells through activation of PI3K/Akt pathway

(Fukuda & Longnecker 2004; Moody et al. 2005). LMP2A can induce cell migration

and invasion in epithelial cells which dependent on the integrin expression and the

activation of ERK, FAK, Sky and Src (Chen et al. 2002; Fotheringham, Coalson &

Raab-Traub 2012; Pegtel et al. 2005; Raab-Traub 2015). Furthermore, expression of

LMP2A and LMP2B can promote epithelial cell spreading and motility on extracellular

matrix (Allen, Young & Dawson 2005). Notably, expression of LMP2A induces EMT

and stem-like cell self-renewal in NPC cells (Kong et al. 2010). Lastly, LMP2A and

LMP2B can restrict the actions of interferon by increasing degradation of interferon

receptors and thus impair the anti-viral effects of interferon (Dawson, Port & Young

2012; Kong et al. 2010; Shah et al. 2009).

20

1.2.4.2 Epstein-Barr nuclear antigens

1.2.4.2.1 EBNA1

EBNA1 was the unique EBV nuclear protein that is consistently expressed in all form

of EBV latency in proliferating cells including NPC (Frappier 2015). EBNA1 was

critically required for the stable persistence of EBV in latently infected cells. EBNA1

modulates replication and mitotic segregation of EBV genome by tethering the origin of

replication (oriP) in EBV episomes to host cell chromosomes (Frappier 2012;

Sivachandran, Thawe & Frappier 2011). In addition to maintaining the EBV episome,

EBNA1 also directly contribute to cell proliferation, cell survival, and invasiveness

(Frappier 2015). EBNA1 can induce tumourigenic phenotypes in mice model (Cheng et

al. 2010; Kaul et al. 2007; Sheu et al. 1996). This is in concordance with the effects of

EBNA1 to increase the levels of nuclear proteins which affecting metastasis potential,

including Nm23-H1, maspin and stathmin1 (Cao, Mansouri & Frappier 2012). Increase

in nuclear levels of maspin and stathim1 directly contribute to metastases, whereas

relocation of Nm23-H1 to nucleus impairs its ability to suppress cell migration (Cao,

Mansouri & Frappier 2012; Murakami et al. 2005). EBNA1 can also dysregulate

various signalling pathways that are involved in carcinogenesis, including, enhanced of

AP-1 and STAT1 pathway and suppressing NF-κB and TGFβ signalling (O'Neil et al.

2008; Valentine et al. 2010; Wood et al. 2007).

Finally, EBNA1 has signalling activity with ubiquitin-specific protease 7 (USP7), a

protein that bind and regulate p53 and MDM2, which USP7 stabilises by preventing

ubiquitin-mediated protein degradation (Saridakis et al. 2005). EBNA1 can enhance the

degradation of p53 and MDM2 by blocking their interaction with USP7. Moreover,

EBNA1 induces loss of promyelocytic leukaemia (PML) nuclear bodies by binding to

both USP7 and CK2 kinases (Holowaty et al. 2003; Sivachandran, Cao & Frappier 2010;

Sivachandran et al. 2012). PML bodies were important for DNA repair and to induce

apoptosis, thus the loss of PML bodies greatly increases the genetic instability in

EBNA1 expressing cells (Bernardi & Pandolfi 2007; Frappier 2015; Sivachandran,

Wang & Frappier 2012). In addition, EBNA1 can promote oxidative stress induced

DNA damage by increasing reactive oxygen species and NADPH oxidase NOX1 and

NOX2 in cells (Cao, Mansouri & Frappier 2012).

21

1.2.4.2.2 EBNA2 and its co-activator EBNA-LP

EBNA2 and Epstein-Barr nuclear antigen leader protein, EBNA-LP were co-expressed

soon after EBV infection in resting B lymphocytes (Alfieri, Birkenbach & Kieff 1991).

Both proteins were essential for the conversion of B lymphocytes to lymphoblastoid cell

lines (Zhao et al. 2011b). EBNA2 binds to various cellular promoters through RBPJ

tethering and dysregulates their genes expression, thereby promoting viability and

proliferation of infected B lymphocytes (Kang & Kieff 2015; Kempkes & Ling 2015).

For example, EBNA2 promotes the expression of proto-oncogene Myc and induces

continuous B lymphocytes proliferation (Kaiser et al. 1999). Since RBPJ is important

for Notch signal transduction pathway, EBNA2 is also regarded as a functional

homologue of an activated Notch receptor (Hayward, Liu & Fujimuro 2006; Rowe,

Raithatha & Shannon-Lowe 2014; Zimber-Strobl & Strobl 2001). In contrast to EBNA2,

the principal function of EBNA-LP was to coactivate EBNA2 transcriptional activation

(Peng, Zhao & Kieff 2004; Peng et al. 2005). EBNA-LP facilitates EBNA2 coactivation

indirectly through the modulation of repressors, such as relocation of HDAC4,

displacement of Sp100 and Hp1α, disruption of matrix-associated deacetylase bodies

and the repressor complex NCoR (Ling et al. 2005; Portal, Rosendorff & Kieff 2006;

Portal et al. 2011; Portal et al. 2013).

1.2.4.2.3 EBNA3 family

EBNA3 family comprise of three closely related proteins, namely EBNA3A, EBNA3B

and EBNA3C. EBNA3 proteins are derived from a long transcript that is initiated at the

same promoter, however it is alternatively spliced into three structurally similar proteins

(Allday, Bazot & White 2015). All three EBNA3 proteins can bind to DNA-binding

factor RBPJ and negatively regulate EBNA2-mediated activation of transcription (Kang

& Kieff 2015; Robertson, Lin & Kieff 1996). Although they were related to one another,

only EBNA3A and EBNA3C are essential for B lymphocyte transformation, whereas

EBNA3B was dispensable and suggested to be a tumour suppressor (Maruo et al. 2011;

Ohashi et al. 2015; Styles et al. 2017). EBNA3B expression promotes secretion of a T-

cells chemoattractant CXCL10, leading to recruitment of T cells and induction of T cell-

mediated apoptosis (White et al. 2012). Recently, studies showed that the EBNA3

proteins regulate the expression of more than a thousand host genes, and majority of the

genes were regulated by combinations of EBNA3 proteins (Allday, Bazot & White

22

2015; Chen et al. 2006; Kelly et al. 2013; McClellan et al. 2012; Skalska et al. 2010;

White et al. 2010; Zhao et al. 2011a). Notably, EBNA3A and EBNA3C can induce

epigenetic repression of both the pro-apoptotic gene Bim and cell cycle inhibitor p16

(Paschos et al. 2009; Skalska et al. 2010). Moreover, EBNA3C also extensively

modulate cell cycle regulator, including E2F1, Chk2, c-Myc, cyclin, p53, pRb, and

MDM2 (Bhattacharjee et al. 2016; Saha & Robertson 2013; White et al. 2010).

1.2.4.3 BamHI-A rightward frame 1 (BARF1)

BARF1 gene was derived from the BamHI region of EBV genome and translated into a

protein of 31 kDa (Decaussin et al. 2000; Zhang et al. 1988). BARF1 was thought to be

a lytic gene in early studies but recent studies have shown that BARF1 gene was

extensively expressed in NPC and EBVGC as a latent gene (Ramayanti et al. 2017; Seto

et al. 2005). BARF1 was the homologue of human colony stimulating factor 1 (CSF-1)

receptor and may modulate the host immune response in epithelial cells (Strockbine et

al. 1998). BARF1 functions as a viral oncogene, which induces malignant

transformation of rodent fibroblast, immortalizes primary monkey epithelia cells and

enhances tumourigenicity in NPC cells (Seto et al. 2008; Wei et al. 1997; Wei & Ooka

1989). It was also shown to have an anti-apoptotic role through upregulating Bcl-2 level

in cells (Mohidin & Ng 2015; Wang et al. 2006). Co-expression of BARF1 with H-Ras

and SV40 T antigens can transform non-malignant human nasopharyngeal epithelia cell

NP69 (Jiang et al. 2009). BARF1 was quickly secreted into culture medium when

expressed in epithelial cells (Decaussin et al. 2000). The secreted form of BARF1, p29

was a strong mitogenic growth factor. Expression of BARF1 or treatments of cells with

its secreted form were also shown to promote cell growth and activate cell cycle in

epithelial cells of different origin (Chang et al. 2013; Houali et al. 2007; Kim et al. 2016;

Sakka et al. 2013; Sall et al. 2004; Seto et al. 2008; Seto et al. 2005; Wiech et al. 2008).

Recent studies showed that BARF1 promotes cell proliferation in gastric carcinoma by

upregulating NF-κB, miR-146, RelA and cyclin D1, whilst also downregulating

SMAD4 and p21 (Chang et al. 2013; Kim et al. 2016).

1.2.4.4 BamHI-H rightward frame 1 (BHRF1)

BHRF1 gene is an EBV early lytic gene that can also be expressed in virus latency

phase by utilizing different promoters in the EBV genome (Austin et al. 1988). The

23

BHRF1gene encodes a 17 kDa putative transmembrane protein which localize in the

mitochondria outer membrane (Khanim et al. 1997; Pearson et al. 1987). BHRF1

protein was structurally and functionally homologous to the oncoprotein Bcl-2.

Expression of BHRF1 can inhibit the apoptosis induced by a variety of stimuli (Davis et

al. 2000; Dawson et al. 1998; Fanidi, Hancock & Littlewood 1998; Flanagan & Letai

2008; Foghsgaard & Jaattela 1997; Henderson et al. 1993; Huang, Pan & Zhou 1999;

Huang et al. 1997; Kawanishi 1997; Khanim et al. 1997; Kvansakul et al. 2010). A

recent study showed that BHRF1 inhibits apoptosis by directly downregulating pro-

apoptotic Bcl-2 family proteins Bid, Bim, Bax and Puma (Kvansakul et al. 2010). In

addition to anti-apoptotic effects, BHRF1 can promote cell proliferation in epithelial

cells but not in NPC cells (Dawson et al. 1998; Huang, Pan & Zhou 1999; Huang et al.

1997).

1.2.4.5 EBV immediate-early proteins

BZLF1 and BRLF1 genes are the first two viral lytic genes expressed following EBV

reactivation and encode for the BZLF1 protein, Zta and the BRLF1 protein, Rta

respectively (Young, Arrand & Murray 2007). Subsequently, they cooperatively initiate

EBV lytic cascade by activating the transcription of early viral genes that encode the

viral replication proteins (Kenney & Mertz 2014). Following viral replication, late viral

genes that are required for viral morphogenesis were transcribed (Kenney & Mertz

2014). BZLF1 and BRLF1 were readily detected in the sera of NPC patients and NPC

biopsies (Cochet et al. 1993; Feng et al. 2000; Martel-Renoir et al. 1995). Furthermore,

recent studies revealed detection of BZLF1 and BRLF1 in NPC samples was due to

sporadic EBV reactivation in NPC tumours (Ramayanti et al. 2017). Asides from EBV

reactivation, BZLF1 and BRLF1 function as transcription factors and modulate several

cellular activities (Kenney 2007). A recent study showed that BZLF1 induce genome

instability in NPC cells by impairing the NHEJ mediated DNA damage repair pathway

and downregulating G2/M checkpoint (Yang et al. 2015). In addition, BZLF1 also binds

to p53, induces MDM2-independent ubiquitination of p53 and thus represses p53-

mediated transcription (Sato et al. 2009). BLZF1 was reported to suppress TNF-α and

INF-γ pro-inflammatory responses through disrupting NF-κB activation (Li et al.

2016b). Similar to BZLF1, BRLF1 can induce genomic instability and accumulate

24

tumorigenic phenotypes of NPC cells by interfering with chromosome segregation

(Huang et al. 2017).

1.2.4.6 EBV-encoded small RNAs

EBV encodes two small non-polyadenylated RNAs, EBER1 and EBER2, which

contains 167 and 172 nucleotides respectively, and were folded in double-stranded

RNA structures (Takada 2012; Takada & Nanbo 2001). They were transcribed by host

RNA polymerase III and are abundantly expressed in all forms of EBV latency (Takada

2012). EBERs unique structure facilitates their interaction with various cellular proteins

and thus modulates cell growth and innate immune response (Iwakiri 2014). EBERs can

induce autocrine cell growth in NPC and GC cells by increasing the expression of

insulin-like growth factor 1 (IGF-1) via RIG-1-mediated IRF3 signalling pathway

(Iwakiri 2014; Iwakiri et al. 2003; Iwakiri et al. 2005; Samanta, Iwakiri & Takada 2008;

Wong et al. 2005). EBERs also promote cell survival by blocking PKR signalling

pathway and thus inhibit Fas-mediated apoptosis (Nanbo et al. 2002; Nanbo,

Yoshiyama & Takada 2005; Samanta et al. 2006).

1.2.4.7 EBV-encoded microRNAs

EBV encodes two miRNA clusters which are transcribed into a total of 48 mature

miRNAs and named after the regions that are transcribed in EBV genome (Wang et al.

2017). The BHRF1 miRNA cluster encodes three miRNA precursors (miR-BHRF1-1,

miR-BHRF1-2 and miR-BHRF1-3) that generate four mature miRNA (miR-BHRF1-1,

1-2, 1-2 variant and 1-3) (Poling et al. 2017). The second miRNAs cluster located in

BART region, which encoded 22 miRNA precursors with 44 mature miRNAs (Lo et al.

2012; Poling et al. 2017). The BHRF1 miRNAs were only limited to cells in type III

latency and cooperatively functions as the key factors in B lymphocytes transformation

(Feederle et al. 2011; Haar et al. 2016; Vereide et al. 2014). Although absent in NPC

biopsies, low level of BHRF1 miRNAs were detected in NPC cells (Cosmopoulos et al.

2009; Li et al. 2012b). EBV miRNAs can regulate multiple viral and cellular genes at

post-transcriptional level by targeting their 3’ UTR and either blocking the translation

of mRNAs or degrading the mRNAs, thereby modulating host cell survival, cell

proliferation, immune response and promoting the development of NPC (Bartel 2009;

Lo et al. 2012; Skalsky & Cullen 2015; Wang et al. 2017). For example, overexpression

25

of miR-BHRF1-1 modulates cell survival in NPC cells by inhibiting expression of p53

(Li et al. 2012b). In addition, overexpression of BART miRNAs, such as BART cluster

1, miR-BART5 and mir-BART20, were also directly suppress apoptosis by targeting the

pro-apoptotic genes Bim, PUMA and Bad (Choy et al. 2008; Kim, Choi & Lee 2015;

Marquitz et al. 2011). Moreover, BART miRNAs can enhance cell proliferation and

metastasis potential by repressing the expression of DICE1, PTEN and E-cadherin (Cai

et al. 2015a; Cai et al. 2015b; Chan et al. 2012; Hsu et al. 2014; Lei et al. 2013). Lastly,

BART miRNAs also auto-regulate the expression of EBV genes to maintain latency,

evade immune response and repress inhibitory effects of viral proteins (Jung et al. 2014;

Lo et al. 2007; Lung et al. 2009).

1.4 In vivo and in vitro model systems of NPC

Previous studies of EBV involvement in NPC were conducted in established cancer cell

lines or in vitro models. In vivo models are derived from transplantation of human NPC

tumour into severely compromised immunedeficient (SCID) mice or genetically

engineered mouse (GEM) (Hsu et al. 2015; Tentler et al. 2012). The main advantage of

using in vivo models was that NPC xenografts retain the EBV episomes even after long

term expansion in immune deficient animals (Tsao et al. 2014). In addition, in vivo

models were also useful to examine cancer development and predict therapeutic

responses to drugs (Richmond & Su 2008). However, managing in vivo models are time

consuming, expensive and technically challenging (Morgan 2012; Richmond & Su

2008). In vitro models of NPC were derived from NPC patient’s tissues and established

into the long term NPC cell lines (Gullo, Low & Teoh 2008). Most of the NPC cell lines

used today do not harbour EBV due to fact that EBV infected NPC cells may lost their

EBV genome after adaptation of primary NPC tumours in an artificial medium or upon

prolonged propagation (Dittmer et al. 2008). C666-1 was one of the few NPC cell lines

that are stably harbouring EBV genome and resemble as type II EBV latency as in NPC

tumour (Cheung et al. 1999). However, C666-1 has been passaged in BALB/c nude

mice for prolonged period and thus its representative of cell base NPC model remains

controversial. An immortalised nasopharyngeal epithelial cell line, NP460hTert, was

established by immortalising primary non-malignant nasopharyngeal biopsies with

human telomerase (Li et al. 2006a). The NP460hTert cells are non-tumorigenic and

however they harbour several genetic alterations that were similar to premalignant

26

nasopharyngeal lesions (Lo, To & Huang 2004; Tsang et al. 2010). These genetic

alterations included loss of tumour suppressor gene p16, inactivation of another tumour

suppressor gene RASSFIA, activation of NF-κB and upregulation of ID-1 (Li et al.

2006a). These genetic alterations are suggested to confer growth advantages to the

premalignant nasopharyngeal lesions and predispose the nasopharyngeal epithelial cells

to EBV infections.

1.5 Aims and objectives

Premalignant nasopharyngeal lesions have been postulated to play important roles in

pathogenesis of NPC. The premalignant nasopharyngeal lesions may arise from

exposure to environmental factors and become susceptible to EBV. Once infected, EBV

viral genes may confer selective advantages for tumour growth and survival which

transform premalignant nasopharyngeal lesions into cancerous cells. Therefore,

understanding the pathogenic roles of EBV viral genes in premalignant nasopharyngeal

lesions provides insight to the contribution of EBV in the early stage of NPC

development. The aim of this study was to examine the pathogenic roles of EBV genes

in nasopharyngeal epithelial cells NP460hTert. To do this, 13 EBV genes were selected

for ectopic expression in a cell line that models a premalignant nasopharyngeal lesion

(NP460hTert). These 13 EBV genes were amplified using specific primers and cloned

into lentiviral vector pLVX-Puro. The EBV genes were transduced into NP460hTert via

lentiviral transduction to generate nasopharyngeal epithelial cell lines expressing

specific EBV proteins. The pathogenic roles of EBV genes regarding their capacity to

transform the nasopharyngeal epithelial cell line were evaluated through various

biological assays, including cell proliferation assays and migration assay.

27

Chapter 2

Methodology

2.1 Primers design

Three types of primers, the cloning primers, short primers and sub cloning primers were

designed and purchased from Integrated DNA Technologies. All primers were designed

based on Akata strain EBV genome sequences KC207813.1 and B95.8 strain EBV

genome sequences NC007605. The forward primers contain the same 5’ end upstream

sequence with Kozak sequence followed by c-Myc epitope tag and an ATG initiation

codon. All cloning primers were having HindIII/XhoI recognition sites except for

ENBA3C and BRLF1 primers which have only HindIII recognition site while BZLF1

primers have only XhoI recognition site. Gene expression primers were designed using

Primers3Plus (Untergasser et al. 2007). The specificity of each primer was checked

using BLAST search against the NCBI database. The sequences and details of primers

are listed in Table 2.1.

The primers were resuspened and diluted with sterile water before used. The optimal

annealing temperatures for PCR were obtained by a series of PCR at different

temperatures ranging from 55oC to 62oC as per Table 2.1.

28

Table 2.1: Cloning primers and gene expression primers list

Gene Cloning and gene expression primers from 5’-3’ EBV strain Annealing temperature (oC)

Product size (bp)

LMP1

Cloning primer forward: ATGGAACGCGACCTTGAGAG Cloning primer reverse: TTAGTCATAGTAGCTTAGCTG B95.8

57 1116

Gene expression primer forward: ACTGATGAACACCACCACGA Gene expression primer reverse: GTGCGCCTAGGTTTTGAGAG 55 160

LMP2A

Cloning primer forward: ATGGGGTCCCTAGAAATGGTG Cloning primer reverse: TTATACAGTGTTGCGATATG B95.8

56 1494

Gene expression primer forward: GGGGCAGTGGAAATAGAACA Gene expression primer reverse: GCCAATGAGGAAAATCAGGA 55 152

LMP2B

Cloning primer forward: ATGAATCCAGTATGCCTGCCTG Cloning primer reverse: TTATACAGTGTTGCGATATG B95.8

56 1137

Gene expression primer forward: TTCTGGTGATGCTTGTGCTC Gene expression primer reverse: AAAGGGCTGCACCAAGAGTA 55 234

EBNA1

Cloning primer forward: ATGTCTGACGAGGGGCCAGGTAC Cloning primer reverse: TCACTCCTGCCCTTCCTCAC B95.8

60 1794

Gene expression primer forward: AGTCGTCTCCCCTTTGGAAT Gene expression primer reverse: ATCGTCAAAGCTGCACACAG 55 198

EBNA2

Cloning primer forward: ATGCCTACATTCTATCTTGCG Cloning primer reverse: TTACTGGATGGAGGGGCGAG Akata

58 1461

Gene expression primer forward: GCCAAACACCTCCAGTCCTA Gene expression primer reverse: TCTGCGGGGTCTATAGATGG 55 237

EBNA3A

Cloning primer forward: ATGGACAAGGACAGGCCGGGTC Cloning primer reverse: TTAGGCCTCATCTGGAGGATC Akata

- 2835

Gene expression primer forward: GCCCTGAGCCAGAGTGTTAG Gene expression primer reverse: GATGTTGGACCACGTCAGTG - 193

29

EBNA3B

Cloning primer forward: ATGAAGAAAGCGTGGCTCAGC Cloning primer reverse: TCACTCATCGTTCGATGTTTC Akata

- 2757

Gene expression primer forward: CGATGAAGTCATGGAGCAGA Gene expression primer reverse: TGGATTTCAAGAGGGTCAGG - 189

EBNA3C

Cloning primer forward: ATGGAATCATTTGAAGGACAG Cloning primer reverse: TTAATCTAGCTCACTTTCAG Akata

- 3030

Gene expression primer forward: CCATATTACCCGTGGAATGC Gene expression primer reverse: CATCGTCCGAGGACTCTAGC - 223

EBNALP

Cloning primer forward: ATGGGAGACCGAAGTGAAGTC Cloning primer reverse: TTAGTCTTCATCCTCTTCTTC Akata

- 1521

Gene expression primer forward: TTCACCTTCAGGGCCACTAC Gene expression primer reverse: TAGTCTTCATCCTCTTCTTCTTCTATG - 150

BARF1

Cloning primer forward: ATGGCCAGGTTCATCGCTCAG Cloning primer reverse: TTATTGCGACAAGTATCCAG Akata

55 666

Gene expression primer forward: GCCTCTAACGCTGTCTGTCC Gene expression primer reverse: GAGAGGCTCCCATCCTTTTC 55 183

BHRF1

Cloning primer forward: ATGGCCTATTCAACAAGGGAG Cloning primer reverse: TTAGTGTCTTCCTCTGGAG Akata

55 576

Gene expression primer forward: AACACACACCGAACATGTGG Gene expression primer reverse: GGCTTCTAACATCCCACGAA 55 190

BRLF1

Cloning primer forward: ATGAGGCCTAAAAAGGATGG Cloning primer reverse: CTAAAATAAGCTGGTGTCAAAAATAG Akata

57 1818

Gene expression primer forward: AATTTACAGCCGGGAGTGTG Gene expression primer reverse: AGCCCGTCTTCTTACCCTGT 55 167

BZLF1

Cloning primer forward: ATGATGGACCCAAACTCGAC Cloning primer reverse: TTAGAAATTTAAGAGATCCTC Akata

55 738

Gene expression primer forward: GGGGCTAACCAAGAACAACA Gene expression primer reverse: GAAGCCACCCGATTCTTGTA 55 158

30

2.2 DNA sample preparation

Four templates of EBV genes (LMP1, LMP2A, LMP2B and EBNA1) were kindly

provided in pLXSN plasmids by Dr Christopher Dawson (Institute of Cancer and

Genomic Sciences, Birmingham, UK). The cDNA from lytic stage of NP460hTert-EBV

was served as the templates for the rest of EBV genes (EBNA2, EBNA3A, EBNA3B,

EBNA3C, BARF1, BHRF1 and BZLF1). Lytic stage of NP460hTert-EBV cells was

induced by treating the cells with sub lethal dose (8 µM) of SAHA for 72 hours.

2.2.1 Total RNA extraction for lytic stage NP460hTert-EBV

Total RNA from NP460hTert-EBV was extracted with AxyPrep Multisource Total

RNA Miniprep Kit (Axygen). Briefly, cells were trypsinised and pelleted by

centrifugation at 2000 rpm for 5 minutes. The supernatant were removed then 400 µL of

Buffer R-1 were added to lyse the cells. Cells were fully homogenized by passing the

lysate 10 times through a 21-gauge needle. A total of 150 µL of Buffer R-II was added,

vortexed for 30 second and then centrifuged at 12,000 g for 5 minutes. The supernatant

was transferred to a new tube followed by addition of 250 µL of isopropanol and then

mix by vortexing. The supernatant was extracted to a fresh spin column and centrifuge

at 6,000 g for 1 minute at room temperature. The column was subsequently washed with

500 µL of Buffer W1A, 700 µL of Buffer W1 and 700 µL of Buffer W2 by adding the

respective buffer into the column then centrifuge at 12,000 g for 1 minute. After drying

the column at 12,000 g centrifugation for 1 minute, 70 µL of Buffer TE was added to

the center of column membrane and incubate for 15 minutes at room temperature. Total

RNA was eluted by centrifuge at 12,000 g for 1 minute. Total RNA concentration was

determined by NanoDrop 2000 spectrophotometer (Thermo Scientific) and stored at -

80oC

31

2.2.2 DNase I treatment and cDNA synthesis for PCR amplification

Total RNA was treated with DNase I (Sigma Aldrich) before being converted to cDNA

with M-MuLV Reverse Transcriptase (NEB). For DNase I treatment, 8 µL of RNA, 1

µL of 10X reaction buffer and 1 unit/µL of DNase I were added to a PCR tube and

incubate for 15 minutes at room temperature. One µL of stop solution was added to

inactivate the DNase I and then heat at 70oC for 10 minutes to denature both the DNase

I and RNA followed by chilling the tube on ice. For reverse transcription reaction, RNA

mix and master mix were prepared as shown in following tables (Table 2.2, 2.3 and 2.4):

Table 2.2: RNA mix setup

Component Volume

DNase I treated RNA 1 µg

100 µM Random hexamer 1 µL

10µM dNTP mix 1 µL

Sterile filtered water To a total volume of 10µL

Table 2.3: Master mix setup

Component Volume

10 X M-MuLV buffers 2 µL

200 U/µL M-MuLV reverse transcriptase 1 µL

Sterile filtered water To a total volume of 10µL

Equal volume of master mix was added to the RNA mix and mixed well. The cDNA

synthesis was then carried out in a thermal cycler with the program listed in Table 2.4.

Table 2.4: cDNA synthesis conditions

Temperature Time

25oC 5 minutes

42oC 60 minutes

65oC 20 minutes

4oC Hold until collect

cDNA was stored at -20oC for further experiments.

32

2.3 Polymerase chain reaction (PCR)

PCR was performed using GoTaq Flexi DNA Polymerase kit (Promega). Briefly, PCR

reactions were prepared in a 25 µL mix which consists of following components listed

in Table 2.5 on ice.

Table 2.5: PCR setup

Component Volume Final Concentration

5X Green GoTaq Flexi Buffer 5 µL 1X

25mM MgCl2 solution 1 µL 1.0 mM

10µM dNTP mix 1 µL 0.4 µM each dNTP

10µM Forward primer 1.25 µL 0.5 µM

10µM Reverse primer 1.25 µL 0.5 µM

5 U/µL GoTaq DNA

polymerase 0.25 µL 1.25 U

Plasmids or cDNA 100 ng

Sterile filtered water To a total volume of 25 µL

PCR was carried out in a VeritiTM 96-Well Thermal Cycler (Applied Biosystems) with

conditions as follow:

Table 2.6: Thermocycling conditions for PCR

Step Temperature Time Number of cycles

Initial denaturation 95 2 minutes 1 cycle

Denaturation 95 30 seconds

35 cycles Annealing Primers specific 45 seconds

Extension 72 1 minute per kb

Final extension 72 5 minutes 1 cycle

Soak 4 Indefinite 1 cycle

33

2.4 PCR free nucleotide removal

PCR products were cleaned up using AxyPrep PCR Clean-up Kit (Axygen). Briefly,

100 µL of Buffer PCR-A was added to the PCR sample and mixed well. The reaction

was transferred into PCR columns and then centrifuged at 12,000 g for 1 minute. The

column was washed with 700 µL of Buffer W2, followed by 400 µL Buffer W2. The

columns were dried by centrifugation at 12,000 g for 2 minutes. After incubation with

30 µL of eluent for 10 minutes, final cleanup PCR products were eluted from the

columns into fresh tubes by centrifugation at 12,000 g for 2 minutes. Eluted PCR

products were stored at 4oC.

2.5 Agarose gel electrophoresis

PCR products were analyzed using gel electrophoresis on 0.6 – 1% w/v agarose gels

depending on the products size. Agarose powder (Norgen Biotek) was dissolved in a

suitable volume of 1X TAE buffer (Tris-acetate-EDTA, 40 mM Tris, 20 mM acetic acid,

and 1 mM EDTA). Ethidium bromide or SyBr green dye was added into the cooled

solution. The agarose solution was then poured into a casting tray with a gel comb and

allowed gel to solidify for 30 minutes. Next, the tray was transferred into an

electrophoresis tank filled with 1X TAE buffer. DNA ladder with dye (Bioline or

Promega) and the PCR products were loaded, and the gel was run at 100 V for 20

minutes before visualization with gel doc (UVP) or UV transilluminator (UVP).

34

2.6 Cloning

The EBV genes amplified from DNA templates were cloned into HindIII-HindIII or

HindIII-XhoI sites of pcDNA 3.1 Hygro (+). The map of pcDNA 3.1 Hygro (+) was

shown in Figure 2.1.

Figure 2.1: The restriction recognition sites of HindIII and XhoI in pcDNA 3.1 Hygro

(SnapGene).

35

2.6.1 Restriction enzyme digestion

Cleaned up PCR products and pcDNA 3.1 Hygro (+) (kindly provided by A/P Peter

Morin) were digested with restriction enzymes HindIII (NEB) only or HindII/XhoI

(NEB) depending on the compactible digestion site on PCR products. The digestions

were prepared in 15 µL mix as listed in Table 2.7.

Table 2.7: Restriction digestion setup

Component Volume

10X NEB Cut Smart buffer 1 µL

HindIII or HindIII/XhoI 0.5 µL each enzyme

pCDNA 3.1 Hygro (+)/PCR products 1 µg for plasmids and 5 µL for PCR products

Sterile filtered water To a total volume of 15 µL

Restriction digestion was performed by incubation at 37oC water bath for 2 hours. Two

µL of shrimp alkaline phosphatase (NEB) was added to pcDNA 3.1 Hygro during 90

minutes incubation time.

2.6.2 Gel purification

The restriction digestion products were purified with AxyPrep DNA Gel Extraction Kit

(Axygen). Briefly, the products were run on agarose gel with conditions described

previously except for adding loading dye to the samples before loaded into gel. The gel

was imaged on UV transilluminator while the gel slices containing the samples band

were excised with a clean scalpel and transferred into the fresh tubes. Three hundred µL

of Buffer DE-A was added, vortex to resuspend and then heated at 75oC for 8 minutes

to dissolve the agarose slice. Next, 150 µL of Buffer DE-A was added and mixed well.

The solubilized agarose was then transferred to a miniprep column and centrifuge at

12,000 g for 1 minute. The columns were washed with 500 µL Buffer W1 and followed

by 700 µL Buffer W2 twice. After the columns were dried by centrifugation at 12,000 g

for 1 minute, 30 µL of eluent was added to the center of the membrane and incubate for

10 minutes. The DNA samples were then eluted to a fresh tube by centrifugation at

12,000 g for 1 minute.

36

2.6.3 Ligation of PCR products into pcDNA 3.1 Hygro

Ligation of PCR products into pcDNA 3.1 Hygro were carried out with T4 DNA ligase

(NEB) at 1:4 plasmids to gene fragment ratio. Ligation reactions were prepared in 20

µL on ice as listed in Table 2.8.

Table 2.8: PCR products ligation setup

Component Volume

Gene fragments 8 µL

pcDNA 3.1 Hygro 2 µL

10X T4 DNA ligase Bufer 2 µL

T4 DNA ligase 1 U/µL 1 µL

Sterile filtered water To a volume of 20 µL

Negative control was prepared by replacing the gene fragment with sterile filtered water.

The ligation mixes were incubated at 16oC for 2 hours then incubated overnight at 4oC.

The products of ligation were then kept at -20oC prior to transformation.

2.7 Preparation of chemically competent cells

Two different strains of E.Coli, JM109 (Promega) and Top10F’ (ThermoFisher

Scientific), competent cells were used to generate competent cells. E.Coli cells were

picked from a freshly streaked LB agar (LabM) plate and transferred into a shake flask

containing 5 mL LB medium (LabM). The cells were cultured overnight at 37oC. A 200

mL LB medium inoculated with 2 mL of overnight culture was grown with aeration to

mid logarithmic phase (OD600 approximately 0.3 – 0.4). The culture was then kept on

ice for 20 minutes followed by aliquot equally to five 50 mL tubes, then pelleted at 4oC,

3,000 g for 10 minutes. The cells were resuspended gently in 2 mL of pre-chilled

buffers then pool all the suspension into one 50 mL centrifuge tube. The buffers used

were either CCMB80 buffer (calcium/manganese-based, 80 mM calcium chloride, 20

mM manganese chloride, 10 mM magnesium chloride, 10 mM potassium acetate and 10%

glycerol) or CaCl2 buffer (100 mM calcium chloride, 10% glycerol). The suspension

was incubated on ice for 20 minutes and pelleted by centrifugation at 4oC, 3,000 g for

10 minutes. The competent cells were resuspended gently in 2 mL of either buffers and

37

mixed well without vortexing. The competent cells were divided in aliquots of 50 µL

each in pre-chilled Eppendorf tubes and stored at -80oC until use.

2.8 Transformation

The frozen competent cells were thawed on ice for 20 minutes, gently mixed with 5 µL

of DNA (ligation mix or purified plasmids) and then incubated on ice for 30 minutes.

The competent cells were subjected to heat shock at 42oC for 45 seconds, incubated on

ice for 2 minutes and then diluted with 500 µL of LB broth. Diluted cells were

outgrowth at 37oC with aeration for 1 hour. The transformed cells were plated on LB

agar plates containing 100 µg/mL of carbenicillin (Sigma Aldrich) or ampicillin (Sigma

Aldrich). Transformation efficiency was evaluated by transforming competent cells with

200 pg PUC19 and then counting the number of colonies after 16 hours incubation at

37oC.

2.9 Plasmid purification

Isolation of plasmids from transformed competent cells was carried out with EasyPure

Plasmid Miniprep Kit (Transgen). Transformed competent cells were picked from

overnight culture LB plates, transferred into 5 mL LB medium with antibiotic selection

and incubated overnight at 37oC with aeration. An aliquot of 1.5 mL of cells were

pelleted by centrifugation at 10,000 g for 1 minute. The supernatant was removed, and

250 µL of Buffer LB was added to lyse the cells. A 350 µL of Buffer NB was added to

neutralize the reaction and the lysate was incubated at room temperature for 2 minutes.

Next, the lysate was centrifuged at 12,000 g for 5 minutes. The supernatant was

transferred to a fresh spin column and centrifuged at 12,000 g for 1 minute at room

temperature. The column was washed with 600 µL of Buffer WB by adding the buffer

into the column then centrifuged at 12,000 g for 1 minute. After drying the column at

12,000 g centrifugation for 2 minutes, 30 µL of Buffer EB was added to the center of

column membrane and incubated for 15 minutes at room temperature. Plasmid was

eluted by centrifugation at 12,000 g for 2 minutes. The plasmid concentration was then

determined by NanoDrop 2000 spectrophotometer (Thermo Scientific). The purified

plasmids were verified by using diagnostic restriction enzyme digestion.

38

2.10 Sub-cloning into pLVX-Puro

The EBV genes from pcDNA 3.1 Hygro were used as templates for PCR with

subcloning primers as per Table 2.9. The PCR products were cloned into EcoRI-XbaI

sites of pLVX-Puro. The restriction map of pLVX-Puro was shown in Figure 2.1. The

cloning method was similar to pcDNA 3.1 Hygro cloning described in the previous

sections. Diagnostic restriction enzyme digestion was carried to verify the insert.

Figure 2.1: The restriction map of pLVX-Puro for EcorRI and XbaI.

Table 2.9: The sub-cloning primers

Sub-cloning primer forward

5’ CACACACA GAA TTC ACC ATG GCA TCA ATG CAG AAG CTG ATC TCA GAG GAG GAC CTG ATG 3’

Sub-cloning primer reverse 5’ AAC TAG AAG GCA CAG TCG AGG 3’

39

2.11 Maxi preparation of pLVX-EBV

Maxi preparation of plasmid DNA from bacteria transformed with pLVX clones was

carried out with QIAGEN Plasmid Maxi Kit (Qiagen).

2.11.1 Preparation of bacteria culture

Transformed cells were prepared as described in the previous sections. A 200 mL LB

broth containing selective antibiotic was inoculated with 400 µL of overnight culture

and grown with aeration for 16 hours.

2.11.2 Extraction of plasmid

The cells were harvested by centrifugation at 6,000 g for 15 minutes at 4oC. Ten mL of

Buffer P1 containing RNase A and LyseBlue reagent was added and vortex to

resuspend. Next, 10 mL of buffer P2 was added, mix thoroughly by vigoursly inverting

the tubs for 6 times and then incubate at room temperature for 5 minutes. Similar step

was repeated with 10 mL of pre-chilled buffer P3 except the incubation was carried out

on ice for 20 minutes. The suspension was centrifuged at 18,000 g for 30 minutes at 4oC.

Meanwhile, a Qiagen-tip 500 column was equilibrated with 10 mL buffer QBT. The

supernatant was transferred to the column and was allowed to pass through the resin by

gravity flow. The column was then washed twice with 30 mL of buffer QC. Plasmid

was eluted to a fresh 50 mL tubes with 15 mL buffer QF.

2.11.3 Precipitation of plasmid

A 10.5 mL of room temperature isopropanol was added to the eluted plasmid, mixed

well and centrifuged immediately at 15,000 g for 30 minutes at 4oC. The supernatant

was removed and then 5 mL of room temperature 70% ethanol was added to resuspend

the plasmid. The plasmid was pelleted by centrifugation at 15,000 g for 10 minutes and

then air dried for 10 minutes. A total of 200 µL TE buffer was added to resuspend the

plasmid. The plasmid concentration was determined by NanoDrop 2000 and stored at -

20oC.

40

2.12 Cell lines and reagents

NP460hTert, which is a telomerase immortalized nasopharyngeal epithelial cell lines,

and NP460hTert-EBV, an Akata EBV infected NP460hTert, were kindly gifted from

Professor George Sai Wah Tsao (Department of Anatomy, University of Hong Kong,

Hong Kong, China). The establishment and characterization of the immortalized

nasopharyngeal epithelial cells have been described in previous studies (Li et al. 2006a;

Tsang et al. 2010). The parental and EBV infected nasopharyngeal epithelial cells were

cultured in a complete medium consists of 1:1 ratio of Defined Keratinocytes Serum

Free Medium (ThermoFisher Scientific) and EpiLifeTM Medium (ThermoFisher

Scientific) with growth supplements plus 100 U/mL penicillin-streptomycin

(ThermoFisher Scientific).

HEK293T is an adenovirus-immortalized human embryonic kidney cells with a gene

encoding the SV40T-antigen and a neomycin resistance gene (Pear et al. 1993) was

kindly provided by Dr Yap Lee Fah. Cells were cultured in high glucose Dulbecco’s

modified Eagle’s medium (DMEM) (ThermoFisher Scientific) supplement with 10%

fetal bovine serum (FBS) (ThermoFisher Scientific) and 100 U/mL penicillin-

streptomycin (ThermoFisher Scientific).

2.13 Cell lines maintenance

All cell lines were cultured in 37 oC humidified incubators supplied with 5% carbon

dioxide gas. The cells were grown in 75cm2 flasks and fed every two days until it

reached 90% confluence, afterwhich, were then sub-cultured accordingly. The cells

were washed with 5 mL Dulbecco’s phosphate buffered saline (DPBS) (ThermoFisher

Scientific) and trypsinized with 2 mL trypsin (ThermoFisher Scientific). The cells were

returned to the incubator for 5 minutes. After 5 minutes, the flasks were removed from

incubator and gently tapped until all the cells were dislodged. A 3 mL of complete

DMEM containing 10% FBS were added to recover the cells and to inactivate trypsin.

The cells were pelleted by centrifugation at 1,000 g for 5 minutes. The supernatants

were removed, and 1 mL of fresh medium was added to resuspend the cells. The total

cells numbers were counted using Luna automated cell counter (Logosbio). The cells

were then plated at a cell density as indicated in the specific experimental design.

41

2.14 Cell lines cryopreservation and recovery from cryopreservation

The cells were pelleted as described in the previous method. Pellets were resuspended in

1 mL of freezing medium containing 90% FBS (ThermoFisher Scientific) and 10%

DMSO (ThermoFisher Scientific) and transferred into cryo tubes (Thermo Fisher). The

cryo tubes were placed into a Mr Frosty and keep in -80 oC for overnight. On the next

day, the cryo tubes were transferred to liquid nitrogen storage for long term preservation.

Cells were recovered from cryopreservation by quick thaw in a 37 oC water bath after

remove from liquid nitrogen storage. Equal volume of fresh complete medium was

gently added to the cells suspension. The mixtures were transferred into a universal

bottle then centrifuge at 1,000 g for 5 minutes to pellet the cells. The cell pellets were

resuspended in fresh 1 mL complete medium and seed to new flasks accordingly.

2.15 Transfection of HEK293T and lentiviruses production

The HEK293T cells were seeded at 1 x 106 cells in T75 flask and was allowed to reach

90% confluence prior transfection. Transfections were performed with

polyethylenimine (PEI) (Sigma Aldrich). The vectors mix, and PEI solution were

prepared two separated fresh tubes as followed:

Tube 1: Vectors mix

Dilute pLVX, psPAX and pMD2.G at a 4:3:1 ratio in 3 mL of Opti-MEM.

Filtered with 0.22µm PES filter (Sartorius).

Tube 2: PEI solution

Dilute 1.5 µL of PEI stock solution in 7 mL Opti-MEM.

Filtered with 0.22µm PES filter (Sartorius).

The solutions were incubated separately for 5 minutes and then equal volume of diluted

PEI was added to vectors and mixed well by pipetting. The mixture was incubated at

room temperature for 20 minutes. By the end of the incubation time, 5 mL of

PEI/Vector solution was added to the HEK293T cells and these were incubated at 37oC

for 4 hours. Then, the cells were supplemented with 10 mL of fresh medium and further

incubated for 48 hours. The lentiviral containing medium was collected, filtered with

42

0.45µm PES filter (Sartorius) and then 1.5 mL was aliquoted into each fresh tube. The

virus stocks were kept in -80oC before transduction.

2.16 Establishment of NP460hTert puromycin selection concentration

NP460hTert cells were seeded at 2.5 x105 cells per wells in 6 wells plate one day prior

the puromycin selection. Six different concentrations of puromycin (0, 0.25, 0.5, 0.75, 1

and 2 µg/mL) were prepared by diluting the stock puromycin solution (1 mg/mL)

(Sigma Aldrich) with fresh medium. The cells were washed with PBS and then replaced

with complete medium containing different concentrations of puromycin. The optimal

concentration of puromycin was determined 2 days after incubation.

2.17 Transduction of NP460hTert

NP460hTert was seeded at 5 x 105 cells in 100 mm dish and allowed to reach 50 %

confluence. The virus stock was thawed on ice for 20 minutes and then diluted with

equal volume of complete medium. Polybrene (Sigma Aldrich) with final concentration

of 8 µg/mL was added to the diluted virus solution and incubated for 5 minutes. The

medium of NP460hTert was replaced with 3 mL of diluted virus mix and allowed to

incubate overnight at 37oC. Culture medium was changed at 16 hours post transduction.

After 48 hours, the cells were sub-cultured into two new 100 mm dish with complete

medium contain 0.5 µg/mL puromycin. The cells were fed every 3 days with fresh

medium with puromycin until resistant cells were identified. All the resistant cells were

pooled into a polyclonal population and expanded to T75 flask. Once the stable cells

were reaching confluence, half of the cells were preserved as cells stocks while other

half were sub-cultured for further experiments.

2.18 RNA preparation for reverse-transcription PCR analysis

2.18.1 RNA extraction from transduced NP460hTert

RNA from transduced NP460hTert was extracted with RNeasy Mini Kit (Qiagen).

Briefly, 5 x 105 cells were seeded in T25 flask and harvested once it reaches 90 %

confluence. The cells were trypsinized and then pelleted by centrifugation at 1,000 g for

8 minutes. The pellets were then washed with 1 mL of PBS and then resuspended in 350

mL buffer RLT with 1/100 β-mercaptoethanol. Cells were lysed by transferring the

43

suspension into QiaShredder (Qiagen) and centrifuged at 12,000 g for 15 seconds. A

total of 350 µL 70% ethanol was added to the filtered mixture followed by transferring

700 µL of mixture into a new RNeasy column. After centrifugation at 12,000 g for 15

seconds, the column was washed with 350 µL of buffer RW1. DNase I mixture (10 µL

DNase I + 70 µL buffer RDD) were added to the membrane of column and then it was

incubated for 15 minutes at room temperature. The column was subsequently washed

with 350 µL of buffer RW1 and 500 µL of buffer RPE twice by adding the respective

buffer into the column then centrifuged at 12,000 g for 15 seconds. Next, the column

was dried by centrifugation at 12,000 g for 1 minute. RNase free water was added to the

column membrane, and was subsequently incubated at room temperature for 15 minutes.

RNA was eluted into the fresh tubes by centrifugation at 12,000 g for 2 minutes. The

concentration of RNA was measure by NanoDrop 2000 spectrophotometer (Thermo

Scientific) and stored at -80oC.

2.18.2 cDNA synthesis

cDNA was synthesized with High-Capacity cDNA Reverse Transcription Kit

(ThermoFisher Scientific). For each cDNA synthesis reaction, RNA mix and RT master

mix were prepared as following tables (Tables 2.10, 2.11 and 2.12):

Table 2.10: RNA mix setup for High-Capacity cDNA Reverse Transcription Kit

Component Volume

RNA 1 µg

RNase free water To a total volume of 10µL

Table 2.11: Master mix setup for High-Capacity cDNA Reverse Transcription Kit

Component Volume

10 X RT buffer 2 µL

25 X dNTP mix (100 mM) 0.8 µL

10 X RT random primers 2 µL

MultiscribeTM reverse transcriptase 50 U/μL 1 µL

Nuclease free water To a total volume of 10µL

44

Equal volume of RNA mix was added to the master mix and mixed well by pipetting.

The cDNA synthesis was then carried out in a thermal cycler with following program

listed in Table 2.12.

Table 2.12: cDNA synthesis conditions for High-Capacity cDNA Reverse Transcription

Kit

Temperature Time

25oC 10 minutes

37oC 120 minutes

85oC 5 minutes

4oC Hold until collect

cDNA was stored at -20oC for further experiments.

2.18.3 Reverse transcription polymerase chain reaction

Reverse transcription PCR preparation and conditions were as described above. cDNA

from HONE1, CNE2, IgG activated Akata and pLXSN plasmids were used as template

for positive control. GAPDH was amplified as RT PCR loading control. The PCR

products were run on 1% gel, 100 V for 20 minutes then visualization with gel doc

(UVP).

2.19 Protein extraction and quantification

Five hundred thousand cells were seeded in 100 mm dish and harvested when the cells

reached 90% confluence. Cells were washed with cold PBS and then detached from the

dish with cell scrapper. One mL of cold PBS was added to resuspend the detached cells.

The suspension was transferred into a pre-chilled micro centrifuge tube. Cells were

pelleted with 2 minutes of 12,000 g centrifugation. Thirty µL of 1X RIPA buffer

(ThermoFisher Scientific) containing protease and phosphatase inhibitor was added to

lyse the cells pellet. After sonication for 2 minutes, the sample was incubated on ice for

30 minutes, followed by centrifugation at 4oC, 13,000 g for 30 minutes. The supernatant

was pipetted into new fresh tubes and protein concentrations were determined by using

Quick StartTM Bradford Protein Assay (Bio-Rad).

45

2.19.1 Bradford protein assay

Briefly, 250 µL of 1x Dye Reagent was added into each well of 96 wells plate. Protein

samples were diluted with PBS at 1:10 ratio. Diluted protein samples and BSA standard

were then added into the Dye reagent. The mixtures were incubated at room temperature

for 5 minutes before the absorbance at 595 nm was read on Infinite M200 Pro multiplate

reader (TECAN). Concentration of protein samples was then calculated from the

standard curve generated at 595 nm.

Forty µg of protein sample was diluted at 1:3 with 4x LaemmLi sample buffer (Bio-Rad)

containing 10% β-mercaptoethanol. The mixtures were boiled at 95oC for 5 minutes and

kept at -80oC prior experiment.

2.20 SDS-PAGE

Ten percent of resolving gel was prepared by adding 42 µL of 10% (w/v) ammonium

persulfate (APS) solutions (ThermoFisher Scientific) and 4.2 µL

Tetramethylethylenediamine (TEMED) (Acros Organics) into 7.2 mL of 10% EZ-Run

gel solution (ThermoFisher Scientific) then mixed well.

The gel was casted in the gel cassette with a gel comb inserted. Once the gel has set, it

was kept in 4oC for overnight. The gel was thawed on the following day and then placed

into an electrophoresis tank filled with 1X EZ-Run running buffer (ThermoFisher

Scientific). The gel comb was removed, and each well was washed with running buffer.

A protein ladder (Bio-Rad) and equal amounts of protein samples were loaded into the

gel. The gel was run at 50V for 5 minutes followed by 100 V for 90 minutes. Gel

electrophoresis was carried out with Bio-Rad Mini-Protean Tetra Cell.

2.21 Western blotting

2.21.1 Transferring the protein from gel to PVDF membrane

The gel was removed from gel cassettes and incubated in transfer buffer (25 mM Tris,

192 mM glycine, 10% methanol) for 10 minutes. PVDF membrane and filter paper were

soaked in the transfer buffer prior to the assembly. The gel, PVDF membrane together

with two layers of filter paper were tightly assembled in the transfer cassette. The

46

transfer cassette was then placed into transfer tank filled with transfer buffer and an ice

block. Transfer was carried out at 100 V for 90 minutes on ice.

2.21.2 Antibody incubation and imaging

The membrane was removed from transfer cassette, rinsed with sterile water and then

stained with Ponceau S solution for transfer validation. After rinsing off Ponceasu S

stain with TBS-T (Tris buffered saline Tween, 50 mM Tris, 150 mM NaCl, 2 mM KCl,

0.1% Tween 20, pH 7.4), the membrane was blocked in 5% skim milk solution (5% w/v

skim milk in TBS-T) or 1% BSA (1% w/v BSA in TBS-T) for 1 hour at room

temperature followed by incubation at 4oC overnight with primary antibody solution

(Table 2.13). The following day, the membrane was rinsed with TBS-T 3 times for 5

minutes, incubated in corresponding HRP-conjugated secondary antibody (2.14) for 1

hour at room temperature and then further rinsed with TBS-T 3 times for 5 minutes. The

antigen-antibody complexes were detected by WesternBright ECL HRP substrate kit

(Advansta) according to the manufacturer’s protocol and visualized at 30 seconds

exposure by using BioSpectrum 810 Imaging System (UVP).

2.21.3 Stripping and reprobing

The membrane was incubated in pre-warm stripping buffer (62.5 mM Tris, 2% SDS,

100 mM β-mercaptoethanol, pH 6.8) at 50oC for 45 minutes and then rinse with sterile

water for 5 minutes. The membrane was reprobed with antibody as described above.

Table 2.13: Primary antibody list

Antibody Species Dilution Supplier c-Myc Mouse monoclonal 1:1000 Clonetech (9E10) Β-actin Mouse monoclonal 1:1000 SantaCruz (C4)

Table 2.14: Secondary antibody list

Antibody Dilution Supplier Anti-Mouse preoxidase 1:5000 SantaCruz

47

2.22 Cell proliferation assay with MTT

For cell proliferation assay, 1500 cells were seeded in six replicates in 96 wells plates

and grown for 5 days. The MTT signals were ready every 24 hours. Briefly, every 24

hours 10% MTT solutions (3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium

Bromide, Thiazole Blue) (Merck Millipore) were added into each well and then

incubated for 4 hours. After the incubation, medium with MTT solutions were replaced

with 150 µL of DMSO. The plates were shaked for 180 seconds then the absorbance

value was read immediately at 570 nm with 650 nm as reference wavelength.

2.23 Migration and wound healing assay

For cell migration assay, 7 x 105 cells were seeded in triplicates, plated in 6 well plates

and incubated in complete medium for overnight. On the following day, 10 µg/mL of

mitomycin C (Sigma Aldrich) were added into each well and incubated for 2 hours.

After the incubation, the cells were scratched horizontally with a P200 pipette tip. The

medium was removed and the cells were washed with 1 mL of PBS twice. Five mL of

supplement free medium were then added to each well. Three spots along the scratch

wound were selected and viewed under microscope. The wound pictures were taken

from 0 hours until the wounds were healed with Leica DMI 1B (Leica Biosystem) at

100X phase contrast resolution. The open wound areas were analyzed by using Tscratch

(Geback et al. 2009) with default setting. The results were expressed in percentage of

open wound area at different time frame compared to initial wound area.

2.24 Collection of conditioned medium

For conditioned medium collection, 1 x 106 cells were seeded in T75 flask with

complete media for 48 hours. After 48 hours, the cells were washed with PBS and

supplement free medium. Fifteen mL of supplement free medium were added to the

flask and allowed to condition the medium for 48 hours. The medium was collected,

centrifuged at 3,000 g for 10 minutes and then filtered with 0.22 µm PES filter

(Sartorius) to remove cells debris. The cells were trypsinized and counted with Luna

automated cell counter (Logosbio). The conditioned medium was normalized to 5 x 106

cells in 10 mL with supplement free medium and stored in -80oC. The normalized

48

media was then further diluted 1:1 with supplement free medium prior experiment

usage.

For secreted BARF1 detection, the conditioned medium were collected and

concentrated with either acetone precipitation or Amicon Ultra 15 centrifugal filter unit

with 10 kDa cut off (Millipore). Briefly, 15 mL of conditioned media was precipitated

with 4-fold volume of cold acetone and the pellet was dissolve in PBS. For Amicon

Ultra-15 centrifugal filter unit, 15 ml of conditioned medium was centrifuged and

concentrated to 500 µl at 4,000 g, 4oC and 60 minutes. A total of 20 µl resuspended

pellet solution and concentrated medium were run on SDS-PAGE, followed by either

Ponceau S staining or western blot analysis.

2.25 Proliferation assay with conditioned medium

The proliferation assay was carried out as described in section 2.22 with minor

modification. Briefly, 1500 cells of NP460hTert were plated in 96 wells plate with

conditioned medium for 5 days. The MTT signals were measured at 24 hours intervals

over 5 days as described.

2.26 Migration assay with conditioned medium

The migration assay was carried out as described in section 2.23 with minor

modification. Briefly, 7 x 105 cells of NP460hTert were plated in 6 wells plate and

grown overnight with complete medium. On following day, the cells were incubated

with 10 µg/mL of mitomycin C for two hours. After the horizontal wounds were created,

the cells were washed with PBS twice and then incubated in 3 mL of conditioned

medium. The images of open wound area were acquired and measured as described.

49

Chapter 3

Results and discussion

3.1 Introduction

Epstein-Barr virus (EBV) infection is strongly associated with nasopharyngeal

carcinoma (NPC). In NPC, a more restricted set of viral genes were expressed, and

these viral gene products are involved in many crucial cellular pathways in epithelial

cells. However, the involvement of EBV genes in transformation of premalignant

nasopharyngeal epithelial cells is remains unclear. Therefore, the main aim of this

project is to attempt to elucidate the pathogenic roles of EBV genes in telomerase

immortalized nasopharyngeal epithelial cells NP460hTert.

This project marks a milestone in Swinburne University of Technology history as the

first mammalian vector cloning and gene expression study that has ever been conducted

However, due to a lack of any predecessors, many optimisation and adaptation were

made in order to overcome the challenges faced to accomplish our objective. The aims

of this project are to clone 13 EBV genes (LMP1, LMP2A, LMP2B, EBNA1, EBNA2,

ENBA3A, EBNA3B, EBNA3C, EBNA-LP, BARF1, BHRF1, BRLF1 and BZLF1), to

stably express them in nasopharyngeal epithelial cells NP460hTert and to evaluate their

pathogenic roles through various biological assays. Yet, unexpected challenges have

arisen during the cloning of DNA constructs and genes expression in epithelial cells.

Because of these unexpected challenges, only four EBV genes were stably expressed in

NP460hTert while the other nine EBV genes excluded in different stages during this

project. Briefly, four EBV genes (EBNA3A, EBNA3B, EBNA3C and EBNA-LP) were

failed to PCR amplify from the sources, one genes (BZLF1) was failed to clone into

pcDNA 3.1 Hygro, two genes (EBNA1 and EBNA2) were failed to sub-clone into

pLVX-Puro and two genes (LMP2B and BRLF1) were failed the sequencing analysis.

When expressed in NP460hTert, LMP1 was excluded due to the cytotoxicity in

epithelial cells whereas inadequate expression of LMP2A did not show any significant

results. Lastly, two EBV genes, BARF1 and BHRF1, were evaluated for their ability in

promoting cell proliferation and migration whereas only BARF1 was evaluated in its

autocrine/paracrine. The progression of each EBV genes were summarised in Figure 3.1.

50

This chapter is dedicated to discussing the optimisation and adaptation made, present

the preliminary data from different experiments and finally interpret the results from

each experiment.

51

Figure 3.1: The progression of 13 EBV genes in this project. The blue arrows represent the progression of EBV genes through different

experiments. The red x marks represent the failure of EBV genes in particular experiments.

52

3.2 Experiment optimisation

As mentioned above, this project was the first of its kind that has ever been conducted

in Swinburne University of Technology. And thus, this project established and

optimised several protocols that were essential to complete our project. One of the most

crucial protocols that have been established in this project was the preparation of

chemically competent cells for transformation. Competent cells play an important role

in cloning of gene constructs by facilitating the multiplication of cloning vectors. Prior

to the establishment of this protocol, generation of any EBV DNA constructs was

unsuccessful due to difficulties in transforming ligated vectors. Part of the success

approaches involved the success determination of puromycin concentration required for

antibiotic selection in NP460hTert. The detailed optimisation for these two experiments

will be discussed in the following sections.

3.2.1 Preparation of competent cells and optimisation of transformation

Transformation is a process in which the foreign DNA such as vectors is introduced into

bacteria. Delivering cloning vectors into bacteria is important for genetic manipulation

in bacteria. Besides genetic study, bacteria can also act as a medium for vectors storing

and replicating. The fundamental feature for bacteria to accept foreign DNA is the

existence of competent phase for DNA uptake (Hanahan 1983). Competent phase for

bacteria could be achieved with chemical, electrical or physical methods (Ren et al.

2017). Chemical induced competency is preferable to the electrical or physical methods

in that it does not require any specific machinery. Several commonly available

chemicals are enough for preparation of competent cells. Escherichia coli chemical

transformation was first mentioned in 1970 studies (Mandel & Higa 1970), where phage

DNA was delivered into Escherichia coli in the presence of calcium ions at 0oC and

heat shock at 37oC. Under these conditions, a brief state of competence for DNA

transformation was shown in Escherichia coli and whereby plasmids were able to be

transferred into the bacteria. Once the vectors enter the bacteria, it will be able to

multiple independently from the host and provide specific antibiotic resistant to host on

selection culture medium.

To optimise the transformation, two different strains of E. coli (JM109 and Top10F’)

were obtained from multiple sources and prepared for the competent cells according to

53

conditions mentioned in previous studies (Hanahan 1983; Nishimura et al. 1990; Tang

et al. 1994). The competent cells, their sources and the conditions used for preparation

were listed in Table 3.1.

The transformation efficiency of each competent cell was assessed by transforming the

competent cells with 0.2 ng pUC19 through heat shock transformation. As shown in

Table 3.2, JM109 (1) and JM109 (2) did not produce any colonies after transformation

with pUC19. JM109 (3) treated with 0.1M of CaCl2 show the lowest transformation

efficiency (1.4 x 105 cfu/µg) with only 5 colonies observed. On the other hand, both

chemically competent Top10F’ produced more colonies (120 and 356 respectively) and

has higher transformation efficiency compared to JM109. Notably, Top10F’ treated

with CCMB80 buffer has higher transformation efficiency (3.3 x 106 cfu/µg) than

Top10F’ treated with 0.1M CaCl2 (9.8 x 106 cfu/µg).

Table 3.1: The sources of competent cells and their condition of preparation

E. coli strain Preparation condition Source

JM109 (1) Treated with 0.1 M CaCl2 Swinburne University of

Technology

JM109 (2) Treated with 0.1 M CaCl2 Kindly gifted from Dr. Huang

JM109 (3) Treated with 0.1 M CaCl2 Kindly gifted from Malaysian

Pepper Board

Top10F’ Treated with 0.1 M CaCl2 Kindly provided from Dr. Peter

Top10F’ Treated with CCMB80 buffer

54

Table 3.2: Transformation efficiency of different E. coli strain

E. coli strain JM109 (1) JM109 (2) JM109 (3) Top10F’ Top10F’

Washing buffer 0.1 M CaCl2

0.1 M CaCl2

0.1 M CaCl2

0.1 M CaCl2

CCMB80

pUC19 concentration

(ng) 0.2

Dilution of plating 100 mL/550 mL

Number of colonies observed

0 0 5 120 356

Transformation efficiency (cfu/µg)

0 0 1.4 x 105 3.3 x 106 9.8 x 106

3.2.1.1 Discussion

From the panel of competent cells, all three JM109 were shown to have low

transformation efficiency. JM109 (1) and JM109 (2) were unable to transform any

vectors whereas JM109 (3) has extremely low transformation efficiency (Table 3.2).

Therefore, all JM109 were excluded from transformation experiments due to inadequate

transformation efficiency.

Although Top10F’ treated with 0.1M of CaCl2 could transform pUC19 better than

JM109, but it has very poor transformation efficiency when used to transform

recombinant vectors. Transformation efficiency at 3.3 x 106 cfu/µg was not sufficient to

transform small amounts of recombinant DNA products. The percentage of vectors

containing proper insert with the correct orientation is very low within the ligation

mixture. To overcome this problem, competent cells with higher transformation

efficiency is required. Higher transformation efficiency will result in more bacteria

becoming highly receptive to ligated vector intake which in turn increases the

percentage of producing the desired clones.

Our solution to generate high efficiency Top10F’ was to substitute CaCl2 washing

buffer with CCMB80 buffer. The advantage of this buffer was that it has more elements

compared to the CaCl2 buffer. The additional elements were manganese, magnesium

and potassium. Introduction of manganese, magnesium and potassium in the CCMB80

washing buffer will allow us to generate Top10F’ with higher transformation efficiency

(Hanahan, Jessee & Bloom 1991).

55

Addition of manganese ions has shown to enhance the transformation efficiency by

500-fold, while lack of calcium ions only reduces the transformation efficiency by 15

times. Manganese ions have higher relative transformation efficiency compared to

calcium ions either alone or in complex conditions (Hanahan 1983). Presence of

magnesium in washing buffer will be subsequently retained in culture medium. The

magnesium rich growth medium will stimulate transformation efficiency during

antibiotics outgrowth period (Hanahan 1983). Potassium acts as replacement ion for

rubidium which is a monovalent ion that is beneficial to transformation probability.

Potassium salt is more common and easily obtained monovalent ions compared to

Rubidium (Hanahan 1983).

By changing these variables, the production of higher efficiency Top10F’ was finally

feasible. The number of colonies from selection was improved by at least 71 folds from

JM109 treated with 0.1M CaCl2 and nearly 3 folds from Top10F’ treated with 0.1M of

CaCl2. The final improved competent cells have allowed us to continue the

transformation of ligated vectors with EBV genes.

56

3.2.2 Dose response for puromycin selection of NP460hTert

Antibiotic resistance genes in vectors allow transduced cells expressing them to be

selected out from the populations of non−transduced cells. To generate stable EBV gene

expressing NP460hTert cells, it is important to determine the minimum puromycin

concentration required to kill non-transduced cells. This dosage also must not be too

concentrated otherwise it will kill both non-transduced and transduced cells. Parental

NP460hTert cells were seeded in 6 wells plate one day prior to puromycin selection. Six

different concentrations of puromycin (0, 0.25, 0.5, 0.75, 1.0, 2.0 µg/mL) were added

into each well and incubated for 48 hours. The results of puromycin selection were

shown in Figure 3.2.

After two days of puromycin selection, approximately 50% of NP460hTert were viable

at the concentration 0.25 µg/mL. At 0.5 µg/mL of puromycin or above concentrations,

all the NP460hTert were killed after incubated for 48 hours. Since 0.5 µg/ml of

puromycin was the lowest concentration that kills 100% of NP460hTert, therefore this

dose of puromycin was selected as the optimal concentration for transduction selection.

Figure 3.2: Puromycin selection of NP460hTert. The cell viability of NP460hTert when

incubated at six different concentration of puromycin for 48 hours. Micrographs were

documented using Leica DMI 3000B (Leica Biosystem) at 40X phase contrast

resolution.

57

3.3 Primer design for the cloning of the 13 EBV genes used in this study

As shown in Figure 3.1, the first experiment in this project was to PCR amplify the

EBV genes and clone them into pcDNA 3.1 Hygro. To perform the PCR, the specific

cloning primers must be designed and modified. The forward and reverses primers were

designed based Akata strain EBV genome sequences KC207813.1 and B95.8 strain

EBV genome sequences NC007605 (Table 2.1). After that, few sequence modifications

were added to the forward and reverse primers. A sequence overhang, restriction site

and Kozak sequence were added to the forward primers. On the other hand, a sequence

overhang and restriction sites were added to the reverse primers. All cloning primers

were having HindIII/XhoI recognition sites except for ENBA3C and BRLF1 primers

which have only HindIII recognition site while BZLF1 primers have only XhoI

recognition site. The features of final cloning primers are shown in Figure 3.3.

In addition to cloning primers, a series of short primers used to check the expression of

EBV genes were also designed. These gene expression primers for short amplicons

were designed based on 3’ end of EBV transcripts. The gene expression primers were

listed in Table 2.1.

Figure 3.3: The detailed description of the cloning primers. A: Forward primer; B:

Reverse primer.

58

3.4 PCR cloning of 13 EBV genes

Having successfully designed the primers, they were synthesised by IDT Technology

and used for subsequent PCR to amplify the 13 EBV genes. The sources of the template

used to amplify the 13 EBV genes are listed in Table 3.3. pLXSN vectors containing

LMP1, LMP2A, LMP2B and EBNA1 were used as the templates for respective EBV

genes. Whereas the cDNA from NP460hTert-EBV treated with 8 µM of SAHA for 72

hours was used as the templates for the rest of EBV genes. Previous study demonstrated

that sub lethal dose of histone deacetylase inhibitors was able to induce viral lytic cycle

in EBV infected nasopharyngeal epithelial cells (Hui & Chiang 2010). Establishment of

NP460hTert-EBV is similar to HK1-EBV and HONE1-EBV where parental

nasopharyngeal epithelial cell was infected (NP460hTert, HK1 and HONE1) with IgG

activated Akata cells (Lo et al. 2006; Lui et al. 2009; Tsang et al. 2010). Thus, this

project aimed to harvest Akata EBV mRNA form the lytic stage following treatment

with SAHA and then extracted and converted it into Akata cDNA. The Akata

cDNA/NP460hTert-EBV cDNA will then serve as template for EBV genes that not

available in plasmids form. The EBV genes and their respective sources for PCR

amplification are summarized in Table 3.3.

Once the genes of interest have been PCR amplified, they were digested with restriction

enzymes and then ligated into pcDNA 3.1 Hygro by T4 DNA ligase. Before the ligation,

pcDNA 3.1 Hygro was analysed by restriction enzyme digestion with HindIII. The

ligation products were then transformed into Top10F’. Surviving Top10F’ colonies

were chosen, propagated and extracted for the recombinant pcDNA 3.1 Hygro. The

EBV genes inserted in pcDNA 3.1 Hygro was analysed by restriction enzyme digestion.

The EBV genes sizes were expected to be 74 base pairs higher than the original sizes

due to the presence of extra DNA sequences in cloning primers.

Table 3.3: The EBV templates used for PCR of respective genes

EBV templates

pLXSN Akata cDNA/NP460hTert-EBV cDNA

LMP1, LMP2A, LMP2B and EBNA1

EBNA2, EBNA3A, EBNA3B, EBNA3C,

EBNA-LP, BARF1, BHRF1, BRLF1 and

BZLF1

59

Before the cloning of EBV genes, pcDNA 3.1 Hygro was subjected to resection enzyme

digestion to ensure the identity of vectors. Linearized pcDNA 3.1 Hygro was expected

to have a size of 5597 base pairs. After the HindIII digestion, the size of pcDNA 3.1

Hygro was shown to be in expected size ranges which were between the 5000 and 6000

base pairs markers in the Bioline DNA ladder (Figure 3.4).

As shown in Figure 3.1, nine EBV genes (LMP1, LMP2A, LMP2B, EBNA1, EBNA2,

BARF1, BHRF1, BRLF1 and BZLF1) were successfully PCR amplified from their

respective sources while the four EBV genes (EBNA3A, EBNA3B, EBNA3C and

EBNA-LP) failed to do so (Figure 3.5a). The presence of EBNA3A, EBNA3B,

EBNA3C and EBNA-LP in Akata cDNA/NP460hTert-EBV cDNA was also analysed

by PCR amplification with gene expression primers (Figure 3.5b). Short amplicons of

EBNA3A, EBNA3B, EBNA3C and EBNA-LP were shown to be in expected size of

193 base pairs, 189 base pairs, 223 base pairs and 150 base pairs respectively.

However, only eight EBV genes were cloned into pcDNA 3.1 Hygro. The recombinant

pcDNA 3.1 Hygro were then analysed by restriction enzyme digestion with either

HindIII/XhoI or HindIII digestion. Four EBV genes, LMP1, LMP2A, LMP2B and

EBNA1, were successfully PCR amplified from pLSXN and cloned into pcDNA 3.1

Hygro. LMP1, LMP2A, LMP2B and EBNA1 were shown to be in expected size ranges

(1190 base pairs, 1568 base pairs and 1211 base pairs and 1868 base pairs respectively)

when their respective vectors were double-digested with the restriction enzymes

HindIII/XhoII (Figure 3.6). The other four EBV genes, EBNA2, BARF1, BHRF1 and

BRLF1 were successfully PCR amplified from Akata cDNA/NP460hTert-EBV cDNA

and cloned into pcDNA 3.1 Hygro. EBNA2, BARF1, BHRF1 and BRLF1 were shown

to be in expected size ranges with the size of 1535 base pairs, 740 base pairs, 650 base

pairs and two bands of 1214 base pairs and 604 base pairs respectively (Figure 3.6). The

eight EBV genes in pcDNA 3.1 Hygro were also analysed with short gene expression

primers and all of them shown to be in expected size ranges (Figure 3.7). Short

amplicons of LMP1, LMP2A, LMP2B, EBNA1, EBNA2, BARF1, BHRF1 and BRLF1

were expected to have a size of 160 base pairs, 152 base pairs, 234 base pairs, 198 base

pairs, 237 base pairs, 183 base pairs, 190 base pairs, and 167 base pairs respectively.

60

BZLF1 was successfully PCR amplified from Akata cDNA/NP460hTert-EBV cDNA

but was unable to ligate into pcDNA 3.1 Hygro (Figure 3.8). BZLF1 were shown to

have an expected size of 812 base pairs. The presence of BZLF1 in Akata

cDNA/NP460hTert-EBV cDNA was also analysed by PCR amplification with gene

expression primers and shown to have the expected size of 158 base pairs (Figure 3.5).

Figure 3.4: The restriction enzyme digestion of pcDNA 3.1 Hygro. A: Gel image of

pcDNA 3.1 Hygro digested with restriction enzyme HindIII. B: The vector map of

circular pcDNA 3.1 Hygro (SnapGene). The HindIII recognition site located at 911

bases in pcDNA 3.1 Hygro multiple cloning site.

61

Figure 3.5: Gel images of PCR amplification for Akata cDNA/NP460hTert-EBV cDNA.

A: PCR amplified of ENBA3A, EBNA3B, EBNA3C, EBNA-LP and BZLF1 with

cloning primers. B: Short amplicons of ENBA3A, EBNA3B, EBNA3C, EBNA-LP and

BZLF1 from PCR with gene expression primers.

62

Figure 3.6: Gel images of restriction enzymes digestion for recombinant pcDNA 3.1

Hygro. A: The double-digestion of recombinant pcDNA 3.1 Hygro containing LMP1,

LMP2A and LMP2B with the restriction enzymes HindIII/XhoI. B: The double-

digestion of recombinant pcDNA 3.1 Hygro containing EBNA1, EBNA2, BARF1,

BHRF1 and BRLF1 with the restriction enzymes HindIII/XhoI.

63

Figure 3.7: Gel images of short amplicons PCR amplification for recombinant pcDNA

3.1 Hygro. The short amplicons for LMP1, LMP2A, LMP2B, EBNA1, EBNA2,

BARF1, BHRF1 and BRLF1 amplified from recombinant pcDNA 3.1 Hygro with gene

expression primers.

Figure 3.8: Gel image of restriction enzyme digestion for pcDNA 3.1 Hygro-BZLF1.

The vectors generated from ligation between pcDNA 3.1 Hygro and BZLF1 fragment

were digested with restriction enzyme XhoI.

64

3.4.1 Discussion

To generate EBV DNA constructs, 13 EBV genes were PCR amplified from either

pLXSN or Akata cDNA/NP460hTert-EBV cDNA and then cloned into pcDNA 3.1

Hygro. From a panel of EBV genes, only 8 out of 13 EBV genes were successfully PCR

amplified from their respective sources and cloned into pcDNA 3.1 Hygro. These EBV

genes were LMP1, LMP2A, LMP2B, EBNA1, EBNA2, BARF1, BHRF1 and BRLF1.

BZLF1 was successfully amplified from Akata cDNA/NP460hTert-EBV cDNA but

interestingly could not ligated into pcDNA 3.1 Hygro. Multiple attempts of ligation

were performed to ligate BZLF1 fragments into pcDNA 3.1 Hygro, yet none of the

attempts were successful. The failure in ligation indicates that the vector might undergo

self-ligation, or the restriction enzyme digestion process was incomplete. To prevent

these possibilities, shrimp alkaline phosphatase was introduced to dephosphorylate

pcDNA 3.1 Hygro as a prevention of self-ligation and the restriction enzyme digestion

time was extended to ensure complete digestion of DNA by XhoI. However, the ligation

process was still unsuccessful.

Four EBV genes, EBNA3A, EBNA3B, EBNA3C and EBNA-LP failed to be PCR

amplified from Akata cDNA/NP460hTert-EBV cDNA. Interestingly, the presence of

these EBV genes in Akata cDNA/NP460hTert-EBV cDNA was able to be detected by

using gene expression primers. Short amplicons of EBNA3A, EBNA3B, EBNA3C and

EBNA-LP were detected in Akata cDNA/NP460hTert-EBV cDNA when PCR

amplified with gene expression primers. Various PCR parameters such as annealing

temperatures, MgCl2 concentration and extension time have been evaluated but the PCR

results remain unchanged. There are a few factors that could explain the failure of the

PCR process. First, EBNA3A, EBNA3B and ENBA3C have larger sizes compared to

other EBV genes. EBNA3A, EBNA3B and ENBA3C have 2835 base pairs, 2767 base

pairs and 3030 base pairs in size respectively. Increase in gene sizes could hinder the

chances of these genes being fully amplified by reverse-transcriptase during cDNA

synthesis. The cDNA synthesis process could have ended before the full length of

cDNA being completely synthesized and results in only partial gene fragments

produced. Since the gene expression primers were designed to amplify the short

amplicons of EBV genes, therefore incomplete cDNA would have produced some

positive results similar as the full-length cDNA. Thus, the reason why full length

65

EBNA3A, EBNA3B and ENBA3C could not be amplified from Akata

cDNA/NP460hTert-EBV cDNA might be due to the incomplete cDNA synthesis of

these EBV genes.

Unlike EBNA3A, EBNA3B and EBNA3C, EBNA-LP PCR amplification failure may

not be influenced by its gene size (1521 base pairs) but other factors like derivation of

EBNA-LP. EBNA-LP mRNA is assembly from multiple repeated exons located within

internal repeats 1 of EBV (Dillner et al. 1986; Peng et al. 2000). EBNA-LP mRNA

consists of methionine initiate codon which is splicing of W0 exon (providing AT) and

W1 exon (providing G) followed by internal repeats of W1-W2 exons and ended with a

combination of exons Y1 and Y2 (Finke et al. 1987). The number of internal repeats of

W1-W2 exons is highly variable between different EBV isolates (Peng et al. 2005).

Thus, multiple isoforms of EBNA-LP mRNA could have produced due to various

numbers of W1-W2 repeats and alternative splicing. Our EBNA-LP cloning primers

were designed to only specifically target Akata EBNA-LP. Therefore, our primers

might not be efficient in isolating that specific EBNA-LP variant form multiple EBV

EBNA-LP isoforms and which resulted in failure PCR amplification of EBNA-LP.

3.5 PCR sub-cloning of 8 EBV genes into pLVX-Puro

pLVX-Puro is an HIV-1 based lentiviral expressing vector (Clonetech). It contains all

the necessary viral processing elements such as Rev-response element (RRE),

woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) and central

polypurine tract (cPPT) element for the improvement of transgene expression, viral titer,

viral integration general viral function (Cochrane, Chen & Rosen 1990; Zennou et al.

2000; Zufferey et al. 1999). pLVX-Puro is part of the three plasmids lentiviral

packaging system (Merten, Hebben & Bovolenta 2016; Naldini et al. 1996b). pLVX-

Puro, pMD2.G and psPAX2 were introduced into viral producing cells such as

HEK293T in order to generate lentiviral particles. pMD2.G is a plasmid that encodes

the vesicular stomatitis virus envelope protein. Lentiviruses with VSV-G pseudotype

will have a broad range of tropism and higher stability during preparation of viral

particle (Burns et al. 1993). psPAX2 is a packaging vector expressing HIV-1 Gag

(Structure precursor protein)-Pol (Polymerase) and has a deletion in five pathogenic

HIV-1 genes (Zufferey et al. 1997). This modification in packaging vector will produce

only replication incompetent lentiviral particles. Lentiviruses produced from pLVX-

66

Puro are capable of infecting a wide variety of dividing and non-dividing cells, and

stably integrate into the host genome, resulting in long-term expression of the transgene

(Naldini et al. 1996a; Naldini et al. 1996b). Therefore, pLVX-Puro vector was chosen as

transfer vector to generate stable EBV genes expressing NP460hTert.

As shown in Figure 3.1, only 8 out of 13 EBV genes (LMP1, LMP2A, LMP2B, EBNA1,

EBNA2, BARF1, BHRF1 and BRLF1) were successfully cloned into pcDNA 3.1

Hygro. Therefore, in order to generate stable EBV expressing NP460hTert, eight of

these EBV genes were then shuttled from pcDNA 3.1 Hygro into pLVX Puro by PCR

sub-cloning. A new set of primers were design to facilitate the shuttling of EBV insert

from pcDNA 3.1 Hygro into pLVX Puro. The forward primer was design to contain an

EcoRI recognition site followed by a long DNA sequence which overlapping the Kozak

sequence, c-Myc tag and start codon of EBV genes. The reverse primer was designed to

flank the bovine growth hormone polyadenylation signal in pcDNA 3.1 Hygro, which

located at 19 bases after the multiple cloning site. The detailed sub-cloning primers

were illustrated in Figure 3.9.

Figure 3.9: The detailed description of the sub-cloning primers. A: Forward primer; B:

Reverse primer.

Before the sub-cloning process, pLVX-Puro was analysed by digestion with restriction

enzyme HindIII. Due to insufficient amount of XbaI restriction enzymes, HindIII was

used for restriction enzyme digestion analysis of both pLVX-Puro and recombinant

pLVX-Puro. pLVX-Puro contains seven HindIII recognition site which are located at

531 bases, 1087 bases, 1675 bases, 2185 bases, 2824 bases, 3401 bases and 5348 bases

67

(Figure 3.10b). Single-digestion of pLVX-Puro with restriction enzyme HindIII

produced seven DNA fragments with the sizes of 3285 base pairs, 1947 base pairs, 639

base pairs, 588 base pairs, 577 base pairs, 556 base pairs and 510 base pairs (Figure

3.10a). Notably, the multiple cloning site of pLVX-Puro was located within the 577

base pairs fragments. Thus, the size of this fragment will be shifted depending on the

size of insert.

After the sub-cloning primers were synthesised by IDT technology, eight EBV genes

were PCR amplified from pcDNA 3.1 Hygro, doubled digested with restriction enzymes

EcoRI and XbaI and then ligated into pLVX-Puro with T4 DNA ligase. Only 6 out of 8

EBV genes (LMP1, LMP2A, LMP2B, BARF1 and BRLF1) were successfully PCR

amplified from pcDNA 3.1 Hygro and subsequently cloned into pLVX-Puro (Figure

3.1). The recombinant pLVX-Puro were analysed with single-digestion with restriction

enzyme HindIII. LMP1, LMP2A and LMP2B were shown to be in the expected size of

1767 base pairs, 2145 base pairs and 1788 base pairs respectively (Figure 3.11a).

BARF1, BHRF1 and BRLF1 were also shown to be in the expected size of 1317 base

pairs, 1277 base pairs and 2469 base pairs respectively (Figure 3.11b).

EBNA1 and EBNA2 were PCR amplified from respective pcDNA 3.1 Hygro, but the

sizes of their genes fragments were not in expected range (Figure 3.12). EBNA1 and

EBNA2 were expected to have the size of 1868 base pairs and 1535 base pairs

respectively. However, the bands amplified from pcDNA 3.1 Hygro were shown be in

the ranges between the 1000 and 1500 base pairs markers in the Promega DNA ladder.

68

Figure 3.10: The restriction enzyme digestion of pLVX-Puro. A: Gel image of pLVX-

Puro digested with restriction enzyme HindIII. B: The vector map of circular pLVX-

Puro with seven recognition sites for HindIII.

69

Figure 3.11: Gel images of restriction enzymes digestion for recombinant pLVX-Puro.

A: The single-digestion of recombinant pLVX-Puro containing LMP1, LMP2A and

LMP2B with the restriction enzyme HindIII. B: The single-digestion of recombinant

pLVX-Puro containing BARF1, BHRF1 and BRLF1 with the restriction enzyme

HindIII.

70

Figure 3.12: Gel image of PCR amplification for EBNA1 and EBNA2 from

recombinant pcDNA 3.1 Hygro.

3.5.1 Discussion

Six EBV genes, LMP1, LMP2A, LMP2B, BARF1, BHRF1 and BRLF1 were

successfully shuttled from pcDNA 3.1 Hygro into pLVX-Puro. The sizes of the inserts

were checked by restriction enzyme digestion with HindIII and matched the theoretical

sizes. The other two EBV genes, EBNA1 and EBNA2 were not cloned into pLVX-Puro

due to unforeseen complication in preserving the recombinant pcDNA 3.1 Hygro.

PCR amplification of EBNA1 and EBNA2 from pcDNA 3.1 Hygro produced two

fragments that have shorter sizes, which is in between 1000 and 1500 base pairs,

compared to the expected sizes (Figure 3.12). This result suggests that the PCR

amplification with new primers was successful since it specifically targets the c-Myc

sequence of EBNA1 and EBNA2. Without EBNA1 and EBNA2 inserts in pcDNA 3.1

Hygro, there will be no PCR amplicons when amplified with sub-cloning primers.

Furthermore, the sizes of EBNA1 and EBNA2 in pcDNA 3.1 Hygro were identified in

previous sections. The shortening of EBNA1 and EBNA2 sizes could be explained by

few bases deletion in the middle region of the genes segments. The reason for this

deletion could be due to tandem repeat rearrangement by homologous recombination in

E.coli (Bzymek & Lovett 2001). Repetitive sequences are susceptible to tandem repeat

rearrangement and this sequence rearrangement could result in deletion of sequence

71

repeats. EBNA1 has an IR3 domain that contains approximately 570 base pairs

repetitive sequence which encode for only glycine and alanine repeat (Falk et al. 1995).

ENBA2 has two regions of repetitive sequences of total 160 base pairs that encode for

a polyproline domain and arginine-glycine repeat motif (Wang et al. 2012a). The length

of both repetitive sequences in EBNA1 and EBNA2 matches the length of the missing

fragments. Therefore, the deletion in these repeats might randomly occur during

propagation of Top10F’ and resulted in shorter EBNA1 and EBNA2 PCR amplicons as

observed (Figure 3.12).

3.6 Sequence analysis of 6 EBV genes in pLVX-Puro

All six recombinant pLVX generated from previous section (pLVX-LMP1, pLVX-

LMP2A, pLVX-LMP2B, pLVX-BARF1, pLVX-BHRF1 and pLVX-BRLF1) were

sequenced with ABI 3730XL capillary DNA Sequencer (Figure 3.1). Raw sequences

were quality filtered using Chromas (Technelysium) and aligned with ClustalW

multiple alignment algorithm (GenomeNet). The aligned sequences were then converted

into protein sequence with ExPASy translate tools (Swiss Institute of Bioinformatics).

The sequences of amino acids in 5’ to 3’ direction at Frame 1 or the longest open

reading frame were selected. Final protein sequences were then aligned against the

protein sequences from either Akata or B95.8 EBV genome using ClustalW2 (EMBL-

EBI) and checked using BLAST against the NCBI protein database.

As shown in Figure 3.1, only 4 out of 6 EBV genes (LMP1, LMP2A, BARF1 and

BHRF1) passed the sequence validation. LMP2A and BHRF1 sequences have 100%

homology with the respective reference sequences (Figure 3.13 and Figure 3.14).

Although pass the sequence validation, LMP1 have a single DNA point mutation and

BARF1 has 2 DNA point mutations in their DNA sequences. These sequence mutations

lead to the third amino acid mutation in LMP1 translated protein and the 39 and 41

amino acids mutation in BARF1 translated protein (Figure 3.15 and Figure 3.16). The

other two EBV genes, LMP2B and BRLF1 were shown to have multiple sequence

mutations that lead to premature termination in translated proteins (Figure 3.17 and

Figure 3.18).

72

Figure 3.13: Sequence analysis of LMP2A in pLVX-Puro. The alignment of pLVX

LMP2A translated protein sequence (LMP2ASEQ) against B95.8 EBV LMP2A protein

sequence (LMP2AWT) using ClustalW2.

Figure 3.14: Sequence analysis of BHRF1 in pLVX-Puro. The alignment of pLVX

BHRF1 translated protein sequence (BHRF1SEQ) against Akata EBV BHRF1 protein

sequence (BHRF1WT) using ClustalW2.

73

Figure 3.15: Sequence analysis of LMP1 in pLVX-Puro. The alignment of pLVX LMP1

translated protein sequence (LMP1SEQ) against B95.8 LMP1 protein sequence

(LMP1WT) using ClustalW2.

Figure 3.16: Sequence analysis of BARF1 in pLVX-Puro. The alignment between

pLVX BARF1 translated protein sequence (BARF1SEQ) and Akata EBV counterpart

(BARF1WT).

74

Figure 3.17: Sequence analysis of LMP2B in pLVX-Puro. The alignment between

pLVX LMP2B translated protein sequence (LMP2BSEQ) and B95.8 EBV LMP2B

protein sequence (LMP2BWT).

75

Figure 3.18: Sequence analysis of BRLF1 in pLVX-Puro. The alignment between

pLVX BRLF1 translated protein sequence (BRLF1SEQ) and Akata EBV BRLF1

protein sequence (BRLF1WT).

76

3.6.1 Discussion

Four out of six EBV genes (LMP1, LMP2A, BARF1 and BHRF1) in pLVX passed the

sequence analysis when compared to their respective reference sequences. LMP2A and

BHRF1 have 100% homology to the reference sequences and no mutation was observed

in their translated protein sequences.

Acceptable point mutations were found in LMP1 and BARF1. From the sequencing

data (Figure 3.15), LMP1 translated protein has almost identical sequence compared to

B95.8 LMP1. The only difference between two protein sequences is LMP1 has an

arginine as third amino acid while B95.8 LMP1 has histidine at the same position. This

modification in amino acid was unintentionally introduced when designing the cloning

primers. The forward cloning primer was designed based on Akata EBV LMP1

sequence instead of B95.8 EBV sequences. Akata LMP1 sequence has a guanine at 8

bases while B95.8 LMP1 has an adenine at same position. Thus, this error in designing

cloning primers inevitably creates a point mutation in LMP1. The point mutation in

LMP1 was considered as a conservative point mutation according to GONNET PAM

(point accepted mutation) 250 matrix (Gonnet, Cohen & Benner 1994). Since both

arginine and histidine are basic amino acids, this substitution is acceptable in term of

GONNET PAM matrix. Besides, the arginine residue is present in native LMP1

sequences of Akata EBV. Therefore, this mutation might not affect the final structure of

LMP1 generated form these sequences.

The sequencing results of BARF1 from pLVX shown that it has two amino acid

residues difference compared to Akata EBV BARF1 protein (Figure 3.16). The

differences were asparagine (serine in Akata EBV variant) and serine (glycine in Akata

EBV variant) at amino acids 39 and 41 respectively. These point mutations were

considered as semi conservative substitution according to GONNET PMA 250 matrix.

These substitutions of amino acids might not be introduced during PCR amplification

but were due to variation in BARF1 sequences. Sequence variations of BARF1 have

been reported in NPC (Wang et al. 2012b) and NK/T cell lymphoma (Sun et al. 2015)

biopsies from northern China. Several amino acid mutations were detected in multiple

samples. Among these mutations, V29A where valine at 29 amino acids substituted

with alanine was the most frequent amino acid mutation observed. V29A mutation in

BARF1 does not change its final protein structure and might not have any effect on its

77

biological functions. Besides V29A, other minor amino acid mutations such as V46A,

D79G and V113I were sporadic and only found in a few samples. Interestingly, the

amino acid mutations observed in BARF1 has not been described in any of the previous

studies. These mutations might be cell lines specific since the BARF1 cDNA obtained

in this study was from Akata infected nasopharyngeal epithelial cells. Furthermore, the

mutations could be novel and have a non-destructive amino acid modification to

BARF1 protein. Therefore, BARF1 was selected for further downstream experiments

even though it has certain level of amino acid modifications.

Two of the EBV genes, LMP2B and BRLF1 were excluded from the downstream

experiments due to nonsense mutation in protein sequences. LMP2B protein sequence

has a nonsense mutation that results in premature stop codon at 226 amino acid residues

(Figure 3.17). This nonsense mutation is due to nucleotide substitution at 678 bases of

LMP2B DNA sequence where thymine in triplet codon for cysteine (TGT) changes to

adenine and create a stop codon (TGA). The stop codon will produce an incomplete and

non-functional protein when introduced into a cell system. Therefore, LMP2B was

excluded from downstream experiments. A total of eight DNA mutations were

identified within BRLF1 and have led to the mutations in its protein sequences (Figure

3.18). Four-point mutations were conservative and semi conservative amino acid

substitution. Three amino acid substitutions were neither conservative nor semi

conservative. Unfortunately, the amino acid substitution at 489 residues led to nonsense

mutation in BRFL1. This mutation was due to the substitution of adenine at 1452 bases

in BRLF1 with thymine which in turn created a stop codon (TAG) instead of lysine

(AAG). Since BRLF1 will not be able to generate complete functional protein, it was

excluded from the downstream experiments.

The protein generated from nonsense mutation will be incomplete, non-functional and is

not valuable for our expression study. Multiple DNA sequence mutations were observed

during the sequencing analysis. Based on this observation, it is concluded that the PCR

does not produce satisfactory cloning results because of the amount of mutations in

DNA sequences. One probable source of the mutation is the quality of DNA polymerase

used. DNA polymerase used in this study was Taq polymerase. Taq polymerase is a

relatively low fidelity enzyme that has an error rate of (2 x 10-5) and lack of 3’ to 5’

proofreading exsonuclease (Flaman et al. 1994; McInerney, Adams & Hadi 2014).

78

Without proofreading exsonuclease, Taq polymerase could not remove mismatches

during PCR nucleotides extension and thus produced an error prone PCR amplicon

Therefore, high fidelity enzymes such as Pfu with 3’ to 5’ proofreading exsonuclease

should be used to amplify target genes during PCR cloning. High fidelity enzymes

could be used to minimize PCR generated errors and produce credible replication of

gene of interest. Besides DNA polymerase, our polymerase reactions might not have the

optimized conditions for cloning. Several variables in PCR could be refined to minimize

the mutation frequency during PCR cloning. First, low concentration of MgCl2 and

dNTP could be incorporated to reduce the error frequency. Next, since the PCR error

rates is directly proportional to cycle number, number of PCR cycle could also be

reduced to 25 or 30 cycles instead of 35 cycles. Lastly, an increase in number of PCR

template might improve the fidelity of polymerase extension.

3.7 The generation of 4 EBV genes expressing NP460hTert

The EBV genes expressing NP460hTert cell lines were generated by lentiviral

transduction as described in methodology (Section 2.17). Stably transduced clones were

selected and maintained as polyclonal populations under puromycin selection. The EBV

expressing cell lines were NP460hTert-LMP1, NP460hTert-LMP2A, NP460hTert-

BARF1 and NP460hTert-BHRF1. Vector control was also generated by transducing

pLVX-Puro into NP460hTert.

Once established, the EBV gene expression in the stable transduced cell lines was

analysed by reverse-transcription PCR (Figure 3.1). The cDNA synthesised from total

RNA of NP460hTert-LMP1, NP460hTert-LMP2A, NP460hTert-BARF1 and

NP460hTert-BHRF1 were PCR amplified with cloning primers and gene expression

primers. The GAPDH gene was also PCR amplified as a loading control for reverse-

transcription PCR.

For NP460hTert-BARF1 and NP460hTert-BHRF1, cDNA from four passages

NP460hTert-BARF1 (passage 1, passage 2, passage 3 and passage 4) and two passages

NP460hTert-BHRF1 (passage 3 and passage 4) were selected for reverse-transcription

PCR analysis (Figure 3.19). cDNA from IgG activated Akata cell and vector control

were included as references. BARF1 was expected to have a size of 740 base pairs and

183 base pairs when amplified with cloning primer and gene expression primer

79

respectively. BHRF1 was expected to have a size of 650 base pairs and 190 base pairs

when PCR amplified with cloning primer and gene expression primer respectively.

From Figure 3.19, all cells lines were found to express BARF1 and BHRF1 and theirs

size were in the expected ranges in Promega DNA ladder. The levels of GAPDH were

consistent among all the cell lines

For NP460hTert-LMP2A, two passages of NP460hTert-LMP2A (passage 3 and passage

6) were selected for reverse-transcripttion PCR analysis (Figure 3.20). For comparison,

pLXSN vector and cDNA from LMP2A expressing CNE2 and HONE1 were included

as reference (kindly provided by Dr. Yap). LMP2A was expected to have a size of 1568

base pairs when PCR amplified with cloning primer and to have a 152 base pairs short

amplicon when amplified with gene expression primer. As shown in Figure 3.20, full

length of LMP2A was expressed in all the cells except HONE1 cells whereas short

amplicons of LMP2A were found in all the cells. The sizes of LMP2A expressed were

shown to be in the expected ranges in Promega DNA ladder. The levels of GAPDH

were consistent among all the cell lines.

For NP460hTert-LMP1, cDNA from two passages of transduced cells (passage 1 and

passage 2) were extracted and PCR amplified with cloning primers and gene expression

primers (Figure 3.21). For comparison, cDNA from LMP1 expressing HONE1 cells

(kindly provided by Dr. Yap) and pLXSN vector were included as reference. LMP1 was

expected to have a size of 1190 base pairs when PCR amplified with cloning primer and

to produce a short amplicon of 160 base pairs when PCR amplified with gene

expression primer. From Figure 3.21, undetectable levels of LMP1 were displayed in all

NP460hTert cells and HONE1 cell. Low level of LMP1 short amplicon was observed in

passage 1 but not in passage 2 of NP460hTert-LMP1. The levels of GAPDH were

consistent among all the cell lines.

80

Figure 3.19: Reverser-transcription PCR analysis of NP460hTert-BARF1 and

NP460hTert-BHRF1. A: Gel images of full length (FL) and short amplicons (Short) for

BARF1 and BHRF1 from PCR amplification with cloning primers and gene expression

primers respectively. B: Gel images of GAPDH amplification for all the cell lines.

81

Figure 3.20: Reverser-transcription PCR analysis of LMP2A. Gel images of full length

(FL) and short amplicons (Short) for LMP2A from PCR amplification with cloning

primers and gene expression primers respectively.

Figure 3.21: Reverser-transcription PCR analysis of LMP1. Gel images of full length

(FL) and short amplicons (Short) for LMP1 from PCR amplification with cloning

primers and gene expression primers respectively.

82

3.7.1 Discussion

From the reverse-transcription analysis of EBV genes expressing NP460hTert, it is

found that BARF1 and BHRF1 were expressed in all the respective transduced

NP460hTert. LMP2A was also expressed in NP460hTert. Interestingly, the reference

for LMP2A, which is the cDNA from HONE1, did not produce full length of LMP2A

but the expression of LMP2A can be detected by PCR amplification with gene

expression primer.

The complete LMP1 was not detected in any of the transduced NP460hTert. However,

the expression of LMP1 was detected in early passage of transduced NP460hTert as a

short amplicon. The expression of LMP1 became undetectable after additional passages.

During the puromycin selection of transduced NP460hTert, only a few NP460hTert-

LMP1 cells were able to survive the selection and further propagated. From these

observations, it is postulated that LMP1 could be cytotoxic to the NP460hTert and

therefore most of the cells which expressed high level of LMP1 died and those with low

levels of LMP1 survived. Ectopic expression of LMP1 at high level was toxic to cells

and induced cell death in the form of apoptosis (Hammerschmidt, Sugden & Baichwal

1989). Several studies have reported that LMP1 could inhibit cell growth in NPC cells

(Liu et al. 2002) and induce cell death in epithelial cells (Lu et al. 1996), monocytes

cells and lymphoblastoid cell line (Brocqueville et al. 2013). Previous study shows two

transformation effectors in C terminal of LMP1 were involved in LMP1 induced

apoptosis (Brocqueville et al. 2013). Low level expression of LMP1 in MDCK cells

allowed them to survive the cytotoxic event and then acquire LMP1 oncogenic

properties such as epithelia-mesenchymal transition phenotype and anti-apoptotic effect.

Contrary to their results, the surviving cells with low level of LMP1 expression in the

present study did not display any LMP1 oncogenic properties such as acquisition of

epithelial mesenchymal transition phenotype or enhanced survival and the LMP1

expression is further silenced at later NP460hTert passage. The cells might suppress the

LMP1 expression through gene regulating mechanism such as DNA methylation in

order to survive. The surviving cells could be those with minimum expression of LMP1

but sufficient expression of the puromycin resistant gene.

83

Thus, NP460hTert-LMP2A, NP460hTert-BARF1 and NP460hTert-BHRF1 were

chosen to further protein analysis with western blot whereas LMP1 was excluded due to

the complication in transduced cells (Figure 3.1).

3.8 Western blot analysis of 3 EBV genes in transduced NP460hTert

Having examination of LMP2A, BARF1 and BHRF1 expression in transduced

NP460hTert, western blot analysis was performed to confirm the findings made from

reverse-transcription PCR analysis (Figure 3.1).

To perform western blot analysis, protein lysates were extracted from three different

passage of NP460hTert-LMP2A (passage 3, passage 4 and passage 6), two different

passage of NP460hTert-BHRF1 (passage 3 and passage 4) and four different passages

of NP460hTert-BARF1 (passage 1, passage 2, passage 3 and passage 4). The proteins

lysates were blotted against anti c-Myc antibody and anti beta-actin antibody. Protein

lysate from vector control was included as reference.

Western blot analysis reveals that BHRF1 protein was detected in between the range of

15 kDa and 20 kDa (Figure 3.22). No LMP2A and BARF1 protein were detected in all

the cell lines (Figure 3.22 and Figure 3.23). The beta-actin references were consistent

among all the cell lines. Multiple unknown protein bands were observed in all the blot

images.

84

Figure 3.22: Western blot of LMP2A and BHRF1 in transduced NP460hTert. A: Western blot detection of LMP2A and BHRF1 with anti c-Myc monoclonal antibody. B: Immunoblot detection of the loading control beta actin by reprobing with anti-beta actin antibody.

85

Figure 3.23: Western blot analysis of BARF1 in transduced NP460hTert. A: Western blot detection of BARF1 with anti c-Myc monoclonal antibody. B: Immunoblot detection of loading control beta actin by reprobing with anti-beta actin antibody.

86

3.8.1 Discussion

Multiple strong bands observed in all the samples including the vector control. The

reason for these nonspecific bindings of anti c-Myc monoclonal antibody (9E10) was

not clear. Several factors in the analysis of protein expression might play a role in this

anomaly. First, it could be due to the amount of protein loaded into the SDS-PAGE.

High concentration of protein samples could induce formation of nonspecific

antibodies-antigen complexes and thus results in multiple bands on immunoblot.

However, testing on different concentrations of protein lysates for SDS-PAGE and

western blot produced the same results. Multiple bands were still observed in

immunoblot even with the lower concentration of protein lysates.

Secondly, the blocking agents might not be efficient in preventing the nonspecific

binding of both primary and secondary antibodies. PVDF membranes have a high

binding affinity for protein and this membrane property will allow the transfer of

proteins from the gel to PVDF membranes during blotting (Gultekin & Heermann 1988).

On the other hand, antibodies will bind to the PVDF membrane as well. Therefore, it is

important to block the unbound surface of the membrane to prevent nonspecific binding

of antibodies. The blocking reagent used in this study was 5% commercial skim milk. In

order to troubleshoot this problem, alternative blocking agents such as different brands

of commercial skim milk and 1% BSA were used. Unfortunately, the attempt of using

different blocking agents to eliminate the multiple bands was to no avail.

In addition to previously mentioned troubleshooting, it is also speculated that anti c-

Myc antibody could be the main reason for multiple bands. The antibody used might not

be specific for only c-Myc epitope but also have cross reaction on immunoblot. Thus,

two different anti c-Myc antibodies were used in an attempt to minimize the background

issues. They were anti c-Myc antibodies 9E10 from SantaCruz and 9B11 from Cell

Signalling Technologies. Regrettably, multiple bands were still observed in the

immunoblot with different anti c-Myc antibodies. Anti c-Myc antibody from SantaCruz

was shown to develop an immunoblot with inferior resolution while the antibody from

Cell Signalling Technologies provided the similar blot images as Figure 3.22 and Figure

3.23.

87

Since the multiple bands were nonspecific binding and they were also found in mock

transduced NP460hTert at different optimization, it was decided that the current

immunoblot was used for the current study of transduced construct.

From the immuonoblot analysis, there were only two distinct bands that can be detected

in all four images and both bands were observed at BHRF1 transduced NP460hTert.

Detectable strong distinct bands were absent in all BARF1 and LMP2A transduced

NP460hTert.

3.8.1.1 BHRF1

BHRF1 was detected in between the range of 15 kDa and 20 kDa (Figure 3.22). This is

smaller than the predicted size of BHRF1 protein. BHRF1 protein is predicted to have a

size of 22 kDa which consists of 192 amino acids. The reduction in BHRF1 protein size

was not due to posttranslational modification but because of the anomalous migration of

BHRF1 protein in SDS-PAGE (Austin et al. 1988; Pearson et al. 1987). BHRF1 protein

is a transmembrane protein which contains a hydrophobic transmembrane domain

located at 166 to 186 amino acids (Khanim et al. 1997). This helical transmembrane

domain enables BHRF1 protein to localize into the mitochondria membrane. The

hydrophobic transmembrane domain will also interact with detergents such as SDS in

SDS-PAGE gel. SDS loading in transmembrane domain was shown to have a positive

correlation with protein PAGE mobility (Rath et al. 2009). Increase in bound SDS

within protein structure will reduce the protein gel migration ability, thus have a slower

shift and higher molecular weight than theoretical protein size (Rath et al. 2009).

Interaction between SDS and BHRF1 protein transmembrane domain could have altered

its hydropathy states which changes the SDS partitioning within the transmembrane

domain and leads to loss of SDS aggregation thus resulting in faster than predicted

protein gel shift.

3.8.1.2 LMP2A

LMP2A was not detectable in three different passages of transduced NP460hTert

(Figure 3.22). The LMP2A transcript was however confirmed in the transduced

NP460hTert with RT-PCR. There were several possibilities for this observation such as

the LMP2A protein losses its c-Myc tag during maturation, c-Myc tag was masked after

88

posttranslational modification or the mature LMP2A was degraded by unknown cell

mechanism. After extensive literature review, it is concluded that the LMP2A was in

fact ubiquitinated and was either secreted in exosomes or digested in endolysosome

(Ikeda, Ikeda & Longnecker 2002; Ikeda & Longnecker 2007). The cytosolic amino

terminus of LMP2A contains several signalling motifs and specifically two PY motifs

were shown to be involved in rapid degradation of LMP2A by interacting with neural

precursor cells expressed developmentally downregulated protein 4 (Nedd4)-family

ubiquitin ligases E3s (Ikeda et al. 2003; Ikeda et al. 2000). Nevertheless, it was

expected to detect the traces of LMP2A even under the regulation of Need4 ubiquitin

ligases. Yet, none of the LMP2A prior to normal degradation pathway was detected.

These results suggested that the LMP2A was under acute degradation after maturation

and localization to lipid raft of the membrane. Previous studies have reported the

importance of microenvironment of amino terminal in degradation of LMP1, LMP2A,

MYOD and E7 (Aviel et al. 2000; Breitschopf et al. 1998; Ikeda, Ikeda & Longnecker

2002; Reinstein et al. 2000). In LMP1, MYOD and E7 cases, addition of c-Myc tag to

the amino terminal residues stabilized the proteins and prevents their ubiquitination.

Unlike these proteins, addition of hydrophilic c-Myc tag has dramatically affected the

degradation of LMPA by significantly increasing the ubiquitination of LMP2A (Ikeda,

Ikeda & Longnecker 2002). This could have explained the absence of detectable

LMP2A protein in the cell lysate. Addition of c-Myc tag enhances the ubiquitination of

the LMP2A in transduced NP460hTert and results in missing LMP2A protein on

immunoblot. In contrast to hydrophilic Myc tag, addition of hydrophobic His tag

stabilized LMP2A and have a similar ubiquitination to wild type LMP2A (Ikeda, Ikeda

& Longnecker 2002).

3.8.1.3 BARF1

Similar to LMP2A, BARF1 transcripts were shown in transduced NP460hTert but the

protein was undetectable in immunoblot (Figure 3.23). BARF1 protein has a theoretical

size of 24 kDa and detected as a 31 to 33 kDa protein in cell lysates (de Turenne-Tessier

& Ooka 2007). The increase in size of BARF1 was due to the post translational

modification of BARF1 with N- and O-glycosylation (de Turenne-Tessier & Ooka 2007;

Tarbouriech et al. 2006). Previous computational analysis BARF1 amino acid sequence

suggested that BARF1 protein contains the 20th amino acid signalling peptide at the N-

89

terminus (Sall et al. 2004; Strockbine et al. 1998). This signalling site was predicted to

be cleaved during BARF1 protein processing in the Golgi system to produce a secretory

protein known as p29 BARF1 protein (de Turenne-Tessier & Ooka 2007; Hoebe et al.

2013; Sakka et al. 2013). In this study the non-cleaved form of BARF1 protein prior

secretion was not detected. This indicates that all the BARF1 protein was rapidly

processed in NP460hTert and secreted into the culture medium. The N-terminal c-Myc

tag was also expected to be cleaved and loss during the secretion of BARF1 protein.

Due to all the unexpected post translational modification of BARF1, the protein

detection in intracellular lysates were proven to be difficult. Thus, this study sought to

detect secreted BARF1 in culture medium without c-Myc tag.

Conditioned medium was collected for the detection of BARF1 protein. Transduced

NP460hTert was seeded in complete medium for 48 hours and followed by supplement

free medium for another 48 hours. Changing the culture medium to supplement free

medium was to minimize the amount of supplement in medium which could interfere

with collection of secreted BARF1. After 48 hours, the conditioned medium were

collected and concentrated with either acetone precipitation or Amicon Ultra 15

centrifugal filter with 10 kDa cut off. Fifteen millilitres of conditioned media was

precipitated with cold acetone and the pellet was dissolve in PBS. For Amicon Ultra-15

centrifugal filter, 15 ml of conditioned medium was centrifuged and concentrated to 500

µl. A total of 20 µl resuspended pellet solution and concentrated medium were run on

SDS-PAGE, followed by either staining with Ponceau S or analysing with immunoblot.

SDS-PAGE analysis followed by Ponceau S staining showed the presence of a strong

band located between 25 kDa and 37 kDa and only in acetone precipitation of

conditioned medium from NP460hTert-BARF1 (Figure 3.24). This thick band could be

secreted p29 BARF1 since it is absence in vector control. Vector control only had

shown multiple background bands higher than 37 kDa. Amicon Ultra 10K device was

used to concentrate any protein in conditioned medium with the molecular weight of 10

kDa and above including secreted BARF1. However, secreted BARF1 p29 was not

detected in both concentrated medium from Amicon Ultra 10K device. This might be

due to the concentration factor with single Amicon Ultra 10K device. This study was

only able to concentrate the medium at 30 times while previous study demonstrated that

secreted BARF1 was able to be detected in concentrated medium with minimum 3000-

90

fold concentration (Chang et al. 2013). They have achieved this concentration by using

two Amino Ultra devices. Three hundred millilitre medium was concentrated to at least

one hundred millilitres with Amicon Ultra-15 and followed by Amicon Ultra-2 to

achieve 3000-fold concentration factor. A thick background band at 75 kDa was

observed in all concentrated medium with Amicon device but barely detectable in

acetone precipitated medium.

The concentrated medium was also analysed by immunoblot against anti c-Myc

antibody (Figure 3.25). The p29 band was absent in acetone precipitated NP460hTert-

BARF1 medium. This observation aligns with the nature of BARF1 where BARF1

protein has cleaved its N-terminal amino acids during maturation and secretion of p29

BARF1. More importantly, it supports the prediction that BARF1 in transduced

NP460hTer has lost its c-Myc tag during secretion of p29 form BARF1. Thus,

immunoblot analysis was not able to detect the secreted BARF1. In addition, no

detectable bands were observed in vector control. Several background bands appeared

on concentrated medium with Amicon devices. Similar background bands were also

detected in previous immunoblot analysis of cell lysates with anti c-Myc antibody. This

concluded that anti c-Myc antibody has a weak specificity against Myc tag and

consistently produced identical bands whether it is in cell lysates or in supernatant.

In conclusion, BHRF1 protein was the only one that can be detected in all the

transduced NP460hTert by western blot analysis. The BHRF1 has a lower molecular

weight than theoretical size due to anomalous migration of BHRF1 on SDS-PAGE.

Addition of c-Myc tag to N-terminal of LMP2A accelerated its ubiquitination and thus

no 50 kDa LMP2A band was detected on transduced NP460hTert cell lysates. BARF1

protein rapidly undergoes post translational modification and was cleaved from its N-

terminal amino acids including the c-Myc tag, producing a secreted protein p29. As

expected, no BARF1 protein was detected in cell lysates but secreted BARF1 was

detected in acetone concentrated supernatant from NP460hTert-BARF1 on SDS-PAGE

gel with Ponceau S staining.

91

Figure 3.24: Ponceau S staining of concentrated conditioned medium from NP460hTert-

BARF1 and NP460hTert-pLVX. Conditioned medium was concentrated in two

different methods, either with Amicon Ultra-15 centrifugal filter (CE) or acetone

precipitation (AP).

92

Figure 3.25: Western blot analysis of concentrated conditioned medium from

NP460hTert-BARF1 and NP460hTert-pLVX. Conditioned medium was concentrated in

two different methods; either with Amicon Ultra-15 centrifugal filters (CE) or acetone

precipitation (AP). Anti c-cMyc monoclonal antibody was used for the immunoblot

analysis.

93

3.9 Effect of 3 EBV genes on cell proliferation of transduced NP460hTert

Human cancers are all distinct and heterogeneous, but most of them share the ten

common biological capabilities that enable tumors to growth and metastasize (Hanahan

& Weinberg 2011). These biological capabilities were coined as hallmark of cancer by

Hanahan and Weinberg (Hanahan & Weinberg 2000, 2011). Deregulated cell

proliferations through either sustaining the cell proliferation signal or suppressing the

growth inhibitor are two major cancer traits in hallmark of cancer. Thus, proliferation

plays an important role in cancer development and progression. This deregulation is

achieved in cancer cells by disrupting the mitogenic pathway or activity of cell cycle

related protein.

The establishment of transduced NP460hTert clones enabled us to explore the effects of

three EBV genes (LMP2A, BARF1 and BHRF1) on the proliferation characteristics of

nasopharyngeal epithelial cells (Figure 3.1). In previous sections, it is shown that the

LMP2A was short lived in transduced NP460hTert due to addition of c-Myc tag into its

N-terminal. Nevertheless, NP460hTert-LMP2A was included in further experiments as

to study the effects of short lived LMP2A in cell proliferation. NP460hTert-

LMP2A/BARF1/BHRF1 cells were cultured in a 96 wells plate with complete medium.

Cell proliferation was examined by the MTT assay every 24 hours over four days. The

results of two independent experiments were pooled together and are shown in the

Figure 3.26a. Figure 3.26b represents the comparison between the cells with highest

proliferation rate and vector control.

Proliferation assay demonstrated that LMP2A, BARF1 and BHRF1 were able to

promote cell proliferation in NP460hTert (Figure 3.26a). Higher MTT signal was

observed among EBV gene transduced NP460hTert where NP460hTert-BARF1 cells

displayed the highest proliferation rate followed by NP460hTert-BHRF1 cells and

NP460hTert-LMP2A cells. Notably, NP460hTert-BARF1 has demonstrated an

exceptionally higher cell proliferation rate (p < 0.001) when compared to those in vector

control NP460hTert-pLVX (Figure 3.26b). BHRF1 expressing NP460hTert also has

shown a higher cell proliferation rate than the vector control. NP460hTert-BHRF1

proliferation rates were significantly higher than NP460hTert-pLVX over the four-day

period (Day 1 to 3, p<0.001; Day 4, p<0.01). LMP2A expression in NP460hTert also

shows positive results in cell proliferation but the effects were not as significant as

94

BARF1 and BHRF1 expression. The enhancement of cell proliferation in LMP2A

expressing NP460hTert compared to vector control was only statistically significant for

the first three days (Day 1, p<0.01; Day 2 and 3, p<0.005; Day 4, p>0.05).

95

Figure 3.26: Cell proliferation analysis of NP460hTert clones at daily intervals by MTT

assay. A: Comparison of cell proliferation between NP460hTert-pLVX, NP460hTert-

LMP2A, NP460hTert-BARF1 and NP460hTert-BHRF1. B: Comparison of cell

proliferation between the highest MTT signal (NP460hTert-BARF1) and the vector

control (NP460hTert-pLVX). Results are the means and standard errors of the means

for two independent experiments (***p<0.001, significance difference between pLVX

and BARF1 clones).

96

3.9.1 Discussion

3.9.1.1 BARF1

Hereby, this study shown that BARF1 could upregulate the cell proliferation of

nasopharyngeal epithelial cells. The increased cell proliferation observed in

nasopharyngeal epithelial cells could be contributed by secreted BARF1 instead of

intracellular BARF1. Previous study demonstrated that proliferation rates of BARF1

expressing SNU601 EBV negative gastric carcinoma cells were similar to mock

transfected cells when treated with brefeldin A (Chang et al. 2013). Brefeldin A is a

reversible protein translocation inhibitor that blocks the transfer of protein from

endoplasmic reticulum to the Golgi apparatus and thus blocks the secretion of protein

(Donaldson, Lippincott-Schwartz & Klausner 1991; Lippincott-Schwartz et al. 1991).

Without secreted BARF1, brefeldin A treated SNU601-BARF1 exhibits similar

proliferation rates to vector control SNU601 and proliferate slower when compared to

untreated SNU601-BARF1 (Chang et al. 2013).

In addition, mitogenic activity of secreted BARF1 was also investigated in different

kind of cell lines. Purified secreted BARF1 was able to increase the cell proliferation in

Balb/c-3T3 fibroblasts, Human Louckes B-cell line, primary monkey kidney epithelial

PATAS cells, NPC CNE-1 and HONE-1 cells and human epithelial HaCaT cells (Sakka

et al. 2013; Sall et al. 2004; Seto et al. 2008). Besides direct evaluation of secreted

BARF1 mitogenic activity, introduction of BARF1 gene into in vitro model has led to

higher rates of cell proliferation. Expressing BARF1 in gastric carcinoma SNU216 and

SNU601 cells demonstrated improvement in cell proliferation rates compared to mock

cells (Chang et al. 2013; Kim et al. 2016). Furthermore, co-expressing BARF1 and H-

Ras in SV40 T antigen immortalized human nasopharyngeal epithelial cells NP69 has

exhibited an enhancement in cell growth and greater resistant to growth elements

deprivation (Jiang et al. 2009). Lastly, siRNA knockdown of BARF1 expression in

Burkitt’s lymphoma AG876 and HONE1-AKATA effectively inhibits the cell

proliferation (Mohidin & Ng 2015).

97

3.9.1.2 BHRF1

While previous studies have investigated the cell growth properties of BHRF1 on

epithelial cells, the results were in contradiction to each other. In human squamous cell

carcinoma experiment, BHRF1 expressing SCC12F clones proliferated at faster rates

when compared to vector control (Dawson et al. 1998). The growth potential of BHRF1

expressing SCC12F was even greater under the condition of serum deprivation. Besides,

BHRF1 induced a rapid transition through S phase into G2/M phase in BHRF1

expressing SCC12F. On the other hand, BHRF1 expression on NPC cell line, CNE2

showed a polar opposite result compared to the study mentioned above. The

proliferative rate of BHRF1 expressing CNE2 was slower than vector control and

parental CNE2 (Huang, Pan & Zhou 1999; Huang et al. 1997). BHRF1 expression was

thought to increase G1 phase cell cycle stagnation by elevating p21 level in CNE2

(Huang, Pan & Zhou 1999). Cell cycle distribution is correlated to cell proliferation.

The cell cycle stages are precisely controlled by checkpoints and one of the prominent

checkpoints in preventing oncogenesis at cellular level is G1-S checkpoint. This

checkpoint is primarily regulated by p21, pRb and p53. p21 controlling G1-S transition

by interacting with cyclin-dependent kinases (CDKs) (Abbas & Dutta 2009). Thus,

BHRF1 expression could reduce the proliferation rates by maintaining the cell in G1

phase through upregulation of p21 level which in turn inhibits CDK2 activity,

dephosphorylates pRB and disrupt PCNA binding (Abbas & Dutta 2009; Huang, Pan &

Zhou 1999).

Results from the proliferation assay revealed that BHRF1 expression in NP460hTert has

similar growth characteristic to the BHRF1 expression in SCC12F cells but not CNE2

cells. BHRF1 expression in both NP460hTert and SCC12F demonstrated an

enhancement in cell growth under normal growth conditions. The higher proliferation

rates in BHRF1 expressing NP460hTert might be due to faster cell cycles transition

induced by BHRF1 which was suggested in SCC12F study. The similar findings could

be due to both NP460hTert and SCC12F are immortalized and non-tumorigenic

epithelia cell lines (Dawson et al. 1998; Li et al. 2006a; Rheinwald & Beckett 1981;

Tsang et al. 2010).

Although CNE2 and NP460hTert were both derived from nasopharyngeal origin, the

results were in complete contrast to the results reported in this study. The main reason

98

for this is could be CNE2 was established form malignant NPC biopsies whereas

NP460hTert was derived from nonmalignant nasopharyngeal epithelial biopsies (Li et al.

2006b; Sizhong, Xiukung & Yi 1983). In addition, previous studies suggested that

CNE2 could be possibility partially contaminated with HeLa cells (Chan et al. 2008;

Strong et al. 2014). In PCR analysis for E6/E7 sequences of HPV-18, CNE2 along with

another EBV negative NPC cell lines CNE1 were tested positive for E6/E7 sequences

(Chan et al. 2008). HPV-18 typically infects the genital epithelium and its genome are

generally not detected in primary NPC tumours but readily detected within HeLa cells

(Strong et al. 2014) Short tandem repeat (STR) profiling assay also revealed that CNE2

contains one of the two alleles that are similar to HeLa STR profile (Chan et al. 2008).

HeLa cell line was derived from a glandular cervical carcinoma and HeLa was also the

first human cancer cell line to be established (American Type Culture Collection

Standards Development Organization Workgroup 2010; Masters 2002). Since the

establishment of HeLa, many cell lines were shown to be cross-contaminated with HeLa

cells (American Type Culture Collection Standards Development Organization

Workgroup 2010; Masters 2002). HeLa cross-contamination in cell lines might have

influenced the results of the study and led to skewed conclusion. In CNE2-BHRF1

context, expression of HPV-18 latent products may have unexpectedly contributed to

the reduction in BHRF1 expressing CNE2 proliferative rates. Therefore, this could be

the reason that BHRF1 expression in CNE2 shows a total opposite proliferation result to

the findings in the present study and in SCC12F study.

3.9.1.3 LMP2A

This study showed that short lived LMP2A could slightly improve the proliferation rate

of NP460hTert. LMP2A expressed in the NP460hTert was subjected to rapid

ubiquitination due to the addition of Myc tag in LMP2A amino terminal. The short lived

LMP2A may still be able to interact with cell growth effectors before degradation and

confer minor improvement in cell proliferation. In epithelial cells expression studies,

LMP2A can induce cell growth through activation of PI3-K/Akt pathway and

dysregulated PI3-K/Akt effectors such as β-catenin, mTOR and WNT5A (Dawson, Port

& Young 2012; Fukuda & Longnecker 2007; Moody et al. 2005; Morrison & Raab-

Traub 2005; Scholle, Bendt & Raab-Traub 2000; Yap et al. 2014). Since short lived

LMP2A could contribute to the increased proliferation in NP460hTert, thus it is

99

postulated that stable expression of LMP2A would have a greater impact on promoting

nasopharyngeal epithelial cells growth.

In conclusion, of the three EBV genes, BARF1 expressing NP460hTert shows

exceptional cell proliferation rates followed by BHRF1 expressing NP460hTert and

LMP2A expressing NP460hTert has the least improvement in cell proliferation

compared to the vector control. The BARF1 finding was consistent with previous

studies where BARF1 expressing cells would have higher proliferative rates than the

vector control. Secreted BARF1 could play a major role in promoting NP460hTert cell

growth. BHRF1 expression shows similar improvement in cell proliferation when

expressed in NP460hTert and SCC12F but has a total opposite result in CNE2. The

reason could be both NP460hTert and SCC12F were non-tumorigenic cell lines while

CNE2 was derived from malignant NPC with partial HPV-18 genomes contamination.

Short lived LMP2A provides slight improvement of NP460hTert cell proliferation and

stable LMP2A could have a greater effect in nasopharyngeal epithelial cells growth.

3.10 Effect of 3 EBV genes on cell migration of transduced NP460hTert

Cell migration has played an important role in pathogenesis of cancer. The ability of a

cancer cell to undergo migration allows it to spread within tissues. A distant metastatic

growth will arise from cancer cells that invade through extracellular matrix and enter

the blood vessels. The study of cell migration in cancer research is of particular interest

as the main cause of death in cancer patients is related to metastatic progression. NPC

tumours are highly invasive and the patients often present with distant metastasis with

common sites being bone, liver and lung (Bensouda et al. 2011a; Huang et al. 1996; Lee

et al. 1992). Therefore, understanding the involvement of EBV in NPC metastatic could

be crucial to the diseases prognosis. Since all 3 EBV genes (LMP2A, BARF1 and

BHRF1) could up regulate cell proliferation in NP460hTertthe work further investigated

whether they could have similar effect on cell migration (Figure 3.1). The epithelial cell

migration effects were determined by using wound healing assay.

A preliminary cell migration assay was carried out with all four NP460hTert clones in a

6 wells plate. Approximately 7 x 105 cells were seeded in each well and incubated

overnight. On the next day, P200 pipette tips were used to create a horizontal scratch

along the well. The wounds were then observed and recorded using Leica DMI 3000B

100

(Leica Biosystem) at 100X phase contrast resolution. The plate was returned into

incubator and incubated for 8 hours. After the 8 hours incubation, images of the scratch

wound were recorded again. Open wound area was analysed using TScratch with

default parameter setting. A diagram was plotted with relative open wound area at

different time frame to zero hour (Figure 3.27). The percentage of open wound area was

calculated as follow:

𝑃𝑒𝑟𝑐𝑒𝑛𝑡𝑎𝑔𝑒 𝑜𝑓 𝑥 ℎ𝑜𝑢𝑟𝑠 𝑜𝑝𝑒𝑛 𝑤𝑜𝑢𝑛𝑑 𝑎𝑟𝑒𝑎 = 𝑂𝑝𝑒𝑛 𝑤𝑜𝑢𝑛𝑑 𝑎𝑟𝑒𝑎 𝑜𝑓 𝑥 ℎ𝑜𝑢𝑟𝑂𝑝𝑒𝑛 𝑤𝑜𝑢𝑛𝑑 𝑎𝑟𝑒𝑎 𝑜𝑓 0 ℎ𝑜𝑢𝑟

× 100

Figure 3.27: Preliminary cell migration assay with wound healing method. Percentage

of open wound area of different NP460hTert clones at 8 hours against 0 hours. Data are

the means and standard errors of three replicates (** p<0.01).

Preliminary migration assay was done in single replicate on 6 wells plate. No replicate

was done because the purpose of this assay was to determine which cell line has more

promising results. From Figure 3.27, BARF1 has the most significant wound recovery

among the sample of the cells at eight hours timeframe. The percentage of open wound

area was at least two-fold smaller than vector control. BHRF1 expression does not

confer significant benefits in cell migration of epithelial cells where wound recovery

101

observed in BHRF1 expressing NP460hTert was similar to vector control. Anti-

apoptotic role of BHRF1 protein was well described in previous studies but BHRF1

effects on cell migration was not explored thoroughly. The results showed that BHRF1

expression has no significant effect on cell migration in NP460hTert. NP460hTert

expressing short lived LMP2A demonstrated a slight improvement in cell migration

compared to the vector control. LMP2A has been previously shown to induce migration

and invasion in epithelial cells. Stable expression of full length LMP2A was able to

significantly improve cell migration in primary epithelial tonsil cells, HaCaT cells,

human foreskin keratinocytes HFK and HEK 293 cells (Chen et al. 2002; Fotheringham,

Coalson & Raab-Traub 2012; Pegtel et al. 2005; Scholle, Bendt & Raab-Traub 2000).

Similar to proliferation assay on short lived LMP2A expressing cells, it is hypothesized

that stable expression of full length LMP2A will significantly enhance the migration of

NP460hTert.

Interestingly, BARF1 expression in NP460hTert demonstrated comparable effects on

cell migration compared to previous LMP2A expression studies. BARF1 latent

expression was consistently and frequently found in epithelial carcinoma such as NPC

and GC (Decaussin et al. 2000; Hayes et al. 1999; Nishikawa et al. 2014; Wang et al.

2012b). In other EBV related tumor such as Burkitt lymphoma, BARF1 might be

expressed as a viral lytic protein in only the subpopulation of cells entering lytic cycle

(Rowe et al. 2009). LMP2A expression was not exclusive only in latently infected NPC

but also in other EBV related carcinoma as well. Therefore, the work proceed to further

examine the effect of BARF1 on nasopharyngeal epithelia cells with an optimized

migration assay.

Low dose of proliferation inhibitor, mitomycin C was added to distinguish migration

from proliferation (Pullar, Chen & Isseroff 2003). Cell proliferation is a confounding

nature to cell migration. By adding mitomycin C, the risk of migration assay results

being compromised with cell proliferation was reduced. However, mitomycin C is a

toxic alkylating agent causing DNA cross linkage and thus inhibits DNA synthesis.

Therefore, the dosage of mitomycin C was optimized to prevent cell death during

migration assay. NP460hTert clones were pre-incubated in 10 µg/ml of mitomycin C for

2 hours at 37oC prior the wound scratching. Furthermore, NP460hTert clones were

incubated in supplement free medium after creating the wound. Growth supplement

102

from NP460hTert complete medium was removed to simulate a serum derived

condition. Supplement free medium was used to further suppress the cell proliferation in

wound healing assay.

The process of image recording, and analysis was maintained as in the preliminary

migration assay. Images were taken at different time points until the wound closure

(Figure 3.28). Series of cell images were imported into TScratch and analysed with

default parameter setting (Figure 3.29). Open wound area was quantified on each image

to obtain mean value. A diagram was then plotted as average percentage of open wound

at different time point against zero hour (Figure 3.30).

As shown in Figure 3.28, BARF1 expression induced observable improvement in

NP460hTert migration. NP460hTert-BARF1 has a smaller wound compared to

NP460hTert-pLVX at eight hours and it was completely closed at ten hours. The

observation and quantification of the open wound area was achieved by adding white

overlays to the area of images that contain cells by using Tscratch. With the visuals

from Tscractch, the wound was shown to recovered faster on BARF1 expressing

NP460hTert compared to those in NP460hTert-pLVX (Figure 3.29). NP460hTert-

BARF1 wound was recovered at ten hours whereas NP460hTert-pLVX fully closed its

wound at fourteen hours after being scratched.

The open wound areas were pooled, calculated and tabulated in Figure 3.30 as average

percentage of open wound at specific time points against original wound sizes. Eight

hours after wound-scratch, NP460hTert-BARF1 has an average of 34.8 ± 4.4 % open

wound area while NP460hTert-pLVX has an average of 48.8 ± 3.9 % open wound area

(p<0.05). At ten hours, average open wound area of NP460hTert-BARF1 was

significantly smaller than NP460hTert which was 16.1 ± 3.8 % and 34.1 ± 3.5 %

respectively (p<0.005). The size of average open wound at twelve hours for

NP460hTert-BARF1 was significantly smaller than the vector control (21.6 ± 3.3 %;

p<0.05) and approximately two-fold smaller (8.3 ± 3.0 %) compared to ten hours.

Finally, only a few spots of open wound remained (average 1.6 ± 0.8 %) for

NP460hTert-BARF1 while some of the vector control still has visible of open wound

area (average 6.1 ± 1.8 %) at 14 hours.

103

Figure 3.28: Comparison of migration for NP460hTert expressing either BARF1 or vector control pLVX. Representative micrographs of open

wound area for NP460hTert-pLVX and NP460hTert-BARF1 at 5 different time points in supplement free medium. Representative micrographs

were from nine replicates. Micrographs were documented using Leica DMI 3000B (Leica Biosystem) at 100X phase contrast resolution. Results

are representative for two independent experiments.

104

Figure 3.29: Analysis of micrographs by using Tscratch. Representative micrographs of open wound area for NP460hTert-pLVX and

NP460hTert-BARF1 at 5 different time points in supplement free medium. Micrographs were analyzed automatically with Tscratch. White

overlays were added to visualize the open wound area of micrographs by Tscratch.

105

Figure 3.30: The open wound area of NP460hTert-BARF1 and NP460hTert-pLVX at

four different time points relative to zero hour. The open wound area was quantified

with Tscratch. Data are the means and standard errors of eight replicates and are

representative of two independent experiments (* p<0.05, ** p<0.01).

3.10.1 Discussion

BARF1 expression could induce a mitogenic-independent cellular migration in

nasopharyngeal epithelial cell NP460hTert. BARF1 expression was able to enhance the

wound healing rates of NP460hTert under control conditions. Most studies in the past

have only described the mitogenic and proliferative ability of BARF1 protein. The

effects of BARF1 on cell migration were not extensively evaluated. In EBV negative

gastric carcinoma cell line studies, BARF1 expressing SNU601 did not show any

statistical improvement in migration or invasion compared to vector control (Chang et

al. 2013). In contrast, the present study shows positive impact of BARF1 expression in

cellular migration. This finding may also facilitate the understanding of interaction

between EBV BARF1 and different types of human cells. BARF1 expression might

contribute to cell proliferation and migration distinctively dependent on the cell types.

BARF1 may only contribute to cell proliferation but not migration in gastric carcinoma

106

or stomach cells but it could up-regulating both cell migration and proliferation in

nasopharyngeal epithelial cell.

In conclusion, BHRF1 and short lived LMP2A did not show any promising results in

NP460hTert wound healing. BHRF1 expressing NP460hTert shows similar wound

healing rates with the vector control while short lived LMP2A expression induced

minor enhancement in cell migration. BARF1 however demonstrates significant wound

recovery ability in both preliminary and optimized wound healing assay. BARF1

expressing NP460hTert recovered its wound approximately two times faster than the

vector control. BARF1 might affect cell migration differently dependending on the

expressing cell lines.

3.11 Role of secreted BARF1 in cell proliferation and migration of NP460hTert

As shown in Figure 3.1, LMP2A and BHRF1 were excluded from the secretion

experiments because they were not secreted by transduced cells. Since BARF1

expression could upregulate both cell proliferation and migration in NP460hTert, it was

further investigated whether the secreted BARF1 could act as a growth factor for

parental cells NP460hTert and could also upregulate cell migration of parental

NP460hTert. Conditioned medium was collected from both NP460hTert-BARF1 and

NP460hTert-pLVX for cell proliferation assay and migration assay.

3.11.1 Conditioned medium proliferation assay

Cells were grown until they were 60 % confluent, washed with supplement free medium

and PBS then incubated in supplement free medium for a further 48 hours. The

conditioned medium was collected, centrifuged and filtered to remove dead cells.

Parental NP460hTert cells were cultured in complete medium, supplement free medium

or conditioned medium prepared from BARF1 expressing NP460hTert and vector

control. Cell proliferation was examined by the MTT assay every 24 hours over five-

day intervals. The results were summarized in Figure 3.31.

107

Figure 3.31: Optimization of conditioned medium experiments. NP460hTert was

growth in control medium (Normal medium), supplement free medium (SF medium),

conditioned medium from vector control (pLVX-CM) or conditioned medium from

NP460hTert-BARF1 (BARF1-CM). Cell proliferation was measured by using MTT

assay. Results are shown as mean ± SEM (n = 6).

As shown in Figure 3.31, the MTT signals for NP460hTert in both conditioned medium

from NP460hTert-pLVX and NP460hTert-BARF1 were surprisingly weak (less than

0.5 over the five days period). The signals were lower than NP460hTert cultured in

supplement free medium across five-day intervals. These results indicate that the full

conditioned medium was either not beneficial or toxic to NP460hTert.

Conditioned medium was derived from supplement free medium that was incubated

with transduced cells during exponential cell growth. The conditioned medium contains

several secretomes from NP460hTert includes various cytokines, chemokines and most

importantly secreted BARF1 from BARF1 expressing cells. However, few components

such as essential and non-essential amino acids, vitamins, organic compounds, trance

minerals and inorganic salts were depleted during the incubation period. These

components were crucial for general cellular metabolism and without them the cells

would enter growth arrest which results in weak MTT signals. To overcome this

108

complication, conditioned medium was diluted 1:1 with fresh supplement free medium.

The dilution with fresh supplement free medium allows the conditioned medium to

recover the depleted essential components without losing the secretomes from

transduced cells.

Besides, conditioned medium was also normalized to the number of transduced cells

with fresh supplement free medium before being diluted 1:1 with fresh supplement free

medium. Transduced cells were trypsinised and counted at the end of generating

conditioned medium. Conditioned medium was normalized to 5 x 106 cells in 10 ml

with fresh supplement free medium. The proliferation experiments were repeated with

normalized and diluted conditioned medium and the results were summarized in Figure

3.32.

From Figure 3.32, NP460hTert cultured in conditioned medium from BARF1

expressing cells shows significantly higher proliferative rates than NP460hTert cultured

in vector control (Day 1, p < 0.05; Day 2 onward, p < 0.001). NP460hTert cultured in

conditioned medium from BARF1 expressing cells shown significant lower

proliferation rates on the first two days compared to NP460hTert cultured in supplement

free medium (p < 0.001). However, on the third day, there were no significant

differences between the growth rates of NP460hTert in these three media (p = 0.55).

From the fourth day onwards, NP460hTert cultured in conditioned medium from

BARF1 expressing cells showed significantly higher proliferative rates than

NP460hTert cultured in supplement free medium (Day 4, p < 0.01; Day 5, p < 0.001). In

addition, NP460hTert cultured in conditioned medium from NP460hTert-pLVX showed

similar growth rates as the cells cultured in supplement free medium.

109

Figure 3.32: Cell proliferation rates of NP460hTert in different conditioned medium.

Conditioned medium was normalized to 5 x 106 cells. Cell proliferation was measured

by using MTT assay. A: Growth of NP460hTert in control medium (Normal medium),

supplement free medium (SF medium), conditioned medium from vector control

NP460hTert (pLVX-CM) or conditioned medium from NP460hTert-BARF1 (BARF1-

CM). B: Focus on the growth of NP460hTert in conditioned medium from vector

control NP460hTert (pLVX-CM) or conditioned medium from NP460hTert-BARF1

(BARF1-CM). Results are the means and standard errors of the means for two

independent experiments. (*p<0.05, ***p<0.001)

110

3.11.2 Conditioned medium migration assay

Conditioned mediums were collected from both NP460hTer-BARF1 and vector control

in similar methods as previous sections. NP460hTert cells were seeded in 6-wells plate

and incubated overnight. After two hours of mitomycin C incubation, the wounds were

introduced to each well by using P200 pipettes tip. The conditioned medium from either

BARF1 expressing cells or vector control was the added into each well. Images were

taken with Leica DMI 3000B (Leica Biosystem) at 100X phase contrast resolution at 0

hour, eight hours, ten hours and twelve hours (Figure 3.33). Tscratch was used to

analyse all the images (Figure 3.34) and the data was summarised in Figures 3.35.

Figure 3.33 and Figure 3.34 showed that the NP460hTert recovered its wound faster in

conditioned medium form NP460hTert-BARF1 compared to the vector control.

NP460hTert cultured in conditioned medium from BARF1 expressing cells has

relatively healed wound at eight hours and the wound was fully healed at ten hours. In

contrast, NP460hTert migration induced by conditioned medium from vector control

was considerably slower and the wound was not fully healed at the end of experiments.

The average percentage of NP460hTert open wound area at different time intervals

compared to zero hour is compiled in Figure 3.35. The average open wound size of

NP460hTert cultured in BARF1 conditioned medium was significantly smaller than

NP46hTert cultured in conditioned medium from vector control (at eight and ten hours,

p<0.01; at 12 hours, p<0.05). In NP460hTert-BARF1 conditioned medium, NP460hTert

has an average of 23.8 ± 4.1 % open wound area remaining at eight hours. The wound

further reduced to 11.8 ± 3.2 % at ten hours and finally to 1.68 ± 0.6 % of at the end of

experiments. On the other hand, NP460hTert cultured in conditioned medium form

vector control, the average open wound remaining at eight and ten hours were

approximately two-fold larger than in BARF1 conditioned medium (44.9 ± 4.1 % and

29.2 ± 3.8 % respectively). At twelve hours, an average of 7.23 ± 1.7 % of open wound

area remained for the NP460hTert cultured in conditioned medium from the vector

control.

111

Figure 3.33: Comparison of migration for NP460hTert incubated in either conditioned medium form NP460hTert-BARF1 (BARF1 CM) or

vector control (pLVX CM). Representative micrographs of open wound area for NP460hTert in two different conditioned medium at 4 different

time points. Representative micrographs were from six replicates. Micrographs were documented using Leica DMI 3000B (Leica Biosystem) at

100X phase contrast resolution. Results are representative of two independent experiments.

112

Figure 3.34: Analysis of micrographs by using Tscratch. Representative micrographs of open wound area for NP460hTert in conditioned medium

form either NP460hTert BARF1 (BARF1 CM) or vector control (pLVX CM) at 4 different time points. Micrographs were analyzed

automatically with Tscratch. White overlays were added to visualize the open wound area of micrographs by Tscratch.

113

Figure 3.35: The open wound area of NP460hTert in conditioned medium form either

NP460hTert-BARF1 or NP460hTert-pLVX at four different time points relative to zero

hour. The open wound area was quantified with Tscratch. Data are the means and

standard errors of six replicates and are representative of two independent experiments

(* p<0.05, ** p<0.01).

3.11.3 Discussion

The results suggested that conditioned medium from BARF1 expressing NP460hTert

was able to promote cell proliferation and cell migration in parental NP460hTert. The

cell proliferation promoting activity of BARF1 conditioned medium is likely due to

secreted BARF1 found in the conditioned medium. This result further reinforced the

previous SDS-PAGE data that p29 BARF1 was secreted from NP460hTert-BARF1.

The mitogenic ability of BARF1 secreted from the epithelial cells was well described in

previous studies. Here, BARF1 secreted from transduced nasopharyngeal epithelial

NP460hTert cells would also have powerful mitogenic activity on parental NP460hTert.

Recent study suggested that BARF1 secreted from in vitro models have similar

mitogenic activity to the secreted BARF1 collected from in vivo models and NPC serum

(Houali et al. 2007). Serum from mouse harbouring C666-1 tumour and NPC patients

were efficiently simulated the cell mitogenic activity of human B cells. In addition,

114

mitogenic activity of secreted BARF1 was readily inhibited by the addition of anti-

BARF1 antibody.

Although conditioned medium from BARF1 expressing cells was able to upregulate the

proliferation of NP460hTert, it was not as potent as complete NP460hTert culture

medium. Nevertheless, the conditioned medium from NP460hTert-BARF1 was able to

significantly induce cell proliferation compared to supplement free medium on fourth

days onwards. Several growth components such as human insulin-like growth factor

type-1 (rhlGF-1), prostaglandin E2 (PGE2) and recombinant human epidermal growth

factor (rhEGF) were absent in supplement free medium but were present in complete

medium. These results suggested that mitogenic ability of secreted BARF1 was

comparable to the supplements found in NP460hTert complete medium. The findings

here also concur with previous studies on secreted BARF1 where p29 BARF1 was

showed to have similar or higher mitogenic activity than 10 % FCS (Sakka et al. 2013;

Sall et al. 2004).

The present study also demonstrated that conditioned medium from NP460hTert-

BARF1 could significantly promote cell migration on NP460hTert. Unlike its mitogenic

activity, secreted BARF1 stimulated cell migration was not clearly evaluated in

previous studies. Here, it is demonstrated that secreted BARF1 could improve the

recovery of NP460hTert by approximately two folds. NP460hTert cells were migrated

faster under the influences of BARF1 conditioned medium.

115

Chapter 4

General conclusion and future work

Epstein-Barr virus (EBV) is a herpes virus associated with many human diseases. One

particular human malignancy, nasopharyngeal carcinoma (NPC) is tightly associated

with EBV. NPC is a malignant tumour arising from the surface epithelium of

nasopharynx. EBV infection is detected in most of the NPC cells. Almost all NPC cells

contain EBV genome and express few EBV encoded proteins (Tsao et al. 2012).

However, the critical role of EBV infection in initiation and progression of NPC have

not been clearly defined. The aim of this thesis was to amplify and generate EBV genes

harbouring vectors, to establish EBV expressing nasopharyngeal epithelial cells, and to

examine the biological context of EBV genes in nasopharyngeal epithelial cells.

The present study have successfully established five EBV genes expressing cell system

using telomerase immortalized nasopharyngeal epithelial cells and demonstrated the

biological roles for EBV genes in affecting cell migration and proliferation of

nasopharyngeal epithelial cells. In addition, this study has also established, refined and

improvised the transformation protocol for TOP10F’, lentiviral transduction protocol

for NP460hTert, proliferation assay and migration assay for NP460hTert. It is thus

suggested that both EBV genes BHRF1 and BARF1 may contribute towards

nasopharyngeal epithelial cell proliferation while BARF1 could also upregulate cell

migration. Furthermore, BARF1 may be secreted from BARF1 expressing cells and

may play an important role in NPC through cell proliferation and migration. Finally,

these EBV oncopoteins may be crucial for the microenvironment that is critical to the

initiation, progression and even the maintenance of NPC.

4.1 Primary data conclusions

Although LMP2A in this study was subjected to rapid ubiquitination in host cells, data

obtained showed that short lived LMP2A contributed to a slight improvement in

nasopharyngeal epithelial cell proliferation and migration. Thus, it is postulated that

perhaps complete LMP2A would have greater effect on nasopharyngeal epithelial cell.

Further studies looking at LMP2A contribution in nasopharyngeal epithelial cells are

needed to support the above-mentioned postulation.

116

Interestingly, ectopic expression of LMP1 in nasopharyngeal epithelial cell results in

massive cell death after lentiviral transduction. While LMP1 was capable of activating

several pathways that leads towards the expression of genes involved in cell

proliferation, migration and survival, it has also been suggested that high level of LMP1

was toxic to cells and could induce apoptosis (Brocqueville et al. 2013). Nevertheless,

the precise mechanisms of LMP1 involved in apoptosis of nasopharyngeal epithelial

cell are clearly an area for future investigation.

From the MTT test, it is shown that BARF1 and BHRF1 can promote cell proliferation

in nasopharyngeal epithelial cells NP460hTert. Both BARF1 and BHRF1 expressing

nasopharyngeal epithelial cells proliferated more rapidly than the vector control. While

the expression of both EBV genes could upregulate cell proliferation in nasopharyngeal

epithelial cells, BARF1 expressing cells showed higher proliferation rate than BHRF1

expressing cells. The mitogenic activity of BARF1 was consistent with previous studies,

which stated that the expression of BARF1 induced cell proliferation in human

epithelial cells, gastric carcinoma and NPC (Sakka et al. 2013; Sall et al. 2004; Seto et

al. 2005). This study further expanded the understanding regarding BARF1 by

demonstrating that ectopic expression of BARF1 could upregulate the cell proliferation

of nasopharyngeal epithelial cells.

Although studies have addressed the anti-apoptotic effects of BHRF1 in different cell

lines, mitogenic roles of BHRF1 in epithelial cells were in contradiction. BHRF1

expression was shown to promote cell proliferation in human squamous cell carcinoma

but reduced the NPC cell proliferative rate. In this regard, the data from this study

provided additional insight on the proliferative activity of BHRF1 that might be

dependent on the nature of cells. For instant, the data from this study showed that the

proliferative activity of BHRF1 in non-tumorigenic nasopharyngeal epithelial cells was

similar to non-tumorigenic human squamous cell carcinoma but totally opposite to

malignant NPC cells. In addition, possible HeLa contamination might have unforeseen

effects on BHRF1 proliferation in NPC cells.

In contrast with the effect of the increase of cell proliferation, BHRF1 expression did

not increase cell migration in NP460hTert. Similar to mitogenic role of BHRF1,

BHRF1 migration capability was not well reported in previous studies. That BHRF1

promote cell proliferation rather than cell migration suggests that it may only affect

117

proliferation signalling pathway but not migration signalling pathway. The interaction

between BHRF1 and cell proliferation regulator is clearly an area for future study. On

the other hand, it was observed that BARF1 expressing nasopharyngeal epithelial cells

closed its wound faster than the vector control. In the past, most studies only described

BARF1 as a strong mitogenic agent and an earlier report showed that BARF1 did not

improve the cell migration of gastric carcinoma cells (Chang et al. 2013). Our

observation suggested that BARF1 could induce both cell migration and proliferation in

nasopharyngeal epithelial cells. Interestingly, this discrepancy might indicate that

BARF1 expression may have different biological effects depending on cell types.

Furthermore, the results in this study suggested that the cell migration induced by

BARF1 was independent from cell proliferation.

The increased cell proliferation and migration observed in BARF1 expressing

nasopharyngeal epithelial cells might be contributed by secreted BARF1. In order to

verify the autocrine or paracrine activity of secreted BARF1 on cell proliferation and

migration, the parental nasopharyngeal epithelial cells were cultivated in conditioned

medium generated from either BARF1 expressing cells or the vector control.

Interestingly, parental nasopharyngeal epithelial cells with BARF1 conditioned medium

appeared to have greater proliferation rate and faster migration than cells in conditioned

medium from the vector control. These findings indicated that secreted form of BARF1

could be produced from BARF1 expressing nasopharyngeal epithelial cells and could

promote both proliferation and migration in parental cells. The findings also

demonstrated that secreted BARF1 have mitogenic activity that in comparison to

growth supplement found in complete medium for nasopharyngeal epithelial cells. The

precise signalling pathways involved in BARF1 related cell proliferation and migration

remains to be elucidated.

4.2 Technical conclusions

Recombinant DNA technology has revolutionized the molecular science by providing

tools that allows us to understand the structures, expressions and functions of genes

(Pasternak 2005). It also has a profound impact in medical science through the

understanding of the molecular basis of genetic disorder and development of new

therapeutic strategies (Khan et al. 2016). Generation of recombinant DNA typically

involved extraction of DNA from source organism, then digesting the DNA with

118

restriction enzyme and finally ligation of the DNA to specific designed vector. In the

present study, the isolation of targeted EBV genes from EBV infected nasopharyngeal

epithelial cells, the generation of four transduced NP460hTert cell lines including vector

control and the determination of the molecular effects of three EBV genes were made

possible with the help of recombinant DNA technology. The novelty of this project lies

in its use of mammalian cell culture and to perform cloning of DNA constructs. Several

adaptations, optimizations and changes were made in order to overcome the challenges

faced to accomplish the objectives of this study.

In this study, it was demonstrated that specific primers could be designed to target and

amplify genes of interest based on the cDNA sequences found in GenBank database.

The functional cDNA must first be synthesised from source mRNA to exclude all the

introns from the gene. Furthermore, several primer modifications such as a tag,

restriction sites and the Kozak sequence could be added into the primers depending on

the objectives of current study. These modifications wrere added to the cDNA during

PCR amplification. Kozak sequence, added to the 5’ end of cDNA, was incorporated to

initiate the translation and to improve the translation efficiency. Since innate cDNA

lacked restriction sites, two restriction sites were added to flank both ends of the cDNA.

The restriction sites added could facilitate the cloning of cDNA into vector or shuttle

the cDNA across different vectors.

The c-Myc epitope tag sequence was placed in between Kozak sequence and forward

primers sequence. The choice of the tag placement has an important impact on

experimental outcome. Initially, the objective was to integrate a similar tag in every

EBV genes and use only one antibody for the entire detection assay. This design has a

few advantages such as a streamlined detection process with only one antibody and

reducing the expenses from purchasing multiple costly antibodies. However, there are

some underlying issues that were beyond our considerations during the design of the tag

system. First, protein stability is regulated by the microenvironment of its amino

terminal. Addition of a tag in the amino terminal of protein might block the

ubiquitination of protein and prevent the subsequent degradation or induce a rapid

unbuqitination of the tagged protein. In this study, the addition of c-Myc tag at the

amino terminal end of LMP2A had dramatically increased the LMP2A ubiquitination

and resulted in establishment of inadequate LMP2A expression in the NP460hTert cell

119

line. Secondly, the tag could be subjected to proteolytic cleavage during post-

translational modification of secreted protein. The cleavage of amino terminal

methionine and specific signal peptide is important for maturation and secretion of

protein (Rogers & Overall 2013). As a secreted protein, the removal of first twenty

amino acids is essential for maturation and secretion of BARF1. Because of this

cleavage event, the amino terminal c-Myc tag was removed during the secretion of

BARF1 and the detection of secreted BARF1 using antibody was hindered in the

conditioned medium from NP460hTert-BARF1. Therefore, comprehensive and

thorough understanding of protein biosynthesis is recommended for designing the

cloning primers.

The cDNA generated were incorporated into the cloning vectors through restriction

digestion and ligation. The cDNA was first cloned into mammalian expression vector

pcDNA 3.1 Hygro and then shuttled into lentiviral vector pLVX-Puro. The host

independent self-replicating attribute of cloning vectors allowed us to perpetuate the

insert by transforming the recombinant DNA into bacterial host cells. In addition,

cloning vectors have few selectable markers that enable the isolation of host cells with

proper DNA construct. Escherichia coli has been developed as the universal bacterial

host for cloning of recombinant DNA (Hanahan 1983). However, the process when

recombinant DNA was introduced into E. coli, transformation, is extremely inefficient.

A competent state of E. coli must be first induced before the uptake of exogenous DNA

through transformation. In the present study, E. coli strain TOP10F’ was induced to a

highly competent state for transformation through chemical induction. The utilization of

manganese, magnesium and potassium in addition to calcium was able to produce

competent TOP10F’ with higher transformation efficiency. Furthermore, this project

was able to generate highly competent TOP10F’ consistently among different batches of

competent cells by using similar chemical treatments.

Multiple DNA sequence mutations were observed in the recombinant DNA produced in

this study. A few of the mutations were likely introduced during the PCR amplification

while one of the mutations was incorporated unintentionally. High fidelity DNA

synthesis was an important technique for cloning of the targeted gene with superb

accuracy. Precise DNA sequences are required for in vitro synthesis of functional

protein from gene of interest. However, PCR cloning is susceptible to PCR generated

120

errors especially during the cloning of large pool DNA templates with low fidelity

polymerase. Therefore, utilising high fidelity polymerase that contains proofreading

exonuclease is crucial to synthesise the DNA free from mismatched nucleotides. This

would allow to overcome the challenges arising from PCR larger templates and to

generate error free EBV cDNA.

The nasopharyngeal epithelial cells NP460hTert was the only cell line used in the

present study. NP460hTert was established from primary non-malignant

nasopharyngeal biopsies and immortalized with overexpression of human telomerase

(Li et al. 2006b). NP460hTert harbours several genetic alterations such as inactivation

of p16 and RASSF1A that has been previously identified in premalignant

nasopharyngeal epithelial cells (Lo, To & Huang 2004). Furthermore, due to the lack of

representative models, previous studies of EBV infection in epithelial cells were mainly

conducted in established cancer cell lines (Tsang et al. 2010). Thus, NP460hTert was

considered as an excellenct model for the investigation of EBV involvement in the

pathogenesis of NPC.

Lentiviral vectors have become one of the most widely used vectors for transgene

expression due to their relative broad range of tropism coupled with the ability to infect

both diving and non-dividing cells (Merten, Hebben & Bovolenta 2016). By using

second generation lentiviral system, this study successfully transduced nasopharyngeal

epithelial cells NP460hTert and generated five different clones including the vector

control. Thus, this study demonstrated that lentiviral system was albe to transduce

nasopharyngeal epithelial cells efficiently, producing cells with stable expressed gene of

interest, and without any complication.

121

References

Abbas, T & Dutta, A 2009, 'p21 in cancer: intricate networks and multiple activities', Nat Rev Cancer, vol. 9, no. 6, Jun, pp. 400-14.

Adham, M, Kurniawan, AN, Muhtadi, AI, Roezin, A, Hermani, B, Gondhowiardjo, S, Tan, IB & Middeldorp, JM 2012, 'Nasopharyngeal carcinoma in Indonesia: epidemiology, incidence, signs, and symptoms at presentation', Chin J Cancer, vol. 31, no. 4, Apr, pp. 185-96. Al-Sarraf, M, LeBlanc, M, Giri, PG, Fu, KK, Cooper, J, Vuong, T, Forastiere, AA, Adams, G, Sakr, WA, Schuller, DE & Ensley, JF 1998, 'Chemoradiotherapy versus radiotherapy in patients with advanced nasopharyngeal cancer: phase III randomized Intergroup study 0099', J Clin Oncol, vol. 16, no. 4, Apr, pp. 1310-7. Alfieri, C, Birkenbach, M & Kieff, E 1991, 'Early events in Epstein-Barr virus infection of human B lymphocytes', Virology, vol. 181, no. 2, Apr, pp. 595-608. Allday, MJ, Bazot, Q & White, RE 2015, 'The EBNA3 Family: Two Oncoproteins and a Tumour Suppressor that Are Central to the Biology of EBV in B Cells', Curr Top Microbiol Immunol, vol. 391, pp. 61-117. Allen, MD, Young, LS & Dawson, CW 2005, 'The Epstein-Barr virus-encoded LMP2A and LMP2B proteins promote epithelial cell spreading and motility', J Virol, vol. 79, no. 3, Feb, pp. 1789-802. American Type Culture Collection Standards Development Organization Workgroup, ASN 2010, 'Cell line misidentification: the beginning of the end', Nat Rev Cancer, vol. 10, no. 6, Jun, pp. 441-8. Armstrong, RW, Imrey, PB, Lye, MS, Armstrong, MJ, Yu, MC & Sani, S 1998, 'Nasopharyngeal carcinoma in Malaysian Chinese: salted fish and other dietary exposures', Int J Cancer, vol. 77, no. 2, Jul 17, pp. 228-35. Armstrong, RW, Imrey, PB, Lye, MS, Armstrong, MJ, Yu, MC & Sani, S 2000, 'Nasopharyngeal carcinoma in Malaysian Chinese: occupational exposures to particles, formaldehyde and heat', Int J Epidemiol, vol. 29, no. 6, Dec, pp. 991-8. Armstrong, RW, Kutty, MK & Dharmalingam, SK 1974, 'Incidence of nasopharyngeal carcinoma in Malaysia, with special reference to the state of Selangor', Br J Cancer, vol. 30, no. 1, Jul, pp. 86-94. Austin, PJ, Flemington, E, Yandava, CN, Strominger, JL & Speck, SH 1988, 'Complex transcription of the Epstein-Barr virus BamHI fragment H rightward open reading frame 1 (BHRF1) in latently and lytically infected B lymphocytes', Proc Natl Acad Sci U S A, vol. 85, no. 11, Jun, pp. 3678-82.

122

Azizah, AM, Nor Saleha, IT, Noor Hashimah, A, Asmah, ZA & Mastulu, W 2016, in MALAYSIAN NATIONAL CANCER REGISTRY REPORT 2007-2011, National Cancer Institute Ministry of Health, Putrajaya, Malaysia. Baer, R, Bankier, AT, Biggin, MD, Deininger, PL, Farrell, PJ, Gibson, TJ, Hatfull, G, Hudson, GS, Satchwell, SC, Seguin, C & et al. 1984, 'DNA sequence and expression of the B95-8 Epstein-Barr virus genome', Nature, vol. 310, no. 5974, Jul 19-25, pp. 207-11. Bartel, DP 2009, 'MicroRNAs: target recognition and regulatory functions', Cell, vol. 136, no. 2, Jan 23, pp. 215-33. Bei, JX, Li, Y, Jia, WH, Feng, BJ, Zhou, G, Chen, LZ, Feng, QS, Low, HQ, Zhang, H, He, F, Tai, ES, Kang, T, Liu, ET, Liu, J & Zeng, YX 2010, 'A genome-wide association study of nasopharyngeal carcinoma identifies three new susceptibility loci', Nat Genet, vol. 42, no. 7, Jul, pp. 599-603. Bensouda, Y, Kaikani, W, Ahbeddou, N, Rahhali, R, Jabri, M, Mrabti, H, Boussen, H & Errihani, H 2011a, 'Treatment for metastatic nasopharyngeal carcinoma', Eur Ann Otorhinolaryngol Head Neck Dis, vol. 128, no. 2, Apr, pp. 79-85. Bensouda, Y, Kaikani, W, Ahbeddou, N, Rahhali, R, Jabri, M, Mrabti, H, Boussen, H & Errihani, H 2011b, 'Treatment for metastatic nasopharyngeal carcinoma', European Annals of Otorhinolaryngology, Head and Neck Diseases, vol. 128, no. 2, 2011/04/01/, pp. 79-85. Bernardi, R & Pandolfi, PP 2007, 'Structure, dynamics and functions of promyelocytic leukaemia nuclear bodies', Nat Rev Mol Cell Biol, vol. 8, no. 12, Dec, pp. 1006-16. Bhattacharjee, S, Ghosh Roy, S, Bose, P & Saha, A 2016, 'Role of EBNA-3 Family Proteins in EBV Associated B-cell Lymphomagenesis', Front Microbiol, vol. 7, p. 457. Bray, F, Colombet, M, Mery, L, Piñeros, M, Znaor, A, Zanetti, R & Ferlay, J 2017, in Cancer Incidence in Five Continents, Vol. XI, International Agency for Research on Cancer, Lyon, France. Bray, F, Ferlay, J, Laversanne, M, Brewster, DH, Gombe Mbalawa, C, Kohler, B, Pineros, M, Steliarova-Foucher, E, Swaminathan, R, Antoni, S, Soerjomataram, I & Forman, D 2015, 'Cancer Incidence in Five Continents: Inclusion criteria, highlights from Volume X and the global status of cancer registration', Int J Cancer, vol. 137, no. 9, Nov 1, pp. 2060-71. Brocqueville, G, Ndour, PA, Ouk, TS, Le Goff, A, De Witte, C, Mougel, A, Coll, J, Fafeur, V, Le Bourhis, X & Adriaenssens, E 2013, 'LMP1-induced cell death may contribute to the emergency of its oncogenic property', PLoS One, vol. 8, no. 4, p. e60743. Burns, JC, Friedmann, T, Driever, W, Burrascano, M & Yee, JK 1993, 'Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells', Proc Natl Acad Sci U S A, vol. 90, no. 17, Sep 01, pp. 8033-7.

123

Bzymek, M & Lovett, ST 2001, 'Instability of repetitive DNA sequences: The role of replication in multiple mechanisms', Proceedings of the National Academy of Sciences, vol. 98, no. 15, July 17, 2001, pp. 8319-8325. Cai, L, Ye, Y, Jiang, Q, Chen, Y, Lyu, X, Li, J, Wang, S, Liu, T, Cai, H, Yao, K, Li, JL & Li, X 2015a, 'Epstein-Barr virus-encoded microRNA BART1 induces tumour metastasis by regulating PTEN-dependent pathways in nasopharyngeal carcinoma', Nat Commun, vol. 6, Jul 2, p. 7353. Cai, LM, Lyu, XM, Luo, WR, Cui, XF, Ye, YF, Yuan, CC, Peng, QX, Wu, DH, Liu, TF, Wang, E, Marincola, FM, Yao, KT, Fang, WY, Cai, HB & Li, X 2015b, 'EBV-miR-BART7-3p promotes the EMT and metastasis of nasopharyngeal carcinoma cells by suppressing the tumor suppressor PTEN', Oncogene, vol. 34, no. 17, Apr 23, pp. 2156-66. Cao, JY, Mansouri, S & Frappier, L 2012, 'Changes in the nasopharyngeal carcinoma nuclear proteome induced by the EBNA1 protein of Epstein-Barr virus reveal potential roles for EBNA1 in metastasis and oxidative stress responses', J Virol, vol. 86, no. 1, Jan, pp. 382-94. Cao, Y, Miao, XP, Huang, MY, Deng, L, Lin, DX, Zeng, YX & Shao, JY 2010, 'Polymorphisms of death pathway genes FAS and FASL and risk of nasopharyngeal carcinoma', Mol Carcinog, vol. 49, no. 11, Nov, pp. 944-50. Carbone, A, Gloghini, A & Dotti, G 2008, 'EBV-associated lymphoproliferative disorders: classification and treatment', Oncologist, vol. 13, no. 5, May, pp. 577-85. Cen, O & Longnecker, R 2015, 'Latent Membrane Protein 2 (LMP2)', Curr Top Microbiol Immunol, vol. 391, pp. 151-80. Chai, SJ, Pua, KC, Saleh, A, Yap, YY, Lim, PV, Subramaniam, SK, Lum, CL, Krishnan, G, Mahiyuddin, WR, Teo, SH, Khoo, AS & Yap, LF 2012, 'Clinical significance of plasma Epstein-Barr Virus DNA loads in a large cohort of Malaysian patients with nasopharyngeal carcinoma', J Clin Virol, vol. 55, no. 1, Sep, pp. 34-9. Chan, AT, Leung, SF, Ngan, RK, Teo, PM, Lau, WH, Kwan, WH, Hui, EP, Yiu, HY, Yeo, W, Cheung, FY, Yu, KH, Chiu, KW, Chan, DT, Mok, TS, Yau, S, Yuen, KT, Mo, FK, Lai, MM, Ma, BB, Kam, MK, Leung, TW, Johnson, PJ, Choi, PH & Zee, BC 2005, 'Overall survival after concurrent cisplatin-radiotherapy compared with radiotherapy alone in locoregionally advanced nasopharyngeal carcinoma', J Natl Cancer Inst, vol. 97, no. 7, Apr 6, pp. 536-9. Chan, JY, Gao, W, Ho, WK, Wei, WI & Wong, TS 2012, 'Overexpression of Epstein-Barr virus-encoded microRNA-BART7 in undifferentiated nasopharyngeal carcinoma', Anticancer Res, vol. 32, no. 8, Aug, pp. 3201-10. Chan, SY, Choy, KW, Tsao, SW, Tao, Q, Tang, T, Chung, GT & Lo, KW 2008, 'Authentication of nasopharyngeal carcinoma tumor lines', Int J Cancer, vol. 122, no. 9, May 01, pp. 2169-71.

124

Chang, CM, Yu, KJ, Mbulaiteye, SM, Hildesheim, A & Bhatia, K 2009, 'The extent of genetic diversity of Epstein-Barr virus and its geographic and disease patterns: a need for reappraisal', Virus Res, vol. 143, no. 2, Aug, pp. 209-21. Chang, ET & Adami, HO 2006, 'The enigmatic epidemiology of nasopharyngeal carcinoma', Cancer Epidemiol Biomarkers Prev, vol. 15, no. 10, Oct, pp. 1765-77. Chang, MS, Kim, DH, Roh, JK, Middeldorp, JM, Kim, YS, Kim, S, Han, S, Kim, CW, Lee, BL, Kim, WH & Woo, JH 2013, 'Epstein-Barr virus-encoded BARF1 promotes proliferation of gastric carcinoma cells through regulation of NF-kappaB', J Virol, vol. 87, no. 19, Oct, pp. 10515-23. Chang, SH, Chang, HC & Hung, WC 2008, 'Transcriptional repression of tissue inhibitor of metalloproteinase-3 by Epstein-Barr virus latent membrane protein 1 enhances invasiveness of nasopharyngeal carcinoma cells', Oral Oncol, vol. 44, no. 9, Sep, pp. 891-7. Chen, A, Zhao, B, Kieff, E, Aster, JC & Wang, F 2006, 'EBNA-3B- and EBNA-3C-regulated cellular genes in Epstein-Barr virus-immortalized lymphoblastoid cell lines', J Virol, vol. 80, no. 20, Oct, pp. 10139-50. Chen, L, Gallicchio, L, Boyd-Lindsley, K, Tao, XG, Robinson, KA, Lam, TK, Herman, JG, Caulfield, LE, Guallar, E & Alberg, AJ 2009, 'Alcohol consumption and the risk of nasopharyngeal carcinoma: a systematic review', Nutr Cancer, vol. 61, no. 1, pp. 1-15. Chen, SY, Lu, J, Shih, YC & Tsai, CH 2002, 'Epstein-Barr virus latent membrane protein 2A regulates c-Jun protein through extracellular signal-regulated kinase', J Virol, vol. 76, no. 18, Sep, pp. 9556-61. Chen, Y & Chan, SH 1994, 'Polymorphism of T-cell receptor genes in nasopharyngeal carcinoma', Int J Cancer, vol. 56, no. 6, Mar 15, pp. 830-3. Cheng, TC, Hsieh, SS, Hsu, WL, Chen, YF, Ho, HH & Sheu, LF 2010, 'Expression of Epstein-Barr nuclear antigen 1 in gastric carcinoma cells is associated with enhanced tumorigenicity and reduced cisplatin sensitivity', Int J Oncol, vol. 36, no. 1, Jan, pp. 151-60. Chesnokova, LS & Hutt-Fletcher, LM 2014, 'Epstein-Barr virus infection mechanisms', Chin J Cancer, vol. 33, no. 11, Nov, pp. 545-8. Cheung, ST, Huang, DP, Hui, AB, Lo, KW, Ko, CW, Tsang, YS, Wong, N, Whitney, BM & Lee, JC 1999, 'Nasopharyngeal carcinoma cell line (C666-1) consistently harbouring Epstein-Barr virus', Int J Cancer, vol. 83, no. 1, Sep 24, pp. 121-6. Chia, WK, Teo, M, Wang, WW, Lee, B, Ang, SF, Tai, WM, Chee, CL, Ng, J, Kan, R, Lim, WT, Tan, SH, Ong, WS, Cheung, YB, Tan, EH, Connolly, JE, Gottschalk, S & Toh, HC 2014, 'Adoptive T-cell transfer and chemotherapy in the first-line treatment of metastatic and/or locally recurrent nasopharyngeal carcinoma', Mol Ther, vol. 22, no. 1, Jan, pp. 132-9.

125

Chien, YC, Chen, JY, Liu, MY, Yang, HI, Hsu, MM, Chen, CJ & Yang, CS 2001, 'Serologic markers of Epstein-Barr virus infection and nasopharyngeal carcinoma in Taiwanese men', N Engl J Med, vol. 345, no. 26, Dec 27, pp. 1877-82. Cho, EY, Hildesheim, A, Chen, CJ, Hsu, MM, Chen, IH, Mittl, BF, Levine, PH, Liu, MY, Chen, JY, Brinton, LA, Cheng, YJ & Yang, CS 2003, 'Nasopharyngeal carcinoma and genetic polymorphisms of DNA repair enzymes XRCC1 and hOGG1', Cancer Epidemiol Biomarkers Prev, vol. 12, no. 10, Oct, pp. 1100-4. Choy, EY, Siu, KL, Kok, KH, Lung, RW, Tsang, CM, To, KF, Kwong, DL, Tsao, SW & Jin, DY 2008, 'An Epstein-Barr virus-encoded microRNA targets PUMA to promote host cell survival', J Exp Med, vol. 205, no. 11, Oct 27, pp. 2551-60. Chua, DT, Sham, JS, Kwong, DL & Au, GK 2003, 'Treatment outcome after radiotherapy alone for patients with Stage I-II nasopharyngeal carcinoma', Cancer, vol. 98, no. 1, Jul 1, pp. 74-80. Cochet, C, Martel-Renoir, D, Grunewald, V, Bosq, J, Cochet, G, Schwaab, G, Bernaudin, JF & Joab, I 1993, 'Expression of the Epstein-Barr virus immediate early gene, BZLF1, in nasopharyngeal carcinoma tumor cells', Virology, vol. 197, no. 1, Nov, pp. 358-65. Cochrane, AW, Chen, CH & Rosen, CA 1990, 'Specific interaction of the human immunodeficiency virus Rev protein with a structured region in the env mRNA', Proc Natl Acad Sci U S A, vol. 87, no. 3, Feb, pp. 1198-202. Coghill, AE, Hsu, WL, Pfeiffer, RM, Juwana, H, Yu, KJ, Lou, PJ, Wang, CP, Chen, JY, Chen, CJ, Middeldorp, JM & Hildesheim, A 2014, 'Epstein-Barr virus serology as a potential screening marker for nasopharyngeal carcinoma among high-risk individuals from multiplex families in Taiwan', Cancer Epidemiol Biomarkers Prev, vol. 23, no. 7, Jul, pp. 1213-9. Cogliano, VJ, Grosse, Y, Baan, RA, Straif, K, Secretan, MB & El Ghissassi, F 2005, 'Meeting report: summary of IARC monographs on formaldehyde, 2-butoxyethanol, and 1-tert-butoxy-2-propanol', Environ Health Perspect, vol. 113, no. 9, Sep, pp. 1205-8. Cosmopoulos, K, Pegtel, M, Hawkins, J, Moffett, H, Novina, C, Middeldorp, J & Thorley-Lawson, DA 2009, 'Comprehensive profiling of Epstein-Barr virus microRNAs in nasopharyngeal carcinoma', J Virol, vol. 83, no. 5, Mar, pp. 2357-67. da Costa, VG, Marques-Silva, AC & Moreli, ML 2015, 'The Epstein-Barr virus latent membrane protein-1 (LMP1) 30-bp deletion and XhoI-polymorphism in nasopharyngeal carcinoma: a meta-analysis of observational studies', Syst Rev, vol. 4, Apr 13, p. 46. Dai, Q, Li, XP, Chai, L, Long, HA & Yang, ZH 2014, 'Polymorphisms of Toll-like receptor 9 are associated with nasopharyngeal carcinoma susceptibility', Tumour Biol, vol. 35, no. 4, Apr, pp. 3247-53.

126

Davis, JE, Sutton, VR, Smyth, MJ & Trapani, JA 2000, 'Dependence of granzyme B-mediated cell death on a pathway regulated by Bcl-2 or its viral homolog, BHRF1', Cell Death Differ, vol. 7, no. 10, Oct, pp. 973-83. Dawson, CW, Dawson, J, Jones, R, Ward, K & Young, LS 1998, 'Functional differences between BHRF1, the Epstein-Barr virus-encoded Bcl-2 homologue, and Bcl-2 in human epithelial cells', J Virol, vol. 72, no. 11, Nov, pp. 9016-24. Dawson, CW, Port, RJ & Young, LS 2012, 'The role of the EBV-encoded latent membrane proteins LMP1 and LMP2 in the pathogenesis of nasopharyngeal carcinoma (NPC)', Semin Cancer Biol, vol. 22, no. 2, Apr, pp. 144-53. De Paschale, M & Clerici, P 2012, 'Serological diagnosis of Epstein-Barr virus infection: Problems and solutions', World J Virol, vol. 1, no. 1, Feb 12, pp. 31-43. de Turenne-Tessier, M & Ooka, T 2007, 'Post-translational modifications of Epstein Barr virus BARF1 oncogene-encoded polypeptide', J Gen Virol, vol. 88, no. Pt 10, Oct, pp. 2656-61. Decaussin, G, Sbih-Lammali, F, de Turenne-Tessier, M, Bouguermouh, A & Ooka, T 2000, 'Expression of BARF1 gene encoded by Epstein-Barr virus in nasopharyngeal carcinoma biopsies', Cancer Res, vol. 60, no. 19, Oct 01, pp. 5584-8. Devi, BC, Pisani, P, Tang, TS & Parkin, DM 2004, 'High incidence of nasopharyngeal carcinoma in native people of Sarawak, Borneo Island', Cancer Epidemiol Biomarkers Prev, vol. 13, no. 3, Mar, pp. 482-6. Dillner, J, Kallin, B, Alexander, H, Ernberg, I, Uno, M, Ono, Y, Klein, G & Lerner, RA 1986, 'An Epstein-Barr virus (EBV)-determined nuclear antigen (EBNA5) partly encoded by the transformation-associated Bam WYH region of EBV DNA: preferential expression in lymphoblastoid cell lines', Proc Natl Acad Sci U S A, vol. 83, no. 17, Sep, pp. 6641-5. Dittmer, DP, Hilscher, CJ, Gulley, ML, Yang, EV, Chen, M & Glaser, R 2008, 'Multiple pathways for Epstein-Barr virus episome loss from nasopharyngeal carcinoma', Int J Cancer, vol. 123, no. 9, Nov 1, pp. 2105-12. Donaldson, JG, Lippincott-Schwartz, J & Klausner, RD 1991, 'Guanine nucleotides modulate the effects of brefeldin A in semipermeable cells: regulation of the association of a 110-kD peripheral membrane protein with the Golgi apparatus', J Cell Biol, vol. 112, no. 4, Feb, pp. 579-88. Dubrulle, F, Souillard, R & Hermans, R 2007, 'Extension patterns of nasopharyngeal carcinoma', Eur Radiol, vol. 17, no. 10, Oct, pp. 2622-30. Epstein, MA, Achong, BG & Barr, YM 1964, 'VIRUS PARTICLES IN CULTURED LYMPHOBLASTS FROM BURKITT'S LYMPHOMA', Lancet, vol. 1, no. 7335, Mar 28, pp. 702-3.

127

Falk, K, Gratama, JW, Rowe, M, Zou, JZ, Khanim, F, Young, LS, Oosterveer, MA & Ernberg, I 1995, 'The role of repetitive DNA sequences in the size variation of Epstein-Barr virus (EBV) nuclear antigens, and the identification of different EBV isolates using RFLP and PCR analysis', J Gen Virol, vol. 76 ( Pt 4), Apr, pp. 779-90. Fang, CY, Lee, CH, Wu, CC, Chang, YT, Yu, SL, Chou, SP, Huang, PT, Chen, CL, Hou, JW, Chang, Y, Tsai, CH, Takada, K & Chen, JY 2009, 'Recurrent chemical reactivations of EBV promotes genome instability and enhances tumor progression of nasopharyngeal carcinoma cells', Int J Cancer, vol. 124, no. 9, May 1, pp. 2016-25. Fanidi, A, Hancock, DC & Littlewood, TD 1998, 'Suppression of c-Myc-induced apoptosis by the Epstein-Barr virus gene product BHRF1', J Virol, vol. 72, no. 10, Oct, pp. 8392-5. Farrell, PJ 2015, 'Epstein-Barr Virus Strain Variation', Curr Top Microbiol Immunol, vol. 390, no. Pt 1, pp. 45-69. Farrow, DC, Vaughan, TL, Berwick, M, Lynch, CF, Swanson, GM & Lyon, JL 1998, 'Diet and nasopharyngeal cancer in a low-risk population', Int J Cancer, vol. 78, no. 6, Dec 9, pp. 675-9. Feederle, R, Haar, J, Bernhardt, K, Linnstaedt, SD, Bannert, H, Lips, H, Cullen, BR & Delecluse, HJ 2011, 'The members of an Epstein-Barr virus microRNA cluster cooperate to transform B lymphocytes', J Virol, vol. 85, no. 19, Oct, pp. 9801-10. Feederle, R, Klinke, O, Kutikhin, A, Poirey, R, Tsai, MH & Delecluse, HJ 2015, 'Epstein-Barr Virus: From the Detection of Sequence Polymorphisms to the Recognition of Viral Types', Curr Top Microbiol Immunol, vol. 390, no. Pt 1, pp. 119-48. Feng, BJ 2013, 'Descriptive, environmental and genetic epidemiology of nasopharyngeal carcinoma', in Nasopharyngeal Carcinoma, Springer, pp. 23-41. Feng, BJ, Huang, W, Shugart, YY, Lee, MK, Zhang, F, Xia, JC, Wang, HY, Huang, TB, Jian, SW, Huang, P, Feng, QS, Huang, LX, Yu, XJ, Li, D, Chen, LZ, Jia, WH, Fang, Y, Huang, HM, Zhu, JL, Liu, XM, Zhao, Y, Liu, WQ, Deng, MQ, Hu, WH, Wu, SX, Mo, HY, Hong, MF, King, MC, Chen, Z & Zeng, YX 2002, 'Genome-wide scan for familial nasopharyngeal carcinoma reveals evidence of linkage to chromosome 4', Nat Genet, vol. 31, no. 4, Aug, pp. 395-9. Feng, BJ, Jalbout, M, Ayoub, WB, Khyatti, M, Dahmoul, S, Ayad, M, Maachi, F, Bedadra, W, Abdoun, M, Mesli, S, Hamdi-Cherif, M, Boualga, K, Bouaouina, N, Chouchane, L, Benider, A, Ben Ayed, F, Goldgar, D & Corbex, M 2007, 'Dietary risk factors for nasopharyngeal carcinoma in Maghrebian countries', Int J Cancer, vol. 121, no. 7, Oct 1, pp. 1550-5. Feng, P, Ren, EC, Liu, D, Chan, SH & Hu, H 2000, 'Expression of Epstein-Barr virus lytic gene BRLF1 in nasopharyngeal carcinoma: potential use in diagnosis', J Gen Virol, vol. 81, no. Pt 10, Oct, pp. 2417-23.

128

Ferlay, J, Soerjomataram, I, Dikshit, R, Eser, S, Mathers, C, Rebelo, M, Parkin, DM, Forman, D & Bray, F 2015, 'Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012', Int J Cancer, vol. 136, no. 5, Mar 1, pp. E359-86. Ferlay, J, Soerjomataram, I, Ervik, M, Dikshit, R, Eser, S, Mathers, C, Rebelo, M, Parkin, D, Forman, D & Bray, F 2013, in GLOBOCAN 2012 v1.0, Cancer Incidence and Mortality Worldwide: IARC CancerBase No. 11 International Agency for Research on Cancer, Lyon, France. Finke, J, Rowe, M, Kallin, B, Ernberg, I, Rosen, A, Dillner, J & Klein, G 1987, 'Monoclonal and polyclonal antibodies against Epstein-Barr virus nuclear antigen 5 (EBNA-5) detect multiple protein species in Burkitt's lymphoma and lymphoblastoid cell lines', J Virol, vol. 61, no. 12, Dec, pp. 3870-8. Flanagan, AM & Letai, A 2008, 'BH3 domains define selective inhibitory interactions with BHRF-1 and KSHV BCL-2', Cell Death Differ, vol. 15, no. 3, Mar, pp. 580-8. Foghsgaard, L & Jaattela, M 1997, 'The ability of BHRF1 to inhibit apoptosis is dependent on stimulus and cell type', J Virol, vol. 71, no. 10, Oct, pp. 7509-17. Fotheringham, JA, Coalson, NE & Raab-Traub, N 2012, 'Epstein-Barr virus latent membrane protein-2A induces ITAM/Syk- and Akt-dependent epithelial migration through alphav-integrin membrane translocation', J Virol, vol. 86, no. 19, Oct, pp. 10308-20. Fotheringham, JA, Mazzucca, S & Raab-Traub, N 2010, 'Epstein-Barr virus latent membrane protein-2A-induced DeltaNp63alpha expression is associated with impaired epithelial-cell differentiation', Oncogene, vol. 29, no. 30, Jul 29, pp. 4287-96. Frappier, L 2012, 'Role of EBNA1 in NPC tumourigenesis', Semin Cancer Biol, vol. 22, no. 2, Apr, pp. 154-61. Frappier, L 2015, 'EBNA1', Curr Top Microbiol Immunol, vol. 391, pp. 3-34. Fukuda, M & Longnecker, R 2004, 'Latent membrane protein 2A inhibits transforming growth factor-beta 1-induced apoptosis through the phosphatidylinositol 3-kinase/Akt pathway', J Virol, vol. 78, no. 4, Feb, pp. 1697-705. Fukuda, M & Longnecker, R 2007, 'Epstein-Barr virus latent membrane protein 2A mediates transformation through constitutive activation of the Ras/PI3-K/Akt Pathway', J Virol, vol. 81, no. 17, Sep, pp. 9299-306. Gallicchio, L, Matanoski, G, Tao, XG, Chen, L, Lam, TK, Boyd, K, Robinson, KA, Balick, L, Mickelson, S, Caulfield, LE, Herman, JG, Guallar, E & Alberg, AJ 2006, 'Adulthood consumption of preserved and nonpreserved vegetables and the risk of nasopharyngeal carcinoma: a systematic review', Int J Cancer, vol. 119, no. 5, Sep 1, pp. 1125-35.

129

Gao, LB, Liang, WB, Xue, H, Rao, L, Pan, XM, Lv, ML, Bai, P, Fang, WL, Liu, J, Liao, M & Zhang, L 2009, 'Genetic polymorphism of interleukin-16 and risk of nasopharyngeal carcinoma', Clin Chim Acta, vol. 409, no. 1-2, Nov, pp. 132-5. Geback, T, Schulz, MM, Koumoutsakos, P & Detmar, M 2009, 'TScratch: a novel and simple software tool for automated analysis of monolayer wound healing assays', Biotechniques, vol. 46, no. 4, Apr, pp. 265-74. Gilligan, KJ, Rajadurai, P, Lin, JC, Busson, P, Abdel-Hamid, M, Prasad, U, Tursz, T & Raab-Traub, N 1991, 'Expression of the Epstein-Barr virus BamHI A fragment in nasopharyngeal carcinoma: evidence for a viral protein expressed in vivo', J Virol, vol. 65, no. 11, Nov, pp. 6252-9. Gonnet, GH, Cohen, MA & Benner, SA 1994, 'Analysis of amino acid substitution during divergent evolution: the 400 by 400 dipeptide substitution matrix', Biochem Biophys Res Commun, vol. 199, no. 2, Mar 15, pp. 489-96. Gullo, C, Low, WK & Teoh, G 2008, 'Association of Epstein-Barr virus with nasopharyngeal carcinoma and current status of development of cancer-derived cell lines', Ann Acad Med Singapore, vol. 37, no. 9, Sep, pp. 769-77. Haar, J, Contrant, M, Bernhardt, K, Feederle, R, Diederichs, S, Pfeffer, S & Delecluse, HJ 2016, 'The expression of a viral microRNA is regulated by clustering to allow optimal B cell transformation', Nucleic Acids Res, vol. 44, no. 3, Feb 18, pp. 1326-41. Hadinoto, V, Shapiro, M, Sun, CC & Thorley-Lawson, DA 2009, 'The dynamics of EBV shedding implicate a central role for epithelial cells in amplifying viral output', PLoS Pathog, vol. 5, no. 7, Jul, p. e1000496. Hammerschmidt, W 2015, 'The Epigenetic Life Cycle of Epstein-Barr Virus', Curr Top Microbiol Immunol, vol. 390, no. Pt 1, pp. 103-17. Hammerschmidt, W, Sugden, B & Baichwal, VR 1989, 'The transforming domain alone of the latent membrane protein of Epstein-Barr virus is toxic to cells when expressed at high levels', Journal of Virology, vol. 63, no. 6, pp. 2469-2475. Hanahan, D 1983, 'Studies on transformation of Escherichia coli with plasmids', J Mol Biol, vol. 166, no. 4, Jun 05, pp. 557-80. Hanahan, D, Jessee, J & Bloom, FR 1991, 'Plasmid transformation of Escherichia coli and other bacteria', Methods Enzymol, vol. 204, pp. 63-113. Hanahan, D & Weinberg, RA 2000, 'The hallmarks of cancer', Cell, vol. 100, no. 1, Jan 07, pp. 57-70. Hanahan, D & Weinberg, RA 2011, 'Hallmarks of cancer: the next generation', Cell, vol. 144, no. 5, Mar 04, pp. 646-74. Hayes, DP, Brink, AA, Vervoort, MB, Middeldorp, JM, Meijer, CJ & van den Brule, AJ 1999, 'Expression of Epstein-Barr virus (EBV) transcripts encoding homologues to

130

important human proteins in diverse EBV associated diseases', Mol Pathol, vol. 52, no. 2, Apr, pp. 97-103. Hayward, SD, Liu, J & Fujimuro, M 2006, 'Notch and Wnt signaling: mimicry and manipulation by gamma herpesviruses', Sci STKE, vol. 2006, no. 335, May 16, p. re4. He, JF, Jia, WH, Fan, Q, Zhou, XX, Qin, HD, Shugart, YY & Zeng, YX 2007, 'Genetic polymorphisms of TLR3 are associated with Nasopharyngeal carcinoma risk in Cantonese population', BMC Cancer, vol. 7, Oct 17, p. 194. He, Y, Zhou, G, Zhai, Y, Dong, X, Lv, L, He, F & Yao, K 2005, 'Association of PLUNC gene polymorphisms with susceptibility to nasopharyngeal carcinoma in a Chinese population', J Med Genet, vol. 42, no. 2, Feb, pp. 172-6. Henderson, S, Huen, D, Rowe, M, Dawson, C, Johnson, G & Rickinson, A 1993, 'Epstein-Barr virus-coded BHRF1 protein, a viral homologue of Bcl-2, protects human B cells from programmed cell death', Proc Natl Acad Sci U S A, vol. 90, no. 18, Sep 15, pp. 8479-83. Henle, W, Henle, G, Ho, HC, Burtin, P, Cachin, Y, Clifford, P, de Schryver, A, de-The, G, Diehl, V & Klein, G 1970, 'Antibodies to Epstein-Barr virus in nasopharyngeal carcinoma, other head and neck neoplasms, and control groups', J Natl Cancer Inst, vol. 44, no. 1, Jan, pp. 225-31. Hildesheim, A, Chen, CJ, Caporaso, NE, Cheng, YJ, Hoover, RN, Hsu, MM, Levine, PH, Chen, IH, Chen, JY, Yang, CS & et al. 1995, 'Cytochrome P4502E1 genetic polymorphisms and risk of nasopharyngeal carcinoma: results from a case-control study conducted in Taiwan', Cancer Epidemiol Biomarkers Prev, vol. 4, no. 6, Sep, pp. 607-10. Hildesheim, A, Dosemeci, M, Chan, CC, Chen, CJ, Cheng, YJ, Hsu, MM, Chen, IH, Mittl, BF, Sun, B, Levine, PH, Chen, JY, Brinton, LA & Yang, CS 2001, 'Occupational exposure to wood, formaldehyde, and solvents and risk of nasopharyngeal carcinoma', Cancer Epidemiol Biomarkers Prev, vol. 10, no. 11, Nov, pp. 1145-53. Hirunsatit, R, Kongruttanachok, N, Shotelersuk, K, Supiyaphun, P, Voravud, N, Sakuntabhai, A & Mutirangura, A 2003, 'Polymeric immunoglobulin receptor polymorphisms and risk of nasopharyngeal cancer', BMC Genet, vol. 4, Jan 21, p. 3. Hjalgrim, H, Friborg, J & Melbye, M 2007, 'The epidemiology of EBV and its association with malignant disease', in A Arvin, G Campadelli-Fiume, E Mocarski, PS Moore, B Roizman, R Whitley and K Yamanishi (eds), Human Herpesviruses: Biology, Therapy, and Immunoprophylaxis, Cambridge University Press, Cambridge. Hochberg, D, Middeldorp, JM, Catalina, M, Sullivan, JL, Luzuriaga, K & Thorley-Lawson, DA 2004, 'Demonstration of the Burkitt's lymphoma Epstein-Barr virus phenotype in dividing latently infected memory cells in vivo', Proc Natl Acad Sci U S A, vol. 101, no. 1, Jan 6, pp. 239-44.

131

Hoebe, EK, Le Large, TY, Greijer, AE & Middeldorp, JM 2013, 'BamHI-A rightward frame 1, an Epstein-Barr virus-encoded oncogene and immune modulator', Rev Med Virol, vol. 23, no. 6, Nov, pp. 367-83. Holowaty, MN, Sheng, Y, Nguyen, T, Arrowsmith, C & Frappier, L 2003, 'Protein interaction domains of the ubiquitin-specific protease, USP7/HAUSP', J Biol Chem, vol. 278, no. 48, Nov 28, pp. 47753-61. Hong, GK, Kumar, P, Wang, L, Damania, B, Gulley, ML, Delecluse, HJ, Polverini, PJ & Kenney, SC 2005, 'Epstein-Barr virus lytic infection is required for efficient production of the angiogenesis factor vascular endothelial growth factor in lymphoblastoid cell lines', J Virol, vol. 79, no. 22, Nov, pp. 13984-92. Horikawa, T, Yoshizaki, T, Kondo, S, Furukawa, M, Kaizaki, Y & Pagano, JS 2011, 'Epstein-Barr Virus latent membrane protein 1 induces Snail and epithelial-mesenchymal transition in metastatic nasopharyngeal carcinoma', Br J Cancer, vol. 104, no. 7, Mar 29, pp. 1160-7. Houali, K, Wang, X, Shimizu, Y, Djennaoui, D, Nicholls, J, Fiorini, S, Bouguermouh, A & Ooka, T 2007, 'A new diagnostic marker for secreted Epstein-Barr virus encoded LMP1 and BARF1 oncoproteins in the serum and saliva of patients with nasopharyngeal carcinoma', Clin Cancer Res, vol. 13, no. 17, Sep 01, pp. 4993-5000. Hsu, CL, Kuo, YC, Huang, Y, Huang, YC, Lui, KW, Chang, KP, Lin, TL, Fan, HC, Lin, AC, Hsieh, CH, Lee, LY, Wang, HM, Li, HP & Chang, YS 2015, 'Application of a patient-derived xenograft model in cytolytic viral activation therapy for nasopharyngeal carcinoma', Oncotarget, vol. 6, no. 31, Oct 13, pp. 31323-34. Hsu, CY, Yi, YH, Chang, KP, Chang, YS, Chen, SJ & Chen, HC 2014, 'The Epstein-Barr virus-encoded microRNA MiR-BART9 promotes tumor metastasis by targeting E-cadherin in nasopharyngeal carcinoma', PLoS Pathog, vol. 10, no. 2, Feb, p. e1003974. Hu, LF, Qiu, QH, Fu, SM, Sun, D, Magnusson, K, He, B, Lindblom, A & Ernberg, I 2008, 'A genome-wide scan suggests a susceptibility locus on 5p 13 for nasopharyngeal carcinoma', Eur J Hum Genet, vol. 16, no. 3, Mar, pp. 343-9. Huang, CJ, Leung, SW, Lian, SL, Wang, CJ, Fang, FM & Ho, YH 1996, 'Patterns of distant metastases in nasopharyngeal carcinoma', Kaohsiung J Med Sci, vol. 12, no. 4, Apr, pp. 229-34. Huang, H, Pan, X & Zhou, J 1999, 'BHRF1 antisense oligonucleotide inhibits anti-apoptosis of nasopharyngeal carcinoma cells', Int J Mol Med, vol. 4, no. 6, Dec, pp. 649-53. Huang, H, Zhou, JH, Zhou, SM, Hu, JH, Pan, XH, Kong, XT, Yu, L, Sun, XY & Wu, W 1997, 'Epstein-Barr virus BHRF1 prohibits the cells of nasopharyngeal carcinoma from apoptosis', J Laryngol Otol, vol. 111, no. 12, Dec, pp. 1147-50. Huang, SY, Wu, CC, Cheng, YJ, Chou, SP, Jiang, YJ, Chu, KC, Tsai, CH, Lin, SF & Chen, JY 2017, 'Epstein-Barr virus BRLF1 induces genomic instability and progressive

132

malignancy in nasopharyngeal carcinoma cells', Oncotarget, vol. 8, no. 45, Oct 3, pp. 78948-78964. Huang, YT, Liu, MY, Tsai, CH & Yeh, TH 2010, 'Upregulation of interleukin-1 by Epstein-Barr virus latent membrane protein 1 and its possible role in nasopharyngeal carcinoma cell growth', Head Neck, vol. 32, no. 7, Jul, pp. 869-76. Hui, EP, Taylor, GS, Jia, H, Ma, BB, Chan, SL, Ho, R, Wong, WL, Wilson, S, Johnson, BF, Edwards, C, Stocken, DD, Rickinson, AB, Steven, NM & Chan, AT 2013, 'Phase I trial of recombinant modified vaccinia ankara encoding Epstein-Barr viral tumor antigens in nasopharyngeal carcinoma patients', Cancer Res, vol. 73, no. 6, Mar 15, pp. 1676-88. Hui, KF & Chiang, AK 2010, 'Suberoylanilide hydroxamic acid induces viral lytic cycle in Epstein-Barr virus-positive epithelial malignancies and mediates enhanced cell death', Int J Cancer, vol. 126, no. 10, May 15, pp. 2479-89. Hutt-Fletcher, LM 2007, 'Epstein-Barr virus entry', J Virol, vol. 81, no. 15, Aug, pp. 7825-32. Imai, S, Nishikawa, J & Takada, K 1998, 'Cell-to-cell contact as an efficient mode of Epstein-Barr virus infection of diverse human epithelial cells', J Virol, vol. 72, no. 5, May, pp. 4371-8. Iwakiri, D 2014, 'Epstein-Barr Virus-Encoded RNAs: Key Molecules in Viral Pathogenesis', Cancers (Basel), vol. 6, no. 3, Aug 6, pp. 1615-30. Iwakiri, D, Eizuru, Y, Tokunaga, M & Takada, K 2003, 'Autocrine growth of Epstein-Barr virus-positive gastric carcinoma cells mediated by an Epstein-Barr virus-encoded small RNA', Cancer Res, vol. 63, no. 21, Nov 1, pp. 7062-7. Iwakiri, D, Sheen, TS, Chen, JY, Huang, DP & Takada, K 2005, 'Epstein-Barr virus-encoded small RNA induces insulin-like growth factor 1 and supports growth of nasopharyngeal carcinoma-derived cell lines', Oncogene, vol. 24, no. 10, Mar 3, pp. 1767-73. Jia, WH, Feng, BJ, Xu, ZL, Zhang, XS, Huang, P, Huang, LX, Yu, XJ, Feng, QS, Yao, MH, Shugart, YY & Zeng, YX 2004, 'Familial risk and clustering of nasopharyngeal carcinoma in Guangdong, China', Cancer, vol. 101, no. 2, Jul 15, pp. 363-9. Jia, WH, Luo, XY, Feng, BJ, Ruan, HL, Bei, JX, Liu, WS, Qin, HD, Feng, QS, Chen, LZ, Yao, SY & Zeng, YX 2010, 'Traditional Cantonese diet and nasopharyngeal carcinoma risk: a large-scale case-control study in Guangdong, China', BMC Cancer, vol. 10, Aug 20, p. 446. Jiang, R, Cabras, G, Sheng, W, Zeng, Y & Ooka, T 2009, 'Synergism of BARF1 with Ras induces malignant transformation in primary primate epithelial cells and human nasopharyngeal epithelial cells', Neoplasia, vol. 11, no. 9, Sep, pp. 964-73.

133

Jin, H, Xie, X, Wang, H, Hu, J, Liu, F, Liu, Z, Zhou, J, Zhang, Y, Xi, X, Hu, B, Liao, Y & Tang, J 2014, 'ERCC1 Cys8092Ala and XRCC1 Arg399Gln polymorphisms predict progression-free survival after curative radiotherapy for nasopharyngeal carcinoma', PLoS One, vol. 9, no. 7, p. e101256. Jung, YJ, Choi, H, Kim, H & Lee, SK 2014, 'MicroRNA miR-BART20-5p stabilizes Epstein-Barr virus latency by directly targeting BZLF1 and BRLF1', J Virol, vol. 88, no. 16, Aug, pp. 9027-37. Kaiser, C, Laux, G, Eick, D, Jochner, N, Bornkamm, GW & Kempkes, B 1999, 'The proto-oncogene c-myc is a direct target gene of Epstein-Barr virus nuclear antigen 2', J Virol, vol. 73, no. 5, May, pp. 4481-4. Kang, MS & Kieff, E 2015, 'Epstein-Barr virus latent genes', Exp Mol Med, vol. 47, Jan 23, p. e131. Kaul, R, Murakami, M, Choudhuri, T & Robertson, ES 2007, 'Epstein-Barr virus latent nuclear antigens can induce metastasis in a nude mouse model', J Virol, vol. 81, no. 19, Oct, pp. 10352-61. Kawanishi, M 1997, 'Epstein-Barr virus BHRF1 protein protects intestine 407 epithelial cells from apoptosis induced by tumor necrosis factor alpha and anti-Fas antibody', J Virol, vol. 71, no. 4, Apr, pp. 3319-22. Kaye, KM, Izumi, KM & Kieff, E 1993, 'Epstein-Barr virus latent membrane protein 1 is essential for B-lymphocyte growth transformation', Proc Natl Acad Sci U S A, vol. 90, no. 19, Oct 1, pp. 9150-4. Kelly, GL, Stylianou, J, Rasaiyaah, J, Wei, W, Thomas, W, Croom-Carter, D, Kohler, C, Spang, R, Woodman, C, Kellam, P, Rickinson, AB & Bell, AI 2013, 'Different patterns of Epstein-Barr virus latency in endemic Burkitt lymphoma (BL) lead to distinct variants within the BL-associated gene expression signature', J Virol, vol. 87, no. 5, Mar, pp. 2882-94. Kempkes, B & Ling, PD 2015, 'EBNA2 and Its Coactivator EBNA-LP', Curr Top Microbiol Immunol, vol. 391, pp. 35-59. Kenney, SC 2007, 'Reactivation and lytic replication of EBV', in A Arvin, G Campadelli-Fiume, E Mocarski, PS Moore, B Roizman, R Whitley and K Yamanishi (eds), Human Herpesviruses: Biology, Therapy, and Immunoprophylaxis, Cambridge University Press, Cambridge. Kenney, SC & Mertz, JE 2014, 'Regulation of the latent-lytic switch in Epstein-Barr virus', Semin Cancer Biol, vol. 26, Jun, pp. 60-8. Khan, S, Ullah, MW, Siddique, R, Nabi, G, Manan, S, Yousaf, M & Hou, H 2016, 'Role of Recombinant DNA Technology to Improve Life', Int J Genomics, vol. 2016, p. 14. Khanim, F, Dawson, C, Meseda, CA, Dawson, J, Mackett, M & Young, LS 1997, 'BHRF1, a viral homologue of the Bcl-2 oncogene, is conserved at both the sequence

134

and functional level in different Epstein-Barr virus isolates', J Gen Virol, vol. 78 ( Pt 11), Nov, pp. 2987-99. Kieser, A & Sterz, KR 2015, 'The Latent Membrane Protein 1 (LMP1)', Curr Top Microbiol Immunol, vol. 391, pp. 119-49. Kim, DH, Chang, MS, Yoon, CJ, Middeldorp, JM, Martinez, OM, Byeon, SJ, Rha, SY, Kim, SH, Kim, YS & Woo, JH 2016, 'Epstein-Barr virus BARF1-induced NFkappaB/miR-146a/SMAD4 alterations in stomach cancer cells', Oncotarget, vol. 7, no. 50, Dec 13, pp. 82213-82227. Kim, H, Choi, H & Lee, SK 2015, 'Epstein-Barr virus miR-BART20-5p regulates cell proliferation and apoptosis by targeting BAD', Cancer Lett, vol. 356, no. 2 Pt B, Jan 28, pp. 733-42. Kondo, S, Seo, SY, Yoshizaki, T, Wakisaka, N, Furukawa, M, Joab, I, Jang, KL & Pagano, JS 2006, 'EBV latent membrane protein 1 up-regulates hypoxia-inducible factor 1alpha through Siah1-mediated down-regulation of prolyl hydroxylases 1 and 3 in nasopharyngeal epithelial cells', Cancer Res, vol. 66, no. 20, Oct 15, pp. 9870-7. Kong, QL, Hu, LJ, Cao, JY, Huang, YJ, Xu, LH, Liang, Y, Xiong, D, Guan, S, Guo, BH, Mai, HQ, Chen, QY, Zhang, X, Li, MZ, Shao, JY, Qian, CN, Xia, YF, Song, LB, Zeng, YX & Zeng, MS 2010, 'Epstein-Barr virus-encoded LMP2A induces an epithelial-mesenchymal transition and increases the number of side population stem-like cancer cells in nasopharyngeal carcinoma', PLoS Pathog, vol. 6, no. 6, Jun 3, p. e1000940. Kongruttanachok, N, Sukdikul, S, Setavarin, S, Kerekhjanarong, V, Supiyaphun, P, Voravud, N, Poovorawan, Y & Mutirangura, A 2001, 'Cytochrome P450 2E1 polymorphism and nasopharyngeal carcinoma development in Thailand: a correlative study', BMC Cancer, vol. 1, p. 4. Kvansakul, M, Wei, AH, Fletcher, JI, Willis, SN, Chen, L, Roberts, AW, Huang, DC & Colman, PM 2010, 'Structural basis for apoptosis inhibition by Epstein-Barr virus BHRF1', PLoS Pathog, vol. 6, no. 12, Dec 23, p. e1001236. Kwong, DL, Sham, JS, Au, GK, Chua, DT, Kwong, PW, Cheng, AC, Wu, PM, Law, MW, Kwok, CC, Yau, CC, Wan, KY, Chan, RT & Choy, DD 2004, 'Concurrent and adjuvant chemotherapy for nasopharyngeal carcinoma: a factorial study', J Clin Oncol, vol. 22, no. 13, Jul 1, pp. 2643-53. Laichalk, LL & Thorley-Lawson, DA 2005, 'Terminal differentiation into plasma cells initiates the replicative cycle of Epstein-Barr virus in vivo', J Virol, vol. 79, no. 2, Jan, pp. 1296-307. Lee, AW, Foo, W, Law, SC, Poon, YF, Sze, WM, O, SK, Tung, SY & Lau, WH 1997, 'Nasopharyngeal carcinoma: presenting symptoms and duration before diagnosis', Hong Kong Med J, vol. 3, no. 4, Dec, pp. 355-361.

135

Lee, AW, Lau, WH, Tung, SY, Chua, DT, Chappell, R, Xu, L, Siu, L, Sze, WM, Leung, TW, Sham, JS, Ngan, RK, Law, SC, Yau, TK, Au, JS, O'Sullivan, B, Pang, ES, O, SK, Au, GK & Lau, JT 2005, 'Preliminary results of a randomized study on therapeutic gain by concurrent chemotherapy for regionally-advanced nasopharyngeal carcinoma: NPC-9901 Trial by the Hong Kong Nasopharyngeal Cancer Study Group', J Clin Oncol, vol. 23, no. 28, Oct 1, pp. 6966-75. Lee, AW, Poon, YF, Foo, W, Law, SC, Cheung, FK, Chan, DK, Tung, SY, Thaw, M & Ho, JH 1992, 'Retrospective analysis of 5037 patients with nasopharyngeal carcinoma treated during 1976-1985: overall survival and patterns of failure', Int J Radiat Oncol Biol Phys, vol. 23, no. 2, pp. 261-70. Lee, DC, Chua, DT, Wei, WI, Sham, JS & Lau, AS 2007, 'Induction of matrix metalloproteinases by Epstein-Barr virus latent membrane protein 1 isolated from nasopharyngeal carcinoma', Biomed Pharmacother, vol. 61, no. 9, Oct, pp. 520-6. Lee, HP, Gourley, L, Duffy, SW, Esteve, J, Lee, J & Day, NE 1994, 'Preserved foods and nasopharyngeal carcinoma: a case-control study among Singapore Chinese', Int J Cancer, vol. 59, no. 5, Dec 1, pp. 585-90. Lee, NY, Zhang, Q, Pfister, DG, Kim, J, Garden, AS, Mechalakos, J, Hu, K, Le, QT, Colevas, AD, Glisson, BS, Chan, AT & Ang, KK 2012, 'Addition of bevacizumab to standard chemoradiation for locoregionally advanced nasopharyngeal carcinoma (RTOG 0615): a phase 2 multi-institutional trial', Lancet Oncol, vol. 13, no. 2, Feb, pp. 172-80. Lei, T, Yuen, KS, Xu, R, Tsao, SW, Chen, H, Li, M, Kok, KH & Jin, DY 2013, 'Targeting of DICE1 tumor suppressor by Epstein-Barr virus-encoded miR-BART3* microRNA in nasopharyngeal carcinoma', Int J Cancer, vol. 133, no. 1, Jul, pp. 79-87. Levine, PH, Pocinki, AG, Madigan, P & Bale, S 1992, 'Familial nasopharyngeal carcinoma in patients who are not Chinese', Cancer, vol. 70, no. 5, Sep 1, pp. 1024-9. Li, H, Liu, S, Hu, J, Luo, X, Li, N, A, MB & Cao, Y 2016a, 'Epstein-Barr virus lytic reactivation regulation and its pathogenic role in carcinogenesis', Int J Biol Sci, vol. 12, no. 11, pp. 1309-1318. Li, HM, Man, C, Jin, Y, Deng, W, Yip, YL, Feng, HC, Cheung, YC, Lo, KW, Meltzer, PS, Wu, ZG, Kwong, YL, Yuen, AP & Tsao, SW 2006a, 'Molecular and cytogenetic changes involved in the immortalization of nasopharyngeal epithelial cells by telomerase', Int J Cancer, vol. 119, no. 7, Oct 01, pp. 1567-76. Li, HM, Man, C, Jin, Y, Deng, W, Yip, YL, Feng, HC, Cheung, YC, Lo, KW, Meltzer, PS, Wu, ZG, Kwong, YL, Yuen, APW & Tsao, SW 2006b, 'Molecular and cytogenetic changes involved in the immortalization of nasopharyngeal epithelial cells by telomerase', International Journal of Cancer, vol. 119, no. 7, pp. 1567-1576. Li, L, Guo, L, Tao, Y, Zhou, S, Wang, Z, Luo, W, Hu, D, Li, Z, Xiao, L, Tang, M, Yi, W, Tsao, SW & Cao, Y 2007, 'Latent membrane protein 1 of Epstein-Barr virus

136

regulates p53 phosphorylation through MAP kinases', Cancer Lett, vol. 255, no. 2, Oct 8, pp. 219-31. Li, WF, Sun, Y, Chen, M, Tang, LL, Liu, LZ, Mao, YP, Chen, L, Zhou, GQ, Li, L & Ma, J 2012a, 'Locoregional extension patterns of nasopharyngeal carcinoma and suggestions for clinical target volume delineation', Chin J Cancer, vol. 31, no. 12, Dec, pp. 579-87. Li, Y, Long, X, Huang, L, Yang, M, Yuan, Y, Wang, Y, Delecluse, HJ & Kuang, E 2016b, 'Epstein-Barr Virus BZLF1-Mediated Downregulation of Proinflammatory Factors Is Essential for Optimal Lytic Viral Replication', J Virol, vol. 90, no. 2, Jan 15, pp. 887-903. Li, Z, Chen, X, Li, L, Liu, S, Yang, L, Ma, X, Tang, M, Bode, AM, Dong, Z, Sun, L & Cao, Y 2012b, 'EBV encoded miR-BHRF1-1 potentiates viral lytic replication by downregulating host p53 in nasopharyngeal carcinoma', Int J Biochem Cell Biol, vol. 44, no. 2, Feb, pp. 275-9. Li, Z & Zong, YS 2014, 'Review of the histological classification of nasopharyngeal carcinoma', Journal of NasoPharyngeal Carcinoma, vol. 15 Sept Liao, D, Wu, Y, Pu, X, Chen, H, Luo, S, Li, B, Ding, C, Huang, GL & He, Z 2014, 'Cyclin D1 G870A polymorphism and risk of nasopharyngeal carcinoma: a case-control study and meta-analysis', PLoS One, vol. 9, no. 11, p. e113299. Lin, JC, Jan, JS, Hsu, CY, Liang, WM, Jiang, RS & Wang, WY 2003, 'Phase III study of concurrent chemoradiotherapy versus radiotherapy alone for advanced nasopharyngeal carcinoma: positive effect on overall and progression-free survival', J Clin Oncol, vol. 21, no. 4, Feb 15, pp. 631-7. Ling, PD, Peng, RS, Nakajima, A, Yu, JH, Tan, J, Moses, SM, Yang, WH, Zhao, B, Kieff, E, Bloch, KD & Bloch, DB 2005, 'Mediation of Epstein-Barr virus EBNA-LP transcriptional coactivation by Sp100', Embo j, vol. 24, no. 20, Oct 19, pp. 3565-75. Lippincott-Schwartz, J, Yuan, L, Tipper, C, Amherdt, M, Orci, L & Klausner, RD 1991, 'Brefeldin A's effects on endosomes, lysosomes, and the TGN suggest a general mechanism for regulating organelle structure and membrane traffic', Cell, vol. 67, no. 3, Nov 01, pp. 601-16. Liu, MY, Shih, YY, Li, LY, Chou, SP, Sheen, TS, Chen, CL, Yang, CS & Chen, JY 2000, 'Expression of the Epstein-Barr virus BHRF1 gene, a homologue of Bcl-2, in nasopharyngeal carcinoma tissue', J Med Virol, vol. 61, no. 2, Jun, pp. 241-50. Liu, RR, Chen, JC, Li, MD, Li, T, Tan, Y & Zhang, M 2015, 'A meta-analysis of glutathione S-transferase M1 and T1 genetic polymorphism in relation to susceptibility to nasopharyngeal carcinoma', Int J Clin Exp Med, vol. 8, no. 7, pp. 10626-32. Liu, T 1999, 'Issues in the management of nasopharyngeal carcinoma', Crit Rev Oncol Hematol, vol. 31, no. 1, Jun, pp. 55-69.

137

Liu, Y, Wang, X, Lo, AK, Wong, YC, Cheung, AL & Tsao, SW 2002, 'Latent membrane protein-1 of Epstein-Barr virus inhibits cell growth and induces sensitivity to cisplatin in nasopharyngeal carcinoma cells', J Med Virol, vol. 66, no. 1, Jan, pp. 63-9. Lo, AK, Dawson, CW, Jin, DY & Lo, KW 2012, 'The pathological roles of BART miRNAs in nasopharyngeal carcinoma', J Pathol, vol. 227, no. 4, Aug, pp. 392-403. Lo, AK, Dawson, CW, Lo, KW, Yu, Y & Young, LS 2010, 'Upregulation of Id1 by Epstein-Barr virus-encoded LMP1 confers resistance to TGFbeta-mediated growth inhibition', Mol Cancer, vol. 9, Jun 18, p. 155. Lo, AK, Huang, DP, Lo, KW, Chui, YL, Li, HM, Pang, JC & Tsao, SW 2004, 'Phenotypic alterations induced by the Hong Kong-prevalent Epstein-Barr virus-encoded LMP1 variant (2117-LMP1) in nasopharyngeal epithelial cells', Int J Cancer, vol. 109, no. 6, May 10, pp. 919-25. Lo, AK, Lo, KW, Tsao, SW, Wong, HL, Hui, JW, To, KF, Hayward, DS, Chui, YL, Lau, YL, Takada, K & Huang, DP 2006, 'Epstein-Barr virus infection alters cellular signal cascades in human nasopharyngeal epithelial cells', Neoplasia, vol. 8, no. 3, Mar, pp. 173-80. Lo, AK, To, KF, Lo, KW, Lung, RW, Hui, JW, Liao, G & Hayward, SD 2007, 'Modulation of LMP1 protein expression by EBV-encoded microRNAs', Proc Natl Acad Sci U S A, vol. 104, no. 41, Oct 9, pp. 16164-9. Lo, KW, To, KF & Huang, DP 2004, 'Focus on nasopharyngeal carcinoma', Cancer Cell, vol. 5, no. 5, May, pp. 423-8. Lu, JJ-Y, Chen, J-Y, Hsu, T-Y, Yu, WCY, Su, I-J & Yang, C-S 1996, 'Induction of apoptosis in epithelial cells by Epstein—Barr virus latent membrane protein 1', Journal of General Virology, vol. 77, no. 8, pp. 1883-1892. Lu, JJ, Cooper, JS & Lee, AW 2010, Nasopharyngeal cancer: multidisciplinary management, Springer Science & Business Media. Lui, VWY, Wong, EYL, Ho, Y, Hong, B, Wong, SCC, Tao, Q, Choi, GCG, Au, TCC, Ho, K, Yau, DMS, Ma, BBY, Hui, EP, Chan, AS-K, Tsang, C-M, Tsao, S-W, Grandis, JR & Chan, AT-C 2009, 'STAT3 activation contributes directly to Epstein-Barr virus–mediated invasiveness of nasopharyngeal cancer cells in vitro', International Journal of Cancer, vol. 125, no. 8, pp. 1884-1893. Lung, RW, Tong, JH, Sung, YM, Leung, PS, Ng, DC, Chau, SL, Chan, AW, Ng, EK, Lo, KW & To, KF 2009, 'Modulation of LMP2A expression by a newly identified Epstein-Barr virus-encoded microRNA miR-BART22', Neoplasia, vol. 11, no. 11, Nov, pp. 1174-84. Ma, BB & Chan, AT 2006, 'Systemic treatment strategies and therapeutic monitoring for advanced nasopharyngeal carcinoma', Expert Rev Anticancer Ther, vol. 6, no. 3, Mar, pp. 383-94.

138

Ma, BB, Kam, MK, Leung, SF, Hui, EP, King, AD, Chan, SL, Mo, F, Loong, H, Yu, BK, Ahuja, A & Chan, AT 2012, 'A phase II study of concurrent cetuximab-cisplatin and intensity-modulated radiotherapy in locoregionally advanced nasopharyngeal carcinoma', Ann Oncol, vol. 23, no. 5, May, pp. 1287-92. Mandel, M & Higa, A 1970, 'Calcium-dependent bacteriophage DNA infection', J Mol Biol, vol. 53, no. 1, Oct 14, pp. 159-62. Marks, JE, Phillips, JL & Menck, HR 1998, 'The National Cancer Data Base report on the relationship of race and national origin to the histology of nasopharyngeal carcinoma', Cancer, vol. 83, no. 3, Aug 1, pp. 582-8. Marquitz, AR, Mathur, A, Nam, CS & Raab-Traub, N 2011, 'The Epstein-Barr Virus BART microRNAs target the pro-apoptotic protein Bim', Virology, vol. 412, no. 2, Apr 10, pp. 392-400. Marron, M, Boffetta, P, Zhang, ZF, Zaridze, D, Wunsch-Filho, V, Winn, DM, Wei, Q, Talamini, R, Szeszenia-Dabrowska, N, Sturgis, EM, Smith, E, Schwartz, SM, Rudnai, P, Purdue, MP, Olshan, AF, Eluf-Neto, J, Muscat, J, Morgenstern, H, Menezes, A, McClean, M, Matos, E, Mates, IN, Lissowska, J, Levi, F, Lazarus, P, La Vecchia, C, Koifman, S, Kelsey, K, Herrero, R, Hayes, RB, Franceschi, S, Fernandez, L, Fabianova, E, Daudt, AW, Dal Maso, L, Curado, MP, Cadoni, G, Chen, C, Castellsague, X, Boccia, S, Benhamou, S, Ferro, G, Berthiller, J, Brennan, P, Moller, H & Hashibe, M 2010, 'Cessation of alcohol drinking, tobacco smoking and the reversal of head and neck cancer risk', Int J Epidemiol, vol. 39, no. 1, Feb, pp. 182-96. Martel-Renoir, D, Grunewald, V, Touitou, R, Schwaab, G & Joab, I 1995, 'Qualitative analysis of the expression of Epstein-Barr virus lytic genes in nasopharyngeal carcinoma biopsies', J Gen Virol, vol. 76 ( Pt 6), Jun, pp. 1401-8. Maruo, S, Zhao, B, Johannsen, E, Kieff, E, Zou, J & Takada, K 2011, 'Epstein-Barr virus nuclear antigens 3C and 3A maintain lymphoblastoid cell growth by repressing p16INK4A and p14ARF expression', Proc Natl Acad Sci U S A, vol. 108, no. 5, Feb 1, pp. 1919-24. Masters, JR 2002, 'HeLa cells 50 years on: the good, the bad and the ugly', Nat Rev Cancer, vol. 2, no. 4, Apr, pp. 315-9. McClellan, MJ, Khasnis, S, Wood, CD, Palermo, RD, Schlick, SN, Kanhere, AS, Jenner, RG & West, MJ 2012, 'Downregulation of integrin receptor-signaling genes by Epstein-Barr virus EBNA 3C via promoter-proximal and -distal binding elements', J Virol, vol. 86, no. 9, May, pp. 5165-78. Merten, OW, Hebben, M & Bovolenta, C 2016, 'Production of lentiviral vectors', Mol Ther Methods Clin Dev, vol. 3, p. 16017. Middeldorp, JM, Brink, AA, van den Brule, AJ & Meijer, CJ 2003, 'Pathogenic roles for Epstein-Barr virus (EBV) gene products in EBV-associated proliferative disorders', Crit Rev Oncol Hematol, vol. 45, no. 1, Jan, pp. 1-36.

139

Mohidin, TB & Ng, CC 2015, 'BARF1 gene silencing triggers caspase-dependent mitochondrial apoptosis in Epstein-Barr virus-positive malignant cells', J Biosci, vol. 40, no. 1, Mar, pp. 41-51. Moody, CA, Scott, RS, Amirghahari, N, Nathan, CO, Young, LS, Dawson, CW & Sixbey, JW 2005, 'Modulation of the cell growth regulator mTOR by Epstein-Barr virus-encoded LMP2A', J Virol, vol. 79, no. 9, May, pp. 5499-506. Morgan, RA 2012, 'Human tumor xenografts: the good, the bad, and the ugly', Mol Ther, vol. 20, no. 5, May, pp. 882-4. Morris, MA, Dawson, CW & Young, LS 2009, 'Role of the Epstein-Barr virus-encoded latent membrane protein-1, LMP1, in the pathogenesis of nasopharyngeal carcinoma', Future Oncol, vol. 5, no. 6, Aug, pp. 811-25. Morrison, JA & Raab-Traub, N 2005, 'Roles of the ITAM and PY motifs of Epstein-Barr virus latent membrane protein 2A in the inhibition of epithelial cell differentiation and activation of {beta}-catenin signaling', J Virol, vol. 79, no. 4, Feb, pp. 2375-82. Murakami, M, Lan, K, Subramanian, C & Robertson, ES 2005, 'Epstein-Barr virus nuclear antigen 1 interacts with Nm23-H1 in lymphoblastoid cell lines and inhibits its ability to suppress cell migration', J Virol, vol. 79, no. 3, Feb, pp. 1559-68. Murata, T & Tsurumi, T 2014, 'Switching of EBV cycles between latent and lytic states', Rev Med Virol, vol. 24, no. 3, May, pp. 142-53. Murono, S, Inoue, H, Tanabe, T, Joab, I, Yoshizaki, T, Furukawa, M & Pagano, JS 2001, 'Induction of cyclooxygenase-2 by Epstein-Barr virus latent membrane protein 1 is involved in vascular endothelial growth factor production in nasopharyngeal carcinoma cells', Proc Natl Acad Sci U S A, vol. 98, no. 12, Jun 5, pp. 6905-10. Murray, P & Bell, A 2015, 'Contribution of the Epstein-Barr Virus to the Pathogenesis of Hodgkin Lymphoma', Curr Top Microbiol Immunol, vol. 390, no. Pt 1, pp. 287-313. Naldini, L, Blomer, U, Gage, FH, Trono, D & Verma, IM 1996a, 'Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector', Proc Natl Acad Sci U S A, vol. 93, no. 21, Oct 15, pp. 11382-8. Naldini, L, Blomer, U, Gallay, P, Ory, D, Mulligan, R, Gage, FH, Verma, IM & Trono, D 1996b, 'In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector', Science, vol. 272, no. 5259, Apr 12, pp. 263-7. Nanbo, A, Inoue, K, Adachi-Takasawa, K & Takada, K 2002, 'Epstein-Barr virus RNA confers resistance to interferon-alpha-induced apoptosis in Burkitt's lymphoma', Embo j, vol. 21, no. 5, Mar 1, pp. 954-65. Nanbo, A, Yoshiyama, H & Takada, K 2005, 'Epstein-Barr virus-encoded poly(A)- RNA confers resistance to apoptosis mediated through Fas by blocking the PKR

140

pathway in human epithelial intestine 407 cells', J Virol, vol. 79, no. 19, Oct, pp. 12280-5. Ng, CC, Yew, PY, Puah, SM, Krishnan, G, Yap, LF, Teo, SH, Lim, PV, Govindaraju, S, Ratnavelu, K, Sam, CK, Takahashi, A, Kubo, M, Kamatani, N, Nakamura, Y & Mushiroda, T 2009, 'A genome-wide association study identifies ITGA9 conferring risk of nasopharyngeal carcinoma', J Hum Genet, vol. 54, no. 7, Jul, pp. 392-7. Nicholls, J & Niedobitek, G 2013, 'Histopathological diagnosis of nasopharyngeal carcinoma: Looking beyond the blue book', in Nasopharyngeal carcinoma, Springer, pp. 10-22. Niedobitek, G, Hansmann, ML, Herbst, H, Young, LS, Dienemann, D, Hartmann, CA, Finn, T, Pitteroff, S, Welt, A, Anagnostopoulos, I & et al. 1991, 'Epstein-Barr virus and carcinomas: undifferentiated carcinomas but not squamous cell carcinomas of the nasopharynx are regularly associated with the virus', J Pathol, vol. 165, no. 1, Sep, pp. 17-24. Nishikawa, J, Yoshiyama, H, Iizasa, H, Kanehiro, Y, Nakamura, M, Nishimura, J, Saito, M, Okamoto, T, Sakai, K, Suehiro, Y, Yamasaki, T, Oga, A, Yanai, H & Sakaida, I 2014, 'Epstein-barr virus in gastric carcinoma', Cancers (Basel), vol. 6, no. 4, Nov 07, pp. 2259-74. O'Neil, JD, Owen, TJ, Wood, VH, Date, KL, Valentine, R, Chukwuma, MB, Arrand, JR, Dawson, CW & Young, LS 2008, 'Epstein-Barr virus-encoded EBNA1 modulates the AP-1 transcription factor pathway in nasopharyngeal carcinoma cells and enhances angiogenesis in vitro', J Gen Virol, vol. 89, no. Pt 11, Nov, pp. 2833-42. Ohashi, M, Holthaus, AM, Calderwood, MA, Lai, CY, Krastins, B, Sarracino, D & Johannsen, E 2015, 'The EBNA3 family of Epstein-Barr virus nuclear proteins associates with the USP46/USP12 deubiquitination complexes to regulate lymphoblastoid cell line growth', PLoS Pathog, vol. 11, no. 4, Apr, p. e1004822. Ove, R, Allison, RR & Lu, JJ 2010, 'Early Stage Nasopharyngeal Cancer: A Highly Curative Disease with Radiation Therapy', in JJ Lu, JS Cooper and AWM Lee (eds), Nasopharyngeal Cancer: Multidisciplinary Management, Springer Berlin Heidelberg, Berlin, Heidelberg, pp. 137-147. Pai, PC, Tseng, CK, Chuang, CC, Wei, KC, Hao, SP, Hsueh, C, Chang, KP & Tsang, NM 2007, 'Polymorphism of C-terminal activation region 2 of Epstein-Barr virus latent membrane protein 1 in predicting distant failure and post-metastatic survival in patients with nasopharyngeal carcinoma', Head Neck, vol. 29, no. 2, Feb, pp. 109-19. Palser, AL, Grayson, NE, White, RE, Corton, C, Correia, S, Ba Abdullah, MM, Watson, SJ, Cotten, M, Arrand, JR, Murray, PG, Allday, MJ, Rickinson, AB, Young, LS, Farrell, PJ & Kellam, P 2015, 'Genome diversity of Epstein-Barr virus from multiple tumor types and normal infection', J Virol, vol. 89, no. 10, May, pp. 5222-37. Paschos, K, Smith, P, Anderton, E, Middeldorp, JM, White, RE & Allday, MJ 2009, 'Epstein-barr virus latency in B cells leads to epigenetic repression and CpG

141

methylation of the tumour suppressor gene Bim', PLoS Pathog, vol. 5, no. 6, Jun, p. e1000492. Pasternak, JJ 2005, 'Recombinant DNA Technology', in An Introduction to Human Molecular Genetics, John Wiley & Sons, Inc., pp. 107-152. Pathmanathan, R, Prasad, U, Chandrika, G, Sadler, R, Flynn, K & Raab-Traub, N 1995a, 'Undifferentiated, nonkeratinizing, and squamous cell carcinoma of the nasopharynx. Variants of Epstein-Barr virus-infected neoplasia', Am J Pathol, vol. 146, no. 6, Jun, pp. 1355-67. Pathmanathan, R, Prasad, U, Sadler, R, Flynn, K & Raab-Traub, N 1995b, 'Clonal proliferations of cells infected with Epstein-Barr virus in preinvasive lesions related to nasopharyngeal carcinoma', N Engl J Med, vol. 333, no. 11, Sep 14, pp. 693-8. Pear, WS, Nolan, GP, Scott, ML & Baltimore, D 1993, 'Production of high-titer helper-free retroviruses by transient transfection', Proc Natl Acad Sci U S A, vol. 90, no. 18, Sep 15, pp. 8392-6. Pearson, GR, Luka, J, Petti, L, Sample, J, Birkenbach, M, Braun, D & Kieff, E 1987, 'Identification of an Epstein-Barr virus early gene encoding a second component of the restricted early antigen complex', Virology, vol. 160, no. 1, Sep, pp. 151-61. Pegtel, DM, Subramanian, A, Sheen, TS, Tsai, CH, Golub, TR & Thorley-Lawson, DA 2005, 'Epstein-Barr-virus-encoded LMP2A induces primary epithelial cell migration and invasion: possible role in nasopharyngeal carcinoma metastasis', J Virol, vol. 79, no. 24, Dec, pp. 15430-42. Peng, CW, Zhao, B & Kieff, E 2004, 'Four EBNA2 domains are important for EBNALP coactivation', J Virol, vol. 78 Peng, R, Gordadze, AV, Fuentes Panana, EM, Wang, F, Zong, J, Hayward, GS, Tan, J & Ling, PD 2000, 'Sequence and functional analysis of EBNA-LP and EBNA2 proteins from nonhuman primate lymphocryptoviruses', J Virol, vol. 74, no. 1, Jan, pp. 379-89. Peng, R, Moses, SC, Tan, J, Kremmer, E & Ling, PD 2005, 'The Epstein-Barr virus EBNA-LP protein preferentially coactivates EBNA2-mediated stimulation of latent membrane proteins expressed from the viral divergent promoter', J Virol, vol. 79, no. 7, Apr, pp. 4492-505. Poirier, S, Bouvier, G, Malaveille, C, Ohshima, H, Shao, YM, Hubert, A, Zeng, Y, de The, G & Bartsch, H 1989, 'Volatile nitrosamine levels and genotoxicity of food samples from high-risk areas for nasopharyngeal carcinoma before and after nitrosation', Int J Cancer, vol. 44, no. 6, Dec 15, pp. 1088-94. Poirier, S, Ohshima, H, de-The, G, Hubert, A, Bourgade, MC & Bartsch, H 1987, 'Volatile nitrosamine levels in common foods from Tunisia, south China and Greenland, high-risk areas for nasopharyngeal carcinoma (NPC)', Int J Cancer, vol. 39, no. 3, Mar 15, pp. 293-6.

142

Poling, BC, Price, AM, Luftig, MA & Cullen, BR 2017, 'The Epstein-Barr virus miR-BHRF1 microRNAs regulate viral gene expression in cis', Virology, vol. 512, Dec, pp. 113-123. ‘Population and Housing Census 2010’, Population Distribution and Basic Demographic Characteristics, Department of Statistics, Malaysia Portal, D, Rosendorff, A & Kieff, E 2006, 'Epstein-Barr nuclear antigen leader protein coactivates transcription through interaction with histone deacetylase 4', Proc Natl Acad Sci U S A, vol. 103, no. 51, Dec 19, pp. 19278-83. Portal, D, Zhao, B, Calderwood, MA, Sommermann, T, Johannsen, E & Kieff, E 2011, 'EBV nuclear antigen EBNALP dismisses transcription repressors NCoR and RBPJ from enhancers and EBNA2 increases NCoR-deficient RBPJ DNA binding', Proc Natl Acad Sci U S A, vol. 108, no. 19, May 10, pp. 7808-13. Portal, D, Zhou, H, Zhao, B, Kharchenko, PV, Lowry, E, Wong, L, Quackenbush, J, Holloway, D, Jiang, S, Lu, Y & Kieff, E 2013, 'Epstein-Barr virus nuclear antigen leader protein localizes to promoters and enhancers with cell transcription factors and EBNA2', Proc Natl Acad Sci U S A, vol. 110, no. 46, Nov 12, pp. 18537-42. Prasad, U & Pua, KC 2000, 'Nasopharyngeal carcinoma: a delay in diagnosis', Med J Malaysia, vol. 55, no. 2, Jun, pp. 230-5. Pullar, CE, Chen, J & Isseroff, RR 2003, 'PP2A activation by beta2-adrenergic receptor agonists: novel regulatory mechanism of keratinocyte migration', J Biol Chem, vol. 278, no. 25, Jun 20, pp. 22555-62. Qin, HD, Shugart, YY, Bei, JX, Pan, QH, Chen, L, Feng, QS, Chen, LZ, Huang, W, Liu, JJ, Jorgensen, TJ, Zeng, YX & Jia, WH 2011, 'Comprehensive pathway-based association study of DNA repair gene variants and the risk of nasopharyngeal carcinoma', Cancer Res, vol. 71, no. 8, Apr 15, pp. 3000-8. Qin, X, Peng, Q, Lao, X, Chen, Z, Lu, Y, Lao, X, Mo, C, Sui, J, Wu, J, Zhai, L, Yang, S, Li, S & Zhao, J 2014, 'The association of interleukin-16 gene polymorphisms with IL-16 serum levels and risk of nasopharyngeal carcinoma in a Chinese population', Tumour Biol, vol. 35, no. 3, Mar, pp. 1917-24. Raab-Traub, N 2002, 'Epstein-Barr virus in the pathogenesis of NPC', Semin Cancer Biol, vol. 12, no. 6, Dec, pp. 431-41. Raab-Traub, N 2015, 'Nasopharyngeal Carcinoma: An Evolving Role for the Epstein-Barr Virus', Curr Top Microbiol Immunol, vol. 390, no. Pt 1, pp. 339-63. Raab-Traub, N & Flynn, K 1986, 'The structure of the termini of the Epstein-Barr virus as a marker of clonal cellular proliferation', Cell, vol. 47, no. 6, Dec 26, pp. 883-9. Ramayanti, O, Juwana, H, Verkuijlen, SA, Adham, M, Pegtel, MD, Greijer, AE & Middeldorp, JM 2017, 'Epstein-Barr virus mRNA profiles and viral DNA methylation

143

status in nasopharyngeal brushings from nasopharyngeal carcinoma patients reflect tumor origin', Int J Cancer, vol. 140, no. 1, Jan 1, pp. 149-162. Rath, A, Glibowicka, M, Nadeau, VG, Chen, G & Deber, CM 2009, 'Detergent binding explains anomalous SDS-PAGE migration of membrane proteins', Proc Natl Acad Sci U S A, vol. 106, no. 6, Feb 10, pp. 1760-5. Ren, J, Lee, H, Yoo, SM, Yu, MS, Park, H & Na, D 2017, 'Combined chemical and physical transformation method with RbCl and sepiolite for the transformation of various bacterial species', J Microbiol Methods, vol. 135, Apr, pp. 48-51. Rheinwald, JG & Beckett, MA 1981, 'Tumorigenic keratinocyte lines requiring anchorage and fibroblast support cultured from human squamous cell carcinomas', Cancer Res, vol. 41, no. 5, May, pp. 1657-63. Richmond, A & Su, Y 2008, 'Mouse xenograft models vs GEM models for human cancer therapeutics', Dis Model Mech, vol. 1, no. 2-3, Sep-Oct, pp. 78-82. Robertson, ES, Lin, J & Kieff, E 1996, 'The amino-terminal domains of Epstein-Barr virus nuclear proteins 3A, 3B, and 3C interact with RBPJ(kappa)', J Virol, vol. 70, no. 5, May, pp. 3068-74. Rochford, R & Moormann, AM 2015, 'Burkitt's Lymphoma', Curr Top Microbiol Immunol, vol. 390, no. Pt 1, pp. 267-85. Rogers, LD & Overall, CM 2013, 'Proteolytic post-translational modification of proteins: proteomic tools and methodology', Mol Cell Proteomics, vol. 12, no. 12, Dec, pp. 3532-42. Rovedo, M & Longnecker, R 2007, 'Epstein-barr virus latent membrane protein 2B (LMP2B) modulates LMP2A activity', J Virol, vol. 81, no. 1, Jan, pp. 84-94. Rowe, M, Kelly, GL, Bell, AI & Rickinson, AB 2009, 'Burkitt's lymphoma: the Rosetta Stone deciphering Epstein-Barr virus biology', Semin Cancer Biol, vol. 19, no. 6, Dec, pp. 377-88. Rowe, M, Raithatha, S & Shannon-Lowe, C 2014, 'Counteracting effects of cellular Notch and Epstein-Barr virus EBNA2: implications for stromal effects on virus-host interactions', J Virol, vol. 88, no. 20, Oct, pp. 12065-76. Saha, A & Robertson, ES 2013, 'Impact of EBV essential nuclear protein EBNA-3C on B-cell proliferation and apoptosis', Future Microbiol, vol. 8, no. 3, Mar, pp. 323-52. Sakka, E, Zur Hausen, A, Houali, K, Liu, H, Fiorini, S & Ooka, T 2013, 'Cellular localization of BARF1 oncoprotein and its cell stimulating activity in human epithelial cell', Virus Res, vol. 174, no. 1-2, Jun, pp. 8-17. Sall, A, Caserta, S, Jolicoeur, P, Franqueville, L, de Turenne-Tessier, M & Ooka, T 2004, 'Mitogenic activity of Epstein-Barr virus-encoded BARF1 protein', Oncogene, vol. 23, no. 28, Jun 17, pp. 4938-44.

144

Sam, CK, Brooks, LA, Niedobitek, G, Young, LS, Prasad, U & Rickinson, AB 1993, 'Analysis of Epstein-Barr virus infection in nasopharyngeal biopsies from a group at high risk of nasopharyngeal carcinoma', Int J Cancer, vol. 53, no. 6, Apr 1, pp. 957-62. Samanta, M, Iwakiri, D, Kanda, T, Imaizumi, T & Takada, K 2006, 'EB virus-encoded RNAs are recognized by RIG-I and activate signaling to induce type I IFN', Embo j, vol. 25, no. 18, Sep 20, pp. 4207-14. Samanta, M, Iwakiri, D & Takada, K 2008, 'Epstein-Barr virus-encoded small RNA induces IL-10 through RIG-I-mediated IRF-3 signaling', Oncogene, vol. 27, no. 30, Jul 10, pp. 4150-60. Sample, J, Young, L, Martin, B, Chatman, T, Kieff, E, Rickinson, A & Kieff, E 1990, 'Epstein-Barr virus types 1 and 2 differ in their EBNA-3A, EBNA-3B, and EBNA-3C genes', J Virol, vol. 64, no. 9, Sep, pp. 4084-92. Saridakis, V, Sheng, Y, Sarkari, F, Holowaty, MN, Shire, K, Nguyen, T, Zhang, RG, Liao, J, Lee, W, Edwards, AM, Arrowsmith, CH & Frappier, L 2005, 'Structure of the p53 binding domain of HAUSP/USP7 bound to Epstein-Barr nuclear antigen 1 implications for EBV-mediated immortalization', Mol Cell, vol. 18, no. 1, Apr 1, pp. 25-36. Sato, H, Takimoto, T, Tanaka, S, Tanaka, J & Raab-Traub, N 1990, 'Concatameric replication of Epstein-Barr virus: structure of the termini in virus-producer and newly transformed cell lines', J Virol, vol. 64, no. 11, Nov, pp. 5295-300. Sato, Y, Shirata, N, Kudoh, A, Iwahori, S, Nakayama, S, Murata, T, Isomura, H, Nishiyama, Y & Tsurumi, T 2009, 'Expression of Epstein-Barr virus BZLF1 immediate-early protein induces p53 degradation independent of MDM2, leading to repression of p53-mediated transcription', Virology, vol. 388, no. 1, May 25, pp. 204-11. Scholle, F, Bendt, KM & Raab-Traub, N 2000, 'Epstein-Barr virus LMP2A transforms epithelial cells, inhibits cell differentiation, and activates Akt', J Virol, vol. 74, no. 22, Nov, pp. 10681-9. Seto, E, Ooka, T, Middeldorp, J & Takada, K 2008, 'Reconstitution of nasopharyngeal carcinoma-type EBV infection induces tumorigenicity', Cancer Res, vol. 68, no. 4, Feb 15, pp. 1030-6. Seto, E, Yang, L, Middeldorp, J, Sheen, TS, Chen, JY, Fukayama, M, Eizuru, Y, Ooka, T & Takada, K 2005, 'Epstein-Barr virus (EBV)-encoded BARF1 gene is expressed in nasopharyngeal carcinoma and EBV-associated gastric carcinoma tissues in the absence of lytic gene expression', J Med Virol, vol. 76, no. 1, May, pp. 82-8. Shah, KM, Stewart, SE, Wei, W, Woodman, CBJ, O’Neil, JD, Dawson, CW & Young, LS 2009, 'The EBV-encoded Latent Membrane Proteins, LMP2A and LMP2B, Limit the Actions of Interferon by Targeting Interferon Receptors for Degradation', Oncogene, vol. 28, no. 44, 08/31, pp. 3903-3914.

145

Shanmugaratnam, K, Chan, SH, de-The, G, Goh, JE, Khor, TH, Simons, MJ & Tye, CY 1979, 'Histopathology of nasopharyngeal carcinoma: correlations with epidemiology, survival rates and other biological characteristics', Cancer, vol. 44, no. 3, Sep, pp. 1029-44. Shanmugaratnam, K & Sobin, LH 1991, Histological typing of tumours of the upper respiratory tract and ear, Springer-Verlag. Shanmugaratnam, K & Sobin, LH 1993, 'The World Health Organization histological classification of tumours of the upper respiratory tract and ear. A commentary on the second edition', Cancer, vol. 71, no. 8, Apr 15, pp. 2689-97. Shanmugaratnam, K & Sobin, LH 2012, Histological Typing of Tumours of the Upper Respiratory Tract and Ear, Springer Berlin Heidelberg. Shannon-Lowe, CD, Neuhierl, B, Baldwin, G, Rickinson, AB & Delecluse, HJ 2006, 'Resting B cells as a transfer vehicle for Epstein-Barr virus infection of epithelial cells', Proc Natl Acad Sci U S A, vol. 103, no. 18, May 2, pp. 7065-70. Shao, YM, Poirier, S, Ohshima, H, Malaveille, C, Zeng, Y, de The, G & Bartsch, H 1988, 'Epstein-Barr virus activation in Raji cells by extracts of preserved food from high risk areas for nasopharyngeal carcinoma', Carcinogenesis, vol. 9, no. 8, Aug, pp. 1455-7. Sheu, LF, Chen, A, Lee, HS, Hsu, HY & Yu, DS 2004, 'Cooperative interactions among p53, bcl-2 and Epstein-Barr virus latent membrane protein 1 in nasopharyngeal carcinoma cells', Pathol Int, vol. 54, no. 7, Jul, pp. 475-85. Sheu, LF, Chen, A, Meng, CL, Ho, KC, Lee, WH, Leu, FJ & Chao, CF 1996, 'Enhanced malignant progression of nasopharyngeal carcinoma cells mediated by the expression of Epstein-Barr nuclear antigen 1 in vivo', J Pathol, vol. 180, no. 3, Nov, pp. 243-8. Sivachandran, N, Cao, JY & Frappier, L 2010, 'Epstein-Barr virus nuclear antigen 1 Hijacks the host kinase CK2 to disrupt PML nuclear bodies', J Virol, vol. 84, no. 21, Nov, pp. 11113-23. Sivachandran, N, Dawson, CW, Young, LS, Liu, FF, Middeldorp, J & Frappier, L 2012, 'Contributions of the Epstein-Barr virus EBNA1 protein to gastric carcinoma', J Virol, vol. 86, no. 1, Jan, pp. 60-8. Sivachandran, N, Thawe, NN & Frappier, L 2011, 'Epstein-Barr virus nuclear antigen 1 replication and segregation functions in nasopharyngeal carcinoma cell lines', J Virol, vol. 85, no. 19, Oct, pp. 10425-30. Sivachandran, N, Wang, X & Frappier, L 2012, 'Functions of the Epstein-Barr virus EBNA1 protein in viral reactivation and lytic infection', J Virol, vol. 86, no. 11, Jun, pp. 6146-58. Sizhong, Z, Xiukung, G & Yi, Z 1983, 'Cytogenetic studies on an epithelial cell line derived from poorly differentiated nasopharyngeal carcinoma', Int J Cancer, vol. 31, no. 5, May 15, pp. 587-90.

146

Skalska, L, White, RE, Franz, M, Ruhmann, M & Allday, MJ 2010, 'Epigenetic repression of p16(INK4A) by latent Epstein-Barr virus requires the interaction of EBNA3A and EBNA3C with CtBP', PLoS Pathog, vol. 6, no. 6, Jun 10, p. e1000951. Skalsky, RL & Cullen, BR 2015, 'EBV Noncoding RNAs', Curr Top Microbiol Immunol, vol. 391, pp. 181-217. Slots, J, Saygun, I, Sabeti, M & Kubar, A 2006, 'Epstein-Barr virus in oral diseases', J Periodontal Res, vol. 41, no. 4, Aug, pp. 235-44. Strockbine, LD, Cohen, JI, Farrah, T, Lyman, SD, Wagener, F, DuBose, RF, Armitage, RJ & Spriggs, MK 1998, 'The Epstein-Barr virus BARF1 gene encodes a novel, soluble colony-stimulating factor-1 receptor', J Virol, vol. 72, no. 5, May, pp. 4015-21. Strong, MJ, Baddoo, M, Nanbo, A, Xu, M, Puetter, A & Lin, Z 2014, 'Comprehensive high-throughput RNA sequencing analysis reveals contamination of multiple nasopharyngeal carcinoma cell lines with HeLa cell genomes', J Virol, vol. 88, no. 18, Sep, pp. 10696-704. Styles, CT, Bazot, Q, Parker, GA, White, RE, Paschos, K & Allday, MJ 2017, 'EBV epigenetically suppresses the B cell-to-plasma cell differentiation pathway while establishing long-term latency', PLoS Biol, vol. 15, no. 8, Aug, p. e2001992. Sun, L, Che, K, Zhao, Z, Liu, S, Xing, X & Luo, B 2015, 'Sequence analysis of Epstein-Barr virus (EBV) early genes BARF1 and BHRF1 in NK/T cell lymphoma from Northern China', Virol J, vol. 12, Sep 04, p. 135. Suzina, SA & Hamzah, M 2003, 'Clinical presentation of patients with nasopharyngeal carcinoma', Med J Malaysia, vol. 58, no. 4, Oct, pp. 539-45. Takada, K 2012, 'Role of EBER and BARF1 in nasopharyngeal carcinoma (NPC) tumorigenesis', Semin Cancer Biol, vol. 22, no. 2, Apr, pp. 162-5. Takada, K & Nanbo, A 2001, 'The role of EBERs in oncogenesis', Semin Cancer Biol, vol. 11, no. 6, Dec, pp. 461-7. Tao, Q & Chan, AT 2007, 'Nasopharyngeal carcinoma: molecular pathogenesis and therapeutic developments', Expert Rev Mol Med, vol. 9, no. 12, May 4, pp. 1-24. Tao, Q, Srivastava, G, Chan, AC, Chung, LP, Loke, SL & Ho, FC 1995, 'Evidence for lytic infection by Epstein-Barr virus in mucosal lymphocytes instead of nasopharyngeal epithelial cells in normal individuals', J Med Virol, vol. 45, no. 1, Jan, pp. 71-7. Tarbouriech, N, Ruggiero, F, de Turenne-Tessier, M, Ooka, T & Burmeister, WP 2006, 'Structure of the Epstein-Barr virus oncogene BARF1', J Mol Biol, vol. 359, no. 3, Jun 9, pp. 667-78. Taylor, GS, Jia, H, Harrington, K, Lee, LW, Turner, J, Ladell, K, Price, DA, Tanday, M, Matthews, J, Roberts, C, Edwards, C, McGuigan, L, Hartley, A, Wilson, S, Hui, EP, Chan, AT, Rickinson, AB & Steven, NM 2014, 'A recombinant modified vaccinia

147

ankara vaccine encoding Epstein-Barr Virus (EBV) target antigens: a phase I trial in UK patients with EBV-positive cancer', Clin Cancer Res, vol. 20, no. 19, Oct 1, pp. 5009-22. Tentler, JJ, Tan, AC, Weekes, CD, Jimeno, A, Leong, S, Pitts, TM, Arcaroli, JJ, Messersmith, WA & Eckhardt, SG 2012, 'Patient-derived tumour xenografts as models for oncology drug development', Nat Rev Clin Oncol, vol. 9, no. 6, Apr 17, pp. 338-50. Thorley-Lawson, DA 2005, 'EBV the prototypical human tumor virus--just how bad is it?', J Allergy Clin Immunol, vol. 116, no. 2, Aug, pp. 251-61; quiz 262. Thorley-Lawson, DA 2015, 'EBV Persistence--Introducing the Virus', Curr Top Microbiol Immunol, vol. 390, no. Pt 1, pp. 151-209. Tiong, TS & Selva, KS 2005, 'Clinical presentation of nasopharyngeal carcinoma in Sarawak Malaysia', Med J Malaysia, vol. 60, no. 5, Dec, pp. 624-8. Tiwawech, D, Srivatanakul, P, Karalak, A & Ishida, T 2006, 'Cytochrome P450 2A6 polymorphism in nasopharyngeal carcinoma', Cancer Lett, vol. 241, no. 1, Sep 8, pp. 135-41. Tsai, MH, Raykova, A, Klinke, O, Bernhardt, K, Gartner, K, Leung, CS, Geletneky, K, Sertel, S, Munz, C, Feederle, R & Delecluse, HJ 2013, 'Spontaneous lytic replication and epitheliotropism define an Epstein-Barr virus strain found in carcinomas', Cell Rep, vol. 5, no. 2, Oct 31, pp. 458-70. Tsai, ST, Jin, YT, Mann, RB & Ambinder, RF 1998, 'Epstein-Barr virus detection in nasopharyngeal tissues of patients with suspected nasopharyngeal carcinoma', Cancer, vol. 82, no. 8, Apr 15, pp. 1449-53. Tsang, CM & Tsao, SW 2015, 'The role of Epstein-Barr virus infection in the pathogenesis of nasopharyngeal carcinoma', Virol Sin, vol. 30, no. 2, Apr, pp. 107-21. Tsang, CM, Zhang, G, Seto, E, Takada, K, Deng, W, Yip, YL, Man, C, Hau, PM, Chen, H, Cao, Y, Lo, KW, Middeldorp, JM, Cheung, AL & Tsao, SW 2010, 'Epstein-Barr virus infection in immortalized nasopharyngeal epithelial cells: regulation of infection and phenotypic characterization', Int J Cancer, vol. 127, no. 7, Oct 1, pp. 1570-83. Tsao, SW, Tsang, CM, Pang, PS, Zhang, G, Chen, H & Lo, KW 2012, 'The biology of EBV infection in human epithelial cells', Semin Cancer Biol, vol. 22, no. 2, Apr, pp. 137-43. Tsao, SW, Tsang, CM, To, KF & Lo, KW 2015, 'The role of Epstein-Barr virus in epithelial malignancies', J Pathol, vol. 235, no. 2, Jan, pp. 323-33. Tsao, SW, Yip, YL, Tsang, CM, Pang, PS, Lau, VM, Zhang, G & Lo, KW 2014, 'Etiological factors of nasopharyngeal carcinoma', Oral Oncol, vol. 50, no. 5, May, pp. 330-8. Tse, KP, Su, WH, Chang, KP, Tsang, NM, Yu, CJ, Tang, P, See, LC, Hsueh, C, Yang, ML, Hao, SP, Li, HY, Wang, MH, Liao, LP, Chen, LC, Lin, SR, Jorgensen, TJ, Chang,

148

YS & Shugart, YY 2009, 'Genome-wide association study reveals multiple nasopharyngeal carcinoma-associated loci within the HLA region at chromosome 6p21.3', Am J Hum Genet, vol. 85, no. 2, Aug, pp. 194-203. Tsuji, A, Wakisaka, N, Kondo, S, Murono, S, Furukawa, M & Yoshizaki, T 2008, 'Induction of receptor for advanced glycation end products by EBV latent membrane protein 1 and its correlation with angiogenesis and cervical lymph node metastasis in nasopharyngeal carcinoma', Clin Cancer Res, vol. 14, no. 17, Sep 1, pp. 5368-75. Untergasser, A, Nijveen, H, Rao, X, Bisseling, T, Geurts, R & Leunissen, JA 2007, 'Primer3Plus, an enhanced web interface to Primer3', Nucleic Acids Res, vol. 35, no. Web Server issue, Jul, pp. W71-4. Valentine, R, Dawson, CW, Hu, C, Shah, KM, Owen, TJ, Date, KL, Maia, SP, Shao, J, Arrand, JR, Young, LS & O'Neil, JD 2010, 'Epstein-Barr virus-encoded EBNA1 inhibits the canonical NF-kappaB pathway in carcinoma cells by inhibiting IKK phosphorylation', Mol Cancer, vol. 9, Jan 5, p. 1. Vaughan, TL, Stewart, PA, Teschke, K, Lynch, CF, Swanson, GM, Lyon, JL & Berwick, M 2000, 'Occupational exposure to formaldehyde and wood dust and nasopharyngeal carcinoma', Occup Environ Med, vol. 57, no. 6, Jun, pp. 376-84. Vereide, DT, Seto, E, Chiu, YF, Hayes, M, Tagawa, T, Grundhoff, A, Hammerschmidt, W & Sugden, B 2014, 'Epstein-Barr virus maintains lymphomas via its miRNAs', Oncogene, vol. 33, no. 10, Mar 6, pp. 1258-64. Wang, D, Liebowitz, D & Kieff, E 1985, 'An EBV membrane protein expressed in immortalized lymphocytes transforms established rodent cells', Cell, vol. 43, no. 3 Pt 2, Dec, pp. 831-40. Wang, Q, Tsao, SW, Ooka, T, Nicholls, JM, Cheung, HW, Fu, S, Wong, YC & Wang, X 2006, 'Anti-apoptotic role of BARF1 in gastric cancer cells', Cancer Lett, vol. 238, no. 1, Jul 8, pp. 90-103. Wang, X, Wang, Y, Wu, G, Chao, Y, Sun, Z & Luo, B 2012a, 'Sequence analysis of Epstein-Barr virus EBNA-2 gene coding amino acid 148-487 in nasopharyngeal and gastric carcinomas', Virology Journal, vol. 9, no. 1, February 21, p. 49. Wang, Y, Guo, Z, Shu, Y, Zhou, H, Wang, H & Zhang, W 2017, 'BART miRNAs: an unimaginable force in the development of nasopharyngeal carcinoma', Eur J Cancer Prev, vol. 26, no. 2, Mar, pp. 144-150. Wang, Y, Wang, XF, Sun, ZF & Luo, B 2012b, 'Unique variations of Epstein-Barr virus-encoded BARF1 gene in nasopharyngeal carcinoma biopsies', Virus Res, vol. 166, no. 1-2, Jun, pp. 23-30. Ward, MH, Pan, WH, Cheng, YJ, Li, FH, Brinton, LA, Chen, CJ, Hsu, MM, Chen, IH, Levine, PH, Yang, CS & Hildesheim, A 2000, 'Dietary exposure to nitrite and nitrosamines and risk of nasopharyngeal carcinoma in Taiwan', Int J Cancer, vol. 86, no. 5, Jun 1, pp. 603-9.

149

Wee, J, Tan, EH, Tai, BC, Wong, HB, Leong, SS, Tan, T, Chua, ET, Yang, E, Lee, KM, Fong, KW, Tan, HS, Lee, KS, Loong, S, Sethi, V, Chua, EJ & Machin, D 2005, 'Randomized trial of radiotherapy versus concurrent chemoradiotherapy followed by adjuvant chemotherapy in patients with American Joint Committee on Cancer/International Union against cancer stage III and IV nasopharyngeal cancer of the endemic variety', J Clin Oncol, vol. 23, no. 27, Sep 20, pp. 6730-8. Wei, MX, de Turenne-Tessier, M, Decaussin, G, Benet, G & Ooka, T 1997, 'Establishment of a monkey kidney epithelial cell line with the BARF1 open reading frame from Epstein-Barr virus', Oncogene, vol. 14, no. 25, Jun 26, pp. 3073-81. Wei, MX & Ooka, T 1989, 'A transforming function of the BARF1 gene encoded by Epstein-Barr virus', Embo j, vol. 8, no. 10, Oct, pp. 2897-903. Wei, WI & Sham, JS 2005, 'Nasopharyngeal carcinoma', Lancet, vol. 365, no. 9476, Jun 11, pp. 2041-54. Wei, YS, Kuang, XH, Zhu, YH, Liang, WB, Yang, ZH, Tai, SH, Zhao, Y & Zhang, L 2007a, 'Interleukin-10 gene promoter polymorphisms and the risk of nasopharyngeal carcinoma', Tissue Antigens, vol. 70, no. 1, Jul, pp. 12-7. Wei, YS, Lan, Y, Luo, B, Lu, D & Nong, HB 2009, 'Association of variants in the interleukin-27 and interleukin-12 gene with nasopharyngeal carcinoma', Mol Carcinog, vol. 48, no. 8, Aug, pp. 751-7. Wei, YS, Lan, Y, Tang, RG, Xu, QQ, Huang, Y, Nong, HB & Huang, WT 2007b, 'Single nucleotide polymorphism and haplotype association of the interleukin-8 gene with nasopharyngeal carcinoma', Clin Immunol, vol. 125, no. 3, Dec, pp. 309-17. Wei, YS, Lan, Y, Zhang, L & Wang, JC 2010, 'Association of the interleukin-2 polymorphisms with interleukin-2 serum levels and risk of nasopharyngeal carcinoma', DNA Cell Biol, vol. 29, no. 7, Jul, pp. 363-8. White, RE, Groves, IJ, Turro, E, Yee, J, Kremmer, E & Allday, MJ 2010, 'Extensive co-operation between the Epstein-Barr virus EBNA3 proteins in the manipulation of host gene expression and epigenetic chromatin modification', PLoS One, vol. 5, no. 11, Nov 15, p. e13979. White, RE, Ramer, PC, Naresh, KN, Meixlsperger, S, Pinaud, L, Rooney, C, Savoldo, B, Coutinho, R, Bodor, C, Gribben, J, Ibrahim, HA, Bower, M, Nourse, JP, Gandhi, MK, Middeldorp, J, Cader, FZ, Murray, P, Munz, C & Allday, MJ 2012, 'EBNA3B-deficient EBV promotes B cell lymphomagenesis in humanized mice and is found in human tumors', J Clin Invest, vol. 122, no. 4, Apr, pp. 1487-502. Wiech, T, Nikolopoulos, E, Lassman, S, Heidt, T, Schopflin, A, Sarbia, M, Werner, M, Shimizu, Y, Sakka, E, Ooka, T & zur Hausen, A 2008, 'Cyclin D1 expression is induced by viral BARF1 and is overexpressed in EBV-associated gastric cancer', Virchows Arch, vol. 452, no. 6, Jun, pp. 621-7.

150

Wong, HL, Wang, X, Chang, RC, Jin, DY, Feng, H, Wang, Q, Lo, KW, Huang, DP, Yuen, PW, Takada, K, Wong, YC & Tsao, SW 2005, 'Stable expression of EBERs in immortalized nasopharyngeal epithelial cells confers resistance to apoptotic stress', Mol Carcinog, vol. 44, no. 2, Oct, pp. 92-101. Wood, VH, O'Neil, JD, Wei, W, Stewart, SE, Dawson, CW & Young, LS 2007, 'Epstein-Barr virus-encoded EBNA1 regulates cellular gene transcription and modulates the STAT1 and TGFbeta signaling pathways', Oncogene, vol. 26, no. 28, Jun 14, pp. 4135-47. Wu, CC, Liu, MT, Chang, YT, Fang, CY, Chou, SP, Liao, HW, Kuo, KL, Hsu, SL, Chen, YR, Wang, PW, Chen, YL, Chuang, HY, Lee, CH, Chen, M, Wayne Chang, WS & Chen, JY 2010, 'Epstein-Barr virus DNase (BGLF5) induces genomic instability in human epithelial cells', Nucleic Acids Res, vol. 38, no. 6, Apr, pp. 1932-49. Wu, HC, Lu, TY, Lee, JJ, Hwang, JK, Lin, YJ, Wang, CK & Lin, CT 2004, 'MDM2 expression in EBV-infected nasopharyngeal carcinoma cells', Lab Invest, vol. 84, no. 12, Dec, pp. 1547-56. Xiao, M, Zhang, L, Zhu, X, Huang, J, Jiang, H, Hu, S & Liu, Y 2010, 'Genetic polymorphisms of MDM2 and TP53 genes are associated with risk of nasopharyngeal carcinoma in a Chinese population', BMC Cancer, vol. 10, Apr 18, p. 147. Xiong, W, Zeng, ZY, Xia, JH, Xia, K, Shen, SR, Li, XL, Hu, DX, Tan, C, Xiang, JJ, Zhou, J, Deng, H, Fan, SQ, Li, WF, Wang, R, Zhou, M, Zhu, SG, Lu, HB, Qian, J, Zhang, BC, Wang, JR, Ma, J, Xiao, BY, Huang, H, Zhang, QH, Zhou, YH, Luo, XM, Zhou, HD, Yang, YX, Dai, HP, Feng, GY, Pan, Q, Wu, LQ, He, L & Li, GY 2004, 'A susceptibility locus at chromosome 3p21 linked to familial nasopharyngeal carcinoma', Cancer Res, vol. 64, no. 6, Mar 15, pp. 1972-4. Xue, WQ, Qin, HD, Ruan, HL, Shugart, YY & Jia, WH 2013, 'Quantitative association of tobacco smoking with the risk of nasopharyngeal carcinoma: a comprehensive meta-analysis of studies conducted between 1979 and 2011', Am J Epidemiol, vol. 178, no. 3, Aug 1, pp. 325-38. Yang, J, Deng, W, Hau, PM, Liu, J, Lau, VM, Cheung, AL, Huen, MS & Tsao, SW 2015, 'Epstein-Barr virus BZLF1 protein impairs accumulation of host DNA damage proteins at damage sites in response to DNA damage', Lab Invest, vol. 95, no. 8, Aug, pp. 937-50. Yang, ZH, Dai, Q, Gu, YJ, Guo, QX & Gong, L 2012, 'Cytokine and chemokine modification by Toll-like receptor polymorphisms is associated with nasopharyngeal carcinoma', Cancer Sci, vol. 103, no. 4, Apr, pp. 653-8. Yang, ZH, Dai, Q, Kong, XL, Yang, WL & Zhang, L 2009, 'Association of ERCC1 polymorphisms and susceptibility to nasopharyngeal carcinoma', Mol Carcinog, vol. 48, no. 3, Mar, pp. 196-201. Yap, LF, Ahmad, M, Zabidi, MM, Chu, TL, Chai, SJ, Lee, HM, Lim, PV, Wei, W, Dawson, C, Teo, SH & Khoo, AS 2014, 'Oncogenic effects of WNT5A in Epstein-Barr

151

virusassociated nasopharyngeal carcinoma', Int J Oncol, vol. 44, no. 5, May, pp. 1774-80. Yeung, WM, Zong, YS, Chiu, CT, Chan, KH, Sham, JS, Choy, DT & Ng, MH 1993, 'Epstein-Barr virus carriage by nasopharyngeal carcinoma in situ', Int J Cancer, vol. 53, no. 5, Mar 12, pp. 746-50. Young, LS, Arrand, JR & Murray, PG 2007, 'EBV gene expression and regulation', in A Arvin, G Campadelli-Fiume, E Mocarski, PS Moore, B Roizman, R Whitley and K Yamanishi (eds), Human Herpesviruses: Biology, Therapy, and Immunoprophylaxis, Cambridge University Press, Cambridge. Young, LS & Dawson, CW 2014, 'Epstein-Barr virus and nasopharyngeal carcinoma', Chin J Cancer, vol. 33, no. 12, Dec, pp. 581-90. Young, LS, Dawson, CW, Clark, D, Rupani, H, Busson, P, Tursz, T, Johnson, A & Rickinson, AB 1988, 'Epstein-Barr virus gene expression in nasopharyngeal carcinoma', J Gen Virol, vol. 69 ( Pt 5), May, pp. 1051-65. Young, LS, Yap, LF & Murray, PG 2016, 'Epstein-Barr virus: more than 50 years old and still providing surprises', Nat Rev Cancer, vol. 16, no. 12, Dec, pp. 789-802. Yu, MC, Ho, JH, Lai, SH & Henderson, BE 1986, 'Cantonese-style salted fish as a cause of nasopharyngeal carcinoma: report of a case-control study in Hong Kong', Cancer Res, vol. 46, no. 2, Feb, pp. 956-61. Yu, MC & Yuan, JM 2002, 'Epidemiology of nasopharyngeal carcinoma', Semin Cancer Biol, vol. 12, no. 6, Dec, pp. 421-9. Zeng, YX & Jia, WH 2002, 'Familial nasopharyngeal carcinoma', Semin Cancer Biol, vol. 12, no. 6, Dec, pp. 443-50. Zennou, V, Petit, C, Guetard, D, Nerhbass, U, Montagnier, L & Charneau, P 2000, 'HIV-1 genome nuclear import is mediated by a central DNA flap', Cell, vol. 101, no. 2, Apr 14, pp. 173-85. Zhang, CX, Decaussin, G, Daillie, J & Ooka, T 1988, 'Altered expression of two Epstein-Barr virus early genes localized in BamHI-A in nonproducer Raji cells', J Virol, vol. 62, no. 6, Jun, pp. 1862-9. Zhao, B, Mar, JC, Maruo, S, Lee, S, Gewurz, BE, Johannsen, E, Holton, K, Rubio, R, Takada, K, Quackenbush, J & Kieff, E 2011a, 'Epstein-Barr virus nuclear antigen 3C regulated genes in lymphoblastoid cell lines', Proc Natl Acad Sci U S A, vol. 108, no. 1, Jan 4, pp. 337-42. Zhao, B, Zou, J, Wang, H, Johannsen, E, Peng, CW, Quackenbush, J, Mar, JC, Morton, CC, Freedman, ML, Blacklow, SC, Aster, JC, Bernstein, BE & Kieff, E 2011b, 'Epstein-Barr virus exploits intrinsic B-lymphocyte transcription programs to achieve immortal cell growth', Proc Natl Acad Sci U S A, vol. 108, no. 36, Sep 6, pp. 14902-7.

152

Zheng, X, Luo, Y, Christensson, B & Drettner, B 1994, 'Induction of nasal and nasopharyngeal tumours in Sprague-Dawley rats fed with Chinese salted fish', Acta Otolaryngol, vol. 114, no. 1, Jan, pp. 98-104. Zhou, XX, Jia, WH, Shen, GP, Qin, HD, Yu, XJ, Chen, LZ, Feng, QS, Shugart, YY & Zeng, YX 2006, 'Sequence variants in toll-like receptor 10 are associated with nasopharyngeal carcinoma risk', Cancer Epidemiol Biomarkers Prev, vol. 15, no. 5, May, pp. 862-6. Zhuo, X, Cai, L, Xiang, Z, Li, Q & Zhang, X 2009a, 'GSTM1 and GSTT1 polymorphisms and nasopharyngeal cancer risk: an evidence-based meta-analysis', J Exp Clin Cancer Res, vol. 28, Apr 1, p. 46. Zhuo, XL, Cai, L, Xiang, ZL, Zhuo, WL, Wang, Y & Zhang, XY 2009b, 'TP53 codon 72 polymorphism contributes to nasopharyngeal cancer susceptibility: a meta-analysis', Arch Med Res, vol. 40, no. 4, May, pp. 299-305. Zimber-Strobl, U & Strobl, LJ 2001, 'EBNA2 and Notch signalling in Epstein-Barr virus mediated immortalization of B lymphocytes', Semin Cancer Biol, vol. 11, no. 6, Dec, pp. 423-34. Zufferey, R, Donello, JE, Trono, D & Hope, TJ 1999, 'Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors', J Virol, vol. 73, no. 4, Apr, pp. 2886-92.

Zufferey, R, Nagy, D, Mandel, RJ, Naldini, L & Trono, D 1997, 'Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo', Nat Biotechnol, vol. 15, no. 9, Sep, pp. 871-5.

Documents

Determining the oncogenic activity of different …...Epstein-Barr virus (EBV) infection is strongly associated with nasopharyngeal carcinoma and EBV genes products are believed to